Sample records for acid synthesis fas

  1. Microbial Type I Fatty Acid Synthases (FAS): Major Players in a Network of Cellular FAS Systems

    PubMed Central

    Schweizer, Eckhart; Hofmann, Jörg


    The present review focuses on microbial type I fatty acid synthases (FASs), demonstrating their structural and functional diversity. Depending on their origin and biochemical function, multifunctional type I FAS proteins form dimers or hexamers with characteristic organization of their catalytic domains. A single polypeptide may contain one or more sets of the eight FAS component functions. Alternatively, these functions may split up into two different and mutually complementing subunits. Targeted inactivation of the individual yeast FAS acylation sites allowed us to define their roles during the overall catalytic process. In particular, their pronounced negative cooperativity is presumed to coordinate the FAS initiation and chain elongation reactions. Expression of the unlinked genes, FAS1 and FAS2, is in part constitutive and in part subject to repression by the phospholipid precursors inositol and choline. The interplay of the involved regulatory proteins, Rap1, Reb1, Abf1, Ino2/Ino4, Opi1, Sin3 and TFIIB, has been elucidated in considerable detail. Balanced levels of subunits α and β are ensured by an autoregulatory effect of FAS1 on FAS2 expression and by posttranslational degradation of excess FAS subunits. The functional specificity of type I FAS multienzymes usually requires the presence of multiple FAS systems within the same cell. De novo synthesis of long-chain fatty acids, mitochondrial fatty acid synthesis, acylation of certain secondary metabolites and coenzymes, fatty acid elongation, and the vast diversity of mycobacterial lipids each result from specific FAS activities. The microcompartmentalization of FAS activities in type I multienzymes may thus allow for both the controlled and concerted action of multiple FAS systems within the same cell. PMID:15353567

  2. Anti-cancer drugs targeting fatty acid synthase (FAS).


    Pandey, Puspa R; Liu, Wen; Xing, Fei; Fukuda, Koji; Watabe, Kounosuke


    Fatty acid synthase (FAS) is a key enzyme of the fatty acid biosynthetic pathway which catalyzes de novo lipid synthesis. FAS expression in normal adult tissues is generally very low or undetectable as majority of fatty acids obtained are from dietary sources, whereas it is significantly upregulated in cancer cells despite adequate nutritional lipid supply. Activation of FAS provides rapidly proliferating tumor cells sufficient amount of lipids for membrane biogenesis and confers growth and survival advantage possibly acting as a metabolic oncogene. Importantly, inhibition of FAS in cancer cells using the pharmacological FAS inhibitors results in tumor cell death by apoptosis whereas normal cells are resistant. Due to this differential expression of FAS, the inhibitors of this enzyme are selectively toxic to tumor cells and therefore FAS is considered an attractive therapeutic target for cancer. Several FAS inhibitors are already patented and commercially available; however, the potential toxicity of these FAS inhibitors remains to be tested in clinical trials. In this review, we discuss some of the potent FAS inhibitors along with their patent information, the mechanism of anti-cancer effects and the development of more specific and potent FAS inhibitors with lower side effects that are expected to emerge as anti-cancer treatment in the near future. PMID:22338595

  3. Cryo-EM structure of fatty acid synthase (FAS) from Rhodosporidium toruloides provides insights into the evolutionary development of fungal FAS

    PubMed Central

    Fischer, Manuel; Rhinow, Daniel; Zhu, Zhiwei; Mills, Deryck J; Zhao, Zongbao K; Vonck, Janet; Grininger, Martin


    Fungal fatty acid synthases Type I (FAS I) are up to 2.7 MDa large molecular machines composed of large multifunctional polypeptides. Half of the amino acids in fungal FAS I are involved in structural elements that are responsible for scaffolding the elaborate barrel-shaped architecture and turning fungal FAS I into highly efficient de novo producers of fatty acids. Rhodosporidium toruloides is an oleaginous fungal species and renowned for its robust conversion of carbohydrates into lipids to over 70% of its dry cell weight. Here, we use cryo-EM to determine a 7.8-Å reconstruction of its FAS I that reveals unexpected features; its novel form of splitting the multifunctional polypeptide chain into the two subunits α and β, and its duplicated ACP domains. We show that the specific distribution into α and β occurs by splitting at one of many possible sites that can be accepted by fungal FAS I. While, therefore, the specific distribution in α and β chains in R. toruloides FAS I is not correlated to increased protein activities, we also show that the duplication of ACP is an evolutionary late event and argue that duplication is beneficial for the lipid overproduction phenotype. PMID:25761671

  4. Purification and properties of the fatty acids synthetase complex from Neurospora crassa, and the nature of the fas-mutation.

    PubMed Central

    Elovson, J


    A procedure is described for the purification of the fatty acid synthetase complex (FAS) from Neurospora crassa. The enzyme complex has a molecular weight of 2.3 times 10(6), contains 6 mol of 4'-phosphopantetheine per mol, and on polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate gives a single band, or a closely spaced doublet, which comigrates with standard myosin (molecular weight, 2 times 10(5)). Since the slightly retarded component in the doublet accounts for all protein-bound 4'-phosphopantetheine, the complex appears to be made up of 11 to 12 equally sized subunits, 6 of which carry the acyl carrier protein function. In this unusual arrangement, notably the lack of the low-molecular-weight acyl carrier protein component seen in other FAS systems, as well as in its enzymatic properties, the Neurospora FAS complex is quite similar to the yeast enzyme. The FAS complex of a saturated fatty acid-requiring mutant, previously disignated cel-, contains less than 2% of the 4'-phosphopantetheine prosthetic groups found in the wild-type complex. The leaky phenotype of this mutant, here designated fas-, is accounted for by a residual fatty acid synthesizing activity in its FAS complex, which is several-fold higher than expected from its residual content of 4'-phosphopanthetheine. Images PMID:126228

  5. Novel Type II Fatty Acid Biosynthesis (FAS II) Inhibitors as Multistage Antimalarial Agents

    PubMed Central

    Schrader, Florian C.; Glinca, Serghei; Sattler, Julia M.; Dahse, Hans-Martin; Afanador, Gustavo A.; Prigge, Sean T.; Lanzer, Michael; Mueller, Ann-Kristin; Klebe, Gerhard; Schlitzer, Martin


    Malaria is a potentially fatal disease caused by Plasmodium parasites and poses a major medical risk in large parts of the world. The development of new, affordable antimalarial drugs is of vital importance as there are increasing reports of resistance to the currently available therapeutics. In addition, most of the current drugs used for chemoprophylaxis merely act on parasites already replicating in the blood. At this point, a patient might already be suffering from the symptoms associated with the disease and could additionally be infectious to an Anopheles mosquito. These insects act as a vector, subsequently spreading the disease to other humans. In order to cure not only malaria but prevent transmission as well, a drug must target both the blood- and pre-erythrocytic liver stages of the parasite. P. falciparum (Pf) enoyl acyl carrier protein (ACP) reductase (ENR) is a key enzyme of plasmodial type II fatty acid biosynthesis (FAS II). It has been shown to be essential for liver-stage development of Plasmodium berghei and is therefore qualified as a target for true causal chemoprophylaxis. Using virtual screening based on two crystal structures of PfENR, we identified a structurally novel class of FAS inhibitors. Subsequent chemical optimization yielded two compounds that are effective against multiple stages of the malaria parasite. These two most promising derivatives were found to inhibit blood-stage parasite growth with IC50 values of 1.7 and 3.0 µm and lead to a more prominent developmental attenuation of liver-stage parasites than the gold-standard drug, primaquine. PMID:23341167

  6. Crystal structure of FAS thioesterase domain with polyunsaturated fatty acyl adduct and inhibition by dihomo-[gamma]-linolenic acid

    SciTech Connect

    Zhang, Wei; Chakravarty, Bornali; Zheng, Fei; Gu, Ziwei; Wu, Hongmei; Mao, Jianqiang; Wakil, Salih J.; Quiocho, Florante A.


    Human fatty acid synthase (hFAS) is a homodimeric multidomain enzyme that catalyzes a series of reactions leading to the de novo biosynthesis of long-chain fatty acids, mainly palmitate. The carboxy-terminal thioesterase (TE) domain determines the length of the fatty acyl chain and its ultimate release by hydrolysis. Because of the upregulation of hFAS in a variety of cancers, it is a target for antiproliferative agent development. Dietary long-chain polyunsaturated fatty acids (PUFAs) have been known to confer beneficial effects on many diseases and health conditions, including cancers, inflammations, diabetes, and heart diseases, but the precise molecular mechanisms involved have not been elucidated. We report the crystal structure of the hFAS TE domain covalently modified and inactivated by methyl {gamma}-linolenylfluorophosphonate. Whereas the structure confirmed the phosphorylation by the phosphonate head group of the active site serine, it also unexpectedly revealed the binding of the 18-carbon polyunsaturated {gamma}-linolenyl tail in a long groove-tunnel site, which itself is formed mainly by the emergence of an {alpha} helix (the 'helix flap'). We then found inhibition of the TE domain activity by the PUFA dihomo-{gamma}-linolenic acid; {gamma}- and {alpha}-linolenic acids, two popular dietary PUFAs, were less effective. Dihomo-{gamma}-linolenic acid also inhibited fatty acid biosynthesis in 3T3-L1 preadipocytes and selective human breast cancer cell lines, including SKBR3 and MDAMB231. In addition to revealing a novel mechanism for the molecular recognition of a polyunsaturated fatty acyl chain, our results offer a new framework for developing potent FAS inhibitors as therapeutics against cancers and other diseases.

  7. A novel cisplatin mediated apoptosis pathway is associated with acid sphingomyelinase and FAS proapoptotic protein activation in ovarian cancer.


    Maurmann, L; Belkacemi, L; Adams, N R; Majmudar, P M; Moghaddas, S; Bose, R N


    Platinum-based anticancer drugs, including cisplatin and carboplatin, have been cornerstones in the treatment of solid tumors. We report here that these DNA-damaging agents, particularly cisplatin, induce apoptosis through plasma membrane disruption, triggering FAS death receptor via mitochondrial (intrinsic) pathways. Our objectives were to: quantify the composition of membrane metabolites; and determine the potential involvement of acid sphingomyelinase (ASMase) in the FAS-mediated apoptosis in ovarian cancer after cisplatin treatment. The resulting analysis revealed enhanced apoptosis as measured by: increased phosphocholine, and glycerophosphocholine; elevated cellular energetics; and phosphocreatine and nucleoside triphosphate concentrations. The plasma membrane alterations were accompanied by increased ASMase activity, leading to the upregulation of FAS, FASL and related pro-apoptotic BAX and PUMA genes. Moreover FAS, FASL, BAX, PUMA, CASPASE-3 and -9 proteins were upregulated. Our findings implicate ASMase activity and the intrinsic pathways in cisplatin-mediated membrane demise, and contribute to our understanding of the mechanisms by which ovarian tumors may become resistant to cisplatin. PMID:25846011

  8. 2-Hexadecynoic Acid Inhibits Plasmodial FAS-II Enzymes and Arrest Erythrocytic and Liver Stage Plasmodium Infections

    PubMed Central

    Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L.; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H.; Brun, Reto; Carballeira, Néstor M.


    Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of P. yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC50 value 6.6. μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC50 value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescense analysis (IC50 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory against the PfFAS-II enzymes PfFabI and PfFabZ with IC50 values of 0.38 and 0.58 μg/ml (IC50 control drugs 14 and 30 ng/ml) respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC50 values 3.7–31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC50 20.2 μg/ml), and Leishmania donovani (IC50 values 4.1–13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature and calculated pharmacokinetic properties suggest that 2-HDA could be a useful compound to study the interaction of fatty

  9. Fas and Fas ligand expression in fetal and adult human testis with normal or deranged spermatogenesis.


    Francavilla, S; D'Abrizio, P; Rucci, N; Silvano, G; Properzi, G; Straface, E; Cordeschi, G; Necozione, S; Gnessi, L; Arizzi, M; Ulisse, S


    In mice, the Fas/Fas ligand (FasL) system has been shown to be involved in germ cell apoptosis. In the present study we evaluated the expression of Fas and Fas ligand (FasL) in fetal and adult human testis. Semiquantitative RT-PCR demonstrated the expression of Fas and FasL messenger ribonucleic acids in adult testis, but not in fetal testis (20-22 weeks gestation). In situ RT-PCR and immunohistochemistry experiments on adult human testis demonstrated the expression of FasL messenger ribonucleic acid and protein in Sertoli and Leydig cells, whereas the expression of Fas was confined to the Leydig cells and sporadic degenerating spermatocytes. The number of Fas-positive germ cells per 100 Sertoli cell nuclei was increased in 10 biopsies with postmeiotic germ cell arrest compared to 10 normal testis biopsies (mean, 3.82 +/- 0.45 vs. 2.02 +/- 0.29; P = 0.0001), but not in 10 biopsies with meiotic germ cell arrest (mean, 1.56 +/- 1.07). Fas and FasL proteins were not expressed in cases of idiopathic hypogonadotropic hypogonadism. Together, these findings may suggest that Fas/FasL expression in the human testis is developmentally regulated and under gonadotropin control. The increased germ cell expression of Fas in patients with postmeiotic germ cell arrest suggests that the Fas/FasL system may be involved in the quality control mechanism of the produced gametes. PMID:10946867

  10. Regulation of hippocampal Fas receptor and death-inducing signaling complex after kainic acid treatment in mice.


    Keller, Benjamin; García-Sevilla, Jesús A


    Kainic acid (KA)-induced brain neuronal cell death (especially in the hippocampus) was shown to be mainly mediated by the intrinsic (mitochondrial) apoptotic pathway. This study investigated the regulation of the extrinsic apoptotic pathway mediated by Fas ligand/Fas receptor and components of the indispensable death-inducing signaling complex (DISC) in the hippocampus (marked changes) and cerebral cortex (modest changes) of KA-treated mice. KA (45mg/kg) induced a severe behavioral syndrome with recurrent motor seizures (scores; maximal at 60-90min; minimal at 72h) with activation of hippocampal pro-apoptotic JNK (+2.5 fold) and increased GFAP (+57%) and nuclear PARP-1 fragmentation (+114%) 72h post-treatment (delayed neurotoxicity). In the extrinsic apoptotic pathway (hippocampus), KA (72h) reduced Fas ligand (-92%) and Fas receptor aggregates (-24%). KA (72h) also altered the contents of major DISC components: decreased FADD adaptor (-44%), reduced activation of initiator caspase-8 (-47%) and increased survival FLIP-S (+220%). Notably, KA (72h) upregulated the content of anti-apoptotic p-Ser191 FADD (+41%) and consequently the expression of p-FADD/FADD ratio (+1.9-fold), a neuroplastic index. Moreover, the p-FADD dependent transcription factor NF-κB was also increased (+61%) in the hippocampus after KA (72h). The convergent adaptation of the extrinsic apoptotic machinery 72h after KA in mice (with otherwise normal gross behavior) is a novel finding which suggests the induction of survival mechanisms to partly counteract the delayed neuronal death in the hippocampus. PMID:26044520

  11. Synthesis of amino acids


    Davis, J.W. Jr.


    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  12. The Mycobacterium tuberculosis FAS-II condensing enzymes: their role in mycolic acid biosynthesis, acid-fastness, pathogenesis and in future drug development.


    Bhatt, Apoorva; Molle, Virginie; Besra, Gurdyal S; Jacobs, William R; Kremer, Laurent


    Mycolic acids are very long-chain fatty acids representing essential components of the mycobacterial cell wall. Considering their importance, characterization of key enzymes participating in mycolic acid biosynthesis not only allows an understanding of their role in the physiology of mycobacteria, but also might lead to the identification of new drug targets. Mycolates are synthesized by at least two discrete elongation systems, the type I and type II fatty acid synthases (FAS-I and FAS-II respectively). Among the FAS-II components, the condensing enzymes that catalyse the formation of carbon-carbon bonds have received considerable interest. Four condensases participate in initiation (mtFabH), elongation (KasA and KasB) and termination (Pks13) steps, leading to full-length mycolates. We present the recent biochemical and structural data for these important enzymes. Special emphasis is given to their role in growth, intracellular survival, biofilm formation, as well as in the physiopathology of tuberculosis. Recent studies demonstrated that phosphorylation of these enzymes by mycobacterial kinases affects their activities. We propose here a model in which kinases that sense environmental changes can phosphorylate the condensing enzymes, thus representing a novel mechanism of regulating mycolic acid biosynthesis. Finally, we discuss the attractiveness of these enzymes as valid targets for future antituberculosis drug development. PMID:17555433

  13. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei


    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  14. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.


    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  15. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.


    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  16. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  17. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.


    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  18. Disrupted short chain specific β-oxidation and improved synthase expression increase synthesis of short chain fatty acids in Saccharomyces cerevisiae.


    Leber, Christopher; Choi, Jin Wook; Polson, Brian; Da Silva, Nancy A


    Biologically derived fatty acids have gained tremendous interest as an alternative to petroleum-derived fuels and chemical precursors. We previously demonstrated the synthesis of short chain fatty acids in Saccharomyces cerevisiae by introduction of the Homo sapiens fatty acid synthase (hFAS) with heterologous phosphopantetheine transferases and heterologous thioesterases. In this study, short chain fatty acid production was improved by combining a variety of novel enzyme and metabolic engineering strategies. The use of a H. sapiens-derived thioesterase and phosphopantetheine transferase were evaluated. In addition, strains were engineered to disrupt either the full β-oxidation (by deleting FAA2, PXA1, and POX1) or short chain-specific β-oxidation (by deleting FAA2, ANT1, and PEX11) pathways. Prohibiting full β-oxidation increased hexanoic and octanoic acid levels by 8- and 79-fold relative to the parent strain expressing hFAS. However, by targeting only short chain β-oxidation, hexanoic and octanoic acid levels increased further to 31- and 140-fold over the parent. In addition, an optimized hFAS gene increased hexanoic, octanoic, decanoic and total short chain fatty acid levels by 2.9-, 2.0-, 2.3-, and 2.2-fold, respectively, relative to the non-optimized counterpart. By combining these unique enzyme and metabolic engineering strategies, octanoic acid was increased more than 181-fold over the parent strain expressing hFAS. PMID:26388428

  19. Genetics Home Reference: congenital bile acid synthesis defect type 1


    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  20. Genetics Home Reference: congenital bile acid synthesis defect type 2


    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  1. Hydroxamic acids in asymmetric synthesis.


    Li, Zhi; Yamamoto, Hisashi


    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  2. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi


    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  3. Roles of Fas and Fas ligand during mammary gland remodeling

    PubMed Central

    Song, Joon; Sapi, Eva; Brown, Wendi; Nilsen, Jon; Tartaro, Karrie; Kacinski, Barry M.; Craft, Joseph; Naftolin, Frederick; Mor, Gil


    Mammary involution is associated with degeneration of the alveolar structure and programmed cell death of mammary epithelial cells. In this study, we evaluated the expression of Fas and Fas ligand (FasL) in the mammary gland tissue and their possible role in the induction of apoptosis of mammary cells. FasL-positive cells were observed in normal mammary epithelium from pregnant and lactating mice, but not in nonpregnant/virgin mouse mammary tissue. Fas expression was observed in epithelial and stromal cells in nonpregnant mice but was absent during pregnancy. At day 1 after weaning, high levels of both Fas and FasL proteins and caspase 3 were observed and coincided with the appearance of apoptotic cells in ducts and glands. During the same period, no apoptotic cells were found in the Fas-deficient (MRL/lpr) and FasL-deficient (C3H/gld) mice. Increase in Fas and FasL protein was demonstrated in human (MCF10A) and mouse (HC-11) mammary epithelial cells after incubation in hormone-deprived media, before apoptosis was detected. These results suggest that the Fas-FasL interaction plays an important role in the normal remodeling of mammary tissue. Furthermore, this autocrine induction of apoptosis may prevent accumulation of cells with mutations and subsequent neoplastic development. Failure of the Fas/FasL signal could contribute to tumor development. PMID:11086022

  4. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.


    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  5. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth


    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  6. Dual Role for Phospholipid:Diacylglycerol Acyltransferase: Enhancing Fatty Acid Synthesis and Diverting Fatty Acids from Membrane Lipids to Triacylglycerol in Arabidopsis Leaves[C][W

    PubMed Central

    Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng


    There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979

  7. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.


    Cervantes-Madrid, Diana; Dueñas-González, Alfonso


    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors. PMID:26134042

  8. Synthesis of new polysialic acid derivatives.


    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke


    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  9. Castor phospholipid:diacylglycerol acyltransferase facilitates efficient metabolism of hydroxy fatty acids in transgenic Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Producing unusual fatty acids (FAs) in crop plants has been a long-standing goal of green chemistry. However, expression of the enzymes that catalyze the primary synthesis of these unusual FAs in transgenic plants typically results in low levels of the desired FA. For example, seed-specific expressi...

  10. Total synthesis of (+)-zaragozic acid C.


    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G


    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  11. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.


    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  12. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  13. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  14. The Impact of Fatty Acids on the Antibacterial Properties of N-Thiolated β-Lactams

    PubMed Central

    Prosen, Katherine R.; Carroll, Ronan K.; Burda, Whittney N.; Krute, Christina N.; Bhattacharya, Biplob; Dao, My Lien; Turos, Edward; Shaw, Lindsey N.


    Bacterial fatty acid synthesis (FAS) is a potentially important, albeit controversial, target for antimicrobial therapy. Recent studies have suggested that the addition of exogenous fatty acids (FA) to growth media can circumvent the effects of FAS-targeting compounds on bacterial growth. Consequently, such agents may have limited in vivo applicability for the treatment of human disease, as free FAs are abundant within the body. Our group has previously developed N-thiolated β-lactams and found they function by interfering with FAS in select pathogenic bacteria, including MRSA. To determine if the FAS targeting activity of N-thiolated β-lactams can be abrogated by exogenous fatty acids, we performed MIC determinations for MRSA strains cultured with the fatty acids oleic acid and Tween 80. We find that, whilst the activity of the known FAS inhibitor triclosan is severely compromised by the addition of both oleic acid and Tween 80, exogenous FAs do not mitigate the antibacterial activity of N-thiolated β-lactams towards MRSA. Consequently, we propose that N-thiolated β-lactams are unique amongst FAS-inhibiting antimicrobials, as their effects are unimpeded by exogenous FAs. PMID:21821415

  15. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.


    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  16. Enantioselective Total Synthesis of Secalonic Acid E.


    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F


    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  17. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].


    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua


    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  18. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  19. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  20. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.


    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  1. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.


    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  2. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H


    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  3. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  4. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.


    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  5. Fas Receptor-deficient lpr Mice are protected against Acetaminophen Hepatotoxicity due to Higher Glutathione Synthesis and Enhanced Detoxification of Oxidant Stress

    PubMed Central

    Williams, C. David; McGill, Mitchell R.; Farhood, Anwar; Jaeschke, Hartmut


    Acetaminophen (APAP) overdose is a classical model of hepatocellular necrosis; however, the involvement of the Fas receptor in the pathophysiology remains controversial. Fas receptor-deficient (lpr) and C57BL/6 mice were treated with APAP to compare the mechanisms of hepatotoxicity. Lpr mice were partially protected against APAP hepatotoxicity as indicated by reduced plasma ALT and GDH levels and liver necrosis. Hepatic Cyp2e1 protein, adduct formation and hepatic glutathione (GSH) depletion were similar, demonstrating equivalent reactive metabolite generation. There was no difference in cytokine formation or hepatic neutrophil recruitment. Interestingly, hepatic GSH recovered faster in lpr mice than in wild type animals resulting in enhanced detoxification of reactive oxygen species. Driving the increased GSH levels, mRNA induction and protein expression of glutamate-cysteine ligase (gclc) were higher in lpr mice. Inducible nitric oxide synthase (iNOS) mRNA and protein levels at 6h were significantly lower in lpr mice, which correlated with reduced nitrotyrosine staining. Heat shock protein 70 (Hsp70) mRNA levels were substantially higher in lpr mice after APAP. Conclusion: Our data suggest that the faster recovery of hepatic GSH levels during oxidant stress and peroxynitrite formation, reduced iNOS expression and enhanced induction of Hsp70 attenuated the susceptibility to APAP-induced cell death in lpr mice. PMID:23628456

  6. Platelets induce apoptosis via membrane-bound FasL

    PubMed Central

    Schleicher, Rebecca I.; Reichenbach, Frank; Kraft, Peter; Kumar, Anil; Lescan, Mario; Todt, Franziska; Göbel, Kerstin; Hilgendorf, Ingo; Geisler, Tobias; Bauer, Axel; Olbrich, Marcus; Schaller, Martin; Wesselborg, Sebastian; O’Reilly, Lorraine; Meuth, Sven G.; Schulze-Osthoff, Klaus; Gawaz, Meinrad; Li, Xuri; Kleinschnitz, Christoph; Edlich, Frank


    After tissue injury, both wound sealing and apoptosis contribute to restoration of tissue integrity and functionality. Although the role of platelets (PLTs) for wound closure and induction of regenerative processes is well established, the knowledge about their contribution to apoptosis is incomplete. Here, we show that PLTs present the death receptor Fas ligand (FasL) on their surface after activation. Activated PLTs as well as the isolated membrane fraction of activated PLTs but not of resting PLTs induced apoptosis in a dose-dependent manner in primary murine neuronal cells, human neuroblastoma cells, and mouse embryonic fibroblasts. Membrane protein from PLTs lacking membrane-bound FasL (FasL△m/△m) failed to induce apoptosis. Bax/Bak-mediated mitochondrial apoptosis signaling in target cells was not required for PLT-induced cell death, but increased the apoptotic response to PLT-induced Fas signaling. In vivo, PLT depletion significantly reduced apoptosis in a stroke model and an inflammation-independent model of N-methyl-d-aspartic acid-induced retinal apoptosis. Furthermore, experiments using PLT-specific PF4Cre+ FasLfl/fl mice demonstrated a role of PLT-derived FasL for tissue apoptosis. Because apoptosis secondary to injury prevents inflammation, our findings describe a novel mechanism on how PLTs contribute to tissue homeostasis. PMID:26232171

  7. Synthesis of carbon-13-labeled tetradecanoic acids.


    Sparrow, J T; Patel, K M; Morrisett, J D


    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  8. Nucleolin inhibits Fas ligand binding and suppresses Fas-mediated apoptosis in vivo via a surface nucleolin-Fas complex.


    Wise, Jillian F; Berkova, Zuzana; Mathur, Rohit; Zhu, Haifeng; Braun, Frank K; Tao, Rong-Hua; Sabichi, Anita L; Ao, Xue; Maeng, Hoyoung; Samaniego, Felipe


    Resistance to Fas-mediated apoptosis is associated with poor cancer outcomes and chemoresistance. To elucidate potential mechanisms of defective Fas signaling, we screened primary lymphoma cell extracts for Fas-associated proteins that would have the potential to regulate Fas signaling. An activation-resistant Fas complex selectively included nucleolin. We confirmed the presence of nucleolin-Fas complexes in B-cell lymphoma cells and primary tissues, and the absence of such complexes in B-lymphocytes from healthy donors. RNA-binding domain 4 and the glycine/arginine-rich domain of nucleolin were essential for its association with Fas. Nucleolin colocalized with Fas on the surface of B-cell lymphoma cells. Nucleolin knockdown sensitized BJAB cells to Fas ligand (FasL)-induced and Fas agonistic antibody-induced apoptosis through enhanced binding, suggesting that nucleolin blocks the FasL-Fas interaction. Mice transfected with nucleolin were protected from the lethal effects of agonistic anti-mouse Fas antibody (Jo2) and had lower rates of hepatocyte apoptosis, compared with vector and a non-Fas-binding mutant of nucleolin. Our results show that cell surface nucleolin binds Fas, inhibits ligand binding, and thus prevents induction of Fas-mediated apoptosis in B-cell lymphomas and may serve as a new therapeutic target. PMID:23599269

  9. Synthesis of alpha-amino acids


    Davis, J.W. Jr.


    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  10. Synthesis and evaluation of small libraries of triazolylmethoxy chalcones, flavanones and 2-aminopyrimidines as inhibitors of mycobacterial FAS-II and PknG.


    Anand, Namrata; Singh, Priyanka; Sharma, Anindra; Tiwari, Sameer; Singh, Vandana; Singh, Diwakar K; Srivastava, Kishore K; Singh, B N; Tripathi, Rama Pati


    A synthetic strategy to access small libraries of triazolylmethoxy chalcones 4{1-20}, triazolylmethoxy flavanones 5{1-10} and triazolylmethoxy aminopyrimidines 6{1-17} from a common substrate 4-propargyloxy-2-hydroxy acetophenone using a set of different reactions has been developed. The chalcones and flavanones were screened against mycobacterial FAS-II pathway using a recombinant mycobacterial strain, against which the most potent compound showed ∼88% inhibition in bacterial growth and substantially induction of reporter gene activity at 100 μM concentration. The triazolylmethoxy aminopyrimdines were screened against PknG of Mycobaceterium tuberculosis displaying moderate to good activity (23-53% inhibition at 100 μM), comparable to the action of a standard inhibitor. PMID:22854194

  11. The Multiple DSF-family QS Signals are Synthesized from Carbohydrate and Branched-chain Amino Acids via the FAS Elongation Cycle

    PubMed Central

    Zhou, Lian; Yu, Yonghong; Chen, Xiping; Diab, Abdelgader Abdeen; Ruan, Lifang; He, Jin; Wang, Haihong; He, Ya-Wen


    Members of the diffusible signal factor (DSF) family are a novel class of quorum sensing (QS) signals in diverse Gram-negative bacteria. Although previous studies have identified RpfF as a key enzyme for the biosynthesis of DSF family signals, many questions in their biosynthesis remain to be addressed. In this study with the phytopathogen Xanthomonas campestris pv. campestris (Xcc), we show that Xcc produces four DSF-family signals (DSF, BDSF, CDSF and IDSF) during cell culture, and that IDSF is a new functional signal characterized as cis-10-methyl-2-dodecenoic acid. Using a range of defined media, we further demonstrate that Xcc mainly produces BDSF in the presence of carbohydrates; leucine and valine are the primary precursor for DSF biosynthesis; isoleucine is the primary precursor for IDSF biosynthesis. Furthermore, our biochemical analyses show that the key DSF synthase RpfF has both thioesterase and dehydratase activities, and uses 3-hydroxydedecanoyl-ACP as a substrate to produce BDSF. Finally, our results show that the classic fatty acid synthesis elongation cycle is required for the biosynthesis of DSF-family signals. Taken all together, these findings establish a general biosynthetic pathway for the DSF-family quorum sensing signals. PMID:26289160

  12. Mycobacterium tuberculosis Proteins Involved in Mycolic Acid Synthesis and Transport Localize Dynamically to the Old Growing Pole and Septum

    PubMed Central

    Cantaloube, Sylvain; Bonne, Mélanie; Diagne, Cheikh T.; Laval, Françoise; Daffé, Mamadou; Zerbib, Didier


    Understanding the mechanism that controls space-time coordination of elongation and division of Mycobacterium tuberculosis (Mtb), the causative agent of tuberculosis (TB), is critical for fighting the tubercle bacillus. Most of the numerous enzymes involved in the synthesis of Mycolic acid - Arabinogalactan-Peptidoglycan complex (MAPc) in the cell wall are essential in vivo. Using a dynamic approach, we localized Mtb enzymes belonging to the fatty acid synthase-II (FAS-II) complexes and involved in mycolic acid (MA) biosynthesis in a mycobacterial model of Mtb: M. smegmatis. Results also showed that the MA transporter MmpL3 was present in the mycobacterial envelope and was specifically and dynamically accumulated at the poles and septa during bacterial growth. This localization was due to its C-terminal domain. Moreover, the FAS-II enzymes were co-localized at the poles and septum with Wag31, the protein responsible for the polar localization of mycobacterial peptidoglycan biosynthesis. The dynamic localization of FAS-II and of the MA transporter with Wag31, at the old-growing poles and at the septum suggests that the main components of the mycomembrane may potentially be synthesized at these precise foci. This finding highlights a major difference between mycobacteria and other rod-shaped bacteria studied to date. Based on the already known polar activities of envelope biosynthesis in mycobacteria, we propose the existence of complex polar machinery devoted to the biogenesis of the entire envelope. As a result, the mycobacterial pole would represent the Achilles' heel of the bacillus at all its growing stages. PMID:24817274

  13. A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site.


    Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A


    Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor. PMID:25086508

  14. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei


    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  15. Hyaluronic acid lipoate: synthesis and physicochemical properties.


    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco


    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  16. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.


    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  17. FAS — EDRN Public Portal

    FAS is a member of the TNF-receptor superfamily. The FAS protein is a receptor for TNFSF6/FASLG and has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform.

  18. Rapid synthesis of the 7-deoxy zaragozic acid core.


    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J


    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  19. First total synthesis of prasinic acid and its anticancer activity.


    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt


    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  20. Dietary unsaturated fatty acids differently affect catecholamine handling by adrenal chromaffin cells.


    Gomes, Andreia; Correia, Gustavo; Coelho, Marisa; Araújo, João Ricardo; Pinho, Maria João; Teixeira, Ana Luisa; Medeiros, Rui; Ribeiro, Laura


    Catecholamines (CA) play an important role in cardiovascular (CDV) disease risk. Namely, noradrenaline (NA) levels positively correlate whereas adrenaline (AD) levels negatively correlate with obesity and/or CDV disease. Western diets, which are tipically rich in Ω-6 fatty acids (FAs) and deficient in Ω-3 FAs, may contribute to the development of obesity, type 2 diabetes and/or coronary artery disease. Taking this into consideration and the fact that our group has already described that saturated FAs affect catecholamine handling by adrenal chromaffin cells, this work aimed to investigate the effect of unsaturated FAs upon catecholamine handling in the same model. Our results showed that chronic exposure to unsaturated FAs differently modulated CA cellular content and release, regardless of both FA series and number of carbon atoms. Namely, the Ω-6 arachidonic and linoleic acids, based on their effect on CA release and cellular content, seemed to impair NA and AD vesicular transport, whereas γ-linolenic acid selectively impaired AD synthesis and release. Within the Ω-9 FAs, oleic acid was devoid of effect, and elaidic acid behaved similarly to γ-linolenic acid. Eicosapentaenoic and docosahexaenoic acids (Ω-3 series) impaired the synthesis and release of both NA and AD. These results deserve attention and future development, namely, in what concerns the mechanisms involved and correlative effects in vivo. PMID:25727966

  1. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.


    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  2. Expression of soluble Fas and soluble FasL in human nucleus pulposus cells.


    Sun, Zhen; Wan, Zhong-Yuan; Liu, Zhi-Heng; Guo, Yun-Shan; Yin, Jun-Bin; Duan, Chun-Guang; Gao, Yang; Li, Tao; Wang, Hai-Qiang; Luo, Zhuo-Jing


    The study aimed for addressing the expression of soluble Fas (sFas) and soluble Fas Ligand (sFasL) in human nucleus pulposus (NP) and its attendant relationship with disc degeneration. Human NP samples were collected from patients with disc degeneration and cadavers as degenerate and normal groups, respectively. Subsequently, NP cells were cultured in monolayer. ELISA was performed to identify the expression levels of sFas and sFasL in the supernatant of NP cell cultures in vitro. Quantitative real-time PCR was used to detect the expression of sFas and sFasL in human NP cells in mRNA solution. The study comprised 12 degenerate and 8 normal cadaveric NP samples. The concentration value of sFas in the supernatant was significantly higher from degenerate NP than that from normal NP at each time point. In contrast, sFasL was significantly lower at each time point. Moreover, the expression of sFas and sFasL reached the peak at various early stages of cell cultures and decreased thereafter. Furthermore, the mRNA level of Fas in degenerate NP cells was significantly higher than that in normal cells; whereas FasL showed an opposite pattern. The study is the first addressing the expression of sFas and sFasL in human NP cell cultures. Moreover, the expression of sFas and sFasL varies with culture time in vitro with different levels in degenerate and normal settings. These findings indicate that sFas and sFasL might play a role in intervertebral disc degeneration. PMID:23923075

  3. Relation of oxidative stress and glutathione synthesis to CD95(Fas/APO-1)-mediated apoptosis of adult T cell leukemia cells.


    Kohno, T; Yamada, Y; Hata, T; Mori, H; Yamamura, M; Tomonaga, M; Urata, Y; Goto, S; Kondo, T


    An IL-2 dependent adult T cell leukemia cell line (SO4) has been established that is sensitive to CD95-mediated apoptosis as well as a subline (R-SO4) that is resistant. Incubating SO4 cells with anti-CD95 IgM mAb caused concentration-dependent cell death. On the contrary, R-SO4 cells did not die even at 1000 ng/ml of anti-CD95 IgM mAb. The levels of CD95 expression on R-SO4 cells were one-third of those on SO4 cells. However a blocking Ab, anti-CD95 IgG mAb, did not induce complete resistance of SO4 cells to anti-CD95 IgM mAb as R-SO4 cells. As CD95 and TNF receptor are similar, and TNF/TNF receptor binding induces oxygen radicals, the involvement of oxidant and antioxidant systems in CD95-mediated apoptosis has been examined. The addition of anti-CD95 IgM mAb resulted in formation of intracellular oxygen radical species in the SO4 cells as measured using 2',5',-dichlorofluorescein as substrate. The oxygen radical production induced DNA damage as determined by formation of 8-hydroxydeoxyguanosine. No increase in the formation of oxygen radicals was observed in R-SO4 cells. Concentrations of the intracellular antioxidant, glutathione, and the key enzyme for its synthesis, gamma-glutamylcysteine synthetase, were 150% increased in R-SO4 cells in comparison with that of SO4 cells. Moreover, glutathione ester decreased the formation of 8-hydroxydeoxyguanosine. These results suggested that apoptosis mediated by CD95 in ATL cells is related to the production of oxygen radical species and cellular antioxidant systems, especially, glutathione synthesis. PMID:8648118

  4. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.


    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  5. Improved synthesis and characterization of saturated branched-chain fatty acid isomers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The development of viable technologies for producing green products from renewable fats and oils is highly desirable since such materials can serve as replacements for non-renewable and poorly biodegradable petroleum-based products. Mixtures of saturated branched-chain fatty acid isomers (sbc-FAs),...

  6. Theanaphthoquinone inhibits fatty acid synthase expression in EGF-stimulated human breast cancer cells via the regulation of EGFR/ErbB-2 signaling

    SciTech Connect

    Weng, M.-S.; Ho, C.-T.; Ho, Y.-S.; Lin, J.-K. . E-mail:


    Fatty acid synthase (FAS) is a major lipogenic enzyme catalyzing the synthesis of long-chain saturated fatty acids. Most breast cancers require lipogenesis for growth. Here, we demonstrated the effects of theanaphthoquinone (TNQ), a member of the thearubigins generated by the oxidation of theaflavin (TF-1), on the expression of FAS in human breast cancer cells. TNQ was found to suppress the EGF-induced expression of FAS mRNA and FAS protein in MDA-MB-231 cells. Expression of FAS has previously been shown to be regulated by the SREBP family of transcription factors. In this study, we demonstrated that the EGF-induced nuclear translocation of SREBP-1 was blocked by TNQ. Moreover, TNQ also modulated EGF-induced ERK1/2 and Akt phosphorylation. Treatment of MDA-MB-231 cells with PI 3-kinase inhibitors, LY294002 and Wortmannin, inhibited the EGF-induced expression of FAS and nuclear translocation of SREBP-1. Treatment with TNQ inhibited EGF-induced EGFR/ErbB-2 phosphorylation and dimerization. Furthermore, treatment with kinase inhibitors of EGFR and ErbB-2 suggested that EGFR/ErbB-2 activation was involved in EGF-induced FAS expression. In constitutive FAS expression, TNQ inhibited FAS expression and Akt autophosphorylation in BT-474 cells. The PI 3-kinase inhibitors and tyrosine kinase inhibitors of EGFR and ErbB-2 also reduced constitutive FAS expression. In addition, pharmacological blockade of FAS by TNQ decreased cell viability and induced cell death in BT-474 cells. In summary, our findings suggest that TNQ modulates FAS expression by the regulation of EGFR/ErbB-2 pathways and induces cell death in breast cancer cells.

  7. Evaluation of the Fas/FasL signaling pathway in diabetic rat testis.


    Bayram, S; Kizilay, G; Topcu-Tarladacalisir, Y


    We investigated the role of the Fas/Fas ligand (FasL) signaling pathway in diabetic male infertility. Male rats were divided into two groups: a control group and a streptozotocin induced diabetic group. Thirty days after induction of diabetes, samples of testes were harvested and fixed in 10% formalin for light microscopy. Germ cell apoptosis was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick end-labeling (TUNEL) and immunostaining of caspase 8 and active caspase 3. We also investigated the expressions of Fas and FasL using immunohistochemistry. Streptozotocin-induced diabetes caused severe histopathological damage and increased apoptotic tubule and apoptotic cell indices, caspase 8 and caspase 3 expressions, and Fas and FasL-immunopositive cells in the rat testes. We suggest that the Fas/FasL signaling pathway may play a role in male infertility caused by diabetes. PMID:26960002

  8. Total synthesis and complete stereostructure of gambieric acid A.


    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto


    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  9. Synthesis of fatty acids in the perused mouse liver.


    Salmon, D M; Bowen, N L; Hems, D A


    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  10. A symmetry-based formal synthesis of zaragozic acid A.


    Freeman-Cook, K D; Halcomb, R L


    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  11. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.


    Papadopoulos, Giorgos N; Kokotos, Christoforos G


    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  12. Expression of apoptotic regulatory molecules in renal cell carcinoma: elevated expression of Fas ligand.


    Olive, C; Cheung, C; Nicol, D; Falk, M C


    Renal cell carcinoma (RCC) is the most common renal neoplasm. Despite being infiltrated by tumour infiltrating lymphocytes (TIL), these TIL are unable to control tumour growth in vivo, suggesting that the cytotoxic capacity of TIL against RCC is impaired, or that the tumour cells are resistant to killing and therefore escape detection by the immune system. It is postulated that the expression of apoptotic regulatory molecules in RCC favours tumour cell survival. The present study has therefore determined the expression of Fas (APO-1/CD95), Fas ligand (Fas L) and bcl-2 in these tumours. The expression of Fas, Fas L and bcl-2 mRNA transcripts was determined in RCC, normal kidney and peripheral blood by semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR), following RNA extraction and cDNA synthesis from tissues and cell samples. Transcript levels were measured by densitometry after Southern blot hybridization of PCR products with internal radio-labelled oligonucleotide probes; a densitometry score was assigned to each hybridizing DNA band and expressed as a ratio of the glyceraldehyde-3-phosphate dehydrogenase content. In peripheral blood, the expression of Fas L and bcl-2 transcripts was similar between patients and normal healthy individuals; however, Fas transcript expression was significantly down-regulated in the patients' versus normal peripheral blood (P = 0.026). Most interestingly, significantly up-regulated Fas L expression was observed in RCC compared to normal kidney (P = 0.041). In contrast, bcl-2 transcripts were well represented in normal kidney but markedly decreased in RCC (P = 0.021). The expression of Fas transcripts in normal kidney and RCC was variable. These data demonstrate elevated expression of Fas L transcripts in RCC, but the functional relevance of this remains to be investigated. PMID:10101681

  13. Oncolytic poxvirus armed with Fas ligand leads to induction of cellular Fas receptor and selective viral replication in FasR-negative cancer.


    Sathaiah, M; Thirunavukkarasu, P; O'Malley, M E; Kavanagh, M A; Ravindranathan, R; Austin, F; Guo, Z S; Bartlett, D L


    Tumor necrosis factor superfamily members, including Fas ligand and TRAIL, have been studied extensively for cancer therapy, including as components of gene therapy. We examined the use of FasL expression to achieve tumor-selective replication of an oncolytic poxvirus (vFasL), and explored its biology and therapeutic efficacy for FasR- and FasR+ cancers. Infection of FasR+ normal and MC38 cancer cells by vFasL led to abortive viral replication owing to acute apoptosis and subsequently showed both reduced pathogenicity in non-tumor-bearing mice and reduced efficacy in FasR+ tumor-bearing mice. Infection of FasR- B16 cancer cells by vFasL led to efficient viral replication, followed by late induction of FasR and subsequent apoptosis. Treatment with vFasL as compared with its parental virus (vJS6) led to increased tumor regression and prolonged survival of mice with FasR- cancer (B16) but not with FasR+ cancer (MC38). The delayed induction of FasR by viral infection in FasR- cells provides for potential increased efficacy beyond the limit of the direct oncolytic effect. FasR induction provides one mechanism for tumor-selective replication of oncolytic poxviruses in FasR- cancers with enhanced safety. The overall result is both a safer and more effective oncolytic virus for FasR- cancer. PMID:22116377

  14. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  15. In vitro reconstitution and steady-state analysis of the fatty acid synthase from Escherichia coli

    PubMed Central

    Yu, Xingye; Liu, Tiangang; Zhu, Fayin; Khosla, Chaitan


    Microbial fatty acid derivatives are emerging as promising alternatives to fossil fuel derived transportation fuels. Among bacterial fatty acid synthases (FAS), the Escherichia coli FAS is perhaps the most well studied, but little is known about its steady-state kinetic behavior. Here we describe the reconstitution of E. coli FAS using purified protein components and report detailed kinetic analysis of this reconstituted system. When all ketosynthases are present at 1 μM, the maximum rate of free fatty acid synthesis of the FAS exceeded 100 μM/ min. The steady-state turnover frequency was not significantly inhibited at high concentrations of any substrate or cofactor. FAS activity was saturated with respect to most individual protein components when their concentrations exceeded 1 μM. The exceptions were FabI and FabZ, which increased FAS activity up to concentrations of 10 μM; FabH and FabF, which decreased FAS activity at concentrations higher than 1 μM; and holo-ACP and TesA, which gave maximum FAS activity at 30 μM concentrations. Analysis of the S36T mutant of the ACP revealed that the unusual dependence of FAS activity on holo-ACP concentration was due, at least in part, to the acyl-phosphopantetheine moiety. MALDI-TOF mass spectrometry analysis of the reaction mixture further revealed medium and long chain fatty acyl-ACP intermediates as predominant ACP species. We speculate that one or more of such intermediates are key allosteric regulators of FAS turnover. Our findings provide a new basis for assessing the scope and limitations of using E. coli as a biocatalyst for the production of diesel-like fuels. PMID:22042840

  16. Soluble Fas and Fas ligand and prognosis in children with acute lymphoblastic leukemia.


    Fathi, Mina; Amirghofran, Zahra; Shahriari, Mehdi


    The soluble forms of Fas and its ligand (sFas and sFasL) correlate with disease progression in various malignancies. We compared serum levels of sFas and sFasL in children with acute lymphoblastic leukemia and healthy children to determine the prognostic significance of these molecules. Serum levels of sFas and sFasL were measured with an enzyme-linked immunosorbent assay in 48 patients with newly diagnosed childhood acute lymphoblastic leukemia and 38 healthy children. Cut-off values of sFas and sFasL levels were based on their levels in controls. Clinical and laboratory characteristics were recorded on admission. The mean serum concentration of sFas was 243 ± 40 pg/mL in patients and 238 ± 29 pg/mL in controls. Serum levels of sFasL were 4.33 ± 0.25 ng/mL in patients and 4.27 ± 0.11 ng/mL in controls. Neither difference was significant. Based on the cut-off value, 12.5% of the patients were positive for sFas, and 16.6% were positive for sFasL. Survival was significantly longer in sFasL-positive patients (394 ± 69.6 vs. 254 ± 24.3 days) and the duration of complete remission was also longer (380 ± 65.0 vs. 246 ± 26.0 days) than in sFasL-negative patients (P < 0.02), indicating the important role of this molecule in the response to therapy. Higher sFas levels were associated with hepatosplenomegaly (P < 0.047). In conclusion, sFasL positivity was associated with a favorable outcome in ALL patients. PMID:21528407

  17. Improved ethyl caproate production of Chinese liquor yeast by overexpressing fatty acid synthesis genes with OPI1 deletion.


    Chen, Yefu; Luo, Weiwei; Gong, Rui; Xue, Xingxiang; Guan, Xiangyu; Song, Lulu; Guo, Xuewu; Xiao, Dongguang


    During yeast fermentation, ethyl esters play a key role in the development of the flavor profiles of Chinese liquor. Ethyl caproate, an ethyl ester eliciting apple-like flavor, is the characteristic flavor of strong aromatic liquor, which is the best selling liquor in China. In the traditional fermentation process, ethyl caproate is mainly produced at the later fermentation stage by aroma-producing yeast, bacteria, and mold in a mud pit instead of Saccharomyces cerevisiae at the expense of grains and fermentation time. To improve the production of ethyl caproate by Chinese liquor yeast (S. cerevisiae) with less food consumption and shorter fermentation time, we constructed three recombinant strains, namely, α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 by overexpressing acetyl-CoA carboxylase (ACC1), fatty acid synthase 1 (FAS1), and fatty acid synthase 2 (FAS2) with OPI1 (an inositol/choline-mediated negative regulatory gene) deletion, respectively. In the liquid fermentation of corn hydrolysate, the contents of ethyl caproate produced by α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 increased by 0.40-, 1.75-, and 0.31-fold, correspondingly, compared with the initial strain α5. The contents of other fatty acid ethyl esters (FAEEs) (C8:0, C10:0, C12:0) also increased. In comparison, the content of FAEEs produced by α5-FAS1ΔOPI1 significantly improved. Meanwhile, the contents of acetyl-CoA and ethyl acetate were enhanced by α5-FAS1ΔOPI1. Overall, this study offers a promising platform for the development of pure yeast culture fermentation of Chinese strong aromatic liquor without the use of a mud pit. PMID:27344573

  18. Natural fatty acid synthase inhibitors as potent therapeutic agents for cancers: A review.


    Zhang, Jia-Sui; Lei, Jie-Ping; Wei, Guo-Qing; Chen, Hui; Ma, Chao-Ying; Jiang, He-Zhong


    Context Fatty acid synthase (FAS) is the only mammalian enzyme to catalyse the synthesis of fatty acid. The expression level of FAS is related to cancer progression, aggressiveness and metastasis. In recent years, research on natural FAS inhibitors with significant bioactivities and low side effects has increasingly become a new trend. Herein, we present recent research progress on natural fatty acid synthase inhibitors as potent therapeutic agents. Objective This paper is a mini overview of the typical natural FAS inhibitors and their possible mechanism of action in the past 10 years (2004-2014). Method The information was collected and compiled through major databases including Web of Science, PubMed, and CNKI. Results Many natural products induce cancer cells apoptosis by inhibiting FAS expression, with fewer side effects than synthetic inhibitors. Conclusion Natural FAS inhibitors are widely distributed in plants (especially in herbs and foods). Some natural products (mainly phenolics) possessing potent biological activities and stable structures are available as lead compounds to synthesise promising FAS inhibitors. PMID:26864638

  19. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.


    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  20. Melissa officinalis essential oil reduces plasma triglycerides in human apolipoprotein E2 transgenic mice by inhibiting sterol regulatory element-binding protein-1c-dependent fatty acid synthesis.


    Jun, Hee-Jin; Lee, Ji Hae; Jia, Yaoyao; Hoang, Minh-Hien; Byun, Hanna; Kim, Kyoung Heon; Lee, Sung-Joon


    We investigated the hypolipidemic effects of Melissa officinalis essential oil (MOEO) in human APOE2 transgenic mice and lipid-loaded HepG2 cells. Plasma TG concentrations were significantly less in APOE2 mice orally administered MOEO (12.5 μg/d) for 2 wk than in the vehicle-treated group. Cellular TG and cholesterol concentrations were also significantly decreased in a dose- (400 and 800 mg/L) and time- (12 and 24 h) dependent manner in HepG2 cells stimulated with MOEO compared with controls. Mouse hepatic transcriptome analysis suggested MOEO feeding altered several lipid metabolic pathways, including bile acid and cholesterol synthesis and fatty acid metabolism. In HepG2 cells, the rate of fatty acid oxidation, as assessed using [1-(14)C]palmitate, was unaltered; however, the rate of fatty acid synthesis quantified with [1-(14)C]acetate was significantly reduced by treatment with 400 and 800 mg/L MOEO compared with untreated controls. This reduction was due to the decreased expression of SREBP-1c and its responsive genes in fatty acid synthesis, including FAS, SCD1, and ACC1. Subsequent chromatin immunoprecipitation analysis further demonstrated that the binding of p300/CBP-associated factor, a coactivator of SREBP-1c, and histone H3 lysine 14 acetylation at the FAS, SCD1, and ACC1 promoters were significantly reduced in the livers of APOE2 mice and HepG2 cells treated with MOEO compared with their controls. Additionally, MOEO stimulation in HepG2 cells induced bile acid synthesis and reduced the nuclear form of SREBP-2, a key transcription factor in hepatic cholesterol synthesis. These findings suggest that the intake of phytochemicals with pleasant scent could have beneficial metabolic effects. PMID:22279139

  1. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  2. Nucleic acid arrays and methods of synthesis


    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles


    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  3. Lower ω-6/ω-3 Polyunsaturated Fatty Acid Ratios Decrease Fat Deposition by Inhibiting Fat Synthesis in Gosling.


    Yu, Lihuai; Wang, Shunan; Ding, Luoyang; Liang, Xianghuan; Wang, Mengzhi; Dong, Li; Wang, Hongrong


    The objective of the current study was to investigate the effects of dietary ω-6/ω-3 polyunsaturated fatty acid (PUFA) ratios on lipid metabolism in goslings. One hundred and sixty 21-day-old Yangzhou geese of similar weight were randomly divided into 4 groups. They were fed different PUFA-supplemented diets (the 4 diets had ω-6/ω-3 PUFA ratios of 12:1, 9:1, 6:1, or 3:1). The geese were slaughtered and samples of liver and muscle were collected at day 70. The activities and the gene expression of enzymes involved in lipid metabolism were measured. The results show that the activities of acetyl coenzyme A carboxylase (ACC), malic enzyme (ME), and fatty acid synthase (FAS) were lower (p<0.05), but the activities of hepatic lipase (HL) and lipoprotein lipase (LPL) were higher (p<0.05), in the liver and the muscle from the 3:1 and 6:1 groups compared with those in the 9:1 and 12:1 groups. Expression of the genes for FAS (p<0.01), ME (p<0.01) and ACC (p<0.05) were higher in the muscle of groups fed diets with higher ω-6/ω-3 PUFA ratios. Additionally, in situ hybridization tests showed that the expression intensities of the high density lipoprotein (HDL-R) gene in the 12:1 and 9:1 groups were significantly lower (p<0.01) than that of the 3:1 group in the muscle of goslings. In conclusion, diets containing lower ω-6/ω-3 PUFA ratios (3:1 or 6:1) could decrease fat deposition by inhibiting fat synthesis in goslings. PMID:27189638

  4. Influence of fatty acid on lipase-catalyzed synthesis of ascorbyl esters and their free radical scavenging capacity.


    Stojanović, Marija; Carević, Milica; Mihailović, Mladen; Veličković, Dušan; Dimitrijević, Aleksandra; Milosavić, Nenad; Bezbradica, Dejan


    Fatty acid (FA) ascorbyl esters are recently emerging food, cosmetic, and pharmaceutical additives, which can be prepared in an eco-friendly way by using lipases as catalysts. Because they are amphiphilic molecules, which possess high free radical scavenging capacity, they can be applied as liposoluble antioxidants as well as emulsifiers and biosurfactants. In this study, the influence of a wide range of acyl donors on ester yield in lipase-catalyzed synthesis and ester antioxidant activity was examined. Among saturated acyl donors, higher yields and antioxidant activities of esters were achieved when short-chain FAs were used. Oleic acid gave the highest yield overall and its ester exhibited a high antioxidant activity. Optimization of experimental factors showed that the highest conversion (60.5%) in acetone was achieved with 5 g L(-1) of lipase, 50 mM of vitamin C, 10-fold molar excess of oleic acid, and 0.7 mL L(-1) of initial water. Obtained results showed that even short- and medium-chain ascorbyl esters could be synthesized with high yields and retained (or even exceeded) free radical scavenging capacity of l-ascorbic acid, indicating prospects of broadening their application in emulsions and liposomes. PMID:25224149

  5. Soluble Fas and the −670 Polymorphism of Fas in Lupus Nephritis

    PubMed Central

    Bollain-y-Goytia, Juan José; Arellano-Rodríguez, Mariela; Torres-Del-Muro, Felipe de Jesús; Daza-Benítez, Leonel; Francisco Muñoz-Valle, José; Avalos-Díaz, Esperanza; Herrera-Esparza, Rafael


    This study was performed to clarify the role of soluble Fas (sFas) in lupus nephritis (LN) and establish a potential relationship between LN and the −670 polymorphism of Fas in 67 patients with systemic lupus erythematosus (SLE), including a subset of 24 LN patients with proteinuria. Additionally, a group of 54 healthy subjects (HS) was included. The allelic frequency of the −670 polymorphism of Fas was determined using PCR-RFLP analysis, and sFas levels were assessed by ELISA. Additionally, the WT-1 protein level in urine was measured. The Fas receptor was determined in biopsies by immunohistochemistry (IHC) and in situ hybridization (FISH) and apoptotic features by TUNEL. Results. The −670 Fas polymorphism showed that the G allele was associated with increased SLE susceptibility, with an odds ratio (OR) of 1.86. The sFas was significantly higher in LN patients with the G/G genotype, and this subgroup exhibited correlations between the sFas level and proteinuria and increased urinary WT-1 levels. LN group shows increased expression of Fas and apoptotic features. In conclusion, our results indicate that the G allele of the −670 polymorphism of Fas is associated with genetic susceptibility in SLE patients with elevated levels of sFas in LN with proteinuria. PMID:25505993

  6. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.


    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  7. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.


    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D


    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  8. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John


    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  9. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.


    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  10. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood


    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  11. Total synthesis of legionaminic acid as basis for serological studies.


    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H


    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  12. Synthesis of α-aminoboronic acids.


    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos


    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  13. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger


    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  14. Synthesis of novel beta-lactone inhibitors of fatty acid synthase.


    Richardson, Robyn D; Ma, Gil; Oyola, Yatsandra; Zancanella, Manuel; Knowles, Lynn M; Cieplak, Piotr; Romo, Daniel; Smith, Jeffrey W


    Fatty acid synthase (FAS) is necessary for growth and survival of tumor cells and is a promising drug target for oncology. Here, we report on the syntheses and activity of novel inhibitors of the thioesterase domain of FAS. Using the structure of orlistat as a starting point, which contains a beta-lactone as the central pharmacophore, 28 novel congeners were synthesized and examined. Structural features such as the length of the alpha- and beta-alkyl chains, their chemical composition, and amino ester substitutions were altered and the resulting compounds explored for inhibitory activity toward the thioesterase domain of FAS. Nineteen congeners show improved potency for FAS in biochemical assays relative to orlistat. Three of that subset, including the natural product valilactone, also display an increased potency in inducing tumor cell death and improved solubility compared to orlistat. These findings support the idea that an orlistat congener can be optimized for use in a preclinical drug design and for clinical drug development. PMID:18710210

  15. Synthesis of Novel β-Lactone Inhibitors of Fatty Acid Synthase

    PubMed Central

    Richardson, Robyn D.; Ma, Gil; Oyola, Yatsandra; Zancanella, Manuel; Knowles, Lynn M.; Cieplak, Piotr; Romo, Daniel; Smith, Jeffrey W.


    Fatty acid synthase (FAS) is necessary for growth and survival of tumor cells and is a promising drug target for oncology. Here, we report on the syntheses and activity of novel inhibitors of the thioesterase domain of FAS. Using the structure of orlistat as a starting point, which contains a β-lactone as the central pharmacophore, 28 novel congeners were synthesized and examined. Structural features such as the length of the α- and β-alkyl chains, their chemical composition, and amino ester substitutions were altered and the resulting compounds explored for inhibitory activity toward the thioesterase domain of FAS. Nineteen congeners show improved potency for FAS in biochemical assays relative to orlistat. Three of that subset, including the natural product valilactone, also display an increased potency in inducing tumor cell death and improved solubility compared to orlistat. These findings support the idea that an orlistat congener can be optimized for use in a preclinical drug design and for clinical drug development. PMID:18710210

  16. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.


    Awasthi, Neeraj Praphulla; Singh, R P


    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  17. Altered expression of Fas receptor on alveolar macrophages and inflammatory effects of soluble Fas ligand following blunt chest trauma.


    Seitz, Daniel H; Palmer, Annette; Niesler, Ulrike; Braumüller, Sonja T; Bauknecht, Simon; Gebhard, Florian; Knöferl, Markus W


    Blunt chest trauma impairs the outcome of multiply-injured patients. Lung contusion induces inflammatory alterations and Fas-dependent apoptosis of alveolar type 2 epithelial (AT2) cells has been described. The Fas/Fas ligand (FasL) system seems to exhibit a proinflammatory potential. We aimed to elucidate the involvement of the Fas/FasL system in the inflammatory response after lung contusion. Chest trauma was induced in male rats by a pressure wave. Soluble FasL concentrations were determined in bronchoalveolar lavage fluids and alveolar macrophage (AMΦ) supernatants. Alveolar macrophages and AT2 cells were isolated to determine the surface expression (FACS) of Fas/FasL, the mRNA expression (reverse transcriptase-polymerase chain reaction) of Fas, FasL, TNF-α, IL-6, and IL-10 and to measure the release of IL-6 and IL-10 after culture with or without stimulation with FasL. After chest trauma, FasL concentration was increased in bronchoalveolar lavage fluid, and AMΦ supernatants and Fas and FasL protein were downregulated on AMΦs and unchanged on AT2 cells. The mRNA expression of Fas was increased in AMΦs and AT2 cells and that of FasL only in AMΦs isolated after lung contusion. Fas ligand stimulation further enhanced IL-6 and suppressed IL-10 release in AMΦs after trauma.The results indicate that the Fas/FasL system is activated after chest trauma, and FasL is associated with the inflammatory response after lung contusion. The proinflammatory response of AMΦs is enhanced by FasL stimulation. Both AMΦs and AT2 cells seem to contribute to the mediator release after lung contusion. These results confirm the importance of the Fas/FasL system in the inflammatory response after chest trauma. PMID:21330946

  18. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.


    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  19. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis.


    Miyanaga, Akimasa; Funa, Nobutaka; Awakawa, Takayoshi; Horinouchi, Sueharu


    Alkylresorcinols and alkylpyrones, which have a polar aromatic ring and a hydrophobic alkyl chain, are phenolic lipids found in plants, fungi, and bacteria. In the Gram-negative bacterium Azotobacter vinelandii, phenolic lipids in the membrane of dormant cysts are essential for encystment. The aromatic moieties of the phenolic lipids in A. vinelandii are synthesized by two type III polyketide synthases (PKSs), ArsB and ArsC, which are encoded by the ars operon. However, details of the synthesis of hydrophobic acyl chains, which might serve as starter substrates for the type III polyketide synthases (PKSs), were unknown. Here, we show that two type I fatty acid synthases (FASs), ArsA and ArsD, which are members of the ars operon, are responsible for the biosynthesis of C(22)-C(26) fatty acids from malonyl-CoA. In vivo and in vitro reconstitution of phenolic lipid synthesis systems with the Ars enzymes suggested that the C(22)-C(26) fatty acids produced by ArsA and ArsD remained attached to the ACP domain of ArsA and were transferred hand-to-hand to the active-site cysteine residues of ArsB and ArsC. The type III PKSs then used the fatty acids as starter substrates and carried out two or three extensions with malonyl-CoA to yield the phenolic lipids. The phenolic lipids in A. vinelandii were thus found to be synthesized solely from malonyl-CoA by the four members of the ars operon. This is the first demonstration that a type I FAS interacts directly with a type III PKS through substrate transfer. PMID:18199837

  20. Synthesis of biobased succinonitrile from glutamic acid and glutamine.


    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M


    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  1. Association of promoter polymorphisms of Fas -FasL genes with development of Chronic Myeloid Leukemia.


    Edathara, Prajitha Mohandas; Gorre, Manjula; Kagita, Sailaja; Vuree, Sugunakar; Cingeetham, Anuradha; Nanchari, Santhoshi Rani; Meka, Phanni Bhushann; Annamaneni, Sandhya; Digumarthi, Raghunadha Rao; Satti, Vishnupriya


    Chronic myeloid leukemia (CML) is a monoclonal myeloproliferative disorder of hematopoietic stem cells (HSCs), characterized by reciprocal translocation, leading to the formation of BCR-ABL oncogene with constitutive tyrosine kinase (TK) activity. This oncogene is known to deregulate different downstream pathways which ultimately lead to cell proliferation, defective DNA repair, and inhibition of apoptosis. Fas (Fas cell surface death receptor) is a member of tumor necrosis factor (TNF) superfamily which interacts with its ligand, FasL, to initiate apoptosis. Promoter polymorphisms in Fas-FasL genes are known to influence the apoptotic signaling. Hence, the present study has been aimed to find out the association of the promoter polymorphisms in Fas and FasL genes with the development and progression of CML. Blood samples from 772 subjects (386 controls and 386 cases) were collected and genotyped for Fas-FasL gene polymorphisms through PCR-RFLP method. The association between SNPs and clinical outcome was analyzed using statistical softwares like SPSS version 20, SNPSTATs, and Haploview 2.1. The study revealed a significant association of Fas -670 G>A and FasL -844 T>C polymorphisms with the development of CML while Fas -670 AG was associated with accelerated phase. Combined risk analysis by taking the risk genotypes in cases and controls revealed a significant increase in CML risk with increase in number of risk genotypes (one risk genotype-OR 1.99 (1.44-2.76), p < 0.0001; two risk genotypes-OR 3.33 (1.91-5.81), p < 0.0001). Kaplan-Meier survival analysis of Fas -670 A>G and FasL -844 T>C showed reduced event-free survival in patients carrying the variant genotypes, Fas -670 GG, 32.363 ± 6.33, and FasL -844 CC, 33.489 ± 5.83, respectively. Our findings revealed a significant association of Fas -670 GG, FasL -844 TC, and CC genotypes with increased risk of CML. PMID:26563376

  2. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.


    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko


    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  3. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.


    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  4. Stereoselective synthesis of unsaturated α-amino acids.


    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine


    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  5. Cytotoxicity Mediated by the Fas Ligand (FasL)-activated Apoptotic Pathway in Stem Cells*

    PubMed Central

    Mazar, Julia; Thomas, Molly; Bezrukov, Ludmila; Chanturia, Alexander; Pekkurnaz, Gulcin; Yin, Shurong; Kuznetsov, Sergei A.; Robey, Pamela G.; Zimmerberg, Joshua


    Whereas it is now clear that human bone marrow stromal cells (BMSCs) can be immunosuppressive and escape cytotoxic lymphocytes (CTLs) in vitro and in vivo, the mechanisms of this phenomenon remain controversial. Here, we test the hypothesis that BMSCs suppress immune responses by Fas-mediated apoptosis of activated lymphocytes and find both Fas and FasL expression by primary BMSCs. Jurkat cells or activated lymphocytes were each killed by BMSCs after 72 h of co-incubation. In comparison, the cytotoxic effect of BMSCs on non-activated lymphocytes and on caspase-8(−/−) Jurkat cells was extremely low. Fas/Fc fusion protein strongly inhibited BMSC-induced lymphocyte apoptosis. Although we detected a high level of Fas expression in BMSCs, stimulation of Fas with anti-Fas antibody did not result in the expected BMSC apoptosis, regardless of concentration, suggesting a disruption of the Fas activation pathway. Thus BMSCs may have an endogenous mechanism to evade Fas-mediated apoptosis. Cumulatively, these data provide a parallel between adult stem/progenitor cells and cancer cells, consistent with the idea that stem/progenitor cells can use FasL to prevent lymphocyte attack by inducing lymphocyte apoptosis during the regeneration of injured tissues. PMID:19531476

  6. Association of FAS and FAS Ligand Genes Polymorphism and Risk of Systemic Lupus Erythematosus

    PubMed Central

    Moudi, Bita; Salimi, Saeedeh; Farajian Mashhadi, Farzaneh; Sandoughi, Mahnaz; Zakeri, Zahra


    FAS/FASL pathway plays a critical role in maintaining peripheral immune tolerance; therefore, the apoptosis genes, Fas and Fas ligand (FasL), could be suitable candidate genes in human SLE susceptibility. Materials and Methods. In this case-control study, 106 SLE patients and 149 sex, age, and ethnicity matched healthy controls were genotyped for the Fas A-670G and FasLC-844T polymorphisms by polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP). Results. The frequency of -670AA genotype was significantly higher in SLE patients than control group and the risk of SLE was 2.1-fold greater in subjects with AA genotype (P = 0.03). The frequency of -670A allele was significantly higher in SLE patients than in controls too (58% versus 49%, P = 0.03). The -844CC genotype frequency was significantly higher in SLE patients than in healthy controls and the risk of SLE was 2.8-fold greater in these subjects (P = 0.01). The C allele frequency was significantly higher in patients than in controls (69% versus 49%, P = 0.001). Increased SLE risk was observed in individuals with combined effect of Fas-670AA and FasL-844CC genotypes (P = 0.001). Conclusion. Fas-670AA and FasL-844CC genotypes were associated with SLE risk, and combined effect of -670AA and -844CC genotypes might increase SLE susceptibility. PMID:24348139

  7. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.


    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  8. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  9. Enantioselective synthesis of isotopically labeled homocitric acid lactone.


    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T


    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  10. Intestinal expression of Fas and Fas ligand is upregulated by bacterial signaling through TLR4 and TLR5, with activation of Fas modulating intestinal TLR-mediated inflammation.


    Fernandes, Philana; O'Donnell, Charlotte; Lyons, Caitriona; Keane, Jonathan; Regan, Tim; O'Brien, Stephen; Fallon, Padraic; Brint, Elizabeth; Houston, Aileen


    TLRs play an important role in mediating intestinal inflammation and homeostasis. Fas is best studied in terms of its function in apoptosis, but recent studies demonstrate that Fas signaling may mediate additional functions such as inflammation. The role of Fas, and the Fas ligand (FasL), in the intestine is poorly understood. The aim of this study was to evaluate potential cross-talk between TLRs and Fas/FasL system in intestinal epithelial cells (IECs). IECs were stimulated with TLR ligands, and expression of Fas and FasL was investigated. Treatment with TLR4 and TLR5 ligands, but not TLR2 and 9 ligands, increased expression of Fas and FasL in IECs in vitro. Consistent with this finding, expression of intestinal Fas and FasL was reduced in vivo in the epithelium of TLR4 knockout (KO), 5KO, and germ-free mice, but not in TLR2KO mice. Modulating Fas signaling using agonistic anti-Fas augmented TLR4- and TLR5-mediated TNF-α and IL-8 production by IECs. In addition, suppression of Fas in IECs reduced the ability of TLR4 and TLR5 ligands and the intestinal pathogens Salmonella typhimurium and Listeria monocytogenes to induce the expression of IL-8. In conclusion, this study demonstrates that extensive cross-talk in IECs occurs between the Fas and TLR signaling pathways, with the FasL/Fas system playing a role in TLR-mediated inflammatory responses in the intestine. PMID:25378591

  11. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.


    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  12. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk


    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  13. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji


    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  14. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.


    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  15. Orthogonal Fatty Acid Biosynthetic Pathway Improves Fatty Acid Ethyl Ester Production in Saccharomyces cerevisiae.


    Eriksen, Dawn T; HamediRad, Mohammad; Yuan, Yongbo; Zhao, Huimin


    Fatty acid ethyl esters (FAEEs) are a form of biodiesel that can be microbially produced via a transesterification reaction of fatty acids with ethanol. The titer of microbially produced FAEEs can be greatly reduced by unbalanced metabolism and an insufficient supply of fatty acids, resulting in a commercially inviable process. Here, we report on a pathway engineering strategy in Saccharomyces cerevisiae for enhancing the titer of microbially produced FAEEs by providing the cells with an orthogonal route for fatty acid synthesis. The fatty acids generated from this heterologous pathway would supply the FAEE production, safeguarding endogenous fatty acids for cellular metabolism and growth. We investigated the heterologous expression of a Type-I fatty acid synthase (FAS) from Brevibacterium ammoniagenes coupled with WS/DGAT, the wax ester synthase/acyl-coenzyme that catalyzes the transesterification reaction with ethanol. Strains harboring the orthologous fatty acid synthesis yielded a 6.3-fold increase in FAEE titer compared to strains without the heterologous FAS. Variations in fatty acid chain length and degree of saturation can affect the quality of the biodiesel; therefore, we also investigated the diversity of the fatty acid production profile of FAS enzymes from other Actinomyces organisms. PMID:25594225

  16. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.


    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu


    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  17. Synthesis and chirality of amino acids under interstellar conditions.


    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J


    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  18. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.


    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  19. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.


    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  20. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.


    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  1. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.


    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  2. dFasArt: dynamic neural processing in FasArt model.


    Cano-Izquierdo, Jose-Manuel; Almonacid, Miguel; Pinzolas, Miguel; Ibarrola, Julio


    The temporal character of the input is, generally, not taken into account in the neural models. This paper presents an extension of the FasArt model focused on the treatment of temporal signals. FasArt model is proposed as an integration of the characteristic elements of the Fuzzy System Theory in an ART architecture. A duality between the activation concept and membership function is established. FasArt maintains the structure of the Fuzzy ARTMAP architecture, implying a static character since the dynamic response of the input is not considered. The proposed novel model, dynamic FasArt (dFasArt), uses dynamic equations for the processing stages of FasArt: activation, matching and learning. The new formulation of dFasArt includes time as another characteristic of the input. This allows the activation of the units to have a history-dependent character instead of being only a function of the last input value. Therefore, dFasArt model is robust to spurious values and noisy inputs. As experimental work, some cases have been used to check the robustness of dFasArt. A possible application has been proposed for the detection of variations in the system dynamics. PMID:19128936

  3. Fas/FasL pathway-mediated alveolar macrophage apoptosis involved in human silicosis

    PubMed Central

    Yao, San-qiao; Rojanasakul, Liying Wang; Chen, Zhi-yuan; Xu, Ying-jun; Bai, Yu-ping; Chen, Gang; Zhang, Xi-ying; Zhang, Chun-min; Yu, Yan-qin; Shen, Fu-hai; Yuan, Ju-xiang; Chen, Jie


    In vitro and in vivo studies have demonstrated that lung cell apoptosis is associated with lung fibrosis; however the relationship between apoptosis of alveolar macrophages (AMs) and human silicosis has not been addressed. In the present study, AM apoptosis was determined in whole-lung lavage fluid from 48 male silicosis patients, 13 male observers, and 13 male healthy volunteers. The relationships between apoptosis index (AI) and silica exposure history, soluble Fas (sFas)/membrane-bound Fas (mFas), and caspase-3/caspase-8 were analyzed. AI, mFas, and caspase-3 were significantly higher in lung lavage fluids from silicosis patients than those of observers or healthy volunteers, but the level of sFas demonstrated a decreasing trend. AI was related to silica exposure, upregulation of mFas, and activation of caspase-3 and -8, as well as influenced by smoking status after adjusting for confounding factors. These results indicate that AM apoptosis could be used as a potential biomarker for human silicosis, and the Fas/FasL pathway may regulate this process. The present data from human lung lavage samples may help to understand the mechanism of silicosis and in turn lead to strategies for preventing or treating this disease. PMID:21910009

  4. FAS 116 and 117: the implementation process.


    Bigalke, J T


    The Financial Accounting Standards Board finalized and issued two new statements in June 1993: "Financial Statements of Not-for-Profit Organizations" (FAS 117) and "Accounting for Contributions Received and Contributions Made" (FAS 116). The statements will become effective for fiscal years beginning after December 15, 1994. Until a revised audit guide is issued, however, several factors will need to be carefully considered when implementing the two standards. PMID:10145884

  5. Lactide Synthesis and Chirality Control for Polylactic acid Production.


    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert


    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  6. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.


    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  7. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.


    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi


    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  8. Increased FasL expression correlates with apoptotic changes in granulocytes cultured with oxidized clozapine

    SciTech Connect

    Husain, Zaheed; Almeciga, Ingrid; Delgado, Julio C.; Clavijo, Olga P.; Castro, Januario E.; Belalcazar, Viviana; Pinto, Clara; Zuniga, Joaquin; Romero, Viviana; Yunis, Edmond J. . E-mail:


    Clozapine has been associated with a 1% incidence of agranulocytosis. The formation of an oxidized intermediate clozapine metabolite has been implicated in direct polymorphonuclear (PMN) toxicity. We utilized two separate systems to analyze the role of oxidized clozapine in inducing apoptosis in treated cells. Human PMN cells incubated with clozapine (0-10 {mu}M) in the presence of 0.1 mM H{sub 2}O{sub 2} demonstrated a progressive decrease of surface CD16 expression along with increased apoptosis. RT-PCR analysis showed decreased CD16 but increased FasL gene expression in clozapine-treated PMN cells. No change in constitutive Fas expression was observed in treated cells. In HL-60 cells induced to differentiate with retinoic acid (RA), a similar increase in FasL expression, but no associated changes in CD16 gene expression, was observed following clozapine treatments. Our results demonstrate increased FasL gene expression in oxidized clozapine-induced apoptotic neutrophils suggesting that apoptosis in granulocytes treated with clozapine involves Fas/FasL interaction that initiates a cascade of events leading to clozapine-induced agranulocytosis.

  9. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  10. Fatty acid profiles of ecotypes of hyperaccumulator Noccaea caerulescens growing under cadmium stress.


    Zemanová, Veronika; Pavlík, Milan; Kyjaková, Pavlína; Pavlíková, Daniela


    Changes in the fatty acid (FAs) composition in response to the extent of Cd contamination of soils (0, 30, 60 and 90 mg Cd kg(-1)) differed between ecotypes of Noccaea caerulescens originating from France - Ganges, Slovenia - Mežica and Austria - Redlschlag. Mežica ecotype accumulated more Cd in aboveground biomass compared to Ganges and Redlschlag ecotypes. Hyperaccumulators contained saturated fatty acids (SFAs) rarely occurring in plants, as are cerotic (26:0), montanic (28:0), melissic (30:0) acids, and unusual unsaturated fatty acids (USFAs), as are 16:2, 16:3, 20:2 and 20:3. Typical USFAs occurring in the family Brassicaceae, such as erucic, oleic and arachidonic acids, were missing in tested plants. Our results clearly indicate a relationship between Cd accumulation and the FAs composition. The content of SFAs decreased and the content of USFAs increased in aboveground biomass of Ganges and Mežica ecotypes with increasing Cd concentration. Opposite trend of FAs content was determined in Redlschlag ecotype. Linoleic (18:2n-6), α-linolenic (18:3n-3) and palmitic (16:0) acids were found in all ecotypes. The results observed in N. caerulescens ecotypes, showed that mainly Mežica ecotype has an efficient defense strategies which can be related on changes in FAs composition, mainly in VLCFAs synthesis. The most significant effect of ecotype on FAs composition was confirmed using multivariate analysis of variance. PMID:25886397

  11. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.


    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  12. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.


    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip


    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  13. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  14. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  15. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.


    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie


    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  16. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.


    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei


    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  17. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )


    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  18. Strategies for the Total Synthesis of Clavicipitic Acid.


    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori


    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  19. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.


    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  20. Fas/FasL pathway participates in regulation of antiviral and inflammatory response during mousepox infection of lungs.


    Bień, Karolina; Sokołowska, Justyna; Bąska, Piotr; Nowak, Zuzanna; Stankiewicz, Wanda; Krzyzowska, Malgorzata


    Fas receptor-Fas ligand (FasL) signalling is involved in apoptosis of immune cells as well as of the virus infected target cells but increasing evidence accumulates on Fas as a mediator of apoptosis-independent processes such as induction of activating and proinflammatory signals. In this study, we examined the role of Fas/FasL pathway in inflammatory and antiviral response in lungs using a mousepox model applied to C57BL6/J, B6. MRL-Faslpr/J, and B6Smn.C3-Faslgld/J mice. Ectromelia virus (ECTV) infection of Fas- and FasL-deficient mice led to increased virus titers in lungs and decreased migration of IFN-γ expressing NK cells, CD4+ T cells, CD8+ T cells, and decreased IL-15 expression. The lungs of ECTV-infected Fas- and FasL-deficient mice showed significant inflammation during later phases of infection accompanied by decreased expression of anti-inflammatory IL-10 and TGF-β1 cytokines and disturbances in CXCL1 and CXCL9 expression. Experiments in vitro demonstrated that ECTV-infected cultures of epithelial cells, but not macrophages, upregulate Fas and FasL and are susceptible to Fas-induced apoptosis. Our study demonstrates that Fas/FasL pathway during ECTV infection of the lungs plays an important role in controlling local inflammatory response and mounting of antiviral response. PMID:25873756

  1. Fas/FasL Pathway Participates in Regulation of Antiviral and Inflammatory Response during Mousepox Infection of Lungs

    PubMed Central

    Bień, Karolina; Sokołowska, Justyna; Bąska, Piotr; Nowak, Zuzanna; Stankiewicz, Wanda; Krzyzowska, Malgorzata


    Fas receptor-Fas ligand (FasL) signalling is involved in apoptosis of immune cells as well as of the virus infected target cells but increasing evidence accumulates on Fas as a mediator of apoptosis-independent processes such as induction of activating and proinflammatory signals. In this study, we examined the role of Fas/FasL pathway in inflammatory and antiviral response in lungs using a mousepox model applied to C57BL6/J, B6. MRL-Faslpr/J, and B6Smn.C3-Faslgld/J mice. Ectromelia virus (ECTV) infection of Fas- and FasL-deficient mice led to increased virus titers in lungs and decreased migration of IFN-γ expressing NK cells, CD4+ T cells, CD8+ T cells, and decreased IL-15 expression. The lungs of ECTV-infected Fas- and FasL-deficient mice showed significant inflammation during later phases of infection accompanied by decreased expression of anti-inflammatory IL-10 and TGF-β1 cytokines and disturbances in CXCL1 and CXCL9 expression. Experiments in vitro demonstrated that ECTV-infected cultures of epithelial cells, but not macrophages, upregulate Fas and FasL and are susceptible to Fas-induced apoptosis. Our study demonstrates that Fas/FasL pathway during ECTV infection of the lungs plays an important role in controlling local inflammatory response and mounting of antiviral response. PMID:25873756

  2. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin


    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  3. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  4. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.


    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G


    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  5. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John


    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  6. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others


    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  7. Regulation of mevalonate synthesis in rat mammary glands by dietary n-3 and n-6 polyunsaturated fatty acids.


    El-Sohemy, A; Archer, M C


    It is well established that dietary n-6 polyunsaturated fatty acids (PU-FAs) enhance rat mammary tumor development whereas n-3 PUFAs inhibit it, yet the mechanisms are unclear. The objective of this study was to investigate a mechanism by which n-3 and n-6 PUFAs could modulate mammary carcinogenesis. Female Sprague Dawley rats were fed diets containing either menhaden (n-3) or safflower oil (n-6) in a 7% fat diet for 1 week. In comparison to the n-6 diet, the n-3 diet significantly reduced the activity and levels of 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase in mammary glands, thereby suppressing the formation of mevalonate. In addition to being essential for cholesterol biosynthesis, mevalonate is also required for DNA synthesis and may be involved in malignant transformation. Serum cholesterol was lower in the n-3 group than in the n-6 group (1.91 +/- 0.18 versus 2.61 +/- 0.37 mM; P < 0.01). Extrahepatic tissues meet most of their cholesterol requirements from circulating cholesterol, and the internalized cholesterol down-regulates HMG-CoA reductase. Thus, the concomitant decrease in serum cholesterol and mammary gland HMG-CoA reductase levels suggests that changes in circulating cholesterol levels do not solely determine the activity of extrahepatic reductase. We conclude that the mevalonate pathway may be a mechanism through which different types of dietary fat modulate breast cancer development. PMID:9288773

  8. sFas and sFas ligand and pediatric sepsis-induced multiple organ failure syndrome.


    Doughty, Lesley; Clark, Robert S B; Kaplan, Sandra S; Sasser, Howell; Carcillo, Joseph


    The Fas-Fas ligand system is important for apoptosis of activated immune cells. Perturbation of this system occurs in diseases with dysregulated inflammation. Increased soluble Fas (sFas) occurs in systemic inflammatory response syndrome (SIRS) and can block apoptosis. Increased shedding of FasL (sFasL) occurs in viral infection and hepatitis. Although dysregulated inflammation is associated with sepsis-induced multiple organ failure (MOF) in children, a role for Fas has not been established. We hypothesize that 1) sFas will be increased in children with severe and persistent sepsis-induced MOF and will correlate with inflammatory markers suggesting a role for sFas in inflammatory dysregulation in severe sepsis, and 2) sFasL will be increased when viral sepsis or sepsis-induced liver failure-associated MOF is present in children. Plasma sFas, sFasL, IL-6, IL-10, nitrite + nitrates, and organ failure scores were measured on d 1 and d 3 in 92 children with severe sepsis and 12 critically ill control children. sFas levels were increased in severe sepsis, continued to increase in persistent MOF and nonsurvivors, and were correlated with serum inflammatory markers (IL-6, IL-10, nitrite + nitrate levels). In contrast, sFasL was not increased in severe sepsis and did not correlate with inflammation. sFasL was, however, increased in liver failure-associated MOF and in nonsurvivors, and was associated with viral infection. At autopsy, hepatocyte destruction and lymphocyte infiltration were associated with increased sFas and sFasL levels. sFas may interfere with activated immune cell death and contribute to dysregulation of inflammation, worsening outcome from severe sepsis. sFasL may contribute to hepatic injury and the development of liver failure-associated MOF. PMID:12438671

  9. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.


    Lem, N W; Stumpf, P K


    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  10. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.


    Cronan, John E


    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  11. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.


    Cronan, John E


    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  12. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.


    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  13. Microsomal prostaglandin E synthase-1 protects against Fas-induced liver injury.


    Yao, Lu; Chen, Weina; Han, Chang; Wu, Tong


    Microsomal prostaglandin E synthase-1 (mPGES-1) is the terminal enzyme for the synthesis of prostaglandin E2 (PGE2), a proproliferative and antiapoptotic lipid molecule important for tissue regeneration and injury repair. In this study, we developed transgenic (Tg) mice with targeted expression of mPGES-1 in the liver to assess Fas-induced hepatocyte apoptosis and acute liver injury. Compared with wild-type (WT) mice, the mPGES-1 Tg mice showed less liver hemorrhage, lower serum alanine transaminase (ALT) and aspartate transaminase (AST) levels, less hepatic necrosis/apoptosis, and lower level of caspase cascade activation after intraperitoneal injection of the anti-Fas antibody Jo2. Western blotting analysis revealed increased expression and activation of the serine/threonine kinase Akt and associated antiapoptotic molecules in the liver tissues of Jo2-treated mPGES-1 Tg mice. Pretreatment with the mPGES-1 inhibitor (MF63) or the Akt inhibitor (Akt inhibitor V) restored the susceptibility of the mPGES-1 Tg mice to Fas-induced liver injury. Our findings provide novel evidence that mPGES-1 prevents Fas-induced liver injury through activation of Akt and related signaling and suggest that induction of mPGES-1 or treatment with PGE2 may represent important therapeutic strategy for the prevention and treatment of Fas-associated liver injuries. PMID:27102561

  14. Ascorbic acid intake and oxalate synthesis.


    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P


    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  15. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.


    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R


    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  16. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.


    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  17. Impaired Fas-Fas Ligand Interactions Result in Greater Recurrent Herpetic Stromal Keratitis in Mice

    PubMed Central

    Yin, Xiao-Tang; Keadle, Tammie L.; Hard, Jessicah; Herndon, John; Potter, Chloe A.; Del Rosso, Chelsea R.; Ferguson, Thomas A.; Stuart, Patrick M.


    Herpes simplex virus-1 (HSV-1) infection of the cornea leads to a potentially blinding condition termed herpetic stromal keratitis (HSK). Clinical studies have indicated that disease is primarily associated with recurrent HSK following reactivation of a latent viral infection of the trigeminal ganglia. One of the key factors that limit inflammation of the cornea is the expression of Fas ligand (FasL). We demonstrate that infection of the cornea with HSV-1 results in increased functional expression of FasL and that mice expressing mutations in Fas (lpr) and FasL (gld) display increased recurrent HSK following reactivation compared to wild-type mice. Furthermore, both gld and lpr mice took longer to clear their corneas of infectious virus and the reactivation rate for these strains was significantly greater than that seen with wild-type mice. Collectively, these findings indicate that the interaction of Fas with FasL in the cornea restricts the development of recurrent HSK. PMID:26504854

  18. The signaling pathways by which the Fas/FasL system accelerates oocyte aging.


    Zhu, Jiang; Lin, Fei-Hu; Zhang, Jie; Lin, Juan; Li, Hong; Li, You-Wei; Tan, Xiu-Wen; Tan, Jing-He


    In spite of great efforts, the mechanisms for postovulatory oocyte aging are not fully understood. Although our previous work showed that the FasL/Fas signaling facilitated oocyte aging, the intra-oocyte signaling pathways are unknown. Furthermore, the mechanisms by which oxidative stress facilitates oocyte aging and the causal relationship between Ca2+ rises and caspase-3 activation and between the cell cycle and apoptosis during oocyte aging need detailed investigations. Our aim was to address these issues by studying the intra-oocyte signaling pathways for Fas/FasL to accelerate oocyte aging. The results indicated that sFasL released by cumulus cells activated Fas on the oocyte by increasing reactive oxygen species via activating NADPH oxidase. The activated Fas triggered Ca2+ release from the endoplasmic reticulum by activating phospholipase C-γ pathway and cytochrome c pathway. The cytoplasmic Ca2+ rises activated calcium/calmodulin-dependent protein kinase II (CaMKII) and caspase-3. While activated CaMKII increased oocyte susceptibility to activation by inactivating maturation-promoting factor (MPF) through cyclin B degradation, the activated caspase-3 facilitated further Ca2+releasing that activates more caspase-3 leading to oocyte fragmentation. Furthermore, caspase-3 activation and fragmentation were prevented in oocytes with a high MPF activity, suggesting that an oocyte must be in interphase to undergo apoptosis. PMID:26869336

  19. Targeting the Fas/FasL system in Rheumatoid Arthritis therapy: Promising or risky?


    Calmon-Hamaty, Flavia; Audo, Rachel; Combe, Bernard; Morel, Jacques; Hahne, Michael


    Rheumatoid Arthritis (RA) is a chronic inflammatory disease affecting synovial joints. Tumor necrosis factor (TNF) α is a key component of RA pathogenesis and blocking this cytokine is the most common strategy to treat the disease. Though TNFα blockers are very efficient, one third of the RA patients are unresponsive or present side effects. Therefore, the development of novel therapeutic approaches is required. RA pathogenesis is characterized by the hyperplasia of the synovium, closely associated to the pseudo-tumoral expansion of fibroblast-like synoviocytes (FLS), which invade and destroy the joint structure. Hence, depletion of RA FLS has been proposed as an alternative therapeutic strategy. The TNF family member Fas ligand (FasL) was reported to trigger apoptosis in FLS of arthritic joints by binding to its receptor Fas and therefore suggested as a promising candidate for targeting the hyperplastic synovial tissue. However, this cytokine is pleiotropic and recent data from the literature indicate that Fas activation might have a disease-promoting role in RA by promoting cell proliferation. Therefore, a FasL-based therapy for RA requires careful evaluation before being applied. In this review we aim to overview what is known about the apoptotic and non-apoptotic effects of Fas/FasL system and discuss its relevance in RA. PMID:25481649

  20. The signaling pathways by which the Fas/FasL system accelerates oocyte aging

    PubMed Central

    Zhu, Jiang; Lin, Fei-Hu; Zhang, Jie; Lin, Juan; Li, Hong; Li, You-Wei; Tan, Xiu-Wen; Tan, Jing-He


    In spite of great efforts, the mechanisms for postovulatory oocyte aging are not fully understood. Although our previous work showed that the FasL/Fas signaling facilitated oocyte aging, the intra-oocyte signaling pathways are unknown. Furthermore, the mechanisms by which oxidative stress facilitates oocyte aging and the causal relationship between Ca2+ rises and caspase-3 activation and between the cell cycle and apoptosis during oocyte aging need detailed investigations. Our aim was to address these issues by studying the intra-oocyte signaling pathways for Fas/FasL to accelerate oocyte aging. The results indicated that sFasL released by cumulus cells activated Fas on the oocyte by increasing reactive oxygen species via activating NADPH oxidase. The activated Fas triggered Ca2+ release from the endoplasmic reticulum by activating phospholipase C-γ pathway and cytochrome c pathway. The cytoplasmic Ca2+ rises activated calcium/calmodulin-dependent protein kinase II (CaMKII) and caspase-3. While activated CaMKII increased oocyte susceptibility to activation by inactivating maturation-promoting factor (MPF) through cyclin B degradation, the activated caspase-3 facilitated further Ca2+ releasing that activates more caspase-3 leading to oocyte fragmentation. Furthermore, caspase-3 activation and fragmentation were prevented in oocytes with a high MPF activity, suggesting that an oocyte must be in interphase to undergo apoptosis. PMID:26869336

  1. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.


    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  2. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.


    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A


    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  3. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W


    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  4. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    SciTech Connect

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.


    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease.

  5. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.


    van den Broek, Lambertus A M; Boeriu, Carmen G


    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  6. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco


    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  7. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.


    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian


    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  8. Synthesis and evaluation of colletoic acid core derivatives.


    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima


    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  9. A lack of Fas/FasL signalling leads to disturbances in the antiviral response during ectromelia virus infection.


    Bień, K; Sobańska, Z; Sokołowska, J; Bąska, P; Nowak, Z; Winnicka, A; Krzyzowska, M


    Ectromelia virus (ECTV) is an orthopoxvirus (OPV) that causes mousepox, the murine equivalent of human smallpox. Fas receptor-Fas ligand (FasL) signaling is involved in apoptosis of immune cells and virus-specific cytotoxicity. The Fas/FasL pathway also plays an important role in controlling the local inflammatory response during ECTV infection. Here, the immune response to the ECTV Moscow strain was examined in Fas (-) (lpr), FasL (-) (gld) and C57BL6 wild-type mice. During ECTV-MOS infection, Fas- and FasL mice showed increased viral titers, decreased total numbers of NK cells, CD4(+) and CD8(+) T cells followed by decreased percentages of IFN-γ expressing NK cells, CD4(+) and CD8(+) T cells in spleens and lymph nodes. At day 7 of ECTV-MOS infection, Fas- and FasL-deficient mice had the highest regulatory T cell (Treg) counts in spleen and lymph nodes in contrast to wild-type mice. Furthermore, at days 7 and 10 of the infection, we observed significantly higher numbers of PD-L1-expressing dendritic cells in Fas (-) and FasL (-) mice in comparison to wild-type mice. Experiments in co-cultures of CD4(+) T cells and bone-marrow-derived dendritic cells showed that the lack of bilateral Fas-FasL signalling led to expansion of Tregs. In conclusion, our results demonstrate that during ECTV infection, Fas/FasL can regulate development of tolerogenic DCs and Tregs, leading to an ineffective immune response. PMID:26780774

  10. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu


    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  11. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.


    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu


    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  12. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio


    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  13. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.


    Kitadai, Norio


    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids. PMID:25796392

  14. Design and synthesis of boronic acid inhibitors of endothelial lipase.


    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W


    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  15. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.


    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  16. Synthesis and biological activity of novel deoxycholic acid derivatives.


    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F


    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  17. Synthesis of all nineteen appropriately protected chiral alpha-hydroxy acid equivalents of the alpha-amino acids for Boc solid-phase depsi-peptide synthesis.


    Deechongkit, Songpon; You, Shu-Li; Kelly, Jeffery W


    [reaction: see text] The preparation of depsi-peptides, amide-to-ester-substituted peptides used to probe the role of hydrogen bonding in protein folding energetics, is accomplished by replacing specific l-alpha-amino acid residues by their alpha-hydroxy acid counterparts in a solid-phase synthesis employing a t-Boc strategy. Herein we describe the efficient stereoselective synthesis of all 19 appropriately protected alpha-hydroxy acid equivalents of the l-alpha-amino acids, employing commercially available materials, expanding the number of available alpha-hydroxy acids from 9 to 19. PMID:14961607

  18. Rapid and transient palmitoylation of the tyrosine kinase Lck mediates Fas signaling

    PubMed Central

    Akimzhanov, Askar M.; Boehning, Darren


    Palmitoylation is the posttranslational modification of proteins with a 16-carbon fatty acid chain through a labile thioester bond. The reversibility of protein palmitoylation and its profound effect on protein function suggest that this modification could play an important role as an intracellular signaling mechanism. Evidence that palmitoylation of proteins occurs with the kinetics required for signal transduction is not clear, however. Here we show that engagement of the Fas receptor by its ligand leads to an extremely rapid and transient increase in palmitoylation levels of the tyrosine kinase Lck. Lck palmitoylation kinetics are consistent with the activation of downstream signaling proteins, such as Zap70 and PLC-γ1. Inhibiting Lck palmitoylation not only disrupts proximal Fas signaling events, but also renders cells resistant to Fas-mediated apoptosis. Knockdown of the palmitoyl acyl transferase DHHC21 eliminates activation of Lck and downstream signaling after Fas receptor stimulation. Our findings demonstrate highly dynamic Lck palmitoylation kinetics that are essential for signaling downstream of the Fas receptor. PMID:26351666

  19. Rapid and transient palmitoylation of the tyrosine kinase Lck mediates Fas signaling.


    Akimzhanov, Askar M; Boehning, Darren


    Palmitoylation is the posttranslational modification of proteins with a 16-carbon fatty acid chain through a labile thioester bond. The reversibility of protein palmitoylation and its profound effect on protein function suggest that this modification could play an important role as an intracellular signaling mechanism. Evidence that palmitoylation of proteins occurs with the kinetics required for signal transduction is not clear, however. Here we show that engagement of the Fas receptor by its ligand leads to an extremely rapid and transient increase in palmitoylation levels of the tyrosine kinase Lck. Lck palmitoylation kinetics are consistent with the activation of downstream signaling proteins, such as Zap70 and PLC-γ1. Inhibiting Lck palmitoylation not only disrupts proximal Fas signaling events, but also renders cells resistant to Fas-mediated apoptosis. Knockdown of the palmitoyl acyl transferase DHHC21 eliminates activation of Lck and downstream signaling after Fas receptor stimulation. Our findings demonstrate highly dynamic Lck palmitoylation kinetics that are essential for signaling downstream of the Fas receptor. PMID:26351666

  20. Synthesis and crystal structures of HgFAsF6, Hg(HF)2(AsF6)2, Hg(HF)(AsF6)2 and Hg(AsF6)(SO3F)

    NASA Astrophysics Data System (ADS)

    Mazej, Zoran; Goreshnik, Evgeny A.


    The colourless HgFAsF6 was synthesized by oxidation of Hg2(AsF6)2 with elemental fluorine in anhydrous hydrogen fluoride. It crystallizes in the monoclinic space group P21/c with a=7.0645(3) Å, b=9.9023(3) Å, c=7.8686(3) Å, β=102.960(4)° V=536.43(3) Å3, and Z=4 at 150 K. The structure of HgFAsF6 consists of infinite zig-zag -[Hg-F-Hg]- chains oriented parallel to each other along the b axis and interconected by AsF6 groups. Hg(HF)2(AsF6)2 crystallizes in the triclinic space group P 1 bar with a=5.0781(3) Å, b=6.6907(5) Å, c=7.7135(5) Å, α=84.045(5), β=79.277(5)°, γ=80.612(6), V=253.32(3) Å3, and Z=1 at 150 K. The crystal structure is composed of infinite columns of Hg atoms linked by AsF6 groups. Each pair of adjacent Hg atoms is bridged by two AsF6 groups. The coordination of Hg is completed by two F atoms provided by HF molecules. Hg(HF)(AsF6)2 crystallizes in the monoclinic space group P21/c with a=9.4921(8) Å, b=9.2834(6) Å, c=10.5448(7) Å, β=103.795(7)°, V=902.53(12) Å3, and Z=4 at 150 K and it is isotypic to Cd(HF)(AsF6)2. The new mixed-anion compound Hg(AsF6)(SO3F) crystallizes in the monoclinic space group P21/c with a=5.1975(8) Å, b=18.046(3) Å, c=15.873(5) Å, β=93.614(13)°, V=1485.9(6) Å3, and Z=4 at 200 K. All three oxygen atoms from each SO3F group utilize for bonding with three Hg atoms. The Hg1 (Hg2) atoms are coordinated by two (four) oxygen atoms from two (four) SO3F groups and by six (three) fluorine atoms from AsF6 groups forming on that way tridimensional framework.

  1. Synthesis and characterization of acidic mesoporous borosilicate thin films.


    Xiu, Tongping; Liu, Qian; Wang, Jiacheng


    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc. PMID:19441565

  2. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.


    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G


    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  3. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen


    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  4. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.


    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  5. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica


    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  6. FAS system deregulation in T-cell lymphoblastic lymphoma

    PubMed Central

    Villa-Morales, M; Cobos, M A; González-Gugel, E; Álvarez-Iglesias, V; Martínez, B; Piris, M A; Carracedo, A; Benítez, J; Fernández-Piqueras, J


    The acquisition of resistance towards FAS-mediated apoptosis may be required for tumor formation. Tumors from various histological origins exhibit FAS mutations, the most frequent being hematological malignancies. However, data regarding FAS mutations or FAS signaling alterations are still lacking in precursor T-cell lymphoblastic lymphomas (T-LBLs). The available data on acute lymphoblastic leukemia, of precursor origin as well, indicate a low frequency of FAS mutations but often report a serious reduction in FAS-mediated apoptosis as well as chemoresistance, thus suggesting the occurrence of mechanisms able to deregulate the FAS signaling pathway, different from FAS mutation. Our aim at this study was to determine whether FAS-mediated apoptotic signaling is compromised in human T-LBL samples and the mechanisms involved. This study on 26 T-LBL samples confirms that the FAS system is impaired to a wide extent in these tumors, with 57.7% of the cases presenting any alteration of the pathway. A variety of mechanisms seems to be involved in such alteration, in order of frequency the downregulation of FAS, the deregulation of other members of the pathway and the occurrence of mutations at FAS. Considering these results together, it seems plausible to think of a cumulative effect of several alterations in each T-LBL, which in turn may result in FAS/FASLG system deregulation. Since defective FAS signaling may render the T-LBL tumor cells resistant to apoptotic cell death, the correct prognosis, diagnosis and thus the success of anticancer therapy may require such an in-depth knowledge of the complete scenario of FAS-signaling alterations. PMID:24603338

  7. FAS system deregulation in T-cell lymphoblastic lymphoma.


    Villa-Morales, M; Cobos, M A; González-Gugel, E; Álvarez-Iglesias, V; Martínez, B; Piris, M A; Carracedo, A; Benítez, J; Fernández-Piqueras, J


    The acquisition of resistance towards FAS-mediated apoptosis may be required for tumor formation. Tumors from various histological origins exhibit FAS mutations, the most frequent being hematological malignancies. However, data regarding FAS mutations or FAS signaling alterations are still lacking in precursor T-cell lymphoblastic lymphomas (T-LBLs). The available data on acute lymphoblastic leukemia, of precursor origin as well, indicate a low frequency of FAS mutations but often report a serious reduction in FAS-mediated apoptosis as well as chemoresistance, thus suggesting the occurrence of mechanisms able to deregulate the FAS signaling pathway, different from FAS mutation. Our aim at this study was to determine whether FAS-mediated apoptotic signaling is compromised in human T-LBL samples and the mechanisms involved. This study on 26 T-LBL samples confirms that the FAS system is impaired to a wide extent in these tumors, with 57.7% of the cases presenting any alteration of the pathway. A variety of mechanisms seems to be involved in such alteration, in order of frequency the downregulation of FAS, the deregulation of other members of the pathway and the occurrence of mutations at FAS. Considering these results together, it seems plausible to think of a cumulative effect of several alterations in each T-LBL, which in turn may result in FAS/FASLG system deregulation. Since defective FAS signaling may render the T-LBL tumor cells resistant to apoptotic cell death, the correct prognosis, diagnosis and thus the success of anticancer therapy may require such an in-depth knowledge of the complete scenario of FAS-signaling alterations. PMID:24603338


    Technology Transfer Automated Retrieval System (TEKTRAN)

    In adults, sepsis reduces protein synthesis in skeletal muscle by restraining translation. The effect of sepsis on amino acid-stimulated muscle protein synthesis has not been determined in neonates, a population who is highly anabolic and whose muscle protein synthesis rates are uniquely sensitive ...

  9. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams


    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  10. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.


    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams


    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  11. A novel interaction linking the FAS-II and phthiocerol dimycocerosate (PDIM) biosynthetic pathways.


    Kruh, Nicole A; Borgaro, Janine G; Ruzsicska, Béla P; Xu, Hua; Tonge, Peter J


    The fatty acid biosynthesis (FAS-II) pathway in Mycobacterium tuberculosis generates long chain fatty acids that serve as the precursors to mycolic acids, essential components of the mycobacterial cell wall. Enzymes in the FAS-II pathway are thought to form one or more noncovalent multi-enzyme complexes within the cell, and a bacterial two-hybrid screen was used to search for missing components of the pathway and to furnish additional data on interactions involving these enzymes in vivo. Using the FAS-II beta-ketoacyl synthase, KasA, as bait, an extensive bacterial two-hybrid screen of a M. tuberculosis genome fragment library unexpectedly revealed a novel interaction between KasA and PpsB as well as PpsD, two polyketide modules involved in the biosynthesis of the virulence lipid phthiocerol dimycocerosate (PDIM). Sequence analysis revealed that KasA interacts with PpsB and PpsD in the region of the acyl carrier domain of each protein, raising the possibility that lipids could be transferred between the FAS-II and PDIM biosynthetic pathways. Subsequent studies utilizing purified proteins and radiolabeled lipids revealed that fatty acids loaded onto PpsB were transferred to KasA and also incorporated into long chain fatty acids synthesized using a Mycobacterium smegmatis lysate. These data suggest that in addition to producing PDIMs, the growing phthiocerol product can also be shuttled into the FAS-II pathway via KasA as an entry point for further elongation. Interactions between these biosynthetic pathways may exist as a simple means to increase mycobacterial lipid diversity, enhancing functionality and the overall complexity of the cell wall. PMID:18703500

  12. Total synthesis of the squalene synthase inhibitor zaragozic acid C.


    Nakamura, Seiichi


    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219

  13. Synthesis and scavenging role of furan fatty acids

    PubMed Central

    Lemke, Rachelle A. S.; Peterson, Amelia C.; Ziegelhoffer, Eva C.; Westphall, Michael S.; Tjellström, Henrik; Coon, Joshua J.; Donohue, Timothy J.


    Fatty acids play important functional and protective roles in living systems. This paper reports on the synthesis of a previously unidentified 19 carbon furan-containing fatty acid, 10,13-epoxy-11-methyl-octadecadienoate (9-(3-methyl-5-pentylfuran-2-yl)nonanoic acid) (19Fu-FA), in phospholipids from Rhodobacter sphaeroides. We show that 19Fu-FA accumulation is increased in cells containing mutations that increase the transcriptional response of this bacterium to singlet oxygen (1O2), a reactive oxygen species generated by energy transfer from one or more light-excited donors to molecular oxygen. We identify a previously undescribed class of S-adenosylmethionine-dependent methylases that convert a phospholipid 18 carbon cis unsaturated fatty acyl chain to a 19 carbon methylated trans unsaturated fatty acyl chain (19M-UFA). We also identify genes required for the O2-dependent conversion of this 19M-UFA to 19Fu-FA. Finally, we show that the presence of 1O2 leads to turnover of 19Fu-Fa in vivo. We propose that furan-containing fatty acids like 19Fu-FA can act as a membrane-bound scavenger of 1O2, which is naturally produced by integral membrane enzymes of the R. sphaeroides photosynthetic apparatus. PMID:25092314

  14. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.


    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P


    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. PMID:27012633

  15. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters


    Moens, Luc


    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  16. Helicobacter pylori Modulates Lymphoepithelial Cell Interactions Leading to Epithelial Cell Damage through Fas/Fas Ligand Interactions

    PubMed Central

    Wang, Jide; Fan, Xuejun; Lindholm, Catharina; Bennett, Michael; O'Connoll, Joe; Shanahan, Fergus; Brooks, Edward G.; Reyes, Victor E.; Ernst, Peter B.


    Helicobacter pylori causes a common chronic infection of humans that leads to epithelial cell damage. Studies have shown that apoptosis of the gastric epithelium is increased during infection and this response is associated with an expansion of gastric T-helper type 1 (Th1) cells. We report that gastric T cells contribute to apoptosis of the epithelium by a Fas/Fas ligand (FasL) interaction. Fas receptor expression was detected on freshly isolated gastric epithelial cells by flow cytometry and immunohistochemistry, and this level of expression was increased during infection with H. pylori. The expression of Fas receptor on three gastric epithelial cell lines was increased by H. pylori, either alone or in combination with gamma interferon or tumor necrosis factor alpha. The role of Fas in apoptosis of gastric epithelial cell lines was evidenced by DNA fragmentation after cross-linking of Fas with specific antibodies. FasL expression was detected by immunohistochemistry on mononuclear cells in gastric biopsy specimens of infected but not uninfected subjects. Gastric T-cell lines were also shown to express FasL, as evidenced by reverse transcription-PCR and killing of target cells expressing Fas receptor. Moreover, these T-cell lines were capable of killing cultured gastric epithelial target cells and antibodies that block the interaction between Fas receptor and FasL inhibited this cytotoxic activity. These observations demonstrate that local Th1 cells may contribute to the pathogenesis of gastric disease during H. pylori infection by increasing the expression of Fas on gastric epithelial cells and inducing apoptosis through Fas/FasL interactions. PMID:10858249

  17. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.


    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki


    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved. PMID:17511507

  18. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central


    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  19. Construction of a cyanobacterium synthesizing cyclopropane fatty acids.


    Machida, Shuntaro; Shiraiwa, Yoshihiro; Suzuki, Iwane


    Microalgae have received much attention as a next-generation source of biomass energy. However, most of the fatty acids (FAs) from microalgae are multiply unsaturated; thus, the biofuels derived from them are fluid, but vulnerable to oxidation. In this study, we attempted to synthesize cyclopropane FAs in the cyanobacterium Synechocystis sp. PCC 6803 by expressing the cfa gene for cyclopropane FA synthase from Escherichia coli with the aim of producing FAs that are fluid and stable in response to oxidization. We successfully synthesized cyclopropane FAs in Synechocystis with a yield of ~30% of total FAs. Growth of the transformants was altered, particularly at low temperatures, but photosynthesis and respiration were not significantly affected. C16:1(∆9) synthesis in the desA(-)/desD(-) strain by expression of the desC2 gene for sn-2 specific ∆9 desaturase positively affected growth at low temperatures via promotion of various cellular processes, with the exceptions of photosynthesis and respiration. Estimation of the apparent activities of desaturases suggested that some acyl-lipid desaturases might recognize the lipid side chain. PMID:27263419

  20. Fructose utilization for nucleic acid synthesis in the fetal pig.


    White, C E; Piper, E L; Noland, P R; Daniels, L B


    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  1. Stem Cell Therapies for Intervertebral Disc Degeneration: Immune Privilege Reinforcement by Fas/FasL Regulating Machinery.


    Ma, Chi-Jiao; Liu, Xu; Che, Lu; Liu, Zhi-Heng; Samartzis, Dino; Wang, Hai-Qiang


    As a main contributing factor to low back pain, intervertebral disc degeneration (IDD) is the fundamental basis for various debilitating spinal diseases. The pros and cons of current treatment modalities necessitate biological treatment strategies targeting for reversing or altering the degeneration process in terms of molecules or genes. The advances in stem cell research facilitate the studies aiming for possible clinical application of stem cell therapies for IDD. Human NP cells are versatile with cell morphology full of variety, capable of synthesizing extracellular matrix components, engulfing substances by autophagy and phagocytosis, mitochondrial vacuolization indicating dysfunction, expressing Fas and FasL as significant omens of immune privileged sites. Human discs belong to immune privilege organs with functional FasL expression, which can interact with invasive immune cells by Fas-FasL regulatory machinery. IDD is characterized by decreased expression level of FasL with dysfunctional FasL, which in turn unbalances the interaction between NP cells and immune cells. Certain modulation factors might play a role in the process, such as miR-155. Accumulating evidence indicates that Fas-FasL network expresses in a variety of stem cells. Given the expression of functional FasL and insensitive Fas in stem cells (we term as FasL privilege), transplantation of stem cells into the disc may regenerate the degenerative disc by not only differentiating into NP-like cells, increasing extracellular matrix, but also reinforce immune privilege via interaction with immune cells by Fas-FasL network. PMID:25381758

  2. Synthesis of E. faecium wall teichoic acid fragments.


    van der Es, Daan; Groenia, Nadia A; Laverde, Diana; Overkleeft, Herman S; Huebner, Johannes; van der Marel, Gijsbert A; Codée, Jeroen D C


    The first synthesis of different Enterococcus faecium wall teichoic acid (WTA) fragments is presented. The structure of these major cell wall components was elucidated recently and it was shown that these glycerolphosphate (GroP) based polymers are built up from -6-(GalNAc-α(1-3)-GalNAc-β(1-2)-GroP)- repeating units. We assembled WTA fragments up to three repeating units in length, in two series that differ in the stereochemistry of the glycerolphosphate moiety. The key GalNAc-GalNAc-GroP synthons, required for the synthesis, were generated from galactosazide building blocks that were employed in highly stereoselective glycosylation reactions to furnish both the α- and β-configured linkages. By comparing the NMR spectra of the synthesized fragments with the isolated material it appears that the hereto undefined stereochemistry of the glycerol phosphate moiety is sn-glycerol-3-phosphate. The generated fragments will be valuable tools to study their immunological activity at the molecular level. PMID:26993744

  3. [Effect of gibberellic acid on RNA synthesis in dwarf peas].


    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P


    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  4. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.


    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  5. Intermediates in the Synthesis of Type 2 Adenovirus Deoxyribonucleic Acid

    PubMed Central

    Horwitz, Marshall S.


    Intermediates in the synthesis of adenovirus type 2 deoxyribonucleic acid (DNA) were studied in HeLa cells. Pieces of DNA smaller than the viral genome were demonstrated after labeling with 3H-thymidine for 10 to 240 sec. Intermediates as small as the Okazaki fragments (8 to 10S) do not predominate at any of the above times. No detectable addition of nucleotides to parental genome could be shown, nor was there any breakdown of recently synthesized viral DNA. The DNA intermediates were of viral origin for they hybridized to viral DNA and were made at a stage of the cell cycle (G2) when host DNA is not synthesized. PMID:5132696

  6. Fas/Fas ligand-mediated apoptosis in different cell lineages and functional compartments of human lymph nodes.


    Kokkonen, Tuomo S; Karttunen, Tuomo J


    We have optimized an immunohistochemical double-staining method combining immunohistochemical lymphocyte lineage marker detection and apoptosis detection with terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling. The method was used to trace Fas-mediated apoptosis in human reactive lymph nodes according to cell lineage and anatomical location. In addition to Fas, we also studied the expression of Fas ligand (FasL), CD3, CD20, CD19, CD23, and CD68 of apoptotic cells. The presence of simultaneous Fas and FasL positivity indicated involvement of activation-induced death in the induction of paracortical apoptosis. FasL expression in the high endothelial venules might be an inductor of apoptosis of Fas-positive lymphoid cells. In addition to B-lymphocyte apoptosis in the germinal centers, there was often a high apoptosis rate of CD23-expressing follicular dendritic cells. In summary, our double-staining method provides valuable new information about the occurrence and mechanisms of apoptosis of different immune cell types in the lymph node compartments. Among other things, we present support for the importance of Fas/FasL-mediated apoptosis in lymph node homeostasis. PMID:19826071

  7. Adoptive Transfer of Dendritic Cells Expressing Fas Ligand Modulates Intestinal Inflammation in a Model of Inflammatory Bowel Disease

    PubMed Central

    de Jesus, Edelmarie Rivera; Isidro, Raymond A; Cruz, Myrella L; Marty, Harry; Appleyard, Caroline B


    Background Inflammatory bowel diseases (IBD) are chronic relapsing inflammatory conditions of unknown cause and likely result from the loss of immunological tolerance, which leads to over-activation of the gut immune system. Gut macrophages and dendritic cells (DCs) are essential for maintaining tolerance, but can also contribute to the inflammatory response in conditions such as IBD. Current therapies for IBD are limited by high costs and unwanted toxicities and side effects. The possibility of reducing intestinal inflammation with DCs genetically engineered to over-express the apoptosis-inducing FasL (FasL-DCs) has not yet been explored. Objective Investigate the immunomodulatory effect of administering FasL-DCs in the rat trinitrobenzene sulfonic acid (TNBS) model of acute colitis. Methods Expression of FasL on DCs isolated from the mesenteric lymph nodes (MLNs) of normal and TNBS-colitis rats was determined by flow cytometry. Primary rat bone marrow DCs were transfected with rat FasL plasmid (FasL-DCs) or empty vector (EV-DCs). The effect of these DCs on T cell IFNγ secretion and apoptosis was determined by ELISPOT and flow cytometry for Annexin V, respectively. Rats received FasL-DCs or EV-DCs intraperitoneally 96 and 48 hours prior to colitis induction with TNBS. Colonic T cell and neutrophil infiltration was determined by immunohistochemistry for CD3 and myeloperoxidase activity assay, respectively. Macrophage number and phenotype was measured by double immunofluorescence for CD68 and inducible Nitric Oxide Synthase. Results MLN dendritic cells from normal rats expressed more FasL than those from colitic rats. Compared to EV-DCs, FasL-DCs reduced T cell IFNγ secretion and increased T cell apoptosis in vitro. Adoptive transfer of FasL-DCs decreased macroscopic and microscopic damage scores and reduced colonic T cells, neutrophils, and proinflammatory macrophages when compared to EV-DC adoptive transfer. Conclusion FasL-DCs are effective at treating colonic

  8. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet


    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  9. An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

    PubMed Central

    Carballeira, Néstor M.; Sanabria, David; Oyola, Delise


    An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

  10. Expression of Vibrio harveyi Acyl-ACP Synthetase Allows Efficient Entry of Exogenous Fatty Acids into the Escherichia coli Fatty Acid and Lipid A Synthetic Pathways

    PubMed Central

    Jiang, Yanfang; Morgan-Kiss, Rachael M.; Campbell, John W.; Chan, Chi Ho; Cronan, John E.


    Although the Escherichia coli fatty acid synthesis (FAS) pathway is the best studied type II fatty acid synthesis system, a major experimental limitation has been the inability to feed intermediates into the pathway in vivo because exogenously-supplied free fatty acids are not efficiently converted to the acyl-acyl carrier protein (ACP) thioesters required by the pathway. We report that expression of Vibrio harveyi acyl-ACP synthetase (AasS), a soluble cytosolic enzyme that ligates free fatty acids to ACP to form acyl-ACPs, allows exogenous fatty acids to enter the E. coli fatty acid synthesis pathway. The free fatty acids are incorporated intact and can be elongated or directly incorporated into complex lipids by acyltransferases specific for acyl-ACPs. Moreover, expression of AasS strains and supplementation with the appropriate fatty acid restored growth to E. coli mutant strains that lack essential fatty acid synthesis enzymes. Thus, this strategy provides a new tool for circumventing the loss of enzymes essential for FAS function. PMID:20028080

  11. Synthesis of novel acid electrolytes for phosphoric acid fuel cells. Final report, May 1985-October 1988

    SciTech Connect

    Adcock, J.L.


    Construction of a 40-millimole-per-hour-scale aerosol direct-fluorination reactor was completed June 26, 1986. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4-methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy-1-propene, 18 grams of F-3-(2-methoxy.ethoxy)-1-propene, and 37 grams of F-3,3-dimethyl-1-butene. Eighteen grams of F-2,2-dimethyl-1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy-1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy)-1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other GRI contractors for synthesis of perfluorinated sulfur(VI) and phosphorous(V) acids.

  12. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA


    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  13. Synthesis of hyaluronic acid oligosaccharides and exploration of a fluorous-assisted approach.


    Macchione, Giuseppe; de Paz, José L; Nieto, Pedro M


    The synthesis of hyaluronic acid oligomers (tri- and tetrasaccharide) is described. We have followed a pre-glycosylation oxidation strategy. Glucuronic acid units were directly employed in coupling reactions with suitably protected glucosamine derivatives. In order to simplify the purification of synthetic intermediates, a fluorous-assisted strategy has been also explored. Using this approach, a hyaluronic acid trisaccharide was prepared. PMID:24930061

  14. Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.


    Dacquin, J P; Lee, A F; Pirez, C; Wilson, K


    Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. PMID:22089025

  15. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.


    Szostak, Michal; Spain, Malcolm; Procter, David J


    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  16. Dihydrolipoic acid activates oligomycin-sensitive thiol groups and increases ATP synthesis in mitochondria.


    Zimmer, G; Mainka, L; Krüger, E


    Investigations with dihydrolipoic acid in rat heart mitochondria and mitoplasts reveal an activation of ATP-synthase up to 45%, whereas ATPase activities decrease by 36%. In parallel with an increase in ATP synthesis oligomycin-sensitive mitochondrial -SH groups are activated at 2-4 nmol dihydrolipoic acid/mg protein. ATPase activation by the uncouplers carbonylcyanide-p-trifluoromethoxyphenylhydrazone and oleate is diminished by dihydrolipoic acid, and ATP synthesis depressed by oleate is partially restored. No such efficiency of dihydrolipoic acid is seen with palmitate-induced ATPase activation or decrease of ATP synthesis. This indicates different interference of oleate and palmitate with mitochondria. In addition to its known coenzymatic properties dihydrolipoic acid may act as a substitute for coenzyme A, thereby diminishing the uncoupling efficiency of oleate. Furthermore, dihydrolipoic acid is a very potent antioxidant, shifting the -SH-S-S- equilibrium in mitochondria to the reduced state and improving the energetic state of cells. PMID:1832845

  17. Mechanisms of fatty acid synthesis in marine fungus-like protists.


    Xie, Yunxuan; Wang, Guangyi


    Thraustochytrids are unicellular fungus-like protists and are well known for their ability to produce interesting nutraceutical compounds. Significant efforts have been made to improve their efficient production of important fatty acids (FAs), mostly by optimizing fermentation conditions and selecting highly productive thraustochytrid strains. Furthermore, noticeable improvements have been made in understanding the mechanism of FA biosynthesis, allowing for a better understanding of how thraustochytrids assemble these unique metabolites and how their biosynthesis is coupled with other related pathways. This review summarizes recent achievements on two major FA biosynthesis pathways, the standard pathway and the polyketide synthase pathway, and detail features of individual enzymes involved in FA biosynthesis, biotechnological advances in pathway engineering and enzyme characterization, and the discovery of other pathways that affect the efficiency of FA accumulation. Perspectives of biotechnological potential application of thraustochytrids are also discussed. PMID:26286514

  18. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong


    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  19. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  20. An Alkyne Diboration/6π-Electrocyclization Strategy for the Synthesis of Pyridine Boronic Acid Derivatives.


    Mora-Radó, Helena; Bialy, Laurent; Czechtizky, Werngard; Méndez, María; Harrity, Joseph P A


    A new and efficient synthesis of pyridine-based heteroaromatic boronic acid derivatives is reported through a novel diboration/6π-electrocyclization strategy. This method delivers a range of functionalized heterocycles from readily available starting materials. PMID:27059895

  1. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.


    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  2. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.


    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  3. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.


    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  4. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.


    Snowden, Roger L


    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed. PMID:18618391

  5. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.


    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  6. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  7. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.


    Adhikari, Neil D; Bates, Philip D; Browse, John


    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  8. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John


    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  9. Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.


    Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang


    Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. PMID:25605585

  10. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa


    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  11. Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

    SciTech Connect

    Standaert, Robert F; Park, Dr Seung Bum


    Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

  12. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng


    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  13. Respiratory CO(2) as Carbon Source for Nocturnal Acid Synthesis at High Temperatures in Three Species Exhibiting Crassulacean Acid Metabolism.


    Winter, K; Schröppel-Meier, G; Caldwell, M M


    TEMPERATURE EFFECTS ON NOCTURNAL CARBON GAIN AND NOCTURNAL ACID ACCUMULATION WERE STUDIED IN THREE SPECIES OF PLANTS EXHIBITING CRASSULACEAN ACID METABOLISM: Mamillaria woodsii, Opuntia vulgaris, and Kalanchoë daigremontiana. Under conditions of high soil moisture, nocturnal CO(2) gain and acid accumulation had temperature optima at 15 to 20 degrees C. Between 5 and 15 degrees C, uptake of atmospheric CO(2) largely accounted for acid accumulation. At higher tissue temperatures, acid accumulation exceeded net carbon gain indicating that acid synthesis was partly due to recycling of respiratory CO(2). When plants were kept in CO(2)-free air, acid accumulation based on respiratory CO(2) was highest at 25 to 35 degrees C. Net acid synthesis occurred up to 45 degrees C, although the nocturnal carbon balance became largely negative above 25 to 35 degrees C. Under conditions of water stress, net CO(2) exchange and nocturnal acid accumulation were reduced. Acid accumulation was proportionally more decreased at low than at high temperatures. Acid accumulation was either similar over the whole temperature range (5-45 degrees C) or showed an optimum at high temperatures, although net carbon balance became very negative with increasing tissue temperatures. Conservation of carbon by recycling respiratory CO(2) was temperature dependent. At 30 degrees C, about 80% of the dark respiratory CO(2) was conserved by dark CO(2) fixation, in both well irrigated and water stressed plants. PMID:16664827

  14. Activation of Fas by FasL induces apoptosis by a mechanism that cannot be blocked by Bcl-2 or Bcl-xL

    PubMed Central

    Huang, David C. S.; Hahne, Michael; Schroeter, Michael; Frei, Karl; Fontana, Adriano; Villunger, Andreas; Newton, Kim; Tschopp, Juerg; Strasser, Andreas


    Fas activation triggers apoptosis in many cell types. Studies with anti-Fas antibodies have produced conflicting results on Fas signaling, particularly the role of the Bcl-2 family in this process. Comparison between physiological ligand and anti-Fas antibodies revealed that only extensive Fas aggregation, by membrane bound FasL or aggregated soluble FasL consistently triggered apoptosis, whereas antibodies could act as death agonists or antagonists. Studies on Fas signaling in cell lines and primary cells from transgenic mice revealed that FADD/MORT1 and caspase-8 were required for apoptosis. In contrast, Bcl-2 or Bcl-xL did not block FasL-induced apoptosis in lymphocytes or hepatocytes, demonstrating that signaling for cell death induced by Fas and the pathways to apoptosis regulated by the Bcl-2 family are distinct. PMID:10611305

  15. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.


    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  16. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis.


    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing


    N-Acetylneuraminic acid lyase (NAL, E.C. number is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a "GRAS" (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  17. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  18. Dual control of streptokinase and streptolysin S production by the covRS and fasCAX two-component regulators in Streptococcus dysgalactiae subsp. equisimilis.


    Steiner, Kerstin; Malke, Horst


    Synthesis of the plasminogen activator streptokinase (SK) by group A streptococci (GAS) has recently been shown to be subject to control by two two-component regulators, covRS (or csrRS) and fasBCA. In independent studies, response regulator CovR proved to act as the repressor, whereas FasA was found to act indirectly as the activator by controlling the expression of a stimulatory RNA, fasX. In an attempt at understanding the regulation of SK production in the human group C streptococcal (GCS) strain H46A, the strongest SK producer known yet, we provide here physical and functional evidence for the presence of the cov and fas systems in GCS as well and, using a mutational approach, compare the balance between their opposing actions in H46A and GAS strain NZ131. Sequence analysis combined with Southern hybridization revealed that the covRS and fasCAX operons are preserved at high levels of primary structure identity between the corresponding GAS and GCS genes, with the exception of fasB, encoding a second sensor kinase that is not a member of the GCS fas operon. This analysis also showed that wild-type H46A is actually a derepressed mutant for SK and streptolysin S (SLS) synthesis, carrying a K102 amber mutation in covR. Using cov and fas mutations in various combinations together with strain constructs allowing complementation in trans, we found that, in H46A, cov and fas contribute to approximately equal negative and positive extents, respectively, to constitutive SK and SLS activity. The amounts of SK paralleled the level of skc(H46A) transcription. The most profound difference between H46A and NZ131 regarding the relative activities of the cov and fas systems consisted in significantly higher activity of a functional CovR repressor in NZ131 than in H46A. In NZ131, CovR decreased SK activity in a Fas(+) background about sevenfold, compared to a 1.9-fold reduction of SK activity in H46A. Combined with the very short-lived nature of covR mRNA (decay rate, 1.39/min

  19. Loss of Fas apoptosis inhibitory molecule leads to spontaneous obesity and hepatosteatosis

    PubMed Central

    Huo, J; Ma, Y; Liu, J-J; Ho, Y S; Liu, S; Soh, L Y; Chen, S; Xu, S; Han, W; Hong, A; Lim, S C; Lam, K-P


    Altered hepatic lipogenesis is associated with metabolic diseases such as obesity and hepatosteatosis. Insulin resistance and compensatory hyperinsulinaemia are key drivers of these metabolic imbalances. Fas apoptosis inhibitory molecule (FAIM), a ubiquitously expressed antiapoptotic protein, functions as a mediator of Akt signalling. Since Akt acts at a nodal point in insulin signalling, we hypothesize that FAIM may be involved in energy metabolism. In the current study, C57BL/6 wild-type (WT) and FAIM-knockout (FAIM-KO) male mice were fed with normal chow diet and body weight changes were monitored. Energy expenditure, substrate utilization and physical activities were analysed using a metabolic cage. Liver, pancreas and adipose tissue were subjected to histological examination. Serum glucose and insulin levels and lipid profiles were determined by biochemical assays. Changes in components of the insulin signalling pathway in FAIM-KO mice were examined by immunoblots. We found that FAIM-KO mice developed spontaneous non-hyperphagic obesity accompanied by hepatosteatosis, adipocyte hypertrophy, dyslipidaemia, hyperglycaemia and hyperinsulinaemia. In FAIM-KO liver, lipogenesis was elevated as indicated by increased fatty acid synthesis and SREBP-1 and SREBP-2 activation. Notably, protein expression of insulin receptor beta was markedly reduced in insulin target organs of FAIM-KO mice. Akt phosphorylation was also lower in FAIM-KO liver and adipose tissue as compared with WT controls. In addition, phosphorylation of insulin receptor substrate-1 and Akt2 in response to insulin treatment in isolated FAIM-KO hepatocytes was also markedly attenuated. Altogether, our data indicate that FAIM is a novel regulator of insulin signalling and plays an essential role in energy homoeostasis. These findings may shed light on the pathogenesis of obesity and hepatosteatosis. PMID:26866272

  20. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.


    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea


    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  1. Inhibition of sterol but not fatty acid synthesis by valproate in developing rat brain in vivo.

    PubMed Central

    Bolaños, J P; Medina, J M; Williamson, D H


    The effect of administration of valproate on lipogenesis in the developing rat brain in vivo was studied. Valproate inhibited by 21-38% the rate of 3H2O incorporation into brain sterols, without significantly affecting fatty acid synthesis. Similarly, R-[2-14C]mevalonate incorporation into sterols was inhibited by 33-54%; the low rate of fatty acid synthesis under these conditions was not affected by valproate. Plasma ketone bodies decreased after treatment with valproate. Valproate inhibited (about 50%) both sterol and fatty acid synthesis in livers of weanling rats. It is concluded that valproate can specifically inhibit sterol synthesis in the brain during development, in part at a stage after mevalonate formation, and also by decreased exogenous precursor supply. PMID:2264830

  2. Long noncoding RNA Saf and splicing factor 45 increase soluble Fas and resistance to apoptosis

    PubMed Central

    Riberdy, Janice M.; Persons, Derek A.; Wilber, Andrew


    In multicellular organisms, cell growth and differentiation is controlled in part by programmed cell death or apoptosis. One major apoptotic pathway is triggered by Fas receptor (Fas)-Fas ligand (FasL) interaction. Neoplastic cells are frequently resistant to Fas-mediated apoptosis, evade Fas signals through down regulation of Fas and produce soluble Fas proteins that bind FasL thereby blocking apoptosis. Soluble Fas (sFas) is an alternative splice product of Fas pre-mRNA, commonly created by exclusion of transmembrane spanning sequences encoded within exon 6 (FasΔEx6). Long non-coding RNAs (lncRNAs) interact with other RNAs, DNA, and proteins to regulate gene expression. One lncRNA, Fas-antisense or Saf, was shown to participate in alternative splicing of Fas pre-mRNA through unknown mechanisms. We show that Saf is localized in the nucleus where it interacts with Fas receptor pre-mRNA and human splicing factor 45 (SPF45) to facilitate alternative splicing and exclusion of exon 6. The product is a soluble Fas protein that protects cells against FasL-induced apoptosis. Collectively, these studies reveal a novel mechanism to modulate this critical cell death program by an lncRNA and its protein partner. PMID:26885613

  3. Long noncoding RNA Saf and splicing factor 45 increase soluble Fas and resistance to apoptosis.


    Villamizar, Olga; Chambers, Christopher B; Riberdy, Janice M; Persons, Derek A; Wilber, Andrew


    In multicellular organisms, cell growth and differentiation is controlled in part by programmed cell death or apoptosis. One major apoptotic pathway is triggered by Fas receptor (Fas)-Fas ligand (FasL) interaction. Neoplastic cells are frequently resistant to Fas-mediated apoptosis, evade Fas signals through down regulation of Fas and produce soluble Fas proteins that bind FasL thereby blocking apoptosis. Soluble Fas (sFas) is an alternative splice product of Fas pre-mRNA, commonly created by exclusion of transmembrane spanning sequences encoded within exon 6 (FasΔEx6). Long non-coding RNAs (lncRNAs) interact with other RNAs, DNA, and proteins to regulate gene expression. One lncRNA, Fas-antisense or Saf, was shown to participate in alternative splicing of Fas pre-mRNA through unknown mechanisms. We show that Saf is localized in the nucleus where it interacts with Fas receptor pre-mRNA and human splicing factor 45 (SPF45) to facilitate alternative splicing and exclusion of exon 6. The product is a soluble Fas protein that protects cells against FasL-induced apoptosis. Collectively, these studies reveal a novel mechanism to modulate this critical cell death program by an lncRNA and its protein partner. PMID:26885613

  4. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.


    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine


    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  5. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine


    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  6. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.


    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  7. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.


    Smith, B A; Dworkin, M


    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  8. Production of Multiple Brain-Like Ganglioside Species Is Dispensable for Fas-Induced Apoptosis of Lymphoid Cells

    PubMed Central

    Carpentier, Stéphane; Levade, Thierry; Cuvillier, Olivier; Portoukalian, Jacques


    Activation of an acid sphingomyelinase (aSMase) leading to a biosynthesis of GD3 disialoganglioside has been associated with Fas-induced apoptosis of lymphoid cells. The present study was undertaken to clarify the role of this enzyme in the generation of gangliosides during apoptosis triggered by Fas ligation. The issue was addressed by using aSMase-deficient and aSMase-corrected cell lines derived from Niemann-Pick disease (NPD) patients. Fas cross-linking elicited a rapid production of large amounts of complex a- and b-series species of gangliosides with a pattern and a chromatographic behavior as single bands reminiscent of brain gangliosides. The gangliosides were synthesized within the first ten minutes and completely disappeared within thirty minutes after stimulation. Noteworthy is the observation that GD3 was not the only ganglioside produced. The production of gangliosides and the onset of apoptotic hallmarks occurred similarly in both aSMase-deficient and aSMase-corrected NPD lymphoid cells, indicating that aSMase activation is not accountable for ganglioside generation. Hampering ganglioside production by inhibiting the key enzyme glucosylceramide synthase did not abrogate the apoptotic process. In addition, GM3 synthase-deficient lymphoid cells underwent Fas-induced apoptosis, suggesting that gangliosides are unlikely to play an indispensable role in transducing Fas-induced apoptosis of lymphoid cells. PMID:21629700

  9. Production of multiple brain-like ganglioside species is dispensable for fas-induced apoptosis of lymphoid cells.


    Popa, Iuliana; Therville, Nicole; Carpentier, Stéphane; Levade, Thierry; Cuvillier, Olivier; Portoukalian, Jacques


    Activation of an acid sphingomyelinase (aSMase) leading to a biosynthesis of GD3 disialoganglioside has been associated with Fas-induced apoptosis of lymphoid cells. The present study was undertaken to clarify the role of this enzyme in the generation of gangliosides during apoptosis triggered by Fas ligation. The issue was addressed by using aSMase-deficient and aSMase-corrected cell lines derived from Niemann-Pick disease (NPD) patients. Fas cross-linking elicited a rapid production of large amounts of complex a- and b-series species of gangliosides with a pattern and a chromatographic behavior as single bands reminiscent of brain gangliosides. The gangliosides were synthesized within the first ten minutes and completely disappeared within thirty minutes after stimulation. Noteworthy is the observation that GD3 was not the only ganglioside produced. The production of gangliosides and the onset of apoptotic hallmarks occurred similarly in both aSMase-deficient and aSMase-corrected NPD lymphoid cells, indicating that aSMase activation is not accountable for ganglioside generation. Hampering ganglioside production by inhibiting the key enzyme glucosylceramide synthase did not abrogate the apoptotic process. In addition, GM3 synthase-deficient lymphoid cells underwent Fas-induced apoptosis, suggesting that gangliosides are unlikely to play an indispensable role in transducing Fas-induced apoptosis of lymphoid cells. PMID:21629700

  10. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.


    Hansen, Alexandar L; Behrman, Edward J


    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. PMID:27258673

  11. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf


    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  12. Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

    SciTech Connect

    Chander, A.; Gullo, J.; Reicherter, J.; Fisher, A.


    Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased only by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.

  13. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.


    van Ameijde, Jeroen; Liskamp, Rob M J


    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  14. Prolonged stimulation of muscle protein synthesis by leucine in neonates is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rise in amino acids and insulin after a meal independently stimulate protein synthesis in skeletal muscle of neonates by activating the intracellular signalling pathways that regulate mRNA translation. Leucine, in particular, is important in mediating the response to amino acids. Previously, w...

  15. Diesters from Oleic Acid: Synthesis, Low Temperature Properties, and Oxidation Stability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several diesters were prepared from commercially available oleic acid and common organic acids. The key step in the three step synthesis of oleochemical diesters entails a ring opening esterification of alkyl 9,10-epoxyoctadecanoates (alkyl: propyl, iso-propyl, octyl, 2-ethylhexyl) using propionic a...

  16. [The clinical evaluation of the hypocholesterolemic effects of an inhibitor of cholesterol synthesis: mevalonic acid].


    Del Nero, E; Aloe, N; Augeri, C; Avola, F; Carta, G; Cavagnaro, A; De Grandi, R; Gianfreda, M; Magro, G P; Mazzarello, G P


    Twenty eight patients with heterozygous familial hypercholesterolemia were treated with mevalonic acid (an inhibitor of cholesterol synthesis) for 45 days. Patients received a daily dose of 750 to 1500 mg mevalonic acid depending on plasma cholesterol levels. Results showed a significant reduction in cholesterol values whereas no significant difference was observed in HDL cholesterol and triglyceride levels. PMID:1505176

  17. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.


    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D


    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective. PMID:25055961

  18. Differential regulation of miR-146a/FAS and miR-21/FASLG axes in autoimmune lymphoproliferative syndrome due to FAS mutation (ALPS-FAS).


    Marega, Lia Furlaneto; Teocchi, Marcelo Ananias; Dos Santos Vilela, Maria Marluce


    Most cases of autoimmune lymphoproliferative syndrome (ALPS) have an inherited genetic defect involving apoptosis-related genes of the FAS pathway. MicroRNAs (miRNAs) are a class of small non-coding regulatory RNAs playing a role in the control of gene expression. This is the first report on miRNAs in ALPS patients. We studied a mother and son carrying the same FAS cell surface death receptor (FAS) mutation, but with only the son manifesting the signs and symptoms of ALPS-FAS. The aim was to analyse, by reverse transcription-quantitative polymerase chain reaction (RT-qPCR), the peripheral blood mononuclear cells (PBMC) relative expression of miR-146a and miR-21, including their passenger strands and respective targets (FAS and FASLG). In comparison with healthy matched control individuals, miR-21-3p was over-expressed significantly (P = 0·0313) in the son, with no significant change in the expression of miR-146a, miR-146a-3p and miR-21. In contrast, the mother had a slight under-expression of the miR-146a pair and miR-21-3p (P = 0·0625). Regarding the miRNA targets, FAS was up-regulated markedly for the mother (P = 0·0078), but down-regulated for the son (P = 0·0625), while FASLG did not have any significant alteration. Taken together, our finding clearly suggests a role of the miR-146a/FAS axis in ALPS-FAS variable expressivity in which FAS haploinsufficiency seems to be compensated only in the mother who had the miR-146a pair down-regulated. As only the son had the major clinical manifestations of ALPS-FAS, miR-21-3p should be investigated as playing a critical role in ALPS physiopathology, including the development of lymphoma. PMID:27060458

  19. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.


    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  20. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.


    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  1. Synthesis of zirconium carbide nanosized powders by pursed wire discharge in oleic acid

    NASA Astrophysics Data System (ADS)

    Sugashima, Kenta; Suzuki, Kazuma; Suzuki, Tsuneo; Nakayama, Tadachika; Suematsu, Hisayuki; Niihara, Koichi


    In this study, we propose novel PWD methods in inert gas mixed organic vapor and organic liquid which work as harmless carbon sources. Metal zirconium wire evaporation by PWD in organic vapor or liquid media was investigated. It was confirmed that in the PWD process using oleic acid liquid, single phase zirconium carbide nanopowders were synthesized by a reaction between Zr vapor and oleic acid. A new method for synthesis of carbide nanopowders was developed using the PWD in organic liquid. Therefore, the present result suggested that PWD method in oleic acid liquids is effective for the synthesis of carbide nanopowders.

  2. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives.


    Hayashi, N; Sugawara, T; Kato, S


    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4].Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  3. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives

    PubMed Central

    Hayashi, Nobuyoshi; Sugawara, Tohru; Kato, Shinji


    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4]. Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  4. Variations of the perforin gene in patients with autoimmunity/lymphoproliferation and defective Fas function.


    Clementi, Rita; Chiocchetti, Annalisa; Cappellano, Giuseppe; Cerutti, Elisa; Ferretti, Massimo; Orilieri, Elisabetta; Dianzani, Irma; Ferrarini, Marina; Bregni, Marco; Danesino, Cesare; Bozzi, Valeria; Putti, Maria Caterina; Cerutti, Franco; Cometa, Angela; Locatelli, Franco; Maccario, Rita; Ramenghi, Ugo; Dianzani, Umberto


    Mutations decreasing function of the Fas death receptor cause the autoimmune lymphoproliferative syndrome (ALPS) with autoimmune manifestations, spleen/lymph node enlargement, and expansion of CD4/CD8-negative T cells. Dianzani Autoimmune Lymphoproliferative Disease (DALD) is a variant lacking this expansion. Perforin is involved in cell-mediated cytotoxicity and its biallelic mutations cause familial hemophagocytic lymphohistiocytosis (HLH). We previously described an ALPS patient carrying heterozygous mutations of the Fas and perforin genes and suggested that they concurred in ALPS. This work extends the analysis to 14 ALPS, 28 DALD, and 816 controls, and detects an N252S amino acid substitution in 2 ALPS, and an A91V amino acid substitution in 6 DALD. N252S conferred an OR = 62.7 (P = .0016) for ALPS and A91V conferred an OR = 3 (P = .016) for DALD. Copresence of A91V and variations of the osteopontin gene previously associated with DALD conferred an OR = 17 (P = .0007) for DALD. In one N252S patient, NK activity was strikingly defective in early childhood, but became normal in late childhood. A91V patients displayed lower NK activity than controls. These data suggest that perforin variations are a susceptibility factor for ALPS/DALD development in subjects with defective Fas function and may influence disease expression. PMID:16720836

  5. Role of Malic Enzyme during Fatty Acid Synthesis in the Oleaginous Fungus Mortierella alpina

    PubMed Central

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao


    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi. PMID:24532075

  6. Chemical Synthesis of Uncommon Natural Bile Acids: The 9α-Hydroxy Derivatives of Chenodeoxycholic and Lithocholic Acids.


    Iida, Takashi; Namegawa, Kazunari; Nakane, Naoya; Iida, Kyoko; Hofmann, Alan Frederick; Omura, Kaoru


    The chemical synthesis of the 9α-hydroxy derivatives of chenodeoxycholic and lithocholic acids is reported. For initiating the synthesis of the 9α-hydroxy derivative of chenodeoxycholic acid, cholic acid was used; for the synthesis of the 9α-hydroxy derivative of lithocholic acid, deoxycholic acid was used. The principal reactions involved were (1) decarbonylation of conjugated 12-oxo-Δ(9(11))-derivatives using in situ generated monochloroalane (AlH2Cl) prepared from LiAlH4 and AlCl3, (2) epoxidation of the deoxygenated Δ(9(11))-enes using m-chloroperbenzoic acid catalyzed by 4,4'-thiobis-(6-tert-butyl-3-methylphenol), (3) subsequent Markovnikov 9α-hydroxylation of the Δ(9(11))-enes with AlH2Cl, and (4) selective oxidation of the primary hydroxyl group at C-24 in the resulting 3α,9α,24-triol and 3α,7α,9α,24-tetrol to the corresponding C-24 carboxylic acids using sodium chlorite (NaClO2) in the presence of a catalytic amount of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical (TEMPO) and sodium hypochlorite (NaOCl). The (1)H- and (13)C-NMR spectra are reported. The 3α,7α,9α-trihydroxy-5β-cholan-24-oic acid has been reported to be present in the bile of the Asian bear, and its 7-deoxy derivative is likely to be a bacterial metabolite. These bile acids are now available as authentic reference standards, permitting their identification in vertebrate bile acids. PMID:27319285

  7. Latency, duration and dose response relationships of amino acid effects on human muscle protein synthesis.


    Rennie, Michael J; Bohé, Julien; Wolfe, Robert R


    The components of the stimulatory effect of food on net deposition of protein are beginning to be identified and separated. One of the most important of these appears to be the effect of amino acids per se in stimulating muscle anabolism. Amino acids appear to have a linear stimulatory effect within the range of normal diurnal plasma concentrations from postabsorptive to postprandial. Within this range, muscle protein synthesis (measured by incorporation of stable isotope tracers of amino acids into biopsied muscle protein) appears to be stimulated approximately twofold; however, little further increase occurs when very high concentrations of amino acids (>2.5 times the normal postabsorptive plasma concentration) are made available. Amino acids provided in surfeit of the ability of the system to synthesize protein are disposed of by oxidation, ureagenesis and gluconeogenesis. The stimulatory effect of amino acids appears to be time dependent; a square wave increase in the availability of amino acids causes muscle protein synthesis to be stimulated and to fall back to basal values, despite continued amino acid availability. The relationship between muscle protein synthesis and insulin availability suggests that most of the stimulatory effects occur at low insulin concentrations, with large increases having no effect. These findings may have implications for our understanding of the body's requirements for protein. The maximal capacity for storage of amino acids as muscle protein probably sets an upper value on the extent to which amino acids can be stored after a single meal. PMID:12368422

  8. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan


    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  9. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.


    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  10. Effect of Poliovirus on Deoxyribonucleic Acid Synthesis in HeLa Cells

    PubMed Central

    Ackermann, W. W.; Cox, D. C.; Kurtz, H.; Powers, C. D.; Davies, S. J.


    Ackermann, W. W. (University of Michigan, Ann Arbor), D. C. Cox, H. Kurtz, C. D. Powers, and S. J. Davies. Effect of poliovirus on deoxyribonucleic acid synthesis in HeLa cells. J. Bacteriol. 91:1943–1952. 1966.—Both poliovirus and arginine stimulated deoxyribonucleic acid (DNA) synthesis in cultures of HeLa cells which were preconditioned by incubation in a medium deficient in arginine. However, the number of cells producing DNA was unaffected. DNA synthesis in such preconditioned cells was 10 to 20% of the maximal value obtained with a full complement of amino acids. Inhibition of DNA synthesis was produced in these cultures either by increasing the multiplicity of exposure above 40 plaque-forming units of virus per cell or by increasing the concentration of the deficient amino acid at the time of virus addition. Inhibition of DNA synthesis resulted from a reduction in the fraction of cells producing DNA. The concentration of arginine required for viral inhibition of DNA synthesis is greater than that for viral multiplication. PMID:4287076

  11. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The reaction between epoxidized methyl oleate and the multifunctional carboxylic acid, levulinic acid, is shown to give two products of differing chemical reactivity. A branched alpha-hydroxy ester product which is acid stable, and a ketal product, which shows acid cleavability can be formed. The ...

  12. Associations between variants of FADS genes and omega-3 and omega-6 milk fatty acids of Canadian Holstein cows

    PubMed Central


    Background Fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes code respectively for the enzymes delta-5 and delta-6 desaturases which are rate limiting enzymes in the synthesis of polyunsaturated omega-3 and omega-6 fatty acids (FAs). Omega-3 and-6 FAs as well as conjugated linoleic acid (CLA) are present in bovine milk and have demonstrated positive health effects in humans. Studies in humans have shown significant relationships between genetic variants in FADS1 and 2 genes with plasma and tissue concentrations of omega-3 and-6 FAs. The aim of this study was to evaluate the extent of sequence variations within these two genes in Canadian Holstein cows as well as the association between sequence variants and health promoting FAs in milk. Results Thirty three SNPs were detected within the studied regions of genes including a synonymous mutation (FADS1-07, rs42187261, 306Tyr > Tyr) in exon 8 of FADS1, a non-synonymous mutation (FADS2-14, rs211580559, 294Ala > Val) within FADS2 exon 7, a splice site SNP (FADS2-05, rs211263660), a 3′UTR SNP (FADS2-23, rs109772589), and another 3′UTR SNP with an effect on a microRNA binding site within FADS2 gene (FADS2-19, rs210169303). Association analyses showed significant relations between three out of seven tested SNPs and several FAs. Significant associations (FDR P < 0.05) were recorded between FADS2-23 (rs109772589) and two omega-6 FAs (dihomogamma linolenic acid [C20:3n6] and arachidonic acid [C20:4n6]), FADS1-07 (rs42187261) and one omega-3 FA (eicosapentaenoic acid, C20:5n3) and tricosanoic acid (C23:0), and one intronic SNP, FADS1-01 (rs136261927) and C20:3n6. Conclusion Our study has demonstrated positive associations between three SNPs within FADS1 and FADS2 genes (a SNP within the 3’UTR, a synonymous SNP and an intronic SNP), with three milk PUFAs of Canadian Holstein cows thus suggesting possible involvement of synonymous and non-coding region variants in FA synthesis. These SNPs may serve as

  13. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi


    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  14. Visible-light photoredox synthesis of unnatural chiral α-amino acids.


    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua


    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  15. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua


    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  16. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.


    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  17. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.


    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  18. Fas/FasL, Bcl2 and Caspase-8 gene polymorphisms in Chinese patients with rheumatoid arthritis.


    Zhu, Aiping; Wang, Mingjie; Zhou, Guoxin; Zhang, Hui; Liu, Ruiping; Wang, Yong


    Apoptosis signals are necessary for maintaining homeostasis and an adequate immune response. Dysregulation of apoptosis-related genes in the immune system has an important impact on autoimmune diseases such as rheumatoid arthritis (RA). Thus, we investigated the association between Fas rs2234767 G/A, FasL rs763110 C/T, Bcl2 rs12454712 T/C, Bcl2 rs17757541 C/G, and Caspase-8 rs1035142 G/T polymorphisms and RA susceptibility in a Chinese population. These five single-nucleotide polymorphisms (SNPs) were studied in a Chinese population consisting of 615 patients with RA and 839 controls. Genotyping was performed using a custom-by-design 48-Plex SNP scan TM kit. Furthermore, we undertook a meta-analysis between FasL rs763110 C/T and RA. This study indicated that Fas rs2234767 and Bcl2 rs17757541 polymorphisms were risk factors for RA. No association was observed between FasL rs763110 C/T, Bcl2 rs12454712 T/C, and Caspase-8 rs1035142 G/T polymorphisms and RA in this study. The results of this meta-analysis suggested no significant association between FasL rs763110 C/T and RA. However, stratification analysis of this meta-analysis indicated that FasL rs763110 C/T increased the risk of Caucasian RA patients. In conclusion, this study demonstrated that Fas rs2234767 G/A and Bcl2 rs17757541 T/C polymorphisms might be associated with an increased risk of RA. This meta-analysis revealed that FasL rs763110 C/T was associated with an increased risk of Caucasian RA patients. PMID:26905515

  19. Cell Division During Inhibition of Deoxyribonucleic Acid Synthesis in Escherichia coli

    PubMed Central

    Helmstetter, Charles E.; Pierucci, Olga


    When cultures of Escherichia coli B/r growing at various rates were exposed to ultraviolet light, mitomycin C, or nalidixic acid, deoxyribonucleic acid (DNA) synthesis stopped but cell division continued for at least 20 min. The chromosome configurations in the cells which divided were estimated by determining the rate of DNA synthesis during the division cycle. The cultures were pulse-labeled with 14C-thymidine, and the amount of label incorporated into cells of different ages was found by measuring the radioactivity in cells born subsequent to the labeling period. The cells which divided in the absence of DNA synthesis were those which had completed a round of chromosome replication prior to the treatments. It was concluded that completion of a round of replication is a necessary and sufficient condition of DNA synthesis for cell division. PMID:4870278

  20. Fatty Acid Synthase Impacts the Pathobiology of Candida parapsilosis In Vitro and during Mammalian Infection

    PubMed Central

    Nguyen, Long Nam; Trofa, David; Nosanchuk, Joshua D.


    Cytosolic fungal fatty acid synthase is composed of two subunits α and β, which are encoded by Fas1 and Fas2 genes. In this study, the Fas2 genes of the human pathogen Candida parapsilosis were deleted using a modified SAT1 flipper technique. CpFas2 was essential in media lacking exogenous fatty acids and the growth of Fas2 disruptants (Fas2 KO) was regulated by the supplementation of different long chain fatty acids, such as myristic acid (14∶0), palmitic acid (16∶0), and Tween 80, in a dose-specific manner. Lipidomic analysis revealed that Fas2 KO cells were severely restricted in production of unsaturated fatty acids. The Fas2 KO strains were unable to form normal biofilms and were more efficiently killed by murine-like macrophages, J774.16, than the wild type, heterozygous and reconstituted strains. Furthermore, Fas2 KO yeast were significantly less virulent in a systemic murine infection model. The Fas2 KO cells were also hypersensitive to human serum, and inhibition of CpFas2 in WT C. parapsilosis by cerulenin significantly decreased fungal growth in human serum. This study demonstrates that CpFas2 is essential for C. parapsilosis growth in the absence of exogenous fatty acids, is involved in unsaturated fatty acid production, influences fungal virulence, and represents a promising antifungal drug target. PMID:20027295

  1. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra


    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  2. Synthesis and proteinase inhibitory properties of diphenyl phosphonate analogues of aspartic and glutamic acids.


    Hamilton, R; Walker, B; Walker, B J


    The synthesis of diphenyl phosphonate analogues of aspartic and glutamic acid, and their inhibitory activity against S. aureus V8 protease and granzyme B, is described. The study has revealed difficulties with protecting group compatibility in the synthesis of these analogues. Two analogues, Acetyl. AspP (OPh)2 and Acetyl.GluP (OPh)2 were found to function as irreversible inactivators of V8 proteinase, yet exhibit no activity against granzyme B. PMID:9873408

  3. Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

    PubMed Central

    Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence


    In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

  4. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.


    Klisch, M; Häder, D-P


    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption. PMID:11849984

  5. Mechanism of Shope Fibroma Virus-Induced Suppression of Host Deoxyribonucleic Acid Synthesis

    PubMed Central

    Chan, James C.; Hodes, M. E.


    The effects of treatment with live or inactivated Shope fibroma virus on host cell deoxyribonucleic acid (DNA) synthesis were determined. The incorporation of 3H-thymidine into nuclear DNA was suppressed by both active and inactivated virus, although live virus was more effective. During the early phase of infection, stimulation of host nuclear DNA synthesis of up to 240% of control value was observed in cells infected with active virus. Inhibition of DNA synthesis began at about the 8th h and was maximal by 12 h postinfection. Virus inactivated by ultraviolet-irradiation or heat treatment did not induce viral DNA synthesis but was, nevertheless, able to suppress host DNA synthesis. PMID:4202660

  6. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )


    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  7. 7 CFR 1484.30 - How does FAS formalize its working relationship with approved Cooperators?

    Code of Federal Regulations, 2010 CFR


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false How does FAS formalize its working relationship with... FAS formalize its working relationship with approved Cooperators? FAS will notify each applicant in writing of the final disposition of its application. FAS will send a program agreement,...

  8. 7 CFR 1484.30 - How does FAS formalize its working relationship with approved Cooperators?

    Code of Federal Regulations, 2011 CFR


    ... 7 Agriculture 10 2011-01-01 2011-01-01 false How does FAS formalize its working relationship with... FAS formalize its working relationship with approved Cooperators? FAS will notify each applicant in writing of the final disposition of its application. FAS will send a program agreement,...

  9. Functional characterization of a chimeric soluble Fas ligand polymer with in vivo anti-tumor activity.


    Daburon, Sophie; Devaud, Christel; Costet, Pierre; Morello, Aurore; Garrigue-Antar, Laure; Maillasson, Mike; Hargous, Nathalie; Lapaillerie, Delphine; Bonneu, Marc; Dechanet-Merville, Julie; Legembre, Patrick; Capone, Myriam; Moreau, Jean-François; Taupin, Jean-Luc


    Binding of ligand FasL to its receptor Fas triggers apoptosis via the caspase cascade. FasL itself is homotrimeric, and a productive apoptotic signal requires that FasL be oligomerized beyond the homotrimeric state. We generated a series of FasL chimeras by fusing FasL to domains of the Leukemia Inhibitory Factor receptor gp190 which confer homotypic oligomerization, and analyzed the capacity of these soluble chimeras to trigger cell death. We observed that the most efficient FasL chimera, called pFasL, was also the most polymeric, as it reached the size of a dodecamer. Using a cellular model, we investigated the structure-function relationships of the FasL/Fas interactions for our chimeras, and we demonstrated that the Fas-mediated apoptotic signal did not solely rely on ligand-mediated receptor aggregation, but also required a conformational adaptation of the Fas receptor. When injected into mice, pFasL did not trigger liver injury at a dose which displayed anti-tumor activity in a model of human tumor transplanted to immunodeficient animals, suggesting a potential therapeutic use. Therefore, the optimization of the FasL conformation has to be considered for the development of efficient FasL-derived anti-cancer drugs targeting Fas. PMID:23326557

  10. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.


    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  11. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.


    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György


    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  12. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen


    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  13. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines


    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  14. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  15. Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...

  16. Quantitative assessment of the association between Fas/FasL gene polymorphism and susceptibility to esophageal carcinoma in a north Chinese population.


    Zhang, Meijuan; Wu, Cuiping; Li, Baohuan; Du, Wenjun; Zhang, Chuanzhen; Chen, Ziping


    The case-control study aims to investigate the association of Fas and FasL genetic polymorphisms (Fas-670A/G (rs1800682), Fas-1377G/A (rs2234767) and FasL-844T/C (rs763110)) with esophageal carcinoma susceptibility in a north Chinese population. A total of 204 patients with esophageal carcinoma and 248 healthy controls were enrolled from Henan, China and genotyped by the polymerase chain reaction and restriction fragment length polymorphism method. There were no significant differences in distributions of their genotypes frequencies between patients and controls in Fas-670A/G, Fas-1377G/A and FasL-844T/C polymorphisms (P > 0.05). Stratified analysis showed that no significant association was found between esophageal carcinoma and gene polymorphisms of Fas-670 A/G, Fas-1377G/A, and FasL-844T/C (P > 0.05). Genetic polymorphisms in the death pathway genes Fas and FasL were not associated with risk of developing esophageal carcinoma in a north Chinese population. PMID:26819081

  17. The prebiotic synthesis of amino acids - interstellar vs. atmospheric mechanisms

    NASA Astrophysics Data System (ADS)

    Meierhenrich, U. J.; Muñoz Caro, G. M.; Schutte, W. A.; Barbier, B.; Arcones Segovia, A.; Rosenbauer, H.; Thiemann, W. H.-P.; Brack, A.


    Until very recently, prebiotic amino acids were believed to have been generated in the atmosphere of the early Earth, as successfully simulated by the Urey-Miller experiments. Two independent studies now identified ice photochemistry in the interstellar medium as a possible source of prebiotic amino acids. Ultraviolet irradiation of ice mixtures containing identified interstellar molecules (such as H2O, CO2, CO, CH3OH, and NH3) in the conditions of vacuum and low temperature found in the interstellar medium generated amino acid structures including glycine, alanine, serine, valine, proline, and aspartic acid. After warmup, hydrolysis and derivatization, our team was able to identify 16 amino acids as well as furans and pyrroles. Enantioselective analyses of the amino acids showed racemic mixtures. A prebiotic interstellar origin of amino acid structures is now discussed to be a plausible alternative to the Urey-Miller mechanism.

  18. Synthesis of new optically active propargylic fluorides and application to the enantioselective synthesis of monofluorinated analogues of fatty acid metabolites.


    Prakesch, M; Grée, D; Grée, R


    A new approach to obtain optically active unsaturated or polyunsaturated systems with a single fluorine atom in an allylic or propargylic position is reported. Central to this strategy is the high regio- and stereocontrol observed during the fluorination of propargylic alcohols allowing a short and efficient synthesis of 1. Further, simple functional group transformations gave the enals 2 and 3. These three key intermediates were used for the preparation of optically active monofluorinated analogues of fatty acid metabolites. PMID:11325281

  19. Effect of the “Ribonucleic Acid Control” Locus in Escherichia coli on T4 Bacteriophage-Specific Ribonucleic Acid Synthesis

    PubMed Central

    Sköld, Ola


    Amino acid control of ribonucleic acid (RNA) synthesis in bacteria is known to be governed genetically by the rel locus. We investigated whether the rel gene of the host would also exert its effect on the regulation of phage-specific RNA synthesis in T4 phage-infected Escherichia coli cells. Since T-even phage infection completely shuts off host macromolecular synthesis, phage RNA synthesis could be followed specifically by the cumulative incorporation of radioactivity from labeled precursors into RNA of infected cells. Labeled uracil was shown to accumulate in phage-specific RNA for 30 to 35 min after infection, a phenomenon which probably reflects an expansion of the labile phage-RNA pool. Amino acid starvation was effected by the use of auxotrophic bacterial strains or thienylalanine. The latter substance is an amino acid analogue which induces a chemical auxotrophy by inhibiting the biosynthesis of phenylalanine, tyrosine, and tryptophan. Phage RNA synthesis was strictly dependent on the presence of amino acids, whereas phage deoxyribonucleic acid synthesis was not. By the use of several pairs of bacterial strains which were isogenic except for the rel gene, it was demonstrated that amino acid dependence was related to the allelic state of this gene. If the rel gene was mutated, amino acid starvation did not restrict phage RNA synthesis. PMID:4914097

  20. Synthesis and antimycobacterial evaluation of new trans-cinnamic acid hydrazide derivatives.


    Carvalho, Samir A; da Silva, Edson F; de Souza, Marcus V N; Lourenço, Maria C S; Vicente, Felipe R


    In this work, we report the synthesis and the antimycobacterial evaluation of new trans-cinnamic acid derivatives of isonicotinic acid series (5) and benzoic acid series (6), designed by exploring the molecular hybridization approach between isoniazid (1) and trans-cinnamic acid derivative (3). The minimum inhibitory concentration (MIC) of the compounds 5a-d and 6c exhibited activity between 3.12 and 12.5 microg/mL and could be a good start point to find new lead compounds against multi-drug resistant tuberculosis. PMID:18068364

  1. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.


    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  2. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

  3. Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

  4. Influence of Fenofibrate Treatment on Triacylglycerides, Diacylglycerides and Fatty Acids in Fructose Fed Rats

    PubMed Central

    Kopf, Thomas; Schaefer, Hans-Ludwig; Troetzmueller, Martin; Koefeler, Harald; Broenstrup, Mark; Konovalova, Tatiana; Schmitz, Gerd


    Fenofibrate (FF) lowers plasma triglycerides via PPARα activation. Here, we analyzed lipidomic changes upon FF treatment of fructose fed rats. Three groups with 6 animals each were defined as control, fructose-fed and fructose-fed/FF treated. Male Wistar Unilever Rats were subjected to 10% fructose-feeding for 20 days. On day 14, fenofibrate treatment (100 mg/kg p.o.) was initiated and maintained for 7 days. Lipid species in serum were analyzed using mass spectrometry (ESI-MS/MS; LC-FT-MS, GC-MS) on days 0, 14 and 20 in all three groups. In addition, lipid levels in liver and intestine were determined. Short-chain TAGs increased in serum and liver upon fructose-feeding, while almost all TAG-species decreased under FF treatment. Long-chain unsaturated DAG-levels (36:1, 36:2, 36:4, 38:3, 38:4, 38:5) increased upon FF treatment in rat liver and decreased in rat serum. FAs, especially short-chain FAs (12:0, 14:0, 16:0) increased during fructose-challenge. VLDL secretion increased upon fructose-feeding and together with FA-levels decreased to control levels during FF treatment. Fructose challenge of de novo fatty acid synthesis through fatty acid synthase (FAS) may enhance the release of FAs ≤16:0 chain length, a process reversed by FF-mediated PPARα-activation. PMID:25198467

  5. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei


    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  6. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa


    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  7. Soluble FasR ligand-binding domain: high-yield production of active fusion and non-fusion recombinant proteins using the baculovirus/insect cell system.


    Mahiou, J; Abastado, J P; Cabanie, L; Godeau, F


    We used the recombinant baculovirus/insect cell system to express two soluble forms of the mouse Fas receptor (mFasR) extracellular domain (ECD): a monomer comprising the entire ligand-binding portion of mFasR followed by a carboxy-terminal hexa-histidine extension aiding purification by immobilized metal affinity chromatography and an immunoadhesin in which the same 148 residues were fused to the Fc portion of a truncated human IgG1 immunoglobulin heavy chain. Both constructs harboured a 24 base pairs insertion placed upstream of the initiating ATG [Peakman, Charles, Sydenham, Gewert, Page, and Makoff (1992) Nucleic Acids Res. 20, 6111-6112]. Despite its hexa-histidine extension, the monovalent recombinant protein from crude culture media failed to bind immobilized Ni2+ unless proteins were first precipitated twice by ammonium sulphate. The overall procedure then yielded approximately 10mg/l of protein which could be purified to near homogeneity using two additional chromatographic steps. The glycosylated polypeptide migrated as a band of Mr=(21-31) x 10(3) in SDS/PAGE and was monomeric in physiological buffers. Under non-reducing conditions, denaturation in 6 M guanidinium chloride was reversible after slow removal of the denaturing agent. The mFasR immunoadhesin was secreted (approximately 5-10 mg/l) as a disulphide-linked homodimer, and endowed with ligand-binding activity since it could bind FasL on the surface of D11S, FasL-expressing cells. When tested for their ability to inhibit FasR-dependent cell lysis, the soluble dimeric immunoadhesin markedly inhibited FasL-mediated cytotoxicity (IC50 approximately 30 nM), and was approximately 6 times as effective as its monomeric counterpart. PMID:9480929

  8. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.


    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr


    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials. PMID:27482849

  9. Tetrandrine has anti-adipogenic effect on 3T3-L1 preadipocytes through the reduced expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3.


    Jang, Byeong-Churl


    Tetrandrine is a bisbenzylisoquinoline alkaloid isolated from the roots of Stephania tetrandra S. Moore and has been shown to possess anti-inflammatory and anti-cancerous activities. In this study, the effect of tetrandrine on adipogenesis in 3T3-L1 preadipocytes was investigated. Tetrandrine at 10 μM concentration strongly inhibited lipid accumulation and triglyceride (TG) synthesis during the differentiation of 3T3-L1 preadipocytes into adipocytes. On mechanistic levels, tetrandrine reduced not only the expressions of CCAAT/enhancer-binding protein-α (C/EBP-α), peroxisome proliferator-activated receptor-γ (PPAR-γ), fatty acid synthase (FAS), and perilipin A but also the phosphorylation levels of signal transducer and activator of transcription-3 (STAT-3) during 3T3-L1 adipocyte differentiation. Tetrandrine also reduced the mRNA expression of leptin, but not adiponectin, during 3T3-L1 adipocyte differentiation. Collectively, these findings show that tetrandrine has strong anti-adipogenic effect on 3T3-L1 preadipocytes and the effect is largely attributable to the reduced expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3. PMID:27246736

  10. Artesunate inhibits adipogeneis in 3T3-L1 preadipocytes by reducing the expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3.


    Jang, Byeong-Churl


    Differentiation of preadipocyte, also called adipogenesis, leads to the phenotype of mature adipocyte. However, excessive adipogenesis is closely linked to the development of obesity. Artesunate, one of artemisinin-type sesquiterpene lactones from Artemisia annua L., is known for anti-malarial and anti-cancerous activities. In this study, we investigated the effect of artesunate on adipogenesis in 3T3-L1 preadipocytes. Artesunate strongly inhibited lipid accumulation and triglyceride (TG) synthesis during the differentiation of 3T3-L1 preadipocytes into adipocytes at 5 μM concentration. Artesunate at 5 μM also reduced not only the expressions of CCAAT/enhancer-binding protein-α (C/EBP-α), peroxisome proliferator-activated receptor-γ (PPAR-γ), fatty acid synthase (FAS), and perilipin A but also the phosphorylation levels of signal transducer and activator of transcription-3 (STAT-3) during adipocyte differentiation. Moreover, artesunate at 5 μM reduced leptin, but not adiponectin, mRNA expression during adipocyte differentiation. Taken together, these findings demonstrate that artesunate inhibits adipogenesis in 3T3-L1 preadipoytes through the reduced expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3. PMID:27109481

  11. Possible modulation of FAS and PTP-1B signaling in ameliorative potential of Bombax ceiba against high fat diet induced obesity

    PubMed Central


    Background Bombax ceiba Linn., commonly called as Semal, is used in various gastro-intestinal disturbances. It contains Lupeol which inhibits PTP-1B, adipogenesis, TG synthesis and accumulation of lipids in adipocytes and adipokines whereas the flavonoids isolated from B. ceiba has FAS inhibitory activity. The present study was aimed to investigate ameliorative potential of Bombax ceiba to experimental obesity in Wistar rats, and its possible mechanism of action. Methods Male Wistar albino rats weighing 180-220 g were employed in present study. Experimental obesity was induced by feeding high fat diet for 10 weeks. Methanolic extract of B. ceiba extract 100, 200 and 400 mg/kg and Gemfibrozil 50 mg/kg as standard drug were given orally from 7th to 10th week. Results Induction with HFD for 10 weeks caused significant (p < 0.05) increase in % body wt, BMI, LEE indices; serum glucose, triglyceride, LDL, VLDL, cholesterol, free fatty acid, ALT, AST; tissue TBARS, nitrate/nitrite levels; different fat pads and relative liver weight; and significant decrease in food intake (g and kcal), serum HDL and tissue glutathione levels in HFD control rats. Treatment with B. ceiba extract and Gemfibrozil significantly attenuated these HFD induced changes, as compared to HFD control. The effect of B. ceiba 200 and 400 mg/kg was more pronounced in comparison to Gemfibrozil. Conclusion On the basis of results obtained, it may be concluded that the methanolic extract of stem bark of Bombax ceiba has significant ameliorative potential against HFD induced obesity in rats, possibly through modulation of FAS and PTP-1B signaling due to the presence of flavonoids and lupeol. PMID:24160453

  12. Advanced glycation end-product (AGE) induces apoptosis in human retinal ARPE-19 cells via promoting mitochondrial dysfunction and activating the Fas-FasL signaling.


    Wang, Pu; Xing, Yiqiao; Chen, Changzheng; Chen, Zhen; Qian, Zhimin


    Advanced glycation end-products (AGEs) are extremely accumulated in the retinal vascular and epithelial cells of diabetes mellitus (DM) patients, particularly with diabetic retinopathy (DR). To elucidate the pathogenesis of the AGE-induced toxicity to retinal epithelial cells, we investigated the role of Fas-Fas ligand (FasL) signaling and mitochondrial dysfunction in the AGE-induced apoptosis. Results demonstrated that the AGE-BSA- induced apoptosis of retinal ARPE-19 cells. And the AGE-BSA treatment caused mitochondrial dysfunction, via deregulating the B-cell lymphoma 2 (Bcl-2) signaling. Moreover, the Fas/FasL and its downstreamer Caspase 8 were promoted by the AGE-BSA treatment, and the exogenous α-Fas exacerbated the activation of Caspase 3/8. On the other side, the siRNA-mediated knockdown of Fas/FasL inhibited the AGE-BSA-induced apoptosis. Taken together, we confirmed the activation of Fas-FasL signaling and of mitochondrial dysfunction in the AGE-BSA-promoted apoptosis in retinal ARPE-19 cells, implying the important role of Fas-FasL signaling in the DR in DM. PMID:26479732

  13. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group


    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude


    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  14. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group


    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.


    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.


    EPA Science Inventory

    Male chicks weighing 700 to 900 g. received an acute or eight doses IG of 60 or 40 mg/kg ethylene chlorohydrin (ECH) respectively and were sacrificed eighteen hours after the last dose. Mitochondrial elongation of fatty acids was decreased significantly while fatty acid synthetas...

  16. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...


    EPA Science Inventory

    The project studies the inhibitory effect of lead on the enzymatic activity of brain glutamic amino acid decarboxylase (GADC). The enzyme is responsible for the catalytic formation of gamma amino butyric acid (GABA) inhibitory neurons which is believed to be involved with the tra...

  18. Synthesis and characterization of hydrogen-bond acidic functionalized graphene

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Han, Qiang; Pan, Yong; Cao, Shuya; Ding, Mingyu


    Hexafluoroisopropanol phenyl group functionalized materials have great potential in the application of gas-sensitive materials for nerve agent detection, due to the formation of strong hydrogen-bonding interactions between the group and the analytes. In this paper, take full advantage of ultra-large specific surface area and plenty of carbon-carbon double bonds and hexafluoroisopropanol phenyl functionalized graphene was synthesized through in situ diazonium reaction between -C=C- and p-hexafluoroisopropanol aniline. The identity of the as-synthesis material was confirmed by transmission electron microscopy, Raman spectroscopy, ultraviolet visible spectroscopy, X-ray photoelectron spectroscopy and thermo gravimetric analysis. The synthesis method is simply which retained the excellent physical properties of original graphene. In addition, the novel material can be assigned as an potential candidate for gas sensitive materials towards organophosphorus nerve agent detection.

  19. Stimulation of muscle protein synthesis by leucine is dependent on plasma amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that a physiological increase in plasma leucine increased translation initiation factor activity during 60- and 120-min leucine infusion. Muscle protein synthesis was stimulated at 60 min but not at 120 min, perhaps due to the decrease (-50%) in plasma essential amino acids (AA). ...

  20. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario


    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  1. Tandem Ru-alkylidene-catalysed cross metathesis/hydrogenation: synthesis of lipophilic amino acids.


    Wang, Zhen J; Spiccia, Nicolas D; Jackson, W Roy; Robinson, Andrea J


    Highly efficient synthesis of lipidic amino acids can be achieved via Ru-alkylidene-catalysed cross metathesis of long chain alkenes with commercially available allylglycine. The resultant unsaturated analogues can be then optionally hydrogenated under mild reaction conditions by using the spent metathesis catalyst. PMID:23733491

  2. One-Pot Synthesis of Arylketones from Aromatic Acids via Palladium-Catalyzed Suzuki Coupling.


    Wu, Hongxiang; Xu, Baiping; Li, Yue; Hong, Fengying; Zhu, Dezhao; Jian, Junsheng; Pu, Xiaoer; Zeng, Zhuo


    A palladium-catalyzed one-pot procedure for the synthesis of aryl ketones has been developed. Triazine esters when coupled with aryl boronic acids provided aryl ketones in moderate to excellent yields (up to 95%) in the presence of 1 mol % Pd(PPh3)2Cl2 for 30 min. PMID:26949103


    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  4. Synthesis and bioactivity of novel caffeic acid esters from Zuccagnia punctata.


    Ramachandra, M S; Subbaraju, G V


    Synthesis of novel caffeic acid esters (1 and 2) was accomplished starting from appropriately substituted benzaldehydes (3 and 9). While compound 2 exhibited potent anti-oxidative activity in both the nitroblue tetrazolium and 1,1-diphenyl-2-picrylhydrazyl radical-scavenging models, compound 1 showed moderate 5-lipoxygenase inhibitory activity. PMID:17145655

  5. Templated synthesis of nylon nucleic acids and characterization by nuclease digestion

    PubMed Central

    Liu, Yu; Wang, Risheng; Ding, Liang; Sha, Roujie


    Nylon nucleic acids containing oligouridine nucleotides with pendent polyamide linkers and flanked by unmodified heteronucleotide sequences were prepared by DNA templated synthesis. Templation was more efficient than the single-stranded synthesis: Coupling step yields were as high as 99.2%, with up to 7 amide linkages formed in the synthesis of a molecule containing 8 modified nucleotides. Controlled digestion by calf spleen phosphodiesterase enabled the mapping of modified nucleotides in the sequences. A combination of complete degradation of nylon nucleic acids by snake venom phosphodiesterase and dephosphorylation of the resulting nucleotide fragments by bacterial alkaline phosphatase, followed by LCMS analysis, clarified the linear structure of the oligo-amide linkages. The templated synthesis strategy afforded nylon nucleic acids in the target structure and was compatible with the presence heteronucleotides. The complete digestion procedure produced a new species of DNA analogues, nylon ribonucleosides, which display nucleosides attached via a 2′-alkylthio linkage to each diamine and dicarboxylate repeat unit of the original nylon nucleic acids. The binding affinity of a nylon ribonucleoside octamer to the complementary DNA was evaluated by thermal denaturing experiments. The octamer was found to form stable duplexes with an inverse dependence on salt concentration, in contrast to the salt-dependent DNA control. PMID:23125913

  6. Insulin and amino acids stimulate whole body protein synthesis in neonates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Insulin and amino acids (AA) stimulate muscle protein synthesis in neonatal pigs. To determine the effects of insulin and AA on whole body protein turnover, hyperinsulinemic (0 and 100 ng/(kg[0.66]/min))-euglycemic-AA clamps were performed during euaminoacidemia or hyperaminoacidemia in fasted 7-d-...

  7. Synthesis of selenium-containing amino acid analogues and their biological study.


    Abdel-Hafez, S H; Saad, H A; Aly, M R E


    Synthesis of selenium-containing amino acid analogues is described. These compounds were prepared in a concise and short synthetic route in good yields by nucleophilic substitution reaction of pyridineselenol and quinolineselenol derivatives with N-phthaloylglycyl chloride followed by hydrazinolysis. The newly synthesized compounds were screened against different strains of bacteria and fungi. PMID:21899043

  8. Hydroxy fatty acid synthesis and lipid gene expression during seed development in Lesquerella fendleri (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella fendleri is a developing oilseed crop in U.S. Its seed oil is rich in hydroxy fatty acid (HFA), lesquerolate (C20:1OH), suitable as a raw material for many industrial applications. To understand regulatory mechanism underlying synthesis and accumulation of the lesquerolate, we have inves...

  9. De novo fatty acid synthesis at the mitotic exit is required to complete cellular division

    PubMed Central

    Scaglia, Natalia; Tyekucheva, Svitlana; Zadra, Giorgia; Photopoulos, Cornelia; Loda, Massimo


    Although the regulation of the cell cycle has been extensively studied, much less is known about its coordination with the cellular metabolism. Using mass spectrometry we found that lysophospholipid levels decreased drastically from G2/M to G1 phase, while de novo phosphatidylcholine synthesis, the main phospholipid in mammalian cells, increased, suggesting that enhanced membrane production was concomitant to a decrease in its turnover. In addition, fatty acid synthesis and incorporation into membranes was increased upon cell division. The rate-limiting reaction for de novo fatty acid synthesis is catalyzed by acetyl-CoA carboxylase. As expected, its inhibiting phosphorylation decreased prior to cytokinesis initiation. Importantly, the inhibition of fatty acid synthesis arrested the cells at G2/M despite the presence of abundant fatty acids in the media. Our results suggest that de novo lipogenesis is essential for cell cycle completion. This “lipogenic checkpoint” at G2/M may be therapeutically exploited for hyperproliferative diseases such as cancer. PMID:24418822

  10. Synthesis of polyacrylic-acid-based thermochromic polymers

    NASA Astrophysics Data System (ADS)

    Srivastava, Jyoti; Alam, Sarfaraz; Mathur, G. N.


    Smart materials respond to environmental stimuli with particular changes in some variables (for example temperature, pressure and electric field etc), for that reason they are often called responsive materials. In the present work, we have synthesized thermochromic polymer based on poly acrylic acid cobalt chloride (CoCl2) and phosphoric acid (H3PO4) that visually and reversibly changes color in the temperature range (70 - 130°C). These thermochromic materials can be used as visual sensors of temperature. Thermochromic polymers are based on polyacrylic acid and CoCl2 complex.

  11. Induction of cellular deoxyribonucleic acid synthesis in butyrate-treated cells by simian virus 40 deoxyribonucleic acid

    SciTech Connect

    Kawasaki, S.; Diamond, L.; Baserga, R.


    Sodium butyrate (3mM) inhibited the entry into the S phase of quiescent 3T3 cells stimulated by serum, but had no effect on the accumulation of cellular ribonucleic acid. Simian virus 40 infection or manual microinjection of cloned fragments from the simian virus 40 A gene caused quiescent 3T3 cells to enter the S phase even in the presence of butyrate. NGI cells, a line of 3T3 cells transformed by simian virus 40, grew vigorously in 3 mM butyrate. Homokaryons were formed between G/sub 1/ and S-phase 3T3 cells. Butyrate inhibited the induction of deoxyribonucleic acid synthesis that usually occurs in G/sub 1/ nuclei when G/sub 1/ cells are fused with S-phase cells. However, when G/sub 1/ 3T3 cells were fused with exponentially growing NGI cells, the 3T3 nuclei were induced to enter deoxyribonucleic acid synthesis. In tsAF8 cells, a ribonucleic acid polymerase II mutant that stops in the G/sub 1/ phase of the cell cycle, no temporal sequence was demonstrated between the butyrate block and the temperature-sensitive block. These results confirm previous reports that certain virally coded proteins can induce cell deoxyribonucleic acid synthesis in the absence of cellular functions that are required by serum-stimulated cells. The author's interpretation of these data is that butyrate inhibited cell growth by inhibiting the expression of genes required for the G/sub o/ ..-->.. G/sub 1/ ..-->.. S transition and that the product of the simian virus 40 A gene overrode this inhibition by providing all of the necessary functions for the entry into the S phase.

  12. Induction of Fas receptor and Fas ligand by nodularin is mediated by NF-{kappa}B in HepG2 cells

    SciTech Connect

    Feng Gong; Li Ying; Bai Yansheng


    Nodularin is a natural toxin with multiple features, including inhibitor of protein phosphatases 1 and 2A as well as tumor initiator and promoter. One unique feature of nodularin is that this chemical is a hepatotoxin. It can accumulate into the liver after contact and lead to severe damage to hepatocyte, such as apoptosis. Fas receptor (Fas) and Fas ligand (FasL) system is a critical signaling network triggering apoptosis. In current study, we investigated whether nodularin can induce Fas and FasL expression in HepG2 cell, a well used in vitro model for the study of human hepatocytes. Our data showed nodularin induced Fas and FasL expression, at both mRNA and protein level, in a time- and dose-dependent manner. We also found nodularin induced apoptosis at the concentration and incubation time that Fas and FasL were significantly induced. Neutralizing antibody to FasL reduced nodularin-induced apoptosis. Further studies demonstrated that nodularin promoted nuclear translocation and activation of p65 subunit of NF-{kappa}B. By applying siRNA targeting p65, which knocked down p65 in HepG2 cells, we successfully impaired the activation of NF-{kappa}B by nodularin. In these p65 knockdown cells, we observed that Fas and FasL expression and apoptosis induced by nodularin were significantly reduced. These findings suggest the induction of Fas and FasL expression and thus cell apoptosis in HepG2 cells by nodularin is mediated through NF-{kappa}B pathway.

  13. Fast neutrons-induced apoptosis is Fas-independent in lymphoblastoid cells

    SciTech Connect

    Fischer, Barbara; Benzina, Sami; Jeannequin, Pierre; Dufour, Patrick; Bergerat, Jean-Pierre; Denis, Jean-Marc; Gueulette, John; Bischoff, Pierre L. . E-mail:


    We have previously shown that ionizing radiation-induced apoptosis in human lymphoblastoid cells differs according to their p53 status, and that caspase 8-mediated cleavage of BID is involved in the p53-dependent pathway. In the present study, we investigated the role of Fas signaling in caspase 8 activation induced by fast neutrons irradiation in these cells. Fas and FasL expression was assessed by flow cytometry and by immunoblot. We also measured Fas aggregation after irradiation by fluorescence microscopy. We found a decrease of Fas expression after irradiation, but no change in Fas ligand expression. We also showed that, in contrast to the stimulation of Fas by an agonistic antibody, Fas aggregation did not occur after irradiation. Altogether, our data strongly suggest that fast neutrons induced-apoptosis is Fas-independent, even in p53-dependent apoptosis.

  14. Synthesis and biological evaluation of novel lipoamino acid derivatives.


    Kaki, Shiva Shanker; Arukali, Sammaiah; Korlipara, Padmaja V; Prasad, R B N; Yedla, Poornachandra; Ganesh Kumar, C


    Seven novel lipoamino acid conjugates were synthesized from methyl oleate and amino acids. Methyl oleate was grafted to different amino acids using thioglycolic acid as a spacer group. Seven derivatives (3a-g) were prepared and characterized by spectral data (NMR, IR and MS spectral studies). All the derivatives were studied for their antimicrobial, anti-biofilm and anticancer activities. Among all the derivatives, it was found that compound 3b was the most potent antibacterial compound which showed good activity against four Gram positive bacterial strains and also exhibited excellent antifungal activity against a fungal strain. In the anti-biofilm assay, compound 3b showed promising activity with IC50 value of 2.8μM against Bacillus subtilis MTCC 121. All the compounds showed anticancer activities with 3c showing promising anticancer activity (IC50=15.3-22.4μM) against the four cell lines tested. PMID:26586599

  15. Sp3 regulates fas expression in lung epithelial cells.

    PubMed Central

    Pang, H; Miranda, K; Fine, A


    By transducing an apoptotic signal in immune effector cells, Fas has been directly implicated in the control of immunological activity. Expression and functional results, however, have also suggested a role for Fas in regulating cell turnover in specific epithelial populations. To characterize factors responsible for Fas expression in epithelial cells, approximately 3 kb of the 5' flanking region of the mouse Fas gene was isolated. By rapid amplification of cDNA ends and primer extension, transcriptional start sites were identified within 50 bp upstream of the translation start site. Transient transfection of promoter-luciferase constructs in a mouse lung epithelial cell line, MLE-15, localized promoter activity to the first 77 bp of upstream sequence. By using a 60 bp DNA probe (-18 to -77) in electrophoretic mobility-shift assays, three shifted complexes were found. Incubation with excess cold Sp1 oligonucleotide or an anti-Sp3 antibody inhibited complex formation. Site-directed mutagenesis of the Sp1 site resulted in 60-70% loss of promoter activity. In Drosophila SL-2 cells, promoter activity was markedly increased by co-transfection of an Sp3 expression construct. These results show that the Sp3 protein is involved in regulating Fas gene expression in lung epithelial cells. PMID:9639581

  16. Synthesis and Functionalization of Cyclic Sulfonimidamides: A Novel Chiral Heterocyclic Carboxylic Acid Bioisostere

    PubMed Central


    An efficient synthesis of aryl substituted cyclic sulfonimidamides designed as chiral nonplanar heterocyclic carboxylic acid bioisosteres is described. The cyclic sulfonimidamide ring system could be prepared in two steps from a trifluoroacetyl protected sulfinamide and methyl ester protected amino acids. By varying the amino acid, a range of different C-3 substituted sulfonimidamides could be prepared. The compounds could be further derivatized in the aryl ring using standard cross-coupling reactions to yield highly substituted cyclic sulfonimidamides in excellent yields. The physicochemical properties of the final compounds were examined and compared to those of the corresponding carboxylic acid and tetrazole derivatives. The unique nonplanar shape in combination with the relatively strong acidity (pKa 5–6) and the ease of modifying the chemical structure to fine-tune the physicochemical properties suggest that this heterocycle can be a valuable addition to the range of available carboxylic acid isosteres. PMID:24900513

  17. Synthesis of a bicyclic delta-amino acid as a constrained Gly-Asn dipeptide isostere.


    Trabocchi, A; Menchi, G; Danieli, E; Guarna, A


    Delta-amino acids are very attractive in drug discovery, especially in the peptidomimetic area, because of their capability to act as dipeptide isosteres and reverse turn mimetics. Herein we report the synthesis of a rigid delta-amino acid constrained by a 3-aza-6,8-dioxabicyclo[3.2.1]octane-based scaffold, which can be considered as a Gly-Asn dipeptide mimetic. Key steps are the condensation of glycidol and tartaric acid derivatives, and the intramolecular trans-acetalization of the oxidized adduct to give the bicyclic delta-amino acid. Starting from L-tartaric acid derivative, it was achieved the corresponding Gly-D-Asn isostere, whereas from the enantiomeric D-tartaric acid derivative the corresponding Gly-L-Asn isostere could be obtained, thus giving access to both enantiomeric dipeptide sequences. PMID:18235990

  18. Raman microscopy at the subcellular level: a study on early apoptosis in endothelial cells induced by Fas ligand and cycloheximide.


    Czamara, Krzysztof; Petko, Filip; Baranska, Malgorzata; Kaczor, Agnieszka


    High spatially resolved Raman microscopy was applied to study the early apoptosis in endothelial cells and chemical and structural changes induced by this process. Application of cluster analysis enabled separation of signals due to various subcellular organelles and compartments such as the nuclei, nucleoli, endoplasmic reticulum or cytoplasm and analysis of alterations locally at the subcellular level. Different stimuli, i.e. Fas ligand, a tumor necrosis factor, and cycloheximide, an inhibitor of eukaryotic protein biosynthesis, were applied to induce apoptotic mechanisms. Due to different mechanisms of action, the changes observed in subcellular structures were different for FasL and cycloheximide. Although in both cases a statistically significant decrease of the protein level was observed in all studied cellular structures, the increase of the nucleic acids content locally in apoptotic nuclei was considerably more pronounced upon FasL-induced apoptosis compared to the cycloheximide one. Additionally, apoptosis invokes also a decrease of the proteins with the α-helix protein structure selectively for FasL in the cytoplasm and endoplasmic reticulum. PMID:26765153

  19. Synthesis and properties of coumaric acid derivative homo-polymers.


    Thi, Tran Hang; Matsusaki, Michiya; Shi, Dongjian; Kaneko, Tatsuo; Akashi, Mitsuru


    Poly(4-hydroxycinnamic acid) (P4HCA), poly(3-hydroxycinnamic acid) (P3HCA), poly(3-methoxy-4-hydroxycinnamic acid) (PMHCA) and poly(3,4-dihydroxycinnamic acid) (PDHCA) were synthesized by the thermal poly-condensation of the corresponding monomers, which are lignin precursors, coumaric acid derivatives consisting of cinnamoyl groups and different position and number of OH groups. The solubility of the homo-polymers in organic solvents decreased in the order of P3HCA > PDHCA > P4HCA > PMHCA. The wide angle X-ray diffraction (WAXD) results indicated that P4HCA or PMHCA with p-OH group had higher crystallinity, in contrast to P3HCA or PDHCA with m-OH group which had lower crystallinity. Crossed-polarizing microscopy suggested that P4HCA had the nematic liquid crystal properties at 220 degrees C and PDHCA showed birefringence properties at 200 degrees C. In cell-adhesion tests, PDHCA showed the highest cell adhesion (ca. 70%), whereas P3HCA, P4HCA and PMHCA had 50, 18 and 10% cell adhesion, respectively. The coumaric acid derivative homo-polymers can be useful as cell adhesion controllable thermotropic polymers for biomedical and environmental fields. PMID:18177555

  20. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.


    Napoli, J L


    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  1. Synthesis of novel conjugates of a saccharide, amino acids, nucleobase and the evaluation of their cell compatibility.


    Yuan, Dan; Du, Xuewen; Shi, Junfeng; Zhou, Ning; Baoum, Abdulgader Ahmed; Xu, Bing


    This article reports the synthesis of a novel type of conjugate of three fundamental biological build blocks (i.e., saccharide, amino acids, and nucleobase) and their cell compatibility. The facile synthesis starts with the synthesis of nucleobase and saccharide derivatives, then uses solid-phase peptide synthesis (SPPS) to build the peptide segment (Phe-Arg-Gly-Asp or naphthAla-Phe-Arg-Gly-Asp with fully protected groups), and later, an amidation reaction in liquid phase connects these three parts together. The overall yield of these multiple step synthesis is about 34%. Besides exhibiting excellent solubility, these conjugates of saccharide-amino acids-nucleobase (SAN), like the previously reported conjugates of nucleobase-amino acids-saccharide (NAS) and nucleobase-saccharide-amino acids (NSA), are mammalian cell compatible. PMID:25383110

  2. Synthesis of phosphoramidites of isoGNA, an isomer of glycerol nucleic acid

    PubMed Central

    Kim, Keunsoo; Punna, Venkateshwarlu; Karri, Phaneendrasai


    Summary IsoGNA, an isomer of glycerol nucleic acid GNA, is a flexible (acyclic) nucleic acid with bases directly attached to its linear backbone. IsoGNA exhibits (limited) base-pairing properties which are unique compared to other known flexible nucleic acids. Herein, we report on the details of the preparation of isoGNA phosphoramidites and an alternative route for the synthesis of the adenine derivative. The synthetic improvements described here enable an easy access to isoGNA and allows for the further exploration of this structural unit in oligonucleotide chemistry thereby spurring investigations of its usefulness and applicability. PMID:25246971

  3. Tunable and Diastereoselective Brønsted Acid Catalyzed Synthesis of β-Enaminones.


    Kang, Ye-Won; Cho, Yu Jin; Han, Seung Jin; Jang, Hye-Young


    The Brønsted acid catalyzed Meyer-Schuster reaction of hemiaminals was studied for the stereoselective synthesis of β-enaminones. Hemiaminals were formed from propargyl aldehydes (or the oxidation of propargyl alcohols) and amines in the presence of Brønsted acids. A critical step to control the stereochemistry of the products is the protonation of the corresponding allenol intermediate, which is dictated by the Brønsted acid used, the steric effect of the amine, and the electronic effect of the propargyl aldehyde. PMID:26741050

  4. Chemoenzymatic synthesis of CMP-N-acetyl-7-fluoro-7-deoxy-neuraminic acid.


    Hartlieb, Sina; Günzel, Almut; Gerardy-Schahn, Rita; Münster-Kühnel, Anja K; Kirschning, Andreas; Dräger, Gerald


    7-Fluoro sialic acid was prepared and activated as cytidine monophosphate (CMP) ester. The synthesis started with d-glucose, which was efficiently converted into N-acetyl-4-fluoro-4-deoxy-d-mannosamine. Aldolase catalyzed transformation yielded the corresponding fluorinated sialic acid which was activated as CMP ester using three different synthetases in the presence as well as in the absence of pyrophosphatase which possesses inhibitory properties. Finally, conditions were optimized to perform a one-pot reaction starting from fluorinated mannosamine, which yielded the 7-fluoro-7-deoxy-CMP-sialic acid by incubation with three enzymes. PMID:18353292

  5. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.


    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  6. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.


    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim


    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases. PMID:25282359

  7. Nature's Starships: Amino Acid Synthesis, Frequency, and Delivery to Earth via Meteorites

    NASA Astrophysics Data System (ADS)

    Cobb, Alyssa; Pudritz, Ralph


    Understanding the origin of organic molecules on Earth is vital to our understanding of the origins of life. One proposed mechanism for the introduction of organic material to our planet is via meteorite impacts. Meteoritic parent bodies contain organic material and water ice, which, given radionuclide decay in their interiors, cause the ice to melt and the parent bodies to undergo a process called aqueous alteration. An example of this internal chemistry is Strecker synthesis, a process resulting in the production of various amino acids. Our work summarizes recent discoveries regarding amino acid synthesis and concentration data. We present the amino acid concentrations collated from a variety of meteorites (~20) covering a range of meteorite classes. We can use the dependence of amino acid frequency on variables such as temperature and pressure to model Strecker synthesis inside a theoretical parent body. Our modeling software takes a set of chemical species and outputs their relative frequencies based on a minimization of their Gibbs free energies. The goal of this work is to predict and quantify the presence of amino acids on a foreign landscape using thermodynamic principles.

  8. Templated synthesis of peptide nucleic acids via sequence-selective base-filling reactions.


    Heemstra, Jennifer M; Liu, David R


    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  9. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    PubMed Central


    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  10. Multiple inputs control sulfur-containing amino acid synthesis in Saccharomyces cerevisiae

    PubMed Central

    Sadhu, Meru J.; Moresco, James J.; Zimmer, Anjali D.; Yates, John R.; Rine, Jasper


    In Saccharomyces cerevisiae, transcription of the MET regulon, which encodes the proteins involved in the synthesis of the sulfur-containing amino acids methionine and cysteine, is repressed by the presence of either methionine or cysteine in the environment. This repression is accomplished by ubiquitination of the transcription factor Met4, which is carried out by the SCF(Met30) E3 ubiquitin ligase. Mutants defective in MET regulon repression reveal that loss of Cho2, which is required for the methylation of phosphatidylethanolamine to produce phosphatidylcholine, leads to induction of the MET regulon. This induction is due to reduced cysteine synthesis caused by the Cho2 defects, uncovering an important link between phospholipid synthesis and cysteine synthesis. Antimorphic mutants in S-adenosyl-methionine (SAM) synthetase genes also induce the MET regulon. This effect is due, at least in part, to SAM deficiency controlling the MET regulon independently of SAM's contribution to cysteine synthesis. Finally, the Met30 protein is found in two distinct forms whose relative abundance is controlled by the availability of sulfur-containing amino acids. This modification could be involved in the nutritional control of SCF(Met30) activity toward Met4. PMID:24648496

  11. Synthesis and properties of synthetic fulvic acid derived from hematoxylin

    NASA Astrophysics Data System (ADS)

    Litvin, Valentina A.; Minaev, Boris F.; Baryshnikov, Gleb V.


    A model fulvic acid (FA) was synthesized from a natural dye, hematoxylin, in a slow oxidative polymerization/condensation reaction catalysed by OH- at pH ca. 12. The resulting dark-brown product, acidified to pH ca. 2, did not precipitate from the reaction solution. It was isolated and purified by cation-exchange resin. Its physicochemical and spectroscopic properties, as determined by means of elemental analysis, molecular weight analyses, Fourier transform infra red (FTIR) and ultraviolet-visible (UV-VIS) spectroscopy, X-ray diffraction and electron paramagnetic resonance (EPR) spectroscopy, showed a close resemblance to natural FA. The similarity and differences between synthetic fulvic acids derived from hematoxylin and the natural fulvic acids substances are discussed. Quantum-chemical calculations of the supposed primary oxidation products of hematoxylin are performed and compared with observations.

  12. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)


    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  13. Amino acids in a Fischer Tropsch type synthesis

    NASA Technical Reports Server (NTRS)

    Brown, D. L.; Lawless, J. G.


    One postulation is described for the presence of organic compounds in meteorites which states that they were formed during the condensation of the solar nebula. A viable laboratory simulation of these conditions can be modeled after the industrial Fischer Tropsch reaction, which is known to produce organic compounds called hydrocarbons. In this simulation, a mixture of carbon monoxide, hydrogen and ammonia is heated in the presence of iron meteorite. The reaction products for amino acids, a class of organic compounds important to life, were examined. A large number of these compounds is found in meteorites and other chemical evolution experiments, but only small quantities of a few amino acids were found in the present simulation work. These results are at odds with the existing literature in which many amino acids were reported.

  14. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng


    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  15. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel


    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  16. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.


    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  17. Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S

    PubMed Central

    Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats


    Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631

  18. Urinary excretion of mevalonic acid as an indicator of cholesterol synthesis.


    Lindenthal, B; Simatupang, A; Dotti, M T; Federico, A; Lütjohann, D; von Bergmann, K


    Urinary excretion of mevalonic acid was investigated as an indicator of cholesterol synthesis. In normolipemic volunteers, excretion of mevalonic acid averaged 3.51 +/- 0.59 (SD) micrograms/kg x day1; (n = 24) and was not different from patients with hypercholesterolemia (3.30 +/- 0.92 micrograms/kg x day1; n = 24). In patients with cerebrotendineous xanthomatosis, the excretion was significantly higher (8.55 +/- 1.92 micrograms/kg x day1; n = 6, P < 0.001) but comparable to volunteers treated with cholestyramine (6.69 +/- 2.6 micrograms/kg x day1; n = 5). A significant correlation was found between 24-h excretion of mevalonic acid and cholesterol synthesis (r = 0.835; n = 35; P < 0.001). The coefficient of variation of excretion of mevalonic acid during 3 consecutive days was small (9.8%; n = 7). However, urinary output of mevalonic acid was significantly higher during the night (164 +/- 14 micrograms/12-h) than during the day (129 +/- 9 micrograms/12-h; n = 11; P < 0.05). In patients treated with simvastatin (40 mg/day) for 6 weeks, the ratio of mevalonic acid to creatinine in a morning urine sample decreased significantly compared to pretreatment values (110 +/- 25 micrograms/g vs. 66 +/- 25 micrograms/g; P < 0.001). Furthermore, the ratio of mevalonic acid to creatinine in a morning urine sample correlated with the ratio from the 24-h collection period (r = 0.714; n = 34; P < 0.001). The results indicate that the analysis of urinary mevalonic acid, either in 24-h collection or in a single morning sample, is an attractive method for evaluation of long and very short term changes of the rates of cholesterol synthesis. PMID:8906596

  19. Ex vivo pediatric brain tumors express Fas (CD95) and FasL (CD95L) and are resistant to apoptosis induction.

    PubMed Central

    Riffkin, C. D.; Gray, A. Z.; Hawkins, C. J.; Chow, C. W.; Ashley, D. M.


    Fas (APO-1/CD95/TNFRSF6) is a member of the tumor necrosis/nerve growth factor receptor family that signals apoptotic cell death in sensitive cells.Expression of Fas and its agonistic ligand (FasL/TNFSF6) was investigated in ex vivo pediatric brain tumor specimens of various histologic types. Fas expression was identified in all of the 18 tumors analyzed by flow cytometry and immunohistochemistry. FasL expression was identified in most of the 13 tumors analyzed by both Western analysis and immunohistochemistry. Nine of these tumor specimens were treated with either the agonistic anti-Fas antibody (APO-1) in combination with protein A or FasL in short-term cytotoxicity assays. Sensitivity to apoptosis induced by the topoisomerase II inhibitor, etoposide, was also assessed. Despite the presence of Fas, all the specimens analyzed demonstrated a high degree of resistance to Fas-mediated apoptosis. These 9 specimens also showed a high degree of resistance to etoposide. Only 2 of the 9 specimens were susceptible to etoposide-induced cell death, whereas only 3 were sensitive to Fas-mediated apoptosis. One brain tumor was sensitive to both Fas ligation and etoposide treatment. This contrasted with the high degree of susceptibility to both etoposide- and Fas-induced apoptosis observed in the reference Jurkat cell line. The results suggest that Fas expression may be a general feature of tumors of the CNS and that a significant degree of resistance to Fas-mediated apoptosis may exist in ex vivo pediatric brain tumor specimens. PMID:11584892

  20. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    PubMed Central

    Feagin, Trevor A.; Shah, Nirmal I.; Heemstra, Jennifer M.


    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  1. Convenient and scalable synthesis of fmoc-protected Peptide nucleic Acid backbone.


    Feagin, Trevor A; Shah, Nirmal I; Heemstra, Jennifer M


    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  2. Synthesis and phosphorylation of the glial fibrillary acidic protein during brain development: A tissue slice study

    SciTech Connect

    Noetzel, M.J. )


    Brain slices were incubated with either (3H) amino acids or (32P) orthophosphate in order to characterize the synthesis and phosphorylation of the glial fibrillary acidic protein (GFAP) in the rat nervous system. The incorporation of (3H) amino acids into GFAP was found to increase significantly during early postnatal development, reaching a peak of activity on day 5 of life and then declining over the next 2 weeks. Concomitant with this peak of synthetic activity the content of GFAP in rat brain was also observed to increase dramatically. GFAP continued to accumulate in brain through postnatal day 30 despite a decrease in the synthesis of the protein. These results indicate that the increase in GFAP during the first month of life cannot be ascribed solely to the rate of GFAP synthesis. The findings are consistent with the hypothesis that during later stages of astrocytic development the accumulation of GFAP may be primarily dependent upon a low rate of protein degradation. The pattern of GFAP phosphorylation in the developing rat brain differed from that observed for the incorporation of (3H) amino acids. The peak incorporation of 32P into GFAP occurred on postnatal day 10 at a time when synthesis of the protein had declined by 43%. These findings suggest that during development phosphorylation of GFAP is mediated by factors different from those directing its synthesis. In addition, phosphorylation of GFAP did not alter its solubility in cytoskeletal preparations indicating that GFAP phosphorylation is probably not a major regulatory mechanism in disassembly of the astroglial filaments.

  3. Synthesis and antihyperlipidemic activity of piperic acid derivatives.


    A, Rong; Bao, Narisu; Sun, Zhaorigetu; Borjihan, Gereltu; Qiao, Yanjiang; Jin, Zhuang


    A series of piperic acid derivatives were designed and synthesized from piperine/piperlonguminine, and their antihyperlipidemic activities evaluated in diet-induced hyperlipidemic rats with respect to simvastatin. Two promising analogues 3 and 10 were discovered and their antihyperlipidemic activities were comparable to or better than those of simvastatin. PMID:25920263

  4. Design, synthesis and biological evaluation of novel betulinic acid derivatives

    PubMed Central


    Background Tumor, is one of the major reason for human death, due to its widespread occurrence. Betulinic acid derivatives have attracted considerable attention as cancer chemopreventive agents and also as cancer therapeutics. Many of its derivatives inhibit the growth of human cancer cell lines by triggering apoptosis. With this background, we planned to synthesize a series of betulinic acid derivatives to assess their antiproliferation efficacy on human cancer cell lines. Results A series of novel betulinic acid derivatives were designed and synthesized as highlighted by the preliminary antitumor evaluation against MGC-803, PC3, A375, Bcap-37 and A431 human cancer cell lines in vitro. The pharmacological results showed that some of the compounds displayed moderate to high levels of antitumor activities with most of new exhibiting higher inhibitory activities compared to BA. The IC50 values of compound 3c on the five cancer cell lines were 2.3, 4.6, 3.3, 3.6, and 4.3 μM, respectively. Subsequent fluorescence staining and flow cytometry analysis (FCM) indicated that compound 3c could induce apoptosis in MGC-803 and PC3 cell lines, and the apoptosis ratios reached the peak (37.38% and 33.74%) after 36 h of treatment at 10 μM. Conclusions This study suggests that most of betulinic acid derivatives could inhibit the growth of human cancer cell lines. Furthermore, compound 3c could induce apoptosis of cancer cells. PMID:23174002

  5. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.


    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A


    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  6. Influence of light on the free amino acid content and γ-aminobutyric acid synthesis in Brassica juncea seedlings.


    Li, Xiaohua; Kim, Yeon Bok; Uddin, Md Romij; Lee, Sanghyun; Kim, Sun-Ju; Park, Sang Un


    Glutamate decarboxylase (GAD; EC is an important enzyme in γ-aminobutyric acid (GABA) biosynthesis. Here we report the influence of light on amino acid accumulation and investigate the molecular mechanism by which light influences GABA biosynthesis at the seedling stage of two mustard (Brassica juncea) cultivars (green-leaf and purple-leaf). Gene expression profiles of four GAD-encoding genes (GAD1, GAD2, GAD4a, and GAD4b) and their impact on GABA biosynthesis were analyzed. Light exerted an obvious influence on amino acid accumulation in mustard seedlings. GAD gene expression was also significantly regulated by light/dark or dark treatment, which differentially regulated GABA biosynthesis in B. juncea seedlings. High-performance liquid chromatography (HPLC) revealed that the seeds of purple cultivars contain a higher amount of free amino acids and GABA than do the seeds of green cultivars. After seed germination, however, the accumulation of free amino acids peaked in dark-treated seedlings on day 9 in both cultivars, whereas GABA synthesis peaked at 9 days under light conditions. This study may provide a foundation for understanding the effect of light on amino acids, particularly GABA biosynthesis in Brassica plants. PMID:23909820

  7. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing


    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  8. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2.


    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing


    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru-Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  9. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna


    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  10. Dietary Lipid Levels Influence Lipid Deposition in the Liver of Large Yellow Croaker (Larimichthys crocea) by Regulating Lipoprotein Receptors, Fatty Acid Uptake and Triacylglycerol Synthesis and Catabolism at the Transcriptional Level

    PubMed Central

    Yan, Jing; Liao, Kai; Wang, Tianjiao; Mai, Kangsen; Xu, Wei; Ai, Qinghui


    Ectopic lipid accumulation has been observed in fish fed a high-lipid diet. However, no information is available on the mechanism by which dietary lipid levels comprehensively regulate lipid transport, uptake, synthesis and catabolism in fish. Therefore, the present study aimed to gain further insight into how dietary lipids affect lipid deposition in the liver of large yellow croaker(Larimichthys crocea). Fish (150.00±4.95 g) were fed a diet with a low (6%), moderate (12%, the control diet) or high (18%) crude lipid content for 10 weeks. Growth performance, plasma biochemical indexes, lipid contents and gene expression related to lipid deposition, including lipoprotein assembly and clearance, fatty acid uptake and triacylglycerol synthesis and catabolism, were assessed. Growth performance was not significantly affected. However, the hepato-somatic and viscera-somatic indexes as well as plasma triacylglycerol, non-esterified fatty acids and LDL-cholesterol levels were significantly increased in fish fed the high-lipid diet. In the livers of fish fed the high-lipid diet, the expression of genes related to lipoprotein clearance (LDLR) and fatty acid uptake (FABP11) was significantly up-regulated, whereas the expression of genes involved in lipoprotein assembly (apoB100), triacylglycerol synthesis and catabolism (DGAT2, CPT I) was significantly down-regulated compared with fish fed the control diet, and hepatic lipid deposition increased. In fish fed the low-lipid diet, the expression of genes associated with lipoprotein assembly and clearance (apoB100, LDLR, LRP-1), fatty acid uptake (CD36, FATP1, FABP3) and triacylglycerol synthesis (FAS) was significantly increased, whereas the expression of triacylglycerol catabolism related genes (ATGL, CPT I) was reduced compared with fish fed the control diet. However, hepatic lipid content in fish fed the low-lipid diet decreased mainly due to low dietary lipid intake. In summary, findings of this study provide molecular

  11. The effects of retinoic acid on immunoglobulin synthesis by human cord blood mononuclear cells.


    Israel, H; Odziemiec, C; Ballow, M


    Derivatives of vitamin A have attracted considerable attention as agents which have immune potentiating properties and possibly tumor-suppressive effects. Recent investigations have shown that retinoic acid (RA) can augment immunoglobulin production of B-cell hybridomas from patients with immune deficiency. In this study we examined the ability of RA to modify the mitogen-induced polyclonal immunoglobulin synthesis of cord blood mononuclear cells (CBMC). RA in concentrations ranging from 10(-5) to 10(-7) M augmented IgM synthesis of CBMC in response to formalinized Cowans I strain Staphylococcus aureus (SAC) up to 45.6-fold which was greater at suboptimal responses to SAC. There were no changes in IgG or IgA synthesis and minimal effects on SAC-induced proliferative responses. RA did not produce similar changes in IgM synthesis of SAC-stimulated adult peripheral blood mononuclear cells (PBMC), and RA had no effect on the immunoglobulin synthesis of Epstein-Barr virus (EBV)-stimulated CBMC or adult PBMC. Time course studies showed that peak enhancement occurred when RA was added between 4 and 24 hr after culture initiation and required prior activation by SAC for augmentation of IgM synthesis. Cell separation experiments showed that prior incubation (18 hr) of an enriched T-cell fraction with RA enhanced the IgM synthesis of a T-cell-depleted B-cell fraction. These experiments and the findings that RA-induced augmentation of IgM production in response to SAC, but not to EBV suggest that the immunoregulatory effects of RA may be mediated by either T cells or T-cell products. Further studies will be necessary to understand the mechanism by which RA augments IgM synthesis of CBMC. PMID:2029794

  12. Direct Synthesis of 5-Aryl Barbituric Acids by Rhodium(II)-Catalyzed Reactions of Arenes with Diazo Compounds**

    PubMed Central

    Best, Daniel; Burns, David J; Lam, Hon Wai


    A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544

  13. Complestatin exerts antibacterial activity by the inhibition of fatty acid synthesis.


    Kwon, Yun-Ju; Kim, Hyun-Ju; Kim, Won-Gon


    Bacterial enoyl-acyl carrier protein (ACP) reductase has been confirmed as a novel target for antibacterial drug development. In the screening of inhibitors of Staphylococcus aureus enoyl-ACP reductase (FabI), complestatin was isolated as a potent inhibitor of S. aureus FabI together with neuroprotectin A and chloropeptin I from Streptomyces chartreusis AN1542. Complestatin and related compounds inhibited S. aureus FabI with IC₅₀ of 0.3-0.6 µM. They also prevented the growth of S. aureus as well as methicillin-resistance S. aureus (MRSA) and quinolone-resistant S. aureus (QRSA), with minimum inhibitory concentrations (MICs) of 2-4 µg/mL. Consistent with its FabI-inhibition, complestatin selectively inhibited the intracellular fatty acid synthesis in S. aureus, whereas it did not affect the macromolecular biosynthesis of other cellular components, such as DNA, RNA, proteins, and the cell wall. Additionally, supplementation with exogenous fatty acids reversed the antibacterial effect of complestatin, demonstrating that it targets fatty acid synthesis. In this study, we reported that complestatin and related compounds showed potent antibacterial activity via inhibiting fatty acid synthesis. PMID:25947917

  14. Synthesis and characterization of a pH responsive folic acid functionalized polymeric drug delivery system.


    Li, Xia; McTaggart, Matt; Malardier-Jugroot, Cecile


    We report the computational analysis, synthesis and characterization of folate functionalized poly(styrene-alt-maleic anhydride), PSMA for drug delivery purpose. The selection of the proper linker between the polymer and the folic acid group was performed before conducting the synthesis using Density Functional Theory (DFT). The computational results showed the bio-degradable linker 2, 4-diaminobutyric acid, DABA as a good candidate allowing flexibility of the folic acid group while maintaining the pH sensitivity of PSMA, used as a trigger for drug release. The synthesis was subsequently carried out in multi-step experimental procedures. The functionalized polymer was characterized using InfraRed spectroscopy, Nuclear Magnetic Resonance and Dynamic Light Scattering confirming both the chemical structure and the pH responsiveness of PSMA-DABA-Folate polymers. This study provides an excellent example of how computational chemistry can be used in selection process for the functional materials and product characterization. The pH sensitive polymers are expected to be used in delivering anti-cancer drugs to solid tumors with overly expressed folic acid receptors. PMID:27183249

  15. Role of amidation in bile acid effect on DNA synthesis by regenerating mouse liver.


    Barbero, E R; Herrera, M C; Monte, M J; Serrano, M A; Marin, J J


    Effect of bile acids on DNA synthesis by the regenerating liver was investigated in mice in vivo after partial hepatectomy (PH). Radioactivity incorporation into DNA after [14C]thymidine intraperitoneal administration peaked at 48 h after PH. At this time a significant taurocholate-induced dose-dependent reduction in DNA synthesis without changes in total liver radioactivity content was found (half-maximal effect at approximately 0.1 mumol/g body wt). Effect of taurocholate (0.5 mumol/g body wt) was mimicked by chocolate, ursodeoxycholate, deoxycholate, dehydrocholate, tauroursodeoxycholate, taurochenodeoxycholate, and taurodeoxycholate. In contrast, chenodeoxycholate, glycocholate, glycochenodeoxycholate, glycoursodeoxycholate, glycodeoxycholate, 5 beta-cholestane, bromosulfophthalein, and free taurine lacked this effect. No relationship between hydrophobic-hydrophilic balance and inhibitory effect was observed. Analysis by high-performance liquid chromatography indicated that inhibition of thymidine incorporation into DNA was not accompanied by an accumulation of phosphorylated DNA precursors in the liver but rather by a parallel increase in nucleotide catabolism. Bile acid-induced modifications in DNA synthesis were observed in vivo even in the absence of changes in toxicity tests, which suggests that the inhibitory effect shared by most unconjugated and tauroconjugated bile acids but not by glycoconjugated bile acids should be accounted for by mechanisms other than nonselective liver cell injury. PMID:7611405

  16. Role of the Fas/FasL system in a model of RSV infection in mechanically ventilated mice

    PubMed Central

    van den Berg, Elske; van Woensel, Job B. M.; Bos, Albert P.; Bem, Reinout A.; Altemeier, William A.; Gill, Sean E.; Martin, Thomas R.


    Infection with respiratory syncytial virus (RSV) in children can progress to respiratory distress and acute lung injury necessitating mechanical ventilation (MV). MV enhances apoptosis and inflammation in mice infected with pneumonia virus of mice (PVM), a mouse pneumovirus that has been used as a model for severe RSV infection in mice. We hypothesized that the Fas/Fas ligand (FasL) system, a dual proapoptotic/proinflammatory system involved in other forms of lung injury, is required for enhanced lung injury in mechanically ventilated mice infected with PVM. C57BL/6 mice and Fas-deficient (“lpr”) mice were inoculated intratracheally with PVM. Seven or eight days after PVM inoculation, the mice were subjected to 4 h of MV (tidal volume 10 ml/kg, fraction of inspired O2 = 0.21, and positive end-expiratory pressure = 3 cm H2O). Seven days after PVM inoculation, exposure to MV resulted in less severe injury in lpr mice than in C57BL/6 mice, as evidenced by decreased numbers of polymorphonuclear neutrophils in the bronchoalveolar lavage (BAL), and lower concentrations of the proinflammatory chemokines KC, macrophage inflammatory protein (MIP)-1α, and MIP-2 in the lungs. However, when PVM infection was allowed to progress one additional day, all of the lpr mice (7/7) died unexpectedly between 0.5 and 3.5 h after the onset of ventilation compared with three of the seven ventilated C57BL/6 mice. Parameters of lung injury were similar in nonventilated mice, as was the viral content in the lungs and other organs. Thus, the Fas/FasL system was partly required for the lung inflammatory response in ventilated mice infected with PVM, but attenuation of lung inflammation did not prevent subsequent mortality. PMID:21743025

  17. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi


    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  18. Synthesis and biological activity of tetralone abscisic acid analogues.


    Nyangulu, James M; Nelson, Ken M; Rose, Patricia A; Gai, Yuanzhu; Loewen, Mary; Lougheed, Brenda; Quail, J Wilson; Cutler, Adrian J; Abrams, Suzanne R


    Bicyclic analogues of the plant hormone abscisic acid (ABA) were designed to incorporate the structural elements and functional groups of the parent molecule that are required for biological activity. The resulting tetralone analogues were predicted to have enhanced biological activity in plants, in part because oxidized products would not cyclize to forms corresponding to the inactive catabolite phaseic acid. The tetralone analogues were synthesized in seven steps from 1-tetralone and a range of analogues were accessible through a second route starting with 2-methyl-1-naphthol. Tetralone ABA 8 was found to have greater activity than ABA in two bioassays. The absolute configuration of (+)-8 was established by X-ray crystallography of a RAMP hydrazone derivative. The hydroxymethyl compounds 10 and 11, analogues for studying the roles of 8- and 9-hydroxy ABA 3 and 6, were also synthesized and found to be active. PMID:16557330

  19. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi


    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  20. Synthesis and verification of biobased terephthalic acid from furfural.


    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi


    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  1. Synthesis and antifungal activity of bile acid-derived oxazoles.


    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela


    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives. PMID:26827629

  2. Pre-germinated brown rice prevented high fat diet induced hyperlipidemia through ameliorating lipid synthesis and metabolism in C57BL/6J mice.


    Shen, Kuo-Ping; Hao, Chi-Long; Yen, Hsueh-Wei; Chen, Chun-Yen; Chen, Jia-Hao; Chen, Fu-Chih; Lin, Hui-Li


    Pre-germinated brown rice (PGBR) can ameliorate hyperlipidemia, but the action mechanism is not clear. We focus the mechanisms of PGBR prevented hyperlipidemia. Six-week-old mice were divided into: standard-regular diet (SRD), high-fat diet (HFD) and HFD with PGBR (HFD + PGBR) groups for 16 weeks. The HFD group has higher concentrations of TG, TC, HDL and Non-HDL in the blood, and a higher atherosclerosis index (AI). The TG levels in the liver, and TG, bile acid levels in the feces were enhanced; and the total adipocytokines level in adipose tissue was reduced. The HFD group had higher protein expressions of SREBP-1, SCD-1, FAS, LDLR, and CYP7α1 in the liver. Moreover, the greater expressions of SREBP-1, SCD-1, FAS and the less expressions of PPAR-α and adiponectin were in adipose tissue. In the HFD + PGBR group, the PGBR regulated the levels of TG, TC, HDL, Non-HDL, AI and adipocytokines. PGBR increased more cholesterol and bile acid exhaust in feces. The SREBP-1, SCD-1, FAS, HMGCR, LDLR, CYP7α1 and PPAR-α proteins in the liver; and the SREBP-1, SCD-1, FAS, PPAR-α and adiponectin proteins in adipose tissue were reversed by PGBR. Taken together, PGBR can improve lipid synthesis and metabolism, and we suggest PGBR is a recommendable food for controlling hyperlipidemia. PMID:27499577

  3. Pre-germinated brown rice prevented high fat diet induced hyperlipidemia through ameliorating lipid synthesis and metabolism in C57BL/6J mice

    PubMed Central

    Shen, Kuo-Ping; Hao, Chi-Long; Yen, Hsueh-Wei; Chen, Chun-Yen; Chen, Jia-Hao; Chen, Fu-Chih; Lin, Hui-Li


    Pre-germinated brown rice (PGBR) can ameliorate hyperlipidemia, but the action mechanism is not clear. We focus the mechanisms of PGBR prevented hyperlipidemia. Six-week-old mice were divided into: standard-regular diet (SRD), high-fat diet (HFD) and HFD with PGBR (HFD + PGBR) groups for 16 weeks. The HFD group has higher concentrations of TG, TC, HDL and Non-HDL in the blood, and a higher atherosclerosis index (AI). The TG levels in the liver, and TG, bile acid levels in the feces were enhanced; and the total adipocytokines level in adipose tissue was reduced. The HFD group had higher protein expressions of SREBP-1, SCD-1, FAS, LDLR, and CYP7α1 in the liver. Moreover, the greater expressions of SREBP-1, SCD-1, FAS and the less expressions of PPAR-α and adiponectin were in adipose tissue. In the HFD + PGBR group, the PGBR regulated the levels of TG, TC, HDL, Non-HDL, AI and adipocytokines. PGBR increased more cholesterol and bile acid exhaust in feces. The SREBP-1, SCD-1, FAS, HMGCR, LDLR, CYP7α1 and PPAR-α proteins in the liver; and the SREBP-1, SCD-1, FAS, PPAR-α and adiponectin proteins in adipose tissue were reversed by PGBR. Taken together, PGBR can improve lipid synthesis and metabolism, and we suggest PGBR is a recommendable food for controlling hyperlipidemia. PMID:27499577

  4. Mitochondrial fatty acid synthesis is required for normal mitochondrial morphology and function in Trypanosoma brucei

    PubMed Central

    Guler, Jennifer L.; Kriegova, Eva; Smith, Terry K.; Lukeš, Julius; Englund, Paul T.


    Summary Trypanosoma brucei use microsomal elongases for de novo synthesis of most of its fatty acids. In addition, this parasite utilizes an essential mitochondrial type II synthase for production of octanoate (a lipoic acid precursor) as well as longer fatty acids such as palmitate. Evidence from other organisms suggests that mitochondrially synthesized fatty acids are required for efficient respiration but the exact relationship remains unclear. In procyclic form trypanosomes, we also found that RNAi depletion of the mitochondrial acyl carrier protein, an important component of the fatty acid synthesis machinery, significantly reduces cytochrome-mediated respiration. This reduction was explained by RNAi-mediated inhibition of respiratory complexes II, III and IV, but not complex I. Other effects of RNAi, such as changes in mitochondrial morphology and alterations in membrane potential, raised the possibility of a change in mitochondrial membrane composition. Using mass spectrometry, we observed a decrease in total and mitochondrial phosphatidylinositol and mitochondrial phosphatidylethanolamine. Thus, we conclude that the mitochondrial synthase produces fatty acids needed for maintaining local phospholipid levels that are required for activity of respiratory complexes and preservation of mitochondrial morphology and function. PMID:18221265

  5. Synthesis of 4-substituted nipecotic acid derivatives and their evaluation as potential GABA uptake inhibitors.


    Hellenbrand, Tim; Höfner, Georg; Wein, Thomas; Wanner, Klaus T


    In this study, we disclose the design and synthesis of novel 4-susbtituted nipecotic acid derivatives as inhibitors of the GABA transporter mGAT1. Based on molecular modeling studies the compounds are assumed to adopt a binding pose similar to that of the potent mGAT1 inhibitor nipecotic acid. As substitution in 4-position should not cause an energetically unfavorable orientation of nipecotic acid as it is the case for N-substituted derivatives this is expected to lead to highly potent binders. For the synthesis of novel 4-substituted nipecotic acid derivatives a linear synthetic strategy was employed. As a key step, palladium catalyzed cross coupling reactions were used to attach the required biaryl moieties to the ω-position of the alkenyl- or alkynyl spacers of varying length in the 4-position of the nipecotic acid scaffold. The resulting amino acids were characterized with respect to their binding affinities and inhibitory potencies at mGAT1. Though the biological activities found were generally insignificant to poor, two compounds, one of which possesses a reasonable binding affinity for mGAT1, rac-57, the other a notable inhibitory potency at mGAT4, rac-84, both displaying a slight subtype selectivity for the individual transporters, could be identified. PMID:27039250

  6. Synthesis of glycoaminooxy acid and N-oxyamide-linked glycolipids.


    Chen, N; Xie, J


    Aminooxyl sugar derivatives are versatile building blocks for the generation of various glycoconjugates with interesting bioactivities. We report herein a synthetic method for the preparation of orthogonally protected glycoaminooxy acid from methyl α-d-glycopyranoside in 7 steps. The key steps involve the selective protection, O-alkylation and Mitsunobu reaction. Fully deprotected N-oxyamide-linked novel glycolipids can be easily generated from the glycoaminooxy ester or from the 2-hydroxy free sugar in 5 or 6 steps. PMID:26646087

  7. Synthesis and properties of N-hexadecyl ethylenediamine triacetic acid.


    Wang, Xixin; Zhao, Jianling; Yao, Xingzhi; Chen, Wentao


    A new kind of surfactant named N-hexadecyl ethylenediamine triacetic acid (HED3A) was synthesized from anhydrous ethylenediamine, 1-bromohexadecane, and chloroacetic acid. Testing showed stability of HED3A in hard water, wetting power, dispersing power, and surface tension increased along with pH value. Stability in hard water of trisodium N-hexadecyl ethylenediamine triacetate (3NaHED3A) was at level 4, which was better than that of sodium dodecylsulfate (SDS) and sodium dodecylbenzene sulfonate (LAS). Other properties of 3NaHED3A including wetting power, dispersing power, emulsifying power, and surface tension had intermediate value between SDS, LAS, AES, peregal-O, and cetyltrimethylammonium chloride (CTAC). The ethylenediamine triacetic acid (ED3A) group in 3NaHED3A can chelate many kinds of metal ions, which indicates a promising application prospect in many fields including metal anticorrosion, corrosion control agent, additives in electroplating solution, and ore selection and solid surface treatment. PMID:15464823

  8. Synthesis and bioactivity of 2',3'-benzoabscisic acid analogs.


    Han, Xiaoqiang; Wan, Chuan; Li, Xiuyun; Li, Hong; Yang, Dongyan; Du, Shijie; Xiao, Yumei; Qin, Zhaohai


    2',3'-Benzoabscisic acid 4a is significantly more active than (±)-ABA and can be potentially used as a plant growth regulator for agriculture. In this study, six 4a analogs were designed and synthesized. Bioassay showed that 4a displayed greater activity than (±)-ABA and the six analogs produced less inhibition than 4a itself. Specially, some analogs displayed markedly different activities to different physiological and biochemical process, which were largely different from ABA and 4a. Compared to (±)-ABA, 4b and 4c were more effective germination inhibitors for lettuce, but less effective inhibitors for rice elongation. Five-membered analog 5 was higher or slightly weaker in inhibiting Arabidopsis seed germination and rice elongation, respectively, but at least 10 times less effective than (±)-ABA in lettuce seed germination. Dual acid 6 and alkyne acid 20 nearly produced no inhibitory activity for Arabidopsis seed germination, but displayed excellent activity in inhibiting rice seedling growth. The preference of the analogs to different physiology process indicated that they might provide a strategy to develop novel ABA agonists or antagonist and be used as probe to investigate the function of different ABA receptors. PMID:25913114

  9. Intervention of selenium on apoptosis and Fas/FasL expressions in the liver of fluoride-exposed rats.


    Miao, Keke; Zhang, Lei; Yang, Shuying; Qian, Wei; Zhang, Zigui


    Fluorosis is a major public health problem in numerous areas around the world, including China. To alleviate this problem, selenium has been used. In this study, we aimed to investigate the influence of selenium on apoptosis in fluorosis-affected rat livers and determine the optimal selenium concentration in drinking water to fight fluorosis. The protein levels of Fas in NaF and NaF+Se (0.375 and 0.75 mg/L) groups as well as FasL in NaF, Se (0.75 and 1.5 mg/L), and NaF+Se (0.375 mg/L) groups were significantly increased compared with those in the control group. The mRNA levels of Fas in NaF and Se (1.5 mg/L) groups as well as FasL in NaF and NaF+Se (0.375 mg/L) groups were significantly increased. The protein levels of Fas in NaF+Se (1.5 mg/L) group and FasL in three NaF+Se groups were significantly decreased compared with those in the NaF group. The mRNA levels of Fas in the three NaF+Se groups and FasL in NaF+Se (0.75 and 1.5 mg/L) groups were significantly decreased. Compared with the control group, activity of GSH-Px, and SOD in the NaF group decreased obviously and MDA content increased obviously; activity of SOD in 1.5 mg/L Se group decreased obviously. Compared with the NaF group, activity of GSH-Px in NaF+Se (1.5 mg/L) group significantly increased, and MDA content decreased obviously. Thus, fluoride induced apoptosis in the liver, thereby causing liver damage in the rats. Selenium could alleviate fluorosis-induced liver injury. In particular, selenium at 1.5 mg/L is considered the optimum concentration against fluorosis. PMID:24008008

  10. Akt phosphorylation and regulation of transketolase is a nodal point for amino acid control of purine synthesis.


    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T; Phan, Tony; Pilz, Renate B; Boss, Gerry R


    The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mammalian target of rapamycin 2 and IκB kinase regulate Akt activity and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the nonoxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the nonoxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for 2 days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  11. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto


    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  12. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.


    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  13. Plasma content of soluble fas antigen in patients with adrenal tumors and tumor-like pathologies.


    Kushlinskii, N E; Britvin, T A; Polyakova, G A; Abbasova, S G; Baronini, A A; Tishenina, R S; Molchanova, G S; Sel'chuk, V Yu; Pirogov, D A; Bogatyrev, O P; Lipkin, V M; Kalinin, A P


    We compared plasma content of soluble Fas antigen (sFas) in 59 patients with tumors and tumor-like pathologies of the adrenal cortex and medulla and 60 healthy donors (control). The incidence and content of sFas in the plasma from patients with adrenal tumors was significantly higher than in healthy donors. A direct correlation was found between sFas content and patient's age. The maximum sFas concentrations were found in patients with pheochromocytoma and aldosterone-producing adenoma. In patients with adrenocortical cancer plasma content of sFas was lower than in patients with tumors of other morphological types. Plasma sFas content in patients with adrenocortical cancer directly correlated with the size of tumors. Our results suggest that sFas plays a role in the pathogenesis of primary adrenal tumors. PMID:12459844

  14. Characterization of Calmodulin–Fas Death Domain Interaction: An Integrated Experimental and Computational Study

    PubMed Central


    The Fas death receptor-activated death-inducing signaling complex (DISC) regulates apoptosis in many normal and cancer cells. Qualitative biochemical experiments demonstrate that calmodulin (CaM) binds to the death domain of Fas. The interaction between CaM and Fas regulates Fas-mediated DISC formation. A quantitative understanding of the interaction between CaM and Fas is important for the optimal design of antagonists for CaM or Fas to regulate the CaM–Fas interaction, thus modulating Fas-mediated DISC formation and apoptosis. The V254N mutation of the Fas death domain (Fas DD) is analogous to an identified mutant allele of Fas in lpr-cg mice that have a deficiency in Fas-mediated apoptosis. In this study, the interactions of CaM with the Fas DD wild type (Fas DD WT) and with the Fas DD V254N mutant were characterized using isothermal titration calorimetry (ITC), circular dichroism spectroscopy (CD), and molecular dynamics (MD) simulations. ITC results reveal an endothermic binding characteristic and an entropy-driven interaction of CaM with Fas DD WT or with Fas DD V254N. The Fas DD V254N mutation decreased the association constant (Ka) for CaM–Fas DD binding from (1.79 ± 0.20) × 106 to (0.88 ± 0.14) × 106 M–1 and slightly increased a standard state Gibbs free energy (ΔG°) for CaM–Fas DD binding from −8.87 ± 0.07 to −8.43 ± 0.10 kcal/mol. CD secondary structure analysis and MD simulation results did not show significant secondary structural changes of the Fas DD caused by the V254N mutation. The conformational and dynamical motion analyses, the analyses of hydrogen bond formation within the CaM binding region, the contact numbers of each residue, and the electrostatic potential for the CaM binding region based on MD simulations demonstrated changes caused by the Fas DD V254N mutation. These changes caused by the Fas DD V254N mutation could affect the van der Waals interactions and electrostatic interactions between CaM and Fas DD, thereby

  15. Acid gradient across plasma membrane can drive phosphate bond synthesis in cancer cells: acidic tumor milieu as a potential energy source.


    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam


    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

  16. Ceramide mediates FasL-induced caspase 8 activation in colon carcinoma cells to enhance FasL-induced cytotoxicity by tumor-specific cytotoxic T lymphocytes

    PubMed Central

    Coe, Genevieve L.; Redd, Priscilla S.; Paschall, Amy V.; Lu, Chunwan; Gu, Lilly; Cai, Houjian; Albers, Thomas; Lebedyeva, Iryna O.; Liu, Kebin


    FasL-mediated cytotoxicity is one of the mechanisms that CTLs use to kill tumor cells. However, human colon carcinoma often deregulates the Fas signaling pathway to evade host cancer immune surveillance. We aimed at testing the hypothesis that novel ceramide analogs effectively modulate Fas function to sensitize colon carcinoma cells to FasL-induced apoptosis. We used rational design and synthesized twenty ceramide analogs as Fas function modulators. Five ceramide analogs, IG4, IG7, IG14, IG17, and IG19, exhibit low toxicity and potent activity in sensitization of human colon carcinoma cells to FasL-induced apoptosis. Functional deficiency of Fas limits both FasL and ceramide analogs in the induction of apoptosis. Ceramide enhances FasL-induced activation of the MAPK, NF-κB, and caspase 8 despite induction of potent tumor cell death. Finally, a sublethal dose of several ceramide analogs significantly increased CTL-mediated and FasL-induced apoptosis of colon carcinoma cells. We have therefore developed five novel ceramide analogs that act at a sublethal dose to enhance the efficacy of tumor-specific CTLs, and these ceramide analogs hold great promise for further development as adjunct agents in CTL-based colon cancer immunotherapy. PMID:27487939

  17. Ceramide mediates FasL-induced caspase 8 activation in colon carcinoma cells to enhance FasL-induced cytotoxicity by tumor-specific cytotoxic T lymphocytes.


    Coe, Genevieve L; Redd, Priscilla S; Paschall, Amy V; Lu, Chunwan; Gu, Lilly; Cai, Houjian; Albers, Thomas; Lebedyeva, Iryna O; Liu, Kebin


    FasL-mediated cytotoxicity is one of the mechanisms that CTLs use to kill tumor cells. However, human colon carcinoma often deregulates the Fas signaling pathway to evade host cancer immune surveillance. We aimed at testing the hypothesis that novel ceramide analogs effectively modulate Fas function to sensitize colon carcinoma cells to FasL-induced apoptosis. We used rational design and synthesized twenty ceramide analogs as Fas function modulators. Five ceramide analogs, IG4, IG7, IG14, IG17, and IG19, exhibit low toxicity and potent activity in sensitization of human colon carcinoma cells to FasL-induced apoptosis. Functional deficiency of Fas limits both FasL and ceramide analogs in the induction of apoptosis. Ceramide enhances FasL-induced activation of the MAPK, NF-κB, and caspase 8 despite induction of potent tumor cell death. Finally, a sublethal dose of several ceramide analogs significantly increased CTL-mediated and FasL-induced apoptosis of colon carcinoma cells. We have therefore developed five novel ceramide analogs that act at a sublethal dose to enhance the efficacy of tumor-specific CTLs, and these ceramide analogs hold great promise for further development as adjunct agents in CTL-based colon cancer immunotherapy. PMID:27487939

  18. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.


    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M


    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  19. Study on Synthesis, Characterization and Antiproliferative Activity of Novel Diisopropylphenyl Esters of Selected Fatty Acids.


    Reddy, Yasa Sathyam; Kaki, Shiva Shanker; Rao, Bala Bhaskara; Jain, Nishant; Vijayalakshmi, Penumarthy


    The present study describes the synthesis, characterization and evaluation of antiproliferative activity of novel diisopropylphenyl esters of alpha-linolenic acid (ALA), valproic acid (VA), butyric acid (BA) and 2-ethylhexanoic acid (2-EHA). These esters were chemically synthesized by the esterification of fatty acids with 2,6-diisopropylphenol and 2,4-diisopropylphenol (propofol). The structure of new conjugates viz. propofol-(alpha-linolenic acid) (2,6P-ALA and 2,4P-ALA), propofol-valproic acid (2,6P-VA and 2,4P-VA), propofol-butyric acid (2,6P-BA and 2,4P-BA) and propofol-(2-ethylhexanoic acid) (2,6P2-EHA and 2,4P-2-EHA) were characterized by FT-IR, NMR ((1)H, (13)C) and mass spectral data. The synthesized conjugates having more lipophilic character were tested for antiproliferative in vitro studies on A549, MDA-MB-231, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. All the conjugates showed specific growth inhibition on studied cancer cell lines. Among the synthesized esters, the conjugates synthesized from BA, VA and 2-EHA exhibited prominent growth inhibition against A549, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. The preliminary results suggest that the entire novel conjugates possess antiproliferative properties that reduce the proliferation of cancer cells in vitro. PMID:26666272

  20. Overexpression of malate dehydrogenase in transgenic alfalfa enhances organic acid synthesis and confers tolerance to aluminum.


    Tesfaye, M; Temple, S J; Allan, D L; Vance, C P; Samac, D A


    Al toxicity is a severe impediment to production of many crops in acid soil. Toxicity can be reduced through lime application to raise soil pH, however this amendment does not remedy subsoil acidity, and liming may not always be practical or cost-effective. Addition of organic acids to plant nutrient solutions alleviates phytotoxic Al effects, presumably by chelating Al and rendering it less toxic. In an effort to increase organic acid secretion and thereby enhance Al tolerance in alfalfa (Medicago sativa), we produced transgenic plants using nodule-enhanced forms of malate dehydrogenase and phosphoenolpyruvate carboxylase cDNAs under the control of the constitutive cauliflower mosaic virus 35S promoter. We report that a 1.6-fold increase in malate dehydrogenase enzyme specific activity in root tips of selected transgenic alfalfa led to a 4.2-fold increase in root concentration as well as a 7.1-fold increase in root exudation of citrate, oxalate, malate, succinate, and acetate compared with untransformed control alfalfa plants. Overexpression of phosphoenolpyruvate carboxylase enzyme specific activity in transgenic alfalfa did not result in increased root exudation of organic acids. The degree of Al tolerance by transformed plants in hydroponic solutions and in naturally acid soil corresponded with their patterns of organic acid exudation and supports the concept that enhancing organic acid synthesis in plants may be an effective strategy to cope with soil acidity and Al toxicity. PMID:11743127

  1. Effects of Long Chain Fatty Acid Synthesis and Associated Gene Expression in Microalga Tetraselmis sp

    PubMed Central

    Adarme-Vega, T. Catalina; Thomas-Hall, Skye R.; Lim, David K. Y.; Schenk, Peer M.


    With the depletion of global fish stocks, caused by high demand and effective fishing techniques, alternative sources for long chain omega-3 fatty acids are required for human nutrition and aquaculture feeds. Recent research has focused on land-based cultivation of microalgae, the primary producers of omega-3 fatty acids in the marine food web. The effect of salinity on fatty acids and related gene expression was studied in the model marine microalga, Tetraselmis sp. M8. Correlations were found for specific fatty acid biosynthesis and gene expression according to salinity and the growth phase. Low salinity was found to increase the conversion of C18:4 stearidonic acid (SDA) to C20:4 eicosatetraenoic acid (ETA), correlating with increased transcript abundance of the Δ-6-elongase-encoding gene in salinities of 5 and 10 ppt compared to higher salinity levels. The expression of the gene encoding β-ketoacyl-coenzyme was also found to increase at lower salinities during the nutrient deprivation phase (Day 4), but decreased with further nutrient stress. Nutrient deprivation also triggered fatty acids synthesis at all salinities, and C20:5 eicosapentaenoic acid (EPA) increased relative to total fatty acids, with nutrient starvation achieving a maximum of 7% EPA at Day 6 at a salinity of 40 ppt. PMID:24901700

  2. Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis.


    Kerr, Thomas A; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W; Schwarz, Margrit


    The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  3. Electrodialysis synthesis of concentrated solutions of perrhenic acid

    NASA Astrophysics Data System (ADS)

    Palant, A. A.; Bryukvin, V. A.; Levin, A. M.; Reshetova, O. V.


    The presented results demonstrate the possibility of electrodialysis production of concentrated solutions of perrhenic acid (HReO4 concentration >400 g/l). KReO4 is used as a precursor. The investigations are performed in a three-chamber electrodialysis cell in a continuous mode. The optimal processing parameters are as follows: the current is 3-5 A, the voltage is 30-40 V, and the anode chamber temperature is 20-25°C. Grade AR-0 ammonium perrhenate is precipitated from the obtained HReO4 solution.

  4. Synthesis, preliminary bioevaluation and computational analysis of caffeic acid analogues.


    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong


    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  5. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong


    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  6. Concise synthesis of ether analogues of lysobisphosphatidic acid.


    Jiang, Guowei; Xu, Yong; Falguières, Thomas; Gruenberg, Jean; Prestwich, Glenn D


    We describe a versatile, efficient method for the preparation of ether analogues of (S,S)-lysobisphosphatidic acid (LBPA) and its enantiomer from (S)-solketal. Phosphorylation of a protected sn-2-O-octadecenyl glyceryl ether with 2-cyanoethyl bis-N,N-diisopropylamino phosphine and subsequent deprotection generated the bisether LBPA analogues. By simply changing the sequence of deprotection steps, we obtained the (R,R)- and (S,S)-enantiomers of 2,2'-bisether LBPA. An ELISA assay with anti-LBPA monoclonal antibodies showed that the bisether LBPAs were recognized with the same affinity as the natural 2,2'-bisoleolyl LBPA. [reaction: see text] PMID:16119911

  7. Continuous-flow reactor-based synthesis of carbohydrate and dihydrolipoic acid-capped quantum dots.


    Laurino, Paola; Kikkeri, Raghavendra; Seeberger, Peter H


    A detailed protocol for the large-scale synthesis of carbohydrate and dihydrolipoic acid (DHLA)-coated CdSe/ZnS and CdTe/ZnS nanoparticles using continuous flow reactors is described here. Three continuous flow microreaction systems, operating at three different temperatures, are used for the synthesis of mannose-, galactose- or DHLA-functionalized quantum dots (QDs). In the first step of synthesis, the CdSe and CdTe nanoparticles are prepared. The size and spectral properties of the CdSe core of the nanoparticles are controlled by adjustment of the residence time and the temperature. As a second step, the zinc sulfide capping under homogenous conditions is carried out at a substantially lower temperature than is required for nanoparticle growth in batch processes. Finally, the trioctylphosphine/oleic acid ligand is effectively replaced with either carbohydrate PEG-thiol moieties or DHLA at 60 °C. This new protocol allows the synthesis of biologically active fluorescent QDs in 4 d. PMID:21799489

  8. Synthesis and Evaluation of Aryl Boronic Acids as Fluorescent Artificial Receptors for Biological Carbohydrates

    PubMed Central

    Craig, Sandra


    Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855

  9. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.


    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  10. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.


    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos


    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  11. The Effects of Borate Minerals on the Synthesis of Nucleic Acid Bases, Amino Acids and Biogenic Carboxylic Acids from Formamide

    NASA Astrophysics Data System (ADS)

    Saladino, Raffaele; Barontini, Maurizio; Cossetti, Cristina; di Mauro, Ernesto; Crestini, Claudia


    The thermal condensation of formamide in the presence of mineral borates is reported. The products afforded are precursors of nucleic acids, amino acids derivatives and carboxylic acids. The efficiency and the selectivity of the reaction was studied in relation to the elemental composition of the 18 minerals analyzed. The possibility of synthesizing at the same time building blocks of both genetic and metabolic apparatuses, along with the production of amino acids, highlights the interest of the formamide/borate system in prebiotic chemistry.

  12. Stimulation of skeletal muscle protein synthesis in neonatal pigs by long-term infusion of leucine is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...

  13. Acetyl xylan esterase of Aspergillus ficcum catalyzed the synthesis of peracetic acid from ethyl acetate and hydrogen peroxide.


    Park, Seung-Moon


    Recombinant acetyl xylan esterase (rAXE) of Aspergillus ficcum catalyzed the synthesis of peracetic acid (PAA) from ethyl acetate and hydrogen peroxide. Ten micrograms of rAXE catalyzed the synthesis of 1.34 mM of PAA, which can be used for the pretreatment of cellulosic biomass in situ. PMID:21824816

  14. Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and ...

  15. Efficient Synthesis of 3,3'-Mixed Bisindoles via Lewis Acid Catalyzed Reaction of Spiro-epoxyoxindoles and Indoles.


    Hajra, Saumen; Maity, Subrata; Maity, Ramkrishna


    An efficient strategy for the synthesis of 3-(3-indolyl)-oxindole-3-methanol has been developed to achieve a Lewis acid catalyzed, highly regioselective ring opening of spiro-epoxyoxindoles with indoles. The method is used for the gram-scale formal total synthesis of (±)-gliocladin C. PMID:26158390


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Skeletal muscle grows at a very rapid rate in the neonatal pig, due in part to an enhanced sensitivity of protein synthesis to the postprandial rise in amino acids. An increase in leucine alone stimulates protein synthesis in skeletal muscle of the neonatal pig; however, the effect of isoleucine and...

  17. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease.


    Lake, April D; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D; Lu, Zhenqiang; Lehman-McKeeman, Lois D; Cherrington, Nathan J


    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the 'classical' (neutral) and 'alternative' (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. PMID:23391614

  18. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  19. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.


    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  20. CML10, a variant of calmodulin, modulates ascorbic acid synthesis.


    Cho, Kwang-Moon; Nguyen, Ha Thi Kim; Kim, Soo Youn; Shin, Jin Seok; Cho, Dong Hwa; Hong, Seung Beom; Shin, Jeong Sheop; Ok, Sung Han


    Calmodulins (CaMs) regulate numerous Ca(2+) -mediated cellular processes in plants by interacting with their respective downstream effectors. Due to the limited number of CaMs, other calcium sensors modulate the regulation of Ca(2+) -mediated cellular processes that are not managed by CaMs. Of 50 CaM-like (CML) proteins identified in Arabidopsis thaliana, we characterized the function of CML10. Yeast two-hybrid screening revealed phosphomannomutase (PMM) as a putative interaction partner of CML10. In vitro and in vivo interaction assays were performed to analyze the interaction mechanisms of CML10 and PMM. PMM activity and the phenotypes of cml10 knock-down mutants were studied to elucidate the role(s) of the CML10-PMM interaction. PMM interacted specifically with CML10 in the presence of Ca(2+) through its multiple interaction motifs. This interaction promoted the activity of PMM. The phenotypes of cml10 knock-down mutants were more sensitive to stress conditions than wild-type plants, corresponding with the fact that PMM is an enzyme which modulates the biosynthesis of ascorbic acid, an antioxidant. The results of this research demonstrate that a calcium sensor, CML10, which is an evolutionary variant of CaM, modulates the stress responses in Arabidopsis by regulating ascorbic acid production. PMID:26315131

  1. Dietary omega-3 and -6 polyunsaturated fatty acids affect the composition and development of sheep granulosa cells, oocytes and embryos.


    Wonnacott, K E; Kwong, W Y; Hughes, J; Salter, A M; Lea, R G; Garnsworthy, P C; Sinclair, K D


    The evidence that omega-3 (n-3) and -6 (n-6) polyunsaturated fatty acids (PUFAs) have differential effects on ovarian function, oocytes and embryo quality is inconsistent. We report on the effects of n-3 versus n-6 PUFA-enriched diets fed to 36 ewes over a 6-week period, prior to ovarian stimulation and follicular aspiration, on ovarian steroidogenic parameters and embryo quality. Follicle number and size were unaltered by diet, but follicular-fluid progesterone concentrations were greater in n-3 PUFA-fed ewes than in n-6 PUFA-fed ewes. The percentage of saturated FAs (mostly stearic acid) was greater in oocytes than in either granulosa cells or plasma, indicating selective uptake and/or de novo synthesis of saturated FAs at the expense of PUFAs by oocytes. High-density lipoproteins (HDLs) fractionated from sera of these ewes increased granulosa cell proliferation and steroidogenesis relative to the FA-free BSA control during culture, but there was no differential effect of n-3 and n-6 PUFAs on either oestradiol or progesterone production. HDL was ineffective in delivering FAs to embryos during culture, although n-6 PUFA HDL reduced embryo development. All blastocysts, irrespective of the treatment, contained high levels of unsaturated FAs, in particular linoleic acid. Transcripts for HDL and low-density lipoprotein (LDL) receptors (SCARB1 and LDLR) and stearoyl-CoA desaturase (SCD) are reported in sheep embryos. HDL reduced the expression of transcripts for LDLR and SCD relative to the BSA control. The data support a differential effect of n-3 and n-6 PUFAs on ovarian steroidogenesis and pre-implantation development, the latter in the absence of a net uptake of FAs. PMID:19789173

  2. [Synthesis and properties of nuclear hydroxylated derivatives of flufenamic acid and etofenamate (author's transl)].


    Boltze, K H; Bäcker, U; Kreisfeld, H


    Synthesis of six nuclear hydroxylated derivatives of flufenamic acid and etofenamate (5-OH-, 4'-OH and 5,4'-(OH2) on a preparative scale is described. All compounds show low toxicity, but only weak anti-inflammatory activity in the rat paw kaolin edema test as compared to 2-(2-hydroxyethoxy)ethyl-N-(a,a,a-trifluoro-m-tolyl)-anthranilate (etofenamate, active substance of Rheumon Gel). PMID:7200776

  3. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina


    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  4. Synthesis of milk specific fatty acids and proteins by dispersed goat mammary-gland epithelial cells.

    PubMed Central

    Hansen, H O; Tornehave, D; Knudsen, J


    The method now described for preparation of dispersed lactating goat mammary-gland cells gives a high yield of morphologically and functionally normal mammary cells. The cells synthesize specific goat milk fatty acids in the right proportions, and they respond to hormones by increased protein synthesis. The cells can be frozen and thawed without losing the above properties, which makes them an excellent tool for metabolic and hormonal studies. Images Fig. 1. Fig. 2. PMID:3800930

  5. Synthesis of 15-(p-iodophenyl)-6-tellurapentadecanoic acid: a new myocardial imaging agent

    SciTech Connect

    Goodman, M.M.; Knapp, F.F. Jr.


    1-Cl-9-(p-iodophenyl)nonane was coupled with sodium (methylvaleryl) telluride to produce methyl-15-(p-iodophenyl)-6-tellurapentadecanoate in 90% yield. Hydrolysis produced the title compound. /sup 1/HNMR and chromatographic analysis substantiated the structure. This method can be used in the synthesis of other fatty acid analogues. The compound has been prepared with iodine 125 and 131 labels. These agents showed prolonged myocardial retention in rats with little in vivo deiodination.

  6. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert


    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  7. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity.


    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna; Dallavalle, Sabrina


    The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  8. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone


    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  9. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity

    PubMed Central

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna


    Summary The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  10. Synthesis and sintering of nanocrystalline hydroxyapatite powders by citric acid sol-gel combustion method

    SciTech Connect

    Han Yingchao; Li Shipu; Wang Xinyu; Chen Xiaoming


    The citric acid sol-gel combustion method has been used for the synthesis of nanocrystalline hydroxyapatite (HAP) powder from calcium nitrate, diammonium hydrogen phosphate and citric acid. The phase composition of HAP powder was characterized by X-ray powder diffraction analysis (XRD). The morphology of HAP powder was observed by transmission electron microscope (TEM). The HAP powder has been sintered into microporous ceramic in air at 1200 deg. C with 3 h soaking time. The microstructure and phase composition of the resulting HAP ceramic were characterized by scanning electron microscope (SEM) and XRD, respectively. The physical characterization of open porosity and flexural strength have also been carried out.

  11. Increased fatty acid synthesis inhibits nitrogen starvation-induced autophagy in lipid droplet-deficient yeast.


    Régnacq, Matthieu; Voisin, Pierre; Sere, Yves Y; Wan, Bin; Soeroso, Venty M S; Bernard, Marianne; Camougrand, Nadine; Bernard, François-Xavier; Barrault, Christine; Bergès, Thierry


    Macroautophagy is a degradative pathway whereby cells encapsulate and degrade cytoplasmic material within endogenously-built membranes. Previous studies have suggested that autophagosome membranes originate from lipid droplets. However, it was recently shown that rapamycin could induce autophagy in cells lacking these organelles. Here we show that lipid droplet-deprived cells are unable to perform autophagy in response to nitrogen-starvation because of an accelerated lipid synthesis that is not observed with rapamycin. Using cerulenin, a potent inhibitor of fatty acid synthase, and exogenous addition of palmitic acid we could restore nitrogen-starvation induced autophagy in the absence of lipid droplets. PMID:27270031

  12. Synthesis, characterization, and crystal structure of 2-iodo-3,4,5-trimethoxybenzoic acid

    NASA Astrophysics Data System (ADS)

    Kolev, Iliyan N.; Petrova, Svetlana P.; Nikolova, Rositsa P.; Dimowa, Louiza T.; Shivachev, Boris L.


    This work describes the synthesis of 2-iodo-3,4,5-trimethoxybenzoic acid. The combination of iodine and silver trifluoroacetate (AgTFA) reagents was used successfully for the iodination of 3,4,5-trimetoxybenzoic acid. To improve the efficiency of the synthetic process a significant modification on the experimental design was also performed. The main structural features of the obtained aryl iodide were investigated by a single crystal X-ray diffraction analysis, FTIR, 1H and 13C NMR spectroscopy.

  13. Integrated process of distillation with side reactors for synthesis of organic acid esters

    SciTech Connect

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T


    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  14. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario


    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  15. Synthesis and use of deuterated palmitic acids to decipher the cryptoregiochemistry of a Delta13 desaturation.


    Abad, José-Luis; Serra, Montserrat; Camps, Francisco; Fabriàs, Gemma


    The synthesis of two hexadeuterated palmitic acids differing in the position of the diagnostic labels, and their use to decipher the cryptoregiochemistry of a Delta13 desaturation are described. A dithiane and a triple bond functionalities were used to introduce the diagnostic (C13 or C14) and tagging (C8 and C9) labels, respectively, in the palmitic acid skeleton. Using these probes, the cryptoregiochemistry of the Delta13 desaturation involved in the biosynthesis of Thaumetopoea pityocampa sex pheromone was studied by means of kinetic isotope effect determinations. Transformation of both (Z)-11-hexadecenoic and 11-hexadecynoic acids into (Z, Z)-11,13-hexadecadienoic and (Z)-13-hexadecen-11-ynoic acids, respectively, is initiated by abstraction of the hydrogen atom at the C13 position, followed by the fast elimination of the C14 hydrogen to give the double bond. PMID:17253792

  16. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.


    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij


    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively). PMID:27017352

  17. Uncouplers of Oxidative Phosphorylation Can Enhance a Fas Death Signal

    PubMed Central

    Linsinger, Georg; Wilhelm, Sabine; Wagner, Hermann; Häcker, Georg


    Recent work suggests a participation of mitochondria in apoptotic cell death. This role includes the release of apoptogenic molecules into the cytosol preceding or after a loss of mitochondrial membrane potential ΔΨm. The two uncouplers of oxidative phosphorylation carbonyl cyanide m-chlorophenylhydrazone (CCCP) and 2,4-dinitrophenol (DNP) reduce ΔΨm by direct attack of the proton gradient across the inner mitochondrial membrane. Here we show that both compounds enhance the apoptosis-inducing capacity of Fas/APO-1/CD95 signaling in Jurkat and CEM cells without causing apoptotic changes on their own account. This amplification occurred upstream or at the level of caspases and was not inhibited by Bcl-2. The effect could be blocked by the cowpox protein CrmA and is thus likely to require caspase 8 activity. Apoptosis induction by staurosporine in Jurkat cells as well as by Fas in SKW6 cells was unaffected by CCCP and DNP. The role of cytochrome c during Fas-DNP signaling was investigated. No early cytochrome c release from mitochondria was detected by Western blotting. Functional assays with cytoplasmic preparations from Fas-DNP-treated cells also indicated that there was no major contribution by cytochrome c or caspase 9 to the activation of effector caspases. Furthermore, an increase of rhodamine-123 uptake into intact cells, which has been explained by mitochondrial swelling, occurred considerably later than the caspase activation and was blocked by Z-VAD-fmk. These data show that uncouplers of oxidative phosphorylation can presensitize some but not all cells for a Fas death signal and provide information about the existence of separate pathways in the induction of apoptosis. PMID:10207055

  18. Uncouplers of oxidative phosphorylation can enhance a Fas death signal.


    Linsinger, G; Wilhelm, S; Wagner, H; Häcker, G


    Recent work suggests a participation of mitochondria in apoptotic cell death. This role includes the release of apoptogenic molecules into the cytosol preceding or after a loss of mitochondrial membrane potential DeltaPsim. The two uncouplers of oxidative phosphorylation carbonyl cyanide m-chlorophenylhydrazone (CCCP) and 2, 4-dinitrophenol (DNP) reduce DeltaPsim by direct attack of the proton gradient across the inner mitochondrial membrane. Here we show that both compounds enhance the apoptosis-inducing capacity of Fas/APO-1/CD95 signaling in Jurkat and CEM cells without causing apoptotic changes on their own account. This amplification occurred upstream or at the level of caspases and was not inhibited by Bcl-2. The effect could be blocked by the cowpox protein CrmA and is thus likely to require caspase 8 activity. Apoptosis induction by staurosporine in Jurkat cells as well as by Fas in SKW6 cells was unaffected by CCCP and DNP. The role of cytochrome c during Fas-DNP signaling was investigated. No early cytochrome c release from mitochondria was detected by Western blotting. Functional assays with cytoplasmic preparations from Fas-DNP-treated cells also indicated that there was no major contribution by cytochrome c or caspase 9 to the activation of effector caspases. Furthermore, an increase of rhodamine-123 uptake into intact cells, which has been explained by mitochondrial swelling, occurred considerably later than the caspase activation and was blocked by Z-VAD-fmk. These data show that uncouplers of oxidative phosphorylation can presensitize some but not all cells for a Fas death signal and provide information about the existence of separate pathways in the induction of apoptosis. PMID:10207055

  19. Ontogenesis and cell specific localization of Fas ligand expression in the rat testis.


    D'Abrizio, Piera; Baldini, Enke; Russo, Paola F; Biordi, Leda; Graziano, Filomena M; Rucci, Nadia; Properzi, Giuliana; Francavilla, Sandro; Ulisse, Salvatore


    Over the past few years, a number of experimental evidences suggested the involvement of Fas Ligand (FasL) expressing Sertoli cells to induce apoptosis of Fas bearing germ cells. However, the FasL expression during testicular development and its cell specific localization within the testis is still a matter of debate. In the present study, we have monitored FasL expression during rat testis development by semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR) and evaluated cell specific localization of FasL expression, by in situ RT-PCR and immunohistochemistry, on adult rat testis. RT-PCR analysis, performed on total RNA from rat testes obtained from 1 day up to 1-year-old animals, demonstrated the presence of FasL transcripts at all developmental stages examined. In situ RT-PCR analysis clearly indicated the presence of FasL mRNA in Sertoli cells of adult testis, while we could never detect FasL transcripts in germ cells. Immunohistochemistry experiments showed a strong immunostaining for FasL in Sertoli cells of adult testis and again, no immunopositivity was observed in germ cells. In conclusion, our data suggest that FasL expression in rat testis is present from the early postnatal days up to the adult, and the Sertoli cells is the main FasL expressing cell within the seminiferous tubule. PMID:15379972

  20. 48 CFR 47.303-8 - F.a.s. vessel, port of shipment.

    Code of Federal Regulations, 2010 CFR


    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false F.a.s. vessel, port of... CONTRACT MANAGEMENT TRANSPORTATION Transportation in Supply Contracts 47.303-8 F.a.s. vessel, port of shipment. (a) Explanation of delivery term. F.a.s. vessel, port of shipment means free of expense to...

  1. 48 CFR 52.247-36 - F.a.s. Vessel, Port of Shipment.

    Code of Federal Regulations, 2014 CFR


    ... Shipment. 52.247-36 Section 52.247-36 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION....247-36 F.a.s. Vessel, Port of Shipment. As prescribed in 47.303-8(c), insert the following clause in solicitations and contracts when the delivery term is f.a.s. vessel, port of shipment: F.a.s. Vessel, Port...

  2. Insulin-independent regulation of hepatic triglyceride synthesis by fatty acids

    PubMed Central

    Vatner, Daniel F.; Majumdar, Sachin K.; Kumashiro, Naoki; Petersen, Max C.; Rahimi, Yasmeen; Gattu, Arijeet K.; Bears, Mitchell; Camporez, João-Paulo G.; Cline, Gary W.; Jurczak, Michael J.; Samuel, Varman T.; Shulman, Gerald I.


    A central paradox in type 2 diabetes is the apparent selective nature of hepatic insulin resistance—wherein insulin fails to suppress hepatic glucose production yet continues to stimulate lipogenesis, resulting in hyperglycemia, hyperlipidemia, and hepatic steatosis. Although efforts to explain this have focused on finding a branch point in insulin signaling where hepatic glucose and lipid metabolism diverge, we hypothesized that hepatic triglyceride synthesis could be driven by substrate, independent of changes in hepatic insulin signaling. We tested this hypothesis in rats by infusing [U-13C] palmitate to measure rates of fatty acid esterification into hepatic triglyceride while varying plasma fatty acid and insulin concentrations independently. These experiments were performed in normal rats, high fat-fed insulin-resistant rats, and insulin receptor 2′-O-methoxyethyl chimeric antisense oligonucleotide-treated rats. Rates of fatty acid esterification into hepatic triglyceride were found to be dependent on plasma fatty acid infusion rates, independent of changes in plasma insulin concentrations and independent of hepatocellular insulin signaling. Taken together, these results obviate a paradox of selective insulin resistance, because the major source of hepatic lipid synthesis, esterification of preformed fatty acids, is primarily dependent on substrate delivery and largely independent of hepatic insulin action. PMID:25564660

  3. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.


    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  4. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin


    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  5. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters


    Moens, L.


    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  6. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters


    Moens, Luc


    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  7. The effect of pantothenic acid deficiency on keratinocyte proliferation and the synthesis of keratinocyte growth factor and collagen in fibroblasts.


    Kobayashi, Daisaku; Kusama, Miho; Onda, Masaaki; Nakahata, Norimichi


    It has been reported that pantothenic acid (vitamin B5) and panthenol, an alcohol derivative of pantothenic acid, have beneficial moisturizing effects on the skin. However, few studies have investigated the mechanism of action of pantothenic acid on skin tissues. We tried to clarify the role of pantothenic acid on skin function by using keratinocytes and fibroblasts. The depletion of pantothenic acid from the culture medium suppressed keratinocyte proliferation and promoted differentiation. Moreover, pantothenic acid depletion decreased the synthesis of keratinocyte growth factor and procollagen 4a2 in fibroblasts. These results suggest that pantothenic acid is essential for maintaining keratinocyte proliferation and differentiation. PMID:21258175

  8. Angiopoietin-Like 4 Mediates PPAR Delta Effect on Lipoprotein Lipase-Dependent Fatty Acid Uptake but Not on Beta-Oxidation in Myotubes

    PubMed Central

    Robciuc, Marius R.; Skrobuk, Paulina; Anisimov, Andrey; Olkkonen, Vesa M.; Alitalo, Kari; Eckel, Robert H.; Koistinen, Heikki A.; Jauhiainen, Matti; Ehnholm, Christian


    Peroxisome proliferator-activated receptor (PPAR) delta is an important regulator of fatty acid (FA) metabolism. Angiopoietin-like 4 (Angptl4), a multifunctional protein, is one of the major targets of PPAR delta in skeletal muscle cells. Here we investigated the regulation of Angptl4 and its role in mediating PPAR delta functions using human, rat and mouse myotubes. Expression of Angptl4 was upregulated during myotubes differentiation and by oleic acid, insulin and PPAR delta agonist GW501516. Treatment with GW501516 or Angptl4 overexpression inhibited both lipoprotein lipase (LPL) activity and LPL-dependent uptake of FAs whereas uptake of BSA-bound FAs was not affected by either treatment. Activation of retinoic X receptor (RXR), PPAR delta functional partner, using bexarotene upregulated Angptl4 expression and inhibited LPL activity in a PPAR delta dependent fashion. Silencing of Angptl4 blocked the effect of GW501516 and bexarotene on LPL activity. Treatment with GW501516 but not Angptl4 overexpression significantly increased palmitate oxidation. Furthermore, Angptl4 overexpression did not affect the capacity of GW501516 to increase palmitate oxidation. Basal and insulin stimulated glucose uptake, glycogen synthesis and glucose oxidation were not significantly modulated by Angptl4 overexpression. Our findings suggest that FAs-PPARdelta/RXR-Angptl4 axis controls the LPL-dependent uptake of FAs in myotubes, whereas the effect of PPAR delta activation on beta-oxidation is independent of Angptl4. PMID:23056264

  9. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.


    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K


    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. PMID:26197418

  10. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr


    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  11. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis


    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  12. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin


    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  13. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti


    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  14. Corrole and Porphyrin Amino Acid Conjugates: Synthesis and Physicochemical Properties.


    Karikis, Kostas; Georgilis, Evangelos; Charalambidis, Georgios; Petrou, Athanasia; Vakuliuk, Olena; Chatziioannou, Theodore; Raptaki, Iliana; Tsovola, Sofia; Papakyriacou, Ioanna; Mitraki, Anna; Gryko, Daniel T; Coutsolelos, Athanassios G


    A series of conjugates of amino acids with porphyrins and corroles was synthesized. Their self-assembling ability under defined conditions was investigated by scanning electron microscopy. The morphology and photophysical properties of these molecules were studied by absorption and fluorescence spectroscopy in solid, liquid, and self-assembled forms. We observed that both corrole and porphyrin conjugated with the l-phenylalanine-l-phenylalanine peptide to form spherical nanostructures with bathochromic shifts in the emission spectra, indicating the formation of aggregates. These aggregates are characterized by the impressive absorption of light over nearly the whole visible range. The broadening of all bands was particularly strong in the case of corroles. The fluorescence lifetimes of self-assembled species were longer as compared to the solid-state form. PMID:27356185

  15. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.


    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M


    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter. PMID:25900811

  16. Synthesis and degradation test of hyaluronic acid hydrogels.


    Hahn, Sei Kwang; Park, Jung Kyu; Tomimatsu, Takashi; Shimoboji, Tsuyoshi


    Hyaluronic acid (HA) hydrogels prepared with three different crosslinking reagents were assessed by in vitro and in vivo degradation tests for various tissue engineering applications. Adipic acid dihydrazide grafted HA (HA-ADH) was synthesized and used for the preparation of methacrylated HA (HA-MA) with methacrylic anhydride and thiolated HA (HA-SH) with Traut's reagent (imminothiolane). (1)H NMR analysis showed that the degrees of HA-ADH, HA-MA, and HA-SH modification were 69, 29, and 56 mol%, respectively. HA-ADH hydrogel was prepared by the crosslinking with bis(sulfosuccinimidyl) suberate (BS(3)), HA-MA hydrogel with dithiothreitol (DTT) by Michael addition, and HA-SH hydrogel with sodium tetrathionate by disulfide bond formation. According to in vitro degradation tests, HA-SH hydrogel was degraded very fast, compared to HA-ADH and HA-MA hydrogels. HA-ADH hydrogel was degraded slightly faster than HA-MA hydrogel. Based on these results, HA-MA hydrogels and HA-SH hydrogels were implanted in the back of SD rats and their degradation was assessed according to the pre-determined time schedule. As expected from the in vitro degradation test results, HA-SH hydrogel was in vivo degraded completely only in 2 weeks, whereas HA-MA hydrogels were degraded only partially even in 29 days. The degradation rate of HA hydrogels were thought to be controlled by changing the crosslinking reagents and the functional group of HA derivatives. In addition, the state of HA hydrogel was another factor in controlling the degradation rate. Dried HA hydrogel at 37 degrees C for a day resulted in relatively slow degradation compared to the bulk HA hydrogel. There was no adverse effect during the in vivo tests. PMID:17101173

  17. d-Amino Acids Indirectly Inhibit Biofilm Formation in Bacillus subtilis by Interfering with Protein Synthesis

    PubMed Central

    Leiman, Sara A.; May, Janine M.; Lebar, Matthew D.; Kahne, Daniel; Kolter, Roberto


    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of d-leucine, d-methionine, d-tryptophan, and d-tyrosine and was reported to inhibit biofilm formation via the incorporation of these d-amino acids into the cell wall. Here, we show that l-amino acids were able to specifically reverse the inhibitory effects of their cognate d-amino acids. We also show that d-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding d-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of d-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of d-amino acids without losing the ability to incorporate at least one noncanonical d-amino acid, d-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of d-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  18. D-amino acids indirectly inhibit biofilm formation in Bacillus subtilis by interfering with protein synthesis.


    Leiman, Sara A; May, Janine M; Lebar, Matthew D; Kahne, Daniel; Kolter, Roberto; Losick, Richard


    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of D-leucine, D-methionine, D-tryptophan, and D-tyrosine and was reported to inhibit biofilm formation via the incorporation of these D-amino acids into the cell wall. Here, we show that L-amino acids were able to specifically reverse the inhibitory effects of their cognate D-amino acids. We also show that D-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding D-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of D-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of D-amino acids without losing the ability to incorporate at least one noncanonical D-amino acid, D-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of D-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  19. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes.


    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki


    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids. PMID:27001726

  20. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki


    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  1. Identification of the Calmodulin-Binding Domains of Fas Death Receptor.


    Chang, Bliss J; Samal, Alexandra B; Vlach, Jiri; Fernandez, Timothy F; Brooke, Dewey; Prevelige, Peter E; Saad, Jamil S


    The extrinsic apoptotic pathway is initiated by binding of a Fas ligand to the ectodomain of the surface death receptor Fas protein. Subsequently, the intracellular death domain of Fas (FasDD) and that of the Fas-associated protein (FADD) interact to form the core of the death-inducing signaling complex (DISC), a crucial step for activation of caspases that induce cell death. Previous studies have shown that calmodulin (CaM) is recruited into the DISC in cholangiocarcinoma cells and specifically interacts with FasDD to regulate the apoptotic/survival signaling pathway. Inhibition of CaM activity in DISC stimulates apoptosis significantly. We have recently shown that CaM forms a ternary complex with FasDD (2:1 CaM:FasDD). However, the molecular mechanism by which CaM binds to two distinct FasDD motifs is not fully understood. Here, we employed mass spectrometry, nuclear magnetic resonance (NMR), biophysical, and biochemical methods to identify the binding regions of FasDD and provide a molecular basis for the role of CaM in Fas-mediated apoptosis. Proteolytic digestion and mass spectrometry data revealed that peptides spanning residues 209-239 (Fas-Pep1) and 251-288 (Fas-Pep2) constitute the two CaM-binding regions of FasDD. To determine the molecular mechanism of interaction, we have characterized the binding of recombinant/synthetic Fas-Pep1 and Fas-Pep2 peptides with CaM. Our data show that both peptides engage the N- and C-terminal lobes of CaM simultaneously. Binding of Fas-Pep1 to CaM is entropically driven while that of Fas-Pep2 to CaM is enthalpically driven, indicating that a combination of electrostatic and hydrophobic forces contribute to the stabilization of the FasDD-CaM complex. Our data suggest that because Fas-Pep1 and Fas-Pep2 are involved in extensive intermolecular contacts with the death domain of FADD, binding of CaM to these regions may hinder its ability to bind to FADD, thus greatly inhibiting the initiation of apoptotic signaling pathway

  2. Stabilized epoxygenated fatty acids regulate inflammation, pain, angiogenesis and cancer

    PubMed Central

    Zhang, Guodong; Kodani, Sean; Hammock, Bruce D.


    Epoxygenated fatty acids (EpFAs), which are lipid mediators produced by cytochrome P450 epoxygenases from polyunsaturated fatty acids, are important signaling molecules known to regulate various biological processes including inflammation, pain and angiogenesis. The EpFAs are further metabolized by soluble epoxide hydrolase (sEH) to form fatty acid diols which are usually less-active. Pharmacological inhibitors of sEH that stabilize endogenous EpFAs are being considered for human clinical uses. Here we review the biology of ω-3 and ω-6 EpFAs on inflammation, pain, angiogenesis and tumorigenesis. PMID:24345640

  3. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.


    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S


    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties. PMID:26159785

  4. FasL-triggered death of Jurkat cells requires caspase 8-induced, ATP-dependent cross-talk between Fas and the purinergic receptor P2X(7).


    Aguirre, Adam; Shoji, Kenji F; Sáez, Juan C; Henríquez, Mauricio; Quest, Andrew F G


    Fas ligation via the ligand FasL activates the caspase-8/caspase-3-dependent extrinsic death pathway. In so-called type II cells, an additional mechanism involving tBid-mediated caspase-9 activation is required to efficiently trigger cell death. Other pathways linking FasL-Fas interaction to activation of the intrinsic cell death pathway remain unknown. However, ATP release and subsequent activation of purinergic P2X(7) receptors (P2X(7)Rs) favors cell death in some cells. Here, we evaluated the possibility that ATP release downstream of caspase-8 via pannexin1 hemichannels (Panx1 HCs) and subsequent activation of P2X(7)Rs participate in FasL-stimulated cell death. Indeed, upon FasL stimulation, ATP was released from Jurkat cells in a time- and caspase-8-dependent manner. Fas and Panx1 HCs colocalized and inhibition of the latter, but not connexin hemichannels, reduced FasL-induced ATP release. Extracellular apyrase, which hydrolyzes ATP, reduced FasL-induced death. Also, oxidized-ATP or Brilliant Blue G, two P2X(7)R blockers, reduced FasL-induced caspase-9 activation and cell death. These results represent the first evidence indicating that the two death receptors, Fas and P2X(7)R connect functionally via caspase-8 and Panx1 HC-mediated ATP release to promote caspase-9/caspase-3-dependent cell death in lymphoid cells. Thus, a hitherto unsuspected route was uncovered connecting the extrinsic to the intrinsic pathway to amplify death signals emanating from the Fas receptor in type II cells. PMID:22806078

  5. Effects of Shenqi Fuzheng injection on Fas/FasL protein expression levels in the cardiomyocytes of a mouse model of viral myocarditis

    PubMed Central



    The aim of the present study was to examine the effects of Shenqi Fuzheng injection (SFI) on Fas and FasL protein expression levels in the cardiomyocytes of mice with viral myocarditis (VMC) and to explore the underlying anti-apoptotic mechanisms. A total of 120 male BALB/c mice were randomly divided into five groups as follows: Blank control group, model group, ribavirin group, low-dose SFI group and high-dose SFI group. The VMC model was established by the injection of coxsackievirus group B type 3 and saline, ribavirin or SFI was administered 30 min later. Cardiac samples were harvested from mice in each group on days 3, 10 and 30. Apoptosis of cardiac cells was examined using terminal deoxynucleotidyl transferase dUTP nick-end labeling, and Fas and FasL protein expression levels were detected using immunohistochemistry. Myocardial apoptosis and Fas/FasL protein expression levels were significantly increased in the model group, as compared with the blank group (P<0.01), whereas the apoptotic index (AI) and Fas/FasL protein expression levels of cardiac cells in the high-dose SFI group were significantly decreased compared with those in the model group on day 10 (acute phase; P<0.01). The AI and Fas/FasL protein expression levels of cardiac cells in the low- and high-dose SFI groups were also significantly decreased on day 30 (chronic phase; P<0.01); however, no differences between the high- and low-dose groups were detected. In conclusion, SFI relieves VMC via the downregulation of Fas and FasL protein expression and the inhibition of cell apoptosis. PMID:27168814

  6. Design, Synthesis, and Antimycobacterial Activity of Novel Theophylline-7-Acetic Acid Derivatives With Amino Acid Moieties.


    Stavrakov, Georgi; Valcheva, Violeta; Voynikov, Yulian; Philipova, Irena; Atanasova, Mariyana; Konstantinov, Spiro; Peikov, Plamen; Doytchinova, Irini


    The theophylline-7-acetic acid (7-TAA) scaffold is a promising novel lead compound for antimycobacterial activity. Here, we derive a model for antitubercular activity prediction based on 14 7-TAA derivatives with amino acid moieties and their methyl esters. The model is applied to a combinatorial library, consisting of 40 amino acid and methyl ester derivatives of 7-TAA. The best three predicted compounds are synthesized and tested against Mycobacterium tuberculosis H37Rv. All of them are stable, non-toxic against human cells and show antimycobacterial activity in the nanomolar range being 60 times more active than ethambutol. PMID:26502828

  7. Whole-body DHA synthesis-secretion kinetics from plasma eicosapentaenoic acid and alpha-linolenic acid in the free-living rat.


    Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P


    Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. PMID:27263420

  8. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels

    PubMed Central

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali


    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g. cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three dimensional (2D and 3D) culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  9. Synthesis and characterization of hybrid hyaluronic acid-gelatin hydrogels.


    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali


    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g., cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three-dimensional culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  10. Synthesis and characterization of europium- trimesic acid luminescent complex nanorods

    NASA Astrophysics Data System (ADS)

    Ren, Huijuan; Liu, Guixia; Song, Xinyuan; Hong, Guangyan; Cui, Zhenfeng


    Eu(III)-trimesic acid (TMA) luminescent complex Nanorods were synthesized in the polyvinylpyrrolidone matrix. The obtained sample was characterized by elemental analysis, Inductively Coupled Plasma-atomic emission spectroscopy(ICP-AES), X-ray diffraction(XRD), Fourier-transform Infrared spectroscopy(FT-IR), transmission electron microscopy(TEM) and photoluminescence spectra (PL). The results demonstrated that its chemical constitution is PVP/Eu(MTA) • 2H IIO. The XRD patterns show that the complex was a new kind of crystal whose structure is totally different with the ligand. TEM image indicated that the complex is nanocrystal with rod shape in one dimension, the size of rod diameter is about 50~100 nm, and the length ranges from hundred nanometer to a few micrometers, in addition, the dispersity is better. Photoluminescence analysis indicated that the complex emits Eu 3+ characteristic luminescence under ultraviolet excitation. TG-DTA curves indicated that the complex is heat stable under the temperature of 454°C. Therefore an thermal decomposition mechanism is: Eu(MTA) • 2H IIO->Eu(MTA)-> Eu IIO 3.

  11. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.


    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  12. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    PubMed Central

    Moret, Séverine; Dyson, Paul J.; Laurenczy, Gábor


    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes. PMID:24886955

  13. Chemical synthesis and enzymatic, stereoselective hydrolysis of a functionalized dihydropyrimidine for the synthesis of β-amino acids.


    Slomka, Christin; Zhong, Sabilla; Fellinger, Anna; Engel, Ulrike; Syldatk, Christoph; Bräse, Stefan; Rudat, Jens


    A novel substrate, 6-(4-nitrophenyl)dihydropyrimidine-2,4(1H,3H)-dione (pNO2PheDU), was chemically synthesized and analytically verified for the potential biocatalytic synthesis of enantiopure β-amino acids. The hydantoinase (EC from Arthrobacter crystallopoietes DSM20117 was chosen to prove the enzymatic hydrolysis of this substrate, since previous investigations showed activities of this enzyme toward 6-monosubstituted dihydrouracils. Whole cell biotransformations with recombinant Escherichia coli expressing the hydantoinase showed degradation of pNO2PheDU. Additionally, the corresponding N-carbamoyl-β-amino acid (NCarbpNO2 βPhe) was chemically synthesized, an HPLC-method with chiral stationary phases for detection of this product was established and thus (S)-enantioselectivity toward pNO2PheDU has been shown. Consequently this novel substrate is a potential precursor for the enantiopure β-amino acid para-nitro-β-phenylalanine (pNO2 βPhe). PMID:26705241

  14. High glucose induces mitochondrial dysfunction and apoptosis in human retinal pigment epithelium cells via promoting SOCS1 and Fas/FasL signaling.


    Chen, Min; Wang, Wei; Ma, Jian; Ye, Panpan; Wang, Kaijun


    Diabetic retinopathy (DR) is one of the most serious complications of diabetes mellitus (DM), however, the contribution of high glucose (HG) or hyperglycemia to DR is far from fully understanding. In the present study, we examined the expression of Fas/FasL signaling and suppressors of cytokine signaling (SOCS)1 and 3 in HG-induced human retinal pigment epithelium cells (ARPE-19 cells). And then we investigated the regulatory role of both Fas and SOCS1 in HG-induced mitochondrial dysfunction and apoptosis. Results demonstrated that HG with more than 40mM induced mitochondrial dysfunction via reducing mitochondrial membrane potential (MMP) and via inhibiting the Bcl-2 level, which is the upstream signaling of mitochondria in ARPE-19 cells. HG also upreuglated the Fas signaling and SOCS levels probably via promoting JAK/STAT signaling in ARPE-19 cells. Moreover, the exogenous Fas or entogenous overexpressed SOCS1 accentuated the HG-induced mitochondrial dysfunction and apoptosis, whereas the knockdown of either Fas or SOCS1 reduced the HG-induced mitochondria dysfunction and apoptosis. Thus, the present study confirmed that both Fas/FasL signaling and SOCS1 promoted the HG-induced mitochondrial dysfunction and apoptosis. These results implies the key regulatory role of Fas signaling and SOCS in DR. PMID:26700587

  15. Palladium-catalyzed synthesis of aromatic carboxylic acids with silacarboxylic acids.


    Friis, Stig D; Andersen, Thomas L; Skrydstrup, Troels


    Aryl iodides and bromides were easily converted to their corresponding aromatic carboxylic acids via a Pd-catalyzed carbonylation reaction using silacarboxylic acids as an in situ source of carbon monoxide. The reaction conditions were compatible with a wide range of functional groups, and with the aryl iodides, the carbonylation was complete within minutes. The method was adapted to the double and selective isotope labeling of tamibarotene. PMID:23441830

  16. 'FAS't inhibition of malaria.


    Surolia, Avadhesha; Ramya, T N C; Ramya, V; Surolia, Namita


    Malaria, a tropical disease caused by Plasmodium sp., has been haunting mankind for ages. Unsuccessful attempts to develop a vaccine, the emergence of resistance against the existing drugs and the increasing mortality rate all call for immediate strategies to treat it. Intense attempts are underway to develop potent analogues of the current antimalarials, as well as a search for novel drug targets in the parasite. The indispensability of apicoplast (plastid) to the survival of the parasite has attracted a lot of attention in the recent past. The present review describes the origin and the essentiality of this relict organelle to the parasite. We also show that among the apicoplast specific pathways, the fatty acid biosynthesis system is an attractive target, because its inhibition decimates the parasite swiftly unlike the 'delayed death' phenotype exhibited by the inhibition of the other apicoplast processes. As the enzymes of the fatty acid biosynthesis system are present as discrete entities, unlike those of the host, they are amenable to inhibition without impairing the operation of the host-specific pathway. The present review describes the role of these enzymes, the status of their molecular characterization and the current advancements in the area of developing inhibitors against each of the enzymes of the pathway. PMID:15315475

  17. Physiologic hyperinsulinemia stimulates protein synthesis and enhances transport of selected amino acids in human skeletal muscle.

    PubMed Central

    Biolo, G; Declan Fleming, R Y; Wolfe, R R


    We have investigated the mechanisms of the anabolic effect of insulin on muscle protein metabolism in healthy volunteers, using stable isotopic tracers of amino acids. Calculations of muscle protein synthesis, breakdown, and amino acid transport were based on data obtained with the leg arteriovenous catheterization and muscle biopsy. Insulin was infused (0.15 mU/min per 100 ml leg) into the femoral artery to increase femoral venous insulin concentration (from 10 +/- 2 to 77 +/- 9 microU/ml) with minimal systemic perturbations. Tissue concentrations of free essential amino acids decreased (P < 0.05) after insulin. The fractional synthesis rate of muscle protein (precursor-product approach) increased (P < 0.01) after insulin from 0.0401 +/- 0.0072 to 0.0677 +/- 0.0101%/h. Consistent with this observation, rates of utilization for protein synthesis of intracellular phenylalanine and lysine (arteriovenous balance approach) also increased from 40 +/- 8 to 59 +/- 8 (P < 0.05) and from 219 +/- 21 to 298 +/- 37 (P < 0.08) nmol/min per 100 ml leg, respectively. Release from protein breakdown of phenylalanine, leucine, and lysine was not significantly modified by insulin. Local hyperinsulinemia increased (P < 0.05) the rates of inward transport of leucine, lysine, and alanine, from 164 +/- 22 to 200 +/- 25, from 126 +/- 11 to 221 +/- 30, and from 403 +/- 64 to 595 +/- 106 nmol/min per 100 ml leg, respectively. Transport of phenylalanine did not change significantly. We conclude that insulin promoted muscle anabolism, primarily by stimulating protein synthesis independently of any effect on transmembrane transport. Images PMID:7860765

  18. AMPK activation promotes lipid droplet dispersion on detyrosinated microtubules to increase mitochondrial fatty acid oxidation

    PubMed Central

    Herms, Albert; Bosch, Marta; Reddy, Babu J.N.; Schieber, Nicole L.; Fajardo, Alba; Rupérez, Celia; Fernández-Vidal, Andrea; Ferguson, Charles; Rentero, Carles; Tebar, Francesc; Enrich, Carlos; Parton, Robert G.; Gross, Steven P.; Pol, Albert


    Lipid droplets (LDs) are intracellular organelles that provide fatty acids (FAs) to cellular processes including synthesis of membranes and production of metabolic energy. While known to move bidirectionally along microtubules (MTs), the role of LD motion and whether it facilitates interaction with other organelles are unclear. Here we show that during nutrient starvation, LDs and mitochondria relocate on detyrosinated MT from the cell centre to adopt a dispersed distribution. In the cell periphery, LD–mitochondria interactions increase and LDs efficiently supply FAs for mitochondrial beta-oxidation. This cellular adaptation requires the activation of the energy sensor AMPK, which in response to starvation simultaneously increases LD motion, reorganizes the network of detyrosinated MTs and activates mitochondria. In conclusion, we describe the existence of a specialized cellular network connecting the cellular energetic status and MT dynamics to coordinate the functioning of LDs and mitochondria during nutrient scarcity. PMID:26013497

  19. Fatty acid biosynthesis redirected to medium chains in transgenic oilseed plants

    SciTech Connect

    Voelker, T.A.; Worrell, A.C.; Anderson, L.; Bleibaum, J.; Fan, C.; Hawkins, D.J.; Radke, S.E.; Davies, H.M. )


    Medium-chain fatty acids (FAs), found in storage lipids of certain plants, are an important renewable resource. Seeds of undomesticated California bay accumulate laurate (12:0), and a 12:0-acyl-carrier protein thioesterase (BTE) has been purified from this tissue. Sequencing of BTE enabled the cloning of a complementary DNA coding for a plastid-targeted preprotein. Expression of the complementary DNA in the seeds of Arabidopsis thaliana resulted in BTE activity, and medium chains accumulated at the expense of long-chain ({ge}16) FAs. Laurate became the most abundant FA species and was deposited in the storage triacylglycerols. These results demonstrate a mechanism for medium-chain FA synthesis in plants.

  20. Synthesis and structural characterisation of amides from picolinic acid and pyridine-2,6-dicarboxylic acid

    PubMed Central

    Devi, Prarthana; Barry, Sarah M.; Houlihan, Kate M.; Murphy, Michael J.; Turner, Peter; Jensen, Paul; Rutledge, Peter J.


    Coupling picolinic acid (pyridine-2-carboxylic acid) and pyridine-2,6-dicarboxylic acid with N-alkylanilines affords a range of mono- and bis-amides in good to moderate yields. These amides are of interest for potential applications in catalysis, coordination chemistry and molecular devices. The reaction of picolinic acid with thionyl chloride to generate the acid chloride in situ leads not only to the N-alkyl-N-phenylpicolinamides as expected but also the corresponding 4-chloro-N-alkyl-N-phenylpicolinamides in the one pot. The two products are readily separated by column chromatography. Chlorinated products are not observed from the corresponding reactions of pyridine-2,6-dicarboxylic acid. X-Ray crystal structures for six of these compounds are described. These structures reveal a general preference for cis amide geometry in which the aromatic groups (N-phenyl and pyridyl) are cis to each other and the pyridine nitrogen anti to the carbonyl oxygen. Variable temperature 1H NMR experiments provide a window on amide bond isomerisation in solution. PMID:25954918

  1. Identification of the Calmodulin-Binding Domains of Fas Death Receptor

    PubMed Central

    Chang, Bliss J.; Samal, Alexandra B.; Vlach, Jiri; Fernandez, Timothy F.; Brooke, Dewey; Prevelige, Peter E.; Saad, Jamil S.


    The extrinsic apoptotic pathway is initiated by binding of a Fas ligand to the ectodomain of the surface death receptor Fas protein. Subsequently, the intracellular death domain of Fas (FasDD) and that of the Fas-associated protein (FADD) interact to form the core of the death-inducing signaling complex (DISC), a crucial step for activation of caspases that induce cell death. Previous studies have shown that calmodulin (CaM) is recruited into the DISC in cholangiocarcinoma cells and specifically interacts with FasDD to regulate the apoptotic/survival signaling pathway. Inhibition of CaM activity in DISC stimulates apoptosis significantly. We have recently shown that CaM forms a ternary complex with FasDD (2:1 CaM:FasDD). However, the molecular mechanism by which CaM binds to two distinct FasDD motifs is not fully understood. Here, we employed mass spectrometry, nuclear magnetic resonance (NMR), biophysical, and biochemical methods to identify the binding regions of FasDD and provide a molecular basis for the role of CaM in Fas–mediated apoptosis. Proteolytic digestion and mass spectrometry data revealed that peptides spanning residues 209–239 (Fas-Pep1) and 251–288 (Fas-Pep2) constitute the two CaM-binding regions of FasDD. To determine the molecular mechanism of interaction, we have characterized the binding of recombinant/synthetic Fas-Pep1 and Fas-Pep2 peptides with CaM. Our data show that both peptides engage the N- and C-terminal lobes of CaM simultaneously. Binding of Fas-Pep1 to CaM is entropically driven while that of Fas-Pep2 to CaM is enthalpically driven, indicating that a combination of electrostatic and hydrophobic forces contribute to the stabilization of the FasDD–CaM complex. Our data suggest that because Fas-Pep1 and Fas-Pep2 are involved in extensive intermolecular contacts with the death domain of FADD, binding of CaM to these regions may hinder its ability to bind to FADD, thus greatly inhibiting the initiation of apoptotic signaling

  2. Development of a Medium-Throughput Targeted LCMS Assay to Detect Endogenous Cellular Levels of Malonyl-CoA to Screen Fatty Acid Synthase Inhibitors.


    Hopcroft, Philip J; Fisher, David I


    The fatty acid synthase (FAS) enzyme in mammalian cells is a large multidomain protein responsible for de novo synthesis of fatty acids. The steps catalyzed by FAS involve the condensation of acetyl-CoA and malonyl-CoA moieties in the presence of NADPH until palmitate is formed. Inhibition of FAS causes an accumulation of intracellular malonyl-CoA, as this metabolite is essentially committed to fatty acid synthesis once formed. Detection of intracellular metabolites for screening can be problematic due to a lack of appropriate tools, but here we describe a targeted liquid chromatography-mass spectroscopy (LCMS) method to directly measure endogenous levels of malonyl-CoA to drive a drug development structure-activity relationship (SAR) screening cascade. Our process involves preparation of samples at 96-well scale, normalization postpermeabilization via use of a whole-well imaging platform, and the LCMS detection methodology. The assay is amenable to multiplexing cellular endpoints, has a typical Z' of >0.6, and has high reproducibility of EC50 values. PMID:26586251

  3. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.


    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  4. Synthesis and anticancer activity of novel fluorinated asiatic acid derivatives.


    Gonçalves, Bruno M F; Salvador, Jorge A R; Marín, Silvia; Cascante, Marta


    A series of novel fluorinated Asiatic Acid (AA) derivatives were successfully synthesized, tested for their antiproliferative activity against HeLa and HT-29 cell lines, and their structure activity relationships were evaluated. The great majority of fluorinated derivatives showed stronger antiproliferative activity than AA in a concentration dependent manner. The most active compounds have a pentameric A-ring containing an α,β-unsaturated carbonyl group. The compounds with better cytotoxic activity were then evaluated against MCF-7, Jurkat, PC-3, A375, MIA PaCa-2 and BJ cell lines. Derivative 14 proved to be the most active compound among all tested derivatives and its mechanism of action was further investigated in HeLa cell line. The results showed that compound 14 induced cell cycle arrest in G0/G1 stage as a consequence of up-regulation of p21(cip1/waf1) and p27(kip1) and down-regulation of cyclin D3 and Cyclin E. Furthermore, compound 14 was found to induce caspase driven-apoptosis with activation of caspases-8 and caspase-3 and the cleavage of PARP. The cleavage of Bid into t-Bid, the up-regulation of Bax and the down-regulation of Bcl-2 were also observed after treatment of HeLa cells with compound 14. Taken together, these mechanistic studies revealed the involvement of extrinsic and intrinsic pathways in the apoptotic process induced by compound 14. Importantly, the antiproliferative activity of this compound on the non-tumor BJ human fibroblast cell line is weaker than in the tested cancer cell lines. The enhanced potency (between 45 and 90-fold more active than AA in a panel of cancer cell lines) and selectivity of this new AA derivative warrant further preclinical evaluation. PMID:26974379

  5. Effect of nitric acid concentrations on synthesis and stability of maghemite nanoparticles suspension.


    Nurdin, Irwan; Johan, Mohd Rafie; Yaacob, Iskandar Idris; Ang, Bee Chin


    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension. PMID:24963510

  6. Effect of Nitric Acid Concentrations on Synthesis and Stability of Maghemite Nanoparticles Suspension

    PubMed Central

    Yaacob, Iskandar Idris


    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension. PMID:24963510

  7. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper.


    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo


    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  8. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo


    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  9. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)


    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  10. The effects of retinoic acid on immunoglobulin synthesis: Role of interleukin 6

    SciTech Connect

    Ballow, M.; Xiang, Shunan; Wang, Weiping; Brodsky, L. |


    Retinoic acid (RA) and its parent compound, retinol (ROH, vitamin A), have been recognized as important immunopotentiating agents. Previous studies from our laboratory have demonstrated that PA can augment formalin-treated Staphylococcus aureus (SAC) stimulated immunoglobulin (Ig) synthesis of cord blood mononuclear cells (CBMC). To determine the mechanism(s) by which RA modulates Ig synthesis, we studied the effects of RA on B cells and cytokine production. The addition of RA (10{sup -5} to 10{sup -10} M) to Epstein-Barr virus (EBV)-transformed B-cell clones derived from either adult or cord blood B cells augmented Ig secretion twofold. In contrast, cell proliferation was inhibited as measured by {sup 3}H-thymidine incorporation. We evaluated two cytokines known to be constitutively produced by EBV cell lines, IL-1 and IL-6. While RA had no effect on IL-1 production, IL-6 synthesis was greatly enhanced (20- to 45-fold), which was also reflected by an increase in steady-state mRNA levels for IL-6 but not TNF-{alpha} or TGF-{beta} on Northern blot analysis. Polyclonal rabbit anti-IL-6 antibodies were used to block the augmenting effects of RA on Ig synthesis of adenoidal B cells. RA-induced augmentation in IgG and IgA synthesis was blocked 58 and 29%, respectively, by anti-IL-6 antibodies. These studies suggest that the enhancing effects of RA on Ig synthesis are mediated, at least in part, by the autocrine or paracrine effects of IL-6 on B-cell differentiation. 37 refs., 5 figs.

  11. Reducing isozyme competition increases target fatty acid accumulation in seed triacylglycerols of transgenic Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One goal of green chemistry is the production of industrially useful fatty acids (FAs) in crop plants. We focus on the engineering of industrial FAs, specifically hydroxy fatty acids (HFA) and conjugated polyenoic fatty acids (a-eleostearic acid, ESA), using Arabidopsis (Arabidopsis thaliana) as a m...

  12. TORC1 inhibits GSK3-mediated Elo2 phosphorylation to regulate very long chain fatty acid synthesis and autophagy.


    Zimmermann, Christine; Santos, Aline; Gable, Kenneth; Epstein, Sharon; Gururaj, Charulatha; Chymkowitch, Pierre; Pultz, Dennis; Rødkær, Steven V; Clay, Lorena; Bjørås, Magnar; Barral, Yves; Chang, Amy; Færgeman, Nils J; Dunn, Teresa M; Riezman, Howard; Enserink, Jorrit M


    Very long chain fatty acids (VLCFAs) are essential fatty acids with multiple functions, including ceramide synthesis. Although the components of the VLCFA biosynthetic machinery have been elucidated, how their activity is regulated to meet the cell's metabolic demand remains unknown. The goal of this study was to identify mechanisms that regulate the rate of VLCFA synthesis, and we discovered that the fatty acid elongase Elo2 is regulated by phosphorylation. Elo2 phosphorylation is induced upon inhibition of TORC1 and requires GSK3. Expression of nonphosphorylatable Elo2 profoundly alters the ceramide spectrum, reflecting aberrant VLCFA synthesis. Furthermore, VLCFA depletion results in constitutive activation of autophagy, which requires sphingoid base phosphorylation. This constitutive activation of autophagy diminishes cell survival, indicating that VLCFAs serve to dampen the amplitude of autophagy. Together, our data reveal a function for TORC1 and GSK3 in the regulation of VLCFA synthesis that has important implications for autophagy and cell homeostasis. PMID:24239358

  13. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress.


    Simón, María Victoria; Agnolazza, Daniela L; German, Olga Lorena; Garelli, Andrés; Politi, Luis E; Agbaga, Martin-Paul; Anderson, Robert E; Rotstein, Nora P


    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here, we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat and hydrogen peroxide (H2 O2 ). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in retina photoreceptors, and its precursor, eicosapentaenoic acid (EPA) have multiple beneficial effects. Here, we show that retina neurons in vitro express the desaturase FADS2 and can synthesize DHA from EPA. Moreover, addition of EPA to these cultures protects photoreceptors from oxidative stress and promotes their differentiation through its metabolization to DHA. PMID:26662863

  14. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward


    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  15. The Fas-FADD Death Domain Complex Structure Unravels Signalling by Receptor Clustering

    SciTech Connect

    Scott, F.; Stec, B; Pop, C; Dobaczewska, M; Lee, J; Monosov, E; Robinson, H; Salvesen, G; Schwarzenbacher, R; Riedl, S


    The death inducing signalling complex (DISC) formed by Fas receptor, FADD (Fas-associated death domain protein) and caspase 8 is a pivotal trigger of apoptosis1, 2, 3. The Fas-FADD DISC represents a receptor platform, which once assembled initiates the induction of programmed cell death. A highly oligomeric network of homotypic protein interactions comprised of the death domains of Fas and FADD is at the centre of DISC formation4, 5. Thus, characterizing the mechanistic basis for the Fas-FADD interaction is crucial for understanding DISC signalling but has remained unclear largely because of a lack of structural data. We have successfully formed and isolated the human Fas-FADD death domain complex and report the 2.7 A crystal structure. The complex shows a tetrameric arrangement of four FADD death domains bound to four Fas death domains. We show that an opening of the Fas death domain exposes the FADD binding site and simultaneously generates a Fas-Fas bridge. The result is a regulatory Fas-FADD complex bridge governed by weak protein-protein interactions revealing a model where the complex itself functions as a mechanistic switch. This switch prevents accidental DISC assembly, yet allows for highly processive DISC formation and clustering upon a sufficient stimulus. In addition to depicting a previously unknown mode of death domain interactions, these results further uncover a mechanism for receptor signalling solely by oligomerization and clustering events.

  16. Possible association of FAS and FASLG polymorphisms with the risk of idiopathic azoospermia in southeast Turkey.


    Balkan, Mahmut; Atar, Murat; Erdal, Mehmet Emin; Rustemoğlu, Aydin; Yildiz, Ismail; Gunesacar, Ramazan; Hatipoğlu, Namık Kemal; Bodakçi, Mehmet Nuri; Ay, Ozlem Izci; Çevik, Kenan


    To investigate the association of the genetic variants of FAS/FASLG cell death pathway genes in male infertility, we genotyped the FAS -670A/G, -1377G/A, and FASLG -124A/G single-nucleotide polymorphisms (SNPs) by real-time polymerase chain reaction in 108 infertile men with idiopathic azoospermia and in 125 proven fertile controls. The distribution of genotypes and alleles for SNPs at FAS -1377G/A and FASLG -124A/G loci were determined not to be statistically different between the case and control groups. However, the genotype frequencies of SNPs, FAS -670AA and FAS -670AG, were found to be significantly different between the case and control groups. Whereas the FAS -670AA genotype might be regarded as a higher predisposition for idiopathic azoospermia, FAS -670AG could be interpreted to mean that this genotype provides protection against idiopathic azoospermia. The study of combined genotype and haplotype frequencies has found statistically significant differences between case and control subjects for some combinations. The AA-GG binary genotype for the FAS670 and FAS1377 loci couple, in particular, may have a high degree of predisposition to idiopathic azoospermia. Our results suggest that FAS -670A/G SNP may be a genetic predisposing factor of idiopathic azoospermia among southeastern Anatolian men. Larger studies are needed to verify these findings. Furthermore, our data indicated a possible linkage between the FAS and FASLG genes and idiopathic azoospermia. PMID:24665877

  17. Formation of Amino Acid Thioesters for Prebiotic Peptide Synthesis: Catalysis By Amino Acid Products

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.; DeVincenzi, Donald L. (Technical Monitor)


    The origin of life can be described as a series of events in which a prebiotic chemical process came increasingly under the control of its catalytic products. In our search for this prebiotic process that yielded catalytic takeover products (such as polypeptides), we have been investigating a reaction system that generates peptide-forming amino acid thioesters from formaldehyde, glycolaldehyde, and ammonia in the presence of thiols. As shown below, this model process begins by aldol condensation of formaldehyde and glycolaldehyde to give trioses and releases. These sugars then undergo beta-dehydration yielding their respective alpha-ketoaldehydes. Addition of ammonia to the alpha-ketoaldehydes yields imines which can either: (a) rearrange in the presence of thesis to give amino acid thioesters or (be react with another molecule of aldehyde to give imidazoles. This 'one-pot' reaction system operates under mild aqueous conditions, and like modem amino acid biosynthesis, uses sugar intermediates which are converted to products by energy-yielding redox reactions. Recently, we discovered that amino acids, such as the alanine reaction product, catalyze the first and second steps of the process. In the presence of ammonia the process also generates other synthetically useful products, like the important biochemical -- pyruvic acid.

  18. The Synthesis of α,α-Disubstituted α-Amino Acids via Ichikawa Rearrangement.


    Szcześniak, Piotr; Pieczykolan, Michał; Stecko, Sebastian


    An approach to α,α-disubstituted α-amino acids is reported. The key step is allyl cyanate-to-isocyanate rearrangement. As demonstrated, the resultant allyl isocyanates can be directly trapped with various nucleophiles, for instance, alcohols, amines, and organometallic reagents, to provide a broad range of N-functionalized allylamines. The developed method has been successfully applied in the synthesis of two bioactive peptides: 2-aminoadamantane-2-carboxylic acid derived P2X7-evoked glutamate release inhibitor and 4-amino-tetrahydropyranyl-4-carboxylic acid derived dipeptide GSK-2793660, which is currently in clinical trials as cathepsin C inhibitor for the treatment of cystic fibrosis, noncystic fibrosis bronchiectasis, ANCA-associated vasculitis and bronchiectasis. PMID:26726732

  19. Hybrid Compounds Strategy in the Synthesis of Oleanolic Acid Skeleton-NSAID Derivatives.


    Pawełczyk, Anna; Olender, Dorota; Sowa-Kasprzak, Katarzyna; Zaprutko, Lucjusz


    The current study focuses on the synthesis of several hybrid individuals combining a natural oleanolic acid skeleton and synthetic nonsteroidal anti-inflammatory drug moieties (NSAIDs). It studied structural modifications of the oleanolic acid structure by use of the direct reactivity of hydroxyl or hydroxyimino groups at position C-3 of the triterpenoid skeleton with the carboxylic function of anti-inflammatory drugs leading to new perspective compounds with high potential pharmacological activities. Novel ester- and iminoester-type derivatives of oleanolic unit with the different NSAIDs, such as ibuprofen, aspirin, naproxen, and ketoprofen, were obtained and characterized. Moreover, preliminary research of compounds obtaining structure stability under acidic conditions was examined and the PASS method of prediction of activity spectra for substances was used to estimate the potential biological activity of these compounds. PMID:27077841

  20. Facile synthesis of PtAu alloy nanoparticles with high activity for formic acid oxidation

    SciTech Connect

    Zhang, Sheng; Shao, Yuyan; Yin, Geping; Lin, Yuehe


    We report the facile synthesis of carbon supported PtAu alloy nanoparticles with high electrocatalytic activity as the anode catalyst for direct formic acid fuel cells (DFAFCs). PtAu alloy nanopaticles are synthesized by co-reducing HAuCl4 and H2PtCl6 with NaBH4 in the presence of sodium citrate and then the nanoparticles are deposited on Vulcan XC-72R carbon support (PtAu/C). The obtained catalysts are characterized with X-ray diffraction (XRD) and transmission electron microscope (TEM), which reveal PtAu alloy formation with an average diameter of 4.6 nm. PtAu/C exhibits 8 times higher catalytic activity toward formic acid oxidation than Pt/C. The enhanced activity of PtAu/C catalyst is attributed to noncontinuous Pt sites formed in the presence of the neighbored Au sites, which promotes direct oxidation of formic acid by avoiding poison CO.