Science.gov

Sample records for acid synthesis fas

  1. Acyl-CoA sensing by FasR to adjust fatty acid synthesis in Corynebacterium glutamicum.

    PubMed

    Irzik, Kristina; van Ooyen, Jan; Gätgens, Jochem; Krumbach, Karin; Bott, Michael; Eggeling, Lothar

    2014-12-20

    Corynebacterium glutamicum, like Mycobacterium tuberculosis, is a member of the Corynebacteriales, which have linear fatty acids and as branched fatty acids the mycolic acids. We identified accD1 and fasA as key genes of fatty acid synthesis, encoding the β-subunit of the acetyl-CoA carboxylase and a type-I fatty acid synthase, respectively, and observed their repression during growth on minimal medium with acetate. We also identified the transcriptional regulator FasR and its binding sites in the 5′ upstream regions of accD1 and fasA. In the present work we establish by co-isolation and gel-mobility shifts oleoyl-CoA and palmitoyl-CoA as effectors of FasR, and show by DNA microarray analysis that in presence of exogeneous fatty acids accD1 and fasA are repressed. These results are evidence that acyl-CoA derivatives derived from extracellular fatty acids interact with FasR to repress the genes of fatty acid synthesis. This model also explains the observed repression of accD1 and fasA during growth on acetate, where apparently the known high intracellular acetyl-CoA concentration during growth on this substrate requires reduced accD1 and fasA expression for fine control of de novo fatty acid synthesis. Consequently, this mechanism ensures that membrane lipid homeostasis is maintained when specific nutrients are available resulting in increased acetyl-CoA concentration, as is the case with acetate, or when fatty acids are directly available from the extracellular environment. However, the genes specific to mycolic acid synthesis, which are in part shared with linear fatty acid synthesis, are not controlled by FasR, which is in agreement with the fact that they can not be supplied from the extracellular environment but that their synthesis fully depends on a constant supply of linear fatty acid chains. PMID:25449109

  2. The hydroxymethyldihydropterin pyrophosphokinase domain of the multifunctional folic acid synthesis Fas protein of Pneumocystis carinii expressed as an independent enzyme in Escherichia coli: refolding and characterization of the recombinant enzyme.

    PubMed

    Ballantine, S P; Volpe, F; Delves, C J

    1994-08-01

    The folic acid synthesis (Fas) protein of Pneumocystis carinii is a multifunctional enzyme containing dihydroneopterin aldolase, 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase (PPPK), and dihydropteroate synthase activities. Isolation of the stretch of fas cDNA shown by amino acid similarity to the bacterial counterparts to code for PPPK activity (fasC domain) is described. FasC was expressed to high levels in Escherichia coli inclusion bodies using an inducible tac promoter expression system. Solubilization of the inclusion bodies in 6 M guanidine hydrochloride and refolding of the recombinant protein yielded enzymatically active PPPK which was purified to homogeneity by anion-exchange and gel-filtration chromatography. Sequence analysis showed that the first 13 amino acids of the purified protein were in agreement with those predicted from the DNA sequence and, furthermore, that the amino-terminal methionine had been removed. The enzyme is active in the monomeric form, exhibiting maximum activity at around pH 8.0. Isoelectric focusing gave a pI of 9.1. The Km value for 6-hydroxymethyl-7,8-dihydropterin was 3.6 microM in 50 mM Tris buffer, pH 8.2. The production of independently folded, active P. carinii PPPK will allow detailed biochemical and structural studies, increasing our understanding of this enzyme domain.

  3. A downstream regulatory element located within the coding sequence mediates autoregulated expression of the yeast fatty acid synthase gene FAS2 by the FAS1 gene product.

    PubMed

    Wenz, P; Schwank, S; Hoja, U; Schüller, H J

    2001-11-15

    The fatty acid synthase genes FAS1 and FAS2 of the yeast Saccharomyces cerevisiae are transcriptionally co-regulated by general transcription factors (such as Reb1, Rap1 and Abf1) and by the phospholipid-specific heterodimeric activator Ino2/Ino4, acting via their corresponding upstream binding sites. Here we provide evidence for a positive autoregulatory influence of FAS1 on FAS2 expression. Even with a constant FAS2 copy number, a 10-fold increase of FAS2 transcript amount was observed in the presence of FAS1 in multi-copy, compared to a fas1 null mutant. Surprisingly, the first 66 nt of the FAS2 coding region turned out as necessary and sufficient for FAS1-dependent gene expression. FAS2-lacZ fusion constructs deleted for this region showed high reporter gene expression even in the absence of FAS1, arguing for a negatively-acting downstream repression site (DRS) responsible for FAS1-dependent expression of FAS2. Our data suggest that the FAS1 gene product, in addition to its catalytic function, is also required for the coordinate biosynthetic control of the yeast FAS complex. An excess of uncomplexed Fas1 may be responsible for the deactivation of an FAS2-specific repressor, acting via the DRS. PMID:11713312

  4. Fas-induced programmed cell death is mediated by a Ras-regulated O2- synthesis.

    PubMed Central

    Gulbins, E; Brenner, B; Schlottmann, K; Welsch, J; Heinle, H; Koppenhoefer, U; Linderkamp, O; Coggeshall, K M; Lang, F

    1996-01-01

    Fas induces apoptosis in lymphocytes via a poorly defined intracellular signalling cascade. Previously, we have demonstrated the involvement and significance of a signalling cascade from the Fas receptor via sphingomyelinases and ceramide to Ras in Fas-induced apoptosis. Here we demonstrate rapid and transient synthesis of reactive oxygen intermediates (ROI) via activation of Ras after Fas. Genetic inhibition of Ras by transfection of transdominant inhibitory N17Ras blocked Fas-mediated ROI synthesis and programmed cell death. Likewise, the antioxidants N-acetyl-cysteine and N-t-butyl-phenylnitrone abolished Fas-induced cell death, pointing to an important role for Ras-triggered ROI synthesis in Fas-mediated programmed cell death. Images Figure 1 Figure 3 PMID:8943716

  5. Novel Type II Fatty Acid Biosynthesis (FAS II) Inhibitors as Multistage Antimalarial Agents

    PubMed Central

    Schrader, Florian C.; Glinca, Serghei; Sattler, Julia M.; Dahse, Hans-Martin; Afanador, Gustavo A.; Prigge, Sean T.; Lanzer, Michael; Mueller, Ann-Kristin; Klebe, Gerhard; Schlitzer, Martin

    2013-01-01

    Malaria is a potentially fatal disease caused by Plasmodium parasites and poses a major medical risk in large parts of the world. The development of new, affordable antimalarial drugs is of vital importance as there are increasing reports of resistance to the currently available therapeutics. In addition, most of the current drugs used for chemoprophylaxis merely act on parasites already replicating in the blood. At this point, a patient might already be suffering from the symptoms associated with the disease and could additionally be infectious to an Anopheles mosquito. These insects act as a vector, subsequently spreading the disease to other humans. In order to cure not only malaria but prevent transmission as well, a drug must target both the blood- and pre-erythrocytic liver stages of the parasite. P. falciparum (Pf) enoyl acyl carrier protein (ACP) reductase (ENR) is a key enzyme of plasmodial type II fatty acid biosynthesis (FAS II). It has been shown to be essential for liver-stage development of Plasmodium berghei and is therefore qualified as a target for true causal chemoprophylaxis. Using virtual screening based on two crystal structures of PfENR, we identified a structurally novel class of FAS inhibitors. Subsequent chemical optimization yielded two compounds that are effective against multiple stages of the malaria parasite. These two most promising derivatives were found to inhibit blood-stage parasite growth with IC50 values of 1.7 and 3.0 µm and lead to a more prominent developmental attenuation of liver-stage parasites than the gold-standard drug, primaquine. PMID:23341167

  6. Crystal structure of FAS thioesterase domain with polyunsaturated fatty acyl adduct and inhibition by dihomo-[gamma]-linolenic acid

    SciTech Connect

    Zhang, Wei; Chakravarty, Bornali; Zheng, Fei; Gu, Ziwei; Wu, Hongmei; Mao, Jianqiang; Wakil, Salih J.; Quiocho, Florante A.

    2012-05-29

    Human fatty acid synthase (hFAS) is a homodimeric multidomain enzyme that catalyzes a series of reactions leading to the de novo biosynthesis of long-chain fatty acids, mainly palmitate. The carboxy-terminal thioesterase (TE) domain determines the length of the fatty acyl chain and its ultimate release by hydrolysis. Because of the upregulation of hFAS in a variety of cancers, it is a target for antiproliferative agent development. Dietary long-chain polyunsaturated fatty acids (PUFAs) have been known to confer beneficial effects on many diseases and health conditions, including cancers, inflammations, diabetes, and heart diseases, but the precise molecular mechanisms involved have not been elucidated. We report the crystal structure of the hFAS TE domain covalently modified and inactivated by methyl {gamma}-linolenylfluorophosphonate. Whereas the structure confirmed the phosphorylation by the phosphonate head group of the active site serine, it also unexpectedly revealed the binding of the 18-carbon polyunsaturated {gamma}-linolenyl tail in a long groove-tunnel site, which itself is formed mainly by the emergence of an {alpha} helix (the 'helix flap'). We then found inhibition of the TE domain activity by the PUFA dihomo-{gamma}-linolenic acid; {gamma}- and {alpha}-linolenic acids, two popular dietary PUFAs, were less effective. Dihomo-{gamma}-linolenic acid also inhibited fatty acid biosynthesis in 3T3-L1 preadipocytes and selective human breast cancer cell lines, including SKBR3 and MDAMB231. In addition to revealing a novel mechanism for the molecular recognition of a polyunsaturated fatty acyl chain, our results offer a new framework for developing potent FAS inhibitors as therapeutics against cancers and other diseases.

  7. Tilmicosin-induced bovine neutrophil apoptosis is cell-specific and downregulates spontaneous LTB4 synthesis without increasing Fas expression.

    PubMed

    Lee, Wilson D; Flynn, Andrew N; LeBlanc, Justin M; Merrill, John K; Dick, Paul; Morck, Douglas W; Buret, Andre G

    2004-01-01

    The pathology of bacterial pneumonia, such as seen in the bovine lung infected with Mannheimia haemolytica, is due to pathogen virulence factors and to inflammation initiated by the host. Tilmicosin is a macrolide effective in treating bacterial pneumonia and recent findings suggest that this antibiotic may provide anti-inflammatory benefits by inducing polymorphonuclear neutrophilic leukocyte (PMN) apoptosis. Using an in vitro bovine system, we examined the cell-specificity of tilmicosin, characterized the changes in spontaneous leukotriene B4 (LTB4) synthesis by PMN exposed to the macrolide, and assessed its effects on PMN Fas expression. Previous findings demonstrated that tilmicosin is able to induce PMN apoptosis. These results were confirmed in this study by the Annexin-V staining of externalized phosphatidylserine and the analysis with flow cytometry. The cell-specificity of tilmicosin was assessed by quantification of apoptosis in bovine PMN, mononuclear leukocytes, monocyte-derived macrophages, endothelial cells, epithelial cells, and fibroblasts cultured with the macrolide. The effect of tilmicosin on spontaneous LTB4 production by PMN was evaluated via an enzyme-linked immunosorbent assay. Finally, the mechanisms of tilmicosin-induced PMN apoptosis were examined by assessing the effects of tilmicosin on surface Fas expression on PMN. Tilmicosin-induced apoptosis was found to be at least partially cell-specific, as PMN were the only cell type tested to die via apoptosis in response to incubation with tilmicosin. PMN incubated with tilmicosin under conditions that induce apoptosis spontaneously produced less LTB4, but did not exhibit altered Fas expression. In conclusion, tilmicosin-induced apoptosis is specific to PMN, inhibits spontaneous LTB4 production, and occurs through a pathway independent of Fas upregulation.

  8. Mechanisms of cancer chemoprevention by hop bitter acids (beer aroma) through induction of apoptosis mediated by Fas and caspase cascades.

    PubMed

    Chen, Wei-Jen; Lin, Jen-Kun

    2004-01-14

    The bitter acids of hops (Humulus lupulus L.) mainly consist of alpha-acids, beta-acids, and their oxidation products that contribute the unique aroma of the beer beverage. Hop bitter acids displayed a strong growth inhibitory effect against human leukemia HL-60 cells, with an estimated IC(50) value of 8.67 microg/mL, but were less effective against human histolytic lymphoma U937 cells. Induction of apoptosis was confirmed in HL-60 cells by DNA fragmentation and the appearance of a sub-G1 DNA peak, which were preceded by dissipation of mitochondrial membrane potential, cytochrome c release, and subsequent induction of pro-caspase-9 and -3 processing. Cleavages of PARP and DFF-45 were accompanied with activation of caspase-9 and -3 triggered by hop bitter acids in HL-60 cells. The change in the expression of Bcl-2, Bcl-X(L), and Bax in response to hop bitter acids was studied, and the Bcl-2 protein level slightly decreased; however, the Bcl-X(L) protein level was obviously decreased, whereas the Bax protein level was dramatically increased, indicating that the control of Bcl-2 family proteins by hop bitter acids might participate in the disruption of mitochondrial integrity. In addition, the results showed that hop bitter acids promoted the up-regulation of Fas and FasL prior to the processing and activation of pro-caspase-8 and cleavage of Bid, suggesting the involvement of a Fas-mediated pathway in hop bitter acids-induced cells. Taken together, these findings suggest that a certain intimate link might exist between receptor- and mitochondria-mediated death signalings that committed to cell death induced by hop bitter acids. The induction of apoptosis by hop bitter acids may offer a pivotal mechanism for their chemopreventive action.

  9. Regulation of hippocampal Fas receptor and death-inducing signaling complex after kainic acid treatment in mice.

    PubMed

    Keller, Benjamin; García-Sevilla, Jesús A

    2015-12-01

    Kainic acid (KA)-induced brain neuronal cell death (especially in the hippocampus) was shown to be mainly mediated by the intrinsic (mitochondrial) apoptotic pathway. This study investigated the regulation of the extrinsic apoptotic pathway mediated by Fas ligand/Fas receptor and components of the indispensable death-inducing signaling complex (DISC) in the hippocampus (marked changes) and cerebral cortex (modest changes) of KA-treated mice. KA (45mg/kg) induced a severe behavioral syndrome with recurrent motor seizures (scores; maximal at 60-90min; minimal at 72h) with activation of hippocampal pro-apoptotic JNK (+2.5 fold) and increased GFAP (+57%) and nuclear PARP-1 fragmentation (+114%) 72h post-treatment (delayed neurotoxicity). In the extrinsic apoptotic pathway (hippocampus), KA (72h) reduced Fas ligand (-92%) and Fas receptor aggregates (-24%). KA (72h) also altered the contents of major DISC components: decreased FADD adaptor (-44%), reduced activation of initiator caspase-8 (-47%) and increased survival FLIP-S (+220%). Notably, KA (72h) upregulated the content of anti-apoptotic p-Ser191 FADD (+41%) and consequently the expression of p-FADD/FADD ratio (+1.9-fold), a neuroplastic index. Moreover, the p-FADD dependent transcription factor NF-κB was also increased (+61%) in the hippocampus after KA (72h). The convergent adaptation of the extrinsic apoptotic machinery 72h after KA in mice (with otherwise normal gross behavior) is a novel finding which suggests the induction of survival mechanisms to partly counteract the delayed neuronal death in the hippocampus.

  10. Regulation of hippocampal Fas receptor and death-inducing signaling complex after kainic acid treatment in mice.

    PubMed

    Keller, Benjamin; García-Sevilla, Jesús A

    2015-12-01

    Kainic acid (KA)-induced brain neuronal cell death (especially in the hippocampus) was shown to be mainly mediated by the intrinsic (mitochondrial) apoptotic pathway. This study investigated the regulation of the extrinsic apoptotic pathway mediated by Fas ligand/Fas receptor and components of the indispensable death-inducing signaling complex (DISC) in the hippocampus (marked changes) and cerebral cortex (modest changes) of KA-treated mice. KA (45mg/kg) induced a severe behavioral syndrome with recurrent motor seizures (scores; maximal at 60-90min; minimal at 72h) with activation of hippocampal pro-apoptotic JNK (+2.5 fold) and increased GFAP (+57%) and nuclear PARP-1 fragmentation (+114%) 72h post-treatment (delayed neurotoxicity). In the extrinsic apoptotic pathway (hippocampus), KA (72h) reduced Fas ligand (-92%) and Fas receptor aggregates (-24%). KA (72h) also altered the contents of major DISC components: decreased FADD adaptor (-44%), reduced activation of initiator caspase-8 (-47%) and increased survival FLIP-S (+220%). Notably, KA (72h) upregulated the content of anti-apoptotic p-Ser191 FADD (+41%) and consequently the expression of p-FADD/FADD ratio (+1.9-fold), a neuroplastic index. Moreover, the p-FADD dependent transcription factor NF-κB was also increased (+61%) in the hippocampus after KA (72h). The convergent adaptation of the extrinsic apoptotic machinery 72h after KA in mice (with otherwise normal gross behavior) is a novel finding which suggests the induction of survival mechanisms to partly counteract the delayed neuronal death in the hippocampus. PMID:26044520

  11. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  12. Type II fatty acid synthesis is essential only for malaria parasite late liver stage development

    PubMed Central

    Vaughan, Ashley M; O'Neill, Matthew T; Tarun, Alice S; Camargo, Nelly; Phuong, Thuan M; Aly, Ahmed S I; Cowman, Alan F; Kappe, Stefan H I

    2009-01-01

    Intracellular malaria parasites require lipids for growth and replication. They possess a prokaryotic type II fatty acid synthesis (FAS II) pathway that localizes to the apicoplast plastid organelle and is assumed to be necessary for pathogenic blood stage replication. However, the importance of FAS II throughout the complex parasite life cycle remains unknown. We show in a rodent malaria model that FAS II enzymes localize to the sporozoite and liver stage apicoplast. Targeted deletion of FabB/F, a critical enzyme in fatty acid synthesis, did not affect parasite blood stage replication, mosquito stage development and initial infection in the liver. This was confirmed by knockout of FabZ, another critical FAS II enzyme. However, FAS II-deficient Plasmodium yoelii liver stages failed to form exo-erythrocytic merozoites, the invasive stage that first initiates blood stage infection. Furthermore, deletion of FabI in the human malaria parasite Plasmodium falciparum did not show a reduction in asexual blood stage replication in vitro. Malaria parasites therefore depend on the intrinsic FAS II pathway only at one specific life cycle transition point, from liver to blood. PMID:19068099

  13. The Mycobacterium tuberculosis FAS-II condensing enzymes: their role in mycolic acid biosynthesis, acid-fastness, pathogenesis and in future drug development.

    PubMed

    Bhatt, Apoorva; Molle, Virginie; Besra, Gurdyal S; Jacobs, William R; Kremer, Laurent

    2007-06-01

    Mycolic acids are very long-chain fatty acids representing essential components of the mycobacterial cell wall. Considering their importance, characterization of key enzymes participating in mycolic acid biosynthesis not only allows an understanding of their role in the physiology of mycobacteria, but also might lead to the identification of new drug targets. Mycolates are synthesized by at least two discrete elongation systems, the type I and type II fatty acid synthases (FAS-I and FAS-II respectively). Among the FAS-II components, the condensing enzymes that catalyse the formation of carbon-carbon bonds have received considerable interest. Four condensases participate in initiation (mtFabH), elongation (KasA and KasB) and termination (Pks13) steps, leading to full-length mycolates. We present the recent biochemical and structural data for these important enzymes. Special emphasis is given to their role in growth, intracellular survival, biofilm formation, as well as in the physiopathology of tuberculosis. Recent studies demonstrated that phosphorylation of these enzymes by mycobacterial kinases affects their activities. We propose here a model in which kinases that sense environmental changes can phosphorylate the condensing enzymes, thus representing a novel mechanism of regulating mycolic acid biosynthesis. Finally, we discuss the attractiveness of these enzymes as valid targets for future antituberculosis drug development. PMID:17555433

  14. Valproic acid cooperates with hydralazine to augment the susceptibility of human osteosarcoma cells to Fas- and NK cell-mediated cell death.

    PubMed

    Yamanegi, Koji; Yamane, Junko; Kobayashi, Kenta; Kato-Kogoe, Nahoko; Ohyama, Hideki; Nakasho, Keiji; Yamada, Naoko; Hata, Masaki; Fukunaga, Satoru; Futani, Hiroyuki; Okamura, Haruki; Terada, Nobuyuki

    2012-07-01

    We investigated the effects of valproic acid (VPA), a histone deacetylase inhibitor, in combination with hydralazine, a DNA methylation inhibitor, on the expression of cell-surface Fas and MHC-class I-related chain molecules A and B (MICA and B), the ligands of NKG2D which is an activating receptor of NK cells, and on production of their soluble forms in HOS, U-2 OS and SaOS-2 human osteosarcoma cell lines. We also examined the susceptibility of these cells to Fas- and NK cell-mediated cell death. VPA did not increase the expression of Fas on the surface of osteosarcoma cells, while hydralazine did, and the combination of VPA with hydralazine increased the expression of cell-surface Fas. In contrast, the combination of VPA with hydralazine did not increase the production of soluble Fas by osteosarcoma cells. Both VPA and hydralazine increased the expression of cell-surface MICA and B in osteosarcoma cells, and their combination induced a greater increase in their expression. VPA inhibited the production of both soluble MICA and MICB by osteosarcoma cells while hydralazine produced no effect. Both VPA and hydralazine enhanced the susceptibility of osteosarcoma cells to Fas- and NK cell-mediated cell death and the combination of VPA with hydralazine further enhanced the effects. The present results suggest that combined administration of VPA and hydrazine is valuable for enhancing the therapeutic effects of immunotherapy for osteosarcomas.

  15. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  16. Defects in mitochondrial fatty acid synthesis result in failure of multiple aspects of mitochondrial biogenesis in Saccharomyces cerevisiae.

    PubMed

    Kursu, V A Samuli; Pietikäinen, Laura P; Fontanesi, Flavia; Aaltonen, Mari J; Suomi, Fumi; Raghavan Nair, Remya; Schonauer, Melissa S; Dieckmann, Carol L; Barrientos, Antoni; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2013-11-01

    Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild haem deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a co-ordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell.

  17. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  18. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  19. Inducible resistance to Fas-mediated apoptosis in B cells.

    PubMed

    Rothstein, T L

    2000-12-01

    Apoptosis produced in B cells through Fas (APO-1, CD95) triggering is regulated by signals derived from other surface receptors: CD40 engagement produces upregulation of Fas expression and marked susceptibility to Fas-induced cell death, whereas antigen receptor engagement, or IL-4R engagement, inhibits Fas killing and in so doing induces a state of Fas-resistance, even in otherwise sensitive, CD40-stimulated targets. Surface immunoglobulin and IL-4R utilize at least partially distinct pathways to produce Fas-resistance that differentially depend on PKC and STAT6, respectively. Further, surface immunoglobulin signaling for inducible Fas-resistance bypasses Btk, requires NF-kappaB, and entails new macromolecular synthesis. Terminal effectors of B cell Fas-resistance include the known anti-apoptotic gene products, Bcl-xL and FLIP, and a novel anti-apoptotic gene that encodes FAIM (Fas Apoptosis Inhibitory Molecule). faim was identified by differential display and exists in two alternatively spliced forms; faim-S is broadly expressed, but faim-L expression is tissue-specific. The FAIM sequence is highly evolu- tionarily conserved, suggesting an important role for this molecule throughout phylogeny. Inducible resistance to Fas killing is hypothesized to protect foreign antigen-specific B cells during potentially hazardous interactions with FasL-bearing T cells, whereas autoreactive B cells fail to become Fas-resistant and are deleted via Fas-dependent cytotoxicity. Inadvertent or aberrant acquisition of Fas-resistance may permit autoreactive B cells to escape Fas deletion, and malignant lymphocytes to impede anti-tumor immunity.

  20. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  1. [18F]- and [11C]-Labeled N-benzyl-isatin sulfonamide analogues as PET tracers for apoptosis: synthesis, radiolabeling mechanism, and in vivo imaging of apoptosis in Fas-treated mice

    PubMed Central

    Zhou, Dong; Chu, Wenhua; Chen, Delphine L.; Wang, Qi; Reichert, David E.; Rothfuss, Justin; D'Avignon, Andre; Welch, Michael J.; Mach, Robert H.

    2011-01-01

    Summary The radiolabeled isatin sulfonamide caspase-3 inhibitor, [18F]2 (WC-II-89), is a potential PET radiotracer for noninvasive imaging of apoptosis. The radiolabeling mechanism was studied by 13C NMR, ESI/MS, and computational calculations. It was found that the high electrophilicity of the C3 carbonyl group in the isatin ring, which served as a trap for [18F]fluoride, was responsible for the failure of the radiolabeling via nucleophilic substitution of the mesylate group in 7a by [18F]fluoride. Once treated with a strong base, 7a opened the isatin ring completely to form an isatinate intermediate 16, which lost the ability to trap [18F]fluoride, thereby allowing the displacement of the mesylate group to afford the 18F-labeled isatinate 17. [18F]17 can be converted to isatin [18F]2 efficiently under acidic conditions. The ring-opening and re-closure of the isatin ring under basic and acidic conditions were confirmed by reversed phase HPLC analysis, ESI/MS and 13C NMR studies. Computational studies of model compounds also support the above proposed mechanism. Similarly, the ring-opening and re-closure method was used successfully in the synthesis of the 11C labeled isatin sulfonamide analogue [11C]4 (WC-98). A microPET imaging study using [11C]4 in the Fas liver apoptosis model demonstrated retained activity in the target organ (liver) of the treated mice. Increased caspase-3 activation in the liver was verified by the fluorometric caspase-3 enzyme assay. Therefore, this study provides a useful method for radio-synthesis of isatin derivative radiotracers for PET and SPECT studies, and [11C]4 is a potential PET radiotracer for noninvasive imaging of apoptosis. PMID:19300818

  2. Mitochondrial acyl carrier protein is involved in lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Brody, S; Oh, C; Hoja, U; Schweizer, E

    1997-05-19

    The yeast gene, ACP1, encoding the mitochondrial acyl carrier protein, was deleted by gene replacement. The resulting acp1-deficient mutants had only 5-10% of the wild-type lipoic acid content remaining, and exhibited a respiratory-deficient phenotype. Upon meiosis, the lipoate deficiency co-segregated with the acp1 deletion. The role of ACP1 in long-chain fatty acid synthesis was studied in fast and fas2 null mutants completely lacking cytoplasmic fatty acid synthase. When grown on odd-chain (13:0 and 15:0) fatty acids, these cells showed less than 1% of C-16 and C-18 acids in their total lipids. Mitochondrial ACP is therefore suggested to be involved with the biosynthesis of octanoate, a precursor to lipoic acid. PMID:9187370

  3. Disrupted short chain specific β-oxidation and improved synthase expression increase synthesis of short chain fatty acids in Saccharomyces cerevisiae.

    PubMed

    Leber, Christopher; Choi, Jin Wook; Polson, Brian; Da Silva, Nancy A

    2016-04-01

    Biologically derived fatty acids have gained tremendous interest as an alternative to petroleum-derived fuels and chemical precursors. We previously demonstrated the synthesis of short chain fatty acids in Saccharomyces cerevisiae by introduction of the Homo sapiens fatty acid synthase (hFAS) with heterologous phosphopantetheine transferases and heterologous thioesterases. In this study, short chain fatty acid production was improved by combining a variety of novel enzyme and metabolic engineering strategies. The use of a H. sapiens-derived thioesterase and phosphopantetheine transferase were evaluated. In addition, strains were engineered to disrupt either the full β-oxidation (by deleting FAA2, PXA1, and POX1) or short chain-specific β-oxidation (by deleting FAA2, ANT1, and PEX11) pathways. Prohibiting full β-oxidation increased hexanoic and octanoic acid levels by 8- and 79-fold relative to the parent strain expressing hFAS. However, by targeting only short chain β-oxidation, hexanoic and octanoic acid levels increased further to 31- and 140-fold over the parent. In addition, an optimized hFAS gene increased hexanoic, octanoic, decanoic and total short chain fatty acid levels by 2.9-, 2.0-, 2.3-, and 2.2-fold, respectively, relative to the non-optimized counterpart. By combining these unique enzyme and metabolic engineering strategies, octanoic acid was increased more than 181-fold over the parent strain expressing hFAS.

  4. Downregulation of de Novo Fatty Acid Synthesis in Subcutaneous Adipose Tissue of Moderately Obese Women

    PubMed Central

    Guiu-Jurado, Esther; Auguet, Teresa; Berlanga, Alba; Aragonès, Gemma; Aguilar, Carmen; Sabench, Fàtima; Armengol, Sandra; Porras, José Antonio; Martí, Andreu; Jorba, Rosa; Hernández, Mercè; del Castillo, Daniel; Richart, Cristóbal

    2015-01-01

    The purpose of this work was to evaluate the expression of fatty acid metabolism-related genes in human adipose tissue from moderately obese women. We used qRT-PCR and Western Blot to analyze visceral (VAT) and subcutaneous (SAT) adipose tissue mRNA expression involved in de novo fatty acid synthesis (ACC1, FAS), fatty acid oxidation (PPARα, PPARδ) and inflammation (IL6, TNFα), in normal weight control women (BMI < 25 kg/m2, n = 35) and moderately obese women (BMI 30–38 kg/m2, n = 55). In SAT, ACC1, FAS and PPARα mRNA expression were significantly decreased in moderately obese women compared to controls. The downregulation reported in SAT was more pronounced when BMI increased. In VAT, lipogenic-related genes and PPARα were similar in both groups. Only PPARδ gene expression was significantly increased in moderately obese women. As far as inflammation is concerned, TNFα and IL6 were significantly increased in moderate obesity in both tissues. Our results indicate that there is a progressive downregulation in lipogenesis in SAT as BMI increases, which suggests that SAT decreases the synthesis of fatty acid de novo during the development of obesity, whereas in VAT lipogenesis remains active regardless of the degree of obesity. PMID:26694359

  5. Roles of Fas and Fas ligand during mammary gland remodeling

    PubMed Central

    Song, Joon; Sapi, Eva; Brown, Wendi; Nilsen, Jon; Tartaro, Karrie; Kacinski, Barry M.; Craft, Joseph; Naftolin, Frederick; Mor, Gil

    2000-01-01

    Mammary involution is associated with degeneration of the alveolar structure and programmed cell death of mammary epithelial cells. In this study, we evaluated the expression of Fas and Fas ligand (FasL) in the mammary gland tissue and their possible role in the induction of apoptosis of mammary cells. FasL-positive cells were observed in normal mammary epithelium from pregnant and lactating mice, but not in nonpregnant/virgin mouse mammary tissue. Fas expression was observed in epithelial and stromal cells in nonpregnant mice but was absent during pregnancy. At day 1 after weaning, high levels of both Fas and FasL proteins and caspase 3 were observed and coincided with the appearance of apoptotic cells in ducts and glands. During the same period, no apoptotic cells were found in the Fas-deficient (MRL/lpr) and FasL-deficient (C3H/gld) mice. Increase in Fas and FasL protein was demonstrated in human (MCF10A) and mouse (HC-11) mammary epithelial cells after incubation in hormone-deprived media, before apoptosis was detected. These results suggest that the Fas-FasL interaction plays an important role in the normal remodeling of mammary tissue. Furthermore, this autocrine induction of apoptosis may prevent accumulation of cells with mutations and subsequent neoplastic development. Failure of the Fas/FasL signal could contribute to tumor development. PMID:11086022

  6. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  7. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  8. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  9. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  10. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  11. Cholangiocarcinomas express Fas ligand and disable the Fas receptor.

    PubMed

    Que, F G; Phan, V A; Phan, V H; Celli, A; Batts, K; LaRusso, N F; Gores, G J

    1999-12-01

    Cholangiocarcinoma is a highly-malignant adenocarcinoma originating from cholangiocytes. Current concepts support escape from immune surveillance using aberrant expression of Fas ligand (FasL) and dysregulation of receptor (FasR) signaling as a potential mechanism for tumor progression. Our aims were to determine if altered expression of FasR and FasL or changes in expression of FLICE inhibitor (I-FLICE) allow cholangiocarcinoma cells to escape immune surveillance. Human cholangiocarcinoma cell lines were evaluated for the functional expression of FasR and FasL by (1) quantitating apoptosis after incubation of cells with agonistic antibodies and (2) an in vitro cell death assay involving coculture of cholangiocarcinoma cells with Fas-sensitive thymocytes. I-FLICE antisense treatment was performed by stable transfection with complementary DNA (cDNA) for I-FLICE in the reverse orientation. We found that normal cholangiocytes in vivo express FasL. Human cholangiocarcinoma cell lines express both FasL and FasR and I-FLICE. FasL expressed by cholangiocarcinomas in vitro induced lymphocyte cell death (70% after 24 hours). Despite the expression of FasR, exposure of the cells to agonistic antibodies (500 ng/mL) induced only minimal apoptosis in the Jurkat cells. Antisense treatment of cholangiocarcinomas in vitro with I-FLICE reduced protein expression of I-FLICE by 90% to 95% and increased Fas-mediated apoptosis 2-fold. We concluded that cholangiocarcinomas escape immune surveillance either by disabling FasR signaling through the expression of I-FLICE and/or increased FasL expression to induce apoptosis of invading T cells. Reduction of I-FLICE expression in cholangiocarcinoma cells restored Fas-mediated apoptosis. Therapeutic maneuvers to inhibit expression of I-FLICE may aid in the treatment of cholangiocarcinoma.

  12. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors. PMID:26134042

  13. Response of Fatty Acid Synthesis Genes to the Binding of Human Salivary Amylase by Streptococcus gordonii

    PubMed Central

    Nikitkova, Anna E.; Haase, Elaine M.; Vickerman, M. Margaret; Gill, Steven R.

    2012-01-01

    Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were differentially expressed in response to the binding of purified human salivary amylase versus exposure to purified heat-denatured amylase. Selected genes found to be differentially expressed were validated by quantitative reverse transcription-PCR (qRT-PCR). Five genes from the fatty acid synthesis (FAS) cluster were highly (10- to 35-fold) upregulated in S. gordonii CH1 cells treated with native amylase relative to those treated with denatured amylase. An abpA-deficient strain of S. gordonii exposed to amylase failed to show a response in FAS gene expression similar to that observed in the parental strain. Predicted phenotypic effects of amylase binding to S. gordonii strain CH1 (associated with increased expression of FAS genes, leading to changes in fatty acid synthesis) were noted; these included increased bacterial growth, survival at low pH, and resistance to triclosan. These changes were not observed in the amylase-exposed abpA-deficient strain, suggesting a role for AbpA in the amylase-induced phenotype. These results provide evidence that the binding of salivary amylase elicits a differential gene response in S. gordonii, resulting in a phenotypic adjustment that is potentially advantageous for bacterial survival in the oral environment. PMID:22247133

  14. Synthesis and Isolation of Chelidonic Acid

    ERIC Educational Resources Information Center

    Gagan, J. M. F.; Herbert, R. B.

    1976-01-01

    Described is an undergraduate laboratory experiment involving synthesis of chelidonic acid and its identification in plants. The experiment is offered as an ancillary topic for biology or chemistry classes. (SL)

  15. RGD-FasL Induces Apoptosis in Hepatocellular Carcinoma

    PubMed Central

    Liu, Zhongchen; Wang, Juan; Yin, Ping; Qiu, Jinhua; Liu, Ruizhen; Li, Wenzhu; Fan, Xin; Cheng, Xiaofeng; Chen, Caixia; Zhang, Jiakai; Zhuang, Guohong

    2009-01-01

    Despite impressive results obtained in animal models, the clinical use of Fas ligand (FasL) as an anticancer drug is limited by severe toxicity. Systemic toxicity of death ligands may be prevented by using genes encoding membrane-bound death ligands and by targeted transgene expression through either targeted transduction or targeted transcription. Selective induction of tumor cell death is a promising anticancer strategy. A fusion protein is created by fusing the extracellular domain of Fas ligand (FasL) to the peptide arginine-glycine-aspartic acid (RGD) that selectively targets avβ3-integrins on tumor endothelial cells. The purpose of this study is to evaluate the effects of RGD-FasL on tumor growth and survival in a murine hepatocellular carcinoma (HCC) tumor model. Treatment with RGD-FasL displaying an obvious suppressive effect on the HCC tumor model as compared to that with FasL (p < 0.05) and resulted in a more additive effect on tumor growth delay in this model. RGD-FasL treatment significantly enhanced mouse survival and caused no toxic effect, such as weight loss, organ failure, or other treatment-related toxicities. Apoptosis was detected by flow cytometric analysis and TUNEL assays; those results also showed that RGD-FasL is a more potent inducer of cell apoptosis for H22 and H9101 cell lines than FasL (p < 0.05). In conclusion, RGD-FasL appears to be a low-toxicity selective inducer of tumor cell death, which merits further investigation in preclinical and clinical studies. Furthermore, this approach offers a versatile technology for complexing target ligands with therapeutic recombinant proteins. To distinguish the anti-tumor effects of FasL in vivo, tumor and liver tissues were harvested to examine for evidence of necrotic cells, tumor cells, or apoptotic cells by Hematoxylin and eosin (H&E) staining. PMID:19728930

  16. Role of Fas/Fas-L in vascular cell apoptosis.

    PubMed

    Stoneman, Victoria E A; Bennett, Martin R

    2009-02-01

    Apoptosis of vascular cells is observed in vivo in normal vessel development and a variety of vascular pathologies. Apoptosis occurs in all cell types within the vessel wall, the consequences of which depend on both cell type and the pathology under study. The death receptor Fas is expressed throughout the vessel wall, and increasingly Fas-Fas-L-induced killing has been recognized in the vasculature. This review outlines the current developments in understanding the role, regulation, and consequences of Fas-Fas-L-induced apoptosis in vascular cells.

  17. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  18. Castor phospholipid:diacylglycerol acyltransferase facilitates efficient metabolism of hydroxy fatty acids in transgenic Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Producing unusual fatty acids (FAs) in crop plants has been a long-standing goal of green chemistry. However, expression of the enzymes that catalyze the primary synthesis of these unusual FAs in transgenic plants typically results in low levels of the desired FA. For example, seed-specific expressi...

  19. Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.

    PubMed

    Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko

    2016-09-01

    Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. PMID:27630308

  20. Fas/Fas Ligand Interaction in Human Colorectal Hepatic Metastases

    PubMed Central

    Yoong, Khong F.; Afford, Simon C.; Randhawa, Satinder; Hubscher, Stefan G.; Adams, David H.

    1999-01-01

    This study demonstrates a novel role for the Fas pathway in the promotion of local tumor growth by inducing apoptotic cell death in normal hepatocytes at the tumor margin in colorectal hepatic metastases. Our results show that >85% of lymphocytes infiltrating colorectal liver cancer express high levels of Fas-ligand (Fas-L) by flow cytometry. Using immunohistochemistry of tumor tissue we showed strong Fas expression in noninvolved hepatocytes, whereas Fas-L expression was restricted to tumor cells and infiltrating lymphocytes at the tumor margin. Apoptosis was observed in 45 ± 13% of the Fashigh hepatocytes at the tumor margin whereas only 7 ± 3% tumor cells were apoptotic (n = 10). In vitro, primary human hepatocytes expressed Fas receptor and crosslinking with anti-Fas antibody induced apoptosis in 44 ± 5% of the cells compared with 4.6 ± 1.0% in untreated controls (P = 0.004). Both tumor-infiltrating lymphocytes (TIL) and human metastatic colon cancer cells cells are able to induce Fas-mediated apoptosis of primary human hepatocytes in coculture cytotoxic assays. TIL induced apoptosis in 47 ± 9% hepatocytes compared with control 4.3 ± 1.0% (P = 0.009) and this effect was reduced by anti-human Fas-L mAb (18.7 ± 1.3%, P = 0.009). SW620 cells induced apoptosis in 26 ± 2% hepatocytes compared with control 5.6 ± 1.7% (P = 0.004) and this was reduced to 11.2 ± 1.8% (P = 0.004) in the presence of anti-human Fas-L mAb. These data suggest that the inflammatory response at the margin of colorectal liver metastases induces Fas expression in surrounding hepatocytes, allowing them to be killed by Fas-L-bearing TIL or tumor cells and facilitating the invasion of the tumor into surrounding liver tissue. PMID:10079247

  1. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  2. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  3. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  4. Receptor-specific regulation of B-cell susceptibility to Fas-mediated apoptosis and a novel Fas apoptosis inhibitory molecule.

    PubMed

    Rothstein, T L; Zhong, X; Schram, B R; Negm, R S; Donohoe, T J; Cabral, D S; Foote, L C; Schneider, T J

    2000-08-01

    The susceptibility of primary B cells to Fas (APO-1, CD95)-mediated apoptosis is modulated by signals derived from additional surface receptors: CD40 engagement produces upregulation of Fas expression and marked sensitivity to Fas-induced cell death, whereas antigen receptor engagement, or interleukin-4 receptor (IL-4R) engagement, inhibits Fas killing and thereby produces Fas resistance, even in otherwise susceptible, CD40-stimulated targets. Surface immunoglobulin (sIg) and IL-4R utilize distinct signaling pathways to produce Fas resistance that rely on protein kinase C and signal transducer and activator of transcription 6, respectively sIg signaling for inducible Fas resistance requires nuclear factor-kappaB and depends on new macromolecular synthesis. Proximate mediators for Fas resistance include the known anti-apoptotic gene products Bcl-xL and FLIP (but not Btk), and a novel anti-apoptotic gene that encodes Fas apoptosis inhibitory molecule (FAIM). FAIM was identified by differential display and was cloned as two alternatively spliced forms: FAIM-S is broadly expressed, whereas faim-L expression is tissue specific. faim is highly evolutionarily conserved, suggesting an important function throughout phylogeny. Inducible resistance to Fas-mediated apoptosis is speculated to protect antigen-specific B cells during potentially dangerous interactions with FasL-bearing T cells; the elevated sIg-signaling threshold for inducible Fas resistance in autoreactive, tolerant B cells would insure against autoimmunity. However, aberrant acquisition of Fas resistance may allow autoreactive B cells to escape Fas deletion and malignant lymphocytes to thwart antitumor immunity.

  5. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  6. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  7. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  8. Platelets induce apoptosis via membrane-bound FasL

    PubMed Central

    Schleicher, Rebecca I.; Reichenbach, Frank; Kraft, Peter; Kumar, Anil; Lescan, Mario; Todt, Franziska; Göbel, Kerstin; Hilgendorf, Ingo; Geisler, Tobias; Bauer, Axel; Olbrich, Marcus; Schaller, Martin; Wesselborg, Sebastian; O’Reilly, Lorraine; Meuth, Sven G.; Schulze-Osthoff, Klaus; Gawaz, Meinrad; Li, Xuri; Kleinschnitz, Christoph; Edlich, Frank

    2015-01-01

    After tissue injury, both wound sealing and apoptosis contribute to restoration of tissue integrity and functionality. Although the role of platelets (PLTs) for wound closure and induction of regenerative processes is well established, the knowledge about their contribution to apoptosis is incomplete. Here, we show that PLTs present the death receptor Fas ligand (FasL) on their surface after activation. Activated PLTs as well as the isolated membrane fraction of activated PLTs but not of resting PLTs induced apoptosis in a dose-dependent manner in primary murine neuronal cells, human neuroblastoma cells, and mouse embryonic fibroblasts. Membrane protein from PLTs lacking membrane-bound FasL (FasL△m/△m) failed to induce apoptosis. Bax/Bak-mediated mitochondrial apoptosis signaling in target cells was not required for PLT-induced cell death, but increased the apoptotic response to PLT-induced Fas signaling. In vivo, PLT depletion significantly reduced apoptosis in a stroke model and an inflammation-independent model of N-methyl-d-aspartic acid-induced retinal apoptosis. Furthermore, experiments using PLT-specific PF4Cre+ FasLfl/fl mice demonstrated a role of PLT-derived FasL for tissue apoptosis. Because apoptosis secondary to injury prevents inflammation, our findings describe a novel mechanism on how PLTs contribute to tissue homeostasis. PMID:26232171

  9. Platelets induce apoptosis via membrane-bound FasL.

    PubMed

    Schleicher, Rebecca I; Reichenbach, Frank; Kraft, Peter; Kumar, Anil; Lescan, Mario; Todt, Franziska; Göbel, Kerstin; Hilgendorf, Ingo; Geisler, Tobias; Bauer, Axel; Olbrich, Marcus; Schaller, Martin; Wesselborg, Sebastian; O'Reilly, Lorraine; Meuth, Sven G; Schulze-Osthoff, Klaus; Gawaz, Meinrad; Li, Xuri; Kleinschnitz, Christoph; Edlich, Frank; Langer, Harald F

    2015-09-17

    After tissue injury, both wound sealing and apoptosis contribute to restoration of tissue integrity and functionality. Although the role of platelets (PLTs) for wound closure and induction of regenerative processes is well established, the knowledge about their contribution to apoptosis is incomplete. Here, we show that PLTs present the death receptor Fas ligand (FasL) on their surface after activation. Activated PLTs as well as the isolated membrane fraction of activated PLTs but not of resting PLTs induced apoptosis in a dose-dependent manner in primary murine neuronal cells, human neuroblastoma cells, and mouse embryonic fibroblasts. Membrane protein from PLTs lacking membrane-bound FasL (FasL(△m/△m)) failed to induce apoptosis. Bax/Bak-mediated mitochondrial apoptosis signaling in target cells was not required for PLT-induced cell death, but increased the apoptotic response to PLT-induced Fas signaling. In vivo, PLT depletion significantly reduced apoptosis in a stroke model and an inflammation-independent model of N-methyl-d-aspartic acid-induced retinal apoptosis. Furthermore, experiments using PLT-specific PF4Cre(+) FasL(fl/fl) mice demonstrated a role of PLT-derived FasL for tissue apoptosis. Because apoptosis secondary to injury prevents inflammation, our findings describe a novel mechanism on how PLTs contribute to tissue homeostasis.

  10. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  11. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  12. Fatty acid biosynthesis in actinomycetes

    PubMed Central

    Gago, Gabriela; Diacovich, Lautaro; Arabolaza, Ana; Tsai, Shiou-Chuan; Gramajo, Hugo

    2011-01-01

    All organisms that produce fatty acids do so via a repeated cycle of reactions. In mammals and other animals, these reactions are catalyzed by a type I fatty acid synthase (FAS), a large multifunctional protein to which the growing chain is covalently attached. In contrast, most bacteria (and plants) contain a type II system in which each reaction is catalyzed by a discrete protein. The pathway of fatty acid biosynthesis in Escherichia coli is well established and has provided a foundation for elucidating the type II FAS pathways in other bacteria (White et al., 2005). However, fatty acid biosynthesis is more diverse in the phylum Actinobacteria: Mycobacterium, possess both FAS systems while Streptomyces species have only the multi-enzyme FAS II system and Corynebacterium species exclusively FAS I. In this review we present an overview of the genome organization, biochemical properties and physiological relevance of the two FAS systems in the three genera of actinomycetes mentioned above. We also address in detail the biochemical and structural properties of the acyl-CoA carboxylases (ACCases) that catalyzes the first committed step of fatty acid synthesis in actinomycetes, and discuss the molecular bases of their substrate specificity and the structure-based identification of new ACCase inhibitors with anti-mycobacterial properties. PMID:21204864

  13. Mycobacterium tuberculosis Proteins Involved in Mycolic Acid Synthesis and Transport Localize Dynamically to the Old Growing Pole and Septum

    PubMed Central

    Cantaloube, Sylvain; Bonne, Mélanie; Diagne, Cheikh T.; Laval, Françoise; Daffé, Mamadou; Zerbib, Didier

    2014-01-01

    Understanding the mechanism that controls space-time coordination of elongation and division of Mycobacterium tuberculosis (Mtb), the causative agent of tuberculosis (TB), is critical for fighting the tubercle bacillus. Most of the numerous enzymes involved in the synthesis of Mycolic acid - Arabinogalactan-Peptidoglycan complex (MAPc) in the cell wall are essential in vivo. Using a dynamic approach, we localized Mtb enzymes belonging to the fatty acid synthase-II (FAS-II) complexes and involved in mycolic acid (MA) biosynthesis in a mycobacterial model of Mtb: M. smegmatis. Results also showed that the MA transporter MmpL3 was present in the mycobacterial envelope and was specifically and dynamically accumulated at the poles and septa during bacterial growth. This localization was due to its C-terminal domain. Moreover, the FAS-II enzymes were co-localized at the poles and septum with Wag31, the protein responsible for the polar localization of mycobacterial peptidoglycan biosynthesis. The dynamic localization of FAS-II and of the MA transporter with Wag31, at the old-growing poles and at the septum suggests that the main components of the mycomembrane may potentially be synthesized at these precise foci. This finding highlights a major difference between mycobacteria and other rod-shaped bacteria studied to date. Based on the already known polar activities of envelope biosynthesis in mycobacteria, we propose the existence of complex polar machinery devoted to the biogenesis of the entire envelope. As a result, the mycobacterial pole would represent the Achilles' heel of the bacillus at all its growing stages. PMID:24817274

  14. Synthesis of Lipoteichoic Acids in Bacillus anthracis

    PubMed Central

    Garufi, Gabriella; Hendrickx, Antoni P.; Beeri, Karen; Kern, Justin W.; Sharma, Anshika; Richter, Stefan G.; Schneewind, Olaf

    2012-01-01

    Lipoteichoic acid (LTA), a glycerol phosphate polymer, is a component of the envelope of Gram-positive bacteria that has hitherto not been identified in Bacillus anthracis, the causative agent of anthrax. LTA synthesis in Staphylococcus aureus and other microbes is catalyzed by the product of the ltaS gene, a membrane protein that polymerizes polyglycerol phosphate from phosphatidyl glycerol. Here we identified four ltaS homologues, designated ltaS1 to -4, in the genome of Bacillus anthracis. Polyglycerol phosphate-specific monoclonal antibodies were used to detect LTA in the envelope of B. anthracis strain Sterne (pXO1+ pXO2−) vegetative forms. B. anthracis mutants lacking ltaS1, ltaS2, ltaS3, or ltaS4 did not display defects in growth or LTA synthesis. In contrast, B. anthracis strains lacking both ltaS1 and ltaS2 were unable to synthesize LTA and exhibited reduced viability, altered envelope morphology, aberrant separation of vegetative forms, and decreased sporulation efficiency. Expression of ltaS1 or ltaS2 alone in B. anthracis as well as in other microbes was sufficient for polyglycerol phosphate synthesis. Thus, similar to S. aureus, B. anthracis employs LtaS enzymes to synthesize LTA, an envelope component that promotes bacterial growth and cell division. PMID:22685279

  15. Influence of virgin coconut oil-enriched diet on the transcriptional regulation of fatty acid synthesis and oxidation in rats - a comparative study.

    PubMed

    Arunima, Sakunthala; Rajamohan, Thankappan

    2014-05-28

    The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.

  16. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  17. Dietary unsaturated fatty acids differently affect catecholamine handling by adrenal chromaffin cells.

    PubMed

    Gomes, Andreia; Correia, Gustavo; Coelho, Marisa; Araújo, João Ricardo; Pinho, Maria João; Teixeira, Ana Luisa; Medeiros, Rui; Ribeiro, Laura

    2015-05-01

    Catecholamines (CA) play an important role in cardiovascular (CDV) disease risk. Namely, noradrenaline (NA) levels positively correlate whereas adrenaline (AD) levels negatively correlate with obesity and/or CDV disease. Western diets, which are tipically rich in Ω-6 fatty acids (FAs) and deficient in Ω-3 FAs, may contribute to the development of obesity, type 2 diabetes and/or coronary artery disease. Taking this into consideration and the fact that our group has already described that saturated FAs affect catecholamine handling by adrenal chromaffin cells, this work aimed to investigate the effect of unsaturated FAs upon catecholamine handling in the same model. Our results showed that chronic exposure to unsaturated FAs differently modulated CA cellular content and release, regardless of both FA series and number of carbon atoms. Namely, the Ω-6 arachidonic and linoleic acids, based on their effect on CA release and cellular content, seemed to impair NA and AD vesicular transport, whereas γ-linolenic acid selectively impaired AD synthesis and release. Within the Ω-9 FAs, oleic acid was devoid of effect, and elaidic acid behaved similarly to γ-linolenic acid. Eicosapentaenoic and docosahexaenoic acids (Ω-3 series) impaired the synthesis and release of both NA and AD. These results deserve attention and future development, namely, in what concerns the mechanisms involved and correlative effects in vivo. PMID:25727966

  18. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  19. Involvement of Fas/FasL system in the pathogenesis of autoimmune diseases and Wilson's disease.

    PubMed

    Stassi, G; Di Felice, V; Todaro, M; Cappello, F; Zummo, G; Farina, F; Trucco, M; De Maria, R

    1999-01-01

    The interaction of Fas with FasL has been demonstrated to be implicated in the pathogenesis of several autoimmune and liver diseases. Recently, attention has been focused on the hypothesis that thyrocytes and beta cells undergo massive Fas/FasL-mediated apoptosis during autoimmune response. Similarly, hepatocyte cell death occurring following copper accumulation points towards the same mechanism.

  20. Promoter strength of folic acid synthesis genes affects sulfa drug resistance in Saccharomyces cerevisiae.

    PubMed

    Iliades, Peter; Berglez, Janette; Meshnick, Steven; Macreadie, Ian

    2003-01-01

    The enzyme dihydropteroate synthase (DHPS) is an important target for sulfa drugs in both prokaryotic and eukaryotic microbes. However, the understanding of DHPS function and the action of antifolates in eukaryotes has been limited due to technical difficulties and the complexity of DHPS being a part of a bifunctional or trifunctional protein that comprises the upstream enzymes involved in folic acid synthesis (FAS). Here, yeast strains have been constructed to study the effects of FOL1 expression on growth and sulfa drug resistance. A DHPS knockout yeast strain was complemented by yeast vectors expressing the FOL1 gene under the control of promoters of different strengths. An inverse relationship was observed between the growth rate of the strains and FOL1 expression levels. The use of stronger promoters to drive FOL1 expression led to increased sulfamethoxazole resistance when para-aminobenzoic acid (pABA) levels were elevated. However, high FOL1 expression levels resulted in increased susceptibility to sulfamethoxazole in pABA free media. These data suggest that up-regulation of FOL1 expression can lead to sulfa drug resistance in Saccharomyces cerevisiae.

  1. Plasma fatty acids in chronic kidney disease: nervonic acid predicts mortality.

    PubMed

    Shearer, Gregory C; Carrero, Juan J; Heimbürger, Olof; Barany, Peter; Stenvinkel, Peter

    2012-03-01

    Although the value of red blood cell fatty acids (FAs) in estimating risk for acute coronary syndrome in the general population is evident, the value of FAs in chronic kidney disease (CKD) is unknown. Here, we provide a pilot analysis in a spectrum of CKD patients. Plasma samples were obtained from 20 incident dialysis patients (CKD stage 5), matched with samples from 10 CKD stage 3-4 patients, and 10 control subjects. Whole plasma FAs were measured using gas chromatography. Whereas neither linoleic acid nor arachidonate acid were altered in CKD, metabolic intermediates of arachidonate synthesis (γ-linolenate and dihomo γ-linolenate) were reduced in CKD. Demming (orthogonal) correlation of FA abundance with estimated GFR identified several saturated and unsaturated FAs in addition to the intermediates; again, neither linoleate nor arachidonate were related. Follow-up data within the CKD stage 5 patients revealed that nervonic acid, a component of membrane sphingolipids and phosphatidylethanolamines, was a significant predictor of all-cause mortality; the age-adjusted relative risk for a 0.15% change is 2.1 (1.4, 3.7; 95% CI; P = .0008). These findings support the exploration of FAs in larger studies for validation of the role FAs in cardiovascular risk and mortality in CKD.

  2. Pathway to synthesis and processing of mycolic acids in Mycobacterium tuberculosis.

    PubMed

    Takayama, Kuni; Wang, Cindy; Besra, Gurdyal S

    2005-01-01

    Mycobacterium tuberculosis is known to synthesize alpha-, methoxy-, and keto-mycolic acids. We propose a detailed pathway to the biosynthesis of all mycolic acids in M. tuberculosis. Fatty acid synthetase I provides C(20)-S-coenzyme A to the fatty acid synthetase II system (FAS-IIA). Modules of FAS-IIA and FAS-IIB introduce cis unsaturation at two locations on a growing meroacid chain to yield three different forms of cis,cis-diunsaturated fatty acids (intermediates to alpha-, methoxy-, and keto-meroacids). These are methylated, and the mature meroacids and carboxylated C(26)-S-acyl carrier protein enter into the final Claisen-type condensation with polyketide synthase-13 (Pks13) to yield mycolyl-S-Pks13. We list candidate genes in the genome encoding the proposed dehydrase and isomerase in the FAS-IIA and FAS-IIB modules. We propose that the processing of mycolic acids begins by transfer of mycolic acids from mycolyl-S-Pks13 to d-mannopyranosyl-1-phosphoheptaprenol to yield 6-O-mycolyl-beta-d-mannopyranosyl-1-phosphoheptaprenol and then to trehalose 6-phosphate to yield phosphorylated trehalose monomycolate (TMM-P). Phosphatase releases the phosphate group to yield TMM, which is immediately transported outside the cell by the ABC transporter. Antigen 85 then catalyzes the transfer of a mycolyl group from TMM to the cell wall arabinogalactan and to other TMMs to produce arabinogalactan-mycolate and trehalose dimycolate, respectively. We list candidate genes in the genome that encode the proposed mycolyltransferases I and II, phosphatase, and ABC transporter. The enzymes within this total pathway are targets for new drug discovery.

  3. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  4. Theanaphthoquinone inhibits fatty acid synthase expression in EGF-stimulated human breast cancer cells via the regulation of EGFR/ErbB-2 signaling

    SciTech Connect

    Weng, M.-S.; Ho, C.-T.; Ho, Y.-S.; Lin, J.-K. . E-mail: jklin@ha.mc.ntu.edu.tw

    2007-01-15

    Fatty acid synthase (FAS) is a major lipogenic enzyme catalyzing the synthesis of long-chain saturated fatty acids. Most breast cancers require lipogenesis for growth. Here, we demonstrated the effects of theanaphthoquinone (TNQ), a member of the thearubigins generated by the oxidation of theaflavin (TF-1), on the expression of FAS in human breast cancer cells. TNQ was found to suppress the EGF-induced expression of FAS mRNA and FAS protein in MDA-MB-231 cells. Expression of FAS has previously been shown to be regulated by the SREBP family of transcription factors. In this study, we demonstrated that the EGF-induced nuclear translocation of SREBP-1 was blocked by TNQ. Moreover, TNQ also modulated EGF-induced ERK1/2 and Akt phosphorylation. Treatment of MDA-MB-231 cells with PI 3-kinase inhibitors, LY294002 and Wortmannin, inhibited the EGF-induced expression of FAS and nuclear translocation of SREBP-1. Treatment with TNQ inhibited EGF-induced EGFR/ErbB-2 phosphorylation and dimerization. Furthermore, treatment with kinase inhibitors of EGFR and ErbB-2 suggested that EGFR/ErbB-2 activation was involved in EGF-induced FAS expression. In constitutive FAS expression, TNQ inhibited FAS expression and Akt autophosphorylation in BT-474 cells. The PI 3-kinase inhibitors and tyrosine kinase inhibitors of EGFR and ErbB-2 also reduced constitutive FAS expression. In addition, pharmacological blockade of FAS by TNQ decreased cell viability and induced cell death in BT-474 cells. In summary, our findings suggest that TNQ modulates FAS expression by the regulation of EGFR/ErbB-2 pathways and induces cell death in breast cancer cells.

  5. Expression of apoptotic regulatory molecules in renal cell carcinoma: elevated expression of Fas ligand.

    PubMed

    Olive, C; Cheung, C; Nicol, D; Falk, M C

    1999-02-01

    Renal cell carcinoma (RCC) is the most common renal neoplasm. Despite being infiltrated by tumour infiltrating lymphocytes (TIL), these TIL are unable to control tumour growth in vivo, suggesting that the cytotoxic capacity of TIL against RCC is impaired, or that the tumour cells are resistant to killing and therefore escape detection by the immune system. It is postulated that the expression of apoptotic regulatory molecules in RCC favours tumour cell survival. The present study has therefore determined the expression of Fas (APO-1/CD95), Fas ligand (Fas L) and bcl-2 in these tumours. The expression of Fas, Fas L and bcl-2 mRNA transcripts was determined in RCC, normal kidney and peripheral blood by semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR), following RNA extraction and cDNA synthesis from tissues and cell samples. Transcript levels were measured by densitometry after Southern blot hybridization of PCR products with internal radio-labelled oligonucleotide probes; a densitometry score was assigned to each hybridizing DNA band and expressed as a ratio of the glyceraldehyde-3-phosphate dehydrogenase content. In peripheral blood, the expression of Fas L and bcl-2 transcripts was similar between patients and normal healthy individuals; however, Fas transcript expression was significantly down-regulated in the patients' versus normal peripheral blood (P = 0.026). Most interestingly, significantly up-regulated Fas L expression was observed in RCC compared to normal kidney (P = 0.041). In contrast, bcl-2 transcripts were well represented in normal kidney but markedly decreased in RCC (P = 0.021). The expression of Fas transcripts in normal kidney and RCC was variable. These data demonstrate elevated expression of Fas L transcripts in RCC, but the functional relevance of this remains to be investigated. PMID:10101681

  6. Inhibition of plant fatty acid synthesis by nitroimidazoles.

    PubMed Central

    Jones, A V; Harwood, J L; Stratford, M R; Stumpf, P K

    1981-01-01

    1. The effect of the addition of a number of nitroimidazoles was tested on fatty acid synthesis by germinating pea seeds, isolated lettuce chloroplasts and a soluble fraction from pea seeds. 2. All the compounds tested had a marked inhibition on stearate desaturation by lettuce chloroplasts and on the synthesis of very-long-chain fatty acids by pea seeds. 3. In contrast, the effect of the drugs on total fatty acid synthesis from [14C]acetate in chloroplasts was related to the compound's electron reduction potentials. 4. Of the compounds used, only metronidazole had a marked inhibition on palmitate elongation in the systems tested. 5. The mechanism of inhibition of plant fatty acid synthesis by nitroimidazoles is discussed and the possible relevance of these findings to their neurotoxicity is suggested. PMID:7325993

  7. Functional differentiation and selective inactivation of multiple Saccharomyces cerevisiae genes involved in very-long-chain fatty acid synthesis.

    PubMed

    Rössler, H; Rieck, C; Delong, T; Hoja, U; Schweizer, E

    2003-05-01

    While de novo fatty acid synthesis uses acetyl-CoA, fatty acid elongation uses longer-chain acyl-CoAs as primers. Several mutations that interfere with fatty acid elongation in yeast have already been described, suggesting that there may be different elongases for medium- and long-chain acyl-CoA primers. In the present study, an experimental approach is described that allows differential characterization of the various yeast elongases in vitro. Based on their characteristic primer specificities and product patterns, at least three different yeast elongases are defined. Elongase I extends C12-C16 fatty acyl-CoAs to C16-C18 fatty acids. Elongase II elongates palmitoyl-CoA and stearoyl-CoA up to C22 fatty acids, and elongase III synthesizes 20-26-carbon fatty acids from C18-CoA primers. Elongases I, II and III are specifically inactivated in, respectively, elo1, elo2 and elo3 mutants. Elongases II and III share the same 3-ketoacyl reductase, which is encoded by the YBR159w gene. Inactivation of YBR159w inhibits in vitro fatty acid elongation after the first condensation reaction. Although in vitro elongase activity is absent, the mutant nevertheless contains 10-30% of normal VLCFA levels. On the basis of this finding, an additional elongating activity is inferred to be present in vivo. ybr159Delta cells show synthetic lethality in the presence of cerulenin, which inactivates fatty acid synthase. An involvement of FAS in VLCFA synthesis may account for these findings, but remains to be demonstrated directly. Alternatively, a vital role for C18 and C20 hydroxyacids, which are dramatically overproduced in ybr159Delta cells, may be postulated. PMID:12684876

  8. Intestinal expression of Fas and Fas ligand is upregulated by bacterial signaling through TLR4 and TLR5, with activation of Fas modulating intestinal TLR-mediated inflammation.

    PubMed

    Fernandes, Philana; O'Donnell, Charlotte; Lyons, Caitriona; Keane, Jonathan; Regan, Tim; O'Brien, Stephen; Fallon, Padraic; Brint, Elizabeth; Houston, Aileen

    2014-12-15

    TLRs play an important role in mediating intestinal inflammation and homeostasis. Fas is best studied in terms of its function in apoptosis, but recent studies demonstrate that Fas signaling may mediate additional functions such as inflammation. The role of Fas, and the Fas ligand (FasL), in the intestine is poorly understood. The aim of this study was to evaluate potential cross-talk between TLRs and Fas/FasL system in intestinal epithelial cells (IECs). IECs were stimulated with TLR ligands, and expression of Fas and FasL was investigated. Treatment with TLR4 and TLR5 ligands, but not TLR2 and 9 ligands, increased expression of Fas and FasL in IECs in vitro. Consistent with this finding, expression of intestinal Fas and FasL was reduced in vivo in the epithelium of TLR4 knockout (KO), 5KO, and germ-free mice, but not in TLR2KO mice. Modulating Fas signaling using agonistic anti-Fas augmented TLR4- and TLR5-mediated TNF-α and IL-8 production by IECs. In addition, suppression of Fas in IECs reduced the ability of TLR4 and TLR5 ligands and the intestinal pathogens Salmonella typhimurium and Listeria monocytogenes to induce the expression of IL-8. In conclusion, this study demonstrates that extensive cross-talk in IECs occurs between the Fas and TLR signaling pathways, with the FasL/Fas system playing a role in TLR-mediated inflammatory responses in the intestine.

  9. Role of Cyt-C/caspases-9,3, Bax/Bcl-2 and the FAS death receptor pathway in apoptosis induced by zinc oxide nanoparticles in human aortic endothelial cells and the protective effect by alpha-lipoic acid.

    PubMed

    Liang, Shuhang; Sun, Kuo; Wang, Yue; Dong, Shuying; Wang, Cheng; Liu, LianXin; Wu, YongHui

    2016-10-25

    Zinc oxide nanoparticles (ZnO NPs) are widely used in a variety of products used in daily life. However, their impact on human health has not been completely elucidated. This study was designed to investigate the cytotoxicity associated with ZnO NPs, the role of dissolution in the toxicity of ZnO NPs, the molecular mechanisms and mode of cell death induced by ZnO NPs in human aortic endothelial cells (HAECs), and the protective effects of the antioxidant alpha-lipoic acid (LA). ZnO NPs significantly reduced cell viability in a dose- and time-dependent manner, resulted in intracellular oxidative stress and cell membrane leakage when treated with doses of 8-50 μg/mL for 12 and 24 h in HAECs. The toxicity was produced by undissolved ZnO NPs but not dissolved Zn(2+) and metal impurities. Exposure to ZnO NPs was found to induce apoptosis at 12 h and necrosis after 24 h. Apoptosis was confirmed using reactive oxygen species that triggered a decrease in mitochondria membrane potential, increase in Cyt-C release, activation of caspases 3 and caspases9 and increase in the ratio of Bax/Bcl-2. Futhermore, ZnO NPs could activate the Fas death receptor pathway. In addition, the antioxidant LA was able to protect HAECs from apoptosis induced by ZnO NPs. PMID:27544635

  10. Role of Cyt-C/caspases-9,3, Bax/Bcl-2 and the FAS death receptor pathway in apoptosis induced by zinc oxide nanoparticles in human aortic endothelial cells and the protective effect by alpha-lipoic acid.

    PubMed

    Liang, Shuhang; Sun, Kuo; Wang, Yue; Dong, Shuying; Wang, Cheng; Liu, LianXin; Wu, YongHui

    2016-10-25

    Zinc oxide nanoparticles (ZnO NPs) are widely used in a variety of products used in daily life. However, their impact on human health has not been completely elucidated. This study was designed to investigate the cytotoxicity associated with ZnO NPs, the role of dissolution in the toxicity of ZnO NPs, the molecular mechanisms and mode of cell death induced by ZnO NPs in human aortic endothelial cells (HAECs), and the protective effects of the antioxidant alpha-lipoic acid (LA). ZnO NPs significantly reduced cell viability in a dose- and time-dependent manner, resulted in intracellular oxidative stress and cell membrane leakage when treated with doses of 8-50 μg/mL for 12 and 24 h in HAECs. The toxicity was produced by undissolved ZnO NPs but not dissolved Zn(2+) and metal impurities. Exposure to ZnO NPs was found to induce apoptosis at 12 h and necrosis after 24 h. Apoptosis was confirmed using reactive oxygen species that triggered a decrease in mitochondria membrane potential, increase in Cyt-C release, activation of caspases 3 and caspases9 and increase in the ratio of Bax/Bcl-2. Futhermore, ZnO NPs could activate the Fas death receptor pathway. In addition, the antioxidant LA was able to protect HAECs from apoptosis induced by ZnO NPs.

  11. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  12. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  13. In vitro reconstitution and steady-state analysis of the fatty acid synthase from Escherichia coli.

    PubMed

    Yu, Xingye; Liu, Tiangang; Zhu, Fayin; Khosla, Chaitan

    2011-11-15

    Microbial fatty acid derivatives are emerging as promising alternatives to fossil fuel derived transportation fuels. Among bacterial fatty acid synthases (FAS), the Escherichia coli FAS is perhaps the most well studied, but little is known about its steady-state kinetic behavior. Here we describe the reconstitution of E. coli FAS using purified protein components and report detailed kinetic analysis of this reconstituted system. When all ketosynthases are present at 1 μM, the maximum rate of free fatty acid synthesis of the FAS exceeded 100 μM/ min. The steady-state turnover frequency was not significantly inhibited at high concentrations of any substrate or cofactor. FAS activity was saturated with respect to most individual protein components when their concentrations exceeded 1 μM. The exceptions were FabI and FabZ, which increased FAS activity up to concentrations of 10 μM; FabH and FabF, which decreased FAS activity at concentrations higher than 1 μM; and holo-ACP and TesA, which gave maximum FAS activity at 30 μM concentrations. Analysis of the S36T mutant of the ACP revealed that the unusual dependence of FAS activity on holo-ACP concentration was due, at least in part, to the acyl-phosphopantetheine moiety. MALDI-TOF mass spectrometry analysis of the reaction mixture further revealed medium and long chain fatty acyl-ACP intermediates as predominant ACP species. We speculate that one or more of such intermediates are key allosteric regulators of FAS turnover. Our findings provide a new basis for assessing the scope and limitations of using E. coli as a biocatalyst for the production of diesel-like fuels.

  14. In vitro reconstitution and steady-state analysis of the fatty acid synthase from Escherichia coli

    PubMed Central

    Yu, Xingye; Liu, Tiangang; Zhu, Fayin; Khosla, Chaitan

    2011-01-01

    Microbial fatty acid derivatives are emerging as promising alternatives to fossil fuel derived transportation fuels. Among bacterial fatty acid synthases (FAS), the Escherichia coli FAS is perhaps the most well studied, but little is known about its steady-state kinetic behavior. Here we describe the reconstitution of E. coli FAS using purified protein components and report detailed kinetic analysis of this reconstituted system. When all ketosynthases are present at 1 μM, the maximum rate of free fatty acid synthesis of the FAS exceeded 100 μM/ min. The steady-state turnover frequency was not significantly inhibited at high concentrations of any substrate or cofactor. FAS activity was saturated with respect to most individual protein components when their concentrations exceeded 1 μM. The exceptions were FabI and FabZ, which increased FAS activity up to concentrations of 10 μM; FabH and FabF, which decreased FAS activity at concentrations higher than 1 μM; and holo-ACP and TesA, which gave maximum FAS activity at 30 μM concentrations. Analysis of the S36T mutant of the ACP revealed that the unusual dependence of FAS activity on holo-ACP concentration was due, at least in part, to the acyl-phosphopantetheine moiety. MALDI-TOF mass spectrometry analysis of the reaction mixture further revealed medium and long chain fatty acyl-ACP intermediates as predominant ACP species. We speculate that one or more of such intermediates are key allosteric regulators of FAS turnover. Our findings provide a new basis for assessing the scope and limitations of using E. coli as a biocatalyst for the production of diesel-like fuels. PMID:22042840

  15. Improved ethyl caproate production of Chinese liquor yeast by overexpressing fatty acid synthesis genes with OPI1 deletion.

    PubMed

    Chen, Yefu; Luo, Weiwei; Gong, Rui; Xue, Xingxiang; Guan, Xiangyu; Song, Lulu; Guo, Xuewu; Xiao, Dongguang

    2016-09-01

    During yeast fermentation, ethyl esters play a key role in the development of the flavor profiles of Chinese liquor. Ethyl caproate, an ethyl ester eliciting apple-like flavor, is the characteristic flavor of strong aromatic liquor, which is the best selling liquor in China. In the traditional fermentation process, ethyl caproate is mainly produced at the later fermentation stage by aroma-producing yeast, bacteria, and mold in a mud pit instead of Saccharomyces cerevisiae at the expense of grains and fermentation time. To improve the production of ethyl caproate by Chinese liquor yeast (S. cerevisiae) with less food consumption and shorter fermentation time, we constructed three recombinant strains, namely, α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 by overexpressing acetyl-CoA carboxylase (ACC1), fatty acid synthase 1 (FAS1), and fatty acid synthase 2 (FAS2) with OPI1 (an inositol/choline-mediated negative regulatory gene) deletion, respectively. In the liquid fermentation of corn hydrolysate, the contents of ethyl caproate produced by α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 increased by 0.40-, 1.75-, and 0.31-fold, correspondingly, compared with the initial strain α5. The contents of other fatty acid ethyl esters (FAEEs) (C8:0, C10:0, C12:0) also increased. In comparison, the content of FAEEs produced by α5-FAS1ΔOPI1 significantly improved. Meanwhile, the contents of acetyl-CoA and ethyl acetate were enhanced by α5-FAS1ΔOPI1. Overall, this study offers a promising platform for the development of pure yeast culture fermentation of Chinese strong aromatic liquor without the use of a mud pit. PMID:27344573

  16. Expression of Fas ligand in murine ovary.

    PubMed

    Guo, M W; Xu, J P; Mori, E; Sato, E; Saito, S; Mori, T

    1997-05-01

    Corresponding to the expression of Fas in the ovarian oocytes as previously reported (Guo et al., Biochem Biophys Res Commun 1994; 203:1438-1446; Mori et al., JSIR 1995; 9:49-50), the expression of Fas ligand (FasL) in the ovarian follicle was found to be restricted in the area of granulosa cells by the indirect immunofluorescence (IIF) test. Reverse transcriptase/polymerase chain reaction (RT/PCR) technique coupled with Southern blot hybridization analysis showed that the highest level of FasL mRNA was demonstrated in murine ovaries and granulosa cells 1 day after the administration of pregnant mare's serum gonadotropin (PMSG), while the level of FasL mRNA became very weak on the day 5, respectively. The observed gradual decrease in FasL mRNA could not be attributed to a generalized degradation of cellular RNA during atresia, as evidenced by the presence of constitutive expression of elongation factor 1 alpha (EF-1 alpha) mRNA in murine ovaries and granulosa cells treated with PMSG. Furthermore, in situ hybridization analysis with a FasL-specific probe confirmed that FasL was specifically localized in the granulosa cells of most follicles and its expression was regulated by PMSG administration. FasL localized in granulosa cells might possibly play an important role in the formation of the ovarian atretic follicles, most likely depending on PMSG administration. PMID:9196798

  17. Melissa officinalis essential oil reduces plasma triglycerides in human apolipoprotein E2 transgenic mice by inhibiting sterol regulatory element-binding protein-1c-dependent fatty acid synthesis.

    PubMed

    Jun, Hee-Jin; Lee, Ji Hae; Jia, Yaoyao; Hoang, Minh-Hien; Byun, Hanna; Kim, Kyoung Heon; Lee, Sung-Joon

    2012-03-01

    We investigated the hypolipidemic effects of Melissa officinalis essential oil (MOEO) in human APOE2 transgenic mice and lipid-loaded HepG2 cells. Plasma TG concentrations were significantly less in APOE2 mice orally administered MOEO (12.5 μg/d) for 2 wk than in the vehicle-treated group. Cellular TG and cholesterol concentrations were also significantly decreased in a dose- (400 and 800 mg/L) and time- (12 and 24 h) dependent manner in HepG2 cells stimulated with MOEO compared with controls. Mouse hepatic transcriptome analysis suggested MOEO feeding altered several lipid metabolic pathways, including bile acid and cholesterol synthesis and fatty acid metabolism. In HepG2 cells, the rate of fatty acid oxidation, as assessed using [1-(14)C]palmitate, was unaltered; however, the rate of fatty acid synthesis quantified with [1-(14)C]acetate was significantly reduced by treatment with 400 and 800 mg/L MOEO compared with untreated controls. This reduction was due to the decreased expression of SREBP-1c and its responsive genes in fatty acid synthesis, including FAS, SCD1, and ACC1. Subsequent chromatin immunoprecipitation analysis further demonstrated that the binding of p300/CBP-associated factor, a coactivator of SREBP-1c, and histone H3 lysine 14 acetylation at the FAS, SCD1, and ACC1 promoters were significantly reduced in the livers of APOE2 mice and HepG2 cells treated with MOEO compared with their controls. Additionally, MOEO stimulation in HepG2 cells induced bile acid synthesis and reduced the nuclear form of SREBP-2, a key transcription factor in hepatic cholesterol synthesis. These findings suggest that the intake of phytochemicals with pleasant scent could have beneficial metabolic effects.

  18. Natural fatty acid synthase inhibitors as potent therapeutic agents for cancers: A review.

    PubMed

    Zhang, Jia-Sui; Lei, Jie-Ping; Wei, Guo-Qing; Chen, Hui; Ma, Chao-Ying; Jiang, He-Zhong

    2016-09-01

    Context Fatty acid synthase (FAS) is the only mammalian enzyme to catalyse the synthesis of fatty acid. The expression level of FAS is related to cancer progression, aggressiveness and metastasis. In recent years, research on natural FAS inhibitors with significant bioactivities and low side effects has increasingly become a new trend. Herein, we present recent research progress on natural fatty acid synthase inhibitors as potent therapeutic agents. Objective This paper is a mini overview of the typical natural FAS inhibitors and their possible mechanism of action in the past 10 years (2004-2014). Method The information was collected and compiled through major databases including Web of Science, PubMed, and CNKI. Results Many natural products induce cancer cells apoptosis by inhibiting FAS expression, with fewer side effects than synthetic inhibitors. Conclusion Natural FAS inhibitors are widely distributed in plants (especially in herbs and foods). Some natural products (mainly phenolics) possessing potent biological activities and stable structures are available as lead compounds to synthesise promising FAS inhibitors.

  19. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  20. Soluble Fas and the −670 Polymorphism of Fas in Lupus Nephritis

    PubMed Central

    Bollain-y-Goytia, Juan José; Arellano-Rodríguez, Mariela; Torres-Del-Muro, Felipe de Jesús; Daza-Benítez, Leonel; Francisco Muñoz-Valle, José; Avalos-Díaz, Esperanza; Herrera-Esparza, Rafael

    2014-01-01

    This study was performed to clarify the role of soluble Fas (sFas) in lupus nephritis (LN) and establish a potential relationship between LN and the −670 polymorphism of Fas in 67 patients with systemic lupus erythematosus (SLE), including a subset of 24 LN patients with proteinuria. Additionally, a group of 54 healthy subjects (HS) was included. The allelic frequency of the −670 polymorphism of Fas was determined using PCR-RFLP analysis, and sFas levels were assessed by ELISA. Additionally, the WT-1 protein level in urine was measured. The Fas receptor was determined in biopsies by immunohistochemistry (IHC) and in situ hybridization (FISH) and apoptotic features by TUNEL. Results. The −670 Fas polymorphism showed that the G allele was associated with increased SLE susceptibility, with an odds ratio (OR) of 1.86. The sFas was significantly higher in LN patients with the G/G genotype, and this subgroup exhibited correlations between the sFas level and proteinuria and increased urinary WT-1 levels. LN group shows increased expression of Fas and apoptotic features. In conclusion, our results indicate that the G allele of the −670 polymorphism of Fas is associated with genetic susceptibility in SLE patients with elevated levels of sFas in LN with proteinuria. PMID:25505993

  1. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  2. Lower ω-6/ω-3 Polyunsaturated Fatty Acid Ratios Decrease Fat Deposition by Inhibiting Fat Synthesis in Gosling.

    PubMed

    Yu, Lihuai; Wang, Shunan; Ding, Luoyang; Liang, Xianghuan; Wang, Mengzhi; Dong, Li; Wang, Hongrong

    2016-10-01

    The objective of the current study was to investigate the effects of dietary ω-6/ω-3 polyunsaturated fatty acid (PUFA) ratios on lipid metabolism in goslings. One hundred and sixty 21-day-old Yangzhou geese of similar weight were randomly divided into 4 groups. They were fed different PUFA-supplemented diets (the 4 diets had ω-6/ω-3 PUFA ratios of 12:1, 9:1, 6:1, or 3:1). The geese were slaughtered and samples of liver and muscle were collected at day 70. The activities and the gene expression of enzymes involved in lipid metabolism were measured. The results show that the activities of acetyl coenzyme A carboxylase (ACC), malic enzyme (ME), and fatty acid synthase (FAS) were lower (p<0.05), but the activities of hepatic lipase (HL) and lipoprotein lipase (LPL) were higher (p<0.05), in the liver and the muscle from the 3:1 and 6:1 groups compared with those in the 9:1 and 12:1 groups. Expression of the genes for FAS (p<0.01), ME (p<0.01) and ACC (p<0.05) were higher in the muscle of groups fed diets with higher ω-6/ω-3 PUFA ratios. Additionally, in situ hybridization tests showed that the expression intensities of the high density lipoprotein (HDL-R) gene in the 12:1 and 9:1 groups were significantly lower (p<0.01) than that of the 3:1 group in the muscle of goslings. In conclusion, diets containing lower ω-6/ω-3 PUFA ratios (3:1 or 6:1) could decrease fat deposition by inhibiting fat synthesis in goslings. PMID:27189638

  3. Lower ω-6/ω-3 Polyunsaturated Fatty Acid Ratios Decrease Fat Deposition by Inhibiting Fat Synthesis in Gosling.

    PubMed

    Yu, Lihuai; Wang, Shunan; Ding, Luoyang; Liang, Xianghuan; Wang, Mengzhi; Dong, Li; Wang, Hongrong

    2016-10-01

    The objective of the current study was to investigate the effects of dietary ω-6/ω-3 polyunsaturated fatty acid (PUFA) ratios on lipid metabolism in goslings. One hundred and sixty 21-day-old Yangzhou geese of similar weight were randomly divided into 4 groups. They were fed different PUFA-supplemented diets (the 4 diets had ω-6/ω-3 PUFA ratios of 12:1, 9:1, 6:1, or 3:1). The geese were slaughtered and samples of liver and muscle were collected at day 70. The activities and the gene expression of enzymes involved in lipid metabolism were measured. The results show that the activities of acetyl coenzyme A carboxylase (ACC), malic enzyme (ME), and fatty acid synthase (FAS) were lower (p<0.05), but the activities of hepatic lipase (HL) and lipoprotein lipase (LPL) were higher (p<0.05), in the liver and the muscle from the 3:1 and 6:1 groups compared with those in the 9:1 and 12:1 groups. Expression of the genes for FAS (p<0.01), ME (p<0.01) and ACC (p<0.05) were higher in the muscle of groups fed diets with higher ω-6/ω-3 PUFA ratios. Additionally, in situ hybridization tests showed that the expression intensities of the high density lipoprotein (HDL-R) gene in the 12:1 and 9:1 groups were significantly lower (p<0.01) than that of the 3:1 group in the muscle of goslings. In conclusion, diets containing lower ω-6/ω-3 PUFA ratios (3:1 or 6:1) could decrease fat deposition by inhibiting fat synthesis in goslings.

  4. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  5. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly.

    PubMed

    Bates, Philip D; Johnson, Sean R; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G; Ohlrogge, John B; Browse, John

    2014-01-21

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [(14)C]acetate and [(3)H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [(14)C]acetate and [(14)C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl-CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl-CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid.

  6. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  7. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  8. Molecular cloning and characterisation of the rock bream, Oplegnathus fasciatus, Fas (CD95/APO-1), and its expression analysis in response to bacterial or viral infection

    PubMed Central

    Jeong, Ji-Min; Kim, Ju-Won; Park, Hyoung-Jun; Song, Jeong-Hun; Kim, Do-Hyung; Park, Chan-Il

    2011-01-01

    Fas belongs to the tumour necrosis factor (TNF) receptor superfamily and can transmit a death signal leading to apoptosis. In the present study, we isolated the full-length cDNA for rock bream (Oplegnathus fasciatus) Fas (RbFas). The full-length RbFas cDNA was 1770 bp long and contained an open reading frame of 957 bp that encoded 319 amino acid residues with a predicted molecular mass of 35.1 kDa. The 319 amino-acid predicted RbFas sequence is homologous to other Fas sequences, contains three cysteine-rich domains and a death domain (DD) and two potential N-glycosylation sites. Expression of RbFas mRNA was detected in nine different tissues from healthy rock bream and was the highest in red blood cells. In analyses of mitogen-stimulated RbFas expression in peripheral blood leucocytes, expression of RbFas mRNA was observed between 1 and 36 h after stimulation with LPS, and 1 and 3 h stimulation with poly I:C. In the case of bacterial injection, the RbFas transcript peaked 6 h after injection in both the kidney and the spleen. Otherwise, the RbFas transcript peaked after 1 h in spleen and 6 h in kidney following injection with RSIV. PMID:24371547

  9. Kinetic investigation of erucamide synthesis using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Upadhayay, Santosh K; Singh, R P

    2008-01-01

    Fatty acid amides like erucamide are mainly used for lubrication and as slip agent to decrease friction in polymer and plastic industry. Erucamide is normally synthesized by ammonolysis of triglycerides or fatty acids at 200 degrees C and at high pressure (345-690 kPa.). However using urea in place of ammonia the economic synthesis of erucamide is possible at atmospheric pressure at approx 190 degrees C. In present investigation, the kinetics of synthesis of erucamide by ammonolysis of erucic acid has been investigated. The optimum conditions for the synthesis of erucamide have also been determined. 1:4 molar ratio of erucic acid to urea, 190 degrees C temperature and catalyst [P2O5 with (NH4)2H PO4, {(1:1) w/w }] concentration 3% (by wt. of erucic acid) were the optimum condition for synthesis of erucamide from erucic acid and can obtain a maximum yield of 92% of pure erucamide. Some other catalysts as titanium-iso -propoxide, phosphorus pent oxide were also tried but these catalysts were not economical. PMID:18685229

  10. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  11. Regulation of collagen synthesis by ascorbic acid.

    PubMed Central

    Murad, S; Grove, D; Lindberg, K A; Reynolds, G; Sivarajah, A; Pinnell, S R

    1981-01-01

    After prolonged exposure to ascorbate, collagen synthesis in cultured human skin fibroblasts increased approximately 8-fold with no significant change in synthesis of noncollagen protein. This effect of ascorbate appears to be unrelated to its cofactor function in collagen hydroxylation. The collagenous protein secreted in the absence of added ascorbate was normal in hydroxylysine but was mildly deficient in hydroxyproline. In parallel experiments, lysine hydroxylase (peptidyllysine, 2-oxoglutarate:oxygen 5-oxidoreductase, EC 1.14.11.4) activity increased 3-fold in response to ascorbate administration whereas proline hydroxylase (prolyl-glycyl-peptide, 2-oxoglutarate:oxygen oxidoreductase, EC 1.14.11.2) activity decreased considerably. These results suggest that collage polypeptide synthesis, posttranslational hydroxylations, and activities of the two hydroxylases are independently regulated by ascorbate. PMID:6265920

  12. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  13. Engagement of Fas on Macrophages Modulates Poly I:C Induced Cytokine Production with Specific Enhancement of IP-10

    PubMed Central

    Lyons, Caitriona; Fernandes, Philana; Fanning, Liam J.

    2015-01-01

    Viral double-stranded RNA (dsRNA) is recognised by pathogen recognition receptors such as Toll-Like Receptor 3 (TLR3) and retinoic acid inducible gene-I (RIG-I), and results in cytokine and interferon production. Fas, a well characterised death receptor, has recently been shown to play a role in the inflammatory response. In this study we investigated the role of Fas in the anti-viral immune response. Stimulation of Fas on macrophages did not induce significant cytokine production. However, activation of Fas modified the response of macrophages to the viral dsRNA analogue poly I:C. In particular, poly I:C-induced IP-10 production was significantly enhanced. A similar augmentation of IP-10 by Fas was observed following stimulation with both poly A:U and Sendai virus. Fas activation suppressed poly I:C-induced phosphorylation of the MAP kinases p38 and JNK, while overexpression of the Fas adaptor protein, Fas-associated protein with death domain (FADD), activated AP-1 and inhibited poly I:C-induced IP-10 production. Consistent with an inhibitory role for AP-1 in IP-10 production, mutation of the AP-1 binding site on the IP-10 promoter resulted in augmented poly I:C-induced IP-10. These results demonstrate that engagement of the Fas receptor plays a role in modifying the innate immune response to viral RNA. PMID:25849666

  14. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  15. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  16. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains.

  17. Cytotoxicity Mediated by the Fas Ligand (FasL)-activated Apoptotic Pathway in Stem Cells*

    PubMed Central

    Mazar, Julia; Thomas, Molly; Bezrukov, Ludmila; Chanturia, Alexander; Pekkurnaz, Gulcin; Yin, Shurong; Kuznetsov, Sergei A.; Robey, Pamela G.; Zimmerberg, Joshua

    2009-01-01

    Whereas it is now clear that human bone marrow stromal cells (BMSCs) can be immunosuppressive and escape cytotoxic lymphocytes (CTLs) in vitro and in vivo, the mechanisms of this phenomenon remain controversial. Here, we test the hypothesis that BMSCs suppress immune responses by Fas-mediated apoptosis of activated lymphocytes and find both Fas and FasL expression by primary BMSCs. Jurkat cells or activated lymphocytes were each killed by BMSCs after 72 h of co-incubation. In comparison, the cytotoxic effect of BMSCs on non-activated lymphocytes and on caspase-8(−/−) Jurkat cells was extremely low. Fas/Fc fusion protein strongly inhibited BMSC-induced lymphocyte apoptosis. Although we detected a high level of Fas expression in BMSCs, stimulation of Fas with anti-Fas antibody did not result in the expected BMSC apoptosis, regardless of concentration, suggesting a disruption of the Fas activation pathway. Thus BMSCs may have an endogenous mechanism to evade Fas-mediated apoptosis. Cumulatively, these data provide a parallel between adult stem/progenitor cells and cancer cells, consistent with the idea that stem/progenitor cells can use FasL to prevent lymphocyte attack by inducing lymphocyte apoptosis during the regeneration of injured tissues. PMID:19531476

  18. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis

    PubMed Central

    Miyanaga, Akimasa; Funa, Nobutaka; Awakawa, Takayoshi; Horinouchi, Sueharu

    2008-01-01

    Alkylresorcinols and alkylpyrones, which have a polar aromatic ring and a hydrophobic alkyl chain, are phenolic lipids found in plants, fungi, and bacteria. In the Gram-negative bacterium Azotobacter vinelandii, phenolic lipids in the membrane of dormant cysts are essential for encystment. The aromatic moieties of the phenolic lipids in A. vinelandii are synthesized by two type III polyketide synthases (PKSs), ArsB and ArsC, which are encoded by the ars operon. However, details of the synthesis of hydrophobic acyl chains, which might serve as starter substrates for the type III polyketide synthases (PKSs), were unknown. Here, we show that two type I fatty acid synthases (FASs), ArsA and ArsD, which are members of the ars operon, are responsible for the biosynthesis of C22–C26 fatty acids from malonyl-CoA. In vivo and in vitro reconstitution of phenolic lipid synthesis systems with the Ars enzymes suggested that the C22–C26 fatty acids produced by ArsA and ArsD remained attached to the ACP domain of ArsA and were transferred hand-to-hand to the active-site cysteine residues of ArsB and ArsC. The type III PKSs then used the fatty acids as starter substrates and carried out two or three extensions with malonyl-CoA to yield the phenolic lipids. The phenolic lipids in A. vinelandii were thus found to be synthesized solely from malonyl-CoA by the four members of the ars operon. This is the first demonstration that a type I FAS interacts directly with a type III PKS through substrate transfer. PMID:18199837

  19. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis.

    PubMed

    Miyanaga, Akimasa; Funa, Nobutaka; Awakawa, Takayoshi; Horinouchi, Sueharu

    2008-01-22

    Alkylresorcinols and alkylpyrones, which have a polar aromatic ring and a hydrophobic alkyl chain, are phenolic lipids found in plants, fungi, and bacteria. In the Gram-negative bacterium Azotobacter vinelandii, phenolic lipids in the membrane of dormant cysts are essential for encystment. The aromatic moieties of the phenolic lipids in A. vinelandii are synthesized by two type III polyketide synthases (PKSs), ArsB and ArsC, which are encoded by the ars operon. However, details of the synthesis of hydrophobic acyl chains, which might serve as starter substrates for the type III polyketide synthases (PKSs), were unknown. Here, we show that two type I fatty acid synthases (FASs), ArsA and ArsD, which are members of the ars operon, are responsible for the biosynthesis of C(22)-C(26) fatty acids from malonyl-CoA. In vivo and in vitro reconstitution of phenolic lipid synthesis systems with the Ars enzymes suggested that the C(22)-C(26) fatty acids produced by ArsA and ArsD remained attached to the ACP domain of ArsA and were transferred hand-to-hand to the active-site cysteine residues of ArsB and ArsC. The type III PKSs then used the fatty acids as starter substrates and carried out two or three extensions with malonyl-CoA to yield the phenolic lipids. The phenolic lipids in A. vinelandii were thus found to be synthesized solely from malonyl-CoA by the four members of the ars operon. This is the first demonstration that a type I FAS interacts directly with a type III PKS through substrate transfer.

  20. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  1. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  2. Synthesis of sulfonate analogs of bile acids.

    PubMed

    Kihira, K; Mikami, T; Ikawa, S; Okamoto, A; Yoshii, M; Miki, S; Mosbach, E H; Hoshita, T

    1992-04-01

    Sulfonate analogs of C23 and C24 bile acids were synthesized from norcholic, norchenodeoxycholic, norursodeoxycholic, nordeoxycholic, norhyodeoxycholic, cholic, deoxycholic, hyodeoxycholic, and lithocholic acids. The principal reactions used were (1) reduction of the bile acids with NaBH4 to the corresponding bile alcohols, (2) selective tosylation of the terminal hydroxyl group, (3) iodination of the tosyl esters with NaI, and (4) treatment of the iodides with Na2SO3 to form the sulfonate analogs of the bile acids. The sulfonate analogs showed polarity similar to that of taurine-conjugated bile acids on thin-layer chromatography. The carbon 13 nuclear magnetic resonance spectral data for the sulfonate analogs were tabulated.

  3. The Molecular Genetics of Mycolic Acid Biosynthesis.

    PubMed

    Pawełczyk, Jakub; Kremer, Laurent

    2014-08-01

    Mycolic acids are major and specific long-chain fatty acids that represent essential components of the Mycobacterium tuberculosis cell envelope. They play a crucial role in the cell wall architecture and impermeability, hence the natural resistance of mycobacteria to most antibiotics, and represent key factors in mycobacterial virulence. Biosynthesis of mycolic acid precursors requires two types of fatty acid synthases (FASs), the eukaryotic-like multifunctional enzyme FAS I and the acyl carrier protein (ACP)-dependent FAS II systems, which consists of a series of discrete mono-functional proteins, each catalyzing one reaction in the pathway. Unlike FAS II synthases of other bacteria, the mycobacterial FAS II is incapable of de novo fatty acid synthesis from acetyl-coenzyme A, but instead elongates medium-chain-length fatty acids previously synthesized by FAS I, leading to meromycolic acids. In addition, mycolic acid subspecies with defined biological properties can be distinguished according to the chemical modifications decorating the meromycolate. Nearly all the genetic components involved in both elongation and functionalization of the meromycolic acid have been identified and are generally clustered in distinct transcriptional units. A large body of information has been generated on the enzymology of the mycolic acid biosynthetic pathway and on their genetic and biochemical/structural characterization as targets of several antitubercular drugs. This chapter is a comprehensive overview of mycolic acid structure, function, and biosynthesis. Special emphasis is given to recent work addressing the regulation of mycolic acid biosynthesis, adding new insights to our understanding of how pathogenic mycobacteria adapt their cell wall composition in response to environmental changes.

  4. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  5. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  6. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  7. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  8. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  9. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  10. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  11. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  12. Fas/FasL pathway-mediated alveolar macrophage apoptosis involved in human silicosis

    PubMed Central

    Yao, San-qiao; Rojanasakul, Liying Wang; Chen, Zhi-yuan; Xu, Ying-jun; Bai, Yu-ping; Chen, Gang; Zhang, Xi-ying; Zhang, Chun-min; Yu, Yan-qin; Shen, Fu-hai; Yuan, Ju-xiang; Chen, Jie

    2016-01-01

    In vitro and in vivo studies have demonstrated that lung cell apoptosis is associated with lung fibrosis; however the relationship between apoptosis of alveolar macrophages (AMs) and human silicosis has not been addressed. In the present study, AM apoptosis was determined in whole-lung lavage fluid from 48 male silicosis patients, 13 male observers, and 13 male healthy volunteers. The relationships between apoptosis index (AI) and silica exposure history, soluble Fas (sFas)/membrane-bound Fas (mFas), and caspase-3/caspase-8 were analyzed. AI, mFas, and caspase-3 were significantly higher in lung lavage fluids from silicosis patients than those of observers or healthy volunteers, but the level of sFas demonstrated a decreasing trend. AI was related to silica exposure, upregulation of mFas, and activation of caspase-3 and -8, as well as influenced by smoking status after adjusting for confounding factors. These results indicate that AM apoptosis could be used as a potential biomarker for human silicosis, and the Fas/FasL pathway may regulate this process. The present data from human lung lavage samples may help to understand the mechanism of silicosis and in turn lead to strategies for preventing or treating this disease. PMID:21910009

  13. Osteoprotegerin Induces Apoptosis of Osteoclasts and Osteoclast Precursor Cells via the Fas/Fas Ligand Pathway.

    PubMed

    Liu, Wei; Xu, Chao; Zhao, Hongyan; Xia, Pengpeng; Song, Ruilong; Gu, Jianhong; Liu, Xuezhong; Bian, Jianchun; Yuan, Yan; Liu, Zongping

    2015-01-01

    Osteoprotegerin (OPG) is known to inhibit differentiation and activation of osteoclasts (OCs) by functioning as a decoy receptor blocking interactions between RANK and RANKL. However, the exact role of OPG in the survival/apoptosis of OCs remains unclear. OPG caused increased rates of apoptosis of both OCs and osteoclast precursor cells (OPCs). The expression of Fas and activated caspase-8 was increased by both 20 ng/mL and 40 ng/mL of OPG, but was markedly decreased at 80 ng/mL. Interestingly, we noted that while levels of Fas ligand (FasL) increased with increasing doses of OPG, the soluble form of FasL in the supernatant decreased. The results of a co-immunoprecipitation assay suggested that the decrease of sFasL might be caused by the binding of OPG. This would block the inhibition of the apoptosis of OCs and OPCs. Furthermore, changes in expression levels of Bax/Bcl-2, cleaved-caspase-9, cleaved-caspased-3 and the translocation of cytochrome c, illustrated that OPG induced apoptosis of OCs and OPCs via the classic Fas/FasL apoptosis pathway, and was mediated by mitochondria. Altogether, our results demonstrate that OPG induces OCs and OPCs apoptosis partly by the Fas/FasL signaling pathway.

  14. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  15. Orthogonal Fatty Acid Biosynthetic Pathway Improves Fatty Acid Ethyl Ester Production in Saccharomyces cerevisiae.

    PubMed

    Eriksen, Dawn T; HamediRad, Mohammad; Yuan, Yongbo; Zhao, Huimin

    2015-07-17

    Fatty acid ethyl esters (FAEEs) are a form of biodiesel that can be microbially produced via a transesterification reaction of fatty acids with ethanol. The titer of microbially produced FAEEs can be greatly reduced by unbalanced metabolism and an insufficient supply of fatty acids, resulting in a commercially inviable process. Here, we report on a pathway engineering strategy in Saccharomyces cerevisiae for enhancing the titer of microbially produced FAEEs by providing the cells with an orthogonal route for fatty acid synthesis. The fatty acids generated from this heterologous pathway would supply the FAEE production, safeguarding endogenous fatty acids for cellular metabolism and growth. We investigated the heterologous expression of a Type-I fatty acid synthase (FAS) from Brevibacterium ammoniagenes coupled with WS/DGAT, the wax ester synthase/acyl-coenzyme that catalyzes the transesterification reaction with ethanol. Strains harboring the orthologous fatty acid synthesis yielded a 6.3-fold increase in FAEE titer compared to strains without the heterologous FAS. Variations in fatty acid chain length and degree of saturation can affect the quality of the biodiesel; therefore, we also investigated the diversity of the fatty acid production profile of FAS enzymes from other Actinomyces organisms. PMID:25594225

  16. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  17. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  18. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  19. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats.

  20. Increased FasL expression correlates with apoptotic changes in granulocytes cultured with oxidized clozapine

    SciTech Connect

    Husain, Zaheed; Almeciga, Ingrid; Delgado, Julio C.; Clavijo, Olga P.; Castro, Januario E.; Belalcazar, Viviana; Pinto, Clara; Zuniga, Joaquin; Romero, Viviana; Yunis, Edmond J. . E-mail: edmond_yunis@dfci.harvard.edu

    2006-08-01

    Clozapine has been associated with a 1% incidence of agranulocytosis. The formation of an oxidized intermediate clozapine metabolite has been implicated in direct polymorphonuclear (PMN) toxicity. We utilized two separate systems to analyze the role of oxidized clozapine in inducing apoptosis in treated cells. Human PMN cells incubated with clozapine (0-10 {mu}M) in the presence of 0.1 mM H{sub 2}O{sub 2} demonstrated a progressive decrease of surface CD16 expression along with increased apoptosis. RT-PCR analysis showed decreased CD16 but increased FasL gene expression in clozapine-treated PMN cells. No change in constitutive Fas expression was observed in treated cells. In HL-60 cells induced to differentiate with retinoic acid (RA), a similar increase in FasL expression, but no associated changes in CD16 gene expression, was observed following clozapine treatments. Our results demonstrate increased FasL gene expression in oxidized clozapine-induced apoptotic neutrophils suggesting that apoptosis in granulocytes treated with clozapine involves Fas/FasL interaction that initiates a cascade of events leading to clozapine-induced agranulocytosis.

  1. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  2. Novel synthesis of steryl esters from phytosterols and amino Acid.

    PubMed

    Pang, Min; Jiang, Shaotong; Cao, Lili; Pan, Lijun

    2011-10-12

    The feasibility of esterification of phytosterol with the amino acid l-glutamic acid was established. The influence of various organic solvents was investigated, and n-butanol was selected as an ideal solvent for phytosteryl esters synthesis with l-glutamic acid. The reaction conditions were further optimized by orthogonal experiments, and a 92.3% degree of esterification was obtained when optimum conditions were used. FT-IR spectral, GC-MS, and NMR analyses were adopted to determine the steryl esters of l-glutamic acid. The FT-IR spectrum indicated the presence of ester bonds in the phytosteryl esters with l-glutamic acid, and on the basis of the detailed mass spectrography analysis, GC-MS and NMR offered an efficient and reliable way to confirm the steryl esters. This novel synthesis approach of phytosteryl esters with amino acid supplied a promising alternative to the substrate on esterification of phytosterols and thus can be readily applied to further studies of functional food ingredients of phytosteryl esters.

  3. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  4. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  5. Fas and FasL expression in the spinal cord following cord hemisection in the monkey.

    PubMed

    Jia, Liu; Yu, Zou; Hui, Li; Yu-Guang, Guan; Xin-Fu, Zhou; Chao, You; Yanbin, Xiyang; Xi, Zhan; Jun, Wang; Xin-Hua, Heng; Xin-Hua, Hen; Ting-Hua, Wang

    2011-03-01

    The changes of endogenous Fas/FasL in injured spinal cord, mostly in primates, are not well known. In this study, we investigated the temporal changes in the expression of Fas and FasL and explored their possible roles in the ventral horn of the spinal cord and associated precentral gyrus following T(11) spinal cord hemisection in the adult rhesus monkey. A significant functional improvement was seen with the time going on in monkeys subjected to cord hemisection. Apoptotic cells were also seen in the ventral horn of injured spinal cord with TUNEL staining, and a marked increase presents at 7 days post operation (dpo). Simultaneously, the number of Fas and FasL immunoreactive neurons in the spinal cords caudal and rostral to injury site and their intracellular optical density (OD) in the ipsilateral side of injury site at 7 dpo increased significantly more than that of control group and contralateral sides. This was followed by a decrease and returned to normal level at 60 dpo. No positive neurons were observed in precentral gyrus. The present results may provide some insights to understand the role of Fas/FasL in the spinal cord but not motor cortex with neuronal apoptosis and neuroplasticity in monkeys subjected to hemisection spinal cord injury. PMID:21181266

  6. FAS and FAS-L Genotype and Expression in Patients With Recurrent Pregnancy Loss

    PubMed Central

    Banzato, Priscilla Chamelete Andrade; Daher, Silvia; Traina, Évelyn; Torloni, Maria Regina; Gueuvoghlanian-Silva, Bárbara Yasmin; Puccini, Renata Fiorini; Pendeloski, Karen Priscilla Tezotto

    2013-01-01

    We assessed FAS and FAS-L gene polymorphisms and messenger RNA (mRNA) levels in patients with recurrent pregnancy loss (RPL). This case–control study compared 129 women with RPL with 235 healthy multiparous women (control group). Genomic DNA and total mRNA were extracted from whole blood, and polymorphisms genotyping was performed by polymerase chain reaction (PCR). Messenger RNA expression levels were analyzed by real-time PCR. Data were analyzed by chi-square and Fisher exact tests; P < .05 was considered significant. There were no significant differences in the FAS (670 A/G) genotype or allelic frequencies between the RPL and control groups. We found significant differences in the FAS-L (844 C/T) genotype and allelic frequencies between women with RPL and controls. Patients with RPL had significantly higher FAS-L expression. Our data suggest that FAS-L gene polymorphism is associated with increased susceptibility to RPL. Moreover, women with RPL seem to abnormally express FAS-FAS-L molecules. PMID:23420824

  7. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  8. Fatty acid profiles of ecotypes of hyperaccumulator Noccaea caerulescens growing under cadmium stress.

    PubMed

    Zemanová, Veronika; Pavlík, Milan; Kyjaková, Pavlína; Pavlíková, Daniela

    2015-05-15

    Changes in the fatty acid (FAs) composition in response to the extent of Cd contamination of soils (0, 30, 60 and 90 mg Cd kg(-1)) differed between ecotypes of Noccaea caerulescens originating from France - Ganges, Slovenia - Mežica and Austria - Redlschlag. Mežica ecotype accumulated more Cd in aboveground biomass compared to Ganges and Redlschlag ecotypes. Hyperaccumulators contained saturated fatty acids (SFAs) rarely occurring in plants, as are cerotic (26:0), montanic (28:0), melissic (30:0) acids, and unusual unsaturated fatty acids (USFAs), as are 16:2, 16:3, 20:2 and 20:3. Typical USFAs occurring in the family Brassicaceae, such as erucic, oleic and arachidonic acids, were missing in tested plants. Our results clearly indicate a relationship between Cd accumulation and the FAs composition. The content of SFAs decreased and the content of USFAs increased in aboveground biomass of Ganges and Mežica ecotypes with increasing Cd concentration. Opposite trend of FAs content was determined in Redlschlag ecotype. Linoleic (18:2n-6), α-linolenic (18:3n-3) and palmitic (16:0) acids were found in all ecotypes. The results observed in N. caerulescens ecotypes, showed that mainly Mežica ecotype has an efficient defense strategies which can be related on changes in FAs composition, mainly in VLCFAs synthesis. The most significant effect of ecotype on FAs composition was confirmed using multivariate analysis of variance. PMID:25886397

  9. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  10. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  11. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  12. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  13. Is Acetylcarnitine a Substrate for Fatty Acid Synthesis in Plants?

    PubMed

    Roughan, G.; Post-Beittenmiller, D.; Ohlrogge, J.; Browse, J.

    1993-04-01

    Long-chain fatty acid synthesis from [1-14C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-14C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-14C]-Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-14C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-14C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-14C]acetylcarnitine and 47 to 57% of the [1-14C]acetate taken up was incorporated into lipids. Most (78-82%) of the [1-14C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants.

  14. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  15. Fatty acid synthesis: from CO2 to functional genomics.

    PubMed

    Ohlrogge, J; Pollard, M; Bao, X; Focke, M; Girke, T; Ruuska, S; Mekhedov, S; Benning, C

    2000-12-01

    For over 25 years there has been uncertainty over the pathway from CO(2) to acetyl-CoA in chloroplasts. On the one hand, free acetate is the most effective substrate for fatty acid synthesis by isolated chloroplasts, and free acetate concentrations reported in leaf tissue (0.1-1 mM) appear adequate to saturate fatty acid synthase. On the other hand, a clear mechanism to generate sufficient free acetate for fatty acid synthesis is not established and direct production of acetyl-CoA from pyruvate by a plastid pyruvate dehydrogenase seems a more simple and direct path. We have re-examined this question and attempted to distinguish between the alternatives. The kinetics of (13)CO(2) and (14)CO(2) movement into fatty acids and the absolute rate of fatty acid synthesis in leaves was determined in light and dark. Because administered (14)C appears in fatty acids within < 2-3 min our results are inconsistent with a large pool of free acetate as an intermediate in leaf fatty acid synthesis. In addition, these studies provide an estimate of the turnover rate of fatty acid in leaves. Studies similar to the above are more complex in seeds, and some questions about the regulation of plant lipid metabolism seem difficult to solve using conventional biochemical or molecular approaches. For example, we have little understanding of why or how some seeds produce >50% oil whereas other seeds store largely carbohydrate or protein. Major control over complex plant biochemical pathways may only become possible by understanding regulatory networks which provide 'global' control over these pathways. To begin to discover such networks and provide a broad analysis of gene expression in developing oilseeds, we have produced microarrays that display approx. 5000 seed-expressed Arabidopsis genes. Sensitivity of the arrays was 1-2 copies of mRNA/cell. The arrays have been hybridized with probes derived from seeds, leaves and roots, and analysis of expression ratios between the different tissues

  16. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  17. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  18. Synthesis of rosin acid starch catalyzed by lipase.

    PubMed

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2:1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch.

  19. Pterandric acid--its isolation, synthesis and stereochemistry.

    PubMed

    Haleem, Muhammad A; Capellari, Simone C; Sympson, Beryl B; Marsaioli, Anita J

    2015-01-01

    Some plant families have a specialized type of pollination system, with floral lipid rewards for pollinators, which is common. In neotropical Malpighiaceae species like Pterandra pyroidea, this specialized type of pollination system is apparently shifting from floral oils/lipids to pollen reward. Mass spectrometric analysis (GC/MS-EI) indicated that P. pyroidea floral oil has a unique chemical composition, i.e., few fatty acid constituents possessing acetoxy groups at positions 5 and 7, which is distinct from the other floral oils of sympatric Malpighiaceae species. The structure of the major floral oil constituent, a novel fatty acid, anti-5,7-diacetoxydocosanoic acid, was confirmed based on synthesis, mass fragmentation, and 1H and 13C NMR analyses; the compound is herein named pterandric acid.

  20. The Role of Fas/Fas Ligand System in the Pathogenesis of Liver Cirrhosis and Hepatocellular Carcinoma

    PubMed Central

    Hammam, Olfat; Mahmoud, Ola; Zahran, Manal; Aly, Sohair; Hosny, Karim; Helmy, Amira; Anas, Amgad

    2012-01-01

    Background The Fas receptor/ligand system including soluble forms is the most important apoptotic initiator in the liver. Dysregulation of this pathway may contribute to abnormal cell proliferation and cell death and is regarded as one of the mechanisms preventing the immune system from rejecting the tumor cells. Objectives To analyze the role of Fas system Fas/ Fas ligand (Fas/ FasL) in the multi-step process of hepatic fibrosis/carcinogenesis, and to use of the serum markers as possible candidate biomarkers for early detection of hepatocellular carcinoma (HCC). Patients and Methods Ninety patients were enrolled: 30 cases of chronic hepatitis C (CHC) without cirrhosis, 30 cases of CHC with liver cirrhosis, and 30 cases of HCC and hepatitis V virus (HCV) infection. Ten wedge liver biopsies, taken during laparoscopic cholecystectomy, were served as normal controls. Serum soluble Fas (sFas) levels were measured using ELISA technique; Fas and FasL proteins were detected in hepatic tissue by indirect Immuno-histochemical technique (IHC); electron microscopic (EM) and immune electron microscopic examinations were performed for detection of Fas expression on lymphocytes. Results Hepatic expression of both Fas and FasL as well as expression of Fas on separated lymphocytes were significantly increased in the diseased groups (P < 0. 01) compared to the control specimens. The highest expression was noticed in CHC specimens, particularly with the necro-inflammatory activity and advancement of the fibrosis. The sFas in cirrhotic patients and HCC were significantly higher than that in normal controls and CHC without cirrhosis group (P < 0.01). Conclusions Apoptosis and the Fas system were significantly involved in the process of converting liver cirrhosis into hepatocellular carcinoma. Down-regulation of Fas expression, up regulation of FasL expression in hepatocytes, and elevation of serum sFas levels were important in tumor evasion from immune surveillance, and in hepatic

  1. Very long chain fatty acid synthesis in sunflower kernels.

    PubMed

    Salas, Joaquín J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Most common seed oils contain small amounts of very long chain fatty acids (VLCFAs), the main components of oils from species such as Brassica napus or Lunnaria annua. These fatty acids are synthesized from acyl-CoA precursors in the endoplasmic reticulum through the activity of a dissociated enzyme complex known as fatty acid elongase. We studied the synthesis of the arachidic, behenic, and lignoceric VLCFAs in sunflower kernels, in which they account for 1-3% of the saturated fatty acids. These VLCFAs are synthesized from 18:0-CoA by membrane-bound fatty acid elongases, and their biosynthesis is mainly dependent on NADPH equivalents. Two condensing enzymes appear to be responsible for the synthesis of VLCFAs in sunflower kernels, beta-ketoacyl-CoA synthase-I (KCS-I) and beta-ketoacyl-CoA synthase-II (KCS-II). Both of these enzymes were resolved by ion exchange chromatography and display different substrate specificities. While KCS-I displays a preference for 20:0-CoA, 18:0-CoA was more efficiently elongated by KCS-II. Both enzymes have different sensitivities to pH and Triton X-100, and their kinetic properties indicate that both are strongly inhibited by the presence of their substrates. In light of these results, the VLCFA composition of sunflower oil is considered in relation to that in other commercially exploited oils.

  2. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  3. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  4. Stem Cell Therapies for Intervertebral Disc Degeneration: Immune Privilege Reinforcement by Fas/FasL Regulating Machinery.

    PubMed

    Ma, Chi-Jiao; Liu, Xu; Che, Lu; Liu, Zhi-Heng; Samartzis, Dino; Wang, Hai-Qiang

    2015-01-01

    As a main contributing factor to low back pain, intervertebral disc degeneration (IDD) is the fundamental basis for various debilitating spinal diseases. The pros and cons of current treatment modalities necessitate biological treatment strategies targeting for reversing or altering the degeneration process in terms of molecules or genes. The advances in stem cell research facilitate the studies aiming for possible clinical application of stem cell therapies for IDD. Human NP cells are versatile with cell morphology full of variety, capable of synthesizing extracellular matrix components, engulfing substances by autophagy and phagocytosis, mitochondrial vacuolization indicating dysfunction, expressing Fas and FasL as significant omens of immune privileged sites. Human discs belong to immune privilege organs with functional FasL expression, which can interact with invasive immune cells by Fas-FasL regulatory machinery. IDD is characterized by decreased expression level of FasL with dysfunctional FasL, which in turn unbalances the interaction between NP cells and immune cells. Certain modulation factors might play a role in the process, such as miR-155. Accumulating evidence indicates that Fas-FasL network expresses in a variety of stem cells. Given the expression of functional FasL and insensitive Fas in stem cells (we term as FasL privilege), transplantation of stem cells into the disc may regenerate the degenerative disc by not only differentiating into NP-like cells, increasing extracellular matrix, but also reinforce immune privilege via interaction with immune cells by Fas-FasL network.

  5. The signaling pathways by which the Fas/FasL system accelerates oocyte aging

    PubMed Central

    Zhu, Jiang; Lin, Fei-Hu; Zhang, Jie; Lin, Juan; Li, Hong; Li, You-Wei; Tan, Xiu-Wen; Tan, Jing-He

    2016-01-01

    In spite of great efforts, the mechanisms for postovulatory oocyte aging are not fully understood. Although our previous work showed that the FasL/Fas signaling facilitated oocyte aging, the intra-oocyte signaling pathways are unknown. Furthermore, the mechanisms by which oxidative stress facilitates oocyte aging and the causal relationship between Ca2+ rises and caspase-3 activation and between the cell cycle and apoptosis during oocyte aging need detailed investigations. Our aim was to address these issues by studying the intra-oocyte signaling pathways for Fas/FasL to accelerate oocyte aging. The results indicated that sFasL released by cumulus cells activated Fas on the oocyte by increasing reactive oxygen species via activating NADPH oxidase. The activated Fas triggered Ca2+ release from the endoplasmic reticulum by activating phospholipase C-γ pathway and cytochrome c pathway. The cytoplasmic Ca2+ rises activated calcium/calmodulin-dependent protein kinase II (CaMKII) and caspase-3. While activated CaMKII increased oocyte susceptibility to activation by inactivating maturation-promoting factor (MPF) through cyclin B degradation, the activated caspase-3 facilitated further Ca2+ releasing that activates more caspase-3 leading to oocyte fragmentation. Furthermore, caspase-3 activation and fragmentation were prevented in oocytes with a high MPF activity, suggesting that an oocyte must be in interphase to undergo apoptosis. PMID:26869336

  6. In vivo analysis of Fas/FasL interactions in HIV-infected patients.

    PubMed Central

    Badley, A D; Dockrell, D H; Algeciras, A; Ziesmer, S; Landay, A; Lederman, M M; Connick, E; Kessler, H; Kuritzkes, D; Lynch, D H; Roche, P; Yagita, H; Paya, C V

    1998-01-01

    Recent insights into the pharmacological control of HIV replication and the molecular mechanisms of peripheral T cells homeostasis allowed us to investigate in vivo the mechanisms mediating T cell depletion in HIV-infected patients. Before the initiation of highly active antiretroviral therapy (HAART), a high degree of lymphoid tissue apoptosis is present, which is reduced upon HAART initiation (P < 0.001) and directly correlates with reduction of viral load and increases of peripheral T lymphocytes (P < 0.01). Because Fas/FasL interactions play a key role in peripheral T lymphocyte homeostasis, we investigated the susceptibility to Fas-mediated apoptosis in peripheral T lymphocytes and of FasL expression in lymphoid tissue before and during HAART. High levels of Fas-susceptibility found in peripheral CD4 T lymphocytes before HAART were significantly reduced after HAART, coinciding with decreases in viral load (P = 0.018) and increases in peripheral CD4 T lymphocyte counts (P < 0.01). However, the increased FasL expression in the lymphoid tissue of HIV-infected individuals was not reduced after HAART. These results demonstrate that lymphoid tissue apoptosis directly correlates with viral load and peripheral T lymphocyte numbers, and suggest that HIV-induced susceptibility to Fas-dependent apoptosis may play a key role in the regulation of T cell homeostasis in HIV-infected individuals. PMID:9649560

  7. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  8. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  9. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  10. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1). PMID:27519121

  11. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    SciTech Connect

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.

    2013-11-15

    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease.

  12. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described.

  13. A lack of Fas/FasL signalling leads to disturbances in the antiviral response during ectromelia virus infection.

    PubMed

    Bień, K; Sobańska, Z; Sokołowska, J; Bąska, P; Nowak, Z; Winnicka, A; Krzyzowska, M

    2016-04-01

    Ectromelia virus (ECTV) is an orthopoxvirus (OPV) that causes mousepox, the murine equivalent of human smallpox. Fas receptor-Fas ligand (FasL) signaling is involved in apoptosis of immune cells and virus-specific cytotoxicity. The Fas/FasL pathway also plays an important role in controlling the local inflammatory response during ECTV infection. Here, the immune response to the ECTV Moscow strain was examined in Fas (-) (lpr), FasL (-) (gld) and C57BL6 wild-type mice. During ECTV-MOS infection, Fas- and FasL mice showed increased viral titers, decreased total numbers of NK cells, CD4(+) and CD8(+) T cells followed by decreased percentages of IFN-γ expressing NK cells, CD4(+) and CD8(+) T cells in spleens and lymph nodes. At day 7 of ECTV-MOS infection, Fas- and FasL-deficient mice had the highest regulatory T cell (Treg) counts in spleen and lymph nodes in contrast to wild-type mice. Furthermore, at days 7 and 10 of the infection, we observed significantly higher numbers of PD-L1-expressing dendritic cells in Fas (-) and FasL (-) mice in comparison to wild-type mice. Experiments in co-cultures of CD4(+) T cells and bone-marrow-derived dendritic cells showed that the lack of bilateral Fas-FasL signalling led to expansion of Tregs. In conclusion, our results demonstrate that during ECTV infection, Fas/FasL can regulate development of tolerogenic DCs and Tregs, leading to an ineffective immune response. PMID:26780774

  14. Activation of PPARα by Fatty Acid Accumulation Enhances Fatty Acid Degradation and Sulfatide Synthesis.

    PubMed

    Yang, Yang; Feng, Yuyao; Zhang, Xiaowei; Nakajima, Takero; Tanaka, Naoki; Sugiyama, Eiko; Kamijo, Yuji; Aoyama, Toshifumi

    2016-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) catalyzes the first reaction in the mitochondrial fatty acid β-oxidation pathway. VLCAD deficiency is associated with the accumulation of fat in multiple organs and tissues, which results in specific clinical features including cardiomyopathy, cardiomegaly, muscle weakness, and hepatic dysfunction in infants. We speculated that the abnormal fatty acid metabolism in VLCAD-deficient individuals might cause cell necrosis by fatty acid toxicity. The accumulation of fatty acids may activate peroxisome proliferator-activated receptor (PPAR), a master regulator of fatty acid metabolism and a potent nuclear receptor for free fatty acids. We examined six skin fibroblast lines, derived from VLCAD-deficient patients and identified fatty acid accumulation and PPARα activation in these cell lines. We then found that the expression levels of three enzymes involved in fatty acid degradation, including long-chain acyl-CoA synthetase (LACS), were increased in a PPARα-dependent manner. This increased expression of LACS might enhance the fatty acyl-CoA supply to fatty acid degradation and sulfatide synthesis pathways. In fact, the first and last reactions in the sulfatide synthesis pathway are regulated by PPARα. Therefore, we also measured the expression levels of enzymes involved in sulfatide metabolism and the regulation of cellular sulfatide content. The levels of these enzymes and cellular sulfatide content both increased in a PPARα-dependent manner. These results indicate that PPARα activation plays defensive and compensative roles by reducing cellular toxicity associated with fatty acids and sulfuric acid. PMID:27644403

  15. Involvement of the Fas/FasL pathway in the pathogenesis of germ cell tumours of the adult testis.

    PubMed

    Kersemaekers, Anne-Marie F; van Weeren, Pascale C; Oosterhuis, J Wolter; Looijenga, Leendert H J

    2002-04-01

    Induction of apoptosis by Fas ligand (FasL) of Fas-containing cells is a known mechanism involved in the eradication of inappropriate cells during normal development. Alterations of the Fas/FasL pathway have been found in various types of cancer, leading to circumvention of attack of the tumour by the immune system. An alternative way to circumvent eradication by induction of apoptosis is through changes in the downstream inhibitors. For example, Fas-associating phosphatase-1 (Fap-1) binds directly to the Fas receptor and results in a block of the downstream signalling. To shed more light on the role of the Fas/FasL pathway in the development of human testicular germ cell tumours of the adult testis, this study investigated the presence of Fas, FasL, Fap-1, HLA class I and II molecules, CD45 (lymphocyte marker), and CD57 [natural killer (NK) cell marker] by immunohistochemistry on frozen sections of 41 cases of seminomas, non-seminomas, and spermatocytic seminomas. Every germ cell tumour was positive for Fap-1 and negative for HLA classes I and II, like their non-malignant cells of origin. The infiltrating lymphocytes, predominantly present in seminomas, showed consistently positive staining for Fas and CD45, but not for Fap-1. No Fas was found on NK cells. All seminomas and non-seminomas (except teratomas), including their precursor stages, carcinoma in situ, intratubular seminoma and intratubular non-seminoma, showed positive staining for FasL, but not for Fas. Teratoma showed no staining for FasL and was positive for Fas. In contrast, both Fas and FasL were detectable on spermatocytic seminoma. These data indicate a different regulation of the Fas/FasL system in seminoma and spermatocytic seminoma, supporting a separate pathogenesis for these germ cell-derived tumours. The presence of Fap-1 in all histological variants of germ cell tumours might be related to the consistently positive staining in cells of the germ lineage. This study indicates that production of

  16. [Synthesis of new mandelic acid derivatives with preservative action. Synthesis and acute toxicity study].

    PubMed

    Stan, Cătălina; Năstase, V; Pavelescu, M; Vasile, Cornelia; Dumitrache, M; Gherase, Florenţa; Năstasă, Veronica

    2004-01-01

    Starting from the antiseptic action of DL mandelic acid, there were synthesized a series of esters of the mandelic acid, esters which could have preservative action. This study present the synthesis, structure validation and the acute toxicity study, for the new synthesized compounds. The esters were obtained by acylating 4-hydroxybenzoic acid propyl, ethyl, methyl esters and salicylic acid with the DL mandelic chloride (that was protected initially by the hydroxylic group). The structure of the synthesized compounds was confirmed by quantitative elemental analysis and RMN 1H spectral measurements. The acute toxicity was determined for two of the esters, who proved to had a preservative action (previously studied) and indicated that these esters have a small toxicity.

  17. Proteases in Fas-mediated apoptosis.

    PubMed

    Zhivotovsky, B; Burgess, D H; Schlegel, J; Pörn, M I; Vanags, D; Orrenius, S

    1997-01-01

    Involvement of a unique family of cysteine proteases in the multistep apoptotic process has been documented. Cloning of several mammalian genes identifies some components of this cellular response. However, it is currently unclear which protease plays a role as a signal and/or effector of apoptosis. We summarize contributions to the data concerning proteases in Fas-mediated apoptosis.

  18. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  19. Limiting amino acid for protein synthesis with mammary cells in tissue culture.

    PubMed

    Park, C S; Chandler, P T; Norman, A W

    1976-05-01

    To identify the limiting amino acid in the minimal essential medium as published by Eagle (Science 130:432, 1959) for milk protein synthesis in rat mammary cells in tissue culture, two different experimental approaches were used. The first study involved the reduction of amino acids singly from the total amino acid complement of the medium for milk protein synthesis. The second study was to investigate the effect on milk protein synthesis of single amino acid addition to the basic complement of amino acids. Order of limiting amino acids was lysine (first) and possible methionine, valine, or arginine (second).

  20. Fas/FasL in the immune pathogenesis of severe aplastic anemia.

    PubMed

    Liu, C Y; Fu, R; Wang, H Q; Li, L J; Liu, H; Guan, J; Wang, T; Qi, W W; Ruan, E B; Qu, W; Wang, G J; Liu, H; Wu, Y H; Song, J; Xing, L M; Shao, Z H

    2014-05-30

    Fas/FasL protein expression of bone marrow hematopoietic cells was investigated in severe aplastic anemia (SAA) patients. Fas expression was evaluated in CD34(+), GlycoA(+), CD33(+), and CD14(+) cells labeled with monoclonal antibodies in newly diagnosed and remission SAA patients along with normal controls. FasL expression was evaluated in CD8(+) cells in the same manner. In CD34(+) cells, Fas expression was significantly higher in the newly diagnosed SAA group (46.59 ± 27.60%) than the remission (6.12 ± 3.35%; P < 0.01) and control (8.89 ± 7.28%; P < 0.01) groups. In CD14(+), CD33(+), and GlycoA(+) cells, Fas levels were significantly lower in the newly diagnosed SAA group (29.29 ± 9.23, 46.88 ± 14.30, and 15.15 ± 9.26%, respectively) than in the remission (47.23 ± 31.56, 67.22 ± 34.68, and 43.56 ± 26.85%, respectively; P < 0.05) and normal control (51.25 ± 38.36, 72.06 ± 39.88, 50.38 ± 39.88%, respectively; P < 0.05) groups. FasL expression of CD8(+) cells was significantly higher in the newly diagnosed SAA group (89.53 ± 45.68%) than the remission (56.39 ± 27.94%; P < 0.01) and control (48.63 ± 27.38%; P <0.01) groups. No significant differences were observed between the remission and control groups. FasL expression in CD8(+) T cells was significantly higher in newly diagnosed patients, and CD34(+), CD33(+), CD14(+), and GlycoA(+) cells all showed Fas antigen expression. The Fas/FasL pathway might play an important role in excessive hematopoietic cell apoptosis in SAA bone marrow. Furthermore, CD34(+) cells are likely the main targets of SAA immune injury.

  1. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  2. Trifluoperazine regulation of calmodulin binding to Fas: a computational study.

    PubMed

    Pan, Di; Yan, Qi; Chen, Yabing; McDonald, Jay M; Song, Yuhua

    2011-08-01

    Death-inducing signaling complex (DISC) formation is a critical step in Fas-mediated signaling for apoptosis. Previous experiments have demonstrated that the calmodulin (CaM) antagonist, trifluoperazine (TFP) regulates CaM-Fas binding and affects Fas-mediated DISC formation. In this study, we investigated the anti-cooperative characteristics of TFP binding to CaM and the effect of TFP on the CaM-Fas interaction from both structural and thermodynamic perspectives using combined molecular dynamics simulations and binding free energy analyses. We studied the interactions of different numbers of TFP molecules with CaM and explored the effects of the resulting conformational changes in CaM on CaM-Fas binding. Results from these analyses showed that the number of TFP molecules bound to CaM directly influenced α-helix formation and hydrogen bond occupancy within the α-helices of CaM, contributing to the conformational and motion changes in CaM. These changes affected CaM binding to Fas, resulting in secondary structural changes in Fas and conformational and motion changes of Fas in CaM-Fas complexes, potentially perturbing the recruitment of Fas-associated death domain for DISC formation. The computational results from this study reveal the structural and molecular mechanisms that underlie the role of the CaM antagonist, TFP, in regulation of CaM-Fas binding and Fas-mediated DISC formation in a concentration-dependent manner.

  3. 7 CFR 1484.70 - Must Cooperators report to FAS?

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ..., DEPARTMENT OF AGRICULTURE EXPORT PROGRAMS PROGRAMS TO HELP DEVELOP FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Reporting, Evaluation, and Compliance § 1484.70 Must Cooperators report to FAS? (a) End-of-year... is available on the FAS home page (http://www.fas.usda.gov/mos/programs/fnotice.html) on the...

  4. 7 CFR 1484.70 - Must Cooperators report to FAS?

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ..., DEPARTMENT OF AGRICULTURE EXPORT PROGRAMS PROGRAMS TO HELP DEVELOP FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Reporting, Evaluation, and Compliance § 1484.70 Must Cooperators report to FAS? (a) End-of-year... is available on the FAS home page (http://www.fas.usda.gov/mos/programs/fnotice.html) on the...

  5. 7 CFR 1484.70 - Must Cooperators report to FAS?

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ..., DEPARTMENT OF AGRICULTURE EXPORT PROGRAMS PROGRAMS TO HELP DEVELOP FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Reporting, Evaluation, and Compliance § 1484.70 Must Cooperators report to FAS? (a) End-of-year... is available on the FAS home page (http://www.fas.usda.gov/mos/programs/fnotice.html) on the...

  6. Inhibitory effects of onion (Allium cepa L.) extract on proliferation of cancer cells and adipocytes via inhibiting fatty acid synthase.

    PubMed

    Wang, Yi; Tian, Wei-Xi; Ma, Xiao-Feng

    2012-01-01

    Onions (Allium cepa L.) are widely used in the food industry for its nutritional and aromatic properties. Our studies showed that ethyl acetate extract of onion (EEO) had potent inhibitory effects on animal fatty acid synthase (FAS), and could induce apoptosis in FAS over-expressing human breast cancer MDA-MB-231 cells. Furthermore, this apoptosis was accompanied by reduction of intracellular FAS activity and could be rescued by 25 mM or 50 mM exogenous palmitic acids, the final product of FAS catalyzed synthesis. These results suggest that the apoptosis induced by EEO occurs via inhibition of FAS. We also found that EEO could suppress lipid accumulation during the differentiation of 3T3-L1 adipocytes, which was also related to its inhibition of intracellular FAS activity. Since obesity is closely related to breast cancer and obese patients are at elevated risk of developing various cancers, these findings suggested that onion might be useful for preventing obesity-related malignancy.

  7. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  8. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  9. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  10. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  11. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  12. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  13. Fatty acid synthesis and oxidation in cumulus cells support oocyte maturation in bovine.

    PubMed

    Sanchez-Lazo, Laura; Brisard, Daphné; Elis, Sébastien; Maillard, Virginie; Uzbekov, Rustem; Labas, Valérie; Desmarchais, Alice; Papillier, Pascal; Monget, Philippe; Uzbekova, Svetlana

    2014-09-01

    Oocyte meiotic maturation requires energy from various substrates including glucose, amino acids, and lipids. Mitochondrial fatty acid (FA) β-oxidation (FAO) in the oocyte is required for meiotic maturation, which is accompanied by differential expression of numerous genes involved in FAs metabolism in surrounding cumulus cells (CCs) in vivo. The objective was to elucidate components involved in FAs metabolism in CCs during oocyte maturation. Twenty-seven genes related to lipogenesis, lipolysis, FA transport, and FAO were chosen from comparative transcriptome analysis of bovine CCs before and after maturation in vivo. Using real-time PCR, 22 were significantly upregulated at different times of in vitro maturation (IVM) in relation to oocyte meiosis progression from germinal vesicle breakdown to metaphase-II. Proteins FA synthase, acetyl-coenzyme-A carboxylase, carnitine palmitoyltransferase, perilipin 2, and FA binding protein 3 were detected by Western blot and immunolocalized to CCs and oocyte cytoplasm, with FA binding protein 3 concentrated around oocyte chromatin. By mass spectrometry, CCs lipid profiling was shown to be different before and after IVM. FAO inhibitors etomoxir and mildronate dose-dependently decreased the oocyte maturation rate in vitro. In terms of viability, cumulus enclosed oocytes were more sensitive to etomoxir than denuded oocytes. In CCs, etomoxir (150 μM) led to downregulation of lipogenesis genes and upregulated lipolysis and FAO genes. Moreover, the number of lipid droplets decreased, whereas several lipid species were more abundant compared with nontreated CCs after IVM. In conclusion, FAs metabolism in CCs is important to maintain metabolic homeostasis and may influence meiosis progression and survival of enclosed oocytes. PMID:25058602

  14. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  15. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  16. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  17. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  18. A novel gene coding for a Fas apoptosis inhibitory molecule (FAIM) isolated from inducibly Fas-resistant B lymphocytes.

    PubMed

    Schneider, T J; Fischer, G M; Donohoe, T J; Colarusso, T P; Rothstein, T L

    1999-03-15

    The sensitivity of primary splenic B cells to Fas-mediated apoptosis is modulated in a receptor-specific fashion. Here we used a differential display strategy to detect cDNAs present in B cells rendered Fas resistant but absent in those rendered Fas sensitive. This led to the cloning and characterization of a novel 1.2-kb gene that encodes a Fas apoptosis inhibitory molecule (FAIM). faim-transfected BAL-17 B lymphoma cells were less sensitive by half or more to Fas-mediated apoptosis than were vector-transfected controls, using Fas ligand-bearing T cells or a cytotoxic anti-Fas antibody to trigger Fas, and this was associated with inhibition of Fas- induced poly-ADP ribose polymerase (PARP) cleavage. In primary B cells, the time course of faim mRNA and FAIM protein expression correlated with the induction of Fas resistance by surface (s)Ig engagement. Thus, FAIM is an inducible effector molecule that mediates Fas resistance produced by sIg engagement in B cells. However, faim is broadly expressed in various tissues and the faim sequence is highly conserved evolutionarily, suggesting that its role extends beyond lymphocyte homeostasis. As FAIM has no significant regions of homology to other gene products that modulate Fas killing, it appears to represent a distinct, new class of antiapoptotic protein.

  19. Fatty acid synthase is preferentially degraded by autophagy upon nitrogen starvation in yeast

    PubMed Central

    Shpilka, Tomer; Welter, Evelyn; Borovsky, Noam; Amar, Nira; Shimron, Frida; Peleg, Yoav; Elazar, Zvulun

    2015-01-01

    Autophagy, an evolutionarily conserved intracellular catabolic process, leads to the degradation of cytosolic proteins and organelles in the vacuole/lysosome. Different forms of selective autophagy have recently been described. Starvation-induced protein degradation, however, is considered to be nonselective. Here we describe a novel interaction between autophagy-related protein 8 (Atg8) and fatty acid synthase (FAS), a pivotal enzymatic complex responsible for the entire synthesis of C16- and C18-fatty acids in yeast. We show that although FAS possesses housekeeping functions, under starvation conditions it is delivered to the vacuole for degradation by autophagy in a Vac8- and Atg24-dependent manner. We also provide evidence that FAS degradation is essential for survival under nitrogen deprivation. Our results imply that during nitrogen starvation specific proteins are preferentially recruited into autophagosomes PMID:25605918

  20. Polyunsaturated fatty acid levels in blood during pregnancy, at birth and at 7 years: their associations with two common FADS2 polymorphisms

    PubMed Central

    Steer, Colin D.; Hibbeln, Joseph R.; Golding, Jean; Davey Smith, George

    2012-01-01

    Minor alleles of polymorphisms in the fatty acid desaturase (FADS) gene cluster have been associated with reduced desaturation of the precursor polyunsaturated fatty acids (FAs) in small studies. The effects of these polymorphisms during progressive developmental stages have not previously been reported. Data from blood samples for 4342 pregnant women, 3343 umbilical cords reflecting the newborn's blood supply and 5240 children aged 7 years were analysed to investigate the associations of polyunsaturated FAs with rs1535 and rs174575—two polymorphisms in the FADS2 gene. Strong positive associations were observed between the minor G allele for these two markers, especially rs1535, and the substrates linoleic (18:2n-6) and α-linolenic (18:3n-3) acid. Negative associations were observed for the more highly unsaturated FAs such as arachidonic acid (20:4n-6), timnodonic acid (EPA, 20:5n-3) and cervonic acid (DHA, 22:6n-3). Bivariable genetic associations using the mother and child genotypes suggested that the newborn metabolism had a greater capacity to synthesize the more highly unsaturated omega-6 FAs than the more highly unsaturated omega-3 FAs. Nevertheless, despite the immaturity of the neonate, there was evidence that synthesis of DHA was occurring. However, by 7 years, no associations were observed with the maternal genotype. This suggested that the children's FA levels were related only to their own metabolism with no apparent lasting influences of the in utero environment. PMID:22194195

  1. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  2. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  3. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  4. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    SciTech Connect

    Amikam, D.; Benziman, M. )

    1989-12-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of {sup 32}P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with ({sup 14}C)glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes.

  5. A novel interaction linking the FAS-II and phthiocerol dimycocerosate (PDIM) biosynthetic pathways.

    PubMed

    Kruh, Nicole A; Borgaro, Janine G; Ruzsicska, Béla P; Xu, Hua; Tonge, Peter J

    2008-11-14

    The fatty acid biosynthesis (FAS-II) pathway in Mycobacterium tuberculosis generates long chain fatty acids that serve as the precursors to mycolic acids, essential components of the mycobacterial cell wall. Enzymes in the FAS-II pathway are thought to form one or more noncovalent multi-enzyme complexes within the cell, and a bacterial two-hybrid screen was used to search for missing components of the pathway and to furnish additional data on interactions involving these enzymes in vivo. Using the FAS-II beta-ketoacyl synthase, KasA, as bait, an extensive bacterial two-hybrid screen of a M. tuberculosis genome fragment library unexpectedly revealed a novel interaction between KasA and PpsB as well as PpsD, two polyketide modules involved in the biosynthesis of the virulence lipid phthiocerol dimycocerosate (PDIM). Sequence analysis revealed that KasA interacts with PpsB and PpsD in the region of the acyl carrier domain of each protein, raising the possibility that lipids could be transferred between the FAS-II and PDIM biosynthetic pathways. Subsequent studies utilizing purified proteins and radiolabeled lipids revealed that fatty acids loaded onto PpsB were transferred to KasA and also incorporated into long chain fatty acids synthesized using a Mycobacterium smegmatis lysate. These data suggest that in addition to producing PDIMs, the growing phthiocerol product can also be shuttled into the FAS-II pathway via KasA as an entry point for further elongation. Interactions between these biosynthetic pathways may exist as a simple means to increase mycobacterial lipid diversity, enhancing functionality and the overall complexity of the cell wall. PMID:18703500

  6. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  7. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  8. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  9. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  10. Baker's Yeast Deficient in Storage Lipid Synthesis Uses cis-Vaccenic Acid to Reduce Unsaturated Fatty Acid Toxicity.

    PubMed

    Sec, Peter; Garaiova, Martina; Gajdos, Peter; Certik, Milan; Griac, Peter; Hapala, Ivan; Holic, Roman

    2015-07-01

    The role of cis-vaccenic acid (18:1n-7) in the reduction of unsaturated fatty acids toxicity was investigated in baker's yeast Saccharomyces cerevisiae. The quadruple mutant (QM, dga1Δ lro1Δ are1Δ are2Δ) deficient in enzymes responsible for triacylglycerol and steryl ester synthesis has been previously shown to be highly sensitive to exogenous unsaturated fatty acids. We have found that cis-vaccenic acid accumulated during cultivation in the QM cells but not in the corresponding wild type strain. This accumulation was accompanied by a reduction in palmitoleic acid (16:1n-7) content in the QM cells that is consistent with the proposed formation of cis-vaccenic acid by elongation of palmitoleic acid. Fatty acid analysis of individual lipid classes from the QM strain revealed that cis-vaccenic acid was highly enriched in the free fatty acid pool. Furthermore, production of cis-vaccenic acid was arrested if the mechanism of fatty acids release to the medium was activated. We also showed that exogenous cis-vaccenic acid did not affect viability of the QM strain at concentrations toxic for palmitoleic or oleic acids. Moreover, addition of cis-vaccenic acid to the growth medium provided partial protection against the lipotoxic effects of exogenous oleic acid. Transformation of palmitoleic acid to cis-vaccenic acid is thus a rescue mechanism enabling S. cerevisiae cells to survive in the absence of triacylglycerol synthesis as the major mechanism for unsaturated fatty acid detoxification.

  11. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life.

  12. Inactivation of hypothalamic FAS protects mice from diet-induced obesity and inflammation.

    PubMed

    Chakravarthy, Manu V; Zhu, Yimin; Yin, Li; Coleman, Trey; Pappan, Kirk L; Marshall, Connie A; McDaniel, Michael L; Semenkovich, Clay F

    2009-04-01

    Obesity promotes insulin resistance and chronic inflammation. Disrupting any of several distinct steps in lipid synthesis decreases adiposity, but it is unclear if this approach coordinately corrects the environment that propagates metabolic disease. We tested the hypothesis that inactivation of FAS in the hypothalamus prevents diet-induced obesity and systemic inflammation. Ten weeks of high-fat feeding to mice with inactivation of FAS (FASKO) limited to the hypothalamus and pancreatic beta cells protected them from diet-induced obesity. Though high-fat fed FASKO mice had no beta-cell phenotype, they were hypophagic and hypermetabolic, and they had increased insulin sensitivity at the liver but not the periphery as demonstrated by hyperinsulinemic-euglycemic clamps, and biochemically by increased phosphorylated Akt, glycogen synthase kinase-3beta, and FOXO1 compared with wild-type mice. High-fat fed FASKO mice had decreased excretion of urinary isoprostanes, suggesting less oxidative stress and blunted tumor necrosis factor alpha (TNFalpha) and interleukin-6 (IL-6) responses to endotoxin, suggesting less systemic inflammation. Pair-feeding studies demonstrated that these beneficial effects were dependent on central FAS disruption and not merely a consequence of decreased adiposity. Thus, inducing central FAS deficiency may be a valuable integrative strategy for treating several components of the metabolic syndrome, in part by correcting hepatic insulin resistance and suppressing inflammation.

  13. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  14. Intracellular Triggering of Fas Aggregation and Recruitment of Apoptotic Molecules into Fas-enriched Rafts in Selective Tumor Cell Apoptosis

    PubMed Central

    Gajate, Consuelo; del Canto-Jañez, Esther; Acuña, A. Ulises; Amat-Guerri, Francisco; Geijo, Emilio; Santos-Beneit, Antonio M.; Veldman, Robert J.; Mollinedo, Faustino

    2004-01-01

    We have discovered a new and specific cell-killing mechanism mediated by the selective uptake of the antitumor drug 1-O-octadecyl-2-O-methyl-rac-glycero-3-phosphocholine (ET-18-OCH3, Edelfosine) into lipid rafts of tumor cells, followed by its coaggregation with Fas death receptor (also known as APO-1 or CD95) and recruitment of apoptotic molecules into Fas-enriched rafts. Drug sensitivity was dependent on drug uptake and Fas expression, regardless of the presence of other major death receptors, such as tumor necrosis factor (TNF) receptor 1 or TNF-related apoptosis-inducing ligand R2/DR5 in the target cell. Drug microinjection experiments in Fas-deficient and Fas-transfected cells unable to incorporate exogenous ET-18-OCH3 demonstrated that Fas was intracellularly activated. Partial deletion of the Fas intracellular domain prevented apoptosis. Unlike normal lymphocytes, leukemic T cells incorporated ET-18-OCH3 into rafts coaggregating with Fas and underwent apoptosis. Fas-associated death domain protein, procaspase-8, procaspase-10, c-Jun amino-terminal kinase, and Bid were recruited into rafts, linking Fas and mitochondrial signaling routes. Clustering of rafts was necessary but not sufficient for ET-18-OCH3–mediated cell death, with Fas being required as the apoptosis trigger. ET-18-OCH3–mediated apoptosis did not require sphingomyelinase activation. Normal cells, including human and rat hepatocytes, did not incorporate ET-18-OCH3 and were spared. This mechanism represents the first selective activation of Fas in tumor cells. Our data set a framework for the development of more targeted therapies leading to intracellular Fas activation and recruitment of downstream signaling molecules into Fas-enriched rafts. PMID:15289504

  15. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  16. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  17. New stabilized FastPrep-CLEAs for sialic acid synthesis.

    PubMed

    García-García, María Inmaculada; Sola-Carvajal, Agustín; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2011-05-01

    N-acetyl-D-neuraminic acid aldolase, a key enzyme in the biotechnological production of N-acetyl-D-neuraminic acid (sialic acid) from N-acetyl-D-mannosamine and pyruvate, was immobilized as cross-linked enzyme aggregates (CLEAs) by precipitation with 90% ammonium sulfate and crosslinking with 1% glutaraldehyde. Because dispersion in a reciprocating disruptor (FastPrep) was only able to recover 40% of the activity, improved CLEAs were then prepared by co-aggregation of the enzyme with 10mg/mL bovine serum albumin followed by a sodium borohydride treatment and final disruption by FastPrep (FastPrep-CLEAs). This produced a twofold increase in activity up to 86%, which is a 30% more than that reported for this aldolase in cross-linked inclusion bodies (CLIBs). In addition, these FastPrep-CLEAs presented remarkable biotechnological features for Neu5Ac synthesis, including, good activity and stability at alkaline pHs, a high K(M) for ManNAc (lower for pyruvate) and good operational stability. These results reinforce the practicability of using FastPrep-CLEAs in biocatalysis, thus reducing production costs and favoring reusability.

  18. Construction of a cyanobacterium synthesizing cyclopropane fatty acids.

    PubMed

    Machida, Shuntaro; Shiraiwa, Yoshihiro; Suzuki, Iwane

    2016-09-01

    Microalgae have received much attention as a next-generation source of biomass energy. However, most of the fatty acids (FAs) from microalgae are multiply unsaturated; thus, the biofuels derived from them are fluid, but vulnerable to oxidation. In this study, we attempted to synthesize cyclopropane FAs in the cyanobacterium Synechocystis sp. PCC 6803 by expressing the cfa gene for cyclopropane FA synthase from Escherichia coli with the aim of producing FAs that are fluid and stable in response to oxidization. We successfully synthesized cyclopropane FAs in Synechocystis with a yield of ~30% of total FAs. Growth of the transformants was altered, particularly at low temperatures, but photosynthesis and respiration were not significantly affected. C16:1(∆9) synthesis in the desA(-)/desD(-) strain by expression of the desC2 gene for sn-2 specific ∆9 desaturase positively affected growth at low temperatures via promotion of various cellular processes, with the exceptions of photosynthesis and respiration. Estimation of the apparent activities of desaturases suggested that some acyl-lipid desaturases might recognize the lipid side chain. PMID:27263419

  19. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  20. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  1. Mass Spectrometry-Based Systems Approach for Identification of Inhibitors of Plasmodium falciparum Fatty Acid Synthase▿

    PubMed Central

    Sharma, Shilpi; Sharma, Shailendra Kumar; Modak, Rahul; Karmodiya, Krishanpal; Surolia, Namita; Surolia, Avadhesha

    2007-01-01

    The emergence of strains of Plasmodium falciparum resistant to the commonly used antimalarials warrants the development of new antimalarial agents. The discovery of type II fatty acid synthase (FAS) in Plasmodium distinct from the FAS in its human host (type I FAS) opened up new avenues for the development of novel antimalarials. The process of fatty acid synthesis takes place by iterative elongation of butyryl-acyl carrier protein (butyryl-ACP) by two carbon units, with the successive action of four enzymes constituting the elongation module of FAS until the desired acyl length is obtained. The study of the fatty acid synthesis machinery of the parasite inside the red blood cell culture has always been a challenging task. Here, we report the in vitro reconstitution of the elongation module of the FAS of malaria parasite involving all four enzymes, FabB/F (β-ketoacyl-ACP synthase), FabG (β-ketoacyl-ACP reductase), FabZ (β-ketoacyl-ACP dehydratase), and FabI (enoyl-ACP reductase), and its analysis by matrix-assisted laser desorption-time of flight mass spectrometry (MALDI-TOF MS). That this in vitro systems approach completely mimics the in vivo machinery is confirmed by the distribution of acyl products. Using known inhibitors of the enzymes of the elongation module, cerulenin, triclosan, NAS-21/91, and (−)-catechin gallate, we demonstrate that accumulation of intermediates resulting from the inhibition of any of the enzymes can be unambiguously followed by MALDI-TOF MS. Thus, this work not only offers a powerful tool for easier and faster throughput screening of inhibitors but also allows for the study of the biochemical properties of the FAS pathway of the malaria parasite. PMID:17485508

  2. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  3. Adoptive Transfer of Dendritic Cells Expressing Fas Ligand Modulates Intestinal Inflammation in a Model of Inflammatory Bowel Disease

    PubMed Central

    de Jesus, Edelmarie Rivera; Isidro, Raymond A; Cruz, Myrella L; Marty, Harry; Appleyard, Caroline B

    2016-01-01

    Background Inflammatory bowel diseases (IBD) are chronic relapsing inflammatory conditions of unknown cause and likely result from the loss of immunological tolerance, which leads to over-activation of the gut immune system. Gut macrophages and dendritic cells (DCs) are essential for maintaining tolerance, but can also contribute to the inflammatory response in conditions such as IBD. Current therapies for IBD are limited by high costs and unwanted toxicities and side effects. The possibility of reducing intestinal inflammation with DCs genetically engineered to over-express the apoptosis-inducing FasL (FasL-DCs) has not yet been explored. Objective Investigate the immunomodulatory effect of administering FasL-DCs in the rat trinitrobenzene sulfonic acid (TNBS) model of acute colitis. Methods Expression of FasL on DCs isolated from the mesenteric lymph nodes (MLNs) of normal and TNBS-colitis rats was determined by flow cytometry. Primary rat bone marrow DCs were transfected with rat FasL plasmid (FasL-DCs) or empty vector (EV-DCs). The effect of these DCs on T cell IFNγ secretion and apoptosis was determined by ELISPOT and flow cytometry for Annexin V, respectively. Rats received FasL-DCs or EV-DCs intraperitoneally 96 and 48 hours prior to colitis induction with TNBS. Colonic T cell and neutrophil infiltration was determined by immunohistochemistry for CD3 and myeloperoxidase activity assay, respectively. Macrophage number and phenotype was measured by double immunofluorescence for CD68 and inducible Nitric Oxide Synthase. Results MLN dendritic cells from normal rats expressed more FasL than those from colitic rats. Compared to EV-DCs, FasL-DCs reduced T cell IFNγ secretion and increased T cell apoptosis in vitro. Adoptive transfer of FasL-DCs decreased macroscopic and microscopic damage scores and reduced colonic T cells, neutrophils, and proinflammatory macrophages when compared to EV-DC adoptive transfer. Conclusion FasL-DCs are effective at treating colonic

  4. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  5. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  6. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  7. Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

    PubMed

    Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

    2015-04-01

    D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

  8. Synthesis and application of acid labile anchor groups for the synthesis of peptide amides by Fmoc-solid-phase peptide synthesis.

    PubMed

    Breipohl, G; Knolle, J; Stüber, W

    1989-10-01

    The preparation and application of a new linker for the synthesis of peptide amides using a modified Fmoc-method is described. The new anchor group was developed based on our experience with 4,4'-dimethoxybenzhydryl (Mbh)-protecting group for amides. Lability towards acid treatment was increased dramatically and results in an easy cleavage procedure for the preparation of peptide amides. The synthesis of N-9-fluorenylmethoxycarbonyl- ([5-carboxylatoethyl-2.4-dimethoxyphenyl)- 4'-methoxyphenyl]-methylamin is reported in detail. This linker was coupled to a commercially available aminomethyl polystyrene resin. Peptide synthesis proceeded smoothly using HOOBt esters of Fmoc-amino acids. Release of the peptide amide and final cleavage of the side chain protecting groups was accomplished by treatment with trifluoroacetic acid-dichloromethane mixtures in the presence of scavengers. The synthesis of peptide amides such as LHRH and C-terminal hexapeptide of secretin are given as examples.

  9. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  10. Regulation of protein synthesis by amino acids in muscle of neonates.

    PubMed

    Suryawan, Agus; Davis, Teresa A

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed.

  11. Synthesis of L-ascorbic acid in the phloem

    PubMed Central

    Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto

    2003-01-01

    Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288

  12. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  13. Tailored fatty acid synthesis via dynamic control of fatty acid elongation.

    PubMed

    Torella, Joseph P; Ford, Tyler J; Kim, Scott N; Chen, Amanda M; Way, Jeffrey C; Silver, Pamela A

    2013-07-01

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  14. Thioacetic acid/NaSH-mediated synthesis of N-protected amino thioacids and their utility in peptide synthesis.

    PubMed

    Mali, Sachitanand M; Gopi, Hosahudya N

    2014-03-21

    Thioacids are recently gaining momentum due to their versatile reactivity. The reactivity of thioacids has been widely explored in the selective amide/peptide bond formation. Thioacids are generally synthesized from the reaction between activated carboxylic acids such as acid chlorides, active esters, etc., and Na2S, H2S, or NaSH. We sought to investigate whether the versatile reactivity of the thioacids can be tuned for the conversion of carboxylic acids into corresponding thioacids in the presence of NaSH. Herein, we report that thioacetic acid- and NaSH-mediated synthesis of N-protected amino thioacids from the corresponding N-protected amino acids, oxidative dimerization of thioacids, crystal conformations of thioacid oxidative dimers, and the utility of thioacids and oxidative dimers in peptide synthesis. Our results suggest that peptides can be synthesized without using standard coupling agents.

  15. Pseudomonas aeruginosa directly shunts β-oxidation degradation intermediates into de novo fatty acid biosynthesis.

    PubMed

    Yuan, Yanqiu; Leeds, Jennifer A; Meredith, Timothy C

    2012-10-01

    We identified the fatty acid synthesis (FAS) initiation enzyme in Pseudomonas aeruginosa as FabY, a β-ketoacyl synthase KASI/II domain-containing enzyme that condenses acetyl coenzyme A (acetyl-CoA) with malonyl-acyl carrier protein (ACP) to make the FAS primer β-acetoacetyl-ACP in the accompanying article (Y. Yuan, M. Sachdeva, J. A. Leeds, and T. C. Meredith, J. Bacteriol. 194:5171-5184, 2012). Herein, we show that growth defects stemming from deletion of fabY can be suppressed by supplementation of the growth media with exogenous decanoate fatty acid, suggesting a compensatory mechanism. Fatty acids eight carbons or longer rescue growth by generating acyl coenzyme A (acyl-CoA) thioester β-oxidation degradation intermediates that are shunted into FAS downstream of FabY. Using a set of perdeuterated fatty acid feeding experiments, we show that the open reading frame PA3286 in P. aeruginosa PAO1 intercepts C(8)-CoA by condensation with malonyl-ACP to make the FAS intermediate β-keto decanoyl-ACP. This key intermediate can then be extended to supply all of the cellular fatty acid needs, including both unsaturated and saturated fatty acids, along with the 3-hydroxyl fatty acid acyl groups of lipopolysaccharide. Heterologous PA3286 expression in Escherichia coli likewise established the fatty acid shunt, and characterization of recombinant β-keto acyl synthase enzyme activity confirmed in vitro substrate specificity for medium-chain-length acyl CoA thioester acceptors. The potential for the PA3286 shunt in P. aeruginosa to curtail the efficacy of inhibitors targeting FabY, an enzyme required for FAS initiation in the absence of exogenous fatty acids, is discussed.

  16. FAS and FAS ligand polymorphisms in the promoter regions and risk of gastric cancer in Southern China.

    PubMed

    Wang, Meilin; Wu, Dongmei; Tan, Ming; Gong, Weida; Xue, Hengchuan; Shen, Hongbin; Zhang, Zhengdong

    2009-08-01

    The FAS and FAS ligand (FASLG) system plays a key role in regulating apoptotic cell death, and corruption of this signaling pathway has been shown to participate in tumorigenesis. Functional promoter polymorphisms of the FAS and FASLG genes can alter transcriptional activities and thus alter risk of cancer. We hypothesized that the FAS -1377G>A, FAS -670A>G, and FASLG -844T>C polymorphisms in the promoter regions are associated with risk of gastric cancer. In a population-based case-control study of 332 gastric cancer cases and 324 controls, we genotyped these three polymorphisms and evaluated their association with risk of gastric cancer. We found that the FAS and FASL genotypes and the FAS haplotypes had no significant associations with risk of gastric cancer. In addition, there was no significant interaction between the FAS and FASL polymorphisms in the development of gastric cancer. The FAS and FASLG polymorphisms may not contribute to risk of gastric cancer in the southern Chinese population.

  17. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  18. Mechanisms of fatty acid synthesis in marine fungus-like protists.

    PubMed

    Xie, Yunxuan; Wang, Guangyi

    2015-10-01

    Thraustochytrids are unicellular fungus-like protists and are well known for their ability to produce interesting nutraceutical compounds. Significant efforts have been made to improve their efficient production of important fatty acids (FAs), mostly by optimizing fermentation conditions and selecting highly productive thraustochytrid strains. Furthermore, noticeable improvements have been made in understanding the mechanism of FA biosynthesis, allowing for a better understanding of how thraustochytrids assemble these unique metabolites and how their biosynthesis is coupled with other related pathways. This review summarizes recent achievements on two major FA biosynthesis pathways, the standard pathway and the polyketide synthase pathway, and detail features of individual enzymes involved in FA biosynthesis, biotechnological advances in pathway engineering and enzyme characterization, and the discovery of other pathways that affect the efficiency of FA accumulation. Perspectives of biotechnological potential application of thraustochytrids are also discussed.

  19. Relationship between expression of gastrin, somatostatin, Fas/FasL and caspases in large intestinal carcinoma

    PubMed Central

    Mao, Jia-Ding; Wu, Pei; Yang, Ying-Lin; Wu, Jian; Huang, He

    2008-01-01

    AIM: To explore the correlation between the mRNAs and protein expression of gastrin (GAS), somatostatin (SS) and apoptosis index (AI), apoptosis regulation gene Fas/FasL and caspases in large intestinal carcinoma (LIC). METHODS: Expression of GAS and SS mRNAs were detected by nested RT-PCR in 79 cases of LIC. Cell apoptosis was detected by molecular biology in situ apoptosis detecting methods (TUNEL). Immunohistochemical staining for GAS, SS, Fas/FasL, caspase-3 and caspase-8 was performed according to the standard streptavidin-biotin-peroxidase (S-P) method. RESULTS: There was a significant positive correlation between mRNA and protein expression of GAS and SS (GASrs=0.99, P < 0.01; SSrs = 0.98, P < 0.01). There was significant difference in positive expression rates of GAS, SS mRNAs and protein among different histological differentiation, histological types and Dukes’ stage of LIC. The AI in GAS high and moderate expression groups was significantly lower than that in low expression groups (3.75 ± 2.38 vs 7.82 ± 2.38, P < 0.01; 5.51 ± 2.66 vs 7.82 ± 2.38, P < 0.01), and the AI in SS high and moderate expression groups was significantly higher than that in low expression groups (9.03 ± 1.76 vs 5.35 ± 3.00, P < 0.01; 7.44 ± 2.67 vs 5.35 ± 3.00, P < 0.01). There was a significant negative correlation between the integral ratio of GAS to SS and the AI (rs = -0.41, P < 0.01). The positive expression rate of FasL in GAS high and moderate expression groups was higher than that in low expression group (90.9% and 81.0% vs 53.2%, P < 0.05). The positive expression rates of Fas, caspase-8 and caspase-3 in SS high (90.0%, 90.0% and 100%) and moderate (80.0%, 70.0%, 75.0%) expression groups were higher than that in low expression group (53.1%, 42.9%, 49.0%) (90.0% and 80.0% vs 53.1%, P < 0.05; 90.0% and 70.0% vs 42.9%, P < 0.05; 100.0% and 75.0% vs 49.0%, P < 0.05). There was a significant positive correlation between the integral ratio of GAS to SS and the

  20. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  1. Versatile Multicomponent Reaction Macrocycle Synthesis Using α-Isocyano-ω-carboxylic Acids.

    PubMed

    Liao, George P; Abdelraheem, Eman M M; Neochoritis, Constantinos G; Kurpiewska, Katarzyna; Kalinowska-Tłuścik, Justyna; McGowan, David C; Dömling, Alexander

    2015-10-16

    The direct macrocycle synthesis of α-isocyano-ω-carboxylic acids via an Ugi multicomponent reaction is introduced. This multicomponent reaction (MCR) protocol differs by being especially short, convergent, and versatile, giving access to 12-22 membered rings.

  2. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  3. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  4. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing.

    PubMed

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-21

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au(+) complexes, and then a class of ∼2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ∼1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au(+) complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe(3+) with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe(3+), and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs. PMID:26391420

  5. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  6. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  7. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement. PMID:21157681

  8. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed.

  9. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  10. Fluorine containing amino acids: synthesis and peptide coupling of amino acids containing the all-cis tetrafluorocyclohexyl motif.

    PubMed

    Ayoup, Mohammed Salah; Cordes, David B; Slawin, Alexandra M Z; O'Hagan, David

    2015-05-28

    A synthesis of two (S)-phenylalanine derivatives is described which have the all-cis, 2,3,5,6-tetrafluorocyclohexyl motif attached to the aromatic ring at the meta and para positions; the para substituted isomer is elaborated into illustrative dipeptides via the free amine and carboxylate respectively demonstrating its utility as a novel amino acid for peptide synthesis and offering a vehicle for incorporation of this unique and facially polarized ring system into bioactive compounds.

  11. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  12. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  13. Highly efficient procedure for the synthesis of fructone fragrance using a novel carbon based acid.

    PubMed

    Hu, Baowei; Li, Chunqing; Zhao, Sheng-Xian; Rong, Lin-Mei; Lv, Shao-Qin; Liang, Xuezheng; Qi, Chenze

    2010-08-01

    The novel carbon based acid has been synthesized via one-step hydrothermal carbonization of furaldehyde and hydroxyethylsulfonic acid. A highly efficient procedure for the synthesis of fructone has been developed using the novel carbon based acid. The results showed that the catalyst possessed high activity for the reaction, giving a yield of over 95%. The advantages of high activity, stability, reusability and low cost for a simple synthesis procedure and wide applicability to various diols and beta-keto esters make this novel carbon based acid one of the best choices for the reaction.

  14. The role of submarine hydrothermal systems in the synthesis of amino acids.

    PubMed

    Aubrey, A D; Cleaves, H J; Bada, Jeffrey L

    2009-04-01

    There is little consensus regarding the plausibility of organic synthesis in submarine hydrothermal systems (SHSs) and its possible relevance to the origin of life. The primary reason for the persistence of this debate is that most experimental high temperature and high-pressure organic synthesis studies have neglected important geochemical constraints with respect to source material composition. We report here the results of experiments exploring the potential for amino acid synthesis at high temperature from synthetic seawater solutions of varying composition. The synthesis of amino acids was examined as a function of temperature, heating time, starting material composition and concentration. Using very favorable reactant conditions (high concentrations of reactive, reduced species), small amounts of a limited set of amino acids are generated at moderate temperature conditions ( approximately 125-175 degrees C) over short heating times of a few days, but even these products are significantly decomposed after exposure times of approximately 1 week. The high concentration dependence observed for these synthetic reactions are demonstrated by the fact that a 10-fold drop in concentration results in orders of magnitude lower yields of amino acids. There may be other synthetic mechanisms not studied herein that merit investigation, but the results are likely to be similar. We conclude that although amino acids can be generated from simple likely environmentally available precursors under SHS conditions, the equilibrium at high temperatures characteristic of SHSs favors net amino acid degradation rather than synthesis, and that synthesis at lower temperatures may be more favorable. PMID:19034685

  15. CEACAM1 regulates Fas-mediated apoptosis in Jurkat T-cells via its interaction with β-catenin.

    PubMed

    Li, Yun; Shively, John E

    2013-05-01

    CEACAM1 (Carcinoembryonic Antigen Cell Adhesion molecule 1), an activation induced cell surface marker of T-cells, modulates the T-cell immune response by inhibition of the T-cell and IL-2 receptors. Since T-cells undergo activation induced cell death via Fas activation, it was of interest to determine if this pathway was also affected by CEACAM1. Previously, we identified a novel biochemical interaction between CEACAM1 and the armadillo repeats of β-catenin in Jurkat cells, in which two critical residues, H469 and K470 of the cytoplasmic domain of CEACAM1-4L played an essential role; while in other studies, β-catenin was shown to regulate Fas-mediated apoptosis in Jurkat cells. CEACAM1 expression in Jurkat cells leads to the re-distribution of β-catenin to the actin cytoskeleton as well as inhibition of β-catenin tyrosine phosphorylation and its degradation after Fas stimulation. As a result, Fas-mediated apoptosis in these cells was inhibited. The K470A mutation of CEACAM1 partially rescued the inhibitory effect, in agreement with the prediction that a CEACAM1-β-catenin interaction pathway is involved. Although CEACAM1 has two ITIMs, they were not tyrosine-phosphorylated upon Fas ligation, indicating an ITIM independent mechanism; however, mutation of the critical residue S508, located between the ITIMs, to aspartic acid and a prerequisite for ITIM activation, abrogates the inhibitory activity of CEACAM1 to Fas-mediated apoptosis. Since Fas-mediated apoptosis is a major form of activation-induced cell death, our finding supports the idea that CEACAM1 is a general inhibitory molecule for T-cell activation utilizing a variety of pathways.

  16. Synthesis and characterization of Fatty acid/amino Acid self-assemblies.

    PubMed

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; Fray, Miroslawa El

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as "R" (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196-239 nm and critical micelle concentration (CMC) of 0.125-0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  17. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  18. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  19. Up-regulation of fas and fasL pro-apoptotic genes expression in type 1 diabetes patients after autologous haematopoietic stem cell transplantation

    PubMed Central

    de Oliveira, G L V; Malmegrim, K C R; Ferreira, A F; Tognon, R; Kashima, S; Couri, C E B; Covas, D T; Voltarelli, J C; de Castro, F A

    2012-01-01

    Type 1 diabetes (T1D) is a chronic autoimmune disease characterized by T cell-mediated destruction of pancreatic β cells, resulting in insulin deficiency and hyperglycaemia. Recent studies have described that apoptosis impairment during central and peripheral tolerance is involved in T1D pathogenesis. In this study, the apoptosis-related gene expression in T1D patients was evaluated before and after treatment with high-dose immunosuppression followed by autologous haematopoietic stem cell transplantation (HDI-AHSCT). We also correlated gene expression results with clinical response to HDI-AHSCT. We observed a decreased expression of bad, bax and fasL pro-apoptotic genes and an increased expression of a1, bcl-xL and cIAP-2 anti-apoptotic genes in patients' peripheral blood mononuclear cells (PBMCs) compared to controls. After HDI-AHSCT, we found an up-regulation of fas and fasL and a down-regulation of anti-apoptotic bcl-xL genes expression in post-HDI-AHSCT periods compared to pre-transplantation. Additionally, the levels of bad, bax, bok, fasL, bcl-xL and cIAP-1 genes expression were found similar to controls 2 years after HDI-AHSCT. Furthermore, over-expression of pro-apoptotic noxa at 540 days post-HDI-AHSCT correlated positively with insulin-free patients and conversely with glutamic acid decarboxylase autoantibodies (GAD65) autoantibody levels. Taken together, the results suggest that apoptosis-related genes deregulation in patients' PBMCs might be involved in breakdown of immune tolerance and consequently contribute to T1D pathogenesis. Furthermore, HDI-AHSCT modulated the expression of some apoptotic genes towards the levels similar to controls. Possibly, the expression of these apoptotic molecules could be applied as biomarkers of clinical remission of T1D patients treated with HDI-AHSCT therapy. PMID:22519592

  20. Human B Cell-Derived Lymphoblastoid Cell Lines Constitutively Produce Fas Ligand and Secrete MHCII+FasL+ Killer Exosomes

    PubMed Central

    Klinker, Matthew W.; Lizzio, Vincent; Reed, Tamra J.; Fox, David A.; Lundy, Steven K.

    2013-01-01

    Immune suppression mediated by exosomes is an emerging concept with potentially immense utility for immunotherapy in a variety of inflammatory contexts, including allogeneic transplantation. Exosomes containing the apoptosis-inducing molecule Fas ligand (FasL) have demonstrated efficacy in inhibiting antigen-specific immune responses upon adoptive transfer in animal models. We report here that a very high frequency of human B cell-derived lymphoblastoid cell lines (LCL) constitutively produce MHCII+FasL+ exosomes that can induce apoptosis in CD4+ T cells. All LCL tested for this study (>20 independent cell lines) showed robust expression of FasL, but had no detectable FasL on the cell surface. Given this intracellular sequestration, we hypothesized that FasL in LCL was retained in the secretory lysosome and secreted via exosomes. Indeed, we found both MHCII and FasL proteins present in LCL-derived exosomes, and using a bead-based exosome capture assay demonstrated the presence of MHCII+FasL+ exosomes among those secreted by LCL. Using two independent experimental approaches, we demonstrated that LCL-derived exosomes were capable of inducing antigen-specific apoptosis in autologous CD4+ T cells. These results suggest that LCL-derived exosomes may present a realistic source of immunosuppressive exosomes that could reduce or eliminate T cell-mediated responses against donor-derived antigens in transplant recipients. PMID:24765093

  1. Synthesis of amino-acid derivatives and dipeptides with an original peptidase enzyme.

    PubMed

    Auriol, D; Paul, F; Yoshpe, I; Gripon, J C; Monsan, P

    1991-01-01

    A peptidase from the non pathogenic Staphylococcus sp. strain BEC 299 was purified to a final specific activity of 84,400 U/mg protein. Its molecular weight is 450 kDa and optimum pH 10.0. This enzyme catalyzes the synthesis of dipeptides (aspartame) and alpha-amino acid derivatives (N-L-malyl-L-tyrosine ethyl ester). The influence of cosolvents and pH on dipeptides and alpha-amino acid derivative synthesis is described. Finally, we detail the use of the peptidase as a reagent in protease-catalyzed peptide synthesis.

  2. Loss of Fas apoptosis inhibitory molecule leads to spontaneous obesity and hepatosteatosis

    PubMed Central

    Huo, J; Ma, Y; Liu, J-J; Ho, Y S; Liu, S; Soh, L Y; Chen, S; Xu, S; Han, W; Hong, A; Lim, S C; Lam, K-P

    2016-01-01

    Altered hepatic lipogenesis is associated with metabolic diseases such as obesity and hepatosteatosis. Insulin resistance and compensatory hyperinsulinaemia are key drivers of these metabolic imbalances. Fas apoptosis inhibitory molecule (FAIM), a ubiquitously expressed antiapoptotic protein, functions as a mediator of Akt signalling. Since Akt acts at a nodal point in insulin signalling, we hypothesize that FAIM may be involved in energy metabolism. In the current study, C57BL/6 wild-type (WT) and FAIM-knockout (FAIM-KO) male mice were fed with normal chow diet and body weight changes were monitored. Energy expenditure, substrate utilization and physical activities were analysed using a metabolic cage. Liver, pancreas and adipose tissue were subjected to histological examination. Serum glucose and insulin levels and lipid profiles were determined by biochemical assays. Changes in components of the insulin signalling pathway in FAIM-KO mice were examined by immunoblots. We found that FAIM-KO mice developed spontaneous non-hyperphagic obesity accompanied by hepatosteatosis, adipocyte hypertrophy, dyslipidaemia, hyperglycaemia and hyperinsulinaemia. In FAIM-KO liver, lipogenesis was elevated as indicated by increased fatty acid synthesis and SREBP-1 and SREBP-2 activation. Notably, protein expression of insulin receptor beta was markedly reduced in insulin target organs of FAIM-KO mice. Akt phosphorylation was also lower in FAIM-KO liver and adipose tissue as compared with WT controls. In addition, phosphorylation of insulin receptor substrate-1 and Akt2 in response to insulin treatment in isolated FAIM-KO hepatocytes was also markedly attenuated. Altogether, our data indicate that FAIM is a novel regulator of insulin signalling and plays an essential role in energy homoeostasis. These findings may shed light on the pathogenesis of obesity and hepatosteatosis. PMID:26866272

  3. Loss of Fas apoptosis inhibitory molecule leads to spontaneous obesity and hepatosteatosis.

    PubMed

    Huo, J; Ma, Y; Liu, J-J; Ho, Y S; Liu, S; Soh, L Y; Chen, S; Xu, S; Han, W; Hong, A; Lim, S C; Lam, K-P

    2016-02-11

    Altered hepatic lipogenesis is associated with metabolic diseases such as obesity and hepatosteatosis. Insulin resistance and compensatory hyperinsulinaemia are key drivers of these metabolic imbalances. Fas apoptosis inhibitory molecule (FAIM), a ubiquitously expressed antiapoptotic protein, functions as a mediator of Akt signalling. Since Akt acts at a nodal point in insulin signalling, we hypothesize that FAIM may be involved in energy metabolism. In the current study, C57BL/6 wild-type (WT) and FAIM-knockout (FAIM-KO) male mice were fed with normal chow diet and body weight changes were monitored. Energy expenditure, substrate utilization and physical activities were analysed using a metabolic cage. Liver, pancreas and adipose tissue were subjected to histological examination. Serum glucose and insulin levels and lipid profiles were determined by biochemical assays. Changes in components of the insulin signalling pathway in FAIM-KO mice were examined by immunoblots. We found that FAIM-KO mice developed spontaneous non-hyperphagic obesity accompanied by hepatosteatosis, adipocyte hypertrophy, dyslipidaemia, hyperglycaemia and hyperinsulinaemia. In FAIM-KO liver, lipogenesis was elevated as indicated by increased fatty acid synthesis and SREBP-1 and SREBP-2 activation. Notably, protein expression of insulin receptor beta was markedly reduced in insulin target organs of FAIM-KO mice. Akt phosphorylation was also lower in FAIM-KO liver and adipose tissue as compared with WT controls. In addition, phosphorylation of insulin receptor substrate-1 and Akt2 in response to insulin treatment in isolated FAIM-KO hepatocytes was also markedly attenuated. Altogether, our data indicate that FAIM is a novel regulator of insulin signalling and plays an essential role in energy homoeostasis. These findings may shed light on the pathogenesis of obesity and hepatosteatosis.

  4. The immunohistochemical localization of Fas and Fas ligand in jaw bone and tooth germ of human fetuses.

    PubMed

    Hatakeyama, S; Tomichi, N; Ohara-Nemoto, Y; Satoh, M

    2000-05-01

    The cellular localization and roles of bone morphogenetic protein (BMP)-2 and apoptosis-associating factors in human orofacial development remain unclear. In this study, BMP-2, osteocalcin, and TGF-beta, which are bone-differentiating markers, apoptosis-associating factors (i.e., Bcl-2, Bax, Fas, and Fas ligand), apoptotic cells detected by the in situ 3'-end labeling method (TUNEL), and proliferating cell nuclear antigen (PCNA) were immunohistochemically examined in the heads (in particular, the jaw bone and tooth germs) of human fetuses of 11-week pregnancy. BMP-2 was positive in osteoblasts and newly formed osteoid of the incisive and palatal bone of the maxilla and the mandible, which indicated that BMP-2 was exclusively involved in intramembranous ossification in the human fetal head. Fas was positive in the cytoplasm of osteocytes and a few osteoblasts. In contrast, Fas ligand was positive in the cytoplasm of osteoblasts and abundant in the stroma of the osteoblastic layer, periosteum, and perichondrium. The Fas ligand in the stroma was recognized as the soluble form, which was possibly produced by osteoblasts. TUNEL-positive apoptotic cells were found in a few osteocytes and a few osteoblastic cells in new bone, and in monocytes of degenerate Meckel's cartilage. The induction of apoptosis observed in monocytes seems to be caused via a Fas-Fas ligand cell death system, because some of these monocytes were Fas-positive, and most of them were Fas ligand-positive. Interestingly, the abundant soluble Fas ligand observed in the periosteum probably protects the bone-formative zone from the invasion of the activated lymphocytes by binding to Fas expressing in these lymphocytes and killing these cells. Fas and Fas ligand were focally positive in the dental lamina and inner enamel epithelium and cusps of the enamel organ, nevertheless, the presence of TUNEL-positive cells was very rare. Bcl-2 was clearly and Bax was weakly positive in the cells throughout the dental

  5. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    NASA Astrophysics Data System (ADS)

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-01

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

  6. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  7. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  8. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  9. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  10. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition.

  11. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  12. Production of Multiple Brain-Like Ganglioside Species Is Dispensable for Fas-Induced Apoptosis of Lymphoid Cells

    PubMed Central

    Carpentier, Stéphane; Levade, Thierry; Cuvillier, Olivier; Portoukalian, Jacques

    2011-01-01

    Activation of an acid sphingomyelinase (aSMase) leading to a biosynthesis of GD3 disialoganglioside has been associated with Fas-induced apoptosis of lymphoid cells. The present study was undertaken to clarify the role of this enzyme in the generation of gangliosides during apoptosis triggered by Fas ligation. The issue was addressed by using aSMase-deficient and aSMase-corrected cell lines derived from Niemann-Pick disease (NPD) patients. Fas cross-linking elicited a rapid production of large amounts of complex a- and b-series species of gangliosides with a pattern and a chromatographic behavior as single bands reminiscent of brain gangliosides. The gangliosides were synthesized within the first ten minutes and completely disappeared within thirty minutes after stimulation. Noteworthy is the observation that GD3 was not the only ganglioside produced. The production of gangliosides and the onset of apoptotic hallmarks occurred similarly in both aSMase-deficient and aSMase-corrected NPD lymphoid cells, indicating that aSMase activation is not accountable for ganglioside generation. Hampering ganglioside production by inhibiting the key enzyme glucosylceramide synthase did not abrogate the apoptotic process. In addition, GM3 synthase-deficient lymphoid cells underwent Fas-induced apoptosis, suggesting that gangliosides are unlikely to play an indispensable role in transducing Fas-induced apoptosis of lymphoid cells. PMID:21629700

  13. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  14. Biosynthesis of very long chain fatty acids in Trypanosoma cruzi.

    PubMed

    Livore, Verónica I; Uttaro, Antonio D

    2015-01-01

    Trypanosoma brucei and Trypanosoma cruzi showed similar fatty acid (FA) compositions, having a high proportion of unsaturated FAs, mainly 18:2Δ9,12 (23-39%) and 18:1Δ9 (11-17%). C22 polyunsaturated FAs are in significant amounts only in T. brucei (12-20%) but represent a mere 2% of total FAs in T. cruzi. Both species have also similar profiles of medium- and long-chain saturated FAs, from 14:0 to 20:0. Interestingly, procyclic and bloodstream forms of T. brucei lack very long chain FAs (VLCFAs), whereas epimastigotes and trypomastigotes of T. cruzi contain 22:0 (0.1-0.2%), 24:0 (1.5-2%), and 26:0 (0.1-0.2%). This is in agreement with the presence of an additional FA elongase gene (TcELO4) in T. cruzi. TcELO4 was expressed in a Saccharomyces cerevisiae mutant lacking the endogenous ScELO3, rescuing the synthesis of saturated and hydroxylated C26 FAs in the yeast. Expression of TcELO4 also rescued the synthetic lethality of a ScELO2, ScELO3 double mutation, and the VLCFA profile of the transformed yeast was similar to that found in T. cruzi. By identifying TcELO4 as the enzyme responsible for the elongation of FA from 16:0 and 18:0 up to 26:0, with 24:0 being the preferred product, this work completed the characterization of FA elongases in Trypanosoma spp. PMID:25339514

  15. Biosynthesis of very long chain fatty acids in Trypanosoma cruzi.

    PubMed

    Livore, Verónica I; Uttaro, Antonio D

    2015-01-01

    Trypanosoma brucei and Trypanosoma cruzi showed similar fatty acid (FA) compositions, having a high proportion of unsaturated FAs, mainly 18:2Δ9,12 (23-39%) and 18:1Δ9 (11-17%). C22 polyunsaturated FAs are in significant amounts only in T. brucei (12-20%) but represent a mere 2% of total FAs in T. cruzi. Both species have also similar profiles of medium- and long-chain saturated FAs, from 14:0 to 20:0. Interestingly, procyclic and bloodstream forms of T. brucei lack very long chain FAs (VLCFAs), whereas epimastigotes and trypomastigotes of T. cruzi contain 22:0 (0.1-0.2%), 24:0 (1.5-2%), and 26:0 (0.1-0.2%). This is in agreement with the presence of an additional FA elongase gene (TcELO4) in T. cruzi. TcELO4 was expressed in a Saccharomyces cerevisiae mutant lacking the endogenous ScELO3, rescuing the synthesis of saturated and hydroxylated C26 FAs in the yeast. Expression of TcELO4 also rescued the synthetic lethality of a ScELO2, ScELO3 double mutation, and the VLCFA profile of the transformed yeast was similar to that found in T. cruzi. By identifying TcELO4 as the enzyme responsible for the elongation of FA from 16:0 and 18:0 up to 26:0, with 24:0 being the preferred product, this work completed the characterization of FA elongases in Trypanosoma spp.

  16. Disruption of Fas Receptor Signaling by Nitric Oxide in Eosinophils

    PubMed Central

    Hebestreit, Holger; Dibbert, Birgit; Balatti, Ivo; Braun, Doris; Schapowal, Andreas; Blaser, Kurt; Simon, Hans-Uwe

    1998-01-01

    It has been suggested that Fas ligand–Fas receptor interactions are involved in the regulation of eosinophil apoptosis and that dysfunctions in this system could contribute to the accumulation of these cells in allergic and asthmatic diseases. Here, we demonstrate that nitric oxide (NO) specifically prevents Fas receptor–mediated apoptosis in freshly isolated human eosinophils. In contrast, rapid acceleration of eosinophil apoptosis by activation of the Fas receptor occurs in the presence of eosinophil hematopoietins. Analysis of the intracellular mechanisms revealed that NO disrupts Fas receptor–mediated signaling events at the level of, or proximal to, Jun kinase (JNK), but distal to sphingomyelinase (SMase) activation and ceramide generation. In addition, activation of SMase occurs downstream of an interleukin 1 converting enzyme–like (ICE-like) protease(s) that is not blocked by NO. However, NO prevents activation of a protease that targets lamin B1. These findings suggest a role for an additional NO-sensitive apoptotic signaling pathway that amplifies the proteolytic cascade initialized by activation of the Fas receptor. Therefore, NO concentrations within allergic inflammatory sites may be important in determining whether an eosinophil survives or undergoes apoptosis upon Fas ligand stimulation. PMID:9449721

  17. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  18. Synthesis of Long Chain Unsaturated-alpha,omega-Dicarboxylic Acids from Renewable Materials via Olefin Metathesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The self-metathesis reaction of soy, rapeseed, tall, and linseed oil fatty acids was investigated for the synthesis of symmetrical long-chain unsaturated-alpha,omega-dicarboxylic acids. The metathesis reactions were carried out in the presence of a Grubbs catalyst under solvent-free conditions at a...

  19. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.

    PubMed

    van Ameijde, Jeroen; Liskamp, Rob M J

    2003-08-01

    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  20. Synthesis and antibacterial evaluation of anziaic acid and analogues as topoisomerase I inhibitors

    PubMed Central

    Lin, Hao; Annamalai, Thirunavukkarasu; Bansod, Priyanka; Tse-Dinh, Yuk-Ching

    2013-01-01

    Naturally occurring anziaic acid was very recently reported as a topoisomerase I inhibitor with antibacterial activity. Herein total synthesis of anziaic acid and structural analogues is described and the preliminary structure-activity relationship (SAR) has been developed based on topoisomerase inhibition and whole cell antibacterial activity. PMID:24363888

  1. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  2. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective.

  3. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  4. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  5. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  6. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  7. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity. PMID:23230650

  8. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  9. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  10. De novo synthesis of amino acids by the ruminal anaerobic fungi, Piromyces communis and Neocallimastix frontalis.

    PubMed

    Atasoglu, Cengiz; Wallace, R John

    2002-07-01

    Anaerobic fungi are an important component of the cellulolytic ruminal microflora. Ammonia alone as N source supports growth, but amino acid mixtures are stimulatory. In order to evaluate the extent of de novo synthesis of individual amino acids in Piromyces communis and Neocallimastix frontalis, isotope enrichment in amino acids was determined during growth on (15)NH(4)Cl in different media. Most cell N (0.78 and 0.63 for P. communis and N. frontalis, respectively) and amino acid N (0.73 and 0.59) continued to be formed de novo from ammonia when 1 g l(-1) trypticase was added to the medium; this concentration approximates the peak concentration of peptides in the rumen after feeding. Higher peptide/amino acid concentrations decreased de novo synthesis. Lysine was exceptional, in that its synthesis decreased much more than other amino acids when Trypticase or amino acids were added to the medium, suggesting that lysine synthesis might limit fungal growth in the rumen.

  11. Associations between variants of FADS genes and omega-3 and omega-6 milk fatty acids of Canadian Holstein cows

    PubMed Central

    2014-01-01

    Background Fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes code respectively for the enzymes delta-5 and delta-6 desaturases which are rate limiting enzymes in the synthesis of polyunsaturated omega-3 and omega-6 fatty acids (FAs). Omega-3 and-6 FAs as well as conjugated linoleic acid (CLA) are present in bovine milk and have demonstrated positive health effects in humans. Studies in humans have shown significant relationships between genetic variants in FADS1 and 2 genes with plasma and tissue concentrations of omega-3 and-6 FAs. The aim of this study was to evaluate the extent of sequence variations within these two genes in Canadian Holstein cows as well as the association between sequence variants and health promoting FAs in milk. Results Thirty three SNPs were detected within the studied regions of genes including a synonymous mutation (FADS1-07, rs42187261, 306Tyr > Tyr) in exon 8 of FADS1, a non-synonymous mutation (FADS2-14, rs211580559, 294Ala > Val) within FADS2 exon 7, a splice site SNP (FADS2-05, rs211263660), a 3′UTR SNP (FADS2-23, rs109772589), and another 3′UTR SNP with an effect on a microRNA binding site within FADS2 gene (FADS2-19, rs210169303). Association analyses showed significant relations between three out of seven tested SNPs and several FAs. Significant associations (FDR P < 0.05) were recorded between FADS2-23 (rs109772589) and two omega-6 FAs (dihomogamma linolenic acid [C20:3n6] and arachidonic acid [C20:4n6]), FADS1-07 (rs42187261) and one omega-3 FA (eicosapentaenoic acid, C20:5n3) and tricosanoic acid (C23:0), and one intronic SNP, FADS1-01 (rs136261927) and C20:3n6. Conclusion Our study has demonstrated positive associations between three SNPs within FADS1 and FADS2 genes (a SNP within the 3’UTR, a synonymous SNP and an intronic SNP), with three milk PUFAs of Canadian Holstein cows thus suggesting possible involvement of synonymous and non-coding region variants in FA synthesis. These SNPs may serve as

  12. Synthesis and optical resolution of an allenoic acid by diastereomeric salt formation induced by chiral alkaloids.

    PubMed

    Nyhlén, Jonas; Eriksson, Lars; Bäckvall, Jan-E

    2008-01-01

    A synthetic procedure for the preparation of 4-cyclohexyl-2-methyl-buta-2,3-dienoic acid in the two optically active forms has been developed. Synthesis of the racemic allenoic acid was made by an efficient route with good overall yield. Resolution of the enantiomers was achieved by forming the cinchonidine and cinchonine diastereomeric salt, respectively, and the enantiomers were isolated in up to 95% enantiomeric excess. The absolute configuration of the allenoic acid was determined by X-ray crystallography.

  13. Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

    PubMed

    Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

    2016-09-01

    α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

  14. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  15. Frequent loss of Fas expression and function in human lung tumours with overexpression of FasL in small cell lung carcinoma.

    PubMed

    Viard-Leveugle, Isabelle; Veyrenc, Sylvie; French, Lars E; Brambilla, Christian; Brambilla, Elisabeth

    2003-10-01

    Fas (CD95) and its ligand FasL signal apoptosis and are involved in tissue homeostasis and the elimination of target cells by cytotoxic T cells. Corruption of this signalling pathway in tumour cells, for example by reduced Fas expression or increased FasL expression, can participate in tumour development and immune escape. The present study has analysed Fas/FasL expression and Fas death signalling function in vivo in lung tumour tissues [57 non-small cell lung carcinomas and 64 neuroendocrine lung tumours including small cell lung carcinoma (SCLC)] in comparison with normal lung tissue, and in vitro in neuroendocrine tumour cell lines in comparison with normal human bronchial epithelial cells. The Fas expression score was markedly decreased compared with normal lung tissue in 90% of the 121 lung tumours and was completely lost in 24%. The Fas staining pattern suggested cytoplasmic Fas expression in tumours, whereas membrane expression was observed in normal lung tissue. Loss of Fas at the cell surface was also shown in vitro by FACS analysis of neuroendocrine tumour cell lines and was concomitant with the resistance of tumour cells to FasL-mediated apoptosis according to in vitro cell viability. The lack of cell surface Fas expression in tumour cell lines resulted from the lack of intracellular Fas protein due to impaired Fas gene transcription. The FasL expression score was also decreased in most non-small cell lung carcinomas compared with normal bronchial cells, whereas 91% of SCLCs had higher expression than normal cells. FasL overexpression was related to advanced tumour stage as well as to a Fas/FasL ratio less than 1. It is concluded that a marked decrease in Fas expression may be part of lung tumourigenesis allowing tumour cells to escape from apoptosis. FasL overexpression in the context of Fas down-regulation in SCLC predicts the ability of SCLC cells to induce paracrine killing of Fas-expressing cytotoxic T cells. In lung tumours, Fas restoration may

  16. Direct microwave-assisted amino acid synthesis by reaction of succinic acid and ammonia in the presence of magnetite

    NASA Astrophysics Data System (ADS)

    Jiang, Nan; Liu, Dandan; Shi, Weiguang; Hua, Yingjie; Wang, Chongtai; Liu, Xiaoyang

    2013-10-01

    Since the discovery of submarine hot vents in the late 1970s, it has been postulated that submarine hydrothermal environments would be suitable for emergence of life on Earth. To simulate warm spring conditions, we designed a series of microwave-assisted amino acid synthesis involving direct reactions between succinic acid and ammonia in the presence of the magnetite catalyst. These reactions which generated aspartic acid and glycine were carried out under mild temperatures and pressures (90-180 °C, 4-19 bar). We studied this specific reaction inasmuch as succinic acid and ammonia were traditionally identified as prebiotic compounds in primitive deep-sea hydrothermal systems on Earth. The experimental results were discussed in both biochemical and geochemical context to offer a possible route for abiotic amino acid synthesis. With extremely diluted starting materials (0.002 M carboxylic acid and 0.002 M ammonia) and catalyst loading, an obvious temperature dependency was observed in both cases [neither product was detected at 90 °C in comparison with 21.08 μmol L-1 (aspartic acid) and 70.25 umol L-1 (glycine) in 180 °C]. However, an opposite trend presented for reaction time factor, namely a positive correlation for glycine, but a negative one for aspartic acid.

  17. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.

    2008-01-01

    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  18. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-05-17

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids.

  19. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  20. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  1. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  2. Veterinary Medicine and Omics (Veterinomics): Metabolic Transition of Milk Triacylglycerol Synthesis in Sows from Late Pregnancy to Lactation.

    PubMed

    Lv, Yantao; Guan, Wutai; Qiao, Hanzhen; Wang, Chaoxian; Chen, Fang; Zhang, Yinzhi; Liao, Zhichao

    2015-10-01

    Mammalian milk is a key source of lipids, providing not only important calories but also essential fatty acids. Veterinary medicine and omics systems sciences intersection, termed as "veterinomics" here, has received little attention to date but stands to offer much promise for building bridges between human and animal health. We determined the changes in porcine mammary genes and proteomics expression associated with milk triacylglycerol (TAG) synthesis and secretion from late pregnancy to lactation. TAG content and fatty acid (FA) composition were determined in porcine colostrum (the 1st day of lactation) and milk (the 17th day of lactation). The mammary transcriptome for 70 genes and 13 proteins involved in TAG synthesis and secretion from six sows, each at d -17(late pregnancy), d 1(early lactation), and d 17 (peak lactation) relative to parturition were analyzed using quantitative real-time PCR and Western blot analyses. The TAG content and the concentrations of de novo synthesized FAs, saturated FAs, and monounsaturated FAs were higher in milk than in colostrum (p<0.05). Robust upregulation with high relative mRNA abundance was evident during lactation for genes associated with FA uptake (VLDLR, LPL, CD36), FA activation (ACSS2, ACSL3), and intracellar transport (FABP3), de novo FA synthesis (ACACA, FASN), FA elongation (ELOVL1), FA desaturation (SCD, FADS1), TAG synthesis (GPAM, AGPAT1, LPIN1, DGAT1), lipid droplet formation (BTN2A1, XDH, PLIN2), and transcription factors and nuclear receptors (SREBP1, SCAP, INSIG1/2). In conclusion, a wide variety of lipogenic genes and proteins regulate the channeling of FAs towards milk TAG synthesis and secretion in porcine mammary gland tissue. These findings inform future omics strategies to increase milk fat production and lipid profile and attest to the rise of both veterinomics and lipidomics in postgenomics life sciences.

  3. 7 CFR 1484.30 - How does FAS formalize its working relationship with approved Cooperators?

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false How does FAS formalize its working relationship with... FAS formalize its working relationship with approved Cooperators? FAS will notify each applicant in writing of the final disposition of its application. FAS will send a program agreement,...

  4. Functional characterization of a chimeric soluble Fas ligand polymer with in vivo anti-tumor activity.

    PubMed

    Daburon, Sophie; Devaud, Christel; Costet, Pierre; Morello, Aurore; Garrigue-Antar, Laure; Maillasson, Mike; Hargous, Nathalie; Lapaillerie, Delphine; Bonneu, Marc; Dechanet-Merville, Julie; Legembre, Patrick; Capone, Myriam; Moreau, Jean-François; Taupin, Jean-Luc

    2013-01-01

    Binding of ligand FasL to its receptor Fas triggers apoptosis via the caspase cascade. FasL itself is homotrimeric, and a productive apoptotic signal requires that FasL be oligomerized beyond the homotrimeric state. We generated a series of FasL chimeras by fusing FasL to domains of the Leukemia Inhibitory Factor receptor gp190 which confer homotypic oligomerization, and analyzed the capacity of these soluble chimeras to trigger cell death. We observed that the most efficient FasL chimera, called pFasL, was also the most polymeric, as it reached the size of a dodecamer. Using a cellular model, we investigated the structure-function relationships of the FasL/Fas interactions for our chimeras, and we demonstrated that the Fas-mediated apoptotic signal did not solely rely on ligand-mediated receptor aggregation, but also required a conformational adaptation of the Fas receptor. When injected into mice, pFasL did not trigger liver injury at a dose which displayed anti-tumor activity in a model of human tumor transplanted to immunodeficient animals, suggesting a potential therapeutic use. Therefore, the optimization of the FasL conformation has to be considered for the development of efficient FasL-derived anti-cancer drugs targeting Fas. PMID:23326557

  5. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.

    PubMed

    Klisch, M; Häder, D-P

    2002-02-01

    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption.

  6. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  7. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )

    1989-12-01

    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  8. Approach to Merosesquiterpenes via Lewis Acid Catalyzed Nazarov-Type Cyclization: Total Synthesis of Akaol A.

    PubMed

    Kakde, Badrinath N; Kumar, Nivesh; Mondal, Pradip Kumar; Bisai, Alakesh

    2016-04-15

    A Lewis acid catalyzed Nazarov-type cyclization of arylvinylcarbinol has been developed for the asymmetric synthesis of carbotetracyclic core of merosesquiterpenes. The reaction works only in the presence of 2 mol % of Sn(OTf)2 and Bi(OTf)3 in dichloroethane under elevated temperature. The methodology offers the synthesis of a variety of enantioenriched arylvinylcarbinols from commercially available (3aR)-sclareolide 9 in six steps with an eventual concise total synthesis of marine sesquiterpene quinol, akaol A (1a). PMID:27028314

  9. Retinoic acid response element in the human alcohol dehydrogenase gene ADH3: implications for regulation of retinoic acid synthesis.

    PubMed Central

    Duester, G; Shean, M L; McBride, M S; Stewart, M J

    1991-01-01

    Retinoic acid regulation of one member of the human class I alcohol dehydrogenase (ADH) gene family was demonstrated, suggesting that the retinol dehydrogenase function of ADH may play a regulatory role in the biosynthetic pathway for retinoic acid. Promoter activity of human ADH3, but not ADH1 or ADH2, was shown to be activated by retinoic acid in transient transfection assays of Hep3B human hepatoma cells. Deletion mapping experiments identified a region in the ADH3 promoter located between -328 and -272 bp which confers retinoic acid activation. This region was also demonstrated to confer retinoic acid responsiveness on the ADH1 and ADH2 genes in heterologous promoter fusions. Within a 34-bp stretch, the ADH3 retinoic acid response element (RARE) contains two TGACC motifs and one TGAAC motif, both of which exist in RAREs controlling other genes. A block mutation of the TGACC sequence located at -289 to -285 bp eliminated the retinoic acid response. As assayed by gel shift DNA binding studies, the RARE region (-328 to -272 bp) of ADH3 bound the human retinoic acid receptor beta (RAR beta) and was competed for by DNA containing a RARE present in the gene encoding RAR beta. Since ADH catalyzes the conversion of retinol to retinal, which can be further converted to retinoic acid by aldehyde dehydrogenase, these results suggest that retinoic acid activation of ADH3 constitutes a positive feedback loop regulating retinoic acid synthesis. Images PMID:1996113

  10. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  11. Solvent-free lipase-catalyzed synthesis of a novel hydroxyl-fatty acid derivative of kojic acid.

    PubMed

    El-Boulifi, Noureddin; Ashari, Siti Efliza; Serrano, Marta; Aracil, Jose; Martínez, Mercedes

    2014-02-01

    The aim of this work was the synthesis of a novel hydroxyl-fatty acid derivative of kojic acid rich in kojic acid monoricinoleate (KMR) which can be widely used in the cosmetic and food industry. The synthesis of KMR was carried out by lipase-catalysed esterification of ricinoleic and kojic acids in solvent-free system. Three immobilized lipases were tested and the best KMR yields were attained with Lipozyme TL IM and Novozym 435. Since Lipozyme TL IM is the cheapest, it was selected to optimize the reaction conditions. The optimal reaction conditions were 80 °C for the temperature, 1:1 for the alcohol/acid molar ratio, 600 rpm for stirring speed and 7.8% for the catalyst concentration. Under these conditions, the reaction was scaled up in a 5×10⁻³ m³ stirred tank reactor. ¹H-¹³C HMBC-NMR showed that the primary hydroxyl group of kojic acid was regioselectively esterified. The KMR has more lipophilicity than kojic acid and showed antioxidant activity that improves the oxidation stability of biodiesel.

  12. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-01

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  13. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.

    PubMed

    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György

    2016-01-01

    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  14. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  15. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  16. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  17. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  18. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  19. Butyrate suppresses colonic inflammation through HDAC1-dependent Fas upregulation and Fas-mediated apoptosis of T cells.

    PubMed

    Zimmerman, Mary A; Singh, Nagendra; Martin, Pamela M; Thangaraju, Muthusamy; Ganapathy, Vadivel; Waller, Jennifer L; Shi, Huidong; Robertson, Keith D; Munn, David H; Liu, Kebin

    2012-06-15

    Butyrate, an intestinal microbiota metabolite of dietary fiber, has been shown to exhibit protective effects toward inflammatory diseases such as ulcerative colitis (UC) and inflammation-mediated colorectal cancer. Recent studies have shown that chronic IFN-γ signaling plays an essential role in inflammation-mediated colorectal cancer development in vivo, whereas genome-wide association studies have linked human UC risk loci to IFNG, the gene that encodes IFN-γ. However, the molecular mechanisms underlying the butyrate-IFN-γ-colonic inflammation axis are not well defined. Here we showed that colonic mucosa from patients with UC exhibit increased signal transducer and activator of transcription 1 (STAT1) activation, and this STAT1 hyperactivation is correlated with increased T cell infiltration. Butyrate treatment-induced apoptosis of wild-type T cells but not Fas-deficient (Fas(lpr)) or FasL-deficient (Fas(gld)) T cells, revealing a potential role of Fas-mediated apoptosis of T cells as a mechanism of butyrate function. Histone deacetylase 1 (HDAC1) was found to bind to the Fas promoter in T cells, and butyrate inhibits HDAC1 activity to induce Fas promoter hyperacetylation and Fas upregulation in T cells. Knocking down gpr109a or slc5a8, the genes that encode for receptor and transporter of butyrate, respectively, resulted in altered expression of genes related to multiple inflammatory signaling pathways, including inducible nitric oxide synthase (iNOS), in mouse colonic epithelial cells in vivo. Butyrate effectively inhibited IFN-γ-induced STAT1 activation, resulting in inhibition of iNOS upregulation in human colon epithelial and carcinoma cells in vitro. Our data thus suggest that butyrate delivers a double-hit: induction of T cell apoptosis to eliminate the source of inflammation and suppression of IFN-γ-mediated inflammation in colonic epithelial cells, to suppress colonic inflammation.

  20. Selenium Catalyzed Oxidation of Aldehydes: Green Synthesis of Carboxylic Acids and Esters.

    PubMed

    Sancineto, Luca; Tidei, Caterina; Bagnoli, Luana; Marini, Francesca; Lenardão, Eder J; Santi, Claudio

    2015-01-01

    The stoichiometric use of hydrogen peroxide in the presence of a selenium-containing catalyst in water is here reported as a new ecofriendly protocol for the synthesis of variously functionalized carboxylic acids and esters. The method affords the desired products in good to excellent yields under very mild conditions starting directly from commercially available aldehydes. Using benzaldehyde as a prototype the gram scale synthesis of benzoic acid is described, in which the aqueous medium and the catalyst could be recycled at last five times while achieving an 87% overall yield.

  1. Communic acids: occurrence, properties and use as chirons for the synthesis of bioactive compounds.

    PubMed

    Barrero, Alejandro F; Herrador, M Mar; Arteaga, Pilar; Arteaga, Jesús F; Arteaga, Alejandro F

    2012-01-01

    Communic acids are diterpenes with labdane skeletons found in many plant species, mainly conifers, predominating in the genus Juniperus (fam. Cupresaceae). In this review we briefly describe their distribution and different biological activities (anti- bacterial, antitumoral, hypolipidemic, relaxing smooth muscle, etc.). This paper also includes a detailed explanation of their use as chiral building blocks for the synthesis of bioactive natural products. Among other uses, communic acids have proven useful as chirons for the synthesis of quassinoids (formal), abietane antioxidants, ambrox and other perfume fixatives, podolactone herbicides, etc., featuring shorter and more efficient processes.

  2. Measurement of Microbial Activity and Growth in the Ocean by Rates of Stable Ribonucleic Acid Synthesis

    PubMed Central

    Karl, David M.

    1979-01-01

    A relatively simple and extremely sensitive technique for measuring rates of stable ribonucleic acid (RNA) synthesis was devised and applied to bacterial cultures and seawater samples. The procedure is based upon the uptake and incorporation of exogenous radiolabeled adenine into cellular RNA. To calculate absolute rates of synthesis, measurements of the specific radioactivity of the intracellular adenosine 5′-triphosphate pools (precursor to RNA) and of the total amount of radioactivity incorporated into stable cellular RNA per unit time are required. Since the rate of RNA synthesis is positively correlated with growth rate, measurements of RNA synthesis should be extremely useful for estimating and comparing the productivities of microbial assemblages in nature. Adenosine 5′-triphosphate, adenylate energy charge, and rates of stable RNA synthesis have been measured at a station located in the Columbian Basin of the Caribbean Sea. A subsurface peak in RNA synthesis (and therefore growth) was located within the dissolved oxygen minimum zone (450 m), suggesting in situ microbiological utilization of dissolved molecular oxygen. Calculations of the specific rates of RNA synthesis (i.e., RNA synthesis per unit of biomass) revealed that the middepth maximum corresponded to the highest specific rate of growth (420 pmol of adenine incorporated into RNA·day−1) of all depths sampled, including the euphotic zone. The existence of an intermediate depth zone of active microbial growth may be an important site for nutrient regeneration and may serve as a source of reduced carbon for mesopelagic and deep sea environments. PMID:16345461

  3. Activation of the Fas/Fas ligand pathway in hypertensive renal disease in Dahl/Rapp rats

    PubMed Central

    Sanders, Paul W; Wang, Pei-Xuan

    2002-01-01

    Background Hypertensive nephrosclerosis is the second most common cause of end-stage renal failure in the United States. The mechanism by which hypertension produces renal failure is incompletely understood. Recent evidence demonstrated that an unscheduled and inappropriate increase in apoptosis occurred in the Dahl/Rapp rat, an inbred strain of rat that uniformly develops hypertension and hypertensive nephrosclerosis; early correction of the hypertension prevents the renal injury. The present study examined the role of the Fas/FasL pathway in this process. Methods Young male Dahl/Rapp salt-sensitive (S) and Sprague-Dawley rats were fed diets that contained 0.3% or 8.0% NaCl diets. Kidneys were examined at days 7 and 21 of the study. Results An increase in Fas and FasL expression was observed in glomerular and tubular compartments of kidneys of hypertensive S rats, whereas dietary salt did not change expression of either of these molecules in normotensive Sprague-Dawley rats. Associated with this increase was cleavage of Bid and activation of caspase-8, the initiator caspase in this apoptotic pathway, by day 21 of the study. Conclusions Augmented expression of apoptotic signaling by the Fas/FasL pathway occurred during development of end-stage renal failure in this model of hypertensive nephrosclerosis. PMID:11818026

  4. Squaric acid ester-based total synthesis of echinochrome A.

    PubMed

    Peña-Cabrera, Eduardo; Liebeskind, Lanny S

    2002-03-01

    The total synthesis of echinochrome A is described. Both key intermediates 5 and 8 were efficiently prepared from diisopropyl squarate 7. Nucleophilic addition of aryllithium 8 to 5, followed by thermal ring-expansion/cyclization of the 1,2-adduct 4, furnished hydroquinone 3. Oxidation and full deprotection of 3 gave the title compound.

  5. MAFG is a transcriptional repressor of bile acid synthesis and metabolism.

    PubMed

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Ahn, Hannah; Hagey, Lee R; Romanoski, Casey E; Lee, Richard G; Graham, Mark J; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A

    2015-02-01

    Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis, and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG(+/-) mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR.

  6. MAFG Is a Transcriptional Repressor of Bile Acid Synthesis and Metabolism

    PubMed Central

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Ahn, Hannah; Hagey, Lee R.; Romanoski, Casey E.; Lee, Richard G.; Graham, Mark J.; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A.

    2015-01-01

    Summary Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway, and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG+/− mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-Seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR. PMID:25651182

  7. Racemic synthesis and solid phase peptide synthesis application of the chimeric valine/leucine derivative 2-amino-3,3,4-trimethyl-pentanoic acid.

    PubMed

    Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R

    2014-07-01

    The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.

  8. A Nitrogen-Assisted One-Pot Heteroaryl Ketone Synthesis from Carboxylic Acids and Heteroaryl Halides.

    PubMed

    Demkiw, Krystyna; Araki, Hirofumi; Elliott, Eric L; Franklin, Christopher L; Fukuzumi, Yoonjoo; Hicks, Frederick; Hosoi, Kazushi; Hukui, Tadashi; Ishimaru, Yoichiro; O'Brien, Erin; Omori, Yoshimasa; Mineno, Masahiro; Mizufune, Hideya; Sawada, Naotaka; Sawai, Yasuhiro; Zhu, Lei

    2016-04-15

    A practical and highly effective one-pot synthesis of versatile heteroaryl ketones directly from carboxylic acids and heteroaryl halides under mild conditions is reported. This method does not require derivatization of carboxylic acids (preparation of acid chlorides, Weinreb amides, etc.) or the use of any additives/catalysts. A wide substrate scope of carboxylic acids with high functional group tolerance has also been demonstrated. The results reveal that the presence of an α-nitrogen on the halide substrate greatly improves the desired ketone formation.

  9. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  10. Influence of Fenofibrate Treatment on Triacylglycerides, Diacylglycerides and Fatty Acids in Fructose Fed Rats

    PubMed Central

    Kopf, Thomas; Schaefer, Hans-Ludwig; Troetzmueller, Martin; Koefeler, Harald; Broenstrup, Mark; Konovalova, Tatiana; Schmitz, Gerd

    2014-01-01

    Fenofibrate (FF) lowers plasma triglycerides via PPARα activation. Here, we analyzed lipidomic changes upon FF treatment of fructose fed rats. Three groups with 6 animals each were defined as control, fructose-fed and fructose-fed/FF treated. Male Wistar Unilever Rats were subjected to 10% fructose-feeding for 20 days. On day 14, fenofibrate treatment (100 mg/kg p.o.) was initiated and maintained for 7 days. Lipid species in serum were analyzed using mass spectrometry (ESI-MS/MS; LC-FT-MS, GC-MS) on days 0, 14 and 20 in all three groups. In addition, lipid levels in liver and intestine were determined. Short-chain TAGs increased in serum and liver upon fructose-feeding, while almost all TAG-species decreased under FF treatment. Long-chain unsaturated DAG-levels (36:1, 36:2, 36:4, 38:3, 38:4, 38:5) increased upon FF treatment in rat liver and decreased in rat serum. FAs, especially short-chain FAs (12:0, 14:0, 16:0) increased during fructose-challenge. VLDL secretion increased upon fructose-feeding and together with FA-levels decreased to control levels during FF treatment. Fructose challenge of de novo fatty acid synthesis through fatty acid synthase (FAS) may enhance the release of FAs ≤16:0 chain length, a process reversed by FF-mediated PPARα-activation. PMID:25198467

  11. Tetrandrine has anti-adipogenic effect on 3T3-L1 preadipocytes through the reduced expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3.

    PubMed

    Jang, Byeong-Churl

    2016-08-01

    Tetrandrine is a bisbenzylisoquinoline alkaloid isolated from the roots of Stephania tetrandra S. Moore and has been shown to possess anti-inflammatory and anti-cancerous activities. In this study, the effect of tetrandrine on adipogenesis in 3T3-L1 preadipocytes was investigated. Tetrandrine at 10 μM concentration strongly inhibited lipid accumulation and triglyceride (TG) synthesis during the differentiation of 3T3-L1 preadipocytes into adipocytes. On mechanistic levels, tetrandrine reduced not only the expressions of CCAAT/enhancer-binding protein-α (C/EBP-α), peroxisome proliferator-activated receptor-γ (PPAR-γ), fatty acid synthase (FAS), and perilipin A but also the phosphorylation levels of signal transducer and activator of transcription-3 (STAT-3) during 3T3-L1 adipocyte differentiation. Tetrandrine also reduced the mRNA expression of leptin, but not adiponectin, during 3T3-L1 adipocyte differentiation. Collectively, these findings show that tetrandrine has strong anti-adipogenic effect on 3T3-L1 preadipocytes and the effect is largely attributable to the reduced expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3. PMID:27246736

  12. Artesunate inhibits adipogeneis in 3T3-L1 preadipocytes by reducing the expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3.

    PubMed

    Jang, Byeong-Churl

    2016-05-20

    Differentiation of preadipocyte, also called adipogenesis, leads to the phenotype of mature adipocyte. However, excessive adipogenesis is closely linked to the development of obesity. Artesunate, one of artemisinin-type sesquiterpene lactones from Artemisia annua L., is known for anti-malarial and anti-cancerous activities. In this study, we investigated the effect of artesunate on adipogenesis in 3T3-L1 preadipocytes. Artesunate strongly inhibited lipid accumulation and triglyceride (TG) synthesis during the differentiation of 3T3-L1 preadipocytes into adipocytes at 5 μM concentration. Artesunate at 5 μM also reduced not only the expressions of CCAAT/enhancer-binding protein-α (C/EBP-α), peroxisome proliferator-activated receptor-γ (PPAR-γ), fatty acid synthase (FAS), and perilipin A but also the phosphorylation levels of signal transducer and activator of transcription-3 (STAT-3) during adipocyte differentiation. Moreover, artesunate at 5 μM reduced leptin, but not adiponectin, mRNA expression during adipocyte differentiation. Taken together, these findings demonstrate that artesunate inhibits adipogenesis in 3T3-L1 preadipoytes through the reduced expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3. PMID:27109481

  13. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials. PMID:27482849

  14. Bacterial synthesis of polysialic acid lactosides in recombinant Escherichia coli K-12.

    PubMed

    Richard, Emeline; Buon, Laurine; Drouillard, Sophie; Fort, Sébastien; Priem, Bernard

    2016-07-01

    Bacterial polysialyltransferases (PSTs) are processive enzymes involved in the synthesis of polysialic capsular polysaccharides. They can also synthesize polysialic acid in vitro from disialylated and trisialylated lactoside acceptors, which are the carbohydrate moieties of GD3 and GT3 gangliosides, respectively. Here, we engineered a non-pathogenic Escherichia coli strain that overexpresses recombinant sialyltransferases and sialic acid synthesis genes and can convert an exogenous lactoside into polysialyl lactosides. Several PSTs were assayed for their ability to synthesize polysialyl lactosides in the recombinant strains. Fed-batch cultures produced α-2,8 polysialic acid or alternate α-2,8-2,9 polysialic acid in quantities reaching several grams per liter. Bacterial culture in the presence of propargyl-β-lactoside as the exogenous acceptor led to the production of conjugatable polysaccharides by means of copper-assisted click chemistry. PMID:26927318

  15. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials.

  16. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  17. Polymers from fatty acids: poly(ω-hydroxyl tetradecanoic acid) synthesis and physico-mechanical studies.

    PubMed

    Liu, Chen; Liu, Fei; Cai, Jiali; Xie, Wenchun; Long, Timothy E; Turner, S Richard; Lyons, Alan; Gross, Richard A

    2011-09-12

    This Article describes the synthesis and physicomechanical properties of bioplastics prepared from methyl ω-hydroxytetradecanoic acid (Me-ω-OHC14), a new monomer available by a fermentation process using an engineered Candida tropicalis strain. Melt-condensation experiments were conducted using titanium tetraisopropoxide (Ti[OiPr](4)) as a catalyst in a two-stage polymerization (2 h at 200 °C under N(2), 4 h at 220 °C under 0.1 mmHg). Poly(ω-hydroxytetradecanoate), P(ω-OHC14), M(w), determined by SEC-MALLS, increased from 53K to 110K as the Ti(OiPr)(4) concentration increased from 50 to 300 ppm. By varying the polymerization conditions (catalyst concentration, reaction time, second-stage reaction temperature) a series of P(ω-OHC14) samples were prepared with M(w) values from 53K to 140K. The synthesized polyesters with M(w) ranging from 53K to 140K were subjected to characterization by DSC, TGA, DMTA, and tensile testing. Influences of P(ω-OHC14) molecular weight, melting point, and enthalpies of melting/crystallization on material tensile properties were explored. Cold-drawing tensile tests at room temperature for P(ω-OHC14) with M(w) 53K-78K showed a brittle-to-ductile transition. In contrast, P(ω-OHC14) with M(w) 53K undergoes brittle fracture. Increasing P(ω-OHC14) M(w) above 78K resulted in a strain-hardening phenomena and tough properties with elongation at break ~700% and true tensile strength of ~50 MPa. Comparisons between high density polyethylene and P(ω-OHC14) mechanical and thermal properties as a function of their respective molecular weights are discussed. PMID:21793591

  18. [Synthesis, characterization and application of polyglycerols and polyglycerol fatty acid esters].

    PubMed

    Behrens, H; Mieth, G

    1984-01-01

    The current state of knowledge in the field of synthesis and properties of polyglycerols and polyglycerol fatty acid esters is presented. Alternatives for the analytical characterization of these families by means of physico-chemical methods, with special reference to chromatography and spectroscopy, are described. Furthermore, the use of polyglycerol fatty acid esters as food additives is considered from the view-points of the physiology of nutrition and of processing technology.

  19. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  20. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  1. Novel enzymatic synthesis of 4-O-cinnamoyl quinic and shikimic acid derivatives.

    PubMed

    Armesto, Nuria; Ferrero, Miguel; Fernández, Susana; Gotor, Vicente

    2003-07-11

    The first direct synthesis of 4-O-cinnamoyl derivatives of quinic and shikimic acids were accomplished by regioselective esterification with Candida antarctica lipase A. For hydrocinnamic esters, enzymatic transesterification with vinyl esters gave excellent yields. However, more reactive acylating agents such as anhydrides were used to synthesize cinnamic derivatives of both acids. An inhibitory effect was observed with this lipase for p-methoxy, p-hydroxy, and p-acetoxy vinyl ester and anhydride derivatives (coumarate and ferulate derivatives).

  2. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  3. Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs.

    PubMed

    Suryawan, Agus; O'Connor, Pamela M J; Bush, Jill A; Nguyen, Hanh V; Davis, Teresa A

    2009-05-01

    The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose-amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8-12/group) with insulin at 0, 10, 22, and 110 ng kg(-0.66) min(-1) to achieve approximately 0, 2, 6 and 30 muU ml(-1) insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L: -[4-(3)H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids.

  4. Mutation affecting regulation of synthesis of acetohydroxy acid synthetase in Escherichia coli K-12.

    PubMed Central

    Jackson, J H; Henderson, E K

    1975-01-01

    Altered regulation of synthesis of acetohydroxy acid synthetase (AHAS) was previously reported in a mutant of Escherichia coli strain K-12. The mutant strain, growing in minimal medium, exhibits a partial growth limiatation and derepression of AHAS, owing to deficient synthesis of isoleucine. The genetic lesion (ilvE503) causing the isoleucine limitation was shown to cause derepression of a valine-sensitive AHAS activity. The derepression effect of the ilvE503 mutation upon synthesis of AHAS was conclusively demonstrated by introducing both the ilvE503 allele and an altered AHAS (ilv-521) into the same cell. Evidence is presented that suggests the presence of multiple genetic regions for synthesis and control of the valine-sensitive AHAS activity. PMID:1089632

  5. Induction of Fas receptor and Fas ligand by nodularin is mediated by NF-{kappa}B in HepG2 cells

    SciTech Connect

    Feng Gong; Li Ying; Bai Yansheng

    2011-03-15

    Nodularin is a natural toxin with multiple features, including inhibitor of protein phosphatases 1 and 2A as well as tumor initiator and promoter. One unique feature of nodularin is that this chemical is a hepatotoxin. It can accumulate into the liver after contact and lead to severe damage to hepatocyte, such as apoptosis. Fas receptor (Fas) and Fas ligand (FasL) system is a critical signaling network triggering apoptosis. In current study, we investigated whether nodularin can induce Fas and FasL expression in HepG2 cell, a well used in vitro model for the study of human hepatocytes. Our data showed nodularin induced Fas and FasL expression, at both mRNA and protein level, in a time- and dose-dependent manner. We also found nodularin induced apoptosis at the concentration and incubation time that Fas and FasL were significantly induced. Neutralizing antibody to FasL reduced nodularin-induced apoptosis. Further studies demonstrated that nodularin promoted nuclear translocation and activation of p65 subunit of NF-{kappa}B. By applying siRNA targeting p65, which knocked down p65 in HepG2 cells, we successfully impaired the activation of NF-{kappa}B by nodularin. In these p65 knockdown cells, we observed that Fas and FasL expression and apoptosis induced by nodularin were significantly reduced. These findings suggest the induction of Fas and FasL expression and thus cell apoptosis in HepG2 cells by nodularin is mediated through NF-{kappa}B pathway.

  6. Asymmetric synthesis of aromatic β-amino acids using ω-transaminase: Optimizing the lipase concentration to obtain thermodynamically unstable β-keto acids.

    PubMed

    Mathew, Sam; Jeong, Seong-Su; Chung, Taeowan; Lee, Sang-Hyeup; Yun, Hyungdon

    2016-01-01

    Synthesized aromatic β-amino acids have recently attracted considerable attention for their application as precursors in many pharmacologically relevant compounds. Previous studies on asymmetric synthesis of aromatic β-amino acids using ω-transaminases could not be done efficiently due to the instability of β-keto acids. In this study, a strategy to circumvent the instability problem of β-keto acids was utilized to generate β-amino acids efficiently via asymmetric synthesis. In this work, thermodynamically stable β-ketoesters were initially converted to β-keto acids using lipase, and the β-keto acids were subsequently aminated using ω-transaminase. By optimizing the lipase concentration, we successfully overcame the instability problem of β-keto acids and enhanced the production of β-amino acids. This strategy can be used as a general approach to efficiently generate β-amino acids from β-ketoesters.

  7. Fast neutrons-induced apoptosis is Fas-independent in lymphoblastoid cells

    SciTech Connect

    Fischer, Barbara; Benzina, Sami; Jeannequin, Pierre; Dufour, Patrick; Bergerat, Jean-Pierre; Denis, Jean-Marc; Gueulette, John; Bischoff, Pierre L. . E-mail: Pierre.Bischoff@ircad.u-strasbg.fr

    2005-08-26

    We have previously shown that ionizing radiation-induced apoptosis in human lymphoblastoid cells differs according to their p53 status, and that caspase 8-mediated cleavage of BID is involved in the p53-dependent pathway. In the present study, we investigated the role of Fas signaling in caspase 8 activation induced by fast neutrons irradiation in these cells. Fas and FasL expression was assessed by flow cytometry and by immunoblot. We also measured Fas aggregation after irradiation by fluorescence microscopy. We found a decrease of Fas expression after irradiation, but no change in Fas ligand expression. We also showed that, in contrast to the stimulation of Fas by an agonistic antibody, Fas aggregation did not occur after irradiation. Altogether, our data strongly suggest that fast neutrons induced-apoptosis is Fas-independent, even in p53-dependent apoptosis.

  8. Oxidative allylic rearrangement of cycloalkenols: Formal total synthesis of enantiomerically pure trisporic acid B

    PubMed Central

    Dubberke, Silke; Abbas, Muhammad

    2011-01-01

    Summary Enantiomerically highly enriched unsaturated β-ketoesters bearing a quaternary stereocenter can be utilized as building blocks for the synthesis of natural occurring terpenes, i. a., trisporic acid and its derivatives. An advanced building block has been synthesized in a short reaction sequence, which involves an oxidative allylic rearrangement initiated by pyridinium dichromate (PDC) as the key step. PMID:21512603

  9. An Overview of Stereoselective Synthesis of α-Aminophosphonic Acids and Derivatives

    PubMed Central

    Ordóñez, Mario; Rojas-Cabrera, Haydée; Cativiela, Carlos

    2009-01-01

    An overview of all methodologies published during the last few years focused to the stereoselective (diastereoselective or enantioselective) synthesis of α-aminophosphonic acids and derivatives is reported. The procedures have been classified according a retrosynthetic strategy and taking into account the formation of each one of the bonds connected to the chiral centre. PMID:20871799

  10. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  11. o-Iodoxybenzoic acid mediated oxidative desulfurization initiated domino reactions for synthesis of azoles.

    PubMed

    Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G

    2012-04-20

    A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides.

  12. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  13. Efficient Enantioselective Synthesis of Oxahelicenes Using Redox/Acid Cooperative Catalysts.

    PubMed

    Sako, Makoto; Takeuchi, Yoshiki; Tsujihara, Tetsuya; Kodera, Junpei; Kawano, Tomikazu; Takizawa, Shinobu; Sasai, Hiroaki

    2016-09-14

    An efficient and enantioselective synthesis of oxa[9]helicenes has been established via vanadium(V)-catalyzed oxidative coupling/intramolecular cyclization of polycyclic phenols. A newly developed vanadium complex cooperatively functions as both a redox and Lewis acid catalyst to promote the present sequential reaction and afford oxa[9]helicenes in good yields with up to 94% ee. PMID:27574874

  14. Insulin and amino acids stimulate whole body protein synthesis in neonates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Insulin and amino acids (AA) stimulate muscle protein synthesis in neonatal pigs. To determine the effects of insulin and AA on whole body protein turnover, hyperinsulinemic (0 and 100 ng/(kg[0.66]/min))-euglycemic-AA clamps were performed during euaminoacidemia or hyperaminoacidemia in fasted 7-d-...

  15. FAS Haploinsufficiency Caused by Extracellular Missense Mutations Underlying Autoimmune Lymphoproliferative Syndrome.

    PubMed

    de Bielke, María Gabriela Simesen; Perez, Laura; Yancoski, Judith; Oliveira, João Bosco; Danielian, Silvia

    2015-11-01

    Mutations in the FAS gene are the most common cause of Autoimmune Lymphoproliferative Syndrome (ALPS), and the majority of them affect the intracellular domain of FAS protein, particularly the region termed death domain. However, approximately one third of these mutations affect the extracellular region of FAS and most are stop codons, with very few missense changes having been described to date. We previously described 7 patients with a FAS missense extracellular mutation, C107Y, two in homozygozity and 5 in heterozygosity. We investigated here the mechanistic effects of this mutation and observed that the homozygous patients did not show any FAS surface expression, while the heterozygous patients had diminished receptor expression. Aiming to understand why a missense mutation was abolishing receptor expression, we analyzed intracellular FAS protein trafficking using fluorescent fusion proteins of wild type FAS, two missense extracellular mutants (FAS-C107Y and FAS-C104Y) and one missense change localized in the intracellular region, FAS-D260E. The FAS-C107Y and FAS-C104Y mutants failed to reach the cell surface, being retained at the endoplasmic reticulum, unlike the WT or the FAS-D260E which were clearly expressed at the plasma membrane. These results support haploinsufficiency as the underlying mechanism involved in the pathogenesis of ALPS caused by extracellular FAS missense mutations. PMID:26563159

  16. Synthesis and transdermal properties of acetylsalicylic acid and selected esters.

    PubMed

    Gerber, Minja; Breytenbach, Jaco C; Hadgraft, Jonathan; du Plessis, Jeanetta

    2006-03-01

    The primary aim of this study was to determine the transdermal penetration of acetylsalicylic acid and some of its derivatives, to establish a correlation, if any, with selected physicochemical properties and to determine if transdermal application of acetylsalicylic acid and its derivatives will give therapeutic drug concentrations with respect to transdermal flux. Ten derivatives of acetylsalicylic acid were prepared by esterification of acetylsalicyloyl chloride with ten different alcohols. The experimental aqueous solubility, logD and transdermal flux values were determined for acetylsalicylic acid and its derivatives at pH 4.5. In vitro penetration was measured through excised female human abdominal skin in diffusion cells. The experimental aqueous solubility of acetylsalicylic acid (6.56 mg/ml) was higher than that of the synthesised acetylsalicylate derivatives (ranging from 1.76 x 10(-3) to 3.32 mg/ml), and the logD of acetylsalicylic acid (-0.85) was lower than that of its derivatives (ranging from -0.25 to 1.95). There was thus an inverse correlation between the aqueous solubility data and the logD values. The experimental transdermal flux of acetylsalicylic acid (263.83 nmol/cm(2)h) was much higher than that of its derivatives (ranging from 0.12 to 136.02 nmol/cm(2)h).

  17. [Asymmetric synthesis of aromatic L-amino acids catalyzed by transaminase].

    PubMed

    Xia, Wenna; Sun, Yu; Min, Cong; Han, Wei; Wu, Sheng

    2012-11-01

    Aromatic L-Amino acids are important chiral building blocks for the synthesis of many drugs, pesticides, fine chemicals and food additives. Due to the high activity and steroselectivity, enzymatic synthesis of chiral building blocks has become the main research direction in asymmetric synthesis field. Guided by the phylogenetic analysis of transaminases from different sources, two representative aromatic transaminases TyrB and Aro8 in type I subfamily, from the prokaryote Escherichia coli and eukaryote Saccharomyces cerevisia, respectively, were applied for the comparative study of asymmetric transamination reaction process and catalytic efficiency of reversely converting keto acids to the corresponding aromatic L-amino acid. Both TyrB and Aro8 could efficiently synthesize the natural aromatic amino acids phenylalanine and tyrosine as well as non-natural amino acid phenylglycine. The chiral HPLC analysis showed the produced amino acids were L-configuration and the e.e value was 100%. L-alanine was the optimal amino donor, and the transaminase TyrB and Aro8 could not use D-amino acids as amino donor. The optimal molar ratio of amino donor (L-alanine) and amino acceptor (aromatic alpha-keto acids) was 4:1. Both of the substituted group on the aromatic ring and the length of fatty acid carbon chain part in the molecular structure of aromatic substrate alpha-keto acid have the significant impact on the enzyme-catalyzed transamination efficiency. In the experiments of preparative-scale transamination synthesis of L-phenylglycine, L-phenylalanine and L-tyrosine, the specific production rate catalyzed by TryB were 0.28 g/(g x h), 0.31 g/(g x h) and 0.60 g/(g x h) and the specific production rate catalyzed by Aro8 were 0.61 g/(g x h), 0.48 g/(g x h) and 0.59 g/(g x h). The results obtained here were useful for applying the transaminases to asymmetric synthesis of L-amino acids by reversing the reaction balance in industry.

  18. Microbiologically produced carboxylic acids used as building blocks in organic synthesis.

    PubMed

    Aurich, Andreas; Specht, Robert; Müller, Roland A; Stottmeister, Ulrich; Yovkova, Venelina; Otto, Christina; Holz, Martina; Barth, Gerold; Heretsch, Philipp; Thomas, Franziska A; Sicker, Dieter; Giannis, Athanassios

    2012-01-01

    Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building blocks. Thereby, our biotechnological goal was the development of process fundamentals regarding the variable use of renewable raw materials, the development of a multi purpose bioreactor and application of a pilot plant with standard equipment for organic acid production to minimize the technological effort. Furthermore the development of new product isolation procedures, with the aim of direct product recovery, capture of products or single step operation, was necessary. The application of robust and approved microorganisms, also genetically modified, capable of using a wide range of substrates as well as producing a large spectrum of products, was of special importance. Microbiologically produced acids, like 2-oxo-glutaric acid and 2-oxo-D-gluconic acid, are useful educts for the chemical synthesis of hydrophilic triazines, spiro-connected heterocycles, benzotriazines, and pyranoic amino acids. The chiral intermediate of the tricarboxylic acid cycle, (2R,3S)-isocitric acid, is another promising compound. For the first time our process provides large quantities of enantiopure trimethyl (2R,3S)-isocitrate which was used in subsequent chemical transformations to provide new chiral entities for further usage in total synthesis and pharmaceutical research.Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building

  19. Synthesis and biological evaluation of novel lipoamino acid derivatives.

    PubMed

    Kaki, Shiva Shanker; Arukali, Sammaiah; Korlipara, Padmaja V; Prasad, R B N; Yedla, Poornachandra; Ganesh Kumar, C

    2016-01-01

    Seven novel lipoamino acid conjugates were synthesized from methyl oleate and amino acids. Methyl oleate was grafted to different amino acids using thioglycolic acid as a spacer group. Seven derivatives (3a-g) were prepared and characterized by spectral data (NMR, IR and MS spectral studies). All the derivatives were studied for their antimicrobial, anti-biofilm and anticancer activities. Among all the derivatives, it was found that compound 3b was the most potent antibacterial compound which showed good activity against four Gram positive bacterial strains and also exhibited excellent antifungal activity against a fungal strain. In the anti-biofilm assay, compound 3b showed promising activity with IC50 value of 2.8μM against Bacillus subtilis MTCC 121. All the compounds showed anticancer activities with 3c showing promising anticancer activity (IC50=15.3-22.4μM) against the four cell lines tested. PMID:26586599

  20. New multifunctional phosphonic acid for metal phosphonate synthesis

    NASA Astrophysics Data System (ADS)

    Garczarek, Piotr; Janczak, Jan; Zoń, Jerzy

    2013-03-01

    A new heterotopic phosphonic acid, 3-amino-5-(dihydroxyphosphoryl)benzoic acid (1) has been synthesized and obtained in the crystalline form. Second multifunctional phosphonic acid - namely 3-(dihydroxyphosphoryl)-5-nitrobenzoic acid (2) has also been obtained, following a different synthetic route than previously reported. Compound 1 crystallizes in a centrosymmetric space group of the triclinic system as monohydrate, sbnd C6H3(NH2)(COOH)PO3H2·H2O -1a. The molecule in the crystal exists in a zwitterionic form, in which one of the proton of the phosphonic group is transferred to the amine group. The zwitterionic molecules interact to each other and with water molecules via Nsbnd H…O and Osbnd H…O hydrogen bonds forming a three-dimensional network.

  1. Synthesis and evaluation of dioleoyl glyceric acids showing antitrypsin activity.

    PubMed

    Habe, Hiroshi; Fukuoka, Tokuma; Sato, Shun; Kitamoto, Dai; Sakaki, Keiji

    2011-01-01

    Previously, Lešová et al. reported the isolation and identification of metabolite OR-1, showing antitrypsin activity, produced during fermentation by Penicillium funiculosum. The structure of OR-1 was a mixture of glyceric acid (GA), esterified with C(14)-C(18) fatty acids, and oleic acid (C18:1) as the most predominant fatty acid (Folia Microbiol. 46, 21-23, 2001). In this study, dioleoyl D-GA and dioleoyl L-GA were synthesized via diesterification with oleoyl chloride, and their antitrypsin activities were evaluated using both a disk diffusion method and spectral absorption measurements. The results show that both compounds and their equivalent mixtures possess antitrypsin activities; however, their IC(50) values (approximately 2 mM) are much higher than that of OR-1 (4.25 µM), suggesting that dioleoyl GA does not play a major role in the OR-1 antitrypsin activity. PMID:21606621

  2. Selection on synthesis cost affects interprotein amino acid usage in all three domains of life.

    PubMed

    Swire, Jonathan

    2007-05-01

    Most investigations of the forces shaping protein evolution have focused on protein function. However, cells are typically 50%-75% protein by dry weight, with protein expression levels distributed over five orders of magnitude. Cells may, therefore, be under considerable selection pressure to incorporate amino acids that are cheap to synthesize into proteins that are highly expressed. Such selection pressure has been demonstrated to alter amino acid usage in a few organisms, but whether "cost selection" is a general phenomenon remains unknown. One reason for this is that reliable protein expression level data is not available for most organisms. Accordingly, I have developed a new method for detecting cost selection. This method depends solely on interprotein gradients in amino acid usage. Applying it to an analysis of 43 whole genomes from all three domains of life, I show that selection on the synthesis cost of amino acids is a pervasive force in shaping the composition of proteins. Moreover, some amino acids have different price tags for different organisms--the cost of amino acids is changed for organisms living in hydrothermal vents compared with those living at the sea surface or for organisms that have difficulty acquiring elements such as nitrogen compared with those that do not--so I also investigated whether differences between organisms in amino acid usage might reflect differences in synthesis or acquisition costs. The results suggest that organisms evolve to alter amino acid usage in response to environmental conditions.

  3. Synthesis of an indole analog of folic acid

    SciTech Connect

    Shengeliya, M.S.; Avramenko, V.G.; Kuleshova, L.N.; Ershova, Yu.A.; Chernov, V.A.; Surorov, N.N.

    1987-06-01

    The authors study the replacement of the p-aminobenzoic acid (PABA) moiety. The authors synthesized an indole analog of folic acid, namely dimethyl N-(5-(2'-amino-4'-oxo-6'-pteridinyl)methylaminoindol-2-yl)glutamate. The physicochemical properties and the chemical shifts in the PMR spectra of the compounds obtained are shown. The examination of the compound for antitumor activity was carried out using rats and mice.

  4. Synthesis and antifungal activity of cinnamic acid esters.

    PubMed

    Tawata, S; Taira, S; Kobamoto, N; Zhu, J; Ishihara, M; Toyama, S

    1996-05-01

    Cinnamic, p-coumaric and ferulic acids were isolated from pineapple stems (Ananas comosus var. Cayenne). Twenty-four kinds of esters were prepared from these acids, alcohols and the components of Alpinia. Isopropyl 4-hydroxycinnamate (11) and butyl 4-hydroxycinnamate (12) were found to have almost the same effectiveness in antifungal activity against Pythium sp. at 10 ppm as that of the commercial fungicide iprobenfos (kitazin P).

  5. Induction of cellular deoxyribonucleic acid synthesis in butyrate-treated cells by simian virus 40 deoxyribonucleic acid

    SciTech Connect

    Kawasaki, S.; Diamond, L.; Baserga, R.

    1981-11-01

    Sodium butyrate (3mM) inhibited the entry into the S phase of quiescent 3T3 cells stimulated by serum, but had no effect on the accumulation of cellular ribonucleic acid. Simian virus 40 infection or manual microinjection of cloned fragments from the simian virus 40 A gene caused quiescent 3T3 cells to enter the S phase even in the presence of butyrate. NGI cells, a line of 3T3 cells transformed by simian virus 40, grew vigorously in 3 mM butyrate. Homokaryons were formed between G/sub 1/ and S-phase 3T3 cells. Butyrate inhibited the induction of deoxyribonucleic acid synthesis that usually occurs in G/sub 1/ nuclei when G/sub 1/ cells are fused with S-phase cells. However, when G/sub 1/ 3T3 cells were fused with exponentially growing NGI cells, the 3T3 nuclei were induced to enter deoxyribonucleic acid synthesis. In tsAF8 cells, a ribonucleic acid polymerase II mutant that stops in the G/sub 1/ phase of the cell cycle, no temporal sequence was demonstrated between the butyrate block and the temperature-sensitive block. These results confirm previous reports that certain virally coded proteins can induce cell deoxyribonucleic acid synthesis in the absence of cellular functions that are required by serum-stimulated cells. The author's interpretation of these data is that butyrate inhibited cell growth by inhibiting the expression of genes required for the G/sub o/ ..-->.. G/sub 1/ ..-->.. S transition and that the product of the simian virus 40 A gene overrode this inhibition by providing all of the necessary functions for the entry into the S phase.

  6. Engineered Respiro-Fermentative Metabolism for the Production of Biofuels and Biochemicals from Fatty Acid-Rich Feedstocks▿ †

    PubMed Central

    Dellomonaco, Clementina; Rivera, Carlos; Campbell, Paul; Gonzalez, Ramon

    2010-01-01

    Although lignocellulosic sugars have been proposed as the primary feedstock for the biological production of renewable fuels and chemicals, the availability of fatty acid (FA)-rich feedstocks and recent progress in the development of oil-accumulating organisms make FAs an attractive alternative. In addition to their abundance, the metabolism of FAs is very efficient and could support product yields significantly higher than those obtained from lignocellulosic sugars. However, FAs are metabolized only under respiratory conditions, a metabolic mode that does not support the synthesis of fermentation products. In the work reported here we engineered several native and heterologous fermentative pathways to function in Escherichia coli under aerobic conditions, thus creating a respiro-fermentative metabolic mode that enables the efficient synthesis of fuels and chemicals from FAs. Representative biofuels (ethanol and butanol) and biochemicals (acetate, acetone, isopropanol, succinate, and propionate) were chosen as target products to illustrate the feasibility of the proposed platform. The yields of ethanol, acetate, and acetone in the engineered strains exceeded those reported in the literature for their production from sugars, and in the cases of ethanol and acetate they also surpassed the maximum theoretical values that can be achieved from lignocellulosic sugars. Butanol was produced at yields and titers that were between 2- and 3-fold higher than those reported for its production from sugars in previously engineered microorganisms. Moreover, our work demonstrates production of propionate, a compound previously thought to be synthesized only by propionibacteria, in E. coli. Finally, the synthesis of isopropanol and succinate was also demonstrated. The work reported here represents the first effort toward engineering microorganisms for the conversion of FAs to the aforementioned products. PMID:20525863

  7. Synthesis of locked cyclohexene and cyclohexane nucleic acids (LCeNA and LCNA) with modified adenosine units.

    PubMed

    Šála, Michal; Dejmek, Milan; Procházková, Eliška; Hřebabecký, Hubert; Rybáček, Jiří; Dračínský, Martin; Novák, Pavel; Rosenbergová, Šárka; Fukal, Jiří; Sychrovský, Vladimír; Rosenberg, Ivan; Nencka, Radim

    2015-03-01

    We describe here the preparation of conformationally locked cyclohexane nucleic acids designed as hybrids between locked nucleic acids (LNAs) and cyclohexene nucleic acids (CeNAs), both of which excel in hybridization with complementary RNAs. We have accomplished the synthesis of these adenine derivatives starting from a simple ketoester and installed all four chiral centres by means of total synthesis. The acquired monomers were incorporated into nonamer oligonucleotides.

  8. The Role of Fas-FasL Signaling Pathway in Induction of Apoptosis in Patients with Sulfur Mustard-Induced Chronic Bronchiolitis

    PubMed Central

    Pirzad, Gila; Jafari, Mahvash; Tavana, Sasan; Sadrayee, Homayoon; Ghavami, Saeid; Shajiei, Arezoo; Ghanei, Mostafa

    2010-01-01

    Sulfur mustard (SM) is an alkylating agent that induces apoptosis and necrosis in cells. Fas-Fas ligand (FasL) interaction could induce apoptosis as well. In this study, it was hypothesized that apoptosis might play an important role in the pathogenesis of SM-induced lung injury via Fas-FasL signaling pathway. In a case-control study, Fas and FasL levels, caspase-3 activity and percent of apoptotic cells were measured in bronchoalveolar lavage (BAL) fluid of patients 20 years after exposure to sulfur mustard and compared with the control group. Results show that Fas and FasL levels were significantly higher in BAL fluid cells in patients group compared with the control (P = .001). No significant differences were observed between mild and moderate-severe groups. BAL fluid cells caspase-3 activity was not significantly different among the mild, moderate-severe, and control groups. The data suggest that Fas-FasL-induced apoptosis was impaired in BAL fluid cells of SM-exposed patients which might be one of the initiators of pathogenesis in SM-induced lung injury in these patients. PMID:21317984

  9. Safrole oxide induces apoptosis by up-regulating Fas and FasL instead of integrin beta4 in A549 human lung cancer cells.

    PubMed

    Du, AiYing; Zhao, BaoXiang; Miao, JunYing; Yin, DeLing; Zhang, ShangLi

    2006-04-01

    Previously, we found that 3,4-(methylenedioxy)-1-(2',3'-epoxypropyl)-benzene (safrole oxide) induced a typical apoptosis in A549 human lung cancer cells by activating caspase-3, -8, and -9. In this study, we further investigated which upstream pathways were activated by safrole oxide during the apoptosis. Immunofluorescence assay combined with laser scanning confocal microscopy revealed that both Fas and Fas ligand (FasL) were up-regulated by the small molecule. In addition, Fas protein distribution was altered, showing a clustering distribution instead of a homogeneous one. Subsequently, Western blot analysis confirmed the up-regulations of Fas and its membrane-binding form of FasL (m-FasL), as well as P53 protein. Conversely, safrole oxide hardly affected integrin beta4 subunit expression or distribution, which was reflected from the data obtained by immunofluorescence assay combined with laser scanning confocal microscopy. The results suggested that Fas/FasL pathway might be involved in safrole oxide-induced apoptosis of A549 cells, while integrin beta4 might be irrelevant to the apoptosis. Nevertheless, we first found the strong expression of integrin beta4 in A549 cells. The study first suggested that safrole oxide might be used as a small molecular promoter of Fas/FasL pathway to elicit apoptosis in A549 cells, which would lay the foundation for us to insight into the new strategies for lung cancer therapy.

  10. Transfer of Fas (CD95) protein from the cell surface to the surface of polystyrene beads coated with anti-Fas antibody clone CH-11.

    PubMed

    Sawai, Hirofumi; Domae, Naochika

    2010-02-04

    Mouse monoclonal anti-Fas (CD95) antibody clone CH-11 has been widely used in research on apoptosis. CH-11 has the ability to bind to Fas protein on cell surface and induce apoptosis. Here, we used polystyrene beads coated with CH-11 to investigate the role of lipid rafts in Fas-mediated apoptosis in SKW6.4 cells. Unexpectedly, by treatment of the cells with CH-11-coated beads Fas protein was detached from cell surface and transferred to the surface of CH-11-coated beads. Western blot analysis showed that Fas protein containing both extracellular and intracellular domains was attached to the beads. Fas protein was not transferred from the cells to the surface of the beads coated with other anti-Fas antibodies or Fas ligand. Similar phenomenon was observed in Jurkat T cells. Furthermore, CH-11-induced apoptosis was suppressed by pretreatment with CH-11-coated beads in Jurkat cells. These results suggest that CH-11 might possess distinct properties on Fas protein compared with other anti-Fas antibodies or Fas ligand, and also suggest that caution should be needed to use polystyrene beads coated with antibodies such as CH-11.

  11. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  12. Metabolism of Very Long-Chain Fatty Acids: Genes and Pathophysiology

    PubMed Central

    Sassa, Takayuki; Kihara, Akio

    2014-01-01

    Fatty acids (FAs) are highly diverse in terms of carbon (C) chain-length and number of double bonds. FAs with C>20 are called very long-chain fatty acids (VLCFAs). VLCFAs are found not only as constituents of cellular lipids such as sphingolipids and glycerophospholipids but also as precursors of lipid mediators. Our understanding on the function of VLCFAs is growing in parallel with the identification of enzymes involved in VLCFA synthesis or degradation. A variety of inherited diseases, such as ichthyosis, macular degeneration, myopathy, mental retardation, and demyelination, are caused by mutations in the genes encoding VLCFA metabolizing enzymes. In this review, we describe mammalian VLCFAs by highlighting their tissue distribution and metabolic pathways, and we discuss responsible genes and enzymes with reference to their roles in pathophysiology. PMID:24753812

  13. In vitro synthesis of arachidonoyl amino acids by cytochrome c.

    PubMed

    McCue, Jeffrey M; Driscoll, William J; Mueller, Gregory P

    2009-11-01

    Arachidonoyl amino acids are a class of endogenous lipid messengers that are expressed in the mammalian central nervous system and peripherally. While several of their prominent pharmacologic effects have been documented, the mechanism by which arachidonoyl amino acids are biosynthesized has not been defined. We have previously observed that the mitochondrial protein, cytochrome c, is capable of catalyzing the formation of the prototypic arachidonoyl amino acid, arachidonoyl glycine, utilizing arachidonoyl CoA and glycine as substrates, in the presence of hydrogen peroxide. Here we report that cytochrome c is similarly able to catalyze the formation of N-arachidonoyl serine, N-arachidonoyl alanine, and N-arachidonoyl gamma aminobutyric acid from arachidonoyl CoA and the respective amino acids. The identities of the arachidonoyl amino acid products were verified by mass spectral fragmentation pattern analysis. The synthetic reactions exhibited Michaelis-Menten kinetics and continued favorably at physiologic temperature and pH. Spectral data indicate that both cytochrome c protein structure and a +3 heme iron oxidation state are required for the reaction mechanism to proceed optimally. Reactions designed to catalyze the formation of N-arachidonoyl dopamine were not efficient due to the rapid oxidation of dopamine substrate by hydrogen peroxide, consuming both reactants. Finally, under standard assay conditions, arachidonoyl CoA and ethanolamine were found to react spontaneously to form anandamide, independent of cytochrome c and hydrogen peroxide. Accordingly, it was not possible to demonstrate a potential role for cytochrome c in the biosynthetic mechanism for either arachidonoyl dopamine or anandamide. However, the ability of cytochrome c to effectively catalyze the formation of N-arachidonoyl serine, N-arachidonoyl alanine, and N-arachidonoyl gamma aminobutyric acid in vitro highlights its potential role for the generation of these lipid messengers in vivo.

  14. Nature's Starships: Amino Acid Synthesis, Frequency, and Delivery to Earth via Meteorites

    NASA Astrophysics Data System (ADS)

    Cobb, Alyssa; Pudritz, Ralph

    2013-07-01

    Understanding the origin of organic molecules on Earth is vital to our understanding of the origins of life. One proposed mechanism for the introduction of organic material to our planet is via meteorite impacts. Meteoritic parent bodies contain organic material and water ice, which, given radionuclide decay in their interiors, cause the ice to melt and the parent bodies to undergo a process called aqueous alteration. An example of this internal chemistry is Strecker synthesis, a process resulting in the production of various amino acids. Our work summarizes recent discoveries regarding amino acid synthesis and concentration data. We present the amino acid concentrations collated from a variety of meteorites (~20) covering a range of meteorite classes. We can use the dependence of amino acid frequency on variables such as temperature and pressure to model Strecker synthesis inside a theoretical parent body. Our modeling software takes a set of chemical species and outputs their relative frequencies based on a minimization of their Gibbs free energies. The goal of this work is to predict and quantify the presence of amino acids on a foreign landscape using thermodynamic principles.

  15. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids.

    PubMed

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D V S; Sharma, Rohit K

    2014-10-31

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  16. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  17. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  18. QUANTITATIVE CONTRIBUTIONS OF DIET AND LIVER SYNTHESIS TO DOCOSAHEXAENOIC ACID HOMEOSTASIS

    PubMed Central

    Rapoport, Stanley I.; Igarashi, Miki; Gao, Fei

    2010-01-01

    Dietary requirements for maintaining brain and heart docosahexaenoic acid (DHA, 22:6n-3) homeostasis are not agreed on, in part because rates of liver DHA synthesis from circulating α-linolenic acid (α-LNA, 18:2n-3) have not been quantified. These rates can be estimated in vivo using intravenous radiotracer- or heavy isotope-labeled α-LNA infusion. In adult unanesthetized male rats, such infusion shows that liver synthesis-secretion rates of DHA from α-LNA markedly exceed brain and heart DHA synthesis rates and brain DHA consumption rate, and that liver but not heart or brain synthesis is upregulated as dietary n-3 PUFA content is reduced. These differences in rate reflect much higher expression of DHA-synthesizing enzymes in liver, and upregulation of liver but not heart or brain enzyme expression by reduced dietary n-3 PUFA content. A noninvasive intravenous [U-13C]α-LNA infusion method that produces steady-state liver tracer metabolism gives exact liver DHA synthesis-secretion rates and could be extended for human studies. PMID:20226642

  19. Synthesis of l-(+)-Tartaric Acid from l-Ascorbic Acid via 5-Keto-d-Gluconic Acid in Grapes

    PubMed Central

    Saito, Kazumi; Kasai, Zenzaburo

    1984-01-01

    5-Keto-l-idionic acid (≡5-keto-d-gluconic acid, d-xylo-5-hexulosonic acid) was found as a metabolic product of l-ascorbic acid in slices of immature grapes, Vitis labrusca L. cv `Delaware'. Specifically labeled compounds, recognized as metabolic products of l-ascorbic acid in grapes, were fed to young grape tissues to investigate the metabolic pathway from l-ascorbic acid to l-(+)-tartaric acid. Label from dehydro-l-[1-14C]ascorbic acid, 2-keto-l-[1-14C]idonic acid (l-xylo-2-hexulosonic acid), l-[1-14C]idonic acid, or 5-keto-l-[1-14C] idonic acid was incorporated into l-(+)-tartaric acid in high yields as it was in the l-[1-14C]ascorbic acid experiment. In a double label experiment involving a mixture of l-[1-14C]idonic acid and l-[2-3H]idonic acid, the 3H/14C ratios of 5-keto-l-idonic acid and l-(+)-tartaric acid synthesized in young grape leaves were almost the same as the value of the l-idonic acid fed. Label from 5-keto-l-[6-14C]idonic acid was incorporated into sugars and insoluble residue in the same way as l-[6-14C]ascorbic acid was metabolized in grapes. These results provide strong evidence that in grapes l-(+)-tartaric acid is synthesized from the C4 fragment that corresponds to the C1 to C4 group of the 5-keto-l-idonic acid derived from l-ascorbic acid via 2-keto-l-idonic acid and l-idonic acid. PMID:16663792

  20. Expression of Fas and Fas Ligand on Mouse Renal Tubular Epithelial Cells in the Generalized Shwartzman Reaction and Its Relationship to Apoptosis

    PubMed Central

    Koide, Naoki; Narita, Kayo; Kato, Yutaka; Sugiyama, Tsuyoshi; Chakravortty, Dipshikha; Morikawa, Akiko; Yoshida, Tomoaki; Yokochi, Takashi

    1999-01-01

    Previously we reported that the consecutive injection of lipopolysaccharide (LPS) into LPS-sensitized mice for the generalized Shwartzman reaction (GSR) appeared to induce the injury of renal tubular epithelial cells via apoptosis. The aim of this study was to characterize the mechanism of renal tubular epithelial cell injury in GSR. The expression of Fas and Fas ligand was immunohistochemically detected on renal tubular epithelial cells from GSR-induced mice, although neither Fas nor Fas ligand was found in cells from untreated control mice or in cells from mice receiving a single injection of LPS. GSR-induced renal tubular epithelial cell injury was produced in neither Fas-negative MRL-lpr/lpr mice nor Fas ligand-negative MRL-gld/gld mice. The administration of anti-gamma interferon antibody together with a preparative injection of LPS prevented the expression of Fas and Fas ligand and the apoptosis of renal tubular epithelial cells. A provocative injection of tumor necrosis factor alpha into LPS-sensitized mice augmented Fas and Fas ligand expression and the apoptosis of renal tubular epithelial cells. The administration of tumor necrosis factor alpha to interleukin-12-sensitized mice resulted in Fas and Fas ligand expression and the apoptosis. Sensitization with interleukin-12 together with anti-gamma interferon antibody did not cause the apoptosis of renal tubular epithelial cells. It was suggested that the Fas/Fas ligand system probably plays a critical role in the development of renal tubular epithelial cell injury through apoptotic cell death. PMID:10417181

  1. Studies on chemical modification and biology of a natural product, gambogic acid (II): Synthesis and bioevaluation of gambogellic acid and its derivatives from gambogic acid as antitumor agents.

    PubMed

    Wang, Jinxin; Ma, Junhai; You, Qidong; Zhao, Li; Wang, Fan; Li, Chong; Guo, Qinglong

    2010-09-01

    Gambogic acid (GA) has been reported to be a potent apoptosis inducer. The fact that it is amenable to chemical modification makes GA an attractive molecule for the development of anticancer agents. We firstly reported the synthesis of gambogellic acid, which was generated under acid catalysis from readily available GA by a base-catalyzed diene intramolecular annelation. Sequentially, thirteen new compounds were synthesized and their inhibitory activity on HT-29, Bel-7402, BGC-823, and A549 cell lines were evaluated in vitro by MTT assay, and (38, 40)-epoxy-33-chlorogambogellic acid (4) was identified as a BGC-823 cell apoptosis inducer through MTT cell assay, observations of morphological changes, and Annexin-V/PI double-staining assay. Compound 4 showed significant effects in inducing apoptosis and might serve as a potential lead compound for discovery of new anticancer drugs. Further structure-activity relationships (SARs) of gambogic acid derivatives were discussed.

  2. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  3. Synthesis and properties of synthetic fulvic acid derived from hematoxylin

    NASA Astrophysics Data System (ADS)

    Litvin, Valentina A.; Minaev, Boris F.; Baryshnikov, Gleb V.

    2015-04-01

    A model fulvic acid (FA) was synthesized from a natural dye, hematoxylin, in a slow oxidative polymerization/condensation reaction catalysed by OH- at pH ca. 12. The resulting dark-brown product, acidified to pH ca. 2, did not precipitate from the reaction solution. It was isolated and purified by cation-exchange resin. Its physicochemical and spectroscopic properties, as determined by means of elemental analysis, molecular weight analyses, Fourier transform infra red (FTIR) and ultraviolet-visible (UV-VIS) spectroscopy, X-ray diffraction and electron paramagnetic resonance (EPR) spectroscopy, showed a close resemblance to natural FA. The similarity and differences between synthetic fulvic acids derived from hematoxylin and the natural fulvic acids substances are discussed. Quantum-chemical calculations of the supposed primary oxidation products of hematoxylin are performed and compared with observations.

  4. Amino acids in a Fischer Tropsch type synthesis

    NASA Technical Reports Server (NTRS)

    Brown, D. L.; Lawless, J. G.

    1974-01-01

    One postulation is described for the presence of organic compounds in meteorites which states that they were formed during the condensation of the solar nebula. A viable laboratory simulation of these conditions can be modeled after the industrial Fischer Tropsch reaction, which is known to produce organic compounds called hydrocarbons. In this simulation, a mixture of carbon monoxide, hydrogen and ammonia is heated in the presence of iron meteorite. The reaction products for amino acids, a class of organic compounds important to life, were examined. A large number of these compounds is found in meteorites and other chemical evolution experiments, but only small quantities of a few amino acids were found in the present simulation work. These results are at odds with the existing literature in which many amino acids were reported.

  5. [Effect of citric acid on synthesis of surfactants in Rhodococcus erythropolis IMV Ac-5017].

    PubMed

    Pyroh, T P; Shevchuk, T A; Shuliakova, M O; Tarasenko, D O

    2011-01-01

    Expediency of sodium citrate (regulator of lipids synthesis) substitution is shown in the medium of cultivation of Rhodococcus erythropolis IMV Ac-5017 with ethanol (or hexadecane) and fumarate (gluconeogenesis precursor) by citric acid for pH maintenance at the level optimal for synthesis of surfactants. It has been established the maximum synthesis of surfactants of R. erythropolis IMV Ac-5017 was observed at pH 8.0. Introduction of 0.2% sodium fumarate at the end of experimental growth phase of the strain IMV Ac-5017 in the medium with 2% of ethanol with further periodic acidification of culture liquid by citric acid up to pH 8.0 was accompanied by the increase of conditional concentration of surfactants by 30, 40 and 95% as compared with an analogous process without pH regulation, by the use of sodium citrate as the regulator of lipids synthesis on the medium with ethanol as well as without organic acids, respectively.

  6. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  7. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  8. Synthesis, structure, and biological applications of α-fluorinated β-amino acids and derivatives.

    PubMed

    March, Taryn L; Johnston, Martin R; Duggan, Peter J; Gardiner, James

    2012-11-01

    This review gives a broad overview of the state of play with respect to the synthesis, conformational properties, and biological activity of α-fluorinated β-amino acids and derivatives. General methods are described for the preparation of monosubstituted α-fluoro-β-amino acids (Scheme 1). Nucleophilic methods for the introduction of fluorine predominantly involve the reaction of DAST with alcohols derived from α-amino acids, whereas electrophilic sources of fluorine such as NFSI have been used in conjunction with Arndt-Eistert homologation, conjugate addition or organocatalyzed Mannich reactions. α,α-Difluoro-β-amino acids have also been prepared using DAST; however, this area of synthesis is largely dominated by the use of difluorinated Reformatsky reagents to introduce the difluoro ester functionality (Scheme 9). α-Fluoro-β-amino acids and derivatives analyzed by X-ray crystal and NMR solution techniques are found to adopt preferred conformations which are thought to result from stereoelectronic effects associated with F located close to amines, amides, and esters (Figs. 2-6). α-Fluoro amide and β-fluoro ethylamide/amine effects can influence the secondary structure of α-fluoro-β-amino acid-containing derivatives including peptides and peptidomimetics (Figs. 7-9). α-Fluoro-β-amino acids are also components of a diverse range of bioactive anticancer (e.g., 5-fluorouracil), antifungal, and antiinsomnia agents as well as protease inhibitors where such fluorinated analogs have shown increased potency and spectrum of activity.

  9. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  10. Enhanced synthesis of alkyl amino acids in Miller's 1958 H2S experiment.

    PubMed

    Parker, Eric T; Cleaves, H James; Callahan, Michael P; Dworkin, Jason P; Glavin, Daniel P; Lazcano, Antonio; Bada, Jeffrey L

    2011-12-01

    Stanley Miller's 1958 H(2)S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH(4)), ammonia (NH(3)), carbon dioxide (CO(2)), and hydrogen sulfide (H(2)S) produced several alkyl amino acids, including the α-, β-, and γ-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H(2)S, aspartic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H(2)S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H(2)S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth. PMID:22139514

  11. Synthesis, antimicrobial evaluation and QSAR studies of stearic acid derivatives.

    PubMed

    Tahlan, S; Kumar, P; Narasimhan, B

    2014-02-01

    A series of Schiff bases (1-17) and esters (18-28) of stearic acid was synthesized and characterized by physicochemical as well as spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity by tube dilution method. The antimicrobial screening results indicated that the compounds having electron releasing groups on benzylidene nucleus were found to be more active against bacterial strains and compounds having electron withdrawing groups on benzylidene nucleus were found to be more active against fungal strains. QSAR studies demonstrated that electronic parameters dipole moment (µ) and total energy (Te) were the most important descriptors in describing the antimicrobial activity of synthesized stearic acid derivatives.

  12. Okadaic acid disrupts Golgi structure and impairs enzyme synthesis and secretion in the rat pancreas.

    PubMed

    Waschulewski, I H; Kruse, M L; Agricola, B; Kern, H F; Schmidt, W E

    1996-06-01

    Okadaic acid, a serine/threonine phosphatase inhibitor, has been shown to inhibit rat pancreatic enzyme secretion by interference with late processes in stimulus-secretion coupling. To further characterize its action, we studied the effect of okadaic acid on secretion of newly synthesized proteins, protein synthesis, and cellular ultrastructure in pancreatic lobules derived from rats stimulated in vivo by feeding the synthetic proteinase inhibitor FOY-305. Okadaic acid completely blocked protein secretion at concentrations that inhibit the Ca2+/calmodulin-dependent protein phosphatase 2b, calcineurin. Protein synthesis was abolished at 10(-6) mol/l and reduced by 60% at 5 x 10(-7) mol/l okadaic acid. Pancreatic lobules exposed to 5 x 10(-7) mol/l okadaic acid for 20 min fully restored their secretory capacity on removal of the drug; whereas, after a preincubation with okadaic acid for > 40 min, protein secretion remained impaired during the recovery period. Electron microscopic examination of pancreatic acinar cells treated with 5 x 10(-7) mol/l okadaic acid revealed a dilated Golgi complex after 15 and 30 min and a subsequent fragmentation of Golgi cisternae into clouds of small uniform vesicles after 60 min. Reassembly of Golgi stacks occurred after a 60-min recovery without okadaic acid. These data indicate that serine/threonine phosphatases play an important role not only in the regulation of pancreatic enzyme synthesis and exocytosis but also are crucial for the maintenance of normal Golgi architecture and function in the exocrine rat pancreas. These effects are probably not exclusively mediated via type 2b calcineurin-like protein phosphatases.

  13. sFas levels increase in response to cisplatin-based chemotherapy in lung cancer patients.

    PubMed

    Ulukaya, Engin; Acilan, Ceyda; Yilmaz, Meryem; Yilmaztepe-Oral, Arzu; Ari, Ferda; Zik, Berrin; Ursavas, Ahmet; Tokullugil, Asuman H

    2010-10-01

    The Fas/Fas Ligand (FasL) system and survivin have counteracting roles in cell survival. Therefore, we explored the role of circulating soluble Fas (sFas) and the tissue levels of Fas and survivin with regard to response to chemotherapy in lung cancer patients. Serum samples from 52 lung cancer patients and 54 control subjects (19 benign lung disease and 35 healthy control subjects) were collected prior to and 24 and 48 h after chemotherapy. sFas was statistically significantly higher in the cancer group than that in the control groups (p < 0.001). Baseline (before chemotherapy) sFas values showed a statistically significant inverse correlation with overall survival (r = -0.599, p < 0.001). There was a significant increase in serum sFas levels 24 h after treatment (p < 0.05). Contrarily, tissue levels of Fas and survivin were not changed following the chemotherapy (p > 0,05). In conclusion, increased sFas may be an indicator of poor outcome in lung cancer patients. However, cisplatin-based chemotherapy may not be effective via neither the Fas/FasL system nor survivin pathway. Indeed, larger sample size is required for further evaluation.

  14. Effect of nerve growth factor on the synthesis of amino acids in PC12 cells

    SciTech Connect

    Zielke, H.R.; Tildon, J.T.; Kauffman, F.C.; Baab, P.J. )

    1989-04-01

    Radioactive short-chain fatty acids preferentially label glutamine relative to glutamate in brain due to compartmentation of glutamine and glutamate. To determine whether this phenomenon occurs in a single cell culture model, we examined the effect of fatty acid chain length on the synthesis as well as pool size of selected amino acids in rat pheochromocytoma PC12 cells, a cell culture model of the large glutamate compartment in neurons. Intracellular 14C-amino acids were quantitated by HPLC, and the incorporation of (U-14C)-glucose, (1-14C)-butyrate, (1-14C)-octanoate, and (1-14C)-palmitate into five amino acids was measured in native and NGF-treated PC12 cells. NGF pretreatment decreased the intracellular concentration of amino acids as did addition of fatty acids but these effects were not additive. Specific activities of amino acids in native cells labelled by 14C-octanoate were 1,300 DPM/nmol, 490 DPM/nmol, 200 DPM/nmol, and 110 DPM/nmol for glutamate, aspartate, glutamine, and serine, respectively. No radioactivity was detected in alanine. Similar specific activities were noted when 14C-butyrate was the precursor; however, there was at least 5-fold less if 14C-palmitate was the precursor. Pretreatment of cells with NGF decreased the specific activity of amino acids by 25-65%. Specific activities of amino acids synthesized from 14C-glucose decreased in the following order: glutamate, 1,640 DPM/nmol; aspartate, 1,210 DPM/nmol; alanine, 580 DPM/nmol; glutamine, 275 DPM/nmol; and serine, 80 DPM/nmol for native cells. NGF pretreatment decreased the specific activities of glutamate and glutamine, but not of the other 3 amino acids. The preferred precursor for glutamate synthesis in native PC12 cells was glucose followed by octanoate, butyrate and palmitate (16:6:3:1).

  15. Synthesis and phosphorylation of the glial fibrillary acidic protein during brain development: A tissue slice study

    SciTech Connect

    Noetzel, M.J. )

    1990-01-01

    Brain slices were incubated with either (3H) amino acids or (32P) orthophosphate in order to characterize the synthesis and phosphorylation of the glial fibrillary acidic protein (GFAP) in the rat nervous system. The incorporation of (3H) amino acids into GFAP was found to increase significantly during early postnatal development, reaching a peak of activity on day 5 of life and then declining over the next 2 weeks. Concomitant with this peak of synthetic activity the content of GFAP in rat brain was also observed to increase dramatically. GFAP continued to accumulate in brain through postnatal day 30 despite a decrease in the synthesis of the protein. These results indicate that the increase in GFAP during the first month of life cannot be ascribed solely to the rate of GFAP synthesis. The findings are consistent with the hypothesis that during later stages of astrocytic development the accumulation of GFAP may be primarily dependent upon a low rate of protein degradation. The pattern of GFAP phosphorylation in the developing rat brain differed from that observed for the incorporation of (3H) amino acids. The peak incorporation of 32P into GFAP occurred on postnatal day 10 at a time when synthesis of the protein had declined by 43%. These findings suggest that during development phosphorylation of GFAP is mediated by factors different from those directing its synthesis. In addition, phosphorylation of GFAP did not alter its solubility in cytoskeletal preparations indicating that GFAP phosphorylation is probably not a major regulatory mechanism in disassembly of the astroglial filaments.

  16. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  17. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.

    PubMed

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-08-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  18. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  19. Synthesis and characterization of ultraviolet light-emitting organic acids.

    PubMed

    An, Chun-Ai; Guo, Yanchao; Si, Zhenjun; Duan, Qian

    2014-05-01

    Three ultraviolet light-emitting organic acids of 3,3'-(4-phenyl-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-1), 4,4',4″-(4H-1,2,4-triazole-3,4,5-triyl)tribenzoic acid (Tz-2), and 4,4'-(4-(4'-carboxy-[1,1'-biphenyl]-4-yl)-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-3) were successfully synthesized and fully characterized by the (1)H NMR, the IR absorption spectra, and the X-ray single crystal diffraction. It was found that Tz-1, Tz-2, and Tz-3 could give out the ultraviolet photoluminescent spectra centered at 369 nm, 365 nm and 350 nm, respectively. The luminescence quantum yields of Tz-1 and Tz-2 were measured to be 0.20 and 0.14, respectively. Additionally, the density functional theory (DFT) and the time-dependent DFT calculations were also carried out for Tz-1, Tz-2, and Tz-3.

  20. Butyrate suppresses colonic inflammation through HDAC1-dependent Fas upregulation and Fas-mediated apoptosis of T cells

    PubMed Central

    Zimmerman, Mary A.; Singh, Nagendra; Martin, Pamela M.; Thangaraju, Muthusamy; Ganapathy, Vadivel; Waller, Jennifer L.; Shi, Huidong; Robertson, Keith D.; Munn, David H.

    2012-01-01

    Butyrate, an intestinal microbiota metabolite of dietary fiber, has been shown to exhibit protective effects toward inflammatory diseases such as ulcerative colitis (UC) and inflammation-mediated colorectal cancer. Recent studies have shown that chronic IFN-γ signaling plays an essential role in inflammation-mediated colorectal cancer development in vivo, whereas genome-wide association studies have linked human UC risk loci to IFNG, the gene that encodes IFN-γ. However, the molecular mechanisms underlying the butyrate-IFN-γ-colonic inflammation axis are not well defined. Here we showed that colonic mucosa from patients with UC exhibit increased signal transducer and activator of transcription 1 (STAT1) activation, and this STAT1 hyperactivation is correlated with increased T cell infiltration. Butyrate treatment-induced apoptosis of wild-type T cells but not Fas-deficient (Faslpr) or FasL-deficient (Fasgld) T cells, revealing a potential role of Fas-mediated apoptosis of T cells as a mechanism of butyrate function. Histone deacetylase 1 (HDAC1) was found to bind to the Fas promoter in T cells, and butyrate inhibits HDAC1 activity to induce Fas promoter hyperacetylation and Fas upregulation in T cells. Knocking down gpr109a or slc5a8, the genes that encode for receptor and transporter of butyrate, respectively, resulted in altered expression of genes related to multiple inflammatory signaling pathways, including inducible nitric oxide synthase (iNOS), in mouse colonic epithelial cells in vivo. Butyrate effectively inhibited IFN-γ-induced STAT1 activation, resulting in inhibition of iNOS upregulation in human colon epithelial and carcinoma cells in vitro. Our data thus suggest that butyrate delivers a double-hit: induction of T cell apoptosis to eliminate the source of inflammation and suppression of IFN-γ-mediated inflammation in colonic epithelial cells, to suppress colonic inflammation. PMID:22517765

  1. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    PubMed

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  2. Dietary Lipid Levels Influence Lipid Deposition in the Liver of Large Yellow Croaker (Larimichthys crocea) by Regulating Lipoprotein Receptors, Fatty Acid Uptake and Triacylglycerol Synthesis and Catabolism at the Transcriptional Level

    PubMed Central

    Yan, Jing; Liao, Kai; Wang, Tianjiao; Mai, Kangsen; Xu, Wei; Ai, Qinghui

    2015-01-01

    Ectopic lipid accumulation has been observed in fish fed a high-lipid diet. However, no information is available on the mechanism by which dietary lipid levels comprehensively regulate lipid transport, uptake, synthesis and catabolism in fish. Therefore, the present study aimed to gain further insight into how dietary lipids affect lipid deposition in the liver of large yellow croaker(Larimichthys crocea). Fish (150.00±4.95 g) were fed a diet with a low (6%), moderate (12%, the control diet) or high (18%) crude lipid content for 10 weeks. Growth performance, plasma biochemical indexes, lipid contents and gene expression related to lipid deposition, including lipoprotein assembly and clearance, fatty acid uptake and triacylglycerol synthesis and catabolism, were assessed. Growth performance was not significantly affected. However, the hepato-somatic and viscera-somatic indexes as well as plasma triacylglycerol, non-esterified fatty acids and LDL-cholesterol levels were significantly increased in fish fed the high-lipid diet. In the livers of fish fed the high-lipid diet, the expression of genes related to lipoprotein clearance (LDLR) and fatty acid uptake (FABP11) was significantly up-regulated, whereas the expression of genes involved in lipoprotein assembly (apoB100), triacylglycerol synthesis and catabolism (DGAT2, CPT I) was significantly down-regulated compared with fish fed the control diet, and hepatic lipid deposition increased. In fish fed the low-lipid diet, the expression of genes associated with lipoprotein assembly and clearance (apoB100, LDLR, LRP-1), fatty acid uptake (CD36, FATP1, FABP3) and triacylglycerol synthesis (FAS) was significantly increased, whereas the expression of triacylglycerol catabolism related genes (ATGL, CPT I) was reduced compared with fish fed the control diet. However, hepatic lipid content in fish fed the low-lipid diet decreased mainly due to low dietary lipid intake. In summary, findings of this study provide molecular

  3. Dietary Lipid Levels Influence Lipid Deposition in the Liver of Large Yellow Croaker (Larimichthys crocea) by Regulating Lipoprotein Receptors, Fatty Acid Uptake and Triacylglycerol Synthesis and Catabolism at the Transcriptional Level.

    PubMed

    Yan, Jing; Liao, Kai; Wang, Tianjiao; Mai, Kangsen; Xu, Wei; Ai, Qinghui

    2015-01-01

    Ectopic lipid accumulation has been observed in fish fed a high-lipid diet. However, no information is available on the mechanism by which dietary lipid levels comprehensively regulate lipid transport, uptake, synthesis and catabolism in fish. Therefore, the present study aimed to gain further insight into how dietary lipids affect lipid deposition in the liver of large yellow croaker(Larimichthys crocea). Fish (150.00±4.95 g) were fed a diet with a low (6%), moderate (12%, the control diet) or high (18%) crude lipid content for 10 weeks. Growth performance, plasma biochemical indexes, lipid contents and gene expression related to lipid deposition, including lipoprotein assembly and clearance, fatty acid uptake and triacylglycerol synthesis and catabolism, were assessed. Growth performance was not significantly affected. However, the hepato-somatic and viscera-somatic indexes as well as plasma triacylglycerol, non-esterified fatty acids and LDL-cholesterol levels were significantly increased in fish fed the high-lipid diet. In the livers of fish fed the high-lipid diet, the expression of genes related to lipoprotein clearance (LDLR) and fatty acid uptake (FABP11) was significantly up-regulated, whereas the expression of genes involved in lipoprotein assembly (apoB100), triacylglycerol synthesis and catabolism (DGAT2, CPT I) was significantly down-regulated compared with fish fed the control diet, and hepatic lipid deposition increased. In fish fed the low-lipid diet, the expression of genes associated with lipoprotein assembly and clearance (apoB100, LDLR, LRP-1), fatty acid uptake (CD36, FATP1, FABP3) and triacylglycerol synthesis (FAS) was significantly increased, whereas the expression of triacylglycerol catabolism related genes (ATGL, CPT I) was reduced compared with fish fed the control diet. However, hepatic lipid content in fish fed the low-lipid diet decreased mainly due to low dietary lipid intake. In summary, findings of this study provide molecular

  4. Pre-germinated brown rice prevented high fat diet induced hyperlipidemia through ameliorating lipid synthesis and metabolism in C57BL/6J mice.

    PubMed

    Shen, Kuo-Ping; Hao, Chi-Long; Yen, Hsueh-Wei; Chen, Chun-Yen; Chen, Jia-Hao; Chen, Fu-Chih; Lin, Hui-Li

    2016-07-01

    Pre-germinated brown rice (PGBR) can ameliorate hyperlipidemia, but the action mechanism is not clear. We focus the mechanisms of PGBR prevented hyperlipidemia. Six-week-old mice were divided into: standard-regular diet (SRD), high-fat diet (HFD) and HFD with PGBR (HFD + PGBR) groups for 16 weeks. The HFD group has higher concentrations of TG, TC, HDL and Non-HDL in the blood, and a higher atherosclerosis index (AI). The TG levels in the liver, and TG, bile acid levels in the feces were enhanced; and the total adipocytokines level in adipose tissue was reduced. The HFD group had higher protein expressions of SREBP-1, SCD-1, FAS, LDLR, and CYP7α1 in the liver. Moreover, the greater expressions of SREBP-1, SCD-1, FAS and the less expressions of PPAR-α and adiponectin were in adipose tissue. In the HFD + PGBR group, the PGBR regulated the levels of TG, TC, HDL, Non-HDL, AI and adipocytokines. PGBR increased more cholesterol and bile acid exhaust in feces. The SREBP-1, SCD-1, FAS, HMGCR, LDLR, CYP7α1 and PPAR-α proteins in the liver; and the SREBP-1, SCD-1, FAS, PPAR-α and adiponectin proteins in adipose tissue were reversed by PGBR. Taken together, PGBR can improve lipid synthesis and metabolism, and we suggest PGBR is a recommendable food for controlling hyperlipidemia. PMID:27499577

  5. Pre-germinated brown rice prevented high fat diet induced hyperlipidemia through ameliorating lipid synthesis and metabolism in C57BL/6J mice

    PubMed Central

    Shen, Kuo-Ping; Hao, Chi-Long; Yen, Hsueh-Wei; Chen, Chun-Yen; Chen, Jia-Hao; Chen, Fu-Chih; Lin, Hui-Li

    2016-01-01

    Pre-germinated brown rice (PGBR) can ameliorate hyperlipidemia, but the action mechanism is not clear. We focus the mechanisms of PGBR prevented hyperlipidemia. Six-week-old mice were divided into: standard-regular diet (SRD), high-fat diet (HFD) and HFD with PGBR (HFD + PGBR) groups for 16 weeks. The HFD group has higher concentrations of TG, TC, HDL and Non-HDL in the blood, and a higher atherosclerosis index (AI). The TG levels in the liver, and TG, bile acid levels in the feces were enhanced; and the total adipocytokines level in adipose tissue was reduced. The HFD group had higher protein expressions of SREBP-1, SCD-1, FAS, LDLR, and CYP7α1 in the liver. Moreover, the greater expressions of SREBP-1, SCD-1, FAS and the less expressions of PPAR-α and adiponectin were in adipose tissue. In the HFD + PGBR group, the PGBR regulated the levels of TG, TC, HDL, Non-HDL, AI and adipocytokines. PGBR increased more cholesterol and bile acid exhaust in feces. The SREBP-1, SCD-1, FAS, HMGCR, LDLR, CYP7α1 and PPAR-α proteins in the liver; and the SREBP-1, SCD-1, FAS, PPAR-α and adiponectin proteins in adipose tissue were reversed by PGBR. Taken together, PGBR can improve lipid synthesis and metabolism, and we suggest PGBR is a recommendable food for controlling hyperlipidemia. PMID:27499577

  6. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  7. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  8. An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

    PubMed

    Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

    2014-05-20

    Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies.

  9. Synthesis and characterization of a pH responsive folic acid functionalized polymeric drug delivery system.

    PubMed

    Li, Xia; McTaggart, Matt; Malardier-Jugroot, Cecile

    2016-01-01

    We report the computational analysis, synthesis and characterization of folate functionalized poly(styrene-alt-maleic anhydride), PSMA for drug delivery purpose. The selection of the proper linker between the polymer and the folic acid group was performed before conducting the synthesis using Density Functional Theory (DFT). The computational results showed the bio-degradable linker 2, 4-diaminobutyric acid, DABA as a good candidate allowing flexibility of the folic acid group while maintaining the pH sensitivity of PSMA, used as a trigger for drug release. The synthesis was subsequently carried out in multi-step experimental procedures. The functionalized polymer was characterized using InfraRed spectroscopy, Nuclear Magnetic Resonance and Dynamic Light Scattering confirming both the chemical structure and the pH responsiveness of PSMA-DABA-Folate polymers. This study provides an excellent example of how computational chemistry can be used in selection process for the functional materials and product characterization. The pH sensitive polymers are expected to be used in delivering anti-cancer drugs to solid tumors with overly expressed folic acid receptors. PMID:27183249

  10. Physiological management of dietary deficiency in n-3 fatty acids by spawning Gulf killifish (Fundulus grandis).

    PubMed

    Patterson, Joshua T; Green, Christopher C

    2015-08-01

    Lipid dynamics of spawning fish are critical to the production of viable embryos and larvae. The present study utilized manipulation of dietary fatty acid (FA) profiles to examine the ability of spawning Gulf killifish (Fundulus grandis) to mobilize critical lipid components from somatic reserves or synthesize long-chain polyunsaturated FAs (LC-PUFAs) de novo from shorter-chain C18 precursors. An egg and multi-tissue evaluation of changes in FA concentrations across time after fish were switched from LC-PUFA-rich to LC-PUFA-deficient experimental diets was employed. The two experimental diets contained lipid sources which differed drastically in n-3 C18 FA content but had similar levels of n-6 C18 FAs. Discrete effects of dietary n-3 FAs can be analyzed because n-3 and n-6 represent distinct metabolic families which cannot be exchanged in vivo. Results indicate that a combination of mobilization and de novo synthesis is likely utilized to maintain physiologically required FA levels in critical tissues and embryos. Mobilization was supported by decreases in LC-PUFAs in somatic tissues and decreases in intraperitoneal fat content and liver mass. Evidence for biosynthesis was provided by a higher level of n-3 LC-PUFAs in the liver and ova of fish fed diets containing n-3 C18 precursors versus those fed diets with low levels of precursor FAs. The characteristic physiological plasticity of Gulf killifish is exemplified in the nutritional domain by its management of dietary FA deficiency. PMID:25939715

  11. Characterization of calmodulin-Fas death domain interaction: an integrated experimental and computational study.

    PubMed

    Fancy, Romone M; Wang, Lingyun; Napier, Tiara; Lin, Jiabei; Jing, Gu; Lucius, Aaron L; McDonald, Jay M; Zhou, Tong; Song, Yuhua

    2014-04-29

    The Fas death receptor-activated death-inducing signaling complex (DISC) regulates apoptosis in many normal and cancer cells. Qualitative biochemical experiments demonstrate that calmodulin (CaM) binds to the death domain of Fas. The interaction between CaM and Fas regulates Fas-mediated DISC formation. A quantitative understanding of the interaction between CaM and Fas is important for the optimal design of antagonists for CaM or Fas to regulate the CaM-Fas interaction, thus modulating Fas-mediated DISC formation and apoptosis. The V254N mutation of the Fas death domain (Fas DD) is analogous to an identified mutant allele of Fas in lpr-cg mice that have a deficiency in Fas-mediated apoptosis. In this study, the interactions of CaM with the Fas DD wild type (Fas DD WT) and with the Fas DD V254N mutant were characterized using isothermal titration calorimetry (ITC), circular dichroism spectroscopy (CD), and molecular dynamics (MD) simulations. ITC results reveal an endothermic binding characteristic and an entropy-driven interaction of CaM with Fas DD WT or with Fas DD V254N. The Fas DD V254N mutation decreased the association constant (Ka) for CaM-Fas DD binding from (1.79 ± 0.20) × 10(6) to (0.88 ± 0.14) × 10(6) M(-1) and slightly increased a standard state Gibbs free energy (ΔG°) for CaM-Fas DD binding from -8.87 ± 0.07 to -8.43 ± 0.10 kcal/mol. CD secondary structure analysis and MD simulation results did not show significant secondary structural changes of the Fas DD caused by the V254N mutation. The conformational and dynamical motion analyses, the analyses of hydrogen bond formation within the CaM binding region, the contact numbers of each residue, and the electrostatic potential for the CaM binding region based on MD simulations demonstrated changes caused by the Fas DD V254N mutation. These changes caused by the Fas DD V254N mutation could affect the van der Waals interactions and electrostatic interactions between CaM and Fas DD, thereby affecting

  12. [New biological active derivatives of indomethacin and acetylsalicylic acid. Synthesis, physico-chemical characterisation and structure validation].

    PubMed

    Stan, Catalina; Stefanache, Alina; Dumitrache, M

    2006-01-01

    It is well known that niflumic acid glycinamide has a good antiinflammatory action useful in gum inflammatory diseases. The objective of this study was to obtain new glycinamides of acetylsalicylic acid and indomethacin, which could have a better antiinflammatory action than niflumic acid glycinamide. The study presents the synthesis, physico-chemical characterisation and structure validation of these glycinamides.

  13. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  14. Dihydroasparagusic acid: antioxidant and tyrosinase inhibitory activities and improved synthesis.

    PubMed

    Venditti, Alessandro; Mandrone, Manuela; Serrilli, Anna Maria; Bianco, Armandodoriano; Iannello, Carmelina; Poli, Ferruccio; Antognoni, Fabiana

    2013-07-17

    Dihydroasparagusic acid (DHAA) is the reduced form of asparagusic acid, a sulfur-containing flavor component produced by Asparagus plants. In this work, DHAA was synthetically produced by modifying some published protocols, and the synthesized molecule was tested in several in vitro assays (DPPH, ABTS, FRAP-ferrozine, BCB, deoxyribose assays) to evaluate its radical scavenging activity. Results show that DHAA is endowed with a significant in vitro antioxidant activity, comparable to that of Trolox. DHAA was also evaluated for its inhibitory activity toward tyrosinase, an enzyme involved, among others, in melanogenesis and in browning processes of plant-derived foods. DHAA was shown to exert an inhibitory effect on tyrosinase activity, and the inhibitor kinetics, analyzed by a Lineweaver-Burk plot, exhibited a competitive mechanism. Taken together, these results suggest that DHAA may be considered as a potentially active molecule for use in various fields of application, such as pharmaceutical, cosmetics, agronomic and food. PMID:23790134

  15. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  16. Synthesis and antifungal activity of bile acid-derived oxazoles.

    PubMed

    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela

    2016-04-01

    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives. PMID:26827629

  17. Ceramide mediates FasL-induced caspase 8 activation in colon carcinoma cells to enhance FasL-induced cytotoxicity by tumor-specific cytotoxic T lymphocytes

    PubMed Central

    Coe, Genevieve L.; Redd, Priscilla S.; Paschall, Amy V.; Lu, Chunwan; Gu, Lilly; Cai, Houjian; Albers, Thomas; Lebedyeva, Iryna O.; Liu, Kebin

    2016-01-01

    FasL-mediated cytotoxicity is one of the mechanisms that CTLs use to kill tumor cells. However, human colon carcinoma often deregulates the Fas signaling pathway to evade host cancer immune surveillance. We aimed at testing the hypothesis that novel ceramide analogs effectively modulate Fas function to sensitize colon carcinoma cells to FasL-induced apoptosis. We used rational design and synthesized twenty ceramide analogs as Fas function modulators. Five ceramide analogs, IG4, IG7, IG14, IG17, and IG19, exhibit low toxicity and potent activity in sensitization of human colon carcinoma cells to FasL-induced apoptosis. Functional deficiency of Fas limits both FasL and ceramide analogs in the induction of apoptosis. Ceramide enhances FasL-induced activation of the MAPK, NF-κB, and caspase 8 despite induction of potent tumor cell death. Finally, a sublethal dose of several ceramide analogs significantly increased CTL-mediated and FasL-induced apoptosis of colon carcinoma cells. We have therefore developed five novel ceramide analogs that act at a sublethal dose to enhance the efficacy of tumor-specific CTLs, and these ceramide analogs hold great promise for further development as adjunct agents in CTL-based colon cancer immunotherapy. PMID:27487939

  18. Ultraviolet A radiation induces rapid apoptosis of human leukemia cells by Fas ligand-independent activation of the Fas death pathways.

    PubMed

    Zhuang, Shougang; Kochevar, Irene E

    2003-07-01

    Endogenous cellular chromophores absorb ultraviolet A radiation (UVA, 290-320 nm), the major UV component of terrestrial solar radiation, leading to the formation of reactive oxidizing species that initiate apoptosis, gene expression and mutagenesis. UVA-induced apoptosis of T helper cells is believed to underlie the UVA phototherapy for atopic dermatitis and other T cell-mediated inflammatory skin diseases. We have evaluated the involvement of the Fas-Fas ligand (FasL) pathway in rapid UVA-induced apoptosis in human leukemia HL-60 cells. UVA-induced apoptosis was not inhibited by pretreatment with a neutralizing anti-Fas antibody, although the same UVA treatment initiated cleavage of caspase-8 and subsequent processing of Bid and caspase-3-like proteases. Inhibition of caspase-8 by Lle-Glu (OMe)-Thr-Asp(OMe)-fluoromethyl ketone completely blocked caspase-3 cleavage and apoptosis in UVA-treated cells, suggesting that apoptosis was initiated by the Fas pathway. This inference was supported by demonstrating that immunoprecipitates obtained from UVA-treated cells using anti-Fas antibody contained caspase-8 and Fas-associating protein with death domain (FADD). In addition, Fas clustering in response to UVA treatment was observed by immunofluorescence microscopy. These data support a mechanism for rapid, UVA-induced apoptosis in HL-60 cells involving initial formation of the Fas-FADD-caspase-8 death complex in an FasL-independent manner.

  19. First synthesis of thia steroids from cholic acid.

    PubMed

    Ibrahim-Ouali, Malika; Rocheblave, Luc

    2010-10-01

    Heterosteroids remain interesting due to their potential biological activities. This prompted us to synthesize novel thia steroids possessing the heteroatom in the A-ring. We set out to describe a new and versatile method for preparing 3-thia steroids from cholic acid via a selective oxidation of one hydroxyl group, a Baeyer-Villiger oxidation and a photolysis as the key steps. The characteristic (1)H and (13)C NMR spectroscopic features of the synthesized compounds are reported.

  20. Synthesis and properties of N-hexadecyl ethylenediamine triacetic acid.

    PubMed

    Wang, Xixin; Zhao, Jianling; Yao, Xingzhi; Chen, Wentao

    2004-11-15

    A new kind of surfactant named N-hexadecyl ethylenediamine triacetic acid (HED3A) was synthesized from anhydrous ethylenediamine, 1-bromohexadecane, and chloroacetic acid. Testing showed stability of HED3A in hard water, wetting power, dispersing power, and surface tension increased along with pH value. Stability in hard water of trisodium N-hexadecyl ethylenediamine triacetate (3NaHED3A) was at level 4, which was better than that of sodium dodecylsulfate (SDS) and sodium dodecylbenzene sulfonate (LAS). Other properties of 3NaHED3A including wetting power, dispersing power, emulsifying power, and surface tension had intermediate value between SDS, LAS, AES, peregal-O, and cetyltrimethylammonium chloride (CTAC). The ethylenediamine triacetic acid (ED3A) group in 3NaHED3A can chelate many kinds of metal ions, which indicates a promising application prospect in many fields including metal anticorrosion, corrosion control agent, additives in electroplating solution, and ore selection and solid surface treatment.

  1. Synthesis and bioactivity of 2',3'-benzoabscisic acid analogs.

    PubMed

    Han, Xiaoqiang; Wan, Chuan; Li, Xiuyun; Li, Hong; Yang, Dongyan; Du, Shijie; Xiao, Yumei; Qin, Zhaohai

    2015-06-01

    2',3'-Benzoabscisic acid 4a is significantly more active than (±)-ABA and can be potentially used as a plant growth regulator for agriculture. In this study, six 4a analogs were designed and synthesized. Bioassay showed that 4a displayed greater activity than (±)-ABA and the six analogs produced less inhibition than 4a itself. Specially, some analogs displayed markedly different activities to different physiological and biochemical process, which were largely different from ABA and 4a. Compared to (±)-ABA, 4b and 4c were more effective germination inhibitors for lettuce, but less effective inhibitors for rice elongation. Five-membered analog 5 was higher or slightly weaker in inhibiting Arabidopsis seed germination and rice elongation, respectively, but at least 10 times less effective than (±)-ABA in lettuce seed germination. Dual acid 6 and alkyne acid 20 nearly produced no inhibitory activity for Arabidopsis seed germination, but displayed excellent activity in inhibiting rice seedling growth. The preference of the analogs to different physiology process indicated that they might provide a strategy to develop novel ABA agonists or antagonist and be used as probe to investigate the function of different ABA receptors. PMID:25913114

  2. Fatty Acid Phytyl Ester Synthesis in Chloroplasts of Arabidopsis[W

    PubMed Central

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-01-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. PMID:22623494

  3. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    PubMed

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  4. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-01-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  5. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  6. Eutectic Phases in Ice Facilitate Nonenzymatic Nucleic Acid Synthesis

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia; Monnard, Pierre-Alain; Deamer, David W.

    2001-09-01

    Polymeric compounds similar to oligonucleotides are relevant to the origin of life and particularly to the concept of an RNA world. Although short oligomers of RNA can be synthesized nonenzymatically under laboratory conditions by second-order reactions in concentrated solutions, there is no consensus on how these polymers could have been synthesized de novo on the early Earth from dilute solutions of monomers. To address this question in the context of an RNA world, we have explored ice eutectic phases as a reaction medium. When an aqueous solution freezes, the solutes become concentrated in the spaces between the ice crystals. The increased concentration offsets the effect of the lower temperature and accelerates the reaction. Here we show that in the presence of metal ions in dilute solutions, frozen samples of phosphoimidazolide-activated uridine react within days at -18°C to form oligouridylates up to 11 bases long. Product yields typically exceed 90%, and ~30% of the oligomers include one or more 3‧-5‧ linkages. These conditions facilitate not only the notoriously difficult oligouridylate synthesis, but also the oligomerization of activated cytidylate, adenylate, and guanylate. To our knowledge, this represents the first report to indicate that ice matrices on the early Earth may have accelerated certain prebiotic polymerization reactions.

  7. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  8. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed. PMID:27677557

  9. Acid gradient across plasma membrane can drive phosphate bond synthesis in cancer cells: acidic tumor milieu as a potential energy source.

    PubMed

    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

    2015-01-01

    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target.

  10. Benign synthesis of 2-ethylhexanoic acid by cytochrome P450cam: enzymatic, crystallographic, and theoretical studies.

    PubMed

    French, K J; Strickler, M D; Rock, D A; Rock, D A; Bennett, G A; Wahlstrom, J L; Goldstein, B M; Jones, J P

    2001-08-14

    This study examines the ability of P450cam to catalyze the formation of 2-ethylhexanoic acid from 2-ethylhexanol relative to its activity on the natural substrate camphor. As is the case for camphor, the P450cam exhibits stereoselectivity for binding (R)- and (S)-2-ethylhexanol. Kinetic studies indicate (R)-2-ethylhexanoic acid is produced 3.5 times as fast as the (S)-enantiomer. In a racemic mixture of 2-ethylhexanol, P450cam produces 50% more (R)-2-ethylhexanoic acid than (S)-2-ethylhexanoic acid. The reason for stereoselective 2-ethylhexanoic acid production is seen in regioselectivity assays, where (R)-2-ethylhexanoic acid comprises 50% of total products while (S)-2-ethylhexanoic acid comprises only 13%. (R)- and (S)-2-ethylhexanol exhibit similar characteristics with respect to the amount of oxygen and reducing equivalents consumed, however, with (S)-2-ethylhexanol turnover producing more water than the (R)-enantiomer. Crystallographic studies of P450cam with (R)- or (S)-2-ethylhexanoic acid suggest that the (R)-enantiomer binds in a more ordered state. These results indicate that wild-type P450cam displays stereoselectivity toward 2-ethylhexanoic acid synthesis, providing a platform for rational active site design. PMID:11583152

  11. Study on Synthesis, Characterization and Antiproliferative Activity of Novel Diisopropylphenyl Esters of Selected Fatty Acids.

    PubMed

    Reddy, Yasa Sathyam; Kaki, Shiva Shanker; Rao, Bala Bhaskara; Jain, Nishant; Vijayalakshmi, Penumarthy

    2016-01-01

    The present study describes the synthesis, characterization and evaluation of antiproliferative activity of novel diisopropylphenyl esters of alpha-linolenic acid (ALA), valproic acid (VA), butyric acid (BA) and 2-ethylhexanoic acid (2-EHA). These esters were chemically synthesized by the esterification of fatty acids with 2,6-diisopropylphenol and 2,4-diisopropylphenol (propofol). The structure of new conjugates viz. propofol-(alpha-linolenic acid) (2,6P-ALA and 2,4P-ALA), propofol-valproic acid (2,6P-VA and 2,4P-VA), propofol-butyric acid (2,6P-BA and 2,4P-BA) and propofol-(2-ethylhexanoic acid) (2,6P2-EHA and 2,4P-2-EHA) were characterized by FT-IR, NMR ((1)H, (13)C) and mass spectral data. The synthesized conjugates having more lipophilic character were tested for antiproliferative in vitro studies on A549, MDA-MB-231, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. All the conjugates showed specific growth inhibition on studied cancer cell lines. Among the synthesized esters, the conjugates synthesized from BA, VA and 2-EHA exhibited prominent growth inhibition against A549, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. The preliminary results suggest that the entire novel conjugates possess antiproliferative properties that reduce the proliferation of cancer cells in vitro.

  12. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  13. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail.

  14. Stimulation of phosphatidic acid of calcium influx and cyclic GMP synthesis in neuroblastoma cells.

    PubMed

    Ohsako, S; Deguchi, T

    1981-11-10

    Phosphatidic acid added to the medium markedly elevated intracellular cyclic GMP content in cultured neuroblastoma N1E 115 cells. There was a significant elevation of cyclic GMP with 1 micrograms/ml and a maximum (70-fold) elevation with 100 micrograms/ml of phosphatidic acid. Other natural phospholipids did not increase, or increased only slightly, the cyclic GMP content in the cells. The elevation of cyclic GMP content by phosphatidic acid was absolutely dependent on extracellular calcium. Phosphatidic acid stimulated the influx of calcium into neuroblastoma cells 2- to 5-fold. The pattern of the calcium influx induced by phosphatidic acid was comparable to that of cyclic GMP elevation. The stimulation of calcium influx by phosphatidic acid was also observed in cultured heart cells, indicating that phosphatidic acid acts as a calcium ionophore or opens a specific calcium-gate in a variety of cell membranes. Treatment of neuroblastoma cells with phospholipase C increased 32Pi labeling of phosphatidic acid, stimulated the influx of calcium, and elevated the cyclic GMP content in the cells. Thus exogenous as well as endogenous phosphatidic acid stimulates the translocation of calcium across cell membranes and, as a consequence, induces the synthesis of cyclic GMP in the neuroblastoma cells.

  15. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  16. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  17. Fas and its ligand in a general mechanism of T-cell-mediated cytotoxicity.

    PubMed Central

    Hanabuchi, S; Koyanagi, M; Kawasaki, A; Shinohara, N; Matsuzawa, A; Nishimura, Y; Kobayashi, Y; Yonehara, S; Yagita, H; Okumura, K

    1994-01-01

    To investigate the mechanisms of T-cell-mediated cytotoxicity, we estimated the involvement of apoptosis-inducing Fas molecule on the target cells and its ligand on the effector cells. When redirected by ConA or anti-CD3 monoclonal antibody, a CD4+ T-cell clone, BK1, could lyse the target cells expressing wild-type Fas molecule but not those expressing death signaling-deficient mutants. This indicates the involvement of Fas-mediated signal transduction in the target cell lysis by BK1. Anti-CD3-activated but not resting BK1 expressed Fas ligand as detected by binding of a soluble Fas-Ig fusion protein, and the BK1-mediated cytotoxicity was blocked by the addition of Fas-Ig, implicating the inducible Fas ligand in the BK1 cytotoxicity. Ability to exert the Fas-mediated cytotoxicity was not confined to BK1, but splenic CD4+ T cells and, to a lesser extent, CD8+ T cells could also exert the Fas-dependent target cell lysis. This indicates that the Fas-mediated target cell lytic pathway can be generally involved in the T-cell-mediated cytotoxicity. Interestingly, CD4+ T cells prepared from gld/gld mice did not mediate the Fas-mediated cytotoxicity, indicating defective expression of functional Fas ligand in gld mice. PMID:7515183

  18. 48 CFR 47.303-8 - F.a.s. vessel, port of shipment.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false F.a.s. vessel, port of... CONTRACT MANAGEMENT TRANSPORTATION Transportation in Supply Contracts 47.303-8 F.a.s. vessel, port of shipment. (a) Explanation of delivery term. F.a.s. vessel, port of shipment means free of expense to...

  19. Increased cerebrospinal fluid concentrations of soluble Fas (CD95/Apo-1) in hydrocephalus

    PubMed Central

    Felderhoff-Mueser, U; Herold, R; Hochhaus, F; Koehne, P; Ring-Mrozik, E; Obladen, M; Buhrer, C

    2001-01-01

    BACKGROUND AND AIMS—The ventricular enlargement observed in children with chronically raised intracranial pressure (ICP) causes a secondary loss of brain tissue. In animal studies of hydrocephalus, programmed cell death (apoptosis) has been found as a major mechanism of neuronal injury. One of the regulators of the apoptotic cell death programme is the receptor mediated Fas/Fas ligand interaction.
METHODS—The apoptosis regulating cytokines soluble Fas (sFas) and soluble Fas ligand (sFasL) were studied in the cerebrospinal fluid (CSF) of 31 hydrocephalic children undergoing shunt surgery for symptomatic hydrocephalus and 18controls.
RESULTS—High concentrations of sFas were observed in children with hydrocephalus (median 252 ng/ml); in controls sFas was below the detection limit (0.5 ng/ml). sFasL was undetectable in all but one sample.
CONCLUSION—High concentrations of sFas in the CSF of children with hydrocephalus suggest intrinsic sFas production, potentially antagonising pressure mediated Fas activation.

 PMID:11259245

  20. Purification and characterization of the Fas-ligand that induces apoptosis

    PubMed Central

    1994-01-01

    Fas is a 45-kD cell surface protein belonging to the tumor necrosis factor/nerve growth factor receptor family, and transduces the signal for apoptosis. The cytotoxic T lymphocyte (CTL) hybridoma, PC60-d10S requires the presence of Fas on target cells to induce cytolysis in target cells. This CTL cell line was weakly but specifically stained by a chimeric protein that consisted of the extracellular domain of mouse Fas and the Fc portion of human immunoglobulin G1 (mFas-Fc). Moreover, mFas-Fc inhibited the cytotoxic activity of PC60-d10S. Sublines of d10S that were stained intensively by mFas-Fc were isolated by repetitive fluorescence-activated cell sorter sorting. A cell-surface protein of about 40 kD was specifically precipitated by mFas-Fc from the lysates of these sublines. This protein was homogeneously purified by sequential affinity chromatographies using mFas-Fc and concanavalin A beads. The purified protein exhibited cytotoxic activity against cells expressing Fas but not to the cells which do not express Fas. These results indicated that the 40-kD membrane glycoprotein expressed on PC60-d10S cells is the Fas-ligand that induces the apoptotic signal by binding to Fas. PMID:7509364

  1. Synthesis and Evaluation of Aryl Boronic Acids as Fluorescent Artificial Receptors for Biological Carbohydrates

    PubMed Central

    Craig, Sandra

    2011-01-01

    Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855

  2. Synthesis of Aminoboronic Acid Derivatives from Amines and Amphoteric Boryl Carbonyl Compounds.

    PubMed

    Diaz, Diego B; Scully, Conor C G; Liew, Sean K; Adachi, Shinya; Trinchera, Piera; St Denis, Jeffrey D; Yudin, Andrei K

    2016-10-01

    Herein, we demonstrate the use of α-boryl aldehydes and acyl boronates in the synthesis of aminoboronic acid derivatives. This work highlights the untapped potential of boron-substituted iminium ions and offers insights into the behavior of N-methyliminodiacetyl (MIDA) boronates during condensation and tautomerization processes. The preparative value of this contribution lies in the demonstration that various amines, including linear and cyclic peptides, can be readily conjugated with boron-containing fragments. A mild deprotection of amino MIDA-boronates enables access to α- and β-aminoboronic acids in high chemical yields. This simple process should be applicable to the synthesis of a wide range of bioactive molecules as well as precursors for cross-coupling reactions. PMID:27584917

  3. Synthesis and in vitro Evaluation of Polymeric Prodrug of Ibuprofen with Amino Acid Spacer.

    PubMed

    Redasani, Vivekkumar K; Bari, Sanjay B

    2015-01-01

    The present work is an agreement with simple and efficient method of improving the therapeutic efficacy of ibuprofen by masking its acidic moiety. It aims to reduce gastrointestinal side effects by controlling the rate, duration and site of release. This is achieved by synthesis and evaluation of polymeric prodrug of ibuprofen with natural polymer sodium alginate. The synthesis was supported by N-protected serine as spacer due to chemical incompatibility of drug and polymer. Synthesized prodrug was characterized for confirmation of said structures. The in-vitro dissolution profile of ibuprofen-alginate prodrug showed that the release of the drug is significantly higher in case of pH 7.2 buffer as compared to ibuprofen, which might be due to ester group adjacent to drug get hydrolyzed. The hydrolysis was found to be with faster rate in alkaline media than that of in acidic media.

  4. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.

    1980-01-01

    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  5. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

    PubMed

    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

    2016-01-01

    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  6. REGULATION OF CARDIAC AND SKELETAL MUSCLE PROTEIN SYNTHESIS BY INDIVIDUAL BRANCHED-CHAIN AMINO ACIDS IN NEONATAL PIGS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Skeletal muscle grows at a very rapid rate in the neonatal pig, due in part to an enhanced sensitivity of protein synthesis to the postprandial rise in amino acids. An increase in leucine alone stimulates protein synthesis in skeletal muscle of the neonatal pig; however, the effect of isoleucine and...

  7. Highly diastereoselective synthesis of quaternary α-trifluoromethyl α-amino acids from chiral imines of trifluoropyruvate.

    PubMed

    Min, Qiao-Qiao; He, Chun-Yang; Zhou, Haibing; Zhang, Xingang

    2010-11-14

    An efficient method for highly diastereoselective synthesis of quaternary α-trifluoromethyl α-amino acids was developed via indium mediated allylation of (R)-phenylglycinol methyl ether based imines of trifluoropyruvate in good yields with high diastereoselectivities at room temperature; to illustrate the application of this method in organic synthesis, 2-allyl-2-(trifluoromethyl) aziridine was prepared in an efficient manner.

  8. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  9. A practical synthesis of 3,4-diethoxybenzthioamide based on Friedel-Crafts reaction with potassium thiocyanate in methanesulfonic acid.

    PubMed

    Aki, Shinji; Fujioka, Takafumi; Ishigami, Masashi; Minamikawa, Jun-ichi

    2002-09-01

    The synthesis of 3,4-diethoxybenzthioamide, the key intermediate for OPC-6535, is achieved by employing Friedel-Crafts reaction of 1,2-diethoxybenzene with potassium thiocyanate in methanesulfonic acid at ambient temperature.

  10. Synthesis of Fused Polycyclic Indoles by Brønsted Acid-Catalyzed Intramolecular Alkylation of Indoles with Alcohols.

    PubMed

    Suárez, Anisley; Gohain, Mukut; Fernández-Rodríguez, Manuel A; Sanz, Roberto

    2015-10-16

    An efficient methodology for the synthesis of a series of new fused polyclyclic indoles has been developed by Brønsted acid-catalyzed intramolecular Friedel-Crafts reactions of properly designed indolyl alcohols. PMID:26418556

  11. Green Chemistry in the Organic Teaching Laboratory: An Environmentally Benign Synthesis of Adipic Acid

    NASA Astrophysics Data System (ADS)

    Reed, Scott M.; Hutchison, James E.

    2000-12-01

    Environmentally benign ("green") chemical techniques are growing in importance in academic and industrial research laboratories. Such chemistry has been slow to appear in teaching laboratories, owing in part to a lack of published material on this subject. Recent developments in green synthesis provide opportunities to introduce this material in teaching laboratories. We present a synthesis of adipic acid that utilizes green reagents (hydrogen peroxide as the oxidant), solvents (water), and methods (phase-transfer catalysis, catalyst recycling). The synthesis works well and provides an excellent forum for emphasizing green chemical concepts while teaching laboratory skills. It demonstrates reuse of a product, synthesis using a nonhazardous solvent, elimination of deleterious by-products, and use of a recyclable catalyst. It can be carried out on either the macroscale or microscale and generates little waste if the catalyst solution is recycled. This experiment fits well in a sophomore organic sequence; it covers the topics of oxidation, phase-transfer catalysis, and the technique of recrystallization, reinforces lecture topics such as alkene synthesis and reactivity, and provides an opportunity to introduce polymer chemistry.

  12. Studies on independent synthesis of cytoplasmic ribonucleic acids in Acetabularia mediterranea.

    PubMed

    NAORA, H; BRACHET, J

    1960-07-01

    1. The RNA content of anucleate and nucleate fragments of Acetabularia has been measured. It was found that there is a net synthesis of RNA in nucleate fragments. On the other hand, the RNA content of anucleate fragments did not change significantly after enucleation. 2. Anucleate fragments, however, can readily incorporate (14)C-labeled adenine, orotic acid, and carbon dioxide into their cytoplasmic RNA. 3. The results of experiments on (14)CO(2) incorporation into the RNA of anucleate and nucleate fragments suggest that there is a mechanism for de novo synthesis of RNA in anucleate cytoplasm. 4. In Acetabularia, 81 per cent of the cytoplasmic RNA is bound to a large granule fraction, consisting mainly of chloroplasts. Even after removal of the nucleus, RNA is synthesized in this "chloroplast" fraction. The chloroplasts are thus a major site of RNA synthesis in the cytoplasm of these algae. Synthesis of "chloroplastic" RNA, in anucleate fragments, possibly occurs at the expense of the RNA present in other fractions (microsomes and supernatant). 5. 8-Azaguanine stimulates regeneration and cap formation in anucleate fragments and does not inhibit RNA synthesis in these fragments.

  13. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.

    2015-06-24

    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  14. Arabidopsis Lipins, PDAT1 Acyltransferase, and SDP1 Triacylglycerol Lipase Synergistically Direct Fatty Acids toward β-Oxidation, Thereby Maintaining Membrane Lipid Homeostasis[C][W

    PubMed Central

    Fan, Jilian; Yan, Chengshi; Roston, Rebecca; Shanklin, John

    2014-01-01

    Triacylglycerol (TAG) metabolism is a key aspect of intracellular lipid homeostasis in yeast and mammals, but its role in vegetative tissues of plants remains poorly defined. We previously reported that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is crucial for diverting fatty acids (FAs) from membrane lipid synthesis to TAG and thereby protecting against FA-induced cell death in leaves. Here, we show that overexpression of PDAT1 enhances the turnover of FAs in leaf lipids. Using the trigalactosyldiacylglycerol1-1 (tgd1-1) mutant, which displays substantially enhanced PDAT1-mediated TAG synthesis, we demonstrate that disruption of SUGAR-DEPENDENT1 (SDP1) TAG lipase or PEROXISOMAL TRANSPORTER1 (PXA1) severely decreases FA turnover, leading to increases in leaf TAG accumulation, to 9% of dry weight, and in total leaf lipid, by 3-fold. The membrane lipid composition of tgd1-1 sdp1-4 and tgd1-1 pxa1-2 double mutants is altered, and their growth and development are compromised. We also show that two Arabidopsis thaliana lipin homologs provide most of the diacylglycerol for TAG synthesis and that loss of their functions markedly reduces TAG content, but with only minor impact on eukaryotic galactolipid synthesis. Collectively, these results show that Arabidopsis lipins, along with PDAT1 and SDP1, function synergistically in directing FAs toward peroxisomal β-oxidation via TAG intermediates, thereby maintaining membrane lipid homeostasis in leaves. PMID:25293755

  15. Enzymatic synthesis of enantiopure alpha- and beta-amino acids by phenylalanine aminomutase-catalysed amination of cinnamic acid derivatives.

    PubMed

    Wu, Bian; Szymanski, Wiktor; Wietzes, Piet; de Wildeman, Stefaan; Poelarends, Gerrit J; Feringa, Ben L; Janssen, Dick B

    2009-01-26

    The phenylalanine aminomutase (PAM) from Taxus chinensis catalyses the conversion of alpha-phenylalanine to beta-phenylalanine, an important step in the biosynthesis of the N-benzoyl phenylisoserinoyl side-chain of the anticancer drug taxol. Mechanistic studies on PAM have suggested that (E)-cinnamic acid is an intermediate in the mutase reaction and that it can be released from the enzyme's active site. Here we describe a novel synthetic strategy that is based on the finding that ring-substituted (E)-cinnamic acids can serve as a substrate in PAM-catalysed ammonia addition reactions for the biocatalytic production of several important beta-amino acids. The enzyme has a broad substrate range and a high enantioselectivity with cinnamic acid derivatives; this allows the synthesis of several non-natural aromatic alpha- and beta-amino acids in excellent enantiomeric excess (ee >99 %). The internal 5-methylene-3,5-dihydroimidazol-4-one (MIO) cofactor is essential for the PAM-catalysed amination reactions. The regioselectivity of amination reactions was influenced by the nature of the ring substituent.

  16. Exposure to omega-3 fatty acids at early age accelerate bone growth and improve bone quality.

    PubMed

    Koren, Netta; Simsa-Maziel, Stav; Shahar, Ron; Schwartz, Betty; Monsonego-Ornan, Efrat

    2014-06-01

    Omega-3 fatty acids (FAs) are essential nutritional components that must be obtained from foods. Increasing evidence validate that omega-3 FAs are beneficial for bone health, and several mechanisms have been suggested to mediate their effects on bone, including alterations in calcium absorption and urinary calcium loss, prostaglandin synthesis, lipid oxidation, osteoblast formation and inhibition of osteoclastogenesis. However, to date, there is scant information regarding the effect of omega-3 FAs on the developing skeleton during the rapid growth phase. In this study we aim to evaluate the effect of exposure to high levels of omega-3 FAs on bone development and quality during prenatal and early postnatal period. For this purpose, we used the fat-1 transgenic mice that have the ability to convert omega-6 to omega-3 fatty acids and the ATDC5 chondrogenic cell line as models. We show that exposure to high concentrations of omega-3 FAs at a young age accelerates bone growth through alterations of the growth plate, associated with increased chondrocyte proliferation and differentiation. We further propose that those effects are mediated by the receptors G-protein coupled receptor 120 (GPR120) and hepatic nuclear factor 4α, which are expressed by chondrocytes in culture. Additionally, using a combined study on the structural and mechanical bone parameters, we show that high omega-3 levels contribute to superior trabecular and cortical structure, as well as to stiffer bones and improved bone quality. Most interestingly, the fat-1 model allowed us to demonstrate the role of maternal high omega-3 concentration on bone growth during the gestation and postnatal period.

  17. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  18. Synthesis of milk specific fatty acids and proteins by dispersed goat mammary-gland epithelial cells.

    PubMed Central

    Hansen, H O; Tornehave, D; Knudsen, J

    1986-01-01

    The method now described for preparation of dispersed lactating goat mammary-gland cells gives a high yield of morphologically and functionally normal mammary cells. The cells synthesize specific goat milk fatty acids in the right proportions, and they respond to hormones by increased protein synthesis. The cells can be frozen and thawed without losing the above properties, which makes them an excellent tool for metabolic and hormonal studies. Images Fig. 1. Fig. 2. PMID:3800930

  19. o-Iodoxybenzoic acid mediated oxidative desulfurization initiated domino reactions for synthesis of azoles.

    PubMed

    Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G

    2012-04-20

    A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides. PMID:22423599

  20. Synthesis and activity of 2-oxoamides containing long chain beta-amino acids.

    PubMed

    Constantinou-Kokotou, Violetta; Peristeraki, Anna; Kokotos, Christoforos G; Six, David A; Dennis, Edward A

    2005-07-01

    2-Oxoamides based on long chain beta-amino acids were synthesized. 1-Benzyl substituted long chain amines, needed for such synthesis, were synthesized starting from Boc-phenylalaninol. The oxidative conversion of a phenyl group to a carboxyl group was used as the key transformation synthetic step. The compounds synthesized were studied for their activity against GIVA PLA(2), and were proven to be weak inhibitors. PMID:15635664

  1. Synthesis of kojic acid derivatives as secondary binding site probes of D-amino acid oxidase

    PubMed Central

    Raje, Mithun; Hin, Niyada; Duvall, Bridget; Ferraris, Dana V.; Berry, James F.; Thomas, Ajit G.; Alt, Jesse; Rojas, Camilo; Slusher, Barbara S.; Tsukamoto, Takashi

    2013-01-01

    A series of kojic acid (5-hydroxy-2-hydroxymethyl-4H-pyran-4-one) derivatives were synthesized and tested for their ability to inhibit D-amino acid oxidase (DAAO). Various substituents were incorporated into kojic acid at its 2-hydroxymethyl group. These analogs serve as useful molecular probes to explore the secondary binding site, which can be exploited in designing more potent DAAO inhibitors. PMID:23683589

  2. New Insight on the Synthesis of Neurotoxins Domoic Acid and Kainic Acid.

    PubMed

    Mollica, Adriano; Costante, Roberto; Stefanucci, Azzurra; Novellino, Ettore

    2015-01-01

    Mono or di-substituted prolines, namely proline chimeras of natural or synthetic origin, carry the side chain of other specific amino acids on the pyrrolidine ring. Thus, proline chimeras are useful tools for a wide range of chemical and biological applications as chiral synthons or building blocks for peptidomimetic design. We focused our attention on domoic acid and kainic acid and we report here a concise and up to date review on their stereoselective and asymmetric syntheses.

  3. Integrated process of distillation with side reactors for synthesis of organic acid esters

    SciTech Connect

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  4. Enantioselective Synthesis of Dialkylated α-Hydroxy Carboxylic Acids through Asymmetric Phase-Transfer Catalysis.

    PubMed

    Duan, Shaobo; Li, Sanliang; Ye, Xinyi; Du, Nuan-Nuan; Tan, Choon-Hong; Jiang, Zhiyong

    2015-08-01

    In the presence of an L-tert-leucine-derived urea-ammonium salt as phase-transfer catalyst, a highly enantioselective alkylation of 5H-oxazol-4-ones with various benzyl bromides and allylic bromides has been developed to furnish catalytic asymmetric synthesis of biologically important dialkylated α-hydroxy carboxylic acids with a broad scope. This is the first example of an L-amino acid-derived urea-ammonium salt being used as a phase-transfer catalyst with excellent catalytic efficiency.

  5. Synthesis and sintering of nanocrystalline hydroxyapatite powders by citric acid sol-gel combustion method

    SciTech Connect

    Han Yingchao; Li Shipu; Wang Xinyu; Chen Xiaoming

    2004-01-03

    The citric acid sol-gel combustion method has been used for the synthesis of nanocrystalline hydroxyapatite (HAP) powder from calcium nitrate, diammonium hydrogen phosphate and citric acid. The phase composition of HAP powder was characterized by X-ray powder diffraction analysis (XRD). The morphology of HAP powder was observed by transmission electron microscope (TEM). The HAP powder has been sintered into microporous ceramic in air at 1200 deg. C with 3 h soaking time. The microstructure and phase composition of the resulting HAP ceramic were characterized by scanning electron microscope (SEM) and XRD, respectively. The physical characterization of open porosity and flexural strength have also been carried out.

  6. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity.

    PubMed

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna; Dallavalle, Sabrina

    2016-01-01

    The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  7. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity

    PubMed Central

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna

    2016-01-01

    Summary The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  8. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone

    2014-01-01

    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  9. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin

    2014-12-22

    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  10. Dietary omega-3 and -6 polyunsaturated fatty acids affect the composition and development of sheep granulosa cells, oocytes and embryos.

    PubMed

    Wonnacott, K E; Kwong, W Y; Hughes, J; Salter, A M; Lea, R G; Garnsworthy, P C; Sinclair, K D

    2010-01-01

    The evidence that omega-3 (n-3) and -6 (n-6) polyunsaturated fatty acids (PUFAs) have differential effects on ovarian function, oocytes and embryo quality is inconsistent. We report on the effects of n-3 versus n-6 PUFA-enriched diets fed to 36 ewes over a 6-week period, prior to ovarian stimulation and follicular aspiration, on ovarian steroidogenic parameters and embryo quality. Follicle number and size were unaltered by diet, but follicular-fluid progesterone concentrations were greater in n-3 PUFA-fed ewes than in n-6 PUFA-fed ewes. The percentage of saturated FAs (mostly stearic acid) was greater in oocytes than in either granulosa cells or plasma, indicating selective uptake and/or de novo synthesis of saturated FAs at the expense of PUFAs by oocytes. High-density lipoproteins (HDLs) fractionated from sera of these ewes increased granulosa cell proliferation and steroidogenesis relative to the FA-free BSA control during culture, but there was no differential effect of n-3 and n-6 PUFAs on either oestradiol or progesterone production. HDL was ineffective in delivering FAs to embryos during culture, although n-6 PUFA HDL reduced embryo development. All blastocysts, irrespective of the treatment, contained high levels of unsaturated FAs, in particular linoleic acid. Transcripts for HDL and low-density lipoprotein (LDL) receptors (SCARB1 and LDLR) and stearoyl-CoA desaturase (SCD) are reported in sheep embryos. HDL reduced the expression of transcripts for LDLR and SCD relative to the BSA control. The data support a differential effect of n-3 and n-6 PUFAs on ovarian steroidogenesis and pre-implantation development, the latter in the absence of a net uptake of FAs. PMID:19789173

  11. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively). PMID:27017352

  12. A novel and highly regioselective synthesis of new carbamoylcarboxylic acids from dianhydrides.

    PubMed

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N'-disubstituted 4,4'-carbonylbis(carbamoylbenzoic) acids and N,N'-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3',4,4'-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS.

  13. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  14. Ionic liquids as novel solvents for the synthesis of sugar fatty acid ester.

    PubMed

    Mai, Ngoc Lan; Ahn, Kihun; Bae, Sang Woo; Shin, Dong Woo; Morya, Vivek Kumar; Koo, Yoon-Mo

    2014-12-01

    Sugar fatty acid esters are bio-surfactants known for their non-toxic, non-ionic, and high biodegradability . With great emulsifying and conditioning effects, sugar fatty acids are widely used in the food, pharmaceutical, and cosmetic industries. Biosynthesis of sugar fatty acid esters has attracted growing attention in recent decades. In this study, the enzymatic synthesis of sugar fatty acid esters in ionic liquids was developed, optimized, and scaled up. Reaction parameters affecting the conversion yield of lipase-catalyzed synthesis of glucose laurate from glucose and vinyl laurate (i.e. temperature, vinyl laurate/glucose molar ratio, and enzyme loads) were optimized by response surface methodology (RSM). In addition, production was scaled up to 2.5 L, and recycling of enzyme and ionic liquids was investigated. The results showed that under optimal reaction conditions (66.86 °C, vinyl laurate/glucose molar ratio of 7.63, enzyme load of 73.33 g/L), an experimental conversion yield of 96.4% was obtained which is close to the optimal value predicted by RSM (97.16%). A similar conversion yield was maintained when the reaction was carried out at 2.5 L. Moreover, the enzymes and ionic liquids could be recycled and reused effectively for up to 10 cycles. The results indicate the feasibility of ionic liquids as novel solvents for the biosynthesis of sugar fatty acid esters.

  15. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  16. Metabolic switch during adipogenesis: From branched chain amino acid catabolism to lipid synthesis.

    PubMed

    Halama, Anna; Horsch, Marion; Kastenmüller, Gabriele; Möller, Gabriele; Kumar, Pankaj; Prehn, Cornelia; Laumen, Helmut; Hauner, Hans; Hrabĕ de Angelis, Martin; Beckers, Johannes; Suhre, Karsten; Adamski, Jerzy

    2016-01-01

    Fat cell metabolism has an impact on body homeostasis and its proper function. Nevertheless, the knowledge about simultaneous metabolic processes, which occur during adipogenesis and in mature adipocytes, is limited. Identification of key metabolic events associated with fat cell metabolism could be beneficial in the field of novel drug development, drug repurposing, as well as for the discovery of patterns predicting obesity risk. The main objective of our work was to provide comprehensive characterization of metabolic processes occurring during adipogenesis and in mature adipocytes. In order to globally determine crucial metabolic pathways involved in fat cell metabolism, metabolomics and transcriptomics approaches were applied. We observed significantly regulated metabolites correlating with significantly regulated genes at different stages of adipogenesis. We identified the synthesis of phosphatidylcholines, the metabolism of even and odd chain fatty acids, as well as the catabolism of branched chain amino acids (BCAA; leucine, isoleucine and valine) as key regulated pathways. Our further analysis led to identification of an enzymatic switch comprising the enzymes Hmgcs2 (3-hydroxy-3-methylglutaryl-CoA synthase) and Auh (AU RNA binding protein/enoyl-CoA hydratase) which connects leucine degradation with cholesterol synthesis. In addition, propionyl-CoA, a product of isoleucine degradation, was identified as a putative substrate for odd chain fatty acid synthesis. The uncovered crosstalks between BCAA and lipid metabolism during adipogenesis might contribute to the understanding of molecular mechanisms of obesity and have potential implications in obesity prediction. PMID:26408941

  17. Abolished synthesis of cholic acid reduces atherosclerotic development in apolipoprotein E knockout mice.

    PubMed

    Slätis, Katharina; Gåfvels, Mats; Kannisto, Kristina; Ovchinnikova, Olga; Paulsson-Berne, Gabrielle; Parini, Paolo; Jiang, Zhao-Yan; Eggertsen, Gösta

    2010-11-01

    To investigate the effects of abolished cholic acid (CA) synthesis in the ApoE knockout model [apolipoprotein E (apoE) KO],a double-knockout (DKO) mouse model was created by crossbreeding Cyp8b1 knockout mice (Cyp8b1 KO), unable to synthesize the primary bile acid CA, with apoE KO mice. After 5 months of cholesterol feeding, the development of atherosclerotic plaques in the proximal aorta was 50% less in the DKO mice compared with the apoE KO mice. This effect was associated with reduced intestinal cholesterol absorption, decreased levels of apoB-containing lipoproteins in the plasma, enhanced bile acid synthesis, reduced hepatic cholesteryl esters, and decreased hepatic activity of ACAT2. The upregulation of Cyp7a1 in DKO mice seemed primarily caused by reduced expression of the intestinal peptide FGF15. Treatment of DKO mice with the farnesoid X receptor (FXR) agonist GW4064 did not alter the intestinal cholesterol absorption, suggesting that the action of CA in this process is confined mainly to formation of intraluminal micelles and less to its ability to activate the nuclear receptor FXR. Inhibition of CA synthesis may offer a therapeutic strategy for the treatment of hyperlipidemic conditions that lead to atherosclerosis.

  18. Acid synthesis of luminescent amine-functionalized or erbium-doped silica spheres for biological applications.

    PubMed

    Enrichi, Francesco; Trave, Enrico; Bersani, Marco

    2008-03-01

    In this work we discuss and investigate the morphological and optical properties of luminescent silica spheres which can have interesting applications in bioimaging and biosensing. The spheres are synthesized following an acid route by the hydrolysis and condensation of tetraethylortosilicate (TEOS) and can be functionalized by incorporation of aminopropyl-triethoxysilane (APTES) during the synthesis, inducing a significant luminescence that can be attributed to a recombination mechanism from localized organic defects related to -NH(2) groups. It is shown that the acid synthesis route produces very regular spherical particles, but their diameter vary in the range of 200-4,000 nm. The luminescence properties have been investigated and optimized by variation of the annealing temperature for the functionalized spheres, obtaining the most efficient PL emission after a thermal treatment of 1 h at 600 degrees C in air. Moreover, the possibility to introduce rare earths like erbium in the spheres was also studied and the corresponding Er(3) luminescence emission at 1.53 microm is reported in terms of intensity and lifetime, pointing out that erbium can be easily and efficiently incorporated during the acid synthesis giving high PL intensity with a good lifetime of 3.9 ms.

  19. Synthesis and characterization of agricultural controllable humic acid superabsorbent.

    PubMed

    Gao, Lijuan; Wang, Shiqiang; Zhao, Xuefei

    2013-12-01

    Humic acid superabsorbent polymer (P(AA/AM-HA)) and superabsorbent polymer (P(AA/AM)) were synthesized by aqueous solution polymerization method using acrylic acid (AA), acrylamide (AM) and humic acid (HA) as raw material. The effects of N,N'-methylenebisacrylamide (MBA) crosslinking agent, potassium peroxydisulfate (KPS) initiator, reaction temperature, HA content, ratio of AA to AM, concentration of monomer and neutralization of AA on water absorption were investigated. Absorption and desorption ratios of nitrogen fertilizer and phosphate fertilizer were also investigated by determination of absorption and desorption ratio of NH4(+), PO4(3-) on P(AA/AM-HA) and P(AA/AM). The P(AA/AM-HA) and P(AA/AM) were characterized by Fourier translation infrared spectroscopy, biological photomicroscope and scanning electron microscopy (SEM). The optimal conditions obtained were as follows: the weight ratio of MBA to AA and AM was 0.003; the weight ratio of KPS to AA and AM was 0.008; the weight ratio of HA to AA was 0.1; the mole ratio of AM to AA is 0.1; the mole ratio of NaOH to AA is 0.9; the reaction temperature was 60°C. P(AA/AM-HA) synthesized under optimal conditions, has a good saline tolerance, its water absorbency in distilled water and 0.9 wt.% saline solution is 1180 g/g and 110 g/g, respectively. P(AA/AM-HA) achieves half saturation in 6.5 min. P(AA/AM-HA) is superior to P(AA/AM) on absorption of NH4(+), PO4(3-). The SEM micrograph of P(AA/AM-HA) shows a fine alveolate structure. The biological optical microscope micrograph of P(AA/AM-HA) shows a network structure. Graft polymerization between P(AA/AM) and HA was demonstrated by infrared spectrum. The P(AA/AM-HA) superabsorbent has better absorbing ability of water and fertilizer, electrolytic tolerance and fewer cost than P(AA/AM) superabsorbent. PMID:25078843

  20. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti

    2013-11-01

    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  1. Proton donor acidity controls selectivity in nonaromatic nitrogen heterocycle synthesis.

    PubMed

    Duttwyler, Simon; Chen, Shuming; Takase, Michael K; Wiberg, Kenneth B; Bergman, Robert G; Ellman, Jonathan A

    2013-02-01

    Piperidines are prevalent in natural products and pharmaceutical agents and are important synthetic targets for drug discovery and development. We report on a methodology that provides highly substituted piperidine derivatives with regiochemistry selectively tunable by varying the strength of acid used in the reaction. Readily available starting materials are first converted to dihydropyridines via a cascade reaction initiated by rhodium-catalyzed carbon-hydrogen bond activation. Subsequent divergent regio- and diastereoselective protonation of the dihydropyridines under either kinetic or thermodynamic control provides two distinct iminium ion intermediates that then undergo highly diastereoselective nucleophilic additions. X-ray structural characterization of both the kinetically and thermodynamically favored iminium ions along with density functional theory calculations provide a theoretical underpinning for the high selectivities achieved for the reaction sequences.

  2. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.

    PubMed

    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M

    2015-08-01

    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter.

  3. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.

    PubMed

    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M

    2015-08-01

    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter. PMID:25900811

  4. Synthesis and degradation test of hyaluronic acid hydrogels.

    PubMed

    Hahn, Sei Kwang; Park, Jung Kyu; Tomimatsu, Takashi; Shimoboji, Tsuyoshi

    2007-03-10

    Hyaluronic acid (HA) hydrogels prepared with three different crosslinking reagents were assessed by in vitro and in vivo degradation tests for various tissue engineering applications. Adipic acid dihydrazide grafted HA (HA-ADH) was synthesized and used for the preparation of methacrylated HA (HA-MA) with methacrylic anhydride and thiolated HA (HA-SH) with Traut's reagent (imminothiolane). (1)H NMR analysis showed that the degrees of HA-ADH, HA-MA, and HA-SH modification were 69, 29, and 56 mol%, respectively. HA-ADH hydrogel was prepared by the crosslinking with bis(sulfosuccinimidyl) suberate (BS(3)), HA-MA hydrogel with dithiothreitol (DTT) by Michael addition, and HA-SH hydrogel with sodium tetrathionate by disulfide bond formation. According to in vitro degradation tests, HA-SH hydrogel was degraded very fast, compared to HA-ADH and HA-MA hydrogels. HA-ADH hydrogel was degraded slightly faster than HA-MA hydrogel. Based on these results, HA-MA hydrogels and HA-SH hydrogels were implanted in the back of SD rats and their degradation was assessed according to the pre-determined time schedule. As expected from the in vitro degradation test results, HA-SH hydrogel was in vivo degraded completely only in 2 weeks, whereas HA-MA hydrogels were degraded only partially even in 29 days. The degradation rate of HA hydrogels were thought to be controlled by changing the crosslinking reagents and the functional group of HA derivatives. In addition, the state of HA hydrogel was another factor in controlling the degradation rate. Dried HA hydrogel at 37 degrees C for a day resulted in relatively slow degradation compared to the bulk HA hydrogel. There was no adverse effect during the in vivo tests. PMID:17101173

  5. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin

    2011-06-15

    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  6. FasL-triggered death of Jurkat cells requires caspase 8-induced, ATP-dependent cross-talk between Fas and the purinergic receptor P2X(7).

    PubMed

    Aguirre, Adam; Shoji, Kenji F; Sáez, Juan C; Henríquez, Mauricio; Quest, Andrew F G

    2013-02-01

    Fas ligation via the ligand FasL activates the caspase-8/caspase-3-dependent extrinsic death pathway. In so-called type II cells, an additional mechanism involving tBid-mediated caspase-9 activation is required to efficiently trigger cell death. Other pathways linking FasL-Fas interaction to activation of the intrinsic cell death pathway remain unknown. However, ATP release and subsequent activation of purinergic P2X(7) receptors (P2X(7)Rs) favors cell death in some cells. Here, we evaluated the possibility that ATP release downstream of caspase-8 via pannexin1 hemichannels (Panx1 HCs) and subsequent activation of P2X(7)Rs participate in FasL-stimulated cell death. Indeed, upon FasL stimulation, ATP was released from Jurkat cells in a time- and caspase-8-dependent manner. Fas and Panx1 HCs colocalized and inhibition of the latter, but not connexin hemichannels, reduced FasL-induced ATP release. Extracellular apyrase, which hydrolyzes ATP, reduced FasL-induced death. Also, oxidized-ATP or Brilliant Blue G, two P2X(7)R blockers, reduced FasL-induced caspase-9 activation and cell death. These results represent the first evidence indicating that the two death receptors, Fas and P2X(7)R connect functionally via caspase-8 and Panx1 HC-mediated ATP release to promote caspase-9/caspase-3-dependent cell death in lymphoid cells. Thus, a hitherto unsuspected route was uncovered connecting the extrinsic to the intrinsic pathway to amplify death signals emanating from the Fas receptor in type II cells.

  7. Effects of Shenqi Fuzheng injection on Fas/FasL protein expression levels in the cardiomyocytes of a mouse model of viral myocarditis

    PubMed Central

    WU, TIANMIN; CHEN, JINSHUI; FAN, LIUFANG; XIE, WENYAN; XU, CHANGSHENG; WANG, HUAJUN

    2016-01-01

    The aim of the present study was to examine the effects of Shenqi Fuzheng injection (SFI) on Fas and FasL protein expression levels in the cardiomyocytes of mice with viral myocarditis (VMC) and to explore the underlying anti-apoptotic mechanisms. A total of 120 male BALB/c mice were randomly divided into five groups as follows: Blank control group, model group, ribavirin group, low-dose SFI group and high-dose SFI group. The VMC model was established by the injection of coxsackievirus group B type 3 and saline, ribavirin or SFI was administered 30 min later. Cardiac samples were harvested from mice in each group on days 3, 10 and 30. Apoptosis of cardiac cells was examined using terminal deoxynucleotidyl transferase dUTP nick-end labeling, and Fas and FasL protein expression levels were detected using immunohistochemistry. Myocardial apoptosis and Fas/FasL protein expression levels were significantly increased in the model group, as compared with the blank group (P<0.01), whereas the apoptotic index (AI) and Fas/FasL protein expression levels of cardiac cells in the high-dose SFI group were significantly decreased compared with those in the model group on day 10 (acute phase; P<0.01). The AI and Fas/FasL protein expression levels of cardiac cells in the low- and high-dose SFI groups were also significantly decreased on day 30 (chronic phase; P<0.01); however, no differences between the high- and low-dose groups were detected. In conclusion, SFI relieves VMC via the downregulation of Fas and FasL protein expression and the inhibition of cell apoptosis. PMID:27168814

  8. FasL-triggered death of Jurkat cells requires caspase 8-induced, ATP-dependent cross-talk between Fas and the purinergic receptor P2X(7).

    PubMed

    Aguirre, Adam; Shoji, Kenji F; Sáez, Juan C; Henríquez, Mauricio; Quest, Andrew F G

    2013-02-01

    Fas ligation via the ligand FasL activates the caspase-8/caspase-3-dependent extrinsic death pathway. In so-called type II cells, an additional mechanism involving tBid-mediated caspase-9 activation is required to efficiently trigger cell death. Other pathways linking FasL-Fas interaction to activation of the intrinsic cell death pathway remain unknown. However, ATP release and subsequent activation of purinergic P2X(7) receptors (P2X(7)Rs) favors cell death in some cells. Here, we evaluated the possibility that ATP release downstream of caspase-8 via pannexin1 hemichannels (Panx1 HCs) and subsequent activation of P2X(7)Rs participate in FasL-stimulated cell death. Indeed, upon FasL stimulation, ATP was released from Jurkat cells in a time- and caspase-8-dependent manner. Fas and Panx1 HCs colocalized and inhibition of the latter, but not connexin hemichannels, reduced FasL-induced ATP release. Extracellular apyrase, which hydrolyzes ATP, reduced FasL-induced death. Also, oxidized-ATP or Brilliant Blue G, two P2X(7)R blockers, reduced FasL-induced caspase-9 activation and cell death. These results represent the first evidence indicating that the two death receptors, Fas and P2X(7)R connect functionally via caspase-8 and Panx1 HC-mediated ATP release to promote caspase-9/caspase-3-dependent cell death in lymphoid cells. Thus, a hitherto unsuspected route was uncovered connecting the extrinsic to the intrinsic pathway to amplify death signals emanating from the Fas receptor in type II cells. PMID:22806078

  9. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  10. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis

    2004-01-01

    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  11. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki

    2016-04-01

    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  12. Synthesis and Anti-microbial Activity of Novel Phosphatidylethanolamine-N-amino Acid Derivatives.

    PubMed

    Vijeetha, Tadla; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Surya Koppeswara Rao, Bhamidipati Venkata; Prasad, Rachapudi Badari Narayana; Kumar, Koochana Pranay; Surya Narayana Murthy, Upadyaula

    2015-01-01

    The study involved synthesis of five novel amino acid derivatives of phosphatidylethanolamine isolated from egg yolk lecithin employing a three step procedure i) N-protection of L-amino acids with BOC anhydride in alkaline medium ii) condensation of - CO2H group of N-protected amino acid with free -NH2 of PE by a peptide linkage and iii) deprotection of N-protected group of amino acids to obtain phosphatidylethanolamine-N-amino acid derivatives in 60-75% yield. The five L-amino acids used were L glycine, L-valine, L-leucine, L-isoleucine and L-phenylalanine. The amino acid derivatives were screened for anti-baterial activity against B. subtilis, S. aureus, P. aeroginosa and E. coli taking Streptomycin as reference compound and anti-fungal activity against C. albicans, S. cervisiae, A. niger taking AmphotericinB as reference compound. All the amino acid derivatives exhibited extraordinary anti-bacterial activities about 3 folds or comparable to Streptomycin and moderate or no anti-fungal activity against Amphotericin-B.

  13. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  14. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  15. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, L.

    1999-05-25

    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  16. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  17. Stabilized epoxygenated fatty acids regulate inflammation, pain, angiogenesis and cancer

    PubMed Central

    Zhang, Guodong; Kodani, Sean; Hammock, Bruce D.

    2014-01-01

    Epoxygenated fatty acids (EpFAs), which are lipid mediators produced by cytochrome P450 epoxygenases from polyunsaturated fatty acids, are important signaling molecules known to regulate various biological processes including inflammation, pain and angiogenesis. The EpFAs are further metabolized by soluble epoxide hydrolase (sEH) to form fatty acid diols which are usually less-active. Pharmacological inhibitors of sEH that stabilize endogenous EpFAs are being considered for human clinical uses. Here we review the biology of ω-3 and ω-6 EpFAs on inflammation, pain, angiogenesis and tumorigenesis. PMID:24345640

  18. 'FAS't inhibition of malaria.

    PubMed

    Surolia, Avadhesha; Ramya, T N C; Ramya, V; Surolia, Namita

    2004-11-01

    Malaria, a tropical disease caused by Plasmodium sp., has been haunting mankind for ages. Unsuccessful attempts to develop a vaccine, the emergence of resistance against the existing drugs and the increasing mortality rate all call for immediate strategies to treat it. Intense attempts are underway to develop potent analogues of the current antimalarials, as well as a search for novel drug targets in the parasite. The indispensability of apicoplast (plastid) to the survival of the parasite has attracted a lot of attention in the recent past. The present review describes the origin and the essentiality of this relict organelle to the parasite. We also show that among the apicoplast specific pathways, the fatty acid biosynthesis system is an attractive target, because its inhibition decimates the parasite swiftly unlike the 'delayed death' phenotype exhibited by the inhibition of the other apicoplast processes. As the enzymes of the fatty acid biosynthesis system are present as discrete entities, unlike those of the host, they are amenable to inhibition without impairing the operation of the host-specific pathway. The present review describes the role of these enzymes, the status of their molecular characterization and the current advancements in the area of developing inhibitors against each of the enzymes of the pathway. PMID:15315475

  19. Application of a Fas Ligand Encoding a Recombinant Adenovirus Vector for Prolongation of Transgene Expression

    PubMed Central

    Zhang, Huang-Ge; Bilbao, Guadalupe; Zhou, Tong; Contreras, Juan Luis; Gómez-Navarro, Jesús; Feng, Meizhen; Saito, Izumu; Mountz, John D.; Curiel, David T.

    1998-01-01

    An adenovirus vector encoding murine Fas ligand (mFasL) under an inducible control was derived. In vivo ectopic expression of mFasL in murine livers induced an inflammatory cellular infiltration. Furthermore, ectopic expression of mFasL by myocytes did not allow prolonged vector-mediated transgene expression. Thus, ectopic expression of functional mFasL in vector-transduced cells does not appear to confer, by itself, an immunoprivileged site sufficient to mitigate adenovirus vector immunogenicity. PMID:9499110

  20. Identification of the Calmodulin-Binding Domains of Fas Death Receptor

    PubMed Central

    Chang, Bliss J.; Samal, Alexandra B.; Vlach, Jiri; Fernandez, Timothy F.; Brooke, Dewey; Prevelige, Peter E.; Saad, Jamil S.

    2016-01-01

    The extrinsic apoptotic pathway is initiated by binding of a Fas ligand to the ectodomain of the surface death receptor Fas protein. Subsequently, the intracellular death domain of Fas (FasDD) and that of the Fas-associated protein (FADD) interact to form the core of the death-inducing signaling complex (DISC), a crucial step for activation of caspases that induce cell death. Previous studies have shown that calmodulin (CaM) is recruited into the DISC in cholangiocarcinoma cells and specifically interacts with FasDD to regulate the apoptotic/survival signaling pathway. Inhibition of CaM activity in DISC stimulates apoptosis significantly. We have recently shown that CaM forms a ternary complex with FasDD (2:1 CaM:FasDD). However, the molecular mechanism by which CaM binds to two distinct FasDD motifs is not fully understood. Here, we employed mass spectrometry, nuclear magnetic resonance (NMR), biophysical, and biochemical methods to identify the binding regions of FasDD and provide a molecular basis for the role of CaM in Fas–mediated apoptosis. Proteolytic digestion and mass spectrometry data revealed that peptides spanning residues 209–239 (Fas-Pep1) and 251–288 (Fas-Pep2) constitute the two CaM-binding regions of FasDD. To determine the molecular mechanism of interaction, we have characterized the binding of recombinant/synthetic Fas-Pep1 and Fas-Pep2 peptides with CaM. Our data show that both peptides engage the N- and C-terminal lobes of CaM simultaneously. Binding of Fas-Pep1 to CaM is entropically driven while that of Fas-Pep2 to CaM is enthalpically driven, indicating that a combination of electrostatic and hydrophobic forces contribute to the stabilization of the FasDD–CaM complex. Our data suggest that because Fas-Pep1 and Fas-Pep2 are involved in extensive intermolecular contacts with the death domain of FADD, binding of CaM to these regions may hinder its ability to bind to FADD, thus greatly inhibiting the initiation of apoptotic signaling

  1. LFG: an anti-apoptotic gene that provides protection from Fas-mediated cell death.

    PubMed

    Somia, N V; Schmitt, M J; Vetter, D E; Van Antwerp, D; Heinemann, S F; Verma, I M

    1999-10-26

    Programmed cell death regulates a number of biological phenomena, and the apoptotic signal must itself be tightly controlled to avoid inappropriate cell death. We established a genetic screen to search for molecules that inhibit the apoptotic signal from the Fas receptor. Here we report the isolation of a gene, LFG, that protects cells uniquely from Fas but not from the mechanistically related tumor necrosis factor alpha death signal. LFG is widely distributed, but remarkably is highly expressed in the hippocampus. LFG can bind to the Fas receptor, but does not regulate Fas expression or interfere with binding of an agonist antibody. Furthermore LFG does not inhibit binding of FADD to Fas.

  2. Chemical synthesis and enzymatic, stereoselective hydrolysis of a functionalized dihydropyrimidine for the synthesis of β-amino acids.

    PubMed

    Slomka, Christin; Zhong, Sabilla; Fellinger, Anna; Engel, Ulrike; Syldatk, Christoph; Bräse, Stefan; Rudat, Jens

    2015-12-01

    A novel substrate, 6-(4-nitrophenyl)dihydropyrimidine-2,4(1H,3H)-dione (pNO2PheDU), was chemically synthesized and analytically verified for the potential biocatalytic synthesis of enantiopure β-amino acids. The hydantoinase (EC 3.5.2.2) from Arthrobacter crystallopoietes DSM20117 was chosen to prove the enzymatic hydrolysis of this substrate, since previous investigations showed activities of this enzyme toward 6-monosubstituted dihydrouracils. Whole cell biotransformations with recombinant Escherichia coli expressing the hydantoinase showed degradation of pNO2PheDU. Additionally, the corresponding N-carbamoyl-β-amino acid (NCarbpNO2 βPhe) was chemically synthesized, an HPLC-method with chiral stationary phases for detection of this product was established and thus (S)-enantioselectivity toward pNO2PheDU has been shown. Consequently this novel substrate is a potential precursor for the enantiopure β-amino acid para-nitro-β-phenylalanine (pNO2 βPhe). PMID:26705241

  3. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.

    1981-01-01

    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  4. Synthesis and characterization of hybrid hyaluronic acid-gelatin hydrogels.

    PubMed

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-04-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g., cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three-dimensional culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications.

  5. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels

    PubMed Central

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-01-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g. cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three dimensional (2D and 3D) culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  6. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.

  7. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties. PMID:26159785

  8. Enantiopure synthesis of dihydrobenzo[1,4]-oxazine-3-carboxylic acids and a route to benzoxazinyl oxazolidinones.

    PubMed

    Malhotra, Rajesh; Dey, Tushar K; Basu, Sourav; Hajra, Saumen

    2015-03-21

    A two step protocol is developed for the efficient synthesis of enantiopure N-Boc-dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 from serine derived cyclic sulfamidate via intramolecular arylamination. The RuPhos Palladacycle along with additional RuPhos ligand is found to be an efficient catalyst for the arylamination of β-(2-bromoaryloxy)amino acids 3 to provide easy and direct access to a variety of dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 with complete retention of enantiopurity in moderate to high yields. Dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids are not only important unnatural amino acids, but are key precursors for the synthesis of important compounds such as benzoxazinyl oxazolidinones. A general approach for the synthesis of benzoxazinyl oxazolidinone is presented.

  9. Physiologic hyperinsulinemia stimulates protein synthesis and enhances transport of selected amino acids in human skeletal muscle.

    PubMed Central

    Biolo, G; Declan Fleming, R Y; Wolfe, R R

    1995-01-01

    We have investigated the mechanisms of the anabolic effect of insulin on muscle protein metabolism in healthy volunteers, using stable isotopic tracers of amino acids. Calculations of muscle protein synthesis, breakdown, and amino acid transport were based on data obtained with the leg arteriovenous catheterization and muscle biopsy. Insulin was infused (0.15 mU/min per 100 ml leg) into the femoral artery to increase femoral venous insulin concentration (from 10 +/- 2 to 77 +/- 9 microU/ml) with minimal systemic perturbations. Tissue concentrations of free essential amino acids decreased (P < 0.05) after insulin. The fractional synthesis rate of muscle protein (precursor-product approach) increased (P < 0.01) after insulin from 0.0401 +/- 0.0072 to 0.0677 +/- 0.0101%/h. Consistent with this observation, rates of utilization for protein synthesis of intracellular phenylalanine and lysine (arteriovenous balance approach) also increased from 40 +/- 8 to 59 +/- 8 (P < 0.05) and from 219 +/- 21 to 298 +/- 37 (P < 0.08) nmol/min per 100 ml leg, respectively. Release from protein breakdown of phenylalanine, leucine, and lysine was not significantly modified by insulin. Local hyperinsulinemia increased (P < 0.05) the rates of inward transport of leucine, lysine, and alanine, from 164 +/- 22 to 200 +/- 25, from 126 +/- 11 to 221 +/- 30, and from 403 +/- 64 to 595 +/- 106 nmol/min per 100 ml leg, respectively. Transport of phenylalanine did not change significantly. We conclude that insulin promoted muscle anabolism, primarily by stimulating protein synthesis independently of any effect on transmembrane transport. Images PMID:7860765

  10. The Fas-FADD Death Domain Complex Structure Unravels Signalling by Receptor Clustering

    SciTech Connect

    Scott, F.; Stec, B; Pop, C; Dobaczewska, M; Lee, J; Monosov, E; Robinson, H; Salvesen, G; Schwarzenbacher, R; Riedl, S

    2009-01-01

    The death inducing signalling complex (DISC) formed by Fas receptor, FADD (Fas-associated death domain protein) and caspase 8 is a pivotal trigger of apoptosis1, 2, 3. The Fas-FADD DISC represents a receptor platform, which once assembled initiates the induction of programmed cell death. A highly oligomeric network of homotypic protein interactions comprised of the death domains of Fas and FADD is at the centre of DISC formation4, 5. Thus, characterizing the mechanistic basis for the Fas-FADD interaction is crucial for understanding DISC signalling but has remained unclear largely because of a lack of structural data. We have successfully formed and isolated the human Fas-FADD death domain complex and report the 2.7 A crystal structure. The complex shows a tetrameric arrangement of four FADD death domains bound to four Fas death domains. We show that an opening of the Fas death domain exposes the FADD binding site and simultaneously generates a Fas-Fas bridge. The result is a regulatory Fas-FADD complex bridge governed by weak protein-protein interactions revealing a model where the complex itself functions as a mechanistic switch. This switch prevents accidental DISC assembly, yet allows for highly processive DISC formation and clustering upon a sufficient stimulus. In addition to depicting a previously unknown mode of death domain interactions, these results further uncover a mechanism for receptor signalling solely by oligomerization and clustering events.

  11. Camptothecin sensitizes androgen-independent prostate cancer cells to anti-Fas-induced apoptosis

    PubMed Central

    Costa-Pereira, A P; Cotter, T G

    1999-01-01

    Despite expressing both Fas and Fas ligand, DU145 and LNCaP prostate cancer cells were resistant to anti-Fas-induced cell death. Resistance to Fas-mediated cytotoxicity could be overcome in DU145, but not in LNCaP, cells by pretreating cells with sublethal doses of cytotoxic drugs, such as camptothecin. Activated caspases were shown to be required for this cytotoxicity. Indeed, poly(ADP-Ribose) polymerase was shown to be proteolytically cleaved in cells treated with camptothecin plus anti-Fas, but not in cells treated with anti-Fas only. Moreover, pretreatment of cells with ZVAD completely blocked camptothecin-mediated Fas-induced apoptosis. Sensitization of cells to Fas-induced cell death did not involve up-regulation of Fas or FasL, and it was independent of alterations in the cell cycle. Reactive oxygen intermediates (ROI) have been shown to be important mediators of drug-induced apoptosis. Here, we demonstrate that treatment of DU145 cells with camptothecin, anti-Fas, or both, did not alter the intracellular levels of peroxide or superoxide anion. © 1999 Cancer Research Campaign PMID:10408840

  12. [Enhancement of Fas-mediated apoptosis in leukemic cell line HL-60 by Bay 11 - 7082].

    PubMed

    Wang, Li; Liu, Ling-Bo; Li, Lei; Zou, Ping

    2007-10-01

    The aim of study was to explore the effects of NF-kappaB inhibitor Bay 11 - 7082 on Fas/FasL system and Fas-mediated apoptosis in HL-60 cells. The mRNA and protein expression levels of Fas, FasL and XIAP after treatment with Bay 11 - 7082 were detected by RT-PCR and FCM respectively. The level of sFasL was detected by ELISA before and after treatment with Bay 11 - 7082; apoptosis was detected by FCM before and after treatment with Bay 11 - 7082. The results showed that after treating HL-60 cells with Bay 11 - 7082, the mRNA and protein levels of FasL and XIAP were lower than that of controls, the difference was significant by statistic analysis (p < 0.05). Neither the mRNA and protein levels of Fas, nor the level of sFasL changed significantly (p > 0.05). Apoptotic rate of HL-60 cells treated with Bay 11 - 7082 was significantly higher as compared with controls (p < 0.05). It is concluded that Bay 11 - 7082 can enhance Fas-mediated apoptosis in HL-60 cells by down-regulation of FasL and XIAP levels.

  13. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  14. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward

    2015-01-01

    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  15. Fatty acid biosynthesis redirected to medium chains in transgenic oilseed plants

    SciTech Connect

    Voelker, T.A.; Worrell, A.C.; Anderson, L.; Bleibaum, J.; Fan, C.; Hawkins, D.J.; Radke, S.E.; Davies, H.M. )

    1992-07-03

    Medium-chain fatty acids (FAs), found in storage lipids of certain plants, are an important renewable resource. Seeds of undomesticated California bay accumulate laurate (12:0), and a 12:0-acyl-carrier protein thioesterase (BTE) has been purified from this tissue. Sequencing of BTE enabled the cloning of a complementary DNA coding for a plastid-targeted preprotein. Expression of the complementary DNA in the seeds of Arabidopsis thaliana resulted in BTE activity, and medium chains accumulated at the expense of long-chain ({ge}16) FAs. Laurate became the most abundant FA species and was deposited in the storage triacylglycerols. These results demonstrate a mechanism for medium-chain FA synthesis in plants.

  16. [A role of the Fas system in the pathogenesis of ischemic stroke].

    PubMed

    Sergeeva, S P; Savin, A A; Litvitsky, P F

    2016-01-01

    The Fas system can promote several biological effects due to their activation after ischemic stroke: apoptosis, inflammation, proliferation, differentiation. Fas interacts with adapter proteins activating a number of signaling pathways, including MAPK, NFKB, JNK, ERK, phosphorylation of cytoskeletal proteins, and caspase-dependent apoptosis. Fas expressed by neuronal progenitor cells from the subventricular zone does not induce apoptosis in healthy adult humans. During motion and differentiation of these cells, Fas regulates their morphological structure by the phosphorylation/dephosphorylation of cytoskeletal elements. An increase in the Fas and Fas ligand expression is observed in response to stroke injury. Fas responsible not only for cell death and inflammation but also for neuronal plasticity which occupies a central place in the processes of sanogenesis.

  17. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    PubMed Central

    Moret, Séverine; Dyson, Paul J.; Laurenczy, Gábor

    2014-01-01

    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes. PMID:24886955

  18. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)

    1991-01-01

    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  19. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  20. Effect of Nitric Acid Concentrations on Synthesis and Stability of Maghemite Nanoparticles Suspension

    PubMed Central

    Yaacob, Iskandar Idris

    2014-01-01

    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension. PMID:24963510