Science.gov

Sample records for acid synthesis fas

  1. Quality control of a cytoplasmic protein complex: chaperone motors and the ubiquitin-proteasome system govern the fate of orphan fatty acid synthase subunit Fas2 of yeast.

    PubMed

    Scazzari, Mario; Amm, Ingo; Wolf, Dieter H

    2015-02-20

    For the assembly of protein complexes in the cell, the presence of stoichiometric amounts of the respective protein subunits is of utmost importance. A surplus of any of the subunits may trigger unspecific and harmful protein interactions and has to be avoided. A stoichiometric amount of subunits must finally be reached via transcriptional, translational, and/or post-translational regulation. Synthesis of saturated 16 and 18 carbon fatty acids is carried out by fatty acid synthase: in yeast Saccharomyces cerevisiae, a 2.6-MDa molecular mass assembly containing six protomers each of two different subunits, Fas1 (β) and Fas2 (α). The (α)6(β)6 complex carries six copies of all eight enzymatic activities required for fatty acid synthesis. The FAS1 and FAS2 genes in yeast are unlinked and map on two different chromosomes. Here we study the fate of the α-subunit of the complex, Fas2, when its partner, the β-subunit Fas1, is absent. Individual subunits of fatty acid synthase are proteolytically degraded when the respective partner is missing. Elimination of Fas2 is achieved by the proteasome. Here we show that a ubiquitin transfer machinery is required for Fas2 elimination. The major ubiquitin ligase targeting the superfluous Fas2 subunit to the proteasome is Ubr1. The ubiquitin-conjugating enzymes Ubc2 and Ubc4 assist the degradation process. The AAA-ATPase Cdc48 and the Hsp70 chaperone Ssa1 are crucially involved in the elimination of Fas2.

  2. Fas-induced programmed cell death is mediated by a Ras-regulated O2- synthesis.

    PubMed Central

    Gulbins, E; Brenner, B; Schlottmann, K; Welsch, J; Heinle, H; Koppenhoefer, U; Linderkamp, O; Coggeshall, K M; Lang, F

    1996-01-01

    Fas induces apoptosis in lymphocytes via a poorly defined intracellular signalling cascade. Previously, we have demonstrated the involvement and significance of a signalling cascade from the Fas receptor via sphingomyelinases and ceramide to Ras in Fas-induced apoptosis. Here we demonstrate rapid and transient synthesis of reactive oxygen intermediates (ROI) via activation of Ras after Fas. Genetic inhibition of Ras by transfection of transdominant inhibitory N17Ras blocked Fas-mediated ROI synthesis and programmed cell death. Likewise, the antioxidants N-acetyl-cysteine and N-t-butyl-phenylnitrone abolished Fas-induced cell death, pointing to an important role for Ras-triggered ROI synthesis in Fas-mediated programmed cell death. Images Figure 1 Figure 3 PMID:8943716

  3. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  4. Crystal structure of FAS thioesterase domain with polyunsaturated fatty acyl adduct and inhibition by dihomo-[gamma]-linolenic acid

    SciTech Connect

    Zhang, Wei; Chakravarty, Bornali; Zheng, Fei; Gu, Ziwei; Wu, Hongmei; Mao, Jianqiang; Wakil, Salih J.; Quiocho, Florante A.

    2012-05-29

    Human fatty acid synthase (hFAS) is a homodimeric multidomain enzyme that catalyzes a series of reactions leading to the de novo biosynthesis of long-chain fatty acids, mainly palmitate. The carboxy-terminal thioesterase (TE) domain determines the length of the fatty acyl chain and its ultimate release by hydrolysis. Because of the upregulation of hFAS in a variety of cancers, it is a target for antiproliferative agent development. Dietary long-chain polyunsaturated fatty acids (PUFAs) have been known to confer beneficial effects on many diseases and health conditions, including cancers, inflammations, diabetes, and heart diseases, but the precise molecular mechanisms involved have not been elucidated. We report the crystal structure of the hFAS TE domain covalently modified and inactivated by methyl {gamma}-linolenylfluorophosphonate. Whereas the structure confirmed the phosphorylation by the phosphonate head group of the active site serine, it also unexpectedly revealed the binding of the 18-carbon polyunsaturated {gamma}-linolenyl tail in a long groove-tunnel site, which itself is formed mainly by the emergence of an {alpha} helix (the 'helix flap'). We then found inhibition of the TE domain activity by the PUFA dihomo-{gamma}-linolenic acid; {gamma}- and {alpha}-linolenic acids, two popular dietary PUFAs, were less effective. Dihomo-{gamma}-linolenic acid also inhibited fatty acid biosynthesis in 3T3-L1 preadipocytes and selective human breast cancer cell lines, including SKBR3 and MDAMB231. In addition to revealing a novel mechanism for the molecular recognition of a polyunsaturated fatty acyl chain, our results offer a new framework for developing potent FAS inhibitors as therapeutics against cancers and other diseases.

  5. A novel cisplatin mediated apoptosis pathway is associated with acid sphingomyelinase and FAS proapoptotic protein activation in ovarian cancer.

    PubMed

    Maurmann, L; Belkacemi, L; Adams, N R; Majmudar, P M; Moghaddas, S; Bose, R N

    2015-07-01

    Platinum-based anticancer drugs, including cisplatin and carboplatin, have been cornerstones in the treatment of solid tumors. We report here that these DNA-damaging agents, particularly cisplatin, induce apoptosis through plasma membrane disruption, triggering FAS death receptor via mitochondrial (intrinsic) pathways. Our objectives were to: quantify the composition of membrane metabolites; and determine the potential involvement of acid sphingomyelinase (ASMase) in the FAS-mediated apoptosis in ovarian cancer after cisplatin treatment. The resulting analysis revealed enhanced apoptosis as measured by: increased phosphocholine, and glycerophosphocholine; elevated cellular energetics; and phosphocreatine and nucleoside triphosphate concentrations. The plasma membrane alterations were accompanied by increased ASMase activity, leading to the upregulation of FAS, FASL and related pro-apoptotic BAX and PUMA genes. Moreover FAS, FASL, BAX, PUMA, CASPASE-3 and -9 proteins were upregulated. Our findings implicate ASMase activity and the intrinsic pathways in cisplatin-mediated membrane demise, and contribute to our understanding of the mechanisms by which ovarian tumors may become resistant to cisplatin.

  6. Mechanisms of cancer chemoprevention by hop bitter acids (beer aroma) through induction of apoptosis mediated by Fas and caspase cascades.

    PubMed

    Chen, Wei-Jen; Lin, Jen-Kun

    2004-01-14

    The bitter acids of hops (Humulus lupulus L.) mainly consist of alpha-acids, beta-acids, and their oxidation products that contribute the unique aroma of the beer beverage. Hop bitter acids displayed a strong growth inhibitory effect against human leukemia HL-60 cells, with an estimated IC(50) value of 8.67 microg/mL, but were less effective against human histolytic lymphoma U937 cells. Induction of apoptosis was confirmed in HL-60 cells by DNA fragmentation and the appearance of a sub-G1 DNA peak, which were preceded by dissipation of mitochondrial membrane potential, cytochrome c release, and subsequent induction of pro-caspase-9 and -3 processing. Cleavages of PARP and DFF-45 were accompanied with activation of caspase-9 and -3 triggered by hop bitter acids in HL-60 cells. The change in the expression of Bcl-2, Bcl-X(L), and Bax in response to hop bitter acids was studied, and the Bcl-2 protein level slightly decreased; however, the Bcl-X(L) protein level was obviously decreased, whereas the Bax protein level was dramatically increased, indicating that the control of Bcl-2 family proteins by hop bitter acids might participate in the disruption of mitochondrial integrity. In addition, the results showed that hop bitter acids promoted the up-regulation of Fas and FasL prior to the processing and activation of pro-caspase-8 and cleavage of Bid, suggesting the involvement of a Fas-mediated pathway in hop bitter acids-induced cells. Taken together, these findings suggest that a certain intimate link might exist between receptor- and mitochondria-mediated death signalings that committed to cell death induced by hop bitter acids. The induction of apoptosis by hop bitter acids may offer a pivotal mechanism for their chemopreventive action.

  7. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  8. 2-Octadecynoic acid as a dual life stage inhibitor of Plasmodium infections and plasmodial FAS-II enzymes.

    PubMed

    Carballeira, Néstor M; Bwalya, Angela Gono; Itoe, Maurice Ayamba; Andricopulo, Adriano D; Cordero-Maldonado, María Lorena; Kaiser, Marcel; Mota, Maria M; Crawford, Alexander D; Guido, Rafael V C; Tasdemir, Deniz

    2014-09-01

    The malaria parasite Plasmodium goes through two life stages in the human host, a non-symptomatic liver stage (LS) followed by a blood stage with all clinical manifestation of the disease. In this study, we investigated a series of 2-alkynoic fatty acids (2-AFAs) with chain lengths between 14 and 18 carbon atoms for dual in vitro activity against both life stages. 2-Octadecynoic acid (2-ODA) was identified as the best inhibitor of Plasmodium berghei parasites with ten times higher potency (IC50=0.34 μg/ml) than the control drug. In target determination studies, the same compound inhibited three Plasmodium falciparum FAS-II (PfFAS-II) elongation enzymes PfFabI, PfFabZ, and PfFabG with the lowest IC50 values (0.28-0.80 μg/ml, respectively). Molecular modeling studies provided insights into the molecular aspects underlying the inhibitory activity of this series of 2-AFAs and a likely explanation for the considerably different inhibition potentials. Blood stages of P. falciparum followed a similar trend where 2-ODA emerged as the most active compound, with 20 times less potency. The general toxicity and hepatotoxicity of 2-AFAs were evaluated by in vitro and in vivo methods in mammalian cell lines and zebrafish models, respectively. This study identifies 2-ODA as the most promising antiparasitic 2-AFA, particularly towards P. berghei parasites.

  9. Inhibition of Fatty Acid Synthase (FAS): A New Drug for Breast Cancer Chemoprevention

    DTIC Science & Technology

    2005-04-01

    induced obesity. Proc Natl Acad Sci U S A 99: 9498-9502, 2002. 6. Hakkak, R., Holley, A. W., Macleod, S. L ., Simpson, P. M., Fuchs, G. J., Jo, C. H...transgenic mice Patricia M Alli1, Michael L Pinn1, Elizabeth M Jaffee2, Jill M McFadden3 and Francis P Kuhajda*,1,2,4 Department of Pathology, The Johns...dependent densation of acetyl -CoA 1989). Inhibition of FAS in breast and prostate cancer cells led to apoptosis both in vitro and in vivo (Pizer et al

  10. Defects in Mitochondrial Fatty Acid Synthesis Result in Failure of Multiple Aspects of Mitochondrial Biogenesis in Saccharomyces cerevisiae

    PubMed Central

    Kursu, V. A. Samuli; Pietikäinen, Laura P.; Fontanesi, Flavia; Aaltonen, Mari J.; Suomi, Fumi; Nair, Remya Raghavan; Schonauer, Melissa S.; Dieckmann, Carol L.; Barrientos, Antoni; Hiltunen, J. Kalervo; Kastaniotis, Alexander J.

    2014-01-01

    Summary Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild heme deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a coordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. PMID:24102902

  11. Synthesis and biological evaluation of NAS-21 and NAS-91 analogues as potential inhibitors of the mycobacterial FAS-II dehydratase enzyme Rv0636.

    PubMed

    Bhowruth, Veemal; Brown, Alistair K; Besra, Gurdyal S

    2008-07-01

    The identification of potential new anti-tubercular chemotherapeutics is paramount due to the recent emergence of extensively drug-resistant strains of Mycobacterium tuberculosis (XDR-TB). Libraries of NAS-21 and NAS-91 analogues were synthesized and evaluated for their whole-cell activity against Mycobacterium bovis BCG. NAS-21 analogues 1 and 2 demonstrated enhanced whole-cell activity in comparison to the parental compound, and an M. bovis BCG strain overexpressing the dehydratase enzyme Rv0636 was resistant to these analogues. NAS-91 analogues with ortho-modifications gave enhanced whole-cell activity. However, extension with biphenyl modifications compromised the whole-cell activities of both NAS-21 and NAS-91 analogues. Interestingly, both libraries demonstrated in vitro activity against fatty acid synthase II (FAS-II) but not FAS-I in cell-free extracts. In in vitro assays of FAS-II inhibition, NAS-21 analogues 4 and 5 had IC(50) values of 28 and 19 mug ml(-1), respectively, for the control M. bovis strain, and the M. bovis BCG strain overexpressing Rv0636 showed a marked increase in resistance. In contrast, NAS-91 analogues demonstrated moderate in vitro activity, although increased resistance was again observed in FAS-II activity assays with the Rv0636-overexpressing strain. Fatty acid methyl ester (FAME) and mycolic acid methyl ester (MAME) analysis of M. bovis BCG and the Rv0636-overexpressing strain revealed that the effect of the drug was relieved in the overexpressing strain, further implicating and potentially identifying Rv0636 as the target for these known FabZ dehydratase inhibitors. This study has identified candidates for further development as drug therapeutics against the mycobacterial FAS-II dehydratase enzyme.

  12. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  13. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  14. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  15. Identification and functional differentiation of two type I fatty acid synthases in Brevibacterium ammoniagenes.

    PubMed Central

    Stuible, H P; Wagner, C; Andreou, I; Huter, G; Haselmann, J; Schweizer, E

    1996-01-01

    The fatty acid synthase (FAS) from Brevibacterium ammoniagenes is a homohexameric multienzyme complex that catalyzes the synthesis of both saturated and unsaturated fatty acids. By immunological screening of a B. ammoniagenes expression library, an fas DNA fragment was isolated and subsequently used to clone the entire gene together with its flanking sequences. Within 10,525 bp of sequenced DNA, the 9,189-bp FAS coding region was identified, corresponding to a protein of 3,063 amino acids with a molecular mass of 324,910 Da. This gene (fasA) encodes, at its 5' end, the same amino acid sequence as is observed with purified B. ammoniagenes FAS. A second reading frame encoding another B. ammoniagenes FAS variant (FasB) had been identified previously. Both sequences are colinear and exhibit 61 and 47% identity at the DNA and protein levels, respectively. By using specific antibodies raised against a unique peptide sequence of FasB, this enzyme was shown to represent only 5 to 10% of the cellular FAS protein. Insertional inactivation of the FasB coding sequence causes no defective phenotype, while fasA disruptants require oleic acid for growth. Correspondingly, oleate-dependent B. ammoniagenes cells obtained by ethyl methanesulfonate mutagenesis were complemented by transformation with fasA DNA but not with fasB DNA. The data indicate that B. ammoniagenes contains two related though differently expressed type I FASs. FasA represents the bulk of cellular FAS protein and catalyzes the synthesis of both saturated and unsaturated fatty acids, while the minor variant, FasB, cannot catalyze the synthesis of oleic acid. PMID:8759839

  16. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  17. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  18. [18F]- and [11C]-Labeled N-benzyl-isatin sulfonamide analogues as PET tracers for apoptosis: synthesis, radiolabeling mechanism, and in vivo imaging of apoptosis in Fas-treated mice

    PubMed Central

    Zhou, Dong; Chu, Wenhua; Chen, Delphine L.; Wang, Qi; Reichert, David E.; Rothfuss, Justin; D'Avignon, Andre; Welch, Michael J.; Mach, Robert H.

    2011-01-01

    Summary The radiolabeled isatin sulfonamide caspase-3 inhibitor, [18F]2 (WC-II-89), is a potential PET radiotracer for noninvasive imaging of apoptosis. The radiolabeling mechanism was studied by 13C NMR, ESI/MS, and computational calculations. It was found that the high electrophilicity of the C3 carbonyl group in the isatin ring, which served as a trap for [18F]fluoride, was responsible for the failure of the radiolabeling via nucleophilic substitution of the mesylate group in 7a by [18F]fluoride. Once treated with a strong base, 7a opened the isatin ring completely to form an isatinate intermediate 16, which lost the ability to trap [18F]fluoride, thereby allowing the displacement of the mesylate group to afford the 18F-labeled isatinate 17. [18F]17 can be converted to isatin [18F]2 efficiently under acidic conditions. The ring-opening and re-closure of the isatin ring under basic and acidic conditions were confirmed by reversed phase HPLC analysis, ESI/MS and 13C NMR studies. Computational studies of model compounds also support the above proposed mechanism. Similarly, the ring-opening and re-closure method was used successfully in the synthesis of the 11C labeled isatin sulfonamide analogue [11C]4 (WC-98). A microPET imaging study using [11C]4 in the Fas liver apoptosis model demonstrated retained activity in the target organ (liver) of the treated mice. Increased caspase-3 activation in the liver was verified by the fluorometric caspase-3 enzyme assay. Therefore, this study provides a useful method for radio-synthesis of isatin derivative radiotracers for PET and SPECT studies, and [11C]4 is a potential PET radiotracer for noninvasive imaging of apoptosis. PMID:19300818

  19. Glycolysis, Glutaminolysis and Fatty Acid Synthesis are Required for Distinct Stages of KSHV Lytic Replication.

    PubMed

    Sanchez, Erica L; Pulliam, Thomas H; Dimaio, Terri A; Thalhofer, Angel B; Delgado, Tracie; Lagunoff, Michael

    2017-03-08

    Kaposi's Sarcoma-associated Herpesvirus (KSHV) is the etiologic agent of Kaposi's Sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including glycolysis, glutaminolysis and fatty acid synthesis (FAS) for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription while glutaminolysis is necessary for early gene translation, but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions, but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are non-infectious indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication providing novel therapeutic avenues for KS tumors.IMPORTANCE KSHV is the etiologic agent of Kaposi's Sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state where there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation. Our previous findings showed that

  20. Downregulation of de Novo Fatty Acid Synthesis in Subcutaneous Adipose Tissue of Moderately Obese Women.

    PubMed

    Guiu-Jurado, Esther; Auguet, Teresa; Berlanga, Alba; Aragonès, Gemma; Aguilar, Carmen; Sabench, Fàtima; Armengol, Sandra; Porras, José Antonio; Martí, Andreu; Jorba, Rosa; Hernández, Mercè; del Castillo, Daniel; Richart, Cristóbal

    2015-12-16

    The purpose of this work was to evaluate the expression of fatty acid metabolism-related genes in human adipose tissue from moderately obese women. We used qRT-PCR and Western Blot to analyze visceral (VAT) and subcutaneous (SAT) adipose tissue mRNA expression involved in de novo fatty acid synthesis (ACC1, FAS), fatty acid oxidation (PPARα, PPARδ) and inflammation (IL6, TNFα), in normal weight control women (BMI < 25 kg/m², n = 35) and moderately obese women (BMI 30-38 kg/m², n = 55). In SAT, ACC1, FAS and PPARα mRNA expression were significantly decreased in moderately obese women compared to controls. The downregulation reported in SAT was more pronounced when BMI increased. In VAT, lipogenic-related genes and PPARα were similar in both groups. Only PPARδ gene expression was significantly increased in moderately obese women. As far as inflammation is concerned, TNFα and IL6 were significantly increased in moderate obesity in both tissues. Our results indicate that there is a progressive downregulation in lipogenesis in SAT as BMI increases, which suggests that SAT decreases the synthesis of fatty acid de novo during the development of obesity, whereas in VAT lipogenesis remains active regardless of the degree of obesity.

  1. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  2. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  3. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  4. Apoptosis of HeLa and CaSki cell lines incubated with All-trans retinoid acid.

    PubMed

    Darmochwal-Kolarz, Dorota; Gasowska-Giszczak, Urszula; Paduch, Robert; Kolarz, Bogdan; Wilciński, Piotr; Oleszczuk, Jan; Kwasniewska, Anna

    2009-01-01

    The aim of the study was to evaluate the concentrations of a soluble form of APO-1/Fas antigen (sFas, CD95) and a soluble Ligand for APO-1/Fas antigen (sCD95L, sFasL) in supernatants from CaSki and HeLa cell line cultures after the incubation with All-trans-retinoic acid. HPV-16 and HPV18 - positive cell lines were cultivated with All-trans-retinoic acid in concentrations of 1 x 10(-6) M/L and 1 x 10(-8) M/L. The cultures were incubated for 24 hours. Control culture with 3 microl of dimethyl-sulphoxide (DMSO) was incubated under identical conditions. The concentrations of soluble APO-1/Fas antigen and Fas Ligand in cell culture supernatants were estimated using immunoenzymatic methods. The obtained results showed significant decrease of concentrations of soluble APO-1/Fas antigen in supernatants from HeLa cell lines incubated with retinol in comparison with the control culture. Moreover, the concentrations of soluble Ligand for APO-1/Fas antigen in the supernatants of CaSki and HeLa cell lines were significantly lower in the culture incubated with All-trans retinoid acid when compared to the control culture. Higher concentrations of soluble APO-1/Fas antigen in supernatants from HeLa cell line without retinol may constitute a protective mechanism of the cells infected with the virus before undergoing Fas/FasL-dependent apoptosis. Lower concentrations of soluble APO-1/Fas antigen and soluble Ligand for APO-1/Fas in the supernatants from CaSki and HeLa cell cultures incubated with retinol suggest that retinoids can decrease the synthesis of soluble APO-1//Fas and soluble FasL in HPV-16 and HPV - 18 positive cells and that mechanisms protecting infected cells against Fas/FasL-mediated apoptosis become defective under the influence of retinol.

  5. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  6. Dual Role for Phospholipid:Diacylglycerol Acyltransferase: Enhancing Fatty Acid Synthesis and Diverting Fatty Acids from Membrane Lipids to Triacylglycerol in Arabidopsis Leaves[C][W

    PubMed Central

    Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng

    2013-01-01

    There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979

  7. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  8. Metalloproteinase-mediated release of human Fas ligand

    PubMed Central

    1995-01-01

    Fas ligand (FasL) is a type II integral membrane protein homologous with tumor necrosis factor (TNF). Recent studies indicate that TNF is processed to yield the soluble cytokine by metalloproteinases at the cell surface of activated macrophages and T cells. In the present study, we investigated whether FasL is also released by metalloproteinases. Treatment with hydroxamic acid inhibitors of matrix metalloproteinases specifically led to accumulation of membrane-type FasL (p40) on the surface of human FasL cDNA transfectants and activated human T cells, as estimated by surface immunofluorescence and immunoprecipitation with newly established anti-human FasL monoclonal antibodies. This surface accumulation of mFasL was associated with the decrease of soluble FasL (p27) in the supernatant as estimated by quantitative ELISA and immunoprecipitation with anti-human FasL monoclonal antibodies. These results indicate that human FasL is efficiently released from the cell surface by metalloproteinases like TNF. PMID:7500022

  9. Engineering fungal de novo fatty acid synthesis for short chain fatty acid production

    PubMed Central

    Gajewski, Jan; Pavlovic, Renata; Fischer, Manuel; Boles, Eckhard; Grininger, Martin

    2017-01-01

    Fatty acids (FAs) are considered strategically important platform compounds that can be accessed by sustainable microbial approaches. Here we report the reprogramming of chain-length control of Saccharomyces cerevisiae fatty acid synthase (FAS). Aiming for short-chain FAs (SCFAs) producing baker's yeast, we perform a highly rational and minimally invasive protein engineering approach that leaves the molecular mechanisms of FASs unchanged. Finally, we identify five mutations that can turn baker's yeast into a SCFA producing system. Without any further pathway engineering, we achieve yields in extracellular concentrations of SCFAs, mainly hexanoic acid (C6-FA) and octanoic acid (C8-FA), of 464 mg l−1 in total. Furthermore, we succeed in the specific production of C6- or C8-FA in extracellular concentrations of 72 and 245 mg l−1, respectively. The presented technology is applicable far beyond baker's yeast, and can be plugged into essentially all currently available FA overproducing microorganisms. PMID:28281527

  10. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors.

  11. RGD-FasL Induces Apoptosis in Hepatocellular Carcinoma

    PubMed Central

    Liu, Zhongchen; Wang, Juan; Yin, Ping; Qiu, Jinhua; Liu, Ruizhen; Li, Wenzhu; Fan, Xin; Cheng, Xiaofeng; Chen, Caixia; Zhang, Jiakai; Zhuang, Guohong

    2009-01-01

    Despite impressive results obtained in animal models, the clinical use of Fas ligand (FasL) as an anticancer drug is limited by severe toxicity. Systemic toxicity of death ligands may be prevented by using genes encoding membrane-bound death ligands and by targeted transgene expression through either targeted transduction or targeted transcription. Selective induction of tumor cell death is a promising anticancer strategy. A fusion protein is created by fusing the extracellular domain of Fas ligand (FasL) to the peptide arginine-glycine-aspartic acid (RGD) that selectively targets avβ3-integrins on tumor endothelial cells. The purpose of this study is to evaluate the effects of RGD-FasL on tumor growth and survival in a murine hepatocellular carcinoma (HCC) tumor model. Treatment with RGD-FasL displaying an obvious suppressive effect on the HCC tumor model as compared to that with FasL (p < 0.05) and resulted in a more additive effect on tumor growth delay in this model. RGD-FasL treatment significantly enhanced mouse survival and caused no toxic effect, such as weight loss, organ failure, or other treatment-related toxicities. Apoptosis was detected by flow cytometric analysis and TUNEL assays; those results also showed that RGD-FasL is a more potent inducer of cell apoptosis for H22 and H9101 cell lines than FasL (p < 0.05). In conclusion, RGD-FasL appears to be a low-toxicity selective inducer of tumor cell death, which merits further investigation in preclinical and clinical studies. Furthermore, this approach offers a versatile technology for complexing target ligands with therapeutic recombinant proteins. To distinguish the anti-tumor effects of FasL in vivo, tumor and liver tissues were harvested to examine for evidence of necrotic cells, tumor cells, or apoptotic cells by Hematoxylin and eosin (H&E) staining. PMID:19728930

  12. Castor phospholipid:diacylglycerol acyltransferase facilitates efficient metabolism of hydroxy fatty acids in transgenic Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Producing unusual fatty acids (FAs) in crop plants has been a long-standing goal of green chemistry. However, expression of the enzymes that catalyze the primary synthesis of these unusual FAs in transgenic plants typically results in low levels of the desired FA. For example, seed-specific expressi...

  13. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  14. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  15. Up-regulation of Fas (CD95) expression in tumour cells in vivo

    PubMed Central

    Peshes-Yaloz, Naama; Rosen, Dalia; Sondel, Paul M; Krammer, Peter H; Berke, Gideon

    2007-01-01

    Both the function and regulation of Fas expression in tumours is poorly understood. Our laboratory has reported that cultured, low Fas-expressing tumours undergo massive, yet reversible, up-regulation of cell surface Fas expression when injected into mice. The present study was aimed at determining what causes this enhanced Fas expression and whether the newly expressed Fas functions as a death receptor. Newly expressed Fas is indeed capable of inducing apoptosis. Based on our observation that Fas induction is reduced when tumour cells are injected into immune-deficient mice, we propose that Fas up-regulation in vivo involves the host's immune system. Accordingly, Fas up-regulation occurs in vitro when low Fas-expressing tumour cells are cocultured with lymphoid cells. Furthermore ascitic fluid extracted from tumour-bearing mice trigger Fas up-regulation in low Fas expressing tumours. This last finding suggests that a soluble factor(s) mediates induction of Fas expression. The best candidate for this soluble factor is nitric oxide (NO) based on the following observations: the factor in the ascites is unstable; Fas expression is induced to a lesser degree after injection into inducible NO synthase (NOS)-deficient (iNOS–/–) mice when compared to control mice; similarly, coculture with iNOS–/– splenocytes induces Fas less effectively than coculture with control splenocytes; and finally, the NO donor SNAP induces considerable Fas up-regulation in tumours in vitro. Our model is that host lymphoid cells in response to a tumour increase NO synthesis, which in turn causes enhanced Fas expression in the tumour. PMID:17343612

  16. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  17. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  18. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  19. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  20. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  1. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  2. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  3. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  4. Sialylation of the Fas Death Receptor by ST6Gal-I Provides Protection against Fas-mediated Apoptosis in Colon Carcinoma Cells*

    PubMed Central

    Swindall, Amanda F.; Bellis, Susan L.

    2011-01-01

    The glycosyltransferase, ST6Gal-I, adds sialic acid in an α2–6 linkage to the N-glycans of membrane and secreted glycoproteins. Up-regulation of ST6Gal-I occurs in many cancers, including colon carcinoma, and correlates with metastasis and poor prognosis. However, mechanisms by which ST6Gal-I facilitates tumor progression remain poorly understood due to limited knowledge of enzyme substrates. Herein we identify the death receptor, Fas (CD95), as an ST6Gal-I substrate, and show that α2–6 sialylation of Fas confers protection against Fas-mediated apoptosis. Intriguingly, differences in ST6Gal-I activity do not affect the function of DR4 or DR5 death receptors upon treatment with TRAIL, implicating a selective effect of ST6Gal-I on the Fas receptor. Using ST6Gal-I knockdown and forced overexpression colon carcinoma cell models, we find that α2–6 sialylation of Fas prevents apoptosis stimulated by FasL as well as the Fas-activating antibody, CH11, as evidenced by decreased activation of caspases 8 and 3. We also show that α2–6 sialylation of Fas does not alter the binding of CH11, but rather inhibits the capacity of Fas to induce apoptosis by blocking the association of FADD with Fas cytoplasmic tails, an event that initiates death-inducing signaling complex formation. Furthermore, α2–6 sialylation of Fas inhibits Fas internalization, which is required for apoptotic signaling. Although dysregulated Fas activity is a well known mechanism through which tumors evade apoptosis, the current study is the first to link Fas insensitivity to the actions of a specific sialyltransferase. This finding establishes a new paradigm by which death receptor function is impaired for the self-protection of tumors against apoptosis. PMID:21550977

  5. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  6. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  7. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  8. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  9. Fatty acid biosynthesis in actinomycetes

    PubMed Central

    Gago, Gabriela; Diacovich, Lautaro; Arabolaza, Ana; Tsai, Shiou-Chuan; Gramajo, Hugo

    2011-01-01

    All organisms that produce fatty acids do so via a repeated cycle of reactions. In mammals and other animals, these reactions are catalyzed by a type I fatty acid synthase (FAS), a large multifunctional protein to which the growing chain is covalently attached. In contrast, most bacteria (and plants) contain a type II system in which each reaction is catalyzed by a discrete protein. The pathway of fatty acid biosynthesis in Escherichia coli is well established and has provided a foundation for elucidating the type II FAS pathways in other bacteria (White et al., 2005). However, fatty acid biosynthesis is more diverse in the phylum Actinobacteria: Mycobacterium, possess both FAS systems while Streptomyces species have only the multi-enzyme FAS II system and Corynebacterium species exclusively FAS I. In this review we present an overview of the genome organization, biochemical properties and physiological relevance of the two FAS systems in the three genera of actinomycetes mentioned above. We also address in detail the biochemical and structural properties of the acyl-CoA carboxylases (ACCases) that catalyzes the first committed step of fatty acid synthesis in actinomycetes, and discuss the molecular bases of their substrate specificity and the structure-based identification of new ACCase inhibitors with anti-mycobacterial properties. PMID:21204864

  10. ANTITUMOR ACTIVITY OF HYALURONIC ACID SYNTHESIS INHIBITOR 4-METHYLUMBELLIFERONE IN PROSTATE CANCER CELLS

    PubMed Central

    Lokeshwar, Vinata B.; Lopez, Luis E.; Munoz, Daniel; Chi, Andrew; Shirodkar, Samir P.; Lokeshwar, Soum D.; Escudero, Diogo O.; Dhir, Neetika; Altman, Norman

    2010-01-01

    4-methylumbelliferone (4-MU) is a hyaluronic acid (HA) synthesis inhibitor with anticancer properties; the mechanism of its anticancer effects is unknown. We evaluated the effects of 4-MU on prostate cancer cells. 4-MU inhibited proliferation, motility and invasion of DU145, PC3-ML, LNCaP, C4-2B and/or LAPC-4 cells. At IC50 for HA synthesis (0.4 mM), 4-MU induced > 3-fold apoptosis in prostate cancer cells, which could be prevented by HA addition. 4-MU induced caspase-8, -9 and -3 activation, PARP cleavage, up-regulation of Fas-L, Fas, FADD and DR4 and down regulation of bcl-2, phospho-bad, bcl-XL, phospho-Akt, phospho-IKB, phospho-ErbB2 and phospho-EGFR. At IC50, 4-MU also caused > 90% inhibition of NFkB reporter activity which was prevented partially by HA addition. With the exception of caveolin-1, HA prevented the 4-MU induced down regulation of HA receptors (CD44, RHAMM), matrix-degrading enzymes (MMP-2, MMP-9), IL-8, and chemokine receptors (CXCR1, CXCR4, CXCR7) at protein and mRNA levels. Expression of myristoylated-Akt rescued 4-MU induced apoptosis and inhibition of cell growth and IL-8, RHAMM, HAS2, CD44 and MMP-9 expression. Oral administration of 4-MU significantly decreased PC3-ML tumor growth (> 3-fold), when treatment was started either on the day of tumor cell injection or after the tumors became palpable, without organ toxicity, changes in serum chemistry or body weight. Tumors from 4-MU treated animals showed reduced microvessel density (~ 3-fold) and HA expression but increased TUNEL positive cells and expression of apoptosis-related molecules. Therefore, anticancer effects of 4-MU, an orally bioavailable and relatively non-toxic agent, are primarily mediated by inhibition of HA signaling. PMID:20332231

  11. Mycobacterium tuberculosis proteins involved in mycolic acid synthesis and transport localize dynamically to the old growing pole and septum.

    PubMed

    Carel, Clément; Nukdee, Kanjana; Cantaloube, Sylvain; Bonne, Mélanie; Diagne, Cheikh T; Laval, Françoise; Daffé, Mamadou; Zerbib, Didier

    2014-01-01

    Understanding the mechanism that controls space-time coordination of elongation and division of Mycobacterium tuberculosis (Mtb), the causative agent of tuberculosis (TB), is critical for fighting the tubercle bacillus. Most of the numerous enzymes involved in the synthesis of Mycolic acid - Arabinogalactan-Peptidoglycan complex (MAPc) in the cell wall are essential in vivo. Using a dynamic approach, we localized Mtb enzymes belonging to the fatty acid synthase-II (FAS-II) complexes and involved in mycolic acid (MA) biosynthesis in a mycobacterial model of Mtb: M. smegmatis. Results also showed that the MA transporter MmpL3 was present in the mycobacterial envelope and was specifically and dynamically accumulated at the poles and septa during bacterial growth. This localization was due to its C-terminal domain. Moreover, the FAS-II enzymes were co-localized at the poles and septum with Wag31, the protein responsible for the polar localization of mycobacterial peptidoglycan biosynthesis. The dynamic localization of FAS-II and of the MA transporter with Wag31, at the old-growing poles and at the septum suggests that the main components of the mycomembrane may potentially be synthesized at these precise foci. This finding highlights a major difference between mycobacteria and other rod-shaped bacteria studied to date. Based on the already known polar activities of envelope biosynthesis in mycobacteria, we propose the existence of complex polar machinery devoted to the biogenesis of the entire envelope. As a result, the mycobacterial pole would represent the Achilles' heel of the bacillus at all its growing stages.

  12. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  13. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  14. Influence of virgin coconut oil-enriched diet on the transcriptional regulation of fatty acid synthesis and oxidation in rats - a comparative study.

    PubMed

    Arunima, Sakunthala; Rajamohan, Thankappan

    2014-05-28

    The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.

  15. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  16. Escherichia coli Unsaturated Fatty Acid Synthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.

    2009-01-01

    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA. PMID:19679654

  17. FAS — EDRN Public Portal

    Cancer.gov

    FAS is a member of the TNF-receptor superfamily. The FAS protein is a receptor for TNFSF6/FASLG and has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform.

  18. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  19. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  20. Immunohistochemical study on Fas and Fas ligand in skin wound healing.

    PubMed

    Guan, D W; Ohshima, T; Kondo, T

    2000-02-01

    An immunohistochemical study on the expression of Fas and Fas ligand (Fas L) was performed in order to examine the role of apoptosis through Fas-Fas L in mouse skin wound healing. After a 1-cm-long incision in the central dorsum skin, mice were sacrificed at intervals ranging from 0.5 to 240 h, followed by the sampling of wound margin. The expression of Fas and Fas L in the wound margins and in uninjured skin controls was studied using frozen sections. In uninjured skin controls, a very weak expression of Fas and Fas L was detected immunohistochemically in hair follicles, sebaceous glands and epidermal cells. In wounded specimens, polymorphonuclear cells and inflammatory mononuclear ones (round-shaped and spindle-shaped types) were evident. A single immunostaining showed that Fas or Fas L was detectable in inflammatory mononuclear cells involved in the skin wound healing process. Double immunostaining for Fas and Fas L revealed that inflammatory mononuclear cells co-expressed both antigens. In situ TUNEL combined with immunostaining showed that the inflammatory mononuclear cells expressing Fas or Fas L and the polymorphonuclear cells were TUNEL-stained, although neither Fas nor Fas L was detected in the polymorphonuclear cells. The number of TUNEL-positive, inflammatory mononuclear cells expressing Fas or Fas L per 0.01 x 0.01 cm2 was counted. The average number of 10 randomly selected microscope fields reached a peak at the fibro-proliferative phase of wound healing. These results indicate that apoptosis through Fas and Fas L may play an important role for reducing the cellularity during skin wound healing in mice.

  1. Promoter strength of folic acid synthesis genes affects sulfa drug resistance in Saccharomyces cerevisiae.

    PubMed

    Iliades, Peter; Berglez, Janette; Meshnick, Steven; Macreadie, Ian

    2003-01-01

    The enzyme dihydropteroate synthase (DHPS) is an important target for sulfa drugs in both prokaryotic and eukaryotic microbes. However, the understanding of DHPS function and the action of antifolates in eukaryotes has been limited due to technical difficulties and the complexity of DHPS being a part of a bifunctional or trifunctional protein that comprises the upstream enzymes involved in folic acid synthesis (FAS). Here, yeast strains have been constructed to study the effects of FOL1 expression on growth and sulfa drug resistance. A DHPS knockout yeast strain was complemented by yeast vectors expressing the FOL1 gene under the control of promoters of different strengths. An inverse relationship was observed between the growth rate of the strains and FOL1 expression levels. The use of stronger promoters to drive FOL1 expression led to increased sulfamethoxazole resistance when para-aminobenzoic acid (pABA) levels were elevated. However, high FOL1 expression levels resulted in increased susceptibility to sulfamethoxazole in pABA free media. These data suggest that up-regulation of FOL1 expression can lead to sulfa drug resistance in Saccharomyces cerevisiae.

  2. The FAS Child: A Primer for Teachers.

    ERIC Educational Resources Information Center

    Wentz, Thomas L.; Larson, Julie

    1993-01-01

    This primer on fetal alcohol syndrome (FAS) distinguishes between the syndrome and fetal alcohol effects (FAE), offers a history of FAS, outlines medical criteria for diagnosis, rates of incidence, factors influencing incidence and severity, developmental stages of children with FAS, clinical features, and educational implications and approaches.…

  3. FasParser: a package for manipulating sequence data.

    PubMed

    Sun, Yan-Bo

    2017-03-18

    A computer software package called 'FasParser' was developed for manipulating sequence data. It can be used on personal computers to perform series of analyses, including counting and viewing differences between two sequences at both DNA and codon levels, identifying overlapping regions between two alignments, sorting of sequences according to their IDs or lengths, concatenating sequences of multiple loci for a particular set of samples, translating nucleotide sequences to amino acids, and constructing alignments in several different formats, as well as some extracting and filtrating of data for a particular FASTA file. Majority of these functions can be run in a batch mode, which is very useful for analyzing large data sets. This package can be used by a broad audience, and is designed for researchers that do not have programming experience in sequence analyses. The GUI version of FasParser can be downloaded from https://github.com/Sun-Yanbo/FasParser, free of charge.

  4. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  5. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  6. Improved synthesis and characterization of saturated branched-chain fatty acid isomers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The development of viable technologies for producing green products from renewable fats and oils is highly desirable since such materials can serve as replacements for non-renewable and poorly biodegradable petroleum-based products. Mixtures of saturated branched-chain fatty acid isomers (sbc-FAs),...

  7. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  8. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  9. Alteration of Fas and Fas ligand expression during human visceral leishmaniasis

    PubMed Central

    Eidsmo, L; Wolday, D; Berhe, N; Sabri, F; Satti, I; El Hassan, A M; Sundar, S; Chiodi, F; Akuffo, H

    2002-01-01

    Several studies in murine systems have suggested a role of apoptosis in the pathogenesis of leishmaniasis. However, the role of apoptosis in visceral leishmaniasis in man has not been explored. In this study, we show that patients with visceral leishmaniasis demonstrate significant dysregulation of Fas and Fas ligand. Levels of soluble Fas (sFas) and soluble Fas ligand (sFasL) were elevated in plasma of patients with active visceral leishmaniasis (VL) and individuals co-infected with VL-HIV-1 compared to healthy controls. The levels of sFas and sFasL were normalized 6 months after successful treatment. In VL patients, the expression of membrane bound Fas, and to a lower extent FasL, were up-regulated on Leishmania donovani-infected spleen cells, the site of parasite multiplication. Expression of Fas and FasL on peripheral blood mononuclear cells was within normal range, probably reflecting that the blood is not a normal site of L. donovani infection. Furthermore, this is suggested by the finding that in vitro infection of macrophages with L. donovani up-regulated Fas expression on the surface of infected cells and enhanced the levels of sFasL in supernatants from infected cultures. How this dysregulation may affect the pathogenesis of human visceral leishmaniasis is discussed. PMID:12390320

  10. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  11. Clinicopathological significance of Fas and Fas ligand expressions in esophageal cancer

    PubMed Central

    Wu, Guang-Zhou; Pan, Chun-Xia; Jiang, Dong; Zhang, Qiang; Li, Yin; Zheng, Shi-Ying

    2015-01-01

    Esophageal carcinomas have recently been shown to express Fas ligand (FasL) and down-regulate Fas to escape from host immune surveillance. However, the prognostic importance of Fas/FasL and their correlation with clinicopathological characteristics are yet to be delineated in this highly malignant carcinoma. Specimens from 106 esophageal squamous cell carcinoma patients were used for immuno-histochemical evaluation of Fas, FasL, and CD8 expressions. Fifty-two (49%) and 34 (32%) patients were positive for FasL and Fas, respectively. There were no associations between FasL expression and clinicopathological characteristics except lymph vessel invasion. Strong FasL expression correlated with significant (P < 0.001) decrease in tumor nest CD81 cells. However, neither FasL nor CD81 had any impact on patient survival. Strong Fas expression was correlated with depth of invasion (40.3% in pT1, T2 versus 20.5% in pT3, T4; P5 0.0308), histological differentiation (45.7% in well versus 25.4% in nonwell; P < 0.05), and lymph node metastasis (22.6% in positive versus 45.5% in negative; P < 0.01). Fas expression was one of the independent favorable prognosticators for patients’ survival (risk ratio, 3.26; P < 0.01) in esophageal SCC. Fas expression was an independent prognosticator for recurrencefree survival, whereas FasL expression did not influence the survival in esophageal squamous cell carcinoma. Down-regulation of tumor Fas may be the hallmark of immune privilege for the tumor, thus causing the patients’ poorer outcome. Tumor FasL may counterattack the host immune cells to such an extent that the prognosis is not affected. PMID:26609492

  12. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  13. In vitro reconstitution and steady-state analysis of the fatty acid synthase from Escherichia coli.

    PubMed

    Yu, Xingye; Liu, Tiangang; Zhu, Fayin; Khosla, Chaitan

    2011-11-15

    Microbial fatty acid derivatives are emerging as promising alternatives to fossil fuel derived transportation fuels. Among bacterial fatty acid synthases (FAS), the Escherichia coli FAS is perhaps the most well studied, but little is known about its steady-state kinetic behavior. Here we describe the reconstitution of E. coli FAS using purified protein components and report detailed kinetic analysis of this reconstituted system. When all ketosynthases are present at 1 μM, the maximum rate of free fatty acid synthesis of the FAS exceeded 100 μM/ min. The steady-state turnover frequency was not significantly inhibited at high concentrations of any substrate or cofactor. FAS activity was saturated with respect to most individual protein components when their concentrations exceeded 1 μM. The exceptions were FabI and FabZ, which increased FAS activity up to concentrations of 10 μM; FabH and FabF, which decreased FAS activity at concentrations higher than 1 μM; and holo-ACP and TesA, which gave maximum FAS activity at 30 μM concentrations. Analysis of the S36T mutant of the ACP revealed that the unusual dependence of FAS activity on holo-ACP concentration was due, at least in part, to the acyl-phosphopantetheine moiety. MALDI-TOF mass spectrometry analysis of the reaction mixture further revealed medium and long chain fatty acyl-ACP intermediates as predominant ACP species. We speculate that one or more of such intermediates are key allosteric regulators of FAS turnover. Our findings provide a new basis for assessing the scope and limitations of using E. coli as a biocatalyst for the production of diesel-like fuels.

  14. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  15. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  16. Fas palmitoylation by the palmitoyl acyltransferase DHHC7 regulates Fas stability

    PubMed Central

    Rossin, A; Durivault, J; Chakhtoura-Feghali, T; Lounnas, N; Gagnoux-Palacios, L; Hueber, A-O

    2015-01-01

    The death receptor Fas undergoes a variety of post-translational modifications including S-palmitoylation. This protein acylation has been reported essential for an optimal cell death signaling by allowing both a proper Fas localization in cholesterol and sphingolipid-enriched membrane nanodomains, as well as Fas high-molecular weight complexes. In human, S-palmitoylation is controlled by 23 members of the DHHC family through their palmitoyl acyltransferase activity. In order to better understand the role of this post-translational modification in the regulation of the Fas-mediated apoptosis pathway, we performed a screen that allowed the identification of DHHC7 as a Fas-palmitoylating enzyme. Indeed, modifying DHHC7 expression by specific silencing or overexpression, respectively, reduces or enhances Fas palmitoylation and DHHC7 co-immunoprecipitates with Fas. At a functional level, DHHC7-mediated palmitoylation of Fas allows a proper Fas expression level by preventing its degradation through the lysosomes. Indeed, the decrease of Fas expression obtained upon loss of Fas palmitoylation can be restored by inhibiting the lysosomal degradation pathway. We describe the modification of Fas by palmitoylation as a novel mechanism for the regulation of Fas expression through its ability to circumvent its degradation by lysosomal proteolysis. PMID:25301068

  17. The status of Fas and Fas ligand expression can predict recurrence of hepatocellular carcinoma

    PubMed Central

    Ito, Y; Monden, M; Takeda, T; Eguchi, H; Umeshita, K; Nagano, H; Nakamori, S; Dono, K; Sakon, M; Nakamura, M; Tsujimoto, M; Nakahara, M; Nakao, K; Yokosaki, Y; Matsuura, N

    2000-01-01

    The status of Fas and Fas ligand (Fas L) expression was investigated in this study for 103 hepatocellular carcinomas (HCC). We studied the expression of the following three factors, Fas and Fas L expression in carcinoma cells and Fas L expression in stromal mononuclear cells (defined as stromal Fas L index). Fas expression in HCC cells was significantly decreased in cases with poor differentiation (P< 0.0001) and of larger size (P = 0.0058). Fas L expression in carcinoma cells was observed exclusively in moderately or poorly differentiated cases. Furthermore, each factor had prognostic significance for disease-free survival (DFS) (P< 0.0001, P = 0.0222 and 0.0027 respectively). We then scored the results of each factor and defined the total score as ‘Fas-Fas L risk score’. The P -value of the score for DFS was even lower than that of the clinical stage by multivariate analysis. These results suggest that the evaluation of Fas and Fas ligand expression potentially has a significant prognostic value for DFS of HCC patients, in addition to the clinical stage, and can be regarded as a new prognostic marker. © 2000 Cancer Research Campaign PMID:10735508

  18. Natural fatty acid synthase inhibitors as potent therapeutic agents for cancers: A review.

    PubMed

    Zhang, Jia-Sui; Lei, Jie-Ping; Wei, Guo-Qing; Chen, Hui; Ma, Chao-Ying; Jiang, He-Zhong

    2016-09-01

    Context Fatty acid synthase (FAS) is the only mammalian enzyme to catalyse the synthesis of fatty acid. The expression level of FAS is related to cancer progression, aggressiveness and metastasis. In recent years, research on natural FAS inhibitors with significant bioactivities and low side effects has increasingly become a new trend. Herein, we present recent research progress on natural fatty acid synthase inhibitors as potent therapeutic agents. Objective This paper is a mini overview of the typical natural FAS inhibitors and their possible mechanism of action in the past 10 years (2004-2014). Method The information was collected and compiled through major databases including Web of Science, PubMed, and CNKI. Results Many natural products induce cancer cells apoptosis by inhibiting FAS expression, with fewer side effects than synthetic inhibitors. Conclusion Natural FAS inhibitors are widely distributed in plants (especially in herbs and foods). Some natural products (mainly phenolics) possessing potent biological activities and stable structures are available as lead compounds to synthesise promising FAS inhibitors.

  19. Structure and conformational variability of the mycobacterium tuberculosis fatty acid synthase multienzyme complex.

    PubMed

    Ciccarelli, Luciano; Connell, Sean R; Enderle, Mathias; Mills, Deryck J; Vonck, Janet; Grininger, Martin

    2013-07-02

    Antibiotic therapy in response to Mycobacterium tuberculosis infections targets de novo fatty acid biosynthesis, which is orchestrated by a 1.9 MDa type I fatty acid synthase (FAS). Here, we characterize M. tuberculosis FAS by single-particle cryo-electron microscopy and interpret the data by docking the molecular models of yeast and Mycobacterium smegmatis FAS. Our analysis reveals a porous barrel-like structure of considerable conformational variability that is illustrated by the identification of several conformational states with altered topology in the multienzymatic assembly. This demonstrates that the barrel-like structure of M. tuberculosis FAS is not just a static scaffold for the catalytic domains, but may play an active role in coordinating fatty acid synthesis. The conception of M. tuberculosis FAS as a highly dynamic assembly of domains revises the view on bacterial type I fatty acid synthesis and might inspire new strategies for inhibition of de novo fatty acid synthesis in M. tuberculosis.

  20. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  1. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  2. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  3. Lower ω-6/ω-3 Polyunsaturated Fatty Acid Ratios Decrease Fat Deposition by Inhibiting Fat Synthesis in Gosling

    PubMed Central

    Yu, Lihuai; Wang, Shunan; Ding, Luoyang; Liang, Xianghuan; Wang, Mengzhi; Dong, Li; Wang, Hongrong

    2016-01-01

    The objective of the current study was to investigate the effects of dietary ω-6/ω-3 polyunsaturated fatty acid (PUFA) ratios on lipid metabolism in goslings. One hundred and sixty 21-day-old Yangzhou geese of similar weight were randomly divided into 4 groups. They were fed different PUFA-supplemented diets (the 4 diets had ω-6/ω-3 PUFA ratios of 12:1, 9:1, 6:1, or 3:1). The geese were slaughtered and samples of liver and muscle were collected at day 70. The activities and the gene expression of enzymes involved in lipid metabolism were measured. The results show that the activities of acetyl coenzyme A carboxylase (ACC), malic enzyme (ME), and fatty acid synthase (FAS) were lower (p<0.05), but the activities of hepatic lipase (HL) and lipoprotein lipase (LPL) were higher (p<0.05), in the liver and the muscle from the 3:1 and 6:1 groups compared with those in the 9:1 and 12:1 groups. Expression of the genes for FAS (p<0.01), ME (p<0.01) and ACC (p<0.05) were higher in the muscle of groups fed diets with higher ω-6/ω-3 PUFA ratios. Additionally, in situ hybridization tests showed that the expression intensities of the high density lipoprotein (HDL-R) gene in the 12:1 and 9:1 groups were significantly lower (p<0.01) than that of the 3:1 group in the muscle of goslings. In conclusion, diets containing lower ω-6/ω-3 PUFA ratios (3:1 or 6:1) could decrease fat deposition by inhibiting fat synthesis in goslings. PMID:27189638

  4. Lower ω-6/ω-3 Polyunsaturated Fatty Acid Ratios Decrease Fat Deposition by Inhibiting Fat Synthesis in Gosling.

    PubMed

    Yu, Lihuai; Wang, Shunan; Ding, Luoyang; Liang, Xianghuan; Wang, Mengzhi; Dong, Li; Wang, Hongrong

    2016-10-01

    The objective of the current study was to investigate the effects of dietary ω-6/ω-3 polyunsaturated fatty acid (PUFA) ratios on lipid metabolism in goslings. One hundred and sixty 21-day-old Yangzhou geese of similar weight were randomly divided into 4 groups. They were fed different PUFA-supplemented diets (the 4 diets had ω-6/ω-3 PUFA ratios of 12:1, 9:1, 6:1, or 3:1). The geese were slaughtered and samples of liver and muscle were collected at day 70. The activities and the gene expression of enzymes involved in lipid metabolism were measured. The results show that the activities of acetyl coenzyme A carboxylase (ACC), malic enzyme (ME), and fatty acid synthase (FAS) were lower (p<0.05), but the activities of hepatic lipase (HL) and lipoprotein lipase (LPL) were higher (p<0.05), in the liver and the muscle from the 3:1 and 6:1 groups compared with those in the 9:1 and 12:1 groups. Expression of the genes for FAS (p<0.01), ME (p<0.01) and ACC (p<0.05) were higher in the muscle of groups fed diets with higher ω-6/ω-3 PUFA ratios. Additionally, in situ hybridization tests showed that the expression intensities of the high density lipoprotein (HDL-R) gene in the 12:1 and 9:1 groups were significantly lower (p<0.01) than that of the 3:1 group in the muscle of goslings. In conclusion, diets containing lower ω-6/ω-3 PUFA ratios (3:1 or 6:1) could decrease fat deposition by inhibiting fat synthesis in goslings.

  5. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  6. Influence of fatty acid on lipase-catalyzed synthesis of ascorbyl esters and their free radical scavenging capacity.

    PubMed

    Stojanović, Marija; Carević, Milica; Mihailović, Mladen; Veličković, Dušan; Dimitrijević, Aleksandra; Milosavić, Nenad; Bezbradica, Dejan

    2015-01-01

    Fatty acid (FA) ascorbyl esters are recently emerging food, cosmetic, and pharmaceutical additives, which can be prepared in an eco-friendly way by using lipases as catalysts. Because they are amphiphilic molecules, which possess high free radical scavenging capacity, they can be applied as liposoluble antioxidants as well as emulsifiers and biosurfactants. In this study, the influence of a wide range of acyl donors on ester yield in lipase-catalyzed synthesis and ester antioxidant activity was examined. Among saturated acyl donors, higher yields and antioxidant activities of esters were achieved when short-chain FAs were used. Oleic acid gave the highest yield overall and its ester exhibited a high antioxidant activity. Optimization of experimental factors showed that the highest conversion (60.5%) in acetone was achieved with 5 g L(-1) of lipase, 50 mM of vitamin C, 10-fold molar excess of oleic acid, and 0.7 mL L(-1) of initial water. Obtained results showed that even short- and medium-chain ascorbyl esters could be synthesized with high yields and retained (or even exceeded) free radical scavenging capacity of l-ascorbic acid, indicating prospects of broadening their application in emulsions and liposomes.

  7. Interactions among triphenyltin degradation, phospholipid synthesis and membrane characteristics of Bacillus thuringiensis in the presence of d-malic acid.

    PubMed

    Wang, Linlin; Yi, Wenying; Ye, Jinshao; Qin, Huaming; Long, Yan; Yang, Meng; Li, Qusheng

    2017-02-01

    Degradation pathway and surface biosorption of triphenyltin (TPT) by effective microbes have been investigated in the past. However, unclear interactions among membrane components and TPT binding and transport are still obstacles to understanding TPT biotransformation. To reveal the mechanism involved, the phospholipid expression, membrane potential, cellular mechanism and molecular dynamics between TPT and fatty acids (FAs) during the TPT degradation process in the presence of d-malic acid (DMA) were studied. The results show that the degradation efficiency of 1 mg L(-1) TPT by Bacillus thuringiensis (1 g L(-1)) with 0.5 or 1 mg L(-1) DMA reached values up to approximately 90% due to the promotion of element metabolism and cellular activity, and the depression of FA synthesis induced by DMA. The addition of DMA caused conversion of more linoleic acid into 10-oxo-12(Z)-octadecenoic acid, increased the membrane permeability, and alleviated the decrease in membrane potential, resulting in TPT transport and degradation. Fluorescence analysis reveals that the endospore of B. thuringiensis could act as an indicator for membrane potential and cellular activities. The current findings are advantageous for acceleration of biosorption, transport and removal of pollutants from natural environments.

  8. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  9. Soluble Fas and the −670 Polymorphism of Fas in Lupus Nephritis

    PubMed Central

    Bollain-y-Goytia, Juan José; Arellano-Rodríguez, Mariela; Torres-Del-Muro, Felipe de Jesús; Daza-Benítez, Leonel; Francisco Muñoz-Valle, José; Avalos-Díaz, Esperanza; Herrera-Esparza, Rafael

    2014-01-01

    This study was performed to clarify the role of soluble Fas (sFas) in lupus nephritis (LN) and establish a potential relationship between LN and the −670 polymorphism of Fas in 67 patients with systemic lupus erythematosus (SLE), including a subset of 24 LN patients with proteinuria. Additionally, a group of 54 healthy subjects (HS) was included. The allelic frequency of the −670 polymorphism of Fas was determined using PCR-RFLP analysis, and sFas levels were assessed by ELISA. Additionally, the WT-1 protein level in urine was measured. The Fas receptor was determined in biopsies by immunohistochemistry (IHC) and in situ hybridization (FISH) and apoptotic features by TUNEL. Results. The −670 Fas polymorphism showed that the G allele was associated with increased SLE susceptibility, with an odds ratio (OR) of 1.86. The sFas was significantly higher in LN patients with the G/G genotype, and this subgroup exhibited correlations between the sFas level and proteinuria and increased urinary WT-1 levels. LN group shows increased expression of Fas and apoptotic features. In conclusion, our results indicate that the G allele of the −670 polymorphism of Fas is associated with genetic susceptibility in SLE patients with elevated levels of sFas in LN with proteinuria. PMID:25505993

  10. Fas-FasL expression and myocardial cell apoptosis in patients with viral myocarditis.

    PubMed

    Huang, T F; Wu, X H; Wang, X; Lu, I J

    2016-06-20

    The aim of the current study was to investigate Fas and FasL expression and myocardial cell apoptosis in viral myocarditis patients. Human heart specimens were selected from patients who were autopsied between February 2012 and February 2015; of these, 25 patients were diagnosed with viral myocarditis. Another 15 cases with no diagnosis of myocarditis were selected for the control group. All tissue specimens were divided into two parts, one for reverse transcription-polymerase chain reaction analysis and the other for immunohistochemical and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) analyses. In situ detection of apoptosis was performed by the TUNEL method, which revealed that myocardial cells from the viral myocarditis group exhibited significant apoptosis, whereas no apoptotic cells were observed in the control group. The number of cells staining positive for Fas and FasL protein in the viral myocarditis group was significantly higher than that in the control group (P < 0.05). There was also a correlation between Fas and FasL protein expression levels and scores (r = 0.92, P < 0.05). The mRNA expression of Fas and FasL was significantly higher in the viral myocarditis group than in the control group (P < 0.05). In conclusion, the Fas-FasL system may be involved in the pathogenesis of viral myocarditis. Furthermore, cytotoxic T lymphocytes may mediate cardiac muscle cells apoptosis via Fas-FasL signaling, and thus participate in the pathogenesis of viral myocarditis.

  11. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  12. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  13. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  14. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  15. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  16. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  17. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  18. Autoimmune lymphoproliferative syndrome (ALPS) in a patient with a new germline Fas gene mutation.

    PubMed

    Del-Rey, Manuel J; Manzanares, Javier; Bosque, Alberto; Aguiló, Juan I; Gómez-Rial, José; Roldan, Ernesto; Serrano, Antonio; Anel, Alberto; Paz-Artal, Estela; Allende, Luis M

    2007-01-01

    Autoimmune lymphoproliferative syndrome (ALPS) is a rare genetic disorder characterized by chronic lymphoproliferation, autoimmune manifestations and expansion of TCRalphabeta+CD4-CD8- lymphocytes. The main pathogenic factor is a defective Fas-mediated apoptosis generally caused by mutations in the Fas gene. This report describes a new heterozygous Fas gene mutation in a boy with clinical and immunological features of ALPS. In vitro, T-cell blasts from the patient are completely resistant to the effects on the anti-Fas cytotoxic mAb CH-11, they also have a higher proliferation rate than T cells from healthy donors, while PHA-induced AICD is normal. The location of the mutation (I246S) found in the intracytoplasmic death domain, and the conservation of that residue in four different species from human suggest that I246 is an essential amino acid for Fas function. The patient has inherited the mutation from his father who also shows defective Fas-mediated apoptosis but the clinical and immunological manifestations are much less severe. These results provide evidence that the penetrance of genetic defects in Fas is variable and that other factors may influence the phenotype of the disease.

  19. Posttranslational regulation of Fas ligand function

    PubMed Central

    Voss, Matthias; Lettau, Marcus; Paulsen, Maren; Janssen, Ottmar

    2008-01-01

    The TNF superfamily member Fas ligand acts as a prototypic death factor. Due to its ability to induce apoptosis in Fas (APO-1, CD95) expressing cells, Fas ligand participates in essential effector functions of the immune system. It is involved in natural killer cell- and T cell-mediated cytotoxicity, the establishment of immune privilege, and in termination of immune responses by induction of activation-induced cell death. In addition, Fas ligand-positive tumours may evade immune surveillance by killing Fas-positive tumour-infiltrating cells. Given these strong cytotoxic capabilities of Fas ligand, it is obvious that its function has to be strictly regulated to avoid uncontrolled damage. In hematopoietic cells, the death factor is stored in secretory lysosomes and is mobilised to the immunological synapse only upon activation. The selective sorting to and the release from this specific lysosomal compartment requires interactions of the Fas ligand cytosolic moiety, which mediates binding to various adapter proteins involved in trafficking and cytoskeletal reorganisation. In addition, Fas ligand surface expression is further regulated by posttranslational ectodomain shedding and subsequent regulated intramembrane proteolysis, releasing a soluble ectodomain cytokine into the extracellular space and an N-terminal fragment with a potential role in intracellular signalling processes. Moreover, other posttranslational modifications of the cytosolic domain, including phosphorylation and ubiquitylation, have been described to affect various aspects of Fas ligand biology. Since FasL is regarded as a potential target for immunotherapy, the further characterisation of its biological regulation and function will be of great importance for the development and evaluation of future therapeutic strategies. PMID:19114018

  20. Engagement of Fas on Macrophages Modulates Poly I:C induced cytokine production with specific enhancement of IP-10.

    PubMed

    Lyons, Caitriona; Fernandes, Philana; Fanning, Liam J; Houston, Aileen; Brint, Elizabeth

    2015-01-01

    Viral double-stranded RNA (dsRNA) is recognised by pathogen recognition receptors such as Toll-Like Receptor 3 (TLR3) and retinoic acid inducible gene-I (RIG-I), and results in cytokine and interferon production. Fas, a well characterised death receptor, has recently been shown to play a role in the inflammatory response. In this study we investigated the role of Fas in the anti-viral immune response. Stimulation of Fas on macrophages did not induce significant cytokine production. However, activation of Fas modified the response of macrophages to the viral dsRNA analogue poly I:C. In particular, poly I:C-induced IP-10 production was significantly enhanced. A similar augmentation of IP-10 by Fas was observed following stimulation with both poly A:U and Sendai virus. Fas activation suppressed poly I:C-induced phosphorylation of the MAP kinases p38 and JNK, while overexpression of the Fas adaptor protein, Fas-associated protein with death domain (FADD), activated AP-1 and inhibited poly I:C-induced IP-10 production. Consistent with an inhibitory role for AP-1 in IP-10 production, mutation of the AP-1 binding site on the IP-10 promoter resulted in augmented poly I:C-induced IP-10. These results demonstrate that engagement of the Fas receptor plays a role in modifying the innate immune response to viral RNA.

  1. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  2. Anti-Fas/APO-1 antibody-mediated apoptosis of cultured human glioma cells. Induction and modulation of sensitivity by cytokines.

    PubMed Central

    Weller, M; Frei, K; Groscurth, P; Krammer, P H; Yonekawa, Y; Fontana, A

    1994-01-01

    Fas/APO-1 is a transmembrane protein of the nerve growth factor/TNF alpha receptor family which signals apoptotic cell death in susceptible target cells. We have investigated the susceptibility of seven human malignant glioma cell lines to Fas/APO-1-dependent apoptosis. Sensitivity to Fas/APO-1 antibody-mediated cell killing correlated with cell surface expression of Fas/APO-1. Expression of Fas/APO-1 as well as Fas/APO-1-dependent cytotoxicity were augmented by preexposure of human malignant glioma cells to IFN gamma and TNF alpha. Further, pretreatment with TGF beta 2, IL1 and IL8 enhanced Fas/APO-1 antibody-induced glioma cell apoptosis whereas other cytokines including TNF beta, IL6, macrophage colony-stimulating factor, IL10 and IL13 had no such effect. None of the human malignant glioma cell lines was susceptible to TNF alpha-induced cytotoxicity. Fas/APO-1 antibody-sensitive glioma cell lines (n = 5), but not Fas/APO-1 antibody-resistant glioma cell lines (n = 2), became sensitive to TNF alpha when co-treated with inhibitors of RNA and protein synthesis. Resistance of human glioma cells to Fas/APO-1 antibody-mediated apoptosis was mainly related to low level expression of Fas/APO-1 and appeared not to be linked to overexpression of the anti-apoptotic protooncogene, bcl-2. Given the resistance of human malignant glioma to surgery, irradiation, chemotherapy and immunotherapy, we propose that Fas/APO-1 may be a promising target for a novel locoregionary approach to human malignant glioma. This strategy gains support from the demonstration of Fas/APO-1 expression in ex vivo human malignant glioma specimens and from the absence of Fas/APO-1 in normal human brain parenchyma. Images PMID:7521890

  3. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology

    1999-08-01

    Research. 56: 1189-1193, 1996. 19. Witters, L . and Kemp, B. Insulin activation of acetyl -CoA carboxylase accompanied by inhibition of the 5’-AMP...substrate for FAS, malonyl-CoA acts at the outer mitochondrial membrane to regulate fatty acid oxidation by inhibition of carnitine palmitoyltransferase 1...compared to the xenograft, it has about 10 fold higher levels of acetyl -CoA, and higher levels of other CoA derivatives. These data indicate significant

  4. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  5. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  6. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  7. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  8. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  9. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  10. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  11. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  12. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  13. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  14. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  15. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  16. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  17. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  18. Apoptosis of nur77/N10-transgenic thymocytes involves the Fas/Fas ligand pathway.

    PubMed Central

    Weih, F; Ryseck, R P; Chen, L; Bravo, R

    1996-01-01

    The orphan nuclear receptor Nur77/N10 has recently been demonstrated to be involved in apoptosis of T cell hybridomas. We report here that chronic expression of Nur77/N10 in thymocytes of transgenic mice results in a dramatic reduction of CD4+CD8+ double-positive as well as CD4+CD8- and CD4-CD8+ single-positive cell populations due to an early onset of apoptosis. CD4-CD8- double-negative and CD25+ precursor cells, however, are unaffected. Moreover, nur77/N10-transgenic thymocytes show increased expression of Fas ligand (FasL), while the levels of the Fas receptor (Fas) are not increased. The mouse spontaneous mutant gld (generalized lymphoproliferative disease) carries a point mutation in the extracellular domain of the FasL gene that abolishes the ability of FasL to bind to Fas. Thymuses from nur77/N10-transgenic mice on a gld/gld background have increased cellularity and an almost normal profile of thymocyte subpopulations. Our results demonstrate that one pathway of apoptosis triggered by Nur77/N10 in double-positive thymocytes occurs through the upregulation of FasL expression resulting in increased signaling through Fas. Images Fig. 1 Fig. 2 Fig. 4 PMID:8643610

  19. dFasArt: dynamic neural processing in FasArt model.

    PubMed

    Cano-Izquierdo, Jose-Manuel; Almonacid, Miguel; Pinzolas, Miguel; Ibarrola, Julio

    2009-05-01

    The temporal character of the input is, generally, not taken into account in the neural models. This paper presents an extension of the FasArt model focused on the treatment of temporal signals. FasArt model is proposed as an integration of the characteristic elements of the Fuzzy System Theory in an ART architecture. A duality between the activation concept and membership function is established. FasArt maintains the structure of the Fuzzy ARTMAP architecture, implying a static character since the dynamic response of the input is not considered. The proposed novel model, dynamic FasArt (dFasArt), uses dynamic equations for the processing stages of FasArt: activation, matching and learning. The new formulation of dFasArt includes time as another characteristic of the input. This allows the activation of the units to have a history-dependent character instead of being only a function of the last input value. Therefore, dFasArt model is robust to spurious values and noisy inputs. As experimental work, some cases have been used to check the robustness of dFasArt. A possible application has been proposed for the detection of variations in the system dynamics.

  20. Increased FasL expression correlates with apoptotic changes in granulocytes cultured with oxidized clozapine

    SciTech Connect

    Husain, Zaheed; Almeciga, Ingrid; Delgado, Julio C.; Clavijo, Olga P.; Castro, Januario E.; Belalcazar, Viviana; Pinto, Clara; Zuniga, Joaquin; Romero, Viviana; Yunis, Edmond J. . E-mail: edmond_yunis@dfci.harvard.edu

    2006-08-01

    Clozapine has been associated with a 1% incidence of agranulocytosis. The formation of an oxidized intermediate clozapine metabolite has been implicated in direct polymorphonuclear (PMN) toxicity. We utilized two separate systems to analyze the role of oxidized clozapine in inducing apoptosis in treated cells. Human PMN cells incubated with clozapine (0-10 {mu}M) in the presence of 0.1 mM H{sub 2}O{sub 2} demonstrated a progressive decrease of surface CD16 expression along with increased apoptosis. RT-PCR analysis showed decreased CD16 but increased FasL gene expression in clozapine-treated PMN cells. No change in constitutive Fas expression was observed in treated cells. In HL-60 cells induced to differentiate with retinoic acid (RA), a similar increase in FasL expression, but no associated changes in CD16 gene expression, was observed following clozapine treatments. Our results demonstrate increased FasL gene expression in oxidized clozapine-induced apoptotic neutrophils suggesting that apoptosis in granulocytes treated with clozapine involves Fas/FasL interaction that initiates a cascade of events leading to clozapine-induced agranulocytosis.

  1. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  2. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  3. Fatty acid synthase 2 contributes to diapause preparation in a beetle by regulating lipid accumulation and stress tolerance genes expression

    PubMed Central

    Tan, Qian-Qian; Liu, Wen; Zhu, Fen; Lei, Chao-Liang; Wang, Xiao-Ping

    2017-01-01

    Diapause, also known as dormancy, is a state of arrested development that allows insects to survive unfavorable environmental conditions. Diapause-destined insects store large amounts of fat when preparing for diapause. However, the extent to which these accumulated fat reserves influence diapause remains unclear. To address this question, we investigated the function of fatty acid synthase (FAS), which plays a central role in lipid synthesis, in stress tolerance, the duration of diapause preparation, and whether insects enter diapause or not. In diapause-destined adult female cabbage beetles, Colaphellus bowringi, FAS2 was more highly expressed than FAS1 at the peak stage of diapause preparation. FAS2 knockdown suppressed lipid accumulation and subsequently affected stress tolerance genes expression and water content. However, silencing FAS2 had no significant effects on the duration of diapause preparation or the incidence of diapause. FAS2 transcription was suppressed by juvenile hormone (JH) and the JH receptor methoprene-tolerant (Met). These results suggest that the absence of JH-Met induces FAS2 expression, thereby promoting lipid storage in diapause-destined female beetles. These results demonstrate that fat reserves regulate stress tolerance genes expression and water content, but have no significant effect on the duration of diapause preparation or the incidence of diapause. PMID:28071706

  4. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  5. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  6. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  7. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  8. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  9. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  10. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  11. Nonylphenol induces thymocyte apoptosis through Fas/FasL pathway by mimicking estrogen in vivo.

    PubMed

    Yao, Genhong; Hou, Yayi

    2004-05-01

    Nonylphenol (NP) is the final biodegradation product of nonylphenol polyethoxylates, which are widely used surfactants in domestic and industrial products. Nonylphenol has been reported to have estrogenic activity and shown to have potential reproductive toxicity. However, its influence on immune system function remains unclear. In this study, we investigated the effects of nonylphenol on apoptosis and Fas/FasL gene expression in rat thymus. Nonylphenol were given orally by gavages at 125, 250, and 375mg/kg per day. Negative and positive controls were treated with the vehicle and E(2) 10ng/kg per day, respectively. Atrophy of thymus was determined by in situ morphological examination using hematoxylin and eosin staining. Apoptotic cells were identified by terminal deoxynucleotide transferase-mediated deoxy-UTP nick end labeling (TUNEL) assay. A semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) method was used to analyze Fas and FasL mRNA levels. The results showed that both nonylphenol and E(2) increased the rates of apoptotic death; reduced the expression of Fas; enhanced the expression of FasL. These findings demonstrated that nonylphenol with estrogen-like activity might affect the regulation of the immune function through thymocyte apoptosis. This apoptosis was mediated by altering the expression of Fas and FasL mRNA.

  12. Fas and FasL expression in the spinal cord following cord hemisection in the monkey.

    PubMed

    Jia, Liu; Yu, Zou; Hui, Li; Yu-Guang, Guan; Xin-Fu, Zhou; Chao, You; Yanbin, Xiyang; Xi, Zhan; Jun, Wang; Xin-Hua, Heng; Xin-Hua, Hen; Ting-Hua, Wang

    2011-03-01

    The changes of endogenous Fas/FasL in injured spinal cord, mostly in primates, are not well known. In this study, we investigated the temporal changes in the expression of Fas and FasL and explored their possible roles in the ventral horn of the spinal cord and associated precentral gyrus following T(11) spinal cord hemisection in the adult rhesus monkey. A significant functional improvement was seen with the time going on in monkeys subjected to cord hemisection. Apoptotic cells were also seen in the ventral horn of injured spinal cord with TUNEL staining, and a marked increase presents at 7 days post operation (dpo). Simultaneously, the number of Fas and FasL immunoreactive neurons in the spinal cords caudal and rostral to injury site and their intracellular optical density (OD) in the ipsilateral side of injury site at 7 dpo increased significantly more than that of control group and contralateral sides. This was followed by a decrease and returned to normal level at 60 dpo. No positive neurons were observed in precentral gyrus. The present results may provide some insights to understand the role of Fas/FasL in the spinal cord but not motor cortex with neuronal apoptosis and neuroplasticity in monkeys subjected to hemisection spinal cord injury.

  13. Relationship of Acute Lung Inflammatory Injury to Fas/FasL System

    PubMed Central

    Neff, Thomas A.; Guo, Ren-Feng; Neff, Simona B.; Sarma, J. Vidya; Speyer, Cecilia L.; Gao, Hongwei; Bernacki, Kurt D.; Huber-Lang, Markus; McGuire, Stephanie; Hoesel, L. Marco; Riedemann, Niels C.; Beck-Schimmer, Beatrice; Zetoune, Firas S.; Ward, Peter A.

    2005-01-01

    There is mounting evidence that apoptosis plays a significant role in tissue damage during acute lung injury. To evaluate the role of the apoptosis mediators Fas and FasL in acute lung injury, Fas (lpr)- or FasL (gld)-deficient and wild-type mice were challenged with intrapulmonary deposition of IgG immune complexes. Lung injury parameters (125I-albumin leak, accumulation of myeloperoxidase, and wet lung weights) were measured and found to be consistently reduced in both lpr and gld mice. In wild-type mice, lung injury was associated with a marked increase in Fas protein in lung. Inflamed lungs of wild-type mice showed striking evidence of activated caspase-3, which was much diminished in inflamed lungs from lpr mice. Intratracheal administration of a monoclonal Fas-activating antibody (Jo2) in wild-type mice induced MIP-2 and KC production in bronchoalveolar lavage fluids, and a murine alveolar macrophage cell line (MH-S) showed significantly increased MIP-2 production after incubation with this antibody. Bronchoalveolar lavage fluid content of MIP-2 and KC was substantially reduced in lpr mice after lung injury when compared to levels in wild-type mice. These data suggest that the Fas/FasL system regulates the acute lung inflammatory response by positively affecting CXC-chemokine production, ultimately leading to enhanced neutrophil influx and tissue damage. PMID:15743781

  14. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  15. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  16. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  17. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  18. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  19. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  20. Stem Cell Therapies for Intervertebral Disc Degeneration: Immune Privilege Reinforcement by Fas/FasL Regulating Machinery.

    PubMed

    Ma, Chi-Jiao; Liu, Xu; Che, Lu; Liu, Zhi-Heng; Samartzis, Dino; Wang, Hai-Qiang

    2015-01-01

    As a main contributing factor to low back pain, intervertebral disc degeneration (IDD) is the fundamental basis for various debilitating spinal diseases. The pros and cons of current treatment modalities necessitate biological treatment strategies targeting for reversing or altering the degeneration process in terms of molecules or genes. The advances in stem cell research facilitate the studies aiming for possible clinical application of stem cell therapies for IDD. Human NP cells are versatile with cell morphology full of variety, capable of synthesizing extracellular matrix components, engulfing substances by autophagy and phagocytosis, mitochondrial vacuolization indicating dysfunction, expressing Fas and FasL as significant omens of immune privileged sites. Human discs belong to immune privilege organs with functional FasL expression, which can interact with invasive immune cells by Fas-FasL regulatory machinery. IDD is characterized by decreased expression level of FasL with dysfunctional FasL, which in turn unbalances the interaction between NP cells and immune cells. Certain modulation factors might play a role in the process, such as miR-155. Accumulating evidence indicates that Fas-FasL network expresses in a variety of stem cells. Given the expression of functional FasL and insensitive Fas in stem cells (we term as FasL privilege), transplantation of stem cells into the disc may regenerate the degenerative disc by not only differentiating into NP-like cells, increasing extracellular matrix, but also reinforce immune privilege via interaction with immune cells by Fas-FasL network.

  1. Role of Fas/FasL in regulation of inflammation in vaginal tissue during HSV-2 infection.

    PubMed

    Krzyzowska, M; Shestakov, A; Eriksson, K; Chiodi, F

    2011-03-17

    To assess the role of Fas in lesion development during genital HSV-2 infection, we used a well-established HSV-2 murine model applied to MRL-Fas(lpr)/J (Fas-/-) and C3-Fasl(gld)/J (FasL-/-) C57BL6 mice. In vitro infection of murine keratinocytes and epithelial cells was used to clarify molecular details of HSV-2 infection. Despite upregulation of Fas and FasL, HSV-2-infected keratinocytes and epithelial cells showed a moderate level of apoptosis due to upregulated expression of the anti-apoptotic factors Bcl-2, Akt kinase and NF-κB. Inflammatory lesions within the HSV-2-infected epithelium of C57BL6 mice consisted of infected cells upregulating Fas, FasL and Bcl-2, uninfected cells upregulating Fas and neutrophils expressing both Fas and FasL. Apoptosis was detected in HSV-2-infected cells and to even higher extent in non-infected cells surrounding HSV-2 infection sites. HSV-2 infection of Fas- and FasL-deficient mice led to increased apoptosis and stronger recruitment of neutrophils within the infection sites. We conclude that the Fas pathway participates in regulation of inflammatory response in the vaginal epithelium at the initial stage of HSV-2 infection.

  2. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  3. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  4. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  5. The signaling pathways by which the Fas/FasL system accelerates oocyte aging.

    PubMed

    Zhu, Jiang; Lin, Fei-Hu; Zhang, Jie; Lin, Juan; Li, Hong; Li, You-Wei; Tan, Xiu-Wen; Tan, Jing-He

    2016-02-01

    In spite of great efforts, the mechanisms for postovulatory oocyte aging are not fully understood. Although our previous work showed that the FasL/Fas signaling facilitated oocyte aging, the intra-oocyte signaling pathways are unknown. Furthermore, the mechanisms by which oxidative stress facilitates oocyte aging and the causal relationship between Ca2+ rises and caspase-3 activation and between the cell cycle and apoptosis during oocyte aging need detailed investigations. Our aim was to address these issues by studying the intra-oocyte signaling pathways for Fas/FasL to accelerate oocyte aging. The results indicated that sFasL released by cumulus cells activated Fas on the oocyte by increasing reactive oxygen species via activating NADPH oxidase. The activated Fas triggered Ca2+ release from the endoplasmic reticulum by activating phospholipase C-γ pathway and cytochrome c pathway. The cytoplasmic Ca2+ rises activated calcium/calmodulin-dependent protein kinase II (CaMKII) and caspase-3. While activated CaMKII increased oocyte susceptibility to activation by inactivating maturation-promoting factor (MPF) through cyclin B degradation, the activated caspase-3 facilitated further Ca2+releasing that activates more caspase-3 leading to oocyte fragmentation. Furthermore, caspase-3 activation and fragmentation were prevented in oocytes with a high MPF activity, suggesting that an oocyte must be in interphase to undergo apoptosis.

  6. Targeting the Fas/FasL system in Rheumatoid Arthritis therapy: Promising or risky?

    PubMed

    Calmon-Hamaty, Flavia; Audo, Rachel; Combe, Bernard; Morel, Jacques; Hahne, Michael

    2015-10-01

    Rheumatoid Arthritis (RA) is a chronic inflammatory disease affecting synovial joints. Tumor necrosis factor (TNF) α is a key component of RA pathogenesis and blocking this cytokine is the most common strategy to treat the disease. Though TNFα blockers are very efficient, one third of the RA patients are unresponsive or present side effects. Therefore, the development of novel therapeutic approaches is required. RA pathogenesis is characterized by the hyperplasia of the synovium, closely associated to the pseudo-tumoral expansion of fibroblast-like synoviocytes (FLS), which invade and destroy the joint structure. Hence, depletion of RA FLS has been proposed as an alternative therapeutic strategy. The TNF family member Fas ligand (FasL) was reported to trigger apoptosis in FLS of arthritic joints by binding to its receptor Fas and therefore suggested as a promising candidate for targeting the hyperplastic synovial tissue. However, this cytokine is pleiotropic and recent data from the literature indicate that Fas activation might have a disease-promoting role in RA by promoting cell proliferation. Therefore, a FasL-based therapy for RA requires careful evaluation before being applied. In this review we aim to overview what is known about the apoptotic and non-apoptotic effects of Fas/FasL system and discuss its relevance in RA.

  7. In vivo analysis of Fas/FasL interactions in HIV-infected patients.

    PubMed Central

    Badley, A D; Dockrell, D H; Algeciras, A; Ziesmer, S; Landay, A; Lederman, M M; Connick, E; Kessler, H; Kuritzkes, D; Lynch, D H; Roche, P; Yagita, H; Paya, C V

    1998-01-01

    Recent insights into the pharmacological control of HIV replication and the molecular mechanisms of peripheral T cells homeostasis allowed us to investigate in vivo the mechanisms mediating T cell depletion in HIV-infected patients. Before the initiation of highly active antiretroviral therapy (HAART), a high degree of lymphoid tissue apoptosis is present, which is reduced upon HAART initiation (P < 0.001) and directly correlates with reduction of viral load and increases of peripheral T lymphocytes (P < 0.01). Because Fas/FasL interactions play a key role in peripheral T lymphocyte homeostasis, we investigated the susceptibility to Fas-mediated apoptosis in peripheral T lymphocytes and of FasL expression in lymphoid tissue before and during HAART. High levels of Fas-susceptibility found in peripheral CD4 T lymphocytes before HAART were significantly reduced after HAART, coinciding with decreases in viral load (P = 0.018) and increases in peripheral CD4 T lymphocyte counts (P < 0.01). However, the increased FasL expression in the lymphoid tissue of HIV-infected individuals was not reduced after HAART. These results demonstrate that lymphoid tissue apoptosis directly correlates with viral load and peripheral T lymphocyte numbers, and suggest that HIV-induced susceptibility to Fas-dependent apoptosis may play a key role in the regulation of T cell homeostasis in HIV-infected individuals. PMID:9649560

  8. Fas/Fas ligand interactions promote activation-induced cell death of NK T lymphocytes.

    PubMed

    Leite-de-Moraes, M C; Herbelin, A; Gouarin, C; Koezuka, Y; Schneider, E; Dy, M

    2000-10-15

    NKT cells are a versatile population whose immunoregulatory functions are modulated by their microenvironment. We demonstrate herein that in addition to their IFN-gamma production, NKT lymphocytes stimulated with IL-12 plus IL-18 in vitro underwent activation in terms of CD69 expression, blast transformation, and proliferation. Yet they were unable to survive in culture because, once activated, they were rapidly eliminated by apoptosis, even in the presence of their survival factor IL-7. This process was preceded by up-regulation of Fas (CD95) and Fas ligand expression in response to IL-12 plus IL-18 and was blocked by zVAD, a large spectrum caspase inhibitor, as well as by anti-Fas ligand mAb, suggesting the involvement of the Fas pathway. In accordance with this idea, NKT cells from Fas-deficient C57BL/6-lpr/lpr mice did not die in these conditions, although they shared the same features of cell activation as their wild-type counterpart. Activation-induced cell death occurred also after TCR engagement in vivo, since NKT cells became apoptotic after injection of their cognate ligand, alpha-galactosylceramide, in wild-type, but not in Fas-deficient, mice. Taken together, our data provide the first evidence for a new Fas-dependent mechanism allowing the elimination of TCR-dependent or -independent activated NKT cells, which are potentially dangerous to the organism.

  9. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    SciTech Connect

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.

    2013-11-15

    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease.

  10. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  11. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology

    2000-08-01

    Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer PRINCIPAL INVESTIGATOR: Francis P. Kuhajda, M.D. CONTRACTING ORGANIZATION...SUBTITLE 5. FUNDING NUMBERS Xenograft Studies of Fatty Acid Synthesis DAMD17-96-1-6235 Inhibition as Novel Therapy for Breast Cancer 6. AUTHOR(S...5012. 13. ABSTRACT (Maximum 200 Words) This grant proposed to study the effect of fatty acid synthesis inhibition in human breast cancer xenografts

  12. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  13. Inhibitory effects of onion (Allium cepa L.) extract on proliferation of cancer cells and adipocytes via inhibiting fatty acid synthase.

    PubMed

    Wang, Yi; Tian, Wei-Xi; Ma, Xiao-Feng

    2012-01-01

    Onions (Allium cepa L.) are widely used in the food industry for its nutritional and aromatic properties. Our studies showed that ethyl acetate extract of onion (EEO) had potent inhibitory effects on animal fatty acid synthase (FAS), and could induce apoptosis in FAS over-expressing human breast cancer MDA-MB-231 cells. Furthermore, this apoptosis was accompanied by reduction of intracellular FAS activity and could be rescued by 25 mM or 50 mM exogenous palmitic acids, the final product of FAS catalyzed synthesis. These results suggest that the apoptosis induced by EEO occurs via inhibition of FAS. We also found that EEO could suppress lipid accumulation during the differentiation of 3T3-L1 adipocytes, which was also related to its inhibition of intracellular FAS activity. Since obesity is closely related to breast cancer and obese patients are at elevated risk of developing various cancers, these findings suggested that onion might be useful for preventing obesity-related malignancy.

  14. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  15. A lack of Fas/FasL signalling leads to disturbances in the antiviral response during ectromelia virus infection.

    PubMed

    Bień, K; Sobańska, Z; Sokołowska, J; Bąska, P; Nowak, Z; Winnicka, A; Krzyzowska, M

    2016-04-01

    Ectromelia virus (ECTV) is an orthopoxvirus (OPV) that causes mousepox, the murine equivalent of human smallpox. Fas receptor-Fas ligand (FasL) signaling is involved in apoptosis of immune cells and virus-specific cytotoxicity. The Fas/FasL pathway also plays an important role in controlling the local inflammatory response during ECTV infection. Here, the immune response to the ECTV Moscow strain was examined in Fas (-) (lpr), FasL (-) (gld) and C57BL6 wild-type mice. During ECTV-MOS infection, Fas- and FasL mice showed increased viral titers, decreased total numbers of NK cells, CD4(+) and CD8(+) T cells followed by decreased percentages of IFN-γ expressing NK cells, CD4(+) and CD8(+) T cells in spleens and lymph nodes. At day 7 of ECTV-MOS infection, Fas- and FasL-deficient mice had the highest regulatory T cell (Treg) counts in spleen and lymph nodes in contrast to wild-type mice. Furthermore, at days 7 and 10 of the infection, we observed significantly higher numbers of PD-L1-expressing dendritic cells in Fas (-) and FasL (-) mice in comparison to wild-type mice. Experiments in co-cultures of CD4(+) T cells and bone-marrow-derived dendritic cells showed that the lack of bilateral Fas-FasL signalling led to expansion of Tregs. In conclusion, our results demonstrate that during ECTV infection, Fas/FasL can regulate development of tolerogenic DCs and Tregs, leading to an ineffective immune response.

  16. Immune privilege and FasL: two ways to inactivate effector cytotoxic T lymphocytes by FasL-expressing cells

    PubMed Central

    Li, Jie-Hui; Rosen, Dalia; Sondel, Paul; Berke, Gideon

    2002-01-01

    The theory that Fas ligand (FasL)-expressing tumours are immune-privileged and can directly counterattack Fas-expressing effector T lymphocytes has recently been questioned and several alternative mechanisms have been proposed. To address this controversial issue, we analysed the impact of FasL-expressing tumours on in vivo-primed cytotoxic T lymphocytes (CTLs) and the mechanisms involved. CTLs were obtained from the peritoneal cavity (PEL) after in vivo priming with syngeneic or allogeneic murine tumour cells. We have found that PEL populations undergo Fas-based apoptotic cell death when co-cultured with FasL-expressing tumour cells and that PEL destruction of cognate targets in a 51Cr-release assay was markedly inhibited by the pre-exposure to either cognate or non-cognate tumour cells expressing FasL. Furthermore, cytocidal function of PEL was markedly inhibited by preincubation with FasL-negative tumour cells, if and only if they were the cognate targets of the CTL; this CTL inhibition involved FasL–Fas interactions. The killing function of ‘bystander’ PELs, reactive to a third-party target cell, was inhibited by co-cultivation with PELs mixed with their cognate target. This activation-induced CTL fratricide was not influenced by the expression of FasL on the cognate target cells. These studies demonstrate the existence of two distinct pathways whereby FasL-expressing cells inhibit in vivo-primed FasL- and Fas-expressing CTLs: first, by FasL-based direct tumour counterattack, and second, by FasL-mediated activation-induced cell death of the CTLs, which is consistent with the concept that FasL expression in vivo could play a role in inducing immune privilege. PMID:11918688

  17. Two Adjacent Trimeric Fas Ligands Are Required for Fas Signaling and Formation of a Death-Inducing Signaling Complex

    PubMed Central

    Holler, Nils; Tardivel, Aubry; Kovacsovics-Bankowski, Magdalena; Hertig, Sylvie; Gaide, Olivier; Martinon, Fabio; Tinel, Antoine; Deperthes, David; Calderara, Silvio; Schulthess, Therese; Engel, Jürgen; Schneider, Pascal; Tschopp, Jürg

    2003-01-01

    The membrane-bound form of Fas ligand (FasL) signals apoptosis in target cells through engagement of the death receptor Fas, whereas the proteolytically processed, soluble form of FasL does not induce cell death. However, soluble FasL can be rendered active upon cross-linking. Since the minimal extent of oligomerization of FasL that exerts cytotoxicity is unknown, we engineered hexameric proteins containing two trimers of FasL within the same molecule. This was achieved by fusing FasL to the Fc portion of immunoglobulin G1 or to the collagen domain of ACRP30/adiponectin. Trimeric FasL and hexameric FasL both bound to Fas, but only the hexameric forms were highly cytotoxic and competent to signal apoptosis via formation of a death-inducing signaling complex. Three sequential early events in Fas-mediated apoptosis could be dissected, namely, receptor binding, receptor activation, and recruitment of intracellular signaling molecules, each of which occurred independently of the subsequent one. These results demonstrate that the limited oligomerization of FasL, and most likely of some other tumor necrosis factor family ligands such as CD40L, is required for triggering of the signaling pathways. PMID:12556501

  18. The Contribution of the Fas/FasL Apoptotic Pathway in Ulcer Formation during Leishmania major-Induced Cutaneous Leishmaniasis

    PubMed Central

    Eidsmo, Liv; Nylen, Susanne; Khamesipour, Ali; Hedblad, Mari-Anne; Chiodi, Francesca; Akuffo, Hannah

    2005-01-01

    Cutaneous leishmaniasis (CL), caused by the intracellular protozoan Leishmania major, is characterized by lesion formation and ulceration at the site of infection. The mechanism of ulcer formation during CL is not fully understood. The expression of Fas and FasL and the levels of apoptosis in skin biopsies and in restimulated blood mononuclear cells from patients with 1 to 7 months of L. major-induced CL were analyzed using immunohistochemistry and fluorescence-activated cell sorting analysis. The levels of soluble Fas and FasL were also analyzed by enzyme-linked immunosorbent assay. A substantial number of apoptotic keratinocytes were observed mainly in the superficial epidermis of morphologically active and healing CL skin samples. Fas expression was increased on epidermis in active CL, whereas Fas expression was similar in healing and healthy epidermis. FasL-expressing macrophages and T cells were found in subepidermal infiltrate, mainly in active disease. When CL peripheral blood mononuclear cells were restimulated with L. major, Fas was up-regulated on effector T cells, and high levels of sFasL were secreted. Supernatants from restimulated cultures induced apoptosis in human keratinocytes (HaCaT), possibly through Fas/FasL interactions. Our results indicate that FasL-expressing effector T cells and macrophages may act to induce apoptosis and ulcer formation in Fas-expressing keratinocytes during L. major infection. PMID:15793290

  19. Intracellular Fas ligand in normal and malignant breast epithelium does not induce apoptosis in Fas-sensitive cells

    PubMed Central

    Ragnarsson, G B; Mikaelsdottir, E K; Vidarsson, H; Jónasson, J G; Ólafsdóttir, K; Kristjánsdóttir, K; Kjartansson, J; Ögmundsdóttir, H M; Rafnar, T

    2000-01-01

    Fas ligand (FasL) is expressed on some cancers and may play a role in the immune evasion of the tumour. We used immuno-histochemistry to study the expression of Fas and FasL in tissue samples from breast cancer patients, as well as normal breast tissue. Our results show that Fas and FasL are co-expressed both in normal tissue and in breast tumours. Fas and FasL mRNA were expressed in fresh normal and malignant breast tissue, as well as cultured breast epithelium and breast cancer cell lines. Flow cytometry analysis of live cells failed to detect FasL on the surface of normal or malignant breast cells; however, both stained positive for FasL after permeabilization. Fas was detected on the surface of normal breast cells and T47D and MCF-10A cell lines but only intracellularly in other breast cell lines tested. Neither normal breast epithelium nor breast cell lines induced Fas-dependent apoptosis in Jurkat cells. Finally, 20 tumour samples were stained for apoptosis. Few apoptotic cells were detected and there was no increase in apoptotic cells on the borders between tumour cells and lymphocytes. We conclude that FasL is expressed intracellularly in both normal and malignant breast epithelium and unlikely to be important for the immune evasion of breast tumours. © 2000 Cancer Research Campaign http://www.bjcancer.com PMID:11104571

  20. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  1. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  2. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  3. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  4. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  5. A new version of the HBSC Family Affluence Scale - FAS III: Scottish Qualitative Findings from the International FAS Development Study.

    PubMed

    Hartley, Jane E K; Levin, Kate; Currie, Candace

    A critical review of the Family Affluence Scale (FAS) concluded that FAS II was no longer discriminatory within very rich or very poor countries, where a very high or a very low proportion of children were categorised as high FAS or low FAS respectively (Currie et al. 2008). The review concluded that a new version of FAS - FAS III - should be developed to take into account current trends in family consumption patterns across the European region, the US and Canada. In 2012, the FAS Development and Validation Study was conducted in eight countries - Denmark, Greenland, Italy, Norway, Poland, Romania, Slovakia and Scotland. This paper describes the Scottish qualitative findings from this study. The Scottish qualitative fieldwork comprising cognitive interviews and focus groups sampled from 11, 13 and 15 year-old participants from 18 of the most- and least- economically deprived schools. These qualitative results were used to inform the final FAS III recommendations.

  6. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  7. Synthesis and crystal structures of HgFAsF6, Hg(HF)2(AsF6)2, Hg(HF)(AsF6)2 and Hg(AsF6)(SO3F)

    NASA Astrophysics Data System (ADS)

    Mazej, Zoran; Goreshnik, Evgeny A.

    2015-08-01

    The colourless HgFAsF6 was synthesized by oxidation of Hg2(AsF6)2 with elemental fluorine in anhydrous hydrogen fluoride. It crystallizes in the monoclinic space group P21/c with a=7.0645(3) Å, b=9.9023(3) Å, c=7.8686(3) Å, β=102.960(4)° V=536.43(3) Å3, and Z=4 at 150 K. The structure of HgFAsF6 consists of infinite zig-zag -[Hg-F-Hg]- chains oriented parallel to each other along the b axis and interconected by AsF6 groups. Hg(HF)2(AsF6)2 crystallizes in the triclinic space group P 1 bar with a=5.0781(3) Å, b=6.6907(5) Å, c=7.7135(5) Å, α=84.045(5), β=79.277(5)°, γ=80.612(6), V=253.32(3) Å3, and Z=1 at 150 K. The crystal structure is composed of infinite columns of Hg atoms linked by AsF6 groups. Each pair of adjacent Hg atoms is bridged by two AsF6 groups. The coordination of Hg is completed by two F atoms provided by HF molecules. Hg(HF)(AsF6)2 crystallizes in the monoclinic space group P21/c with a=9.4921(8) Å, b=9.2834(6) Å, c=10.5448(7) Å, β=103.795(7)°, V=902.53(12) Å3, and Z=4 at 150 K and it is isotypic to Cd(HF)(AsF6)2. The new mixed-anion compound Hg(AsF6)(SO3F) crystallizes in the monoclinic space group P21/c with a=5.1975(8) Å, b=18.046(3) Å, c=15.873(5) Å, β=93.614(13)°, V=1485.9(6) Å3, and Z=4 at 200 K. All three oxygen atoms from each SO3F group utilize for bonding with three Hg atoms. The Hg1 (Hg2) atoms are coordinated by two (four) oxygen atoms from two (four) SO3F groups and by six (three) fluorine atoms from AsF6 groups forming on that way tridimensional framework.

  8. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  9. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  10. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  11. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  12. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  13. Role of Fas/FasL in regulation of inflammation in vaginal tissue during HSV-2 infection

    PubMed Central

    Krzyzowska, M; Shestakov, A; Eriksson, K; Chiodi, F

    2011-01-01

    To assess the role of Fas in lesion development during genital HSV-2 infection, we used a well-established HSV-2 murine model applied to MRL-Faslpr/J (Fas−/−) and C3-Faslgld/J (FasL−/−) C57BL6 mice. In vitro infection of murine keratinocytes and epithelial cells was used to clarify molecular details of HSV-2 infection. Despite upregulation of Fas and FasL, HSV-2-infected keratinocytes and epithelial cells showed a moderate level of apoptosis due to upregulated expression of the anti-apoptotic factors Bcl-2, Akt kinase and NF-κB. Inflammatory lesions within the HSV-2-infected epithelium of C57BL6 mice consisted of infected cells upregulating Fas, FasL and Bcl-2, uninfected cells upregulating Fas and neutrophils expressing both Fas and FasL. Apoptosis was detected in HSV-2-infected cells and to even higher extent in non-infected cells surrounding HSV-2 infection sites. HSV-2 infection of Fas- and FasL-deficient mice led to increased apoptosis and stronger recruitment of neutrophils within the infection sites. We conclude that the Fas pathway participates in regulation of inflammatory response in the vaginal epithelium at the initial stage of HSV-2 infection. PMID:21412278

  14. Contributions of Fas-Fas Ligand Interactions to the Pathogenesis of Mouse Hepatitis Virus in the Central Nervous System

    PubMed Central

    Parra, Beatriz; Lin, Mark T.; Stohlman, Stephen A.; Bergmann, Cornelia C.; Atkinson, Roscoe; Hinton, David R.

    2000-01-01

    The pathogenesis of the neurotropic strain of mouse hepatitis virus in Fas-deficient mice suggested that Fas-mediated cytotoxicity may be required during viral clearance after the loss of perforin-mediated cytotoxicity. The absence of both Fas- and perforin-mediated cytolysis resulted in an uncontrolled infection, suggesting a redundancy of cytolytic pathways to control virus replication. PMID:10666278

  15. GABA tea prevents cardiac fibrosis by attenuating TNF-alpha and Fas/FasL-mediated apoptosis in streptozotocin-induced diabetic rats.

    PubMed

    Cherng, Shur-Hueih; Huang, Chih-Yang; Kuo, Wei-Wen; Lai, Shue-Er; Tseng, Chien-Yu; Lin, Yueh-Min; Tsai, Fuu-Jen; Wang, Hsueh-Fang

    2014-03-01

    GABA tea is a tea product that contains a high level of gamma-aminobutyric acid (GABA). This study investigated the effects of GABA tea on the heart in a diabetic rat model. Male Wistar rats were injected with 55mg/kg streptozotocin (STZ) to induce diabetes for 2weeks and then orally given dosages of 4.55 and 45.5mg/kg/day GABA tea extract for 6weeks. The results revealed that fasting blood glucose levels returned to normal levels in GABA tea-treated diabetic rats, but not in the untreated diabetic rats. Additionally, GABA tea effectively inhibited cardiac fibrosis induced by STZ. Further experiments showed that the STZ-induced protein levels of tumor necrosis factor-alpha (TNF-alpha), Fas, activated caspase-8 and caspase-3 were significantly inhibited by the GABA tea treatment. Therefore, our data suggest that the inhibiting effect of GABA tea on STZ-induced cardiac fibrosis in diabetic rats may be mediated by reducing blood glucose and further attenuating TNF-alpha expression and/or Fas/Fas ligand (FasL)-mediated apoptosis. These findings will provide implications for the potential anti-diabetic properties of GABA tea.

  16. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  17. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  18. Roles of proinflammatory cytokines and the Fas/Fas ligand interaction in the pathogenesis of inflammatory myopathies.

    PubMed

    Kondo, Masahiro; Murakawa, Yohko; Harashima, Nanae; Kobayashi, Shotai; Yamaguchi, Shuhei; Harada, Mamoru

    2009-09-01

    Within the lesions of inflammatory myopathies, muscle fibres and invading mononuclear cells express Fas and Fas ligand (FasL), respectively. However, the roles of the Fas/FasL interaction in the pathogenesis of inflammatory myopathies are not fully understood. In the present study, we investigated the roles of proinflammatory cytokines and the Fas/FasL system in the pathogenesis of inflammatory myopathies. In vitro culturing of muscle cells with the proinflammatory cytokines interferon-gamma, tumour necrosis factor-alpha, and interleukin (IL)-1beta synergistically increased Fas expression, susceptibility to Fas-mediated apoptosis, and the expression of cytoplasmic caspases 8 and 3. In addition, culturing of muscle cells with activated CD4(+) T cells induced muscle cell apoptosis, which was partially inhibited by anti-FasL antibody. We also tested the possibility that T helper (Th) 17, which is an IL-17-producing helper T-cell subset that plays crucial roles in autoimmune and inflammatory responses, participates in the pathogenesis of inflammatory myopathies. Interestingly, in vitro culturing of dendritic cells with anti-Fas immunoglobulin M (IgM) or activated CD4(+) T cells induced the expression of mRNA for IL-23p19, but not for IL-12p35, in addition to proinflammatory cytokines. Furthermore, IL-23p19 and IL-17 mRNAs were detected in the majority of biopsy samples from patients with inflammatory myopathies. Taken together, these results suggest that proinflammatory cytokines enhance Fas-mediated apoptosis of muscle cells, and that the Fas/FasL interaction between invading dendritic cells and CD4(+) T cells induces local production of IL-23 and proinflammatory cytokines, which can promote the proliferation of Th17 cells and enhance Fas-mediated apoptosis of muscle cells, respectively.

  19. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  20. A Fas(hi) Lymphoproliferative Phenotype Reveals Non-Apoptotic Fas Signaling in HTLV-1-Associated Neuroinflammation.

    PubMed

    Menezes, Soraya Maria; Leal, Fabio E; Dierckx, Tim; Khouri, Ricardo; Decanine, Daniele; Silva-Santos, Gilvaneia; Schnitman, Saul V; Kruschewsky, Ramon; López, Giovanni; Alvarez, Carolina; Talledo, Michael; Gotuzzo, Eduardo; Nixon, Douglas F; Vercauteren, Jurgen; Brassat, David; Liblau, Roland; Vandamme, Anne Mieke; Galvão-Castro, Bernardo; Van Weyenbergh, Johan

    2017-01-01

    Human T-cell lymphotropic virus (HTLV)-1 was the first human retrovirus to be associated to cancer, namely adult T-cell leukemia (ATL), but its pathogenesis remains enigmatic, since only a minority of infected individuals develops either ATL or the neuroinflammatory disorder HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). A functional FAS -670 polymorphism in an interferon (IFN)-regulated STAT1-binding site has been associated to both ATL and HAM/TSP susceptibility. Fas(hi) T stem cell memory (Tscm) cells have been identified as the hierarchical apex of ATL, but have not been investigated in HAM/TSP. In addition, both FAS and STAT1 have been identified in an IFN-inducible HAM/TSP gene signature, but its pathobiological significance remains unclear. We comprehensively explored Fas expression (protein/mRNA) and function in lymphocyte activation, apoptosis, proliferation, and transcriptome, in PBMC from a total of 47 HAM/TSP patients, 40 asymptomatic HTLV-1-infected individuals (AC), and 58 HTLV-1 -uninfected healthy controls. Fas surface expression followed a two-step increase from HC to AC and from AC to HAM/TSP. In HAM/TSP, Fas levels correlated positively to lymphocyte activation markers, but negatively to age of onset, linking Fas(hi) cells to earlier, more aggressive disease. Surprisingly, increased lymphocyte Fas expression in HAM/TSP was linked to decreased apoptosis and increased lymphoproliferation upon in vitro culture, but not to proviral load. This Fas(hi) phenotype is HAM/TSP-specific, since both ex vivo and in vitro Fas expression was increased as compared to multiple sclerosis (MS), another neuroinflammatory disorder. To elucidate the molecular mechanism underlying non-apoptotic Fas signaling in HAM/TSP, we combined transcriptome analysis with functional assays, i.e., blocking vs. triggering Fas receptor in vitro with antagonist and agonist-, anti-Fas mAb, respectively. Treatment with agonist anti-Fas mAb restored apoptosis

  1. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  2. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  3. Construction of a cyanobacterium synthesizing cyclopropane fatty acids.

    PubMed

    Machida, Shuntaro; Shiraiwa, Yoshihiro; Suzuki, Iwane

    2016-09-01

    Microalgae have received much attention as a next-generation source of biomass energy. However, most of the fatty acids (FAs) from microalgae are multiply unsaturated; thus, the biofuels derived from them are fluid, but vulnerable to oxidation. In this study, we attempted to synthesize cyclopropane FAs in the cyanobacterium Synechocystis sp. PCC 6803 by expressing the cfa gene for cyclopropane FA synthase from Escherichia coli with the aim of producing FAs that are fluid and stable in response to oxidization. We successfully synthesized cyclopropane FAs in Synechocystis with a yield of ~30% of total FAs. Growth of the transformants was altered, particularly at low temperatures, but photosynthesis and respiration were not significantly affected. C16:1(∆9) synthesis in the desA(-)/desD(-) strain by expression of the desC2 gene for sn-2 specific ∆9 desaturase positively affected growth at low temperatures via promotion of various cellular processes, with the exceptions of photosynthesis and respiration. Estimation of the apparent activities of desaturases suggested that some acyl-lipid desaturases might recognize the lipid side chain.

  4. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  5. Involvement of Fas and FasL in Ectromelia virus-induced apoptosis in mouse brain.

    PubMed

    Krzyzowska, Małgorzata; Cymerys, Joanna; Winnicka, Anna; Niemiałtowski, Marek

    2006-02-01

    In this study we showed that the virulent Moscow strain of Ectromelia virus (ECTV-MOS) infection leads to induction of apoptosis in the BALB/c mouse central nervous system. ECTV-MOS-infected cells and inflammation sites were found in brain parenchyma between 5 and 15 days after footpad infection with ECTV-MOS. Infected cells consisted of microglia and monocytes, astrocytes and oligodendrocytes and these type of cells underwent apoptosis within 5-15 days post infection (d.p.i.). The highest number of apoptotic cells was found at 5 and 10 d.p.i. and represented mainly microglia (61.4% and 38.6% of apoptotic cells, respectively) and astrocytes (21% and 8.9%, respectively). The number of apoptotic oligodendrocytes was 5.4% and 4.5%, respectively. Fluorometric assays demonstrated involvement of caspase-1, -3 and -8 but not caspase-9 in apoptosis in ECTV-MOS-infected mouse brains. Expression of Fas/FasL was significantly increased on ECTV-MOS-infected cells between 5 and 15 d.p.i., whereas Fas was up-regulated also on the surrounding, non-infected cells. Taking together we may conclude that ECTV-MOS infection of microglia and astrocytes leads to local inflammation resulting in Fas/FasL up-regulation and apoptosis, which limits mouse central nervous system infection with ECTV-MOS.

  6. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  7. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.

    PubMed

    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus

    2014-10-13

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  8. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.

    PubMed

    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G

    1998-06-01

    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  9. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  10. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  11. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei

    2011-01-01

    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  12. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng

    2009-07-01

    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  13. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.

    1966-01-01

    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  14. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  15. Adoptive Transfer of Dendritic Cells Expressing Fas Ligand Modulates Intestinal Inflammation in a Model of Inflammatory Bowel Disease

    PubMed Central

    de Jesus, Edelmarie Rivera; Isidro, Raymond A; Cruz, Myrella L; Marty, Harry; Appleyard, Caroline B

    2016-01-01

    Background Inflammatory bowel diseases (IBD) are chronic relapsing inflammatory conditions of unknown cause and likely result from the loss of immunological tolerance, which leads to over-activation of the gut immune system. Gut macrophages and dendritic cells (DCs) are essential for maintaining tolerance, but can also contribute to the inflammatory response in conditions such as IBD. Current therapies for IBD are limited by high costs and unwanted toxicities and side effects. The possibility of reducing intestinal inflammation with DCs genetically engineered to over-express the apoptosis-inducing FasL (FasL-DCs) has not yet been explored. Objective Investigate the immunomodulatory effect of administering FasL-DCs in the rat trinitrobenzene sulfonic acid (TNBS) model of acute colitis. Methods Expression of FasL on DCs isolated from the mesenteric lymph nodes (MLNs) of normal and TNBS-colitis rats was determined by flow cytometry. Primary rat bone marrow DCs were transfected with rat FasL plasmid (FasL-DCs) or empty vector (EV-DCs). The effect of these DCs on T cell IFNγ secretion and apoptosis was determined by ELISPOT and flow cytometry for Annexin V, respectively. Rats received FasL-DCs or EV-DCs intraperitoneally 96 and 48 hours prior to colitis induction with TNBS. Colonic T cell and neutrophil infiltration was determined by immunohistochemistry for CD3 and myeloperoxidase activity assay, respectively. Macrophage number and phenotype was measured by double immunofluorescence for CD68 and inducible Nitric Oxide Synthase. Results MLN dendritic cells from normal rats expressed more FasL than those from colitic rats. Compared to EV-DCs, FasL-DCs reduced T cell IFNγ secretion and increased T cell apoptosis in vitro. Adoptive transfer of FasL-DCs decreased macroscopic and microscopic damage scores and reduced colonic T cells, neutrophils, and proinflammatory macrophages when compared to EV-DC adoptive transfer. Conclusion FasL-DCs are effective at treating colonic

  16. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  17. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  18. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.

    PubMed

    Suć, Josipa; Jerić, Ivanka

    2015-01-01

    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  19. Fas transduces dual apoptotic and trophic signals in hematopoietic progenitors.

    PubMed

    Pearl-Yafe, Michal; Stein, Jerry; Yolcu, Esma S; Farkas, Daniel L; Shirwan, Haval; Yaniv, Isaac; Askenasy, Nadir

    2007-12-01

    Stem cells and progenitors are often required to realize their differentiation potential in hostile microenvironments. The Fas/Fas ligand (FasL) interaction is a major effector pathway of apoptosis, which negatively regulates the expansion of differentiated hematopoietic cells. The involvement of this molecular interaction in the function of hematopoietic stem and progenitor cells is not well understood. In the murine syngeneic transplant setting, both Fas and FasL are acutely upregulated in bone marrow-homed donor cells; however, the Fas(+) cells are largely insensitive to FasL-induced apoptosis. In heterogeneous populations of lineage-negative (lin(-)) bone marrow cells and progenitors isolated by counterflow centrifugal elutriation, trimerization of the Fas receptor enhanced the clonogenic activity. Inhibition of caspases 3 and 8 did not affect the trophic signals mediated by Fas, yet it efficiently blocked the apoptotic pathways. Fas-mediated tropism appears to be of physiological significance, as pre-exposure of donor cells to FasL improved the radioprotective qualities of hematopoietic progenitors, resulting in superior survival of myeloablated hosts. Under these conditions, the activity of long-term reconstituting cells was not affected, as determined in sequential secondary and tertiary transplants. Dual caspase-independent tropic and caspase-dependent apoptotic signaling place the Fas receptor at an important junction of activation and death. This regulatory mechanism of hematopoietic homeostasis activates progenitors to promote the recovery from aplasia and converts into a negative regulator in distal stages of cell differentiation. Disclosure of potential conflicts of interest is found at the end of this article.

  20. A convenient synthesis of anthranilic acids by Pd-catalyzed direct intermolecular ortho-C-H amidation of benzoic acids.

    PubMed

    Ng, Ka-Ho; Ng, Fo-Ning; Yu, Wing-Yiu

    2012-12-11

    An efficient method for synthesis of anthranilic acids by Pd-catalyzed ortho-C-H amidation of benzoic acids is disclosed. The amidation is proposed to proceed by carboxylate-assisted ortho-C-H palladation to form an arylpalladium(II) complex, followed by nitrene insertion to the Pd-C bond.

  1. ORAL AND INTRAVENOUSLY ADMINISTERED AMINO ACIDS PRODUCE SIMILAR EFFECTS ON MUSCLE PROTEIN SYNTHESIS IN THE ELDERLY

    PubMed Central

    Rasmussen, B.B.; Wolfe, R.R.; Volpi, E.

    2011-01-01

    BACKGROUND Muscle protein synthesis is stimulated in the elderly when amino acid availability is increased. OBJECTIVE To determine which mode of delivery of amino acids (intravenous vs. oral ingestion) is more effective in stimulating the rate of muscle protein synthesis in elderly subjects. DESIGN Fourteen elderly subjects were assigned to one of two groups. Following insertion of femoral arterial and venous catheters, subjects were infused with a primed, continuous infusion of L-[ring-2H5] phenylalanine. Blood samples and muscle biopsies were obtained to measure muscle protein fractional synthesis rate (FSR) with the precursor-product model, phenylalanine kinetics across the leg with the three-pool model, and whole body phenylalanine kinetics. Protein metabolism parameters were measured in the basal period, and during the administration of oral amino acids (n=8) or a similar amount of intravenous amino acids (n=6). RESULTS Enteral and parenteral amino acid administration increased amino acid arterial concentrations and delivery to the leg to a similar extent in both groups. Muscle protein synthesis as measured by both FSR, and the three-pool model, increased during amino acid administration (P < 0.05 vs. basal) in both groups with no differences between groups. Whole body proteolysis did not change with the oral amino acids whereas it increased slightly during parenteral amino acid administration. CONCLUSIONS Increased amino acid availability stimulates the rate of muscle protein synthesis independent of the route of administration (enteral vs. parenteral). PMID:12459885

  2. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  3. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

    PubMed

    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

    2017-03-01

    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins.

  4. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.

    PubMed

    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes

    2014-05-01

    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  5. Pseudomonas aeruginosa Directly Shunts β-Oxidation Degradation Intermediates into De Novo Fatty Acid Biosynthesis

    PubMed Central

    Yuan, Yanqiu; Leeds, Jennifer A.

    2012-01-01

    We identified the fatty acid synthesis (FAS) initiation enzyme in Pseudomonas aeruginosa as FabY, a β-ketoacyl synthase KASI/II domain-containing enzyme that condenses acetyl coenzyme A (acetyl-CoA) with malonyl-acyl carrier protein (ACP) to make the FAS primer β-acetoacetyl-ACP in the accompanying article (Y. Yuan, M. Sachdeva, J. A. Leeds, and T. C. Meredith, J. Bacteriol. 194:5171-5184, 2012). Herein, we show that growth defects stemming from deletion of fabY can be suppressed by supplementation of the growth media with exogenous decanoate fatty acid, suggesting a compensatory mechanism. Fatty acids eight carbons or longer rescue growth by generating acyl coenzyme A (acyl-CoA) thioester β-oxidation degradation intermediates that are shunted into FAS downstream of FabY. Using a set of perdeuterated fatty acid feeding experiments, we show that the open reading frame PA3286 in P. aeruginosa PAO1 intercepts C8-CoA by condensation with malonyl-ACP to make the FAS intermediate β-keto decanoyl-ACP. This key intermediate can then be extended to supply all of the cellular fatty acid needs, including both unsaturated and saturated fatty acids, along with the 3-hydroxyl fatty acid acyl groups of lipopolysaccharide. Heterologous PA3286 expression in Escherichia coli likewise established the fatty acid shunt, and characterization of recombinant β-keto acyl synthase enzyme activity confirmed in vitro substrate specificity for medium-chain-length acyl CoA thioester acceptors. The potential for the PA3286 shunt in P. aeruginosa to curtail the efficacy of inhibitors targeting FabY, an enzyme required for FAS initiation in the absence of exogenous fatty acids, is discussed. PMID:22753057

  6. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  7. Synthesis and cytotoxic activity of new betulin and betulinic acid esters with conjugated linoleic acid (CLA).

    PubMed

    Tubek, Barbara; Mituła, Paweł; Niezgoda, Natalia; Kempińska, Katarzyna; Wietrzyk, Joanna; Wawrzeńczyk, Czesław

    2013-04-01

    The synthesis of new ester derivatives of betulin (3a-c) and betulinic acid (4) with conjugated linoleic acid isomers (CLA; in a mixture of 43.4% 9c, 11t; 49.5% 10t, 12c; 7.1% other isomers) is presented. Esterification was carried out with N,N'-dicyclohexylcarbodiimide (DCC) as the coupling agent in the presence of 4-dimethylamino-pyridine (DMAP) in dichloromethane (or pyridine). The in vitro cytotoxic effect of betulin (1), betulinic acid (2), a mixture of CLA isomers and their derivatives (3a-c, 4) was examined using the MTT assay against four cancer cell lines (P388, CEM/C2, CCRF/CEM and HL-60) and the SRB assay on the HT-29 cell line. Ester 4 was the most active among the esters synthesized against the CEM/C2 cell line with an ID50 value 16.9 +/- 6.5 microg/mL. Betulin (1), betulinic acid (2) and CLA were the most active agents against the cancer cell lines studied.

  8. Lymphocytes with Aberrant Expression of Fas or Fas-ligand Attenuate Immune Bone Marrow Failure in a Mouse Model

    PubMed Central

    Omokaro, Stephanie O.; Desierto, Marie J.; Eckhaus, Michael A.; Ellison, Felicia M.; Chen, Jichun; Young, Neal S.

    2012-01-01

    Bone marrow (BM) and lymphocyte samples from aplastic anemia patients show up-regulated Fas and Fas-ligand (FasL) expression respectively, supporting a relationship between immune-mediated BM destruction and the Fas apoptotic pathway. Mice with spontaneous lymphoproliferation (lpr) and generalized lymphoproliferative disease (gld) mutations exhibit abnormal expression of Fas and FasL; serving as potential models to elucidate underlying mechanisms of BM failure. We examined cellular and functional characteristics of lpr and gld mutants on the C57BL/6 (B6) background. Lymph node (LN) cells from lpr and gld mice produced less apoptosis when co-incubated with C.B10-H2b/LilMcd (C.B10) BM cells in vitro. This functional difference was confirmed by infusing lpr, gld, and B6 LN cells into sub-lethally irradiated CB10 mice; all donor LN cells showed significant T cell expansion and activation but only B6 LN cells caused severe BM destruction. Mice infused with gld LN cells developed mild to moderate BM failure, despite receiving FasL-deficient effectors, thus suggesting the existence of alternative pathways or incomplete penetrance of the mutation. Paradoxically, mice that received Fas-deficient lpr LN cells also had reduced BM failure, likely due to down-regulation of pro-apoptotic genes, an effect that can be overcome by higher doses of lpr LN cells. Our model demonstrates that abnormal Fas or FasL expression interferes with the development of pancytopenia and marrow hypoplasia, validating a major role for the Fas/FasL cytotoxic pathway in immune-mediated BM failure, although disruption of this pathway does not completely abolish marrow destruction. PMID:19265119

  9. Lymphocytes with aberrant expression of Fas or Fas ligand attenuate immune bone marrow failure in a mouse model.

    PubMed

    Omokaro, Stephanie O; Desierto, Marie J; Eckhaus, Michael A; Ellison, Felicia M; Chen, Jichun; Young, Neal S

    2009-03-15

    Bone marrow (BM) and lymphocyte samples from aplastic anemia patients show up-regulated Fas and Fas-ligand (FasL) expression, respectively, supporting a relationship between immune-mediated BM destruction and the Fas apoptotic pathway. Mice with spontaneous lymphoproliferation (lpr) and generalized lymphoproliferative disease (gld) mutations exhibit abnormal expression of Fas and FasL, serving as potential models to elucidate underlying mechanisms of BM failure. We examined cellular and functional characteristics of lpr and gld mutants on the C57BL/6 (B6) background. Lymph node (LN) cells from lpr and gld mice produced less apoptosis when coincubated with C.B10-H2(b)/LilMcd (C.B10) BM cells in vitro. This functional difference was confirmed by infusing lpr, gld, and B6 LN cells into sublethally irradiated CB10 mice. All donor LN cells showed significant T cell expansion and activation, but only B6 LN cells caused severe BM destruction. Mice infused with gld LN cells developed mild to moderate BM failure despite receiving FasL-deficient effectors, thus suggesting the existence of alternative pathways or incomplete penetrance of the mutation. Paradoxically, mice that received Fas-deficient lpr LN cells also had reduced BM failure, likely due to down-regulation of proapoptotic genes, an effect that can be overcome by higher doses of lpr LN cells. Our model demonstrates that abnormal Fas or FasL expression interferes with the development of pancytopenia and marrow hypoplasia, validating a major role for the Fas/FasL cytotoxic pathway in immune-mediated BM failure, although disruption of this pathway does not completely abolish marrow destruction.

  10. Cysteine proteinases Fas1 and Fas2 are diagnostic markers for Fasciola hepatica infection in alpacas (Lama pacos).

    PubMed

    Neyra, Victor; Chavarry, Elizabeth; Espinoza, Jose R

    2002-04-19

    Circulating antibody against Fasciola hepatica antigens was determined by enzyme-linked immunosorbent assay (ELISA) and immunoelectrophoresis in alpacas naturally exposed to F. hepatica. Serological assay parameters were established by using sera from eight infected animals and seven controls with no record of this parasitic infection. Excretory--secretory (ES-) products, Fas1- and Fas2-ELISA were used to survey 307 alpacas from a F. hepatica endemic area in the Peruvian Andes. Seroprevalence of F. hepatica infection varied from 56.7, 64.8 and 66.8% measured by Fas1-, Fas2- and ES-ELISA, respectively. The sensitivity for ES-ELISA was 95%, corresponding Fas1- and Fas2-ELISA sensitivity values were 90 and 95%. In this population, 7% of animals were positive for F. hepatica eggs in faeces, other parasites detected were Trichuris sp. (40%), Nematodirus sp. (34.6%), Lamanema sp. (12.8%) and Eimeria sp. (11.8%). The results show that F. hepatica infected animals elicit circulating antibodies against ES, Fas1 and Fas2. Fas2-ELISA may be proposed as a sensitive assay for the immunodiagnosis of fasciolosis in alpacas.

  11. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  12. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  13. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  14. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  15. Synthesis of unnatural amino acids from serine derivatives by beta-fragmentation of primary alkoxyl radicals.

    PubMed

    Boto, Alicia; Gallardo, Juan A; Hernández, Dacil; Hernández, Rosendo

    2007-09-14

    The fragmentation of primary alkoxyl radicals has been scarcely used in synthesis since other competing processes (such as oxidation or hydrogen abstraction) usually predominate. However, when serine derivatives were used as substrates, the scission took place in excellent yields. Tandem scission-allylation, -alkylation, or -arylation reactions were subsequently developed. This one-pot methodology was applied to the synthesis of unnatural amino acids, which are useful synthetic blocks or amino acid surrogates in peptidomimetics.

  16. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

    PubMed

    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

    2012-05-18

    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  17. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  18. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement.

  19. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  20. Evolution of abscisic acid synthesis and signaling mechanisms.

    PubMed

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I

    2011-05-10

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  1. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  2. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  3. A Potential of sFasL in Preventing Gland Injury in Sjogren's Syndrome

    PubMed Central

    Wang, Ying; Yu, Bing

    2017-01-01

    Fas and its ligand FasL, members of tumor necrosis factor receptor superfamily, have been implicated in the process of cell apoptosis. FasL consists of two forms, membrane FasL (mFasL) and soluble FasL (sFasL). sFasL can be produced by mFasL cleaved by matrix metalloproteinases (MMP) and also reveals a role for binding to Fas which is expressed on cell surface. Although Fas/FasL axis has been implicated in a variety of diseases, its role in Sjogren's syndrome still remains ill defined. In this study, we investigated the potential of sFasL in the pathogenesis of Sjogren's syndrome (SS). We found that the serum levels of sFasL in SS patients were significantly lower than healthy subjects. Moreover, serum levels of sFasL in patients with mild disease activity were higher than patients with severe disease activity. There is a positive correlation of the serum level of sFasL with uptake index of parotid gland in our expectation. In addition, liver injury involvement in SS patients showed decreased level of sFasL. Furthermore, we here also observed that the protective cytokine IL-10 expression was positively correlated with sFasL expression. Thus, our results here suggest a potential of sFasL in maintaining gland organ homeostasis. PMID:28326325

  4. Cooperative Brønsted Acid-Type Organocatalysis for the Stereoselective Synthesis of Deoxyglycosides

    PubMed Central

    2016-01-01

    A practical approach for the α-stereoselective synthesis of deoxyglycosides using cooperative Brønsted acid-type organocatalysis has been developed. The method is tolerant of a wide range of glycoside donors and acceptors, and its versatility is exemplified in the one-pot synthesis of a trisaccharide. Mechanistic studies suggest that thiourea-induced acid amplification of the chiral acid via H-bonding is key for the enhancement in reaction rate and yield, while stereocontrol is dependent on the chirality of the acid. PMID:28004941

  5. Exogenous amino acids stimulate net muscle protein synthesis in the elderly.

    PubMed Central

    Volpi, E; Ferrando, A A; Yeckel, C W; Tipton, K D; Wolfe, R R

    1998-01-01

    We have investigated the response of amino acid transport and protein synthesis in healthy elderly individuals (age 71+/-2 yr) to the stimulatory effect of increased amino acid availability. Muscle protein synthesis and breakdown, and amino acid transport were measured in the postabsorptive state and during the intravenous infusion of an amino acid mixture. Muscle-free amino acid kinetics were calculated by means of a three compartment model using data obtained by femoral arterio-venous catheterization and muscle biopsies from the vastus lateralis during the infusion of stable isotope tracers of amino acids. In addition, muscle protein fractional synthetic rate (FSR) was measured. Peripheral amino acid infusion significantly increased amino acid delivery to the leg, amino acid transport, and muscle protein synthesis when measured either with the three compartment model (P < 0.05) or with the traditional precursor-product approach (FSR increased from 0. 0474+/-0.0054 to 0.0940+/-0.0143%/h, P < 0.05). Because protein breakdown did not change during amino acid infusion, a positive net balance of amino acids across the muscle was achieved. We conclude that, although muscle mass is decreased in the elderly, muscle protein anabolism can nonetheless be stimulated by increased amino acid availability. We thus hypothesize that muscle mass could be better maintained with an increased intake of protein or amino acids. PMID:9576765

  6. The inhibitory effect of glycolic acid and lactic acid on melanin synthesis in melanoma cells.

    PubMed

    Usuki, Akiko; Ohashi, Akiko; Sato, Hirofumi; Ochiai, Yasunobu; Ichihashi, Masamitsu; Funasaka, Yoko

    2003-01-01

    Alpha-hydroxy acids (AHAs) such as glycolic acid (GA) and lactic acid (LA) have been reported to be effective in treating pigmentary lesions such as melasma, solar lentigines, and postinflammatory hyperpigmentation. The mechanism of this effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion. However, the direct effect of AHAs on melanin synthesis has not yet been well studied. To elucidate such a direct effect of AHAs on melanogenesis, we performed melanin assays, growth curve determinations, Northern and Western blotting for melanogenic proteins [tyrosinase, tyrosinase related protein (TRP)-1 and TRP-2], and tyrosinase and, 4-dihydroxyphenylalaninechrome tautomerase enzyme activity assays using mouse B16 and human melanoma cells. GA or LA (at doses of 300 or 500 microg/ml) inhibited melanin formation in similar dose-dependent manner, without affecting cell growth. Although the mRNA and protein expression or molecular size of tyrosinase, TRP-1 and TRP-2 were not affected, tyrosinase activity was inhibited. To see whether GA and/or LA directly inhibit tyrosinase catalytic function, the effect of GA and LA on human tyrosinase purified from the melanosome-rich large granule fraction of human melanoma cells was performed. GA or LA were shown to inhibit tyrosinase enzyme activity directly, but this effect was not due to the acidity of GA or LA, because adjusting the pH to 5.6 (the pH of GA and LA at concentrations of 2500 microg/ml), did not affect tyrosinase activity. Taken together, these results show that GA and LA suppress melanin formation by directly inhibiting tyrosinase activity, an effect independent of their acidic nature. GA and LA might work on pigmentary lesions not only by accelerating the turnover of the epidermis but also by directly inhibiting melanin formation in melanocytes.

  7. Ursodeoxycholyl Lysophosphatidylethanolamide Protects Against CD95/Fas-Induced Fulminant Hepatitis.

    PubMed

    Utaipan, Tanyarath; Otto, Ann-Christin; Gan-Schreier, Hongying; Chunglok, Warangkana; Pathil, Anita; Stremmel, Wolfgang; Chamulitrat, Walee

    2017-01-04

    Increased activation of CD95/Fas by Fas ligand in viral hepatitis and autoimmunity is involved in pathogenesis of fulminant hepatitis and liver failure. We designed a bile-acid phospholipid conjugate ursodeoxycholyl lysophosphatidylethanolamide (UDCA-LPE with LPE containing oleate at the sn-1) as a hepatoprotectant that was shown to protect against fulminant hepatitis induced by endotoxin. We herein further assessed the ability of UDCA-LPE to prevent death receptor CD95/Fas-induced fulminant hepatitis. C57BL/6 mice were intravenously administered with CD95/Fas agonistic monoclonal antibody (Jo-2) with or without 1 h pretreatment with 50 mg/kg UDCA-LPE. Jo-2 administration caused massive hepatocyte damage as seen by histology, and this was associated with a significant decrease in hepatic phosphatidylcholine (PC), lysoPC, and lysophosphatidylethanolamine levels. By histology, UDCA-LPE pretreatment improved hepatocyte damage and restored the loss of these phospholipids in part by a mechanism involving an inhibition of cytosolic phospholipaseA2 expression. Accordingly, Jo-2 treatment increased hepatic expression of cleaved caspase 8, caspase 3, and poly (ADP-Ribose) polymerase-1, and on the other hand decreased that of anti-apoptotic cellular FLICE-inhibitory protein. UDCA-LPE pretreatment was able to reverse all these changes. Moreover, UDCA-LPE attenuated inflammatory response by lowering the levels of Jo-2-induced proinflammatory cytokines TNF-α, IL-6, and IL-1β in liver and serum. UDCA-LPE was also able to decrease the levels of stimulated Th1/Th17 cytokines in Jo-2-primed isolated splenocytes. Taken together, UDCA-LPE exhibited potent anti-inflammatory effects against CD95/Fas-induced fulminant hepatitis.

  8. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  9. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  10. Eicosanoid synthesis in cardiomyocytes: influence of hypoxia, reoxygenation, and polyunsaturated fatty acids.

    PubMed

    Oudot, F; Grynberg, A; Sergiel, J P

    1995-01-01

    The synthesis of eicosanoids was investigated in cultured rat ventricular myocytes. Under normoxia, the cardiomyocytes released 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha) and prostaglandin (PG) E2 and smaller amounts of PGF2 alpha and thromboxane B2. Hypoxia enhanced the production of PGE2 and PGF2 alpha, whereas the synthesis of 6-keto-PGF1 alpha was not affected. Conversely, posthypoxic reoxygenation greatly increased the synthesis of 6-keto-PGF1 alpha, whereas the synthesis of PGF2 alpha, was not affected and that of PGE2 was reduced. The cardiomyocyte polyunsaturated fatty acid (PUFA) profile was altered by arachidonic acid or eicosapentaenoic acid and docosahexaenoic acid. Under normoxia, the eicosanoid production appeared to be roughly related to the cell phospholipid arachidonic acid content. Conversely, during posthypoxic reoxygenation, the production of eicosanoids was related to the cell phospholipid n-3 PUFA content, with the n-3-rich cells displaying a marked inhibition of the synthesis. This inhibition was mainly attributed to eicosapentaenoic acid and/or docosapentaenoic acid. Whether this inhibition occurs in vivo during postischemic reperfusion, it may contribute to the beneficial effect of n-3 PUFA on the heart.

  11. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis

    PubMed Central

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a “GRAS” (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  12. The control of ribonucleic acid synthesis in bacteria. The synthesis and stability of ribonucleic acids in relaxed and stringent amino acid auxotrophs of Escherichia coli.

    PubMed

    Gray, W J; Midgley, J E

    1972-08-01

    The biosynthesis and stability of various RNA fractions was studied in RC(str) and RC(rel) multiple amino acid auxotrophs of Escherichia coli. In conditions of amino acid deprivation, RC(str) mutants were labelled with exogenous nucleotide bases at less than 1% of the rate found in cultures growing normally in supplemented media. Studies by DNA-RNA hybridization and by other methods showed that, during a period of amino acid withdrawal, not more than 60-70% of the labelled RNA formed in RC(str) mutants had the characteristics of mRNA. Evidence was obtained for some degradation of newly formed 16S and 23S rRNA species to heterogeneous material of lower molecular weight. This led to overestimations of the mRNA content of rapidly labelled RNA from such methods as simple examination of sucrose-density-gradient profiles. In RC(rel) strains the absolute and relative rates of synthesis of the various RNA fractions were not greatly affected. However, the stability of about half of the mRNA fraction was increased in RC(rel) strains during amino acid starvation, giving kinetics of mRNA labelling and turnover that were identical with those found in either RC(str) or RC(rel) strains inhibited by high concentrations of chloramphenicol. Coincidence hybridization techniques showed that the mRNA content of amino acid-starved RC(str) auxotrophs was unchanged from that found in normally growing cells. In contrast, RC(rel) strains deprived of amino acids increased their mRNA content about threefold. In such cultures the mRNA content of accumulating newly formed RNA was a constant 16% by wt.

  13. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  14. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-06-28

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise.

  15. Loss of Fas apoptosis inhibitory molecule leads to spontaneous obesity and hepatosteatosis

    PubMed Central

    Huo, J; Ma, Y; Liu, J-J; Ho, Y S; Liu, S; Soh, L Y; Chen, S; Xu, S; Han, W; Hong, A; Lim, S C; Lam, K-P

    2016-01-01

    Altered hepatic lipogenesis is associated with metabolic diseases such as obesity and hepatosteatosis. Insulin resistance and compensatory hyperinsulinaemia are key drivers of these metabolic imbalances. Fas apoptosis inhibitory molecule (FAIM), a ubiquitously expressed antiapoptotic protein, functions as a mediator of Akt signalling. Since Akt acts at a nodal point in insulin signalling, we hypothesize that FAIM may be involved in energy metabolism. In the current study, C57BL/6 wild-type (WT) and FAIM-knockout (FAIM-KO) male mice were fed with normal chow diet and body weight changes were monitored. Energy expenditure, substrate utilization and physical activities were analysed using a metabolic cage. Liver, pancreas and adipose tissue were subjected to histological examination. Serum glucose and insulin levels and lipid profiles were determined by biochemical assays. Changes in components of the insulin signalling pathway in FAIM-KO mice were examined by immunoblots. We found that FAIM-KO mice developed spontaneous non-hyperphagic obesity accompanied by hepatosteatosis, adipocyte hypertrophy, dyslipidaemia, hyperglycaemia and hyperinsulinaemia. In FAIM-KO liver, lipogenesis was elevated as indicated by increased fatty acid synthesis and SREBP-1 and SREBP-2 activation. Notably, protein expression of insulin receptor beta was markedly reduced in insulin target organs of FAIM-KO mice. Akt phosphorylation was also lower in FAIM-KO liver and adipose tissue as compared with WT controls. In addition, phosphorylation of insulin receptor substrate-1 and Akt2 in response to insulin treatment in isolated FAIM-KO hepatocytes was also markedly attenuated. Altogether, our data indicate that FAIM is a novel regulator of insulin signalling and plays an essential role in energy homoeostasis. These findings may shed light on the pathogenesis of obesity and hepatosteatosis. PMID:26866272

  16. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  17. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  18. Palmitoylation of human FasL modulates its cell death-inducing function

    PubMed Central

    Guardiola-Serrano, F; Rossin, A; Cahuzac, N; Lückerath, K; Melzer, I; Mailfert, S; Marguet, D; Zörnig, M; Hueber, A-O

    2010-01-01

    Fas ligand (FasL) is a transmembrane protein that regulates cell death in Fas-bearing cells. FasL-mediated cell death is essential for immune system homeostasis and the elimination of viral or transformed cells. Because of its potent cytotoxic activity, FasL expression at the cell surface is tightly regulated, for example, via processing by ADAM10 and SPPL2a generating soluble FasL and the intracellular fragments APL (ADAM10-processed FasL form) and SPA (SPPL2a-processed APL). In this study, we report that FasL processing by ADAM10 counteracts Fas-mediated cell death and is strictly regulated by membrane localization, interactions and modifications of FasL. According to our observations, FasL processing occurs preferentially within cholesterol and sphingolipid-rich nanodomains (rafts) where efficient Fas–FasL contact occurs, Fas receptor and FasL interaction is also required for efficient FasL processing, and FasL palmitoylation, which occurs within its transmembrane domain, is critical for efficient FasL-mediated killing and FasL processing. PMID:21368861

  19. Biosynthesis of very long chain fatty acids in Trypanosoma cruzi.

    PubMed

    Livore, Verónica I; Uttaro, Antonio D

    2015-01-01

    Trypanosoma brucei and Trypanosoma cruzi showed similar fatty acid (FA) compositions, having a high proportion of unsaturated FAs, mainly 18:2Δ9,12 (23-39%) and 18:1Δ9 (11-17%). C22 polyunsaturated FAs are in significant amounts only in T. brucei (12-20%) but represent a mere 2% of total FAs in T. cruzi. Both species have also similar profiles of medium- and long-chain saturated FAs, from 14:0 to 20:0. Interestingly, procyclic and bloodstream forms of T. brucei lack very long chain FAs (VLCFAs), whereas epimastigotes and trypomastigotes of T. cruzi contain 22:0 (0.1-0.2%), 24:0 (1.5-2%), and 26:0 (0.1-0.2%). This is in agreement with the presence of an additional FA elongase gene (TcELO4) in T. cruzi. TcELO4 was expressed in a Saccharomyces cerevisiae mutant lacking the endogenous ScELO3, rescuing the synthesis of saturated and hydroxylated C26 FAs in the yeast. Expression of TcELO4 also rescued the synthetic lethality of a ScELO2, ScELO3 double mutation, and the VLCFA profile of the transformed yeast was similar to that found in T. cruzi. By identifying TcELO4 as the enzyme responsible for the elongation of FA from 16:0 and 18:0 up to 26:0, with 24:0 being the preferred product, this work completed the characterization of FA elongases in Trypanosoma spp.

  20. Expression of ADAM10, Fas, FasL and Soluble FasL in Patients with Oral Squamous Cell Carcinoma (OSCC) and their Association with Clinical-Pathological Parameters.

    PubMed

    Zepeda-Nuño, José Sergio; Guerrero-Velázquez, Celia; Del Toro-Arreola, Susana; Vega-Magaña, Natali; Ángeles-Sánchez, Julián; Haramati, Jesse; Pereira-Suárez, Ana L; Bueno-Topete, Miriam R

    2017-04-01

    ADAM10 has been implicated in the progression of various solid tumors. ADAM10 regulates the cleavage of the FasL ectodomain from the plasma membrane of different cell types, generating the soluble FasL fragment (sFasL). Currently, there are few studies in oral squamous cell carcinoma (OSCC) that correlate levels of ADAM10 and FasL in the tumor microenvironment with clinical parameters of the disease. To determine the expression of ADAM10, Fas, FasL and sFasL in patients with OSCC and its association with TNM stage. Twenty-five patients with OSCC and 25 healthy controls were included. Biopsies of tumor tissue from patients with OSCC and buccal mucosa in controls were obtained. ADAM10, Fas, and FasL were analyzed by Western blotting. sFasL was quantified by ELISA. ADAM10 and Fas decreased significantly in OSCC compared with controls. Relatedly, within the OSCC group, Fas and ADAM10 decreased in accordance with tumor disease stage; in stages I/II, as well as in tumors of smaller diameter (T1-T2), ADAM10 showed higher levels when compared to patients with T3-T4 tumors and in stage III-IV. FasL in the tumor microenvironment and serum FasL showed no significant differences between both groups. Levels of complete FasL and cleaved FasL were positively correlated in controls; this correlation is preserved in patients with tumors in early stages (I-II), but is lost in later stage (III-IV). The dysregulation of ADAM10, Fas and FasL could be useful indicators of the progression and severity of OSCC.

  1. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  2. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  3. Prolonged stimulation of protein synthesis by leucine is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leucine is unique among the amino acids in its ability to enhance protein synthesis by activating translation initiation (Kimball and Jefferson, 2005). Our laboratory has shown that raising leucine to postprandial levels, whilst keeping all other amino acids at the post absorptive, level acutely st...

  4. Pyrazinoic acid decreases the proton motive force, respiratory ATP synthesis activity, and cellular ATP levels.

    PubMed

    Lu, Ping; Haagsma, Anna C; Pham, Hoang; Maaskant, Janneke J; Mol, Selena; Lill, Holger; Bald, Dirk

    2011-11-01

    Pyrazinoic acid, the active form of the first-line antituberculosis drug pyrazinamide, decreased the proton motive force and respiratory ATP synthesis rates in subcellular mycobacterial membrane assays. Pyrazinoic acid also significantly lowered cellular ATP levels in Mycobacterium bovis BCG. These results indicate that the predominant mechanism of killing by this drug may operate by depletion of cellular ATP reserves.

  5. Facile synthesis of nucleic acid-polymer amphiphiles and their self-assembly.

    PubMed

    Jia, Fei; Lu, Xueguang; Tan, Xuyu; Zhang, Ke

    2015-05-07

    A solid-phase synthesis for nucleic acid-polymer amphiphiles is developed. Using this strategy, several DNA-b-polymer amphiphiles are synthesized, and their self-assembly in aqueous solution is investigated. This general method can in principle be extended to nearly all polymers synthesized by atom transfer radical polymerization to produce a variety of nucleic acid-polymer conjugates.

  6. Synthesis of Nucleic Acid and Protein in L Cells Infected with the Agent of Meningopneumonitis

    PubMed Central

    Schechter, Esther M.

    1966-01-01

    Schechter, Esther M. (The University of Chicago, Chicago, Ill.). Synthesis of nucleic acid and protein in L cells infected with the agent of meningopneumonitis. J. Bacteriol. 91:2069–2080. 1966.—Synthesis of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein in uninfected L cells and in L cells infected with the meningopneumonitis agent was compared by measuring rates of incorporation of H3-cytidine and C14-lysine into nuclear, cytoplasmic, and agent fractions in successive 5-hr periods during the meningopneumonitis growth cycle. Synthesis of meningopneumonitis DNA, RNA, and protein was first clearly evident in the labeling period 15 to 20 hr after infection, soon after initiation of agent multiplication. The rates of synthesis of agent DNA, RNA, and protein increased logarithmically for a brief period and then declined. However, rates of isotope incorporation into all three meningopneumonitis macromolecules were sustained at near maximal values throughout the remainder of the meningopneumonitis growth cycle. These data are most readily interpreted in terms of multiplication of the meningopneumonitis agent by binary fission. The L cell response to infection was a decreased rate of DNA and RNA synthesis and an accelerated rate of cell death. Host protein synthesis was unaffected. The inhibition of nucleic acid synthesis in infected L cells probably involved competition between host and parasite for nucleic acid precursors. Different sublines of L cells varied greatly in the degree to which their nucleic acid-synthesizing mechanisms were damaged by infection. The cytoplasm of infected L cells contained newly synthesized DNA and RNA that could not be accounted for as intact meningopneumonitis cells. This nucleic acid probably arose from disintegration of the fragile intracellular forms of the meningopneumonitis agent. Images PMID:5937251

  7. Total synthesis of racemic and (R) and (S)-4-methoxyalkanoic acids and their antifungal activity.

    PubMed

    Das, Biswanath; Shinde, Digambar Balaji; Kanth, Boddu Shashi; Kamle, Avijeet; Kumar, C Ganesh

    2011-07-01

    The total synthesis of 4-methoxydecanoic acid and 4-methoxyundecanoic acid in racemic and stereoselective [(R) and (S)] forms has been accomplished. For stereoselective synthesis of the compounds (S) and (R)-BINOL complexes have been used to generate the required chiral centres. The antifungal activity of these compounds has been studied against different organisms and the results were found to be impressive. The activity of the compounds in racemic and in stereoselective forms was compared. (R)-4-Methoxydecanoic acid was found to be most potent (MIC: 0.019 mg/mL against Candida albicans MTCC 227, C. albicans MTCC 4748, Aspergillus brasiliensis (niger) MTCC 281 and Issatchenkia orientalis MTCC 3020).

  8. Final Step of Phosphatidic Acid Synthesis in Pea Chloroplasts Occurs in the Inner Envelope Membrane 1

    PubMed Central

    Andrews, Jaen; Ohlrogge, John B.; Keegstra, Kenneth

    1985-01-01

    The second enzyme of phosphatidic acid synthesis from glycerol-3-phosphate, 1-acylglycerophospate acyltransferase, was localized to the inner envelope membrane of pea chloroplasts. The activity of this enzyme was measured by both a coupled enzyme assay and a direct enzyme assay. Using the coupled enzyme assay, phosphatidic acid phosphatase was also localized to the inner envelope membrane, although this enzyme has very low activity in pea chloroplasts. The addition of UDP-galactose to unfractionated pea chloroplast envelope preparations did not result in significant conversion of newly synthesized diacylglycerol to monogalactosyldiacylglycerol. Thus, the envelope synthesized phosphatidic acid may not be involved in galactolipid synthesis in pea chloroplasts. PMID:16664266

  9. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  10. Differential regulation of miR-146a/FAS and miR-21/FASLG axes in autoimmune lymphoproliferative syndrome due to FAS mutation (ALPS-FAS).

    PubMed

    Marega, Lia Furlaneto; Teocchi, Marcelo Ananias; Dos Santos Vilela, Maria Marluce

    2016-08-01

    Most cases of autoimmune lymphoproliferative syndrome (ALPS) have an inherited genetic defect involving apoptosis-related genes of the FAS pathway. MicroRNAs (miRNAs) are a class of small non-coding regulatory RNAs playing a role in the control of gene expression. This is the first report on miRNAs in ALPS patients. We studied a mother and son carrying the same FAS cell surface death receptor (FAS) mutation, but with only the son manifesting the signs and symptoms of ALPS-FAS. The aim was to analyse, by reverse transcription-quantitative polymerase chain reaction (RT-qPCR), the peripheral blood mononuclear cells (PBMC) relative expression of miR-146a and miR-21, including their passenger strands and respective targets (FAS and FASLG). In comparison with healthy matched control individuals, miR-21-3p was over-expressed significantly (P = 0·0313) in the son, with no significant change in the expression of miR-146a, miR-146a-3p and miR-21. In contrast, the mother had a slight under-expression of the miR-146a pair and miR-21-3p (P = 0·0625). Regarding the miRNA targets, FAS was up-regulated markedly for the mother (P = 0·0078), but down-regulated for the son (P = 0·0625), while FASLG did not have any significant alteration. Taken together, our finding clearly suggests a role of the miR-146a/FAS axis in ALPS-FAS variable expressivity in which FAS haploinsufficiency seems to be compensated only in the mother who had the miR-146a pair down-regulated. As only the son had the major clinical manifestations of ALPS-FAS, miR-21-3p should be investigated as playing a critical role in ALPS physiopathology, including the development of lymphoma.

  11. Formamide Synthesis through Borinic Acid Catalysed Transamidation under Mild Conditions.

    PubMed

    Dine, Tharwat Mohy El; Evans, David; Rouden, Jacques; Blanchet, Jérôme

    2016-04-18

    A highly efficient and mild transamidation of amides with amines co-catalysed by borinic acid and acetic acid has been reported. A wide range of functionalised formamides was synthesized in excellent yields, including important chiral α-amino acid derivatives, with minor racemisation being observed. Experiments suggested that the reaction rely on a cooperative catalysis involving an enhanced boron-derived Lewis acidity rather than an improved Brønsted acidity of acetic acid.

  12. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  13. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  14. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  15. Associations between variants of FADS genes and omega-3 and omega-6 milk fatty acids of Canadian Holstein cows

    PubMed Central

    2014-01-01

    Background Fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes code respectively for the enzymes delta-5 and delta-6 desaturases which are rate limiting enzymes in the synthesis of polyunsaturated omega-3 and omega-6 fatty acids (FAs). Omega-3 and-6 FAs as well as conjugated linoleic acid (CLA) are present in bovine milk and have demonstrated positive health effects in humans. Studies in humans have shown significant relationships between genetic variants in FADS1 and 2 genes with plasma and tissue concentrations of omega-3 and-6 FAs. The aim of this study was to evaluate the extent of sequence variations within these two genes in Canadian Holstein cows as well as the association between sequence variants and health promoting FAs in milk. Results Thirty three SNPs were detected within the studied regions of genes including a synonymous mutation (FADS1-07, rs42187261, 306Tyr > Tyr) in exon 8 of FADS1, a non-synonymous mutation (FADS2-14, rs211580559, 294Ala > Val) within FADS2 exon 7, a splice site SNP (FADS2-05, rs211263660), a 3′UTR SNP (FADS2-23, rs109772589), and another 3′UTR SNP with an effect on a microRNA binding site within FADS2 gene (FADS2-19, rs210169303). Association analyses showed significant relations between three out of seven tested SNPs and several FAs. Significant associations (FDR P < 0.05) were recorded between FADS2-23 (rs109772589) and two omega-6 FAs (dihomogamma linolenic acid [C20:3n6] and arachidonic acid [C20:4n6]), FADS1-07 (rs42187261) and one omega-3 FA (eicosapentaenoic acid, C20:5n3) and tricosanoic acid (C23:0), and one intronic SNP, FADS1-01 (rs136261927) and C20:3n6. Conclusion Our study has demonstrated positive associations between three SNPs within FADS1 and FADS2 genes (a SNP within the 3’UTR, a synonymous SNP and an intronic SNP), with three milk PUFAs of Canadian Holstein cows thus suggesting possible involvement of synonymous and non-coding region variants in FA synthesis. These SNPs may serve as

  16. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  17. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  18. Veterinary Medicine and Omics (Veterinomics): Metabolic Transition of Milk Triacylglycerol Synthesis in Sows from Late Pregnancy to Lactation.

    PubMed

    Lv, Yantao; Guan, Wutai; Qiao, Hanzhen; Wang, Chaoxian; Chen, Fang; Zhang, Yinzhi; Liao, Zhichao

    2015-10-01

    Mammalian milk is a key source of lipids, providing not only important calories but also essential fatty acids. Veterinary medicine and omics systems sciences intersection, termed as "veterinomics" here, has received little attention to date but stands to offer much promise for building bridges between human and animal health. We determined the changes in porcine mammary genes and proteomics expression associated with milk triacylglycerol (TAG) synthesis and secretion from late pregnancy to lactation. TAG content and fatty acid (FA) composition were determined in porcine colostrum (the 1st day of lactation) and milk (the 17th day of lactation). The mammary transcriptome for 70 genes and 13 proteins involved in TAG synthesis and secretion from six sows, each at d -17(late pregnancy), d 1(early lactation), and d 17 (peak lactation) relative to parturition were analyzed using quantitative real-time PCR and Western blot analyses. The TAG content and the concentrations of de novo synthesized FAs, saturated FAs, and monounsaturated FAs were higher in milk than in colostrum (p<0.05). Robust upregulation with high relative mRNA abundance was evident during lactation for genes associated with FA uptake (VLDLR, LPL, CD36), FA activation (ACSS2, ACSL3), and intracellar transport (FABP3), de novo FA synthesis (ACACA, FASN), FA elongation (ELOVL1), FA desaturation (SCD, FADS1), TAG synthesis (GPAM, AGPAT1, LPIN1, DGAT1), lipid droplet formation (BTN2A1, XDH, PLIN2), and transcription factors and nuclear receptors (SREBP1, SCAP, INSIG1/2). In conclusion, a wide variety of lipogenic genes and proteins regulate the channeling of FAs towards milk TAG synthesis and secretion in porcine mammary gland tissue. These findings inform future omics strategies to increase milk fat production and lipid profile and attest to the rise of both veterinomics and lipidomics in postgenomics life sciences.

  19. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  20. Synthesis of bile acid monosulphates by the isolated perfused rat kidney.

    PubMed Central

    Summerfield, J A; Gollan, J L; Billing, B H

    1976-01-01

    Perfusion of an isolated rat kidney with labelled bile acids, in a protein-free medium, resulted in the urinary excretion of the labelled bile acid, 3% being converted into polar metabolities in 1h. These metabolities were neither glycine nor taurine conjugates, nor bile acid glucuronides, and on solovolysis yielded the free bile acid. On t.l.c. the metabolite of [24-14C]lithocholic acid had the mobility of lithocholate 3-sulphate. The principal metabolite of [24-14C]chenodeoxycholic acid had the mobility of chenodeoxycholate 7-sulphate; trace amounts appeared as chenodeoxycholate 3-sulphate. [35S]sulphate was incorporated in chenodeoxycholic acid by the kidney, resulting in a similar pattern of sulphation. No disulphate salt of chenodeoxycholic acid was detected. These findings lend support to the hypothesis that renal synthesis may account for some of the bile acid sulphates present in urine in the cholestatic syndrome in man. PMID:942413

  1. Fas/FasL, Bcl2 and Caspase-8 gene polymorphisms in Chinese patients with rheumatoid arthritis.

    PubMed

    Zhu, Aiping; Wang, Mingjie; Zhou, Guoxin; Zhang, Hui; Liu, Ruiping; Wang, Yong

    2016-06-01

    Apoptosis signals are necessary for maintaining homeostasis and an adequate immune response. Dysregulation of apoptosis-related genes in the immune system has an important impact on autoimmune diseases such as rheumatoid arthritis (RA). Thus, we investigated the association between Fas rs2234767 G/A, FasL rs763110 C/T, Bcl2 rs12454712 T/C, Bcl2 rs17757541 C/G, and Caspase-8 rs1035142 G/T polymorphisms and RA susceptibility in a Chinese population. These five single-nucleotide polymorphisms (SNPs) were studied in a Chinese population consisting of 615 patients with RA and 839 controls. Genotyping was performed using a custom-by-design 48-Plex SNP scan TM kit. Furthermore, we undertook a meta-analysis between FasL rs763110 C/T and RA. This study indicated that Fas rs2234767 and Bcl2 rs17757541 polymorphisms were risk factors for RA. No association was observed between FasL rs763110 C/T, Bcl2 rs12454712 T/C, and Caspase-8 rs1035142 G/T polymorphisms and RA in this study. The results of this meta-analysis suggested no significant association between FasL rs763110 C/T and RA. However, stratification analysis of this meta-analysis indicated that FasL rs763110 C/T increased the risk of Caucasian RA patients. In conclusion, this study demonstrated that Fas rs2234767 G/A and Bcl2 rs17757541 T/C polymorphisms might be associated with an increased risk of RA. This meta-analysis revealed that FasL rs763110 C/T was associated with an increased risk of Caucasian RA patients.

  2. Fatty Acid Synthase Impacts the Pathobiology of Candida parapsilosis In Vitro and during Mammalian Infection

    PubMed Central

    Nguyen, Long Nam; Trofa, David; Nosanchuk, Joshua D.

    2009-01-01

    Cytosolic fungal fatty acid synthase is composed of two subunits α and β, which are encoded by Fas1 and Fas2 genes. In this study, the Fas2 genes of the human pathogen Candida parapsilosis were deleted using a modified SAT1 flipper technique. CpFas2 was essential in media lacking exogenous fatty acids and the growth of Fas2 disruptants (Fas2 KO) was regulated by the supplementation of different long chain fatty acids, such as myristic acid (14∶0), palmitic acid (16∶0), and Tween 80, in a dose-specific manner. Lipidomic analysis revealed that Fas2 KO cells were severely restricted in production of unsaturated fatty acids. The Fas2 KO strains were unable to form normal biofilms and were more efficiently killed by murine-like macrophages, J774.16, than the wild type, heterozygous and reconstituted strains. Furthermore, Fas2 KO yeast were significantly less virulent in a systemic murine infection model. The Fas2 KO cells were also hypersensitive to human serum, and inhibition of CpFas2 in WT C. parapsilosis by cerulenin significantly decreased fungal growth in human serum. This study demonstrates that CpFas2 is essential for C. parapsilosis growth in the absence of exogenous fatty acids, is involved in unsaturated fatty acid production, influences fungal virulence, and represents a promising antifungal drug target. PMID:20027295

  3. Lewis Acid Promoted Oxonium Ion Driven Carboamination of Alkynes for the Synthesis of 4-Alkoxy Quinolines.

    PubMed

    Gharpure, Santosh J; Nanda, Santosh K; Adate, Priyanka A; Shelke, Yogesh G

    2017-02-17

    Lewis acid mediated multisegment coupling cascade is designed for the synthesis of densely substituted 4-alkoxy quinolines via an oxonium ion triggered alkyne carboamination sequence involving C-C and C-N bond formations. Cyclic ether fused-quinolines could also be accessed using this fast, operationally simple, high yielding, chemoselective and functional group tolerant method. Versatility and utility of this methodology is demonstrated by postfunctionalization of products obtained and its use in synthesis of potent drug molecules.

  4. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  5. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-04

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  6. Orthogonally Protected Furanoid Sugar Diamino Acids for Solid-Phase Synthesis of Oligosaccharide Mimetics.

    PubMed

    John, Franklin; Wittmann, Valentin

    2015-08-07

    Sugar diamino acids (SDAs), which differ from the widely used sugar amino acids in the presence of a second amino group connected to the carbohydrate core, share structural features of both amino acids and carbohydrates. They can be used for the preparation of linear and branched amide-linked oligosaccharide mimetics. Such oligomers carry free amino groups, which are positively charged at neutral pH, in a spatially defined way and, thus, represent a potential class of aminoglycoside mimetics. We report here the first examples of orthogonally protected furanoid SDAs and their use in solid-phase synthesis. Starting from d-glucose, we developed a divergent synthetic route to three derivatives of 3,5-diamino-3,5-dideoxy-d-ribofuranose. These building blocks are compatible with solid-phase peptide synthesis following the 9-fluorenylmethoxycarbonyl (Fmoc) strategy, which we demonstrate by the synthesis of an SDA tetramer.

  7. New hydroxamic acid derivatives of fluoroquinolones: synthesis and evaluation of antibacterial and anticancer properties.

    PubMed

    Rajulu, Gavara Govinda; Bhojya Naik, Halehatty Seephya; Viswanadhan, Abhilash; Thiruvengadam, Jayaraman; Rajesh, Kondodiyil; Ganesh, Sambasivam; Jagadheshan, Hiriyan; Kesavan, Poonimangadu Koppolu

    2014-01-01

    A series of new hydroxamic acid derivatives (6a-f) at C-3 position of fluoroquinolones were designed and synthesized through multistep synthesis. The design concept involved replacement of the 3-carboxylic acid in fluoquinolones with hydroxamic acid as an acid mimicking group. The synthetic work employed in this work provides a good example for the synthesis of pure hydroxamic acid based fluoroquinolones. The synthesized compounds were characterized by (1)H-NMR, electrospray ionization (ESI)-MS and IR. The new compounds were tested for their in vitro antimicrobial and anti-proliferative activity. Out of the six derivatives, compound 6e exhibited moderate antibacterial activity by inhibiting the growth of Escherichia coli and Klebsiella pneumoniae (MIC: 4.00-8.00 µg/mL). Compounds 6b and 6f displayed good growth inhibition against A549 Lung adenocarcinoma and HCT-116 Colon carcinoma cell lines.

  8. Synthesis of 5,9-hexacosadienoic acid phospholipids. 11. Phospholipid studies of marine organisms.

    PubMed

    Mena, P L; Djerassi, C

    1985-01-01

    The synthesis of phosphatidylcholines (PC), phosphatidylethanolamines (PE) and phosphatidylserines (PS) containing two acyl chains of the naturally occurring sponge fatty acid (5Z,9Z)-5,9-hexacosadienoic acid as well as its hitherto unknown geometrical isomers is described. The PCs were prepared by deacylation of natural lecithins, followed by reacylation with fatty acid anhydrides. The synthesis of mixed-acid PCs is also reported: a diacyl product was converted to the lyso-PC by treatment with phospholipase A2 and subsequent acylation of the secondary hydroxyl group to give the desired mixed-acid PCs. The PEs and the PSs were prepared from the corresponding PCs by enzymatic transphosphatidylation catalyzed by phospholipase D. Structural assignments of the compounds were confirmed by spectroscopy (1H-NMR and MS). Ammonia chemical ionization mass spectrometry provided molecular ion and significant fragment peaks for PCs and PEs.

  9. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  10. Stimulation of Ribonucleic Acid Synthesis by Chloramphenicol in a rel+ Aminoacyl-Transfer Ribonucleic Acid Synthetase Mutant of Escherichia coli

    PubMed Central

    Yegian, Charles D.; Vanderslice, Rebecca W.

    1971-01-01

    Escherichia coli strain 9D3 possesses a highly temperature-sensitive valyl-transfer ribonucleic acid (tRNA) synthetase (EC 6.1.1.9). Since 9D3 is a rel+ strain, it cannot carry out net RNA synthesis at high temperature. A 100-μg amount of chloramphenicol (CAP) per ml added in the absence of valine cannot stimulate RNA synthesis. Either 300 μg of CAP or 100 μg of CAP plus 50 μg of valine per ml, however, promotes nearly maximal RNA synthesis. These results can be understood as follows. (i) Valyl-tRNA is required for net RNA synthesis, (ii) the synthetase lesion is incomplete, (iii) the rate of mutant acylation of tRNAval at high temperature is valine-dependent, and (iv) the CAP concentration determines the rate of residual protein synthesis. Data are also presented which demonstrate that the rate of net RNA synthesis can greatly increase long after the addition of CAP, if the amount of valyl-tRNA increases. PMID:4942766

  11. Aromatic amino acids are utilized and protein synthesis is stimulated during amino acid infusion in the ovine fetus.

    PubMed

    Liechty, E A; Boyle, D W; Moorehead, H; Auble, L; Denne, S C

    1999-06-01

    The purpose of this study was to determine whether the ovine fetus is capable of increased disposal of an amino acid load; if so, would it respond by increased protein synthesis, amino acid catabolism or both? A further purpose of the study was to determine whether the pathways of aromatic amino acid catabolism are functional in the fetus. Late gestation ovine fetuses of well-nourished ewes received an infusion of Aminosyn PF alone (APF), and Aminosyn PF + glycyl-L-tyrosine (APF+GT) at rates estimated to double the intake of these amino acids. The initial study, using APF, was performed at 126 +/- 1.4 d; the APF+GT study was performed at 132 +/- 1.7 d (term = 150 d). Phenylalanine and tyrosine kinetics were determined using both stable and radioactive isotopes. Plasma concentrations of most amino acids, but not tyrosine, increased during both studies; tyrosine concentration increased only during the APF+GT study. Phenylalanine rate of appearance and phenylalanine hydroxylation increased during both studies. Tyrosine rate of appearance increased only during the APF+GT study; tyrosine oxidation did not increase during either study. Fetal protein synthesis increased significantly during both studies, producing a significant increase in fetal protein accretion. Fetal proteolysis was unchanged in response to either amino acid infusion. These results indicate that the fetus responds to an acute increase in amino acid supply primarily by increasing protein synthesis and accretion, with a smaller but significant increase in amino acid catabolism also. Both phenylalanine hydroxylation and tyrosine oxidation are active in the fetus, and the fetus is able to increase phenylalanine hydroxylation rapidly in response to increased supply.

  12. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-08

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  13. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  14. Enhanced expression of Fas and FasL modulates apoptosis in the lungs of severe P. falciparum malaria patients with pulmonary edema

    PubMed Central

    Punsawad, Chuchard; Viriyavejakul, Parnpen; Setthapramote, Chayanee; Palipoch, Sarawoot

    2015-01-01

    Apoptosis mediated by Fas/FasL has been implicated in pulmonary disorders. However, little is known about the relationship between Fas and FasL in the process of lung injury during malaria infection. Paraffin-embedded lung tissues from malaria patients were divided into two groups: those with pulmonary edema (PE) and those without pulmonary edema (non-PE). Normal lung tissues were used as the control group. Cellular expression of Fas, FasL, and the markers of apoptotic caspases, including cleaved caspase-3 and cleaved caspase-8 in the lung tissues were investigated by the immunohistochemistry (IHC) method. Semi-quantitative analysis of IHC staining revealed that cellular expression of Fas, FasL, cleaved caspase-8, and cleaved caspase-3 were significantly increased in the lungs of patients with PE compared with the lungs of patients with non-PE and control groups (all P < 0.05). In addition, significant positive correlations were obtained between Fas and apoptosis (rs = 0.937, P < 0.001) and FasL and apoptosis (rs = 0.808, P < 0.001). Significant positive correlations were found between Fas and FasL expression (rs = 0.827, P < 0.001) and between cleaved caspase-8 and cleaved caspase-3 expression (rs = 0.823, P < 0.001), which suggests that Fas-dependent initiator and effector caspases, including cleaved caspase-8 and caspase-3, are necessary for inducing apoptosis in the lungs of patients with severe P. falciparum malaria. The Fas/FasL system and downstream activation of caspases are important mediators of apoptosis and may be involved in the pathogenesis of pulmonary edema in severe P. falciparum malaria patients. The proper regulation of the Fas/FasL pathway can be a potential treatment for pulmonary complications in falciparum malaria patients. PMID:26617708

  15. Fas Protects Breast Cancer Stem Cells from Death

    DTIC Science & Technology

    2015-10-01

    AWARD NUMBER: W81XWH-13-1-0301 TITLE: Fas Protects Breast Cancer Stem Cells from Death PRINCIPAL INVESTIGATOR: Paolo Ceppi CONTRACTING...sensitive to Fas-mediated apoptosis, while the BCSCs part is more sensitive to the death induced by the elimination of CD95 (a phenomenon we have recently...identification of novel molecular targets for the treatment of breast cancer. I have in fact observed a significant enhancement of cancer cell death by

  16. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  17. Pigment epithelial-derived factor (PEDF)-triggered lung cancer cell apoptosis relies on p53 protein-driven Fas ligand (Fas-L) up-regulation and Fas protein cell surface translocation.

    PubMed

    Li, Lei; Yao, Ya-Chao; Fang, Shu-Huan; Ma, Cai-Qi; Cen, Yi; Xu, Zu-Min; Dai, Zhi-Yu; Li, Cen; Li, Shuai; Zhang, Ting; Hong, Hong-Hai; Qi, Wei-Wei; Zhou, Ti; Li, Chao-Yang; Yang, Xia; Gao, Guo-Quan

    2014-10-31

    Pigment epithelium-derived factor (PEDF), a potent antiangiogenesis agent, has recently attracted attention for targeting tumor cells in several types of tumors. However, less is known about the apoptosis-inducing effect of PEDF on human lung cancer cells and the underlying molecular events. Here we report that PEDF has a growth-suppressive and proapoptotic effect on lung cancer xenografts. Accordingly, in vitro, PEDF apparently induced apoptosis in A549 and Calu-3 cells, predominantly via the Fas-L/Fas death signaling pathway. Interestingly, A549 and Calu-3 cells are insensitive to the Fas-L/Fas apoptosis pathway because of the low level of cell surface Fas. Our results revealed that, in addition to the enhancement of Fas-L expression, PEDF increased the sensitivity of A549 and Calu-3 cells to Fas-L-mediated apoptosis by triggering the translocation of Fas protein to the plasma membrane in a p53- and FAP-1-dependent manner. Similarly, the up-regulation of Fas-L by PEDF was also mediated by p53. Furthermore, peroxisome proliferator-activated receptor γ was determined to be the upstream regulator of p53. Together, these findings uncover a novel mechanism of tumor cell apoptosis induced by PEDF and provide a potential therapeutic strategy for tumors that are insensitive to Fas-L/Fas-dependent apoptosis because of a low level of cell surface Fas.

  18. Pigment Epithelial-derived Factor (PEDF)-triggered Lung Cancer Cell Apoptosis Relies on p53 Protein-driven Fas Ligand (Fas-L) Up-regulation and Fas Protein Cell Surface Translocation*

    PubMed Central

    Li, Lei; Yao, Ya-Chao; Fang, Shu-Huan; Ma, Cai-Qi; Cen, Yi; Xu, Zu-Min; Dai, Zhi-Yu; Li, Cen; Li, Shuai; Zhang, Ting; Hong, Hong-Hai; Qi, Wei-Wei; Zhou, Ti; Li, Chao-Yang; Yang, Xia; Gao, Guo-Quan

    2014-01-01

    Pigment epithelium-derived factor (PEDF), a potent antiangiogenesis agent, has recently attracted attention for targeting tumor cells in several types of tumors. However, less is known about the apoptosis-inducing effect of PEDF on human lung cancer cells and the underlying molecular events. Here we report that PEDF has a growth-suppressive and proapoptotic effect on lung cancer xenografts. Accordingly, in vitro, PEDF apparently induced apoptosis in A549 and Calu-3 cells, predominantly via the Fas-L/Fas death signaling pathway. Interestingly, A549 and Calu-3 cells are insensitive to the Fas-L/Fas apoptosis pathway because of the low level of cell surface Fas. Our results revealed that, in addition to the enhancement of Fas-L expression, PEDF increased the sensitivity of A549 and Calu-3 cells to Fas-L-mediated apoptosis by triggering the translocation of Fas protein to the plasma membrane in a p53- and FAP-1-dependent manner. Similarly, the up-regulation of Fas-L by PEDF was also mediated by p53. Furthermore, peroxisome proliferator-activated receptor γ was determined to be the upstream regulator of p53. Together, these findings uncover a novel mechanism of tumor cell apoptosis induced by PEDF and provide a potential therapeutic strategy for tumors that are insensitive to Fas-L/Fas-dependent apoptosis because of a low level of cell surface Fas. PMID:25225287

  19. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  20. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  1. The Relationship of Serum Soluble Fas Ligand (sFasL) Level with the Extent of Coronary Artery Disease.

    PubMed

    Sahinarslan, Asife; Boyaci, Bulent; Kocaman, Sinan Altan; Topal, Salih; Ercin, Ugur; Okyay, Kaan; Bukan, Neslihan; Yalçin, Ridvan; Cengel, Atiye

    2012-03-01

    Fas/Fas ligand system contributes to the programmed cell death induced by myocardial ischemia. We investigated whether serum soluble Fas ligand (sFasL) level is independently related with the severity and extent of angiographically assessed coronary artery disease (CAD). We included 169 patients in this study. Two groups were formed based on the existence of a lesion on coronary angiography. First group included patients with normal coronary arteries (NCA; n = 53). Patients with atherosclerotic lesions were included in the second group (n = 116). We used the coronary vessel score (the number of the coronary arteries with a lesion leading to ≥ 50% luminal obstruction) and the Azar score to determine the extent and the severity of CAD. Standard enzyme-linked immunosorbent assay kits were used to measure serum sFasL levels. The serum sFasL level was higher in patients with CAD than in patients with NCA (0.52 ± 0.23 mU/mL vs. 0.45 ± 0.18 mU/mL, p = 0.023). The sFasL level correlated with Azar score (r = 0.231, p = 0.003) and with coronary vessel score (r = 0.269, p < 0.001). In the multivariate analysis, we found that age (beta: 0.188, p = 0.008), gender (beta: 0.317, p < 0.001), diabetes mellitus (DM; beta: 0.195, p = 0.008), and sFasL level (beta: 0.209, p = 0.003) were independently related with Azar score. When we used coronary vessel score as the dependent variable, we found that age (p = 0.020), gender (p < 0.001), DM (p = 0.006), and sFasL level (p = 0.001) were independent predictors. Serum sFasL level is associated with angiographically more severe CAD. Our findings suggest that sFasL level may be a biochemical surrogate of severe coronary atherosclerosis.

  2. The Relationship of Serum Soluble Fas Ligand (sFasL) Level with the Extent of Coronary Artery Disease

    PubMed Central

    Sahinarslan, Asife; Boyaci, Bulent; Kocaman, Sinan Altan; Topal, Salih; Ercin, Ugur; Okyay, Kaan; Bukan, Neslihan; Yalçin, Ridvan; Cengel, Atiye

    2012-01-01

    Fas/Fas ligand system contributes to the programmed cell death induced by myocardial ischemia. We investigated whether serum soluble Fas ligand (sFasL) level is independently related with the severity and extent of angiographically assessed coronary artery disease (CAD). We included 169 patients in this study. Two groups were formed based on the existence of a lesion on coronary angiography. First group included patients with normal coronary arteries (NCA; n = 53). Patients with atherosclerotic lesions were included in the second group (n = 116). We used the coronary vessel score (the number of the coronary arteries with a lesion leading to ≥ 50% luminal obstruction) and the Azar score to determine the extent and the severity of CAD. Standard enzyme-linked immunosorbent assay kits were used to measure serum sFasL levels. The serum sFasL level was higher in patients with CAD than in patients with NCA (0.52 ± 0.23 mU/mL vs. 0.45 ± 0.18 mU/mL, p = 0.023). The sFasL level correlated with Azar score (r = 0.231, p = 0.003) and with coronary vessel score (r = 0.269, p < 0.001). In the multivariate analysis, we found that age (beta: 0.188, p = 0.008), gender (beta: 0.317, p < 0.001), diabetes mellitus (DM; beta: 0.195, p = 0.008), and sFasL level (beta: 0.209, p = 0.003) were independently related with Azar score. When we used coronary vessel score as the dependent variable, we found that age (p = 0.020), gender (p < 0.001), DM (p = 0.006), and sFasL level (p = 0.001) were independent predictors. Serum sFasL level is associated with angiographically more severe CAD. Our findings suggest that sFasL level may be a biochemical surrogate of severe coronary atherosclerosis. PMID:23450131

  3. Influence of Fenofibrate Treatment on Triacylglycerides, Diacylglycerides and Fatty Acids in Fructose Fed Rats

    PubMed Central

    Kopf, Thomas; Schaefer, Hans-Ludwig; Troetzmueller, Martin; Koefeler, Harald; Broenstrup, Mark; Konovalova, Tatiana; Schmitz, Gerd

    2014-01-01

    Fenofibrate (FF) lowers plasma triglycerides via PPARα activation. Here, we analyzed lipidomic changes upon FF treatment of fructose fed rats. Three groups with 6 animals each were defined as control, fructose-fed and fructose-fed/FF treated. Male Wistar Unilever Rats were subjected to 10% fructose-feeding for 20 days. On day 14, fenofibrate treatment (100 mg/kg p.o.) was initiated and maintained for 7 days. Lipid species in serum were analyzed using mass spectrometry (ESI-MS/MS; LC-FT-MS, GC-MS) on days 0, 14 and 20 in all three groups. In addition, lipid levels in liver and intestine were determined. Short-chain TAGs increased in serum and liver upon fructose-feeding, while almost all TAG-species decreased under FF treatment. Long-chain unsaturated DAG-levels (36:1, 36:2, 36:4, 38:3, 38:4, 38:5) increased upon FF treatment in rat liver and decreased in rat serum. FAs, especially short-chain FAs (12:0, 14:0, 16:0) increased during fructose-challenge. VLDL secretion increased upon fructose-feeding and together with FA-levels decreased to control levels during FF treatment. Fructose challenge of de novo fatty acid synthesis through fatty acid synthase (FAS) may enhance the release of FAs ≤16:0 chain length, a process reversed by FF-mediated PPARα-activation. PMID:25198467

  4. Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

  5. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

  6. Amino Acid Starvation Has Opposite Effects on Mitochondrial and Cytosolic Protein Synthesis

    PubMed Central

    Pearce, Sarah F.; Rorbach, Joanna; He, Jiuya; Brea-Calvo, Gloria; Minczuk, Michal; Reyes, Aurelio; Holt, Ian J.; Spinazzola, Antonella

    2014-01-01

    Amino acids are essential for cell growth and proliferation for they can serve as precursors of protein synthesis, be remodelled for nucleotide and fat biosynthesis, or be burnt as fuel. Mitochondria are energy producing organelles that additionally play a central role in amino acid homeostasis. One might expect mitochondrial metabolism to be geared towards the production and preservation of amino acids when cells are deprived of an exogenous supply. On the contrary, we find that human cells respond to amino acid starvation by upregulating the amino acid-consuming processes of respiration, protein synthesis, and amino acid catabolism in the mitochondria. The increased utilization of these nutrients in the organelle is not driven primarily by energy demand, as it occurs when glucose is plentiful. Instead it is proposed that the changes in the mitochondrial metabolism complement the repression of cytosolic protein synthesis to restrict cell growth and proliferation when amino acids are limiting. Therefore, stimulating mitochondrial function might offer a means of inhibiting nutrient-demanding anabolism that drives cellular proliferation. PMID:24718614

  7. Synthesis and characterization of bis-thiourea having amino acid derivatives

    NASA Astrophysics Data System (ADS)

    Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah

    2016-11-01

    In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.

  8. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  9. Programmed Cell Death of Embryonic Motoneurons Triggered through the FAS Death Receptor

    PubMed Central

    Raoul, Cédric; Henderson, Christopher E.; Pettmann, Brigitte

    1999-01-01

    About 50% of spinal motoneurons undergo programmed cell death (PCD) after target contact, but little is known about how this process is initiated. Embryonic motoneurons coexpress the death receptor Fas and its ligand FasL at the stage at which PCD is about to begin. In the absence of trophic factors, many motoneurons die in culture within 2 d. Most (75%) of these were saved by Fas-Fc receptor body, which blocks interactions between Fas and FasL, or by the caspase-8 inhibitor tetrapeptide IETD. Therefore, activation of Fas by endogenous FasL underlies cell death induced by trophic deprivation. In the presence of neurotrophic factors, exogenous Fas activators such as soluble FasL or anti-Fas antibodies triggered PCD of 40–50% of purified motoneurons over the following 3–5 d; this treatment led to activation of caspase-3, and was blocked by IETD. Sensitivity to Fas activation is regulated: motoneurons cultured for 3 d with neurotrophic factors became completely resistant. Levels of Fas expressed by motoneurons varied little, but FasL was upregulated in the absence of neurotrophic factors. Motoneurons resistant to Fas activation expressed high levels of FLICE-inhibitory protein (FLIP), an endogenous inhibitor of caspase-8 activation. Our results suggest that Fas can act as a driving force for motoneuron PCD, and raise the possibility that active triggering of PCD may contribute to motoneuron loss during normal development and/or in pathological situations. PMID:10579724

  10. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  11. The use of ascorbate as an oxidation inhibitor in prebiotic amino acid synthesis: a cautionary note.

    PubMed

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO(2)-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO(2) was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO(2)-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO(2)-rich atmosphere under the conditions studied.

  12. Acyl Meldrum's acid derivatives: application in organic synthesis

    NASA Astrophysics Data System (ADS)

    Janikowska, K.; Rachoń, J.; Makowiec, S.

    2014-07-01

    This review is focused on an important class of Meldrum's acid derivatives commonly known as acyl Meldrum's acids. The preparation methods of these compounds are considered including the recently proposed and rather rarely used ones. The chemical properties of acyl Meldrum's acids are described in detail, including thermal stability and reactions with various nucleophiles. The possible mechanisms of these transformations are analyzed. The bibliography includes 134 references.

  13. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials.

  14. Synthesis and biological activity of glutamic acid derivatives.

    PubMed

    Receveur, J M; Guiramand, J; Récasens, M; Roumestant, M L; Viallefont, P; Martinez, J

    1998-01-20

    In order to develop new specific glutamate analogues at metabotropic glutamate receptors, Diels-Alder, 1-4 ionic and radical reactions were performed starting from (2S)-4-methyleneglutamic acid. Preliminary pharmacological evaluation by measuring IP accumulation using rat forebrain synaptoneurosomes has shown that (2S)-4-(2-phthalimidoethyl)glutamic acid (3a), (2S)-4-(4-phthalimidobutyl)glutamic acid (3b) and 1-[(S)-2-amino-2-carboxyethyl]-3,4-dimethylcyclohex-3-ene-1-carbox ylic acid (8) presented moderate antagonist activities.

  15. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  16. Indole-3-acetic Acid Synthesis in Tumorous and Nontumorous Species of Nicotiana 1

    PubMed Central

    Liu, Shih-Tung; Katz, Charles D.; Knight, C. Arthur

    1978-01-01

    The synthesis of indole-3-acetic acid (IAA) in the enzyme extracts of Nicotiana glauca, Nicotiana langsdorffii, their F1 hybrid, their amphidiploid hybrid, and the nontumorous mutant of the hybrid was investigated. Tryptamine, a possible precursor of IAA biosynthesis in Nicotiana tabacum, was not found in the callus tissue of N. glauca, N. langsdorffii, and their F1 hybrid. In petiole slices, the synthesis of IAA progressively increased during 5 hours of incubation in [14C]tryptophan. The rate of synthesis was about equal in the hybrid and N. langsdorffii but lower in N. glauca on either a cell or fresh weight basis. It was also found that tryptophan was about 25 times more efficient than tryptamine in promoting synthesis of IAA in petiole slices. It was found that indoleacetaldehyde oxidase, indoleacetaldehyde reductase, and tryptophan aminotransferase activities were present in all of the species examined; however, tryptophan decarboxylase activity was not found. The tryptophan aminotransferase activity in N. glauca, N. langsdorffii, and the nontumorous mutant required α-ketoglutaric acid and pyridoxal 5-phosphate whereas the addition of pyridoxal 5-phosphate seemed not to increase the enzyme activity in tumor plants. The tryptophan aminotransferase in the amphidiploid hybrid was partially purified by acetone precipitation. The enzyme activity had a temperature optimum at 49 C and a pH optimum at 8.9. It is suggested that there is an indolepyruvic acid pathway in the synthesis of IAA in the Nicotiana species examined. PMID:16660376

  17. Synthesis of phosphonic analogues of carnitine and gamma-amino-beta-hydroxybutyric acid.

    PubMed

    Tadeusiak, Elzbieta J

    2004-12-01

    The involvement of carnitine and gamma-amino-beta-hydroxybutyric acid in the biology of mammalian cells, the physiology of the human body, and some important aspects of medicinal treatment has induced many research groups to develop their pharmacologically potent analogues. Among them are the very important phosphonic analogues: phosphocarnitine and gamma-amino-beta-hydroxypropylphosphonic acid. This mini-review describes the various methodologies used for the synthesis of these compounds.

  18. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  19. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  20. [Genetic code: codon bases--the symbols of amino acid synthesis and catabolism pathways].

    PubMed

    Konyshev, V A

    1983-01-01

    The correlations between genetic codes of amino acids and pathways of synthesis and catabolism of carbon backbone of amino acids are considered. Codes of amino acids which are synthesized from oxoacids of glycolysis, the Krebs cycle and glyoxalic cycle via transamination without any additional chemical reactions, are initiated with guanine (alanine, glutamic and aspartic acids, glycine). Codons of amino acids which are formed on the branches of glycolysis at the level of compounds with three carbon atoms, begin with uracil (phenylalanine, serine, leucine, tyrosine, cysteine, tryptophan). Codes of amino acids formed from aspartate begin with adenine (methionine, isoleucine, threonine, asparagine, lysine, serine), while those of the amino acids formed from the compounds with five carbon atoms (glutamic acid and phosphoribosyl pyrophosphate) begin with cytosine (arginine, proline, glutamine, histidine). The second letter of codons is linked to catabolic pathways of amino acids: most of amino acids entering glycolysis and the Krebs cycle through even-numbered carbon compounds, have adenine and uracil at the second position of codes (A-U type); most of amino acids entering the glycolysis and the Krebs cycle via odd-numbered carbon compounds, have codons with guanine and cytidine at the second position (G-C type). The usage of purine and pyrimidine as the third letter of weak codones in most of amino acids is linked to the enthropy of amino acid formation. A hypothesis claiming that the linear genetic code was assembled from the purine and pyrimidine derivatives which have acted as participants of primitive control of amino acid synthesis and catabolism, is suggested.

  1. Resistance of lung fatty acid synthesis to inhibition by dietary fat in the meal-fed rat.

    PubMed

    Clarke, S D; Wilson, M D; Ibnoughazala, T

    1984-03-01

    One-half of the palmitate utilized by the lung for production of the surfactant phospholipid, dipalmitoyl phosphatidylcholine, originates from de novo palmitate synthesis in the lung. In this report the lung was examined for the influence of dietary fat on the lung de novo fatty acid synthesis pathway. Lung lipogenesis was reduced by fasting and accelerated by carbohydrate refeeding or insulin injection. However, in general lung fatty acid synthesis was unaffected by dietary fat. Supplementing one meal (high glucose diet) with as much as 36% additional fat kilocalories did not suppress lung fatty acid synthesis. An inhibition of fatty acid synthesis resulted from a fat supplement of +60 and +120% of meal kilocalories, but this inhibition was likely due to an attenuated rate of glucose absorption. Ingestion of a high carbohydrate diet supplemented with 10, 17, or 30% added kilocalories as safflower oil or palmitate had no effect on lipogenesis after 10 days. On the other hand, liver fatty acid synthesis and acetyl-CoA carboxylase were selectively suppressed by safflower oil, whereas dietary palmitate was ineffective as an inhibitor of lipogenesis. These data clearly demonstrate that the well-characterized preferential suppression of liver lipogenesis by dietary polyunsaturated fats does not extend to lung tissue, and, more importantly, the inhibition of liver lipogenesis is not secondary to an essential fatty acid deficiency. The marked resistance of lung fatty acid synthesis to inhibition by dietary fat might be a biological protective mechanism to ensure adequate palmitate for dipalmitoyl phosphatidylcholine synthesis.

  2. Nature of the Fatty Acid Synthetase Systems in Parenchymal and Epidermal Cells of Allium porrum L. Leaves 1

    PubMed Central

    Lessire, Rene; Stumpe, Paul K.

    1983-01-01

    Fatty acid synthesis was compared in cell-free extracts of epidermis and parenchyma of Allium porrum L. leaves. Parenchyma extracts had the major fatty acid synthetase (FAS) activity (70-90%) of the whole leaf; palmitic acid was also the major fatty acid synthesized when acetyl-coenzyme A (CoA) was the primer, but when acetyl-acyl carrier protein (ACP) was employed, C18:0 and C16:0 were synthesized in equal proportion. With the epidermal FAS system when either acetyl-CoA or acetyl-ACP was tested in the presence of labeled malonyl-CoA, palmitic acid was the only product synthesized. Specific activities of the FAS enzyme activities were determined in both tissue extracts. The properties of malonyl-CoA:ACP transacylase were examined from the two different tissues. The molecular weights estimated by Sephadex G-200 chromatography were 38,000 for the epidermal enzyme and 45,000 for parenchymal enzyme. The optimal pH was for both enzymes 7.8 to 8.0 and the maximal velocity 0.4 to 0.5 micromoles per milligram protein per minute. These enzymes had different affinities for malonyl-CoA and ACP. For the malonyl-CoA:ACP transacylase of epidermis, the Km values were 5.6 and 13.7 micromolar for malonyl-CoA and ACP, respectively, and 4.2 and 21.7 micromolar for the parenchymal enzyme. These results suggest that the FAS system in both tissues are nonassociated, that the malonyl-CoA:ACP transacylases are isozymes, and that both in epidermis and in parenchyma tissue two independent FAS system occur. Evidence would suggest that β-ketoacyl-ACP synthase II is present in the parenchymal cells but missing in the epidermal cell. PMID:16663268

  3. Synthesis and characterization of L-lactide and polylactic acid (PLA) from L-lactic acid for biomedical applications

    NASA Astrophysics Data System (ADS)

    Rahmayetty, Sukirno, Prasetya, Bambang; Gozan, Misri

    2017-02-01

    Lactide is the monomer for the polymer polylactic acid (PLA) from lactic acid through polycondensation and depolymerization process. The properties of PLA strongly depend on the quality of the lactide monomer from which it is synthesized. Optical purity of lactide produced in depolymerization process confirmed to be L-lactide. The highest yield of crude lactide was 38.5% at temperature 210 °C with average molecular weight (Mn) of oligomer was 2389. Ring opening polymerization of lactide using Candida rugosa lipase as biocatalyst to PLLA synthesis has been achieved to generate useful biomedical materials free from heavy metal.

  4. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  5. Synthesis and characterization of hydrogen-bond acidic functionalized graphene

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Han, Qiang; Pan, Yong; Cao, Shuya; Ding, Mingyu

    2014-05-01

    Hexafluoroisopropanol phenyl group functionalized materials have great potential in the application of gas-sensitive materials for nerve agent detection, due to the formation of strong hydrogen-bonding interactions between the group and the analytes. In this paper, take full advantage of ultra-large specific surface area and plenty of carbon-carbon double bonds and hexafluoroisopropanol phenyl functionalized graphene was synthesized through in situ diazonium reaction between -C=C- and p-hexafluoroisopropanol aniline. The identity of the as-synthesis material was confirmed by transmission electron microscopy, Raman spectroscopy, ultraviolet visible spectroscopy, X-ray photoelectron spectroscopy and thermo gravimetric analysis. The synthesis method is simply which retained the excellent physical properties of original graphene. In addition, the novel material can be assigned as an potential candidate for gas sensitive materials towards organophosphorus nerve agent detection.

  6. Asymmetric synthesis of aromatic β-amino acids using ω-transaminase: Optimizing the lipase concentration to obtain thermodynamically unstable β-keto acids.

    PubMed

    Mathew, Sam; Jeong, Seong-Su; Chung, Taeowan; Lee, Sang-Hyeup; Yun, Hyungdon

    2016-01-01

    Synthesized aromatic β-amino acids have recently attracted considerable attention for their application as precursors in many pharmacologically relevant compounds. Previous studies on asymmetric synthesis of aromatic β-amino acids using ω-transaminases could not be done efficiently due to the instability of β-keto acids. In this study, a strategy to circumvent the instability problem of β-keto acids was utilized to generate β-amino acids efficiently via asymmetric synthesis. In this work, thermodynamically stable β-ketoesters were initially converted to β-keto acids using lipase, and the β-keto acids were subsequently aminated using ω-transaminase. By optimizing the lipase concentration, we successfully overcame the instability problem of β-keto acids and enhanced the production of β-amino acids. This strategy can be used as a general approach to efficiently generate β-amino acids from β-ketoesters.

  7. Total synthesis of (±)-epithuriferic acid methyl ester via Diels-Alder reaction.

    PubMed

    Koprowski, Marek; Bałczewski, Piotr; Owsianik, Krzysztof; Różycka-Sokołowska, Ewa; Marciniak, Bernard

    2016-02-07

    In this paper, we have described the first total synthesis of (±)-epithuriferic acid methyl ester from non-natural sources, in four steps (20% overall yield). The key step involves the Diels-Alder reaction of isobenzofuran with methyl 3-(dimethoxyphosphoryl)acrylate which is controlled by "ortho" regio- and endo stereoselectivities due to the COOMe group.

  8. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  9. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  10. Total synthesis of (−)-dihydroprotolichesterenic acid via diastereoselective conjugate addition to chiral fumarates

    PubMed Central

    Hethcox, J. Caleb; Shanahan, Charles S.; Martin, Stephen F.

    2013-01-01

    A diastereoselective conjugate addition of a variety of monoorganocuprates, Li[RCuI], to chiral fumarates to provide funtionalized succinates has been developed. The utility of this reaction is demonstrated in a concise total synthesis of (−)-dihydroprotolichesterenic acid that required only four steps and proceeded in an overall 31% yield. PMID:23539490

  11. Diastereoselective addition of monoorganocuprates to a chiral fumarate: reaction development and synthesis of (-)-dihydroprotolichesterinic acid.

    PubMed

    Hethcox, J Caleb; Shanahan, Charles S; Martin, Stephen F

    2015-09-16

    Recent studies of diastereoselective conjugate additions of monoorganocuprates, Li[RCuI], to chiral γ-alkoxycrotonates and fumarates are disclosed. This methodology was applied to the shortest total synthesis of (-)-dihydroprotolichesterinic acid to date, but several attempts to prepare other succinate-derived natural products, such as pilocarpine and antrodin E, were unsuccessful.

  12. Stimulation of muscle protein synthesis by leucine is dependent on plasma amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that a physiological increase in plasma leucine increased translation initiation factor activity during 60- and 120-min leucine infusion. Muscle protein synthesis was stimulated at 60 min but not at 120 min, perhaps due to the decrease (-50%) in plasma essential amino acids (AA). ...

  13. An Overview of Stereoselective Synthesis of α-Aminophosphonic Acids and Derivatives

    PubMed Central

    Ordóñez, Mario; Rojas-Cabrera, Haydée; Cativiela, Carlos

    2009-01-01

    An overview of all methodologies published during the last few years focused to the stereoselective (diastereoselective or enantioselective) synthesis of α-aminophosphonic acids and derivatives is reported. The procedures have been classified according a retrosynthetic strategy and taking into account the formation of each one of the bonds connected to the chiral centre. PMID:20871799

  14. Methods for the synthesis of tritium-labelled fatty acids and their derivatives, oxylipins and steroids

    NASA Astrophysics Data System (ADS)

    Shevchenko, Valerii P.; Nagaev, Igor Yu; Myasoedov, Nikolai F.

    1999-10-01

    The achievements in the field of synthesis and application of tritium-labelled oxylipins, steroids, fatty acids, phospho-, sphingo- and other lipids are reviewed. The importance of these studies for the solution of current problems of biochemistry, biology and pharmacology is exemplified in the application of labelled compounds. The bibliography includes 148 references.

  15. Engineered Respiro-Fermentative Metabolism for the Production of Biofuels and Biochemicals from Fatty Acid-Rich Feedstocks▿ †

    PubMed Central

    Dellomonaco, Clementina; Rivera, Carlos; Campbell, Paul; Gonzalez, Ramon

    2010-01-01

    Although lignocellulosic sugars have been proposed as the primary feedstock for the biological production of renewable fuels and chemicals, the availability of fatty acid (FA)-rich feedstocks and recent progress in the development of oil-accumulating organisms make FAs an attractive alternative. In addition to their abundance, the metabolism of FAs is very efficient and could support product yields significantly higher than those obtained from lignocellulosic sugars. However, FAs are metabolized only under respiratory conditions, a metabolic mode that does not support the synthesis of fermentation products. In the work reported here we engineered several native and heterologous fermentative pathways to function in Escherichia coli under aerobic conditions, thus creating a respiro-fermentative metabolic mode that enables the efficient synthesis of fuels and chemicals from FAs. Representative biofuels (ethanol and butanol) and biochemicals (acetate, acetone, isopropanol, succinate, and propionate) were chosen as target products to illustrate the feasibility of the proposed platform. The yields of ethanol, acetate, and acetone in the engineered strains exceeded those reported in the literature for their production from sugars, and in the cases of ethanol and acetate they also surpassed the maximum theoretical values that can be achieved from lignocellulosic sugars. Butanol was produced at yields and titers that were between 2- and 3-fold higher than those reported for its production from sugars in previously engineered microorganisms. Moreover, our work demonstrates production of propionate, a compound previously thought to be synthesized only by propionibacteria, in E. coli. Finally, the synthesis of isopropanol and succinate was also demonstrated. The work reported here represents the first effort toward engineering microorganisms for the conversion of FAs to the aforementioned products. PMID:20525863

  16. Synthesis of mixed acid anhydrides from methane and carbon dioxide in acid solvents.

    PubMed

    Zerella, Mark; Mukhopadhyay, Sudip; Bell, Alexis T

    2003-09-04

    [reaction: see text] The reaction of CH(4) with CO(2) has been performed in anhydrous acids using VO(acac)(2) and K(2)S(2)O(8) as promoters. NMR analysis establishes that the primary product is a mixed anhydride of acetic acid and the acid solvent. In sulfuric acid, the overall reaction is CH(4) + CO(2) + SO(3) --> CH(3)C(O)-O-SO(3)H. Hydrolysis of the mixed anhydride produces acetic acid and the solvent acid. When trifluoroacetic acid is the solvent, acetic acid is primarily formed via the reaction CH(4) + CF(3)COOH --> CH(3)COOH + CHF(3).

  17. Induction of Fas receptor and Fas ligand by nodularin is mediated by NF-{kappa}B in HepG2 cells

    SciTech Connect

    Feng Gong; Li Ying; Bai Yansheng

    2011-03-15

    Nodularin is a natural toxin with multiple features, including inhibitor of protein phosphatases 1 and 2A as well as tumor initiator and promoter. One unique feature of nodularin is that this chemical is a hepatotoxin. It can accumulate into the liver after contact and lead to severe damage to hepatocyte, such as apoptosis. Fas receptor (Fas) and Fas ligand (FasL) system is a critical signaling network triggering apoptosis. In current study, we investigated whether nodularin can induce Fas and FasL expression in HepG2 cell, a well used in vitro model for the study of human hepatocytes. Our data showed nodularin induced Fas and FasL expression, at both mRNA and protein level, in a time- and dose-dependent manner. We also found nodularin induced apoptosis at the concentration and incubation time that Fas and FasL were significantly induced. Neutralizing antibody to FasL reduced nodularin-induced apoptosis. Further studies demonstrated that nodularin promoted nuclear translocation and activation of p65 subunit of NF-{kappa}B. By applying siRNA targeting p65, which knocked down p65 in HepG2 cells, we successfully impaired the activation of NF-{kappa}B by nodularin. In these p65 knockdown cells, we observed that Fas and FasL expression and apoptosis induced by nodularin were significantly reduced. These findings suggest the induction of Fas and FasL expression and thus cell apoptosis in HepG2 cells by nodularin is mediated through NF-{kappa}B pathway.

  18. Fast neutrons-induced apoptosis is Fas-independent in lymphoblastoid cells

    SciTech Connect

    Fischer, Barbara; Benzina, Sami; Jeannequin, Pierre; Dufour, Patrick; Bergerat, Jean-Pierre; Denis, Jean-Marc; Gueulette, John; Bischoff, Pierre L. . E-mail: Pierre.Bischoff@ircad.u-strasbg.fr

    2005-08-26

    We have previously shown that ionizing radiation-induced apoptosis in human lymphoblastoid cells differs according to their p53 status, and that caspase 8-mediated cleavage of BID is involved in the p53-dependent pathway. In the present study, we investigated the role of Fas signaling in caspase 8 activation induced by fast neutrons irradiation in these cells. Fas and FasL expression was assessed by flow cytometry and by immunoblot. We also measured Fas aggregation after irradiation by fluorescence microscopy. We found a decrease of Fas expression after irradiation, but no change in Fas ligand expression. We also showed that, in contrast to the stimulation of Fas by an agonistic antibody, Fas aggregation did not occur after irradiation. Altogether, our data strongly suggest that fast neutrons induced-apoptosis is Fas-independent, even in p53-dependent apoptosis.

  19. Synthesis of polyacrylic-acid-based thermochromic polymers

    NASA Astrophysics Data System (ADS)

    Srivastava, Jyoti; Alam, Sarfaraz; Mathur, G. N.

    2003-10-01

    Smart materials respond to environmental stimuli with particular changes in some variables (for example temperature, pressure and electric field etc), for that reason they are often called responsive materials. In the present work, we have synthesized thermochromic polymer based on poly acrylic acid cobalt chloride (CoCl2) and phosphoric acid (H3PO4) that visually and reversibly changes color in the temperature range (70 - 130°C). These thermochromic materials can be used as visual sensors of temperature. Thermochromic polymers are based on polyacrylic acid and CoCl2 complex.

  20. FAS Haploinsufficiency Caused by Extracellular Missense Mutations Underlying Autoimmune Lymphoproliferative Syndrome.

    PubMed

    de Bielke, María Gabriela Simesen; Perez, Laura; Yancoski, Judith; Oliveira, João Bosco; Danielian, Silvia

    2015-11-01

    Mutations in the FAS gene are the most common cause of Autoimmune Lymphoproliferative Syndrome (ALPS), and the majority of them affect the intracellular domain of FAS protein, particularly the region termed death domain. However, approximately one third of these mutations affect the extracellular region of FAS and most are stop codons, with very few missense changes having been described to date. We previously described 7 patients with a FAS missense extracellular mutation, C107Y, two in homozygozity and 5 in heterozygosity. We investigated here the mechanistic effects of this mutation and observed that the homozygous patients did not show any FAS surface expression, while the heterozygous patients had diminished receptor expression. Aiming to understand why a missense mutation was abolishing receptor expression, we analyzed intracellular FAS protein trafficking using fluorescent fusion proteins of wild type FAS, two missense extracellular mutants (FAS-C107Y and FAS-C104Y) and one missense change localized in the intracellular region, FAS-D260E. The FAS-C107Y and FAS-C104Y mutants failed to reach the cell surface, being retained at the endoplasmic reticulum, unlike the WT or the FAS-D260E which were clearly expressed at the plasma membrane. These results support haploinsufficiency as the underlying mechanism involved in the pathogenesis of ALPS caused by extracellular FAS missense mutations.

  1. Microbiologically produced carboxylic acids used as building blocks in organic synthesis.

    PubMed

    Aurich, Andreas; Specht, Robert; Müller, Roland A; Stottmeister, Ulrich; Yovkova, Venelina; Otto, Christina; Holz, Martina; Barth, Gerold; Heretsch, Philipp; Thomas, Franziska A; Sicker, Dieter; Giannis, Athanassios

    2012-01-01

    Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building blocks. Thereby, our biotechnological goal was the development of process fundamentals regarding the variable use of renewable raw materials, the development of a multi purpose bioreactor and application of a pilot plant with standard equipment for organic acid production to minimize the technological effort. Furthermore the development of new product isolation procedures, with the aim of direct product recovery, capture of products or single step operation, was necessary. The application of robust and approved microorganisms, also genetically modified, capable of using a wide range of substrates as well as producing a large spectrum of products, was of special importance. Microbiologically produced acids, like 2-oxo-glutaric acid and 2-oxo-D-gluconic acid, are useful educts for the chemical synthesis of hydrophilic triazines, spiro-connected heterocycles, benzotriazines, and pyranoic amino acids. The chiral intermediate of the tricarboxylic acid cycle, (2R,3S)-isocitric acid, is another promising compound. For the first time our process provides large quantities of enantiopure trimethyl (2R,3S)-isocitrate which was used in subsequent chemical transformations to provide new chiral entities for further usage in total synthesis and pharmaceutical research.Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building

  2. Synthesis of deuterated [D32 ]oleic acid and its phospholipid derivative [D64 ]dioleoyl-sn-glycero-3-phosphocholine.

    PubMed

    Darwish, Tamim A; Luks, Emily; Moraes, Greta; Yepuri, Nageshwar R; Holden, Peter J; James, Michael

    2013-01-01

    Oleic acid and its phospholipid derivatives are fundamental to the structure and function of cellular membranes. As a result, there has been increasing interest in the availability of their deuterated forms for many nuclear magnetic resonance, infrared, mass spectroscopy and neutron scattering studies. Here, we present for the first time a straightforward, large-scale (gram quantities) synthesis of highly deuterated [D32 ]oleic acid by using multiple, yet simple and high yielding reactions. The precursors for the synthesis of [D32 ]oleic acid are [D14 ]azelaic acid and [D17 ]nonanoic acid, which were obtained by complete deuteration (>98% D) of their (1) H forms by using metal catalysed hydrothermal H/D exchange reactions. The oleic acid was produced with ca. 94% D isotopic purity and with no contamination by the trans-isomer (elaidic acid). The subsequent synthesis of [D64 ]dioleoyl-sn-glycero-3-phosphocholine from [D32 ]oleic acid is also described.

  3. Fas-activated serine/threonine kinase (FAST K) synergizes with TIA-1/TIAR proteins to regulate Fas alternative splicing.

    PubMed

    Izquierdo, José M; Valcárcel, Juan

    2007-01-19

    The factors and mechanisms that mediate the effects of intracellular signaling cascades on alternative pre-mRNA splicing are poorly understood. TIA-1 (T-cell intracellular antigen 1) and TIAR (TIA-1-related) proteins regulate alternative pre-mRNA splicing by promoting the use of suboptimal 5' splice sites followed by uridine-rich intronic enhancer sequences. These proteins promote, for example, inclusion of Fas receptor exon 6, which leads to an mRNA encoding a pro-apoptotic form of the receptor at the expense of the form that skips exon 6, which encodes an anti-apoptotic form. Fas-activated serine/threonine kinase (FAST K) is known to interact with and phosphorylate TIA-1. Here we have tested the possibility that FAST K influences alternative pre-mRNA splicing by affecting the activity of TIA-1/TIAR. Depletion of FAST K form Jurkat cells leads to skipping of exon 6 from endogenous Fas transcripts. Conversely, FAST K overexpression enhances exon 6 inclusion of Fas reporters transfected in HeLa cells. Consistent with the possibility that the effects of FAST K are mediated by changes in the function of TIA-1/TIAR, the effects of FAST K overexpression (i) are largely suppressed by depletion of TIA-1 and TIAR and (ii) are significantly compromised by mutation of a TIA-1/TIAR-responsive enhancer present downstream of exon 6 5' splice site. Furthermore, in vitro phosphorylation of TIA-1 by FAST K results in enhanced U1 snRNP recruitment. Interestingly, this enhancement is not due to increased binding of TIA-1 to the pre-mRNA. Taken together, the results connect Fas signaling with the activity of splicing factors that modulate Fas alternative splicing, suggesting the existence of an autoregulatory loop that could serve to amplify Fas responses.

  4. Synthesis of Site-Specifically (13)C Labeled Linoleic Acids.

    PubMed

    Offenbacher, Adam R; Zhu, Hui; Klinman, Judith P

    2016-10-12

    Soybean lipoxygenase-1 (SLO-1) catalyzes the C-H abstraction from the reactive carbon (C-11) in linoleic acid as the first and rate-determining step in the formation of alkylhydroperoxides. While previous labeling strategies have focused on deuterium labeling to ascertain the primary and secondary kinetic isotope effects for this reaction, there is an emerging interest and need for selectively enriched (13)C isotopologues. In this report, we present synthetic strategies for site-specific (13)C labeled linoleic acid substrates. We take advantage of a Corey-Fuchs formyl to terminal (13)C-labeled alkyne conversion, using (13)CBr4 as the labeling source, to reduce the number of steps from a previous fatty acid (13)C synthetic labeling approach. The labeled linoleic acid substrates are useful as nuclear tunneling markers and for extracting active site geometries of the enzyme-substrate complex in lipoxygenase.

  5. [Clarification on publications concerning the synthesis of acetylsalicylic acid].

    PubMed

    Lafont, O

    1996-01-01

    Charles Frédéric Gerhardt (1816-1856) mentioned in his Traité de chimie Organique (1854) a publication, in French (realized in 1852 but published in 1853) entitled "Researches on anhydrous organic acids" in which, was reported the reaction of sodium salicylate with acetyl chloride. He thought that the reaction product was an acid anhydride, but obtained really crude acetylsalicylic acid. Later on, but also in 1853, a publication in german, by the same author related the same experiments. Surprisingly only the second publication has been mentioned in most of the historical studies on the subject. Acetyl salicylic acid was identified and synthesised in 1859 by von Gilm by another method and the product obtained by Gerhardt was identified to it in 1869.

  6. Nalidixic Acid and Macromolecular Metabolism in Tetrahymena pyriformis: Effects on Protein Synthesis

    PubMed Central

    de Castro, J. F.; Carvalho, J. F. O.; Moussatché, N.; de Castro, F. T.

    1975-01-01

    A study on the effect of nalidixic acid on macromolecular metabolism, particularly of protein, in Tetrahymena pyriformis was performed. It was shown that the compound is a potent inhibitor of deoxyribonucleic acid, ribonucleic acid, and protein synthesis for this organism. A conspicuous breakdown of polysomes, accompanied by the accumulation of 80S ribosomes, occurred in cells incubated for 10 min with the drug; polysome formation was prevented. The accumulating 80S particles were shown to be run-off ribosomal units. The incorporation of amino acids by a cell-free system is not affected by nalidixic acid. In nonproliferating cells the incorporation was also not prevented, unless the cells were previously incubated with the drug. These results are discussed in terms of the possible mechanism of action of nalidixic acid in T. pyriformis. PMID:807153

  7. Synthesis of an indole analog of folic acid

    SciTech Connect

    Shengeliya, M.S.; Avramenko, V.G.; Kuleshova, L.N.; Ershova, Yu.A.; Chernov, V.A.; Surorov, N.N.

    1987-06-01

    The authors study the replacement of the p-aminobenzoic acid (PABA) moiety. The authors synthesized an indole analog of folic acid, namely dimethyl N-(5-(2'-amino-4'-oxo-6'-pteridinyl)methylaminoindol-2-yl)glutamate. The physicochemical properties and the chemical shifts in the PMR spectra of the compounds obtained are shown. The examination of the compound for antitumor activity was carried out using rats and mice.

  8. Synthesis and biological activity of alkynoic acids derivatives against mycobacteria

    PubMed Central

    Vilchèze, Catherine; Leung, Lawrence W.; Bittman, Robert; Jacobs, William R.

    2015-01-01

    2-alkynoic acids have bactericidal activity against Mycobacterium smegmatis but their activity fall sharply as the length of the carbon chain increased. In this study, derivatives of 2- alkynoic acids were synthesized and tested against fast- and slow-growing mycobacteria. Their activity was first evaluated in M. smegmatis against their parental 2-alkynoic acids, as well as isoniazid, a first-line antituberculosis drug. The introduction of additional unsaturation or heteroatoms into the carbon chain enhanced the antimycobacterial activity of longer chain alkynoic acids (more than 19 carbons long). In contrast, although the modification of the carboxylic group did not improve the antimycobacterial activity, it significantly reduced the toxicity of the compounds against eukaryotic cells. Importantly, 4-(alkylthio)but-2-ynoic acids, had better bactericidal activity than the parental 2-alkynoic acids and on a par with isoniazid against the slow-grower Mycobacterium bovis BCG. These compounds had also low toxicity against eukaryotic cells, suggesting that they could be potential therapeutic agents against other types of topical mycobacterial infections causing skin diseases including Mycobacterium abscessus, Mycobacterium ulcerans, and Mycobacterium leprae. Moreover, they provide a possible scaffold for future drug development. PMID:26256431

  9. Fas ligand enhances hematopoietic cell engraftment through abrogation of alloimmune responses and nonimmunogenic interactions.

    PubMed

    Pearl-Yafe, Michal; Yolcu, Esma S; Stein, Jerry; Kaplan, Ofer; Yaniv, Isaac; Shirwan, Haval; Askenasy, Nadir

    2007-06-01

    Early after transplantation, donor lineage-negative bone marrow cells (lin(-) BMC) constitutively upregulated their expression of Fas ligand (FasL), suggesting an involvement of the Fas/FasL axis in engraftment. Following the observation of impaired engraftment in the presence of a dysfunctional Fas/FasL axis in FasL-defective (gld) donors or Fas-defective (lpr) recipients, we expressed a noncleavable FasL chimeric protein on the surface of donor lin(-) BMC. Despite a short life span of the protein in vivo, expression of FasL on the surface of all the donor lin(-) BMC improved the efficiency of engraftment twofold. The FasL-coated donor cells efficiently blunted the host alloimmune responses in primary recipients and retained their hematopoietic reconstituting potential in secondary transplants. Surprisingly, FasL protein improved the efficiency of engraftment in syngeneic transplants. The deficient engraftment in lpr recipients was not reversed in chimeric mice with Fas(-) stroma and Fas(+) BMC, demonstrating that the host marrow stroma was also a target of donor cell FasL. Hematopoietic stem and progenitor cells are insensitive to Fas-mediated apoptosis and thus can exploit the constitutive expression of FasL to exert potent veto activities in the early stages of engraftment. Manipulation of the donor cells using ectopic FasL protein accentuated the immunogenic and nonimmunogenic interactions between the donor cells and the host, alleviating the requirement for a megadose of transplanted cells to achieve a potent veto effect. Disclosure of potential conflicts of interest is found at the end of this article.

  10. Bioengineering of bacterial polymer inclusions catalyzing the synthesis of N-acetylneuraminic acid.

    PubMed

    Hooks, David O; Blatchford, Paul A; Rehm, Bernd H A

    2013-05-01

    N-Acetylneuraminic acid is produced by alkaline epimerization of N-acetylglucosamine to N-acetylmannosamine and then subsequent condensation with pyruvate catalyzed by free N-acetylneuraminic acid aldolase. The high-alkaline conditions of this process result in the degradation of reactants and products, while the purification of free enzymes to be used for the synthesis reaction is a costly process. The use of N-acetylglucosamine 2-epimerase has been seen as an alternative to the alkaline epimerization process. In this study, these two enzymes involved in N-acetylneuraminic acid production were immobilized to biopolyester beads in vivo in a one-step, cost-efficient process of production and isolation. Beads with epimerase-only, aldolase-only, and combined epimerase/aldolase activity were recombinantly produced in Escherichia coli. The enzymatic activities were 32 U, 590 U, and 2.2 U/420 U per gram dry bead weight, respectively. Individual beads could convert 18% and 77% of initial GlcNAc and ManNAc, respectively, at high substrate concentrations and near-neutral pH, demonstrating the application of this biobead technology to fine-chemical synthesis. Beads establishing the entire N-acetylneuraminic acid synthesis pathway were able to convert up to 22% of the initial N-acetylglucosamine after a 50-h reaction time into N-acetylneuraminic acid.

  11. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases.

  12. Synthesis and Bioactivity of (R)-Ricinoleic Acid Derivatives: A Review.

    PubMed

    Pabiś, Sylwia; Kula, Józef

    2016-01-01

    (R)-Ricinoleic acid (RA) [(12R,9Z)-hydroxyoctadecenoic acid], the main compound of castor seed oil, because of its unusual structure readily undergoes multi-directional chemical and biochemical transformations to produce derivatives with the retained carbon skeleton or with its degradation. Many of these are of high biological activity, as documented by an in vitro study, and possess therapeutic potential. This review article provides an overview of the recent developments in the area of synthesis of RA based compounds with anticancer and antimicrobial activities. Moreover, the antiinflammatory and analgesic properties of some ricinoleic acid derivatives are also highlighted.

  13. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  14. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  15. Double-helical nucleic acids with cross-linked strands: synthesis and applications in molecular biology

    NASA Astrophysics Data System (ADS)

    Antsypovitch, Sergei I.; Oretskaya, Tat'yana S.

    1998-03-01

    Data on the methods employed for cross-linking of DNA strands and for the synthesis of oligonucleotide duplexes with cross-links between strands are summarised. Existing methods are systematised; their advantages and drawbacks are discussed. The examples of applications of DNA duplexes with covalently cross-linked chains for the study of protein-nucleic acid recognition and mechanisms of action of nucleic acid-binding proteins for gaining information about the spatial structure of nucleic acids, and for the solution of other problems of molecular biology are given. The bibliography includes 131 references.

  16. Recent advances in the synthesis and application of fluorescent α-amino acids.

    PubMed

    Harkiss, Alexander H; Sutherland, Andrew

    2016-09-26

    Fluorescence spectroscopy has become a powerful technique for probing a range of complex biological processes including enzyme mechanisms and protein-protein interactions. While the application of this technique uses a number of strategies, many of these rely on the use of fluorescent α-amino acids. This review highlights the recent synthetic methods developed for the incorporation of highly conjugated chromophores into the side-chain of α-amino acids and the application of these compounds as probes for imaging in medicine and biology. In particular, the design and synthesis of α-amino acids bearing coumarin, flavone and polyaromatic derived chromophores is described.

  17. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  18. Enantiomeric deoxycholic acid: total synthesis, characterization, and preliminary toxicity toward colon cancer cell lines.

    PubMed

    Katona, Bryson W; Rath, Nigam P; Anant, Shrikant; Stenson, William F; Covey, Douglas F

    2007-11-23

    Deoxycholic acid (DCA) is an endogenous secondary bile acid implicated in numerous pathological conditions including colon cancer formation and progression and cholestatic liver disease. DCA involvement in these disease processes results partly from its ability to modulate signaling cascades within the cell, presumably through both direct receptor activation and general detergent mediated membrane changes. To further explore DCA induced changes in cell signaling, we completed a total synthesis of enantiomeric deoxycholic acid (ent-DCA) from achiral 2-methyl-1,3-cyclopentanedione. Using a modified method of the synthesis of ent-testosterone that proceeds through the (R)-(-)-Hajos-Parrish ketone, we have completed the successful synthesis of ent-DCA in 25 steps with a yield of 0.3% with all stereochemical assignments of the product confirmed by X-ray crystallography. Our studies toward this synthesis also uncovered the methodology for the development of a novel A,B-cis steroidal skeleton system containing a C3-C9 single bond as well as conditions to selectively ketalize the typically less reactive 12-carbonyl in poly-keto A,B-cis androgens. The critical micelle concentration (cmc) of ent-DCA, determined by a dye solubilization method, was identical to the cmc of natural DCA. Toxicity studies toward HT-29 and HCT-116 human colon cancer cell lines demonstrated that ent-DCA had similar effects on proliferation, yet showed a markedly decreased ability to induce apoptosis as compared to natural DCA.

  19. The promoting effects of geniposidic acid and aucubin in Eucommia ulmoides Oliver leaves on collagen synthesis.

    PubMed

    Li, Y; Sato, T; Metori, K; Koike, K; Che, Q M; Takahashi, S

    1998-12-01

    We have reported that collagen synthesis was stimulated by the administration of a hot water extract from the leaves of Eucommia ulmoides OLIVER, Eucommiaceae (Du-Zhong leaves) in false aged model rats. In this paper, we set out to examine the compounds in Du-Zhong leaves that stimulated collagen synthesis in false aged model rats. In experiment 1, a methanol extract of Du-Zhong leaves also stimulated collagen synthesis in aged model rats. An acetone fraction was derived from the methanol extract by silica gel chromatography in experiment 2. The acetone fraction mainly contained iridoides mono-glycosides such as geniposidic acid and aucubin. The administration of geniposidic acid or aucubin stimulated collagen synthesis in aged model rats in experiments 3 and 4 (significance (p<0.05)). The reported pharmacological effects of Du-Zhong leaves, including healing organs and strengthening bone and muscle, are closely related to collagen metabolism. It appears that geniposidic acid and aucubin are the actual compounds in Du-Zhong which caused the effect in our experiments.

  20. Fluoride reduced the immune privileged function of mouse Sertoli cells via the regulation of Fas/FasL system.

    PubMed

    Sun, Zilong; Nie, Qingli; Zhang, Lianjie; Niu, Ruiyan; Wang, Jundong; Wang, Shaolin

    2017-02-01

    Previous investigations have demonstrated the adverse impacts of fluoride on Sertoli cells (SCs), such as oxidative stress and apoptosis. SCs are the crucial cellular components that can create the immune privileged environment in testis. However, the effect of fluoride on SCs immune privilege is unknown. In this study, mouse SCs were exposed to sodium fluoride with varying concentrations of 10(-5), 10(-4), and 10(-3) mol/L to establish the model of fluoride-treated SCs (F-SCs) in vitro. After 48 h of incubation, F-SCs were transplanted underneath the kidney capsule of mice for 21 days, or cocultured with spleen lymphocytes for another 48 h. Immunohistochemical analysis of GATA4 in SCs grafts underneath kidney capsule presented less SCs distribution and obvious immune cell infiltration in F-SCs groups. In addition, the levels of FasL protein and mRNA in non-cocultured F-SCs decreased with the increase of fluoride concentration. When cocultured with F-SCs, lymphocytes presented significantly high cell viability and low apoptosis in F-SCs groups. Protein and mRNA expressions of FasL in cocultured F-SCs and Fas in lymphocytes were reduced, and the caspase 8 and caspase 3 mRNA levels were also decreased in fluoride groups in a dose-dependent manner. These findings indicated that fluoride influenced the testicular immune privilege through disturbing the Fas/FasL system.

  1. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  2. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  3. Novel chemical synthesis of ginkgolic acid (13:0) and evaluation of its tyrosinase inhibitory activity.

    PubMed

    Fu, Yuanqing; Hong, Shan; Li, Duo; Liu, Songbai

    2013-06-05

    A novel efficient synthesis of ginkgolic acid (13:0) from abundant 2,6-dihydroxybenzoic acid was successfully developed through a state-of-the-art palladium-catalyzed cross-coupling reaction and catalytic hydrogenation with an overall yield of 34% in five steps. The identity of the synthesized ginkgolic acid (13:0) was confirmed by nuclear magnetic resonance, mass spectrometry, infrared, and high-performance liquid chromatography. The reaction sequence of this method can be readily extended to the synthesis of other ginkgolic acids. The synthesized ginkgolic acid (13:0) exhibited promising anti-tyrosinase activity (IC₅₀ = 2.8 mg/mL) that was not correlated to antioxidant activity as probed by 1,1-diphenyl-2-picrylhydrazyl, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), ferric reducing ability of plasma, and oxygen radical absorbance capacity assays. The synthetic strategy developed in this work will significantly facilitate biological studies of ginkgolic acids that have great potential applications in food and pharmaceuticals.

  4. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  5. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  6. The use of supported acidic ionic liquids in organic synthesis.

    PubMed

    Skoda-Földes, Rita

    2014-06-26

    Catalysts obtained by the immobilisation of acidic ionic liquids (ILs) on solid supports offer several advantages compared to the use of catalytically active ILs themselves. Immobilisation may result in an increase in the number of accessible active sites of the catalyst and a reduction of the amount of the IL required. The ionic liquid films on the carrier surfaces provide a homogeneous environment for catalytic reactions but the catalyst appears macroscopically as a dry solid, so it can simply be separated from the reaction mixture. As another advantage, it can easily be applied in a continuous fixed bed reactor. In the present review the main synthetic strategies towards the preparation of supported Lewis acidic and Brønsted acidic ILs are summarised. The most important characterisation methods and structural features of the supported ionic liquids are presented. Their efficiency in catalytic reactions is discussed with special emphasis on their recyclability.

  7. Survival, Deoxyribonucleic Acid Breakdown, and Synthesis in Salmonella typhimurium as Compared with Escherichia coli B Strains

    PubMed Central

    Hudnik-Plevnik, Tamara A.; Djordjević, Nadežda

    1970-01-01

    Salmonella typhimurium LT-2 was compared with radioresistant (B/r) and radiosensitive (Bs−2) strains of Escherichia coli in respect to the survival, deoxyribonucleic acid (DNA) breakdown, and DNA synthesis after X irradiation. It is shown that S. typhimurium LT-2 is about four times more sensitive than E. coli B/r but less sensitive than Bs−2. The DNA breakdown is in S. typhimurium LT-2 lower than the postirradiation breakdown of DNA in both E. coli strains and DNA synthesis proceeds in this bacterium in spite of a much lower survival, as in the radioresistant E. coli B/r. PMID:4916313

  8. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    PubMed Central

    Feagin, Trevor A.; Shah, Nirmal I.; Heemstra, Jennifer M.

    2012-01-01

    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  9. Hydrothermal synthesis of hollow silica spheres under acidic conditions.

    PubMed

    Yu, Qiyu; Wang, Pengpeng; Hu, Shi; Hui, Junfeng; Zhuang, Jing; Wang, Xun

    2011-06-07

    It is well-known that silica can be etched in alkaline media or in a unique hydrofluoric acid (HF) solution, which is widely used to prepare various kinds of hollow nanostructures (including silica hollow structures) via silica-templating methods. In our experiments, we found that stöber silica spheres could be etched in generic acidic media in a well-controlled way under hydrothermal conditions, forming well-defined hollow/rattle-type silica spheres. Furthermore, some salts such as NaCl and Na(2)SO(4) were found to be favorable for the formation of hollow/rattle-type silica spheres.

  10. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    PubMed

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  11. Pre-germinated brown rice prevented high fat diet induced hyperlipidemia through ameliorating lipid synthesis and metabolism in C57BL/6J mice

    PubMed Central

    Shen, Kuo-Ping; Hao, Chi-Long; Yen, Hsueh-Wei; Chen, Chun-Yen; Chen, Jia-Hao; Chen, Fu-Chih; Lin, Hui-Li

    2016-01-01

    Pre-germinated brown rice (PGBR) can ameliorate hyperlipidemia, but the action mechanism is not clear. We focus the mechanisms of PGBR prevented hyperlipidemia. Six-week-old mice were divided into: standard-regular diet (SRD), high-fat diet (HFD) and HFD with PGBR (HFD + PGBR) groups for 16 weeks. The HFD group has higher concentrations of TG, TC, HDL and Non-HDL in the blood, and a higher atherosclerosis index (AI). The TG levels in the liver, and TG, bile acid levels in the feces were enhanced; and the total adipocytokines level in adipose tissue was reduced. The HFD group had higher protein expressions of SREBP-1, SCD-1, FAS, LDLR, and CYP7α1 in the liver. Moreover, the greater expressions of SREBP-1, SCD-1, FAS and the less expressions of PPAR-α and adiponectin were in adipose tissue. In the HFD + PGBR group, the PGBR regulated the levels of TG, TC, HDL, Non-HDL, AI and adipocytokines. PGBR increased more cholesterol and bile acid exhaust in feces. The SREBP-1, SCD-1, FAS, HMGCR, LDLR, CYP7α1 and PPAR-α proteins in the liver; and the SREBP-1, SCD-1, FAS, PPAR-α and adiponectin proteins in adipose tissue were reversed by PGBR. Taken together, PGBR can improve lipid synthesis and metabolism, and we suggest PGBR is a recommendable food for controlling hyperlipidemia. PMID:27499577

  12. Fas Protects Breast Cancer Stem Cells from Death

    DTIC Science & Technology

    2014-10-01

    apoptosis and DICE in breast cancer cells, with many potential therapeutical applications. I could also demonstrate the involvement of miRNA in the...process. Moreover, I have developed a novel plasmid-based tool to isolate BCSCS by the activity of miRNAs , and I am going to optimize and test the...relevance of its use in the next reporting period. 15. SUBJECT TERMS Fas, FasL, Cancer, Cancer Stem cells, Apoptosis, miRNA , EMT, cell death. 16

  13. FAS 33: accurately recording effects of changing prices.

    PubMed

    Sage, L G

    1987-02-01

    FAS 33 addresses the problem of distortion in conventional historical cost financial statements because of changing prices. It requires 1300 business enterprises to report selected changing price data on a supplementary basis. It has been demonstrated that it is also feasible and beneficial for hospitals to present price disclosures as supplementary information to their financial statements. The possible application of FAS 33 is supported on the basis that the accounting and reporting methods of healthcare institutions are similar to the accounting and reporting practices of profit-seeking entities.

  14. Physiological management of dietary deficiency in n-3 fatty acids by spawning Gulf killifish (Fundulus grandis).

    PubMed

    Patterson, Joshua T; Green, Christopher C

    2015-08-01

    Lipid dynamics of spawning fish are critical to the production of viable embryos and larvae. The present study utilized manipulation of dietary fatty acid (FA) profiles to examine the ability of spawning Gulf killifish (Fundulus grandis) to mobilize critical lipid components from somatic reserves or synthesize long-chain polyunsaturated FAs (LC-PUFAs) de novo from shorter-chain C18 precursors. An egg and multi-tissue evaluation of changes in FA concentrations across time after fish were switched from LC-PUFA-rich to LC-PUFA-deficient experimental diets was employed. The two experimental diets contained lipid sources which differed drastically in n-3 C18 FA content but had similar levels of n-6 C18 FAs. Discrete effects of dietary n-3 FAs can be analyzed because n-3 and n-6 represent distinct metabolic families which cannot be exchanged in vivo. Results indicate that a combination of mobilization and de novo synthesis is likely utilized to maintain physiologically required FA levels in critical tissues and embryos. Mobilization was supported by decreases in LC-PUFAs in somatic tissues and decreases in intraperitoneal fat content and liver mass. Evidence for biosynthesis was provided by a higher level of n-3 LC-PUFAs in the liver and ova of fish fed diets containing n-3 C18 precursors versus those fed diets with low levels of precursor FAs. The characteristic physiological plasticity of Gulf killifish is exemplified in the nutritional domain by its management of dietary FA deficiency.

  15. Structural and biophysical characterization of the interactions between the death domain of Fas receptor and calmodulin.

    PubMed

    Fernandez, Timothy F; Samal, Alexandra B; Bedwell, Gregory J; Chen, Yabing; Saad, Jamil S

    2013-07-26

    The extrinsic apoptotic pathway is initiated by cell surface death receptors such as Fas. Engagement of Fas by Fas ligand triggers a conformational change that allows Fas to interact with adaptor protein Fas-associated death domain (FADD) via the death domain, which recruits downstream signaling proteins to form the death-inducing signaling complex (DISC). Previous studies have shown that calmodulin (CaM) is recruited into the DISC in cholangiocarcinoma cells, suggesting a novel role of CaM in Fas-mediated signaling. CaM antagonists induce apoptosis through a Fas-related mechanism in cholangiocarcinoma and other cancer cell lines possibly by inhibiting Fas-CaM interactions. The structural determinants of Fas-CaM interaction and the underlying molecular mechanisms of inhibition, however, are unknown. Here we employed NMR and biophysical techniques to elucidate these mechanisms. Our data show that CaM binds to the death domain of Fas (FasDD) with an apparent dissociation constant (Kd) of ~2 μM and 2:1 CaM:FasDD stoichiometry. The interactions between FasDD and CaM are endothermic and entropically driven, suggesting that hydrophobic contacts are critical for binding. We also show that both the N- and C-terminal lobes of CaM are important for binding. NMR and surface plasmon resonance data show that three CaM antagonists (N-(6-aminohexyl)-5-chloro-1-naphthalene sulfonamide, tamoxifen, and trifluoperazine) greatly inhibit Fas-CaM interactions by blocking the Fas-binding site on CaM. Our findings provide the first structural evidence for Fas-CaM interactions and mechanism of inhibition and provide new insight into the molecular basis for a novel role of CaM in regulating Fas-mediated apoptosis.

  16. The Synthesis and Evaluation of Arctigenin Amino Acid Ester Derivatives.

    PubMed

    Cai, En-Bo; Yang, Li-Min; Jia, Cai-Xia; Zhang, Wei-Yuan; Zhao, Yan; Li, Wei; Song, Xing-Zhuo; Zheng, Man-Ling

    2016-10-01

    The use of arctigenin (ARG), a traditional medicine with many pharmacological activities, has been restricted due to its poor solubility in water. Five amino acid derivatives of ARG have been synthesized using glycine, o-alanine, valine, leucine, and isoleucine, which have t-butyloxy carbonyl (BOC) as a protective group. In this study, we examined the effects of removing these protective groups. The results showed that the amino acid derivatives have better solubility and nitrite-clearing ability than ARG. Among the compounds tested, the amino acid derivatives without protective group were the best. Based on these results, ARG and its two amino acid derivatives without protective group (ARG8, ARG10) were selected to evaluate their anti-tumor activity in vivo at a dosage of 40 mg/kg. The results indicated that ARG8 and ARG10 both exhibit more anti-tumor activity than ARG in H22 tumor-bearing mice. The tumor inhibition rates of ARG8 and ARG10 were 69.27 and 43.58%, which was much higher than ARG. Furthermore, the mice treated with these compounds exhibited less damage to the liver, kidney and immune organs compared with the positive group. Furthermore, ARG8 and ARG10 improved the serum cytokine levels significantly compared to ARG. In brief, this study provides a method to improve the water solubility of drugs, and we also provide a reference basis for new drug development.

  17. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  18. Synthesis of copper sulphide nanoparticles in carboxylic acids as solvent.

    PubMed

    Armelao, Lidia; Camozzo, Daniele; Gross, Silvia; Tondello, Eugenio

    2006-02-01

    A novel method for the preparation of CuS nanoparticles based on the fast nucleation of the sulphide has been developed. The particles have been synthesized by reaction of thioacetic acid with water and copper carboxylates (acetate, propionate) in the corresponding carboxylic acid (acetic, propionic) as a solvent. The use of carboxylic acids presents several advantages: (i) the hydrolysis of the C-S bond is favoured thus producing a fast CuS supersaturation and a high nucleation rate; (ii) the mobility of the precursor molecules is limited so that nucleation events are favoured with respect to particle growth; (iii) the low dielectric constant of the medium stabilises the nanoparticles dispersion by reducing the critical coagulation concentration. The prepared nanoparticles were investigated by UV-Vis spectroscopy, X-ray photoelectron spectroscopy, atomic force microscopy and dynamic light scattering. The nanoparticle suspensions are clear and characterized by a blue-shifted adsorption edge with respect to bulk CuS. Light scattering measurements performed on acetic acid suspensions evidence the formation of monodispersed nanoparticles with an average diameter of about 5 nm.

  19. First Synthesis of 1,4-Dimethoxy-2-Naphthoxyacetic acid.

    PubMed

    Chinea, Kimberly; Banerjee, Ajoy K

    2015-07-01

    2-Acetyl-1-hydroxynaphthalene was converted into 1,4-dimethoxy-2-naphthoxyacetic acid in seven steps (methylation, Bayer-Villiger oxidation, hydrolysis, bromination, methylation, alkylation and hydrolysis). 2-Hydroxy-1,4-naphthoquinone on acetylation, aromatization, methylation and hydrolysis, respectively, also yielded the title compound.

  20. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  1. Mitochondria-independent induction of Fas-mediated apoptosis by MSSP.

    PubMed

    Nomura, Jun; Matsumoto, Ken-Ichi; Iguchi-Ariga, Sanae M M; Ariga, Hiroyoshi

    2005-11-01

    Fas-mediated apoptosis has been proposed to play an important role in homeostasis. Fas triggers apoptosis after stimulation by its ligand FasL or the Fas ligand agonist anti-Fas antibody through a mitochondria-dependent or -independent pathway, and MSSP has been identified as a transcription factor that regulates the c-myc gene and was later found to positively or negatively regulate a variety of genes, including alpha-smooth actin, MHC class I, MHC class 2 and the thyrotropin receptor. We further found that expression of the Fas gene was repressed, resulting in abrogation of the Fas-mediated induction of apoptosis both in Mssp-knockout mice and primary thymocytes. MSSP was then found to stimulate promoter activity of the Fas gene by binding to a specific region. In this study, to identify the MSSP-dependent Fas-induced apoptosis pathway, primary fibroblasts from MSSP (+/+) and MSSP (-/-) cells were treated with the combination of interleukin 1-beta and interferon-gamma and expression of the Fas gene was examined. The results showed that the Fas gene was expressed at the same levels in the two cell types. Furthermore, when these cells were treated with the anti-Fas antibody, it was found that cytochrome C was not released in the cytosol and that activations of caspase 8 and caspase 3 occurred in primary fibroblasts from MSSP (+/+) cells but not from MSSP (-/-) cells. These results indicate that Fas-mediated apoptosis induced by MSSP occurs independently of mitochondria.

  2. An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

    PubMed

    Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

    2014-05-20

    Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies.

  3. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  4. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  5. Progressive familial intrahepatic cholestasis and inborn errors of bile acid synthesis.

    PubMed

    Jankowska, Irena; Socha, Piotr

    2012-06-01

    Progressive familial intrahepatic cholestasis (PFIC), types 1, 2 and 3, are due to defects in genes involved in bile secretion (FIC1, BSEP, MDR3). PFIC and inborn errors of bile acid synthesis (IEBAS) often present in infancy with cholestasis. The distinctive feature of PFIC 1 and 2 and IEBAS is a normal level of GGT, while IEBAS are suspected in patients with low plasma bile acids concentration. Molecular testing, urinary bile acid analysis (IEBAS), liver biopsy and immuno-staining are used for the diagnosis. Some patients with PFIC can be successfully treated with ursodeoxycholic acid or partial external biliary diversion. IEBAS is treated with cholic acid. Liver transplantation is required for cirrhosis with liver failure. Hepatocarcinoma has been reported in PFIC2.

  6. Synthesis of medronic acid monoesters and their purification by high-performance countercurrent chromatography or by hydroxyapatite

    PubMed Central

    Vepsäläinen, Jouko; Turhanen, Petri A

    2016-01-01

    Summary We achieved the synthesis of important medronic acid monoalkyl esters via the dealkylation of mixed trimethyl monoalkyl esters of medronic acid. Two methods were developed for the purification of medronic acid monoesters: 1) small scale (10–20 mg) purification by using hydroxyapatite and 2) large scale (tested up to 140 mg) purification by high-performance countercurrent chromatography (HPCCC). PMID:27829921

  7. Fmoc/Trt-amino acids: comparison to Fmoc/tBu-amino acids in peptide synthesis.

    PubMed

    Barlos, K; Gatos, D; Koutsogianni, S

    1998-03-01

    Model peptides containing the nucleophilic amino acids Trp and Met have been synthesized with the application of Fmoc/Trt- and Fmoc/tBu-amino acids, for comparison. The deprotection of the peptides synthesized using Fmoc/Trt-amino acids in all cases leads to crude peptides of higher purity than that of the same peptides synthesized using Fmoc/tBu-amino acids.

  8. Developmental aspects and factors influencing the synthesis and status of ascorbic Acid in the pig.

    PubMed

    Mahan, D C; Ching, S; Dabrowski, K

    2004-01-01

    Ascorbic acid synthesis in the pig occurs at mid-pregnancy, but activity of the enzyme l-gulono-gamma-lactone oxidase (GLO) declines thereafter during gestation and remains low when the pig nurses the sow. During late gestation the ascorbic acid concentration in the fetus increases, but serum and liver ascorbic acid concentration in the sow declines without affecting the dam's liver GLO activity. It is presumed that as gestation progresses an increased amount of maternal ascorbic acid is transferred to the fetus and to the mammary gland. Colostrum and milk are rich sources of the vitamin and supply the nursing pig with ascorbic acid. The available data suggest that high amounts of ascorbic acid appear to suppress liver GLO activity in the pig. Upon weaning, when exogenous vitamin C is generally not provided, liver GLO activity and serum ascorbic acid increases. During the initial periods postweaning, some reports have indicated growth benefits of supplemental vitamin C. Body tissues differ in their concentrations of ascorbic acid, but tissues of high metabolic need generally have greater concentrations. The corpus luteum in the female, the testis in the male, and the adrenal glands in all pigs contain greater concentrations of the vitamin. Knockout genes preventing ascorbic acid synthesis in pigs have demonstrated poor skeletal and collagen formation and poor antioxidant protection. Under periods of stress ascorbic acid declines in the adrenal, but the pig rapidly recovers to its resting state once the stressor agent is removed. Although there are periods when supplemental vitamin C has been shown to promote pig performance (e.g., during high environmental stress and early postweaning), supplemental vitamin C has not been shown to routinely enhance pig performance.

  9. Fatty Acid Synthesis Intermediates Represent Novel Noninvasive Biomarkers of Prostate Cancer Chemoprevention by Phenethyl Isothiocyanate.

    PubMed

    Singh, Krishna B; Singh, Shivendra V

    2017-03-14

    Increased de novo synthesis of fatty acids is a distinctive feature of prostate cancer, which continues to be a leading cause of cancer-related deaths among American men. Therefore, inhibition of de novo fatty acid synthesis represents an attractive strategy for chemoprevention of prostate cancer. We have shown previously that dietary feeding of phenethyl isothiocyanate (PEITC), a phytochemical derived from edible cruciferous vegetables such as watercress, inhibits incidence and burden of poorly-differentiated prostate cancer in Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model. The present study was designed to test the hypothesis of whether fatty acid intermediate(s) can serve as noninvasive biomarker(s) of prostate cancer chemoprevention by PEITC using archived plasma and tumor specimens from the TRAMP study as well as cellular models of prostate cancer. Exposure of prostate cancer cells (LNCaP and 22Rv1) to pharmacological concentrations of PEITC resulted in downregulation of key fatty acid metabolism proteins, including acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FASN), and carnitine palmitoyltransferase 1A (CPT1A). The mRNA expression of FASN and CPT1A as well as acetyl-CoA levels were decreased by PEITC treatment in both cell lines. PEITC administration to TRAMP mice also resulted in a significant decrease in tumor expression of FASN protein. Consistent with these findings, the levels of total free fatty acids, total phospholipids, triglyceride, and ATP were significantly lower in the plasma and/or prostate tumors of PEITC-treated TRAMP mice compared with controls. The present study is the first to implicate inhibition of fatty acid synthesis in prostate cancer chemoprevention by PEITC.

  10. Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.

    PubMed

    Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M

    2012-03-27

    In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages.

  11. Akt Phosphorylation and Regulation of Transketolase Is a Nodal Point for Amino Acid Control of Purine Synthesis

    PubMed Central

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T.; Phan, Tony; Pilz, Renate B.; Boss, Gerry R.

    2014-01-01

    SUMMARY The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mTORC2 and IκB kinase regulate Akt activity, and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the non-oxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the non-oxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for two days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a new mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  12. Synthesis of repressible acid phosphatase in Saccharomyces cerevisiae under conditions of enzyme instability.

    PubMed Central

    Bostian, K A; Lemire, J M; Halvorson, H O

    1982-01-01

    The synthesis of repressible acid phosphatase in Saccharomyces cerevisiae was examined under conditions of blocked derepression as described by Toh-e et al. (Mol. Gen. Genet. 162:139-149, 1978). Based on a genetic and biochemical analysis of the phenomenon these authors proposed a new regulatory model for acid phosphatase expression involving a simultaneous interaction of regulatory factors in the control of structural gene transcription. We demonstrate here that under growth conditions that fail to produce acid phosphatase the enzyme is readily inactivated. Furthermore, we demonstrate under these conditions the production of acid phosphatase mRNA which is active both in vitro and in vivo in the synthesis of enzyme. This eliminates any step prior to translation of acid phosphatase polypeptide as an explanation for the phenomenon. We interpret our results for the block in appearance of acid phosphatase as a result of both deaccelerated growth and cellular biosynthesis during derepression, accompanied by an enhanced instability of the enzyme. Images PMID:7050664

  13. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    PubMed

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  14. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  15. Protein and Ribonucleic Acid Synthesis During the Diploid Life Cycle of Allomyces arbuscula

    PubMed Central

    Burke, Daniel J.; Seale, Thomas W.; McCarthy, Brian J.

    1972-01-01

    The diploid life cycle of Allomyces arbuscula may be divided into four parts: spore induction, germination, vegetative growth, and mitosporangium formation. Spore induction, germination, and mitosporangium formation are insensitive to inhibition of actinomycin D, probably indicating that stable, pre-existing messenger ribonucleic acid (RNA) is responsible for these developmental events. Protein synthesis is necessary during the entire life cycle except for cyst formation. A system for obtaining synchronous germination of mitospores is described. During germination there is a characteristic increase in the rate of synthesis of RNA and protein although none of the other morphogenetic changes occurring during the life cycle are necessarily accompanied by an appreciable change in the rate of macromolecular synthesis. PMID:4113121

  16. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-01-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  17. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  18. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  19. Synthesis and verification of biobased terephthalic acid from furfural.

    PubMed

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-02-04

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  20. Synthesis and antifungal activity of bile acid-derived oxazoles.

    PubMed

    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela

    2016-04-01

    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives.

  1. Enzymatic synthesis of palm olein-based fatty thiohydroxamic acids.

    PubMed

    Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor Azowa Bt; Rahman, Mohd Zaki Ab

    2010-01-01

    Fatty thiohydroxamic acids (FTAs) have been successfully synthesized from palm olein and thiohydroxamic acid by a one-step lipase catalyzed reaction. The use of immobilized lipase (Lipozyme RMIM) as the catalyst for the preparation reaction provides an easy isolation of the enzyme from the products and other components in the reaction mixture. The FTAs were characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The highest conversion percentage (95 %) was obtained when the process was carried out for 30 hours using urea to palm oil ratio of 6.0: 1.0 at 40 °C. The method employed offers several advantages such as renewable and abundant of the raw material, simple reaction procedure, environmentally friendly process and high yield of the product.

  2. Glycerol and Fatty Acids in Serum Predict the Development of Hyperglycemia and Type 2 Diabetes in Finnish Men

    PubMed Central

    Mahendran, Yuvaraj; Cederberg, Henna; Vangipurapu, Jagadish; Kangas, Antti J.; Soininen, Pasi; Kuusisto, Johanna; Uusitupa, Matti; Ala-Korpela, Mika; Laakso, Markku

    2013-01-01

    OBJECTIVE We investigated the association of fasting serum glycerol and fatty acids (FAs) as predictors for worsening of hyperglycemia and incident type 2 diabetes. RESEARCH DESIGN AND METHODS Cross-sectional and longitudinal analyses of the population-based METabolic Syndrome in Men (METSIM) Study included 9,398 Finnish men (mean age 57 ± 7 years). At baseline, levels of serum glycerol, free FAs (FFAs), and serum FA profile, relative to total FAs, were measured with proton nuclear magnetic resonance spectroscopy. RESULTS At baseline, levels of glycerol, FFAs, monounsaturated FAs, saturated FAs, and monounsaturated n-7 and -9 FAs, relative to total FAs, were increased in categories of fasting and 2-h hyperglycemia, whereas the levels of n-3 and n-6 FAs, relative to total FAs, decreased (N = 9,398). Among 4,335 men with 4.5-year follow-up data available, 276 developed type 2 diabetes. Elevated levels of glycerol, FFAs, monounsaturated FAs, and saturated and monounsaturated n-7 and -9 FAs, relative to total FAs, predicted worsening of hyperglycemia and development of incident type 2 diabetes after adjustment for confounding factors. n-6 FAs, mainly linoleic acid (LA), relative to total FAs, were associated with reduced risk for the worsening of hyperglycemia and conversion to type 2 diabetes. CONCLUSIONS Our large population-based study shows that fasting serum levels of glycerol, FFAs, monounsaturated FAs, saturated FAs, and n-7 and -9 FAs are biomarkers for an increased risk of development of hyperglycemia and type 2 diabetes, whereas high levels of serum n-6 FAs, reflecting dietary intake of LA, were associated with reduced risk for hyperglycemia and type 2 diabetes. PMID:24026559

  3. First synthesis of thia steroids from cholic acid.

    PubMed

    Ibrahim-Ouali, Malika; Rocheblave, Luc

    2010-10-01

    Heterosteroids remain interesting due to their potential biological activities. This prompted us to synthesize novel thia steroids possessing the heteroatom in the A-ring. We set out to describe a new and versatile method for preparing 3-thia steroids from cholic acid via a selective oxidation of one hydroxyl group, a Baeyer-Villiger oxidation and a photolysis as the key steps. The characteristic (1)H and (13)C NMR spectroscopic features of the synthesized compounds are reported.

  4. An approach for the synthesis of nakamuric acid

    PubMed Central

    Wang, Xiaolei; Chen, Chuo

    2014-01-01

    The biosynthesis of dimeric pyrrole–imidazole alkaloids is likely mediated by enzyme-catalyzed reversible single-electron transfer (SET) cycloaddition. We now show that Ir(ppy)3 can promote SET-mediated formal [2+2] and [4+2] cycloaddition reactions of pyrrole–imidazole alkaloids-related substrates under photolytic conditions. This biomimetic approach is useful for the construction of the core skeleton of nakamuric acid and sceptrin. PMID:25983349

  5. Synthesis and characterization of fatty hydroxamic acids from triacylglycerides.

    PubMed

    Hoidy, Wisam H; Ahmad, Mansor B; Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor azowa Bt

    2010-01-01

    In this study, fatty haydroxamic acids (FHAs), which have biological activities as antibiotics and antifungal, have been synthesized via refluxing of triacylglycrides, palm olein, palm stearin or corn oil with hydroxylamine hydrochloride. The products were characterized using the complex formation test of hydroxamic acid group with zinc(I), copper(II) and iron(III), various technique methods including nuclear magnetic resonance ((1)H NMR) spectroscopy, Fourier transform infrared (FTIR) spectroscopy and elemental analysis. Parameters that may affect the conversion of oils to FHAs including the effect of reaction time, effect of organic solvent and effect of hydro/oil molar issue were also investigated in this study. Results of characterization indicate that FHAs were successfully produced from triacylglycrides. The conversion percentages of palm stearin, palm olein and corn oil into their fatty hydroxamic acids are 82, 81 and 78, respectively. Results also showed that hexane is the best organic solvent to produce the FHAs from the three oils used in this study. The optimum reaction time to achieve the maximum conversion percentage of the oils to FHAs was found to be 10 hours for all the three oils, while the optimum molar ration of hydro/to oil was found to be 7:1 for all the different three oils.

  6. Synthesis, crystal structure and computational studies of 4-nitrobenzylphosphonic acid

    NASA Astrophysics Data System (ADS)

    Wilk, Magdalena; Jarzembska, Katarzyna N.; Janczak, Jan; Hoffmann, Józef; Videnova-Adrabinska, Veneta

    2014-09-01

    4-Nitrobenzylphosphonic acid (1a) has been synthesized and structurally characterized by vibrational spectroscopy (IR and Raman) and single-crystal X-ray diffraction. Additionally, Hirshfeld surface analysis and computational methods have been used to compare the intermolecular interactions in the crystal structures of 1a and its carboxylic analogue, 4-nitrobenzylcarboxylic acid (4-NBCA). The crystal structure analysis of 1a has revealed that the acid molecules are extended into helical chains along the b axis using one of the hydrogen bonds established between phosphonic groups. The second (P)Osbnd H⋯O(P) hydrogen bond cross-links the inversion-related chains to form a thick monolayer with phosphonic groups arranged inwards and aromatic rings outwards. The nitro groups serve to link the neighbouring monolayers by weak Csbnd H⋯O(N) hydrogen bonds. Computations have confirmed the great contribution of electrostatic interactions for the crystal lattice stability. The cohesive energy, computed for the crystal structure of 1a exceeds 200 kJ mol-1 in magnitude and is nearly twice as large as that of 4-NBCA. The calculated cohesive energy values have been further related to the results of thermal analyses.

  7. Fas/CD95 prevents autoimmunity independently of lipid raft localization and efficient apoptosis induction

    PubMed Central

    Cruz, Anthony C.; Ramaswamy, Madhu; Ouyang, Claudia; Klebanoff, Christopher A.; Sengupta, Prabuddha; Yamamoto, Tori N.; Meylan, Françoise; Thomas, Stacy K.; Richoz, Nathan; Eil, Robert; Price, Susan; Casellas, Rafael; Rao, V. Koneti; Lippincott-Schwartz, Jennifer; Restifo, Nicholas P.; Siegel, Richard M.

    2016-01-01

    Mutations affecting the apoptosis-inducing function of the Fas/CD95 TNF-family receptor result in autoimmune and lymphoproliferative disease. However, Fas can also costimulate T-cell activation and promote tumour cell growth and metastasis. Palmitoylation at a membrane proximal cysteine residue enables Fas to localize to lipid raft microdomains and induce apoptosis in cell lines. Here, we show that a palmitoylation-defective Fas C194V mutant is defective in inducing apoptosis in primary mouse T cells, B cells and dendritic cells, while retaining the ability to enhance naive T-cell differentiation. Despite inability to efficiently induce cell death, the Fas C194V receptor prevents the lymphoaccumulation and autoimmunity that develops in Fas-deficient mice. These findings indicate that induction of apoptosis through Fas is dependent on receptor palmitoylation in primary immune cells, and Fas may prevent autoimmunity by mechanisms other than inducing apoptosis. PMID:28008916

  8. Superoxide anion is a natural inhibitor of FAS-mediated cell death.

    PubMed Central

    Clément, M V; Stamenkovic, I

    1996-01-01

    The cell surface receptor Fas is a major trigger of apoptosis. However, expression of the Fas receptor in many tumor cell types does not correlate with sensitivity to Fas-mediated cell death. Because a prooxidant state is a common feature of tumor cells, we examined the role of intracellular reactive oxygen intermediates in the regulation of Fas-mediated cytotoxicity. Our results show that an oxidative stress induced by increasing the intracellular superoxide anion (O2-) concentration can abrogate Fas-mediated apoptosis in cells which are constitutively sensitive to Fas. Conversely, an O2- concentration decrease is observed to sensitize cells which are naturally resistant to Fas signals. These observations suggest that intracellular O2- may play a key role in regulating cell sensitivity to a potentially lethal signal and provide tumor cells with a natural, inducible mechanism of resistance to Fas-mediated apoptosis. Images PMID:8617197

  9. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  10. Ceramide mediates FasL-induced caspase 8 activation in colon carcinoma cells to enhance FasL-induced cytotoxicity by tumor-specific cytotoxic T lymphocytes

    PubMed Central

    Coe, Genevieve L.; Redd, Priscilla S.; Paschall, Amy V.; Lu, Chunwan; Gu, Lilly; Cai, Houjian; Albers, Thomas; Lebedyeva, Iryna O.; Liu, Kebin

    2016-01-01

    FasL-mediated cytotoxicity is one of the mechanisms that CTLs use to kill tumor cells. However, human colon carcinoma often deregulates the Fas signaling pathway to evade host cancer immune surveillance. We aimed at testing the hypothesis that novel ceramide analogs effectively modulate Fas function to sensitize colon carcinoma cells to FasL-induced apoptosis. We used rational design and synthesized twenty ceramide analogs as Fas function modulators. Five ceramide analogs, IG4, IG7, IG14, IG17, and IG19, exhibit low toxicity and potent activity in sensitization of human colon carcinoma cells to FasL-induced apoptosis. Functional deficiency of Fas limits both FasL and ceramide analogs in the induction of apoptosis. Ceramide enhances FasL-induced activation of the MAPK, NF-κB, and caspase 8 despite induction of potent tumor cell death. Finally, a sublethal dose of several ceramide analogs significantly increased CTL-mediated and FasL-induced apoptosis of colon carcinoma cells. We have therefore developed five novel ceramide analogs that act at a sublethal dose to enhance the efficacy of tumor-specific CTLs, and these ceramide analogs hold great promise for further development as adjunct agents in CTL-based colon cancer immunotherapy. PMID:27487939

  11. Acid Gradient across Plasma Membrane Can Drive Phosphate Bond Synthesis in Cancer Cells: Acidic Tumor Milieu as a Potential Energy Source

    PubMed Central

    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

    2015-01-01

    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

  12. Arabidopsis Lipins, PDAT1 Acyltransferase, and SDP1 Triacylglycerol Lipase Synergistically Direct Fatty Acids toward β-Oxidation, Thereby Maintaining Membrane Lipid Homeostasis[C][W

    PubMed Central

    Fan, Jilian; Yan, Chengshi; Roston, Rebecca; Shanklin, John

    2014-01-01

    Triacylglycerol (TAG) metabolism is a key aspect of intracellular lipid homeostasis in yeast and mammals, but its role in vegetative tissues of plants remains poorly defined. We previously reported that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is crucial for diverting fatty acids (FAs) from membrane lipid synthesis to TAG and thereby protecting against FA-induced cell death in leaves. Here, we show that overexpression of PDAT1 enhances the turnover of FAs in leaf lipids. Using the trigalactosyldiacylglycerol1-1 (tgd1-1) mutant, which displays substantially enhanced PDAT1-mediated TAG synthesis, we demonstrate that disruption of SUGAR-DEPENDENT1 (SDP1) TAG lipase or PEROXISOMAL TRANSPORTER1 (PXA1) severely decreases FA turnover, leading to increases in leaf TAG accumulation, to 9% of dry weight, and in total leaf lipid, by 3-fold. The membrane lipid composition of tgd1-1 sdp1-4 and tgd1-1 pxa1-2 double mutants is altered, and their growth and development are compromised. We also show that two Arabidopsis thaliana lipin homologs provide most of the diacylglycerol for TAG synthesis and that loss of their functions markedly reduces TAG content, but with only minor impact on eukaryotic galactolipid synthesis. Collectively, these results show that Arabidopsis lipins, along with PDAT1 and SDP1, function synergistically in directing FAs toward peroxisomal β-oxidation via TAG intermediates, thereby maintaining membrane lipid homeostasis in leaves. PMID:25293755

  13. Loss of Nuclear Receptor SHP Impairs but Does Not Eliminate Negative Feedback Regulation of Bile Acid Synthesis

    PubMed Central

    Kerr, Thomas A.; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W.; Schwarz, Margrit

    2014-01-01

    Summary The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  14. Exposure to omega-3 fatty acids at early age accelerate bone growth and improve bone quality.

    PubMed

    Koren, Netta; Simsa-Maziel, Stav; Shahar, Ron; Schwartz, Betty; Monsonego-Ornan, Efrat

    2014-06-01

    Omega-3 fatty acids (FAs) are essential nutritional components that must be obtained from foods. Increasing evidence validate that omega-3 FAs are beneficial for bone health, and several mechanisms have been suggested to mediate their effects on bone, including alterations in calcium absorption and urinary calcium loss, prostaglandin synthesis, lipid oxidation, osteoblast formation and inhibition of osteoclastogenesis. However, to date, there is scant information regarding the effect of omega-3 FAs on the developing skeleton during the rapid growth phase. In this study we aim to evaluate the effect of exposure to high levels of omega-3 FAs on bone development and quality during prenatal and early postnatal period. For this purpose, we used the fat-1 transgenic mice that have the ability to convert omega-6 to omega-3 fatty acids and the ATDC5 chondrogenic cell line as models. We show that exposure to high concentrations of omega-3 FAs at a young age accelerates bone growth through alterations of the growth plate, associated with increased chondrocyte proliferation and differentiation. We further propose that those effects are mediated by the receptors G-protein coupled receptor 120 (GPR120) and hepatic nuclear factor 4α, which are expressed by chondrocytes in culture. Additionally, using a combined study on the structural and mechanical bone parameters, we show that high omega-3 levels contribute to superior trabecular and cortical structure, as well as to stiffer bones and improved bone quality. Most interestingly, the fat-1 model allowed us to demonstrate the role of maternal high omega-3 concentration on bone growth during the gestation and postnatal period.

  15. Stimulation of skeletal muscle protein synthesis in neonatal pigs by long-term infusion of leucine is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...

  16. Synthesis of a Homologous Series of Side Chain Extended Orthogonally-Protected Aminooxy-Containing Amino Acids

    PubMed Central

    Liu, Fa; Thomas, Joshua; Burke, Terrence R.

    2008-01-01

    Practical methodology is reported for the synthesis of a homologous series of side chain extended amino acids containing aminooxy functionality bearing orthogonal protection suitable for Fmoc peptide synthesis. These reagents may be useful for the preparation of libraries containing fragments joined by peptide linkers. PMID:19122755

  17. Choroidal retinoic acid synthesis: a possible mediator between refractive error and compensatory eye growth.

    PubMed

    Mertz, J R; Wallman, J

    2000-04-01

    Research over the past two decades has shown that the growth of young eyes is guided by vision. If near- or far-sightedness is artificially imposed by spectacle lenses, eyes of primates and chicks compensate by changing their rate of elongation, thereby growing back to the pre-lens optical condition. Little is known about what chemical signals might mediate between visual effects on the retina and alterations of eye growth. We present five findings that point to choroidal retinoic acid possibly being such a mediator. First, the chick choroid can convert retinol into all-trans-retinoic acid at the rate of 11 +/- 3 pmoles mg protein(-1) hr(-1), compared to 1.3 +/- 0.3 for retina/RPE and no conversion for sclera. Second, those visual conditions that cause increased rates of ocular elongation (diffusers or negative lens wear) produce a sharp decrease in all-trans-retinoic acid synthesis to levels barely detectable with our assay. In contrast, visual conditions which result in decreased rates of ocular elongation (recovery from diffusers or positive lens wear) produce a four- to five-fold increase in the formation of all-trans-retinoic acid. Third, the choroidal retinoic acid is found bound to a 28-32 kD protein. Fourth, a large fraction of the choroidal retinoic acid synthesized in culture is found in a nucleus-enriched fraction of sclera. Finally, application of retinoic acid to cultured sclera at physiological concentrations produced an inhibition of proteoglycan production (as assessed by measuring sulfate incorporation) with a EC50 of 8 x 10(-7) M. These results show that the synthesis of choroidal retinoic acid is modulated by those visual manipulations that influence ocular elongation and that this retinoic acid may reach the sclera in concentrations adequate to modulate scleral proteoglycan formation.

  18. Inhibition of fatty acid and cholesterol synthesis by stimulation of AMP-activated protein kinase.

    PubMed

    Henin, N; Vincent, M F; Gruber, H E; Van den Berghe, G

    1995-04-01

    AMP-activated protein kinase is a multisubstrate protein kinase that, in liver, inactivates both acetyl-CoA carboxylase, the rate-limiting enzyme of fatty acid synthesis, and 3-hydroxy-3-methyl-glutaryl-CoA reductase, the rate-limiting enzyme of cholesterol synthesis. AICAR (5-amino 4-imidazolecarboxamide ribotide, ZMP) was found to stimulate up to 10-fold rat liver AMP-activated protein kinase, with a half-maximal effect at approximately 5 mM. In accordance with previous observations, addition to suspensions of isolated rat hepatocytes of 50-500 microM AICAriboside, the nucleoside corresponding to ZMP, resulted in the accumulation of millimolar concentrations of the latter. This was accompanied by a dose-dependent inactivation of both acetyl-CoA carboxylase and 3-hydroxy-3-methylglutaryl-CoA reductase. Addition of 50-500 microM AICAriboside to hepatocyte suspensions incubated in the presence of various substrates, including glucose and lactate/pyruvate, caused a parallel inhibition of both fatty acid and cholesterol synthesis. With lactate/pyruvate (10/1 mM), half-maximal inhibition was obtained at approximately 100 microM, and near-complete inhibition at 500 microM AICAriboside. These findings open new perspectives for the simultaneous control of triglyceride and cholesterol synthesis by pharmacological stimulators of AMP-activated protein kinase.

  19. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  20. Stimulation of phosphatidic acid of calcium influx and cyclic GMP synthesis in neuroblastoma cells.

    PubMed

    Ohsako, S; Deguchi, T

    1981-11-10

    Phosphatidic acid added to the medium markedly elevated intracellular cyclic GMP content in cultured neuroblastoma N1E 115 cells. There was a significant elevation of cyclic GMP with 1 micrograms/ml and a maximum (70-fold) elevation with 100 micrograms/ml of phosphatidic acid. Other natural phospholipids did not increase, or increased only slightly, the cyclic GMP content in the cells. The elevation of cyclic GMP content by phosphatidic acid was absolutely dependent on extracellular calcium. Phosphatidic acid stimulated the influx of calcium into neuroblastoma cells 2- to 5-fold. The pattern of the calcium influx induced by phosphatidic acid was comparable to that of cyclic GMP elevation. The stimulation of calcium influx by phosphatidic acid was also observed in cultured heart cells, indicating that phosphatidic acid acts as a calcium ionophore or opens a specific calcium-gate in a variety of cell membranes. Treatment of neuroblastoma cells with phospholipase C increased 32Pi labeling of phosphatidic acid, stimulated the influx of calcium, and elevated the cyclic GMP content in the cells. Thus exogenous as well as endogenous phosphatidic acid stimulates the translocation of calcium across cell membranes and, as a consequence, induces the synthesis of cyclic GMP in the neuroblastoma cells.

  1. Amelioration of collagen-induced arthritis by CD95 (Apo-1/Fas)-ligand gene transfer.

    PubMed Central

    Zhang, H; Yang, Y; Horton, J L; Samoilova, E B; Judge, T A; Turka, L A; Wilson, J M; Chen, Y

    1997-01-01

    Both rheumatoid arthritis and animal models of autoimmune arthritis are characterized by hyperactivation of synovial cells and hyperplasia of the synovial membrane. The activated synovial cells produce inflammatory cytokines and degradative enzymes that lead to destruction of cartilage and bones. Effective treatment of arthritis may require elimination of most or all activated synovial cells. The death factor Fas/Apo-1 and its ligand (FasL) play pivotal roles in maintaining self-tolerance and immune privilege. Fas is expressed constitutively in most tissues, and is dramatically upregulated at the site of inflammation. In both rheumatoid arthritis and animal models of autoimmune arthritis, high levels of Fas are expressed on activated synovial cells and infiltrating leukocytes in the inflamed joints. Unlike Fas, however, the levels of FasL expressed in the arthritic joints are extremely low, and most activated synovial cells survive despite high levels of Fas expression. To upregulate FasL expression in the arthritic joints, we have generated a recombinant replication-defective adenovirus carrying FasL gene; injection of the FasL virus into inflamed joints conferred high levels of FasL expression, induced apoptosis of synovial cells, and ameliorated collagen-induced arthritis in DBA/1 mice. The Fas-ligand virus also inhibited production of interferon-gamma by collagen-specific T cells. Coadministration of Fas-immunoglobulin fusion protein with the Fas-ligand virus prevented these effects, demonstrating the specificity of the Fas-ligand virus. Thus, FasL gene transfer at the site of inflammation effectively ameliorates autoimmune disease. PMID:9329958

  2. Involvement of soluble Fas Ligand in germ cell apoptosis in testis of rats undergoing autoimmune orchitis.

    PubMed

    Jacobo, Patricia Verónica; Fass, Mónica; Pérez, Cecilia Valeria; Jarazo-Dietrich, Sabrina; Lustig, Livia; Theas, María Susana

    2012-11-01

    Experimental autoimmune orchitis (EAO) is a model of chronic inflammation and infertility useful for studying immune and germ cell (GC) interactions. EAO is characterized by severe damage of seminiferous tubules (STs) with GCs that undergo apoptosis and sloughing. Based on previous results showing that Fas-Fas Ligand (L) system is one of the main mediators of apoptosis in EAO, in the present work we studied the involvement of Fas and the soluble form of FasL (sFasL) in GC death induction. EAO was induced in rats by immunization with testis homogenate and adjuvants; control (C) rats were injected with adjuvants; a group of non-immunized normal (N) rats was also studied. Activation of Fas employing an anti-Fas antibody decreased viability (trypan blue exclusion test) and induced apoptosis (TUNEL) of GCs from STs of N and EAO rats, an effect more pronounced on GCs from EAO STs. By Western blot we detected an increase in sFasL content in the testicular fluid of rats with severe EAO compared to N and C rats. By intratesticular injection of FasL conjugated to Strep-Tag molecule (FasL-Strep, BioTAGnology) and its immunofluorescent localization, we demonstrated that sFasL is able to enter the adluminal compartment of the STs. Moreover, FasL-Strep induced GC apoptosis in testicular fragments of N rats. By flow cytometry, we detected an increase in the number of membrane FasL-expressing CD4+ and CD8+ T cells in testis during EAO development but no expression of FasL by macrophages. Our results demonstrate that sFasL is locally produced in the chronically inflamed testis and that this molecule is able to enter the adluminal compartment of STs and induce apoptosis of Fas-bearing GCs.

  3. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.

    1980-01-01

    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  4. Fatty Acid Synthesis and Control of Caspase 2 in Prostate Cancer

    DTIC Science & Technology

    2013-05-01

    July 2011- 30 June 2012 4 . TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fatty Acid Synthesis and control of Caspase 2 in Prostate Cancer 5b. GRANT...Introduction…………………………………………………………….………..….. 4 Body………………………………………………………………………………….. 4 -6 Key Research Accomplishments...combination  with  inhibitors  of  NADPH  production   ( DHEA ),  fatty  acid  synthesis,  (C75,  C93,  cerulenin)  and  CaMKII

  5. Synthesis and in vitro Evaluation of Polymeric Prodrug of Ibuprofen with Amino Acid Spacer.

    PubMed

    Redasani, Vivekkumar K; Bari, Sanjay B

    2015-01-01

    The present work is an agreement with simple and efficient method of improving the therapeutic efficacy of ibuprofen by masking its acidic moiety. It aims to reduce gastrointestinal side effects by controlling the rate, duration and site of release. This is achieved by synthesis and evaluation of polymeric prodrug of ibuprofen with natural polymer sodium alginate. The synthesis was supported by N-protected serine as spacer due to chemical incompatibility of drug and polymer. Synthesized prodrug was characterized for confirmation of said structures. The in-vitro dissolution profile of ibuprofen-alginate prodrug showed that the release of the drug is significantly higher in case of pH 7.2 buffer as compared to ibuprofen, which might be due to ester group adjacent to drug get hydrolyzed. The hydrolysis was found to be with faster rate in alkaline media than that of in acidic media.

  6. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  7. 7 CFR 1484.70 - Must Cooperators report to FAS?

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... after completion of travel (other than local travel), a Cooperator shall submit a trip report. The report must include the name(s) of the traveler(s), purpose of travel, itinerary, names and affiliations... 7 Agriculture 10 2014-01-01 2014-01-01 false Must Cooperators report to FAS? 1484.70 Section...

  8. 7 CFR 1484.70 - Must Cooperators report to FAS?

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Must Cooperators report to FAS? 1484.70 Section 1484.70 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION, DEPARTMENT OF AGRICULTURE EXPORT PROGRAMS PROGRAMS TO HELP DEVELOP FOREIGN MARKETS FOR...

  9. 7 CFR 1484.70 - Must Cooperators report to FAS?

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Must Cooperators report to FAS? 1484.70 Section 1484.70 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS PROGRAMS TO HELP DEVELOP FOREIGN MARKETS...

  10. Ribonucleic Acid and Protein Synthesis During Germination of Myxococcus xanthus Myxospores

    PubMed Central

    Juengst, Fredrick W.; Dworkin, Martin

    1973-01-01

    Ribonucleic acid (RNA) and protein synthesis during myxospore germination were examined. When RNA synthesis was inhibited more than 90% by either actinomycin D (Act D) or rifampin, germination was prevented. The data were consistent with the interpretation that rifampin did not interfere with protein synthesis in any way other than by inhibition of messenger RNA formation. Act D concentrations as high as 20 μg/ml did not totally inhibit RNA synthesis. In the presence of 8 μg of Act D/ml, germinating myxospores synthesized transfer RNA, 16S RNA, and 23S RNA. Evidence was presented which indicated that messenger RNA was also synthesized early in the germination period both in the presence and absence of 8 μg of Act D/ml. One explanation for the escape synthesis of RNA in germinating myxospores is that Act D exerts a differential effect on the transcription of larger versus smaller cistrons, the latter having a lower probability of binding Act D. We have found that in the presence of 8 μg of Act D/ml, escape RNA synthesis in myxospores was 25% for 23S RNA, 55% for 16S RNA, and more than 90% for 4S RNA. We have shown that germination of myxospores requires both RNA and protein synthesis during the first 25 to 35 min in germination medium. This finding does not support the earlier suggestion by Ramsey and Dworkin that a stable germination messenger RNA is required for germination of the myxospores of Myxococcus xanthus. PMID:4690965

  11. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  12. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin

    2014-12-22

    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  13. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  14. Selective synthesis of thioethers in the presence of a transition-metal-free solid Lewis acid.

    PubMed

    Santoro, Federica; Mariani, Matteo; Zaccheria, Federica; Psaro, Rinaldo; Ravasio, Nicoletta

    2016-01-01

    The synthesis of thioethers starting from alcohols and thiols in the presence of amorphous solid acid catalysts is reported. A silica alumina catalyst with a very low content in alumina gave excellent results in terms of both activity and selectivity also under solvent-free conditions. The reaction rate follows the electron density of the carbinol atom in the substrate alcohol and yields up to 99% and can be obtained for a wide range of substrates under mild reaction conditions.

  15. Aminochlorination in water: first Brønsted acid-promoted synthesis of vicinal chloramines.

    PubMed

    Wu, Xue-Liang; Wang, Guan-Wu

    2007-11-23

    A practical and scaleable route for the regio- and diastereoselective synthesis of vicinal chloramines from electron-deficient olefins and Chloramine-T promoted by Brønsted acids in water has been realized for the first time. This novel protocol is efficient, mild, ecofriendly, and broadly applicable for the aminochlorination of various electron-deficient olefins including alpha,beta-unsaturated ketones, cinnamate, and cinnamide. Water represents as a privileged solvent for the aminochlorination reaction in our system.

  16. Synthesis of 2-(hetero)aryl-5-(trimethylsilylethynyl)oxazoles from (hetero)arylacrylic acids.

    PubMed

    Pankova, Alena S; Stukalov, Alexander Yu; Kuznetsov, Mikhail A

    2015-04-17

    A three-step method for the synthesis of 2-(hetero)aryl-5-(trimethylsilylethynyl)oxazoles is described. Easily accessible bis(trimethylsilyl)acetylene and acrylic acid derivatives are used as starting materials for the preparation of mono- and disubstituted 5-(trimethylsilyl)pent-1-en-4-yn-3-ones. Oxidative phthalimidoaziridination of these enynones provides the key 2-acyl-1-phthalimidoaziridines that are further utilized in the thermal expansion of the three-membered ring to furnish the target functionalizable oxazoles.

  17. Synthesis and biological evaluation of new salvinorin A analogues incorporating natural amino acids.

    PubMed

    Fichna, Jakub; Lewellyn, Kevin; Yan, Feng; Roth, Bryan L; Zjawiony, Jordan K

    2011-01-01

    The synthesis and in vitro evaluation of a new series of salvinorin A analogues substituted at the C(2) position with natural amino acids is reported. Compound 12, containing Val, displayed high affinity and full agonist activity at the kappa-opioid receptor. Analogues with bulky and/or aromatic residues were inactive, showing the importance of size and electronegativity of C(2)-substituents for binding affinity of salvinorin A derivatives.

  18. One-step synthesis of 1-chloro-3-arylacetone derivatives from arylacetic acids.

    PubMed

    Zacuto, Michael J; Dunn, Robert F; Figus, Margaret

    2014-09-19

    A practical one-step method has been developed to prepare α-chloroketones from readily available, inexpensive phenylacetic acid derivatives. The method utilizes the unique reactivity of an intermediate Mg-enolate dianion, which displays selectivity for the carbonyl carbon of chloromethyl carbonyl electrophiles. Decarboxylation of the intermediate occurs spontaneously during the reaction quench. The utility of the reaction products has been demonstrated through the total synthesis of the natural product cimiracemate B.

  19. Selective synthesis of thioethers in the presence of a transition-metal-free solid Lewis acid

    PubMed Central

    Santoro, Federica; Mariani, Matteo; Zaccheria, Federica; Psaro, Rinaldo

    2016-01-01

    The synthesis of thioethers starting from alcohols and thiols in the presence of amorphous solid acid catalysts is reported. A silica alumina catalyst with a very low content in alumina gave excellent results in terms of both activity and selectivity also under solvent-free conditions. The reaction rate follows the electron density of the carbinol atom in the substrate alcohol and yields up to 99% and can be obtained for a wide range of substrates under mild reaction conditions. PMID:28144333

  20. Structure and function of eukaryotic fatty acid synthases.

    PubMed

    Maier, Timm; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2010-08-01

    In all organisms, fatty acid synthesis is achieved in variations of a common cyclic reaction pathway by stepwise, iterative elongation of precursors with two-carbon extender units. In bacteria, all individual reaction steps are carried out by monofunctional dissociated enzymes, whereas in eukaryotes the fatty acid synthases (FASs) have evolved into large multifunctional enzymes that integrate the whole process of fatty acid synthesis. During the last few years, important advances in understanding the structural and functional organization of eukaryotic FASs have been made through a combination of biochemical, electron microscopic and X-ray crystallographic approaches. They have revealed the strikingly different architectures of the two distinct types of eukaryotic FASs, the fungal and the animal enzyme system. Fungal FAS is a 2·6 MDa α₆β₆ heterododecamer with a barrel shape enclosing two large chambers, each containing three sets of active sites separated by a central wheel-like structure. It represents a highly specialized micro-compartment strictly optimized for the production of saturated fatty acids. In contrast, the animal FAS is a 540 kDa X-shaped homodimer with two lateral reaction clefts characterized by a modular domain architecture and large extent of conformational flexibility that appears to contribute to catalytic efficiency.

  1. Synthesis and cytotoxicity of A-homo-lactam derivatives of cholic acid and 7-deoxycholic acid.

    PubMed

    Huang, Yanmin; Chen, Sijing; Cui, Jianguo; Gan, Chunfang; Liu, Zhiping; Wei, Yingliang; Song, Huachan

    2011-06-01

    Using cholic acid and deoxycholic acid as starting materials, a series of 3-aza-A-homo-4-one bile acid and 7-deoxycholic acid derivatives were synthesized by the esterification, oxidation, reduction, oximation and Beckman rearrangement etc. The cytotoxicity of the synthesized compounds against MGC 7901 (human ventriculi carcinoma cell line), hela (human cervical carcinoma cell line), SMMC 7404 (human liver carcinoma cell line) were investigated. The results showed that bile acid and 7-deoxycholic-acid derivatives with 3-aza-A-homo-4-one configuration bearing a 6-hydroximino or 12-hydroximino group displayed a distinct cytotoxicity to Hela tumor cell line. In particular, the IC(50) values of the compounds 6 and 13 were 14.3 and 24.3 μmol/L against Hela human tumor cell line respectively. The information obtained from the studies may be useful for the design of novel chemotherapeutic drugs.

  2. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.

    2015-06-24

    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  3. Acetate Dose-Dependently Stimulates Milk Fat Synthesis in Lactating Dairy Cows.

    PubMed

    Urrutia, Natalie L; Harvatine, Kevin J

    2017-03-22

    Background: Acetate is a short-chain fatty acid (FA) that is especially important to cows because it is the major substrate for de novo FA synthesis. However, the effect of acetate supply on mammary lipid synthesis is not clear.Objective: The objective of this experiment was to determine the effect of increasing acetate supply on milk fat synthesis in lactating dairy cows.Methods: Six multiparous lactating Holstein cows were randomly assigned to treatments in a replicated design to investigate the effect of acetate supply on milk fat synthesis. Treatments were 0 (control), 5, 10, and 15 mol acetate/d continuously infused into the rumen for 4 d. Rumen short-chain FAs, plasma hormones and metabolites, milk fat concentration, and milk FA profile were analyzed on day 4 of each treatment. Polynomial contrasts were used to test the linear and quadratic effects of increasing acetate supply.Results: Acetate increased milk fat yield quadratically (P < 0.01) by 7%, 16%, and 14% and increased milk fat concentration linearly (P < 0.001) by 6%, 9%, and 11% for 5, 10, and 15 mol acetate/d, respectively, compared with the control treatment. Increased milk fat yield predominantly was due to a linear increase in 16-carbon FAs (P < 0.001) and a quadratic increase in de novo synthesized FAs (<16-carbon FAs; P < 0.01), indicating that there was stimulation of de novo synthesis pathways. Apparent transfer of acetate to milk fat was 33.4%, 36.2%, and 20.6% for 5, 10, and 15 mol/d, respectively. Acetate infusion linearly increased the relative concentration of rumen acetate (P < 0.001) before feeding, but not after feeding. Acetate linearly increased plasma ß-hydroxybutyric acid by 29%, 50%, and 78%, respectively, after feeding compared with the control treatment (P < 0.01).Conclusions: Increasing acetate supply to lactating cows increases milk fat synthesis, suggesting that nutritional strategies that increase ruminal acetate absorption would be expected to increase milk fat by

  4. 7 CFR 1484.30 - How does FAS formalize its working relationship with approved Cooperators?

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false How does FAS formalize its working relationship with... FAS formalize its working relationship with approved Cooperators? FAS will notify each applicant in... sign the program agreement and submit the signed agreement to the Director, Marketing Operations...

  5. Trophoblasts express Fas ligand: a proposed mechanism for immune privilege in placenta and maternal invasion.

    PubMed

    Uckan, D; Steele, A; Cherry; Wang, B Y; Chamizo, W; Koutsonikolis, A; Gilbert-Barness, E; Good, R A

    1997-08-01

    Cross-linking of Fas (CD95, APO-1) and Fas ligand (FasL; CD95L) induces apoptosis of Fas-bearing cells. Recent evidence suggests that FasL. expression plays an important role in maintenance of immune privilege in murine testis and eye and in tumour escape from immune rejection in colon cancer, melanoma and hepatocellular carcinoma. Bcl-2 is a membrane protein that suppresses apoptosis in response to a variety of stimuli. In this paper we describe abundant expression of FasL protein and mRNA transcripts within the immune privileged environment of the placenta by immunohistochemistry and reverse transcription in-situ polymerase chain reaction methods. The syncytiotrophoblast layer, the main site of feto-maternal interface, and extravillous trophoblasts, demonstrated consistent immunoreactivity for FasL in term placentae. Co-occurrence of Fas and Bcl-2 were detected with a similar pattern of distribution with FasL. The TUNEL method revealed evidence of apoptosis in the placental tissues. We speculate that abundant presence of FasL in the trophoblast contributes to immune privilege in this unique environment, perhaps by fostering apoptosis of activated Fas-expressing lymphocytes of maternal origin. An apoptotic process mediated by FasL may also play a role in placental invasion during implantation and underscores similarities between the trophoblast and neoplastic cells.

  6. 7 CFR 1484.57 - Will FAS make advance payments to a Cooperator?

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... an advance, FAS may require the participant to submit security in a form and amount acceptable to FAS... where a special advance is outstanding from a prior marketing plan year. Cooperators shall deposit and... reimbursement claim. All checks shall be mailed to the Director, Marketing Operations Staff, FAS, USDA....

  7. 7 CFR 1484.57 - Will FAS make advance payments to a Cooperator?

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... an advance, FAS may require the participant to submit security in a form and amount acceptable to FAS... where a special advance is outstanding from a prior marketing plan year. Cooperators shall deposit and... reimbursement claim. All checks shall be mailed to the Director, Marketing Operations Staff, FAS, USDA....

  8. 7 CFR 1484.57 - Will FAS make advance payments to a Cooperator?

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... advance, FAS may require the participant to submit security in a form and amount acceptable to FAS to... special advance is outstanding from a prior marketing plan year. Cooperators shall deposit and maintain... reimbursement claim. All checks shall be mailed to the Director, Marketing Operations Staff, FAS, USDA....

  9. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone

    2014-01-01

    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  10. Integrated process of distillation with side reactors for synthesis of organic acid esters

    DOEpatents

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  11. Oxidation-resistant acidic resins prepared by partial carbonization as cocatalysts in synthesis of adipic acid.

    PubMed

    Wei, Huijuan; Li, Hongbian; Liu, Yangqing; Jin, Peng; Wang, Xiangyu; Li, Baojun

    2012-08-01

    The oxidation-resistant acidic resins are of great importance for the catalytic oxidation systems. In this paper, the oxidatively stable acidic resins are obtained from the cation ion exchange resins (CIERs) through the thermal treatment in N(2) atmosphere. The structure and properties of the thermally treated CIERs were characterized by chemical analysis, Fourier transform infrared (FT-IR) spectra, acid capacity measurement and scanning electron microscope (SEM). The thermally treated CIERs possess high acid capacity up to 4.09 mmol g(-1). A partial carbonization is observed in the thermal treatment process of CIERs, but the morphology of resin spheres maintains well. The as-prepared CIERs are used as solid acids to assist the hydrogen peroxide oxidation of cyclohexene to adipic acid (ADA) with tungstic acid as the catalyst precursor. The improved yields of ADA in the recycling reaction are obtained in the presence of acidic CIERs. Meanwhile, the unproductive decomposition of H(2)O(2) is effectively suppressed. The high yields of ADA (about 81%) are kept by the thermally treated CIERs even after the fifth cycle. The thermally treated CIERs exhibit excellent acid-catalytic performance and possess remarkable oxidation-resistant capability.

  12. A novel and highly regioselective synthesis of new carbamoylcarboxylic acids from dianhydrides.

    PubMed

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N'-disubstituted 4,4'-carbonylbis(carbamoylbenzoic) acids and N,N'-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3',4,4'-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS.

  13. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  14. Systems-level metabolic flux profiling identifies fatty acid synthesis as a target for antiviral therapy

    PubMed Central

    Munger, Joshua; Bennett, Bryson D; Parikh, Anuraag; Feng, Xiao-Jiang; McArdle, Jessica; Rabitz, Herschel A; Shenk, Thomas; Rabinowitz, Joshua D

    2010-01-01

    Viruses rely on the metabolic network of their cellular hosts to provide energy and building blocks for viral replication. We developed a flux measurement approach based on liquid chromatography–tandem mass spectrometry to quantify changes in metabolic activity induced by human cytomegalovirus (HCMV). This approach reliably elucidated fluxes in cultured mammalian cells by monitoring metabolome labeling kinetics after feeding cells 13C-labeled forms of glucose and glutamine. Infection with HCMV markedly upregulated flux through much of the central carbon metabolism, including glycolysis. Particularly notable increases occurred in flux through the tricarboxylic acid cycle and its efflux to the fatty acid biosynthesis pathway. Pharmacological inhibition of fatty acid biosynthesis suppressed the replication of both HCMV and influenza A, another enveloped virus. These results show that fatty acid synthesis is essential for the replication of two divergent enveloped viruses and that systems-level metabolic flux profiling can identify metabolic targets for antiviral therapy. PMID:18820684

  15. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).

  16. Acid synthesis of luminescent amine-functionalized or erbium-doped silica spheres for biological applications.

    PubMed

    Enrichi, Francesco; Trave, Enrico; Bersani, Marco

    2008-03-01

    In this work we discuss and investigate the morphological and optical properties of luminescent silica spheres which can have interesting applications in bioimaging and biosensing. The spheres are synthesized following an acid route by the hydrolysis and condensation of tetraethylortosilicate (TEOS) and can be functionalized by incorporation of aminopropyl-triethoxysilane (APTES) during the synthesis, inducing a significant luminescence that can be attributed to a recombination mechanism from localized organic defects related to -NH(2) groups. It is shown that the acid synthesis route produces very regular spherical particles, but their diameter vary in the range of 200-4,000 nm. The luminescence properties have been investigated and optimized by variation of the annealing temperature for the functionalized spheres, obtaining the most efficient PL emission after a thermal treatment of 1 h at 600 degrees C in air. Moreover, the possibility to introduce rare earths like erbium in the spheres was also studied and the corresponding Er(3) luminescence emission at 1.53 microm is reported in terms of intensity and lifetime, pointing out that erbium can be easily and efficiently incorporated during the acid synthesis giving high PL intensity with a good lifetime of 3.9 ms.

  17. In vitro synthesis of the unit that links teichoic acid to peptidoglycan.

    PubMed

    Hancock, I; Baddiley, J

    1976-03-01

    The role of cytidine diphosphate (CDP)-glycerol in gram-positive bacteria whose walls lack poly(glycerol phosphate) was investigated. Membrane preparations from Staphylococcus aureus H, Bacillus subtilis W23, and Micrococcus sp. 2102 catalyzed the incorporation of glycerol phosphate residues from radioactive CDP-glycerol into a water-soluble polymer. In toluenized cells of Micrococcus sp. 2102, some of this product became linked to the wall. In each case, maximum incorporation of glycerol phosphate residues required the presence of the nucleotide precursors of wall teichoic acid and of uridine diphosphate-N-acetylglucosamine. In membrane preparations capable of synthesizing peptidoglycan, vancomycin caused a decrease in the incorporation of isotope from CDP-glycerol into polymer. Synthesis of the poly (glycerol phosphate) unit thus depended at an early stage on the concomitant synthesis of wall teichoic acid and later on the synthesis of peptidoglycan. It is concluded that CDP-glycerol is the biosynthetic precursor of the tri(glycerol phosphate) linkage unit between teichoic acid and peptidoglycan that has recently been characterized in S. aureus H.

  18. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale.

  19. Novel sol-gel synthesis of acidic MgF(2-x)(OH)(x) materials.

    PubMed

    Wuttke, Stefan; Coman, Simona M; Scholz, Gudrun; Kirmse, Holm; Vimont, Alexandré; Daturi, Maro; Schroeder, Sven L M; Kemnitz, Erhard

    2008-01-01

    Novel magnesium fluorides have been prepared by a new fluorolytic sol-gel synthesis for fluoride materials based on aqueous HF. By changing the amount of water at constant stoichiometric amount of HF, it is possible to tune the surface acidity of the resulting partly hydroxylated magnesium fluorides. These materials possess medium-strength Lewis acid sites and, by increasing the amount of water, Brønsted acid sites as well. Magnesium hydroxyl groups normally have a basic nature and only with this new synthetic route is it possible to create Brønsted acidic magnesium hydroxyl groups. XRD, MAS NMR, TEM, thermal analysis, and elemental analysis have been applied to study the structure, composition, and thermal behaviour of the bulk materials. XPS measurements, FTIR with probe molecules, and the determination of N(2)/Ar adsorption-desorption isotherms have been carried out to investigate the surface properties. Furthermore, activity data have indicated that the tuning of the acidic properties makes these materials versatile catalysts for different classes of reactions, such as the synthesis of (all-rac)-[alpha]-tocopherol through the condensation of 2,3,6-trimethylhydroquinone (TMHQ) with isophytol (IP).

  20. Ionic liquids as novel solvents for the synthesis of sugar fatty acid ester.

    PubMed

    Mai, Ngoc Lan; Ahn, Kihun; Bae, Sang Woo; Shin, Dong Woo; Morya, Vivek Kumar; Koo, Yoon-Mo

    2014-12-01

    Sugar fatty acid esters are bio-surfactants known for their non-toxic, non-ionic, and high biodegradability . With great emulsifying and conditioning effects, sugar fatty acids are widely used in the food, pharmaceutical, and cosmetic industries. Biosynthesis of sugar fatty acid esters has attracted growing attention in recent decades. In this study, the enzymatic synthesis of sugar fatty acid esters in ionic liquids was developed, optimized, and scaled up. Reaction parameters affecting the conversion yield of lipase-catalyzed synthesis of glucose laurate from glucose and vinyl laurate (i.e. temperature, vinyl laurate/glucose molar ratio, and enzyme loads) were optimized by response surface methodology (RSM). In addition, production was scaled up to 2.5 L, and recycling of enzyme and ionic liquids was investigated. The results showed that under optimal reaction conditions (66.86 °C, vinyl laurate/glucose molar ratio of 7.63, enzyme load of 73.33 g/L), an experimental conversion yield of 96.4% was obtained which is close to the optimal value predicted by RSM (97.16%). A similar conversion yield was maintained when the reaction was carried out at 2.5 L. Moreover, the enzymes and ionic liquids could be recycled and reused effectively for up to 10 cycles. The results indicate the feasibility of ionic liquids as novel solvents for the biosynthesis of sugar fatty acid esters.

  1. Relationships between pyruvate decarboxylation and branched-chain volatile acid synthesis in Ascaris mitochondria.

    PubMed

    Komuniecki, R; Komuniecki, P R; Saz, H J

    1981-10-01

    The rate of 14CO2 evolution from 1-[14C]pyruvate by intact Ascaris mitochondria was very slow, but increased with increasing concentrations of pyruvate. At all concentrations of pyruvate, in an aerobic environment, pyruvate decarboxylation was stimulated greatly by the addition of fumarate, malate, or succinate. However, under anaerobic conditions, only malate and fumarate stimulated pyruvate decarboxylation; succinate had no effect. This implies that the aerobic metabolism of succinate, presumably to other dicarboxylic acids, may be required for the stimulation. Incubation of sonicated mitochondria with pyruvate plus fumarate, under rate-limiting concentrations of NAD+, resulted in approximately equal quantities of pyruvate utilized and succinate formed, suggesting that pyruvate oxidation and fumarate reduction may be linked. Branched-chain, volatile fatty acids were not formed during incubations with either malate or succinate, or succinate plus acetate. However, incubations of intact Ascaris mitochondria with pyruvate plus succinate yielded 2-methylbutyrate and 2-methylvalerate, whereas incubations with pyruvate plus propionate yielded almost exclusively 2-methylvalerate. Oxygen dramatically inhibited the synthesis of the branched-chain acids from succinate plus pyruvate, attesting to the apparent anaerobic nature of Ascaris mitochondrial metabolism. Significantly, the addition of glucose plus ADP stimulated the formation of all volatile fatty acids. Therefore, the synthesis of branched-chain acids may be related directly to increased energy generation. Alternatively, they may function in the regulatory role of maintaining the mitochondrial redox balance.

  2. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  3. Synthesis of side chain N,N'-diaminoalkylated derivatives of basic amino acids for application in solid-phase peptide synthesis.

    PubMed

    Pitteloud, Jean-Philippe; Bionda, Nina; Cudic, Predrag

    2013-01-01

    Despite the enormous therapeutic potential, the clinical use of peptides has been limited by their poor bioavailability and low stability under physiological conditions. Hence, efforts have been undertaken to alter peptide structure in ways to improve their pharmacological properties. Inspired by the importance of basic amino acids in biological systems and the remarkable versatility displayed by lysine during the synthesis of complex peptide scaffolds, this chapter describes a simple procedure that enables rapid access to protected N,N'-diaminoalkylated basic amino acid building blocks suitable for standard solid-phase peptide synthesis. This procedure allows preparation of symmetrical, as well as unsymmetrical, dialkylated amino acid derivatives that can be further modified, enhancing their synthetic utility. The suitability of the synthesized branched basic amino acid building blocks for use in standard solid-phase peptide synthesis has been demonstrated by synthesis of an indolicidin analog in which the lysine residue was substituted with its synthetic polyamino derivate. The substitution provided indolicidin analog with increase net positive charge, more ordered secondary structure in biological membranes mimicking conditions, and enhanced antibacterial activity without altering hemolytic activity. Taking into consideration the increasing interest for peptides with unusual structural features due to their improved biological properties, the described synthesis of polyfunctional amino acid building blocks is of particular practical value.

  4. The effects of borate minerals on the synthesis of nucleic acid bases, amino acids and biogenic carboxylic acids from formamide.

    PubMed

    Saladino, Raffaele; Barontini, Maurizio; Cossetti, Cristina; Di Mauro, Ernesto; Crestini, Claudia

    2011-08-01

    The thermal condensation of formamide in the presence of mineral borates is reported. The products afforded are precursors of nucleic acids, amino acids derivatives and carboxylic acids. The efficiency and the selectivity of the reaction was studied in relation to the elemental composition of the 18 minerals analyzed. The possibility of synthesizing at the same time building blocks of both genetic and metabolic apparatuses, along with the production of amino acids, highlights the interest of the formamide/borate system in prebiotic chemistry.

  5. Synthesis and characterization of agricultural controllable humic acid superabsorbent.

    PubMed

    Gao, Lijuan; Wang, Shiqiang; Zhao, Xuefei

    2013-12-01

    Humic acid superabsorbent polymer (P(AA/AM-HA)) and superabsorbent polymer (P(AA/AM)) were synthesized by aqueous solution polymerization method using acrylic acid (AA), acrylamide (AM) and humic acid (HA) as raw material. The effects of N,N'-methylenebisacrylamide (MBA) crosslinking agent, potassium peroxydisulfate (KPS) initiator, reaction temperature, HA content, ratio of AA to AM, concentration of monomer and neutralization of AA on water absorption were investigated. Absorption and desorption ratios of nitrogen fertilizer and phosphate fertilizer were also investigated by determination of absorption and desorption ratio of NH4(+), PO4(3-) on P(AA/AM-HA) and P(AA/AM). The P(AA/AM-HA) and P(AA/AM) were characterized by Fourier translation infrared spectroscopy, biological photomicroscope and scanning electron microscopy (SEM). The optimal conditions obtained were as follows: the weight ratio of MBA to AA and AM was 0.003; the weight ratio of KPS to AA and AM was 0.008; the weight ratio of HA to AA was 0.1; the mole ratio of AM to AA is 0.1; the mole ratio of NaOH to AA is 0.9; the reaction temperature was 60°C. P(AA/AM-HA) synthesized under optimal conditions, has a good saline tolerance, its water absorbency in distilled water and 0.9 wt.% saline solution is 1180 g/g and 110 g/g, respectively. P(AA/AM-HA) achieves half saturation in 6.5 min. P(AA/AM-HA) is superior to P(AA/AM) on absorption of NH4(+), PO4(3-). The SEM micrograph of P(AA/AM-HA) shows a fine alveolate structure. The biological optical microscope micrograph of P(AA/AM-HA) shows a network structure. Graft polymerization between P(AA/AM) and HA was demonstrated by infrared spectrum. The P(AA/AM-HA) superabsorbent has better absorbing ability of water and fertilizer, electrolytic tolerance and fewer cost than P(AA/AM) superabsorbent.

  6. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  7. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis

    2004-01-01

    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  8. Differential modulation of citrate synthesis and release by fatty acids in perfused working rat hearts.

    PubMed

    Vincent, Genevieve; Bouchard, Bertrand; Khairallah, Maya; Des Rosiers, Christine

    2004-01-01

    The objective of this study was to test the effect of increasing fatty acid concentrations on substrate fluxes through pathways leading to citrate synthesis and release in the heart. This was accomplished using semirecirculating work-performing rat hearts perfused with substrate mixtures mimicking the in situ milieu (5.5 mM glucose, 8 nM insulin, 1 mM lactate, 0.2 mM pyruvate, and 0.4 mM oleate-albumin) and 13C methods. Raising the fatty acid concentration from 0.4 to 1 mM with long-chain oleate or medium-chain octanoate resulted in a lowering ( approximately 20%) of cardiac output and efficiency with unaltered O2 consumption. At the metabolic level, beyond the expected effects of high fatty acid levels on the contribution of pyruvate decarboxylation (reduced >3-fold) and beta-oxidation (enhanced approximately 3-fold) to citrate synthesis, there was also a 2.4-fold lowering of anaplerotic pyruvate carboxylation. Despite the dual inhibitory effect of high fatty acids on pyruvate decarboxylation and carboxylation, tissue citrate levels were twofold higher, but citrate release rates remained unchanged at 11-14 nmol/min, representing <0.5% of citric acid cycle flux. A similar trend was observed for most metabolic parameters after oleate or octanoate addition. Together, these results emphasize a differential modulation of anaplerotic pyruvate carboxylation and citrate release in the heart by fatty acids. We interpret the lack of effects of high fatty acid concentrations on citrate release rates as suggesting that, under physiological conditions, this process is maximal, probably limited by the activity of its mitochondrial or plasma membrane transporter. Limited citrate release at high fatty acid concentrations may have important consequences for the heart's fuel metabolism and function.

  9. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin

    2011-06-15

    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  10. Synthesis and biological activity of hydroxylated derivatives of linoleic acid and conjugated linoleic acids.

    PubMed

    Li, Zhen; Tran, Van H; Duke, Rujee K; Ng, Michelle C H; Yang, Depo; Duke, Colin C

    2009-03-01

    Allylic hydroxylated derivatives of the C18 unsaturated fatty acids were prepared from linoleic acid (LA) and conjugated linoleic acids (CLAs). The reaction of LA methyl ester with selenium dioxide (SeO(2)) gave mono-hydroxylated derivatives, 13-hydroxy-9Z,11E-octadecadienoic acid, 13-hydroxy-9E,11E-octadecadienoic acid, 9-hydroxy-10E,12Z-octadecadienoic acid and 9-hydroxy-10E,12E-octadecadienoic acid methyl esters. In contrast, the reaction of CLA methyl ester with SeO(2) gave di-hydroxylated derivatives as novel products including, erythro-12,13-dihydroxy-10E-octadecenoic acid, erythro-11,12-dihydroxy-9E-octadecenoic acid, erythro-10,11-dihydroxy-12E-octadecenoic acid and erythro-9,10-dihydroxy-11E-octadecenoic acid methyl esters. These products were purified by normal-phase short column vacuum chromatography followed by high-performance liquid chromatography (HPLC). Their chemical structures were characterized by liquid chromatography-mass spectrometry (LC-MS) and nuclear magnetic resonance spectroscopy (NMR). The allylic hydroxylated derivatives of LA and CLA exhibited moderate in vitro cytotoxicity against a panel of human cancer cell lines including chronic myelogenous leukemia K562, myeloma RPMI8226, hepatocellular carcinoma HepG2 and breast adenocarcinoma MCF-7 cells (IC(50) 10-75 microM). The allylic hydroxylated derivatives of LA and CLA also showed toxicity to brine shrimp with LD(50) values in the range of 2.30-13.8 microM. However these compounds showed insignificant toxicity to honeybee at doses up to 100 microg/bee.

  11. Synthesis of 11-Thialinoleic Acid and 14-Thialinoleic Acid, Inhibitors of Soybean and Human Lipoxygenases

    PubMed Central

    Jacquot, Cyril; McGinley, Chris M.; Plata, Erik; Holman, Theodore R.

    2010-01-01

    Lipoxygenases catalyse the oxidation of polyunsaturated fatty acids and have been invoked in many diseases including cancer, atherosclerosis and Alzheimer’s disease. Currently, no X-ray structures are available with substrate or substrate analogues bound in a productive conformation. Such structures would be very useful for examining interactions between substrate and active site residues. Reported here are the syntheses of linoleic acid analogues containing a sulphur atom at the 11 or 14 positions. The key steps in the syntheses were the incorporation of sulphur using nucleophilic attack of metallated alkynes on electrophilic sulphur compounds and the subsequent stereospecific tantalum-mediated reduction of the alkynylsulphide to the cis-alkenylsulphide. Kinetic assays performed with soybean lipoxygenase-1 showed that both 11-thialinoleic acid and 14-thialinoleic acid were competitive inhibitors with respect to linoleic acid with Ki values of 22 and 35 µM, respectively. On the other hand, 11-thialinoleic acid was a noncompetitive inhibitor with respect to arachidonic acid with Kis and Kii values of 48 and 36 µM, respectively. 11-Thialinoleic acid was also a noncompetitive inhibitor of human 15-lipoxygenase-1 with arachidonic acid (Kis = 11.4 µM, Kii = 18.1 µM) or linoleic acid as substrate (Kis = 20.1 µM, Kii = 20.0 µM), and a competitive inhibitor of human 12-lipoxygenase with arachidonic acid as substrate (Ki = 2.5 µM). The presence of inhibitor did not change the regioselectivity of soybean lipoxygenase-1, human 12- or 15-lipoxygenase-1. PMID:18972057

  12. Control of the Synthesis of Macromolecules During Amino Acid and Thymine Starvation in Bacillus subtilis

    PubMed Central

    Anraku, Naoyo; Landman, Otto E.

    1968-01-01

    Studies of Maaløe, Lark, and others with amino acid- and thymine-starved cultures revealed successive steps in the biosynthesis of Escherichia coli chromosomes. In this study, the corresponding mechanisms in Bacillus subtilis 168 were examined. Using a strain requiring both thymine and tryptophan, we found that, 3 hr after the start of amino acid starvation, when the deoxyribonucleic acid (DNA) content of the culture had increased 40 to 50%, DNA synthesis ceased. After 4 to 5 hr, 100% of the cells were immune to thymineless death; their chromosomes had presumably been completed. Immune cultures slowly incorporated 3H-thymine. Thymine incorporation increased 20-fold 30 min after readdition of amino acids, indicating reinitiation of chromosome synthesis. Simultaneous presence of amino acids and thymine was required for reinitiation. If 5-bromouracil (5-BU) was added instead of thymine, newly replicated DNA segments could be separated by centrifugation in CsCl. Analysis of the CsCl fractions by a transformation assay showed that the order in which the markers were synthesized was ade-16, thr-5, leu-8, metB5. Less than half the chromosomes started resynthesis synchronously in 5-BU. Nevertheless, chromosome alignment in the amino acid-starved culture is probably very good: marker frequency analysis of its DNA gives the same normalized frequencies as DNA from “perfectly” aligned spores. Full viability is maintained in the chromosome-arrested culture for 10 hr in thymine-free medium in the absence or presence of amino acids. In the latter condition, protein synthesis proceeds, and the cells filament and become more lysozyme-sensitive. Such cells must be incubated and plated on hypertonic or on slow-growth media; otherwise, they undergo “quasiosmotic” thymineless death. This death is thus apparently not directly attributable to any damage of chromosomal DNA. Further, weakening of the teichoic acid portion of the cell wall is not involved, since 32P incorporation

  13. Synthesis and cytotoxic evaluation of novel paraconic acid analogs.

    PubMed

    Le Floch, Camille; Le Gall, Erwan; Léonel, Eric; Martens, Thierry; Cresteil, Thierry

    2011-12-01

    A novel class of 2,3-tri- and tetrasubstituted γ-butyrolactones analogous to paraconic acids has been synthesized in one step using a straightforward three-component reaction among aryl bromides, dimethyl itaconate and carbonyl compounds. The in vitro cytotoxic activity of representative compounds has been evaluated against a panel of human cancer cell lines (KB, HCT116, MCF7, HL60). While most molecules exhibit a low to moderate background activity on both KB and HL60 cancer cell lines, one compound shows increased antiproliferative activities against both cell lines with IC(50) values in the 10(-7)-10(-6)mol/L range. An extended evaluation indicated that this compound also inhibits PC3, SK-OV3, MCF7R and HL60R cell growth in the same fashion.

  14. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti

    2013-11-01

    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  15. Stabilized epoxygenated fatty acids regulate inflammation, pain, angiogenesis and cancer

    PubMed Central

    Zhang, Guodong; Kodani, Sean; Hammock, Bruce D.

    2014-01-01

    Epoxygenated fatty acids (EpFAs), which are lipid mediators produced by cytochrome P450 epoxygenases from polyunsaturated fatty acids, are important signaling molecules known to regulate various biological processes including inflammation, pain and angiogenesis. The EpFAs are further metabolized by soluble epoxide hydrolase (sEH) to form fatty acid diols which are usually less-active. Pharmacological inhibitors of sEH that stabilize endogenous EpFAs are being considered for human clinical uses. Here we review the biology of ω-3 and ω-6 EpFAs on inflammation, pain, angiogenesis and tumorigenesis. PMID:24345640

  16. Synthesis and cholinesterase inhibition of cativic acid derivatives.

    PubMed

    Alza, Natalia P; Richmond, Victoria; Baier, Carlos J; Freire, Eleonora; Baggio, Ricardo; Murray, Ana Paula

    2014-08-01

    Alzheimer's disease (AD) is a neurodegenerative disorder associated with memory impairment and cognitive deficit. Most of the drugs currently available for the treatment of AD are acetylcholinesterase (AChE) inhibitors. In a preliminary study, significant AChE inhibition was observed for the ethanolic extract of Grindelia ventanensis (IC₅₀=0.79 mg/mL). This result prompted us to isolate the active constituent, a normal labdane diterpenoid identified as 17-hydroxycativic acid (1), through a bioassay guided fractionation. Taking into account that 1 showed moderate inhibition of AChE (IC₅₀=21.1 μM), selectivity over butyrylcholinesterase (BChE) (IC₅₀=171.1 μM) and that it was easily obtained from the plant extract in a very good yield (0.15% w/w), we decided to prepare semisynthetic derivatives of this natural diterpenoid through simple structural modifications. A set of twenty new cativic acid derivatives (3-6) was prepared from 1 through transformations on the carboxylic group at C-15, introducing a C2-C6 linker and a tertiary amine group. They were tested for their inhibitory activity against AChE and BChE and some structure-activity relationships were outlined. The most active derivative was compound 3c, with an IC₅₀ value of 3.2 μM for AChE. Enzyme kinetic studies and docking modeling revealed that this inhibitor targeted both the catalytic active site and the peripheral anionic site of this enzyme. Furthermore, 3c showed significant inhibition of AChE activity in SH-SY5Y human neuroblastoma cells, and was non-cytotoxic.

  17. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki

    2016-04-01

    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  18. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  19. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  20. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  1. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, L.

    1999-05-25

    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  2. Synthesis and Physical Properties of Estolide Ester Using Saturated Fatty Acid and Ricinoleic Acid

    PubMed Central

    Salimon, Jumat; Nallathamby, Neeranjini; Salih, Nadia; Abdullah, Bashar Mudhaffar

    2011-01-01

    A study was conveyed to produce estolide ester using ricinoleic acid as the backbone. The ricinoleic acid reacted with saturated fatty acid from C8–C18. These reactions were conducted under vacuum at 60°C for 24 h without solvent. The reaction used acid catalyst, sulphuric acid. The new saturate ricinoleic estolide esters show superior low-temperature properties (−52 ± 0.08°C) and high flash point (>300°C). The yield of the neat estolide esters ranged from 52% to 96%. The viscosity range was 51 ± 0.08 to 86 ± 0.01 cp. These new saturated estolide esters were also compared with saturated branched estolide esters. PMID:22007150

  3. Blockade of Fas signaling in breast cancer cells suppresses tumor growth and metastasis via disruption of Fas signaling-initiated cancer-related inflammation.

    PubMed

    Liu, Qiuyan; Tan, Qinchun; Zheng, Yuanyuan; Chen, Kun; Qian, Cheng; Li, Nan; Wang, Qingqing; Cao, Xuetao

    2014-04-18

    Mechanisms for cancer-related inflammation remain to be fully elucidated. Non-apoptotic functions of Fas signaling have been proposed to play an important role in promoting tumor progression. It has yet to be determined if targeting Fas signaling can control tumor progression through suppression of cancer-related inflammation. In the current study we found that breast cancer cells with constitutive Fas expression were resistant to apoptosis induction by agonistic anti-Fas antibody (Jo2) ligation or Fas ligand cross-linking. Higher expression of Fas in human breast cancer tissue has been significantly correlated with poorer prognosis in breast cancer patients. To determine whether blockade of Fas signaling in breast cancer could suppress tumor progression, we prepared an orthotopic xenograft mouse model with mammary cancer cells 4T1 and found that blockade of Fas signaling in 4T1 cancer cells markedly reduced tumor growth, inhibited tumor metastasis in vivo, and prolonged survival of tumor-bearing mice. Mechanistically, blockade of Fas signaling in cancer cells significantly decreased systemic or local recruitment of myeloid derived suppressor cells (MDSCs) in vivo. Furthermore, blockade of Fas signaling markedly reduced IL-6, prostaglandin E2 production from breast cancer cells by impairing p-p38, and activity of the NFκB pathway. In addition, administration of a COX-2 inhibitor and anti-IL-6 antibody significantly reduced MDSC accumulation in vivo. Therefore, blockade of Fas signaling can suppress breast cancer progression by inhibiting proinflammatory cytokine production and MDSC accumulation, indicating that Fas signaling-initiated cancer-related inflammation in breast cancer cells may be a potential target for treatment of breast cancer.

  4. Fas ligand is not only expressed in immune privileged human organs but is also coexpressed with Fas in various epithelial tissues.

    PubMed Central

    Xerri, L; Devilard, E; Hassoun, J; Mawas, C; Birg, F

    1997-01-01

    AIMS: To confirm the recent data obtained in mice, showing that the Fas ligand (FasL) is involved in the phenomenon of "immune privilege" (the apparent defect of the immune system in specific anatomical sites) and to extend this finding to humans. METHODS: The expression of FasL was analysed in a panel of histologically normal human tissues by reverse transcriptase polymerase chain reaction and Western blotting. The tissues sampled were brain, breast, bone marrow, oesophagus, kidney, liver, lung, lymph node, ovary, pancreas, pituitary gland, prostate, spleen, stomach (antrum and fundus), striated muscle, testis, thyroid, and uterus. These were obtained from patients with various neoplastic and non-neoplastic disorders; placental tissue was obtained after normal obstetric delivery, and spontaneous or voluntary abortion. RESULTS: Strong FasL expression was detected in testis and placenta. FasL expression was also detectable, although it was seen to a lesser extent, in oesophagus, prostate, lung, and uterus, which also coexpressed variable amounts of Fas mRNA or protein or both. The other organs tested for FasL expression were all negative. CONCLUSIONS: FasL in humans is expressed predominantly in immune "sanctuaries" such as testis and placenta, suggesting that, similar to mice, this expression may contribute to the immune privileged status of these organs, by preventing dangerous inflammatory responses. The coexpression of FasL and Fas in particular epithelia suggests that the physiological cell turnover of some tissues may be regulated by the Fas-FasL apoptotic pathway. Images PMID:9231156

  5. Enantiopure synthesis of dihydrobenzo[1,4]-oxazine-3-carboxylic acids and a route to benzoxazinyl oxazolidinones.

    PubMed

    Malhotra, Rajesh; Dey, Tushar K; Basu, Sourav; Hajra, Saumen

    2015-03-21

    A two step protocol is developed for the efficient synthesis of enantiopure N-Boc-dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 from serine derived cyclic sulfamidate via intramolecular arylamination. The RuPhos Palladacycle along with additional RuPhos ligand is found to be an efficient catalyst for the arylamination of β-(2-bromoaryloxy)amino acids 3 to provide easy and direct access to a variety of dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 with complete retention of enantiopurity in moderate to high yields. Dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids are not only important unnatural amino acids, but are key precursors for the synthesis of important compounds such as benzoxazinyl oxazolidinones. A general approach for the synthesis of benzoxazinyl oxazolidinone is presented.

  6. Fatty acid biosynthesis redirected to medium chains in transgenic oilseed plants

    SciTech Connect

    Voelker, T.A.; Worrell, A.C.; Anderson, L.; Bleibaum, J.; Fan, C.; Hawkins, D.J.; Radke, S.E.; Davies, H.M. )

    1992-07-03

    Medium-chain fatty acids (FAs), found in storage lipids of certain plants, are an important renewable resource. Seeds of undomesticated California bay accumulate laurate (12:0), and a 12:0-acyl-carrier protein thioesterase (BTE) has been purified from this tissue. Sequencing of BTE enabled the cloning of a complementary DNA coding for a plastid-targeted preprotein. Expression of the complementary DNA in the seeds of Arabidopsis thaliana resulted in BTE activity, and medium chains accumulated at the expense of long-chain ({ge}16) FAs. Laurate became the most abundant FA species and was deposited in the storage triacylglycerols. These results demonstrate a mechanism for medium-chain FA synthesis in plants.

  7. AMPK activation promotes lipid droplet dispersion on detyrosinated microtubules to increase mitochondrial fatty acid oxidation

    PubMed Central

    Herms, Albert; Bosch, Marta; Reddy, Babu J.N.; Schieber, Nicole L.; Fajardo, Alba; Rupérez, Celia; Fernández-Vidal, Andrea; Ferguson, Charles; Rentero, Carles; Tebar, Francesc; Enrich, Carlos; Parton, Robert G.; Gross, Steven P.; Pol, Albert

    2015-01-01

    Lipid droplets (LDs) are intracellular organelles that provide fatty acids (FAs) to cellular processes including synthesis of membranes and production of metabolic energy. While known to move bidirectionally along microtubules (MTs), the role of LD motion and whether it facilitates interaction with other organelles are unclear. Here we show that during nutrient starvation, LDs and mitochondria relocate on detyrosinated MT from the cell centre to adopt a dispersed distribution. In the cell periphery, LD–mitochondria interactions increase and LDs efficiently supply FAs for mitochondrial beta-oxidation. This cellular adaptation requires the activation of the energy sensor AMPK, which in response to starvation simultaneously increases LD motion, reorganizes the network of detyrosinated MTs and activates mitochondria. In conclusion, we describe the existence of a specialized cellular network connecting the cellular energetic status and MT dynamics to coordinate the functioning of LDs and mitochondria during nutrient scarcity. PMID:26013497

  8. Development of a Medium-Throughput Targeted LCMS Assay to Detect Endogenous Cellular Levels of Malonyl-CoA to Screen Fatty Acid Synthase Inhibitors.

    PubMed

    Hopcroft, Philip J; Fisher, David I

    2016-02-01

    The fatty acid synthase (FAS) enzyme in mammalian cells is a large multidomain protein responsible for de novo synthesis of fatty acids. The steps catalyzed by FAS involve the condensation of acetyl-CoA and malonyl-CoA moieties in the presence of NADPH until palmitate is formed. Inhibition of FAS causes an accumulation of intracellular malonyl-CoA, as this metabolite is essentially committed to fatty acid synthesis once formed. Detection of intracellular metabolites for screening can be problematic due to a lack of appropriate tools, but here we describe a targeted liquid chromatography-mass spectroscopy (LCMS) method to directly measure endogenous levels of malonyl-CoA to drive a drug development structure-activity relationship (SAR) screening cascade. Our process involves preparation of samples at 96-well scale, normalization postpermeabilization via use of a whole-well imaging platform, and the LCMS detection methodology. The assay is amenable to multiplexing cellular endpoints, has a typical Z' of >0.6, and has high reproducibility of EC50 values.

  9. Omega-3 fatty acids predict recurrent venous thromboembolism or total mortality in elderly patients with acute venous thromboembolism.

    PubMed

    Reiner, M F; Stivala, S; Limacher, A; Bonetti, N R; Méan, M; Egloff, M; Rodondi, N; Aujesky, D; von Schacky, C; Lüscher, T F; Camici, G G; Beer, J H

    2017-01-01

    Essentials The role of omega-3 fatty acids (n-3 FAs) in recurrent venous thromboembolism (VTE) is unknown. Association of n-3 FAs with recurrent VTE or total mortality was investigated in 826 patients. Whole blood n-3 FAs were inversely correlated with recurrent VTE or total mortality. Major and non-major bleeding was not increased in patients with higher levels of n-3 FAs.

  10. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.

  11. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels

    PubMed Central

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-01-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g. cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three dimensional (2D and 3D) culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  12. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.

    1981-01-01

    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  13. Autoimmune lymphoproliferative syndrome due to somatic FAS mutation (ALPS-sFAS) combined with a germline caspase-10 (CASP10) variation.

    PubMed

    Martínez-Feito, Ana; Melero, Josefa; Mora-Díaz, Sergio; Rodríguez-Vigil, Carmen; Elduayen, Ramón; González-Granado, Luis I; Pérez-Méndez, Dolores; Sánchez-Zapardiel, Elena; Ruiz-García, Raquel; Menchén, Miguela; Díaz-Madroñero, Josefa; Paz-Artal, Estela; Del Orbe-Barreto, Rafael; Riñón, Marta; Allende, Luis M

    2016-01-01

    Autoimmune lymphoproliferative syndrome (ALPS) is a primary immunodeficiency caused by impaired Fas/FasL-mediated apoptosis of lymphocytes and is characterized by chronic nonmalignant or benign lymphoproliferation, autoimmune manifestations and expansion of double negative (DN) T-cells (TCRαβ+CD4-CD8-). Most cases of ALPS are associated with germline (ALPS-FAS) or somatic (ALPS-sFAS) heterozygous FAS mutations or a combination of both. Here we report three unrelated patients with ALPS-sFAS. Only one of them showed impaired Fas function in PHA-activated T-cells. In this patient, the genetic analysis of the caspase-10 gene (CASP10) identified a heterozygous germline change in exon 9 (c.1337A>G) causing Y446C substitution in the caspase-10 protein. In addition, this patient had a dysregulated T- and B-cell phenotype; circulating lymphocytes showed expansion of T effector memory CD45RA+ (TEMRA) CD4 T-cells, effector memory CD8 T-cells, CD21(low) B-cells and reduced memory switched B-cells. Additionally, this patient showed altered expression in T-cells of several molecules that change during differentiation from naïve to effector cells (CD27, CD95, CD57 and perforin). Molecular alterations in genes of the Fas pathway are necessary for the development of ALPS and this syndrome could be influenced by the concurrent effect of other mutations hitting different genes involved in Fas or related pathways.

  14. CD80 (B7.1) and CD86 (B7.2) induce EBV-transformed B cell apoptosis through the Fas/FasL pathway.

    PubMed

    Park, Ga Bin; Kim, Yeong Seok; Lee, Hyun-Kyung; Cho, Dae-Ho; Kim, Daejin; Hur, Dae Young

    2013-11-01

    CD80 and CD86 expression is strongly regulated in B cells and is induced by various stimuli (e.g., cytokines, ligation of MHC class II and CD40 ligand). Epstein-Barr virus (EBV) infection activates B lymphocytes and transforms them into lymphoblastoid cells. However, the role of CD80 and CD86 in EBV infection of B cells remains unclear. Here, we observed that cross-linking of CD80 and CD86 in EBV-transformed B cells induced apoptosis through caspase-dependent release of apoptosis-related molecules, cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, because Z-VAD-fmk (N-benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone) and N-acetylcysteine (NAC) blocked apoptosis and disruption of mitochondria. Stimulation of CD80 and CD86 induced expression of Fas ligand (FasL) on EBV-transformed B cells and upregulated Fas and FasL expression in IM-9 cells. Apoptosis through Fas-FasL interactions was blocked by treatment of cells with ZB4, an antagonistic anti-Fas antibody. These results suggest that the co-stimulatory molecules CD80 and CD86 induced by EBV infection stimulate apoptosis of EBV-transformed lymphoblastoid B cells via the Fas/FasL pathway.

  15. The effects of retinoic acid on immunoglobulin synthesis: Role of interleukin 6

    SciTech Connect

    Ballow, M.; Xiang, Shunan; Wang, Weiping; Brodsky, L. |

    1996-05-01

    Retinoic acid (RA) and its parent compound, retinol (ROH, vitamin A), have been recognized as important immunopotentiating agents. Previous studies from our laboratory have demonstrated that PA can augment formalin-treated Staphylococcus aureus (SAC) stimulated immunoglobulin (Ig) synthesis of cord blood mononuclear cells (CBMC). To determine the mechanism(s) by which RA modulates Ig synthesis, we studied the effects of RA on B cells and cytokine production. The addition of RA (10{sup -5} to 10{sup -10} M) to Epstein-Barr virus (EBV)-transformed B-cell clones derived from either adult or cord blood B cells augmented Ig secretion twofold. In contrast, cell proliferation was inhibited as measured by {sup 3}H-thymidine incorporation. We evaluated two cytokines known to be constitutively produced by EBV cell lines, IL-1 and IL-6. While RA had no effect on IL-1 production, IL-6 synthesis was greatly enhanced (20- to 45-fold), which was also reflected by an increase in steady-state mRNA levels for IL-6 but not TNF-{alpha} or TGF-{beta} on Northern blot analysis. Polyclonal rabbit anti-IL-6 antibodies were used to block the augmenting effects of RA on Ig synthesis of adenoidal B cells. RA-induced augmentation in IgG and IgA synthesis was blocked 58 and 29%, respectively, by anti-IL-6 antibodies. These studies suggest that the enhancing effects of RA on Ig synthesis are mediated, at least in part, by the autocrine or paracrine effects of IL-6 on B-cell differentiation. 37 refs., 5 figs.

  16. Synthesis of tricyclic indole-2-carboxylic [correction of caboxylic] acids as potent NMDA-glycine antagonists.

    PubMed

    Katayama, S; Ae, N; Nagata, R

    2001-05-18

    The practical synthesis of a series of tricyclic indole-2-carboxylic acids, 7-chloro-3-arylaminocarbonylmethyl-1,3,4,5-tetrahydrobenz[cd]indole-2-carboxylic acids, as a new class of potent NMDA-glycine antagonists is described. The synthetic route to the key intermediate 12a comprises a regioselective iodination of 4-chloro-2-nitrotoluene, modified Reissert indole synthesis, Jeffery's Heck-type reaction with allyl alcohol, Wittig-Horner-Emmons reaction, and iodination at the indole C-3 position. The key step in the route is an intramolecular cyclization of 12a to give the tricyclic indole structure. Two methods of cyclization, (1) an intramolecular radical cyclization of 12a and (2) a sequence of intramolecular Heck reaction of 12a followed by a 1,4-reduction, were performed. The resulting tricyclic indole diester 13a was selectively hydrolyzed to afford the desired tricyclic indole monocarboxylic acid 16 on a multihundred gram scale without any chromatographic purifications. Optical resolution of 16 to (-)-isomer 17 and (+)-isomer 18 was carried out, and the resulting isomers were derivatized, respectively. Evaluation of the optically active derivatives for affinity to the NMDA-glycine binding site using the radio ligand binding assay with [(3)H]-5,7-dichlorokynurenic acid revealed that the derivatives of (-)-isomer 17 were more potent than the others and that especially substituted anilide (-)-isomer 24 (K(i) = 0.8 nM) showed high affinity.

  17. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)

    1991-01-01

    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  18. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  19. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward

    2015-01-01

    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  20. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  1. Synthesis and anticancer activity of novel fluorinated asiatic acid derivatives.

    PubMed

    Gonçalves, Bruno M F; Salvador, Jorge A R; Marín, Silvia; Cascante, Marta

    2016-05-23

    A series of novel fluorinated Asiatic Acid (AA) derivatives were successfully synthesized, tested for their antiproliferative activity against HeLa and HT-29 cell lines, and their structure activity relationships were evaluated. The great majority of fluorinated derivatives showed stronger antiproliferative activity than AA in a concentration dependent manner. The most active compounds have a pentameric A-ring containing an α,β-unsaturated carbonyl group. The compounds with better cytotoxic activity were then evaluated against MCF-7, Jurkat, PC-3, A375, MIA PaCa-2 and BJ cell lines. Derivative 14 proved to be the most active compound among all tested derivatives and its mechanism of action was further investigated in HeLa cell line. The results showed that compound 14 induced cell cycle arrest in G0/G1 stage as a consequence of up-regulation of p21(cip1/waf1) and p27(kip1) and down-regulation of cyclin D3 and Cyclin E. Furthermore, compound 14 was found to induce caspase driven-apoptosis with activation of caspases-8 and caspase-3 and the cleavage of PARP. The cleavage of Bid into t-Bid, the up-regulation of Bax and the down-regulation of Bcl-2 were also observed after treatment of HeLa cells with compound 14. Taken together, these mechanistic studies revealed the involvement of extrinsic and intrinsic pathways in the apoptotic process induced by compound 14. Importantly, the antiproliferative activity of this compound on the non-tumor BJ human fibroblast cell line is weaker than in the tested cancer cell lines. The enhanced potency (between 45 and 90-fold more active than AA in a panel of cancer cell lines) and selectivity of this new AA derivative warrant further preclinical evaluation.

  2. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    PubMed Central

    Moret, Séverine; Dyson, Paul J.; Laurenczy, Gábor

    2014-01-01

    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes. PMID:24886955

  3. Effect of nitric acid concentrations on synthesis and stability of maghemite nanoparticles suspension.

    PubMed

    Nurdin, Irwan; Johan, Mohd Rafie; Yaacob, Iskandar Idris; Ang, Bee Chin

    2014-01-01

    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension.

  4. Chemical synthesis and biological evaluation of ω-hydroxy polyunsaturated fatty acids.

    PubMed

    Hwang, Sung Hee; Wagner, Karen; Xu, Jian; Yang, Jun; Li, Xichun; Cao, Zhengyu; Morisseau, Christophe; Lee, Kin Sing Stephen; Hammock, Bruce D

    2017-02-01

    ω-Hydroxy polyunsaturated fatty acids (PUFAs), natural metabolites from arachidonic acid (ARA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) were prepared via convergent synthesis approach using two key steps: Cu-mediated CC bond formation to construct methylene skipped poly-ynes and a partial alkyne hydrogenation where the presence of excess 2-methyl-2-butene as an additive that is proven to be critical for the success of partial reduction of the poly-ynes to the corresponding cis-alkenes without over-hydrogenation. The potential biological function of ω-hydroxy PUFAs in pain was evaluated in naive rats. Following intraplantar injection, 20-hydroxyeicosatetraenoic acid (20-HETE, ω-hydroxy ARA) generated an acute decrease in paw withdrawal thresholds in a mechanical nociceptive assay indicating pain, but no change was observed from rats which received either 20-hydroxyeicosapentaenoic acid (20-HEPE, ω-hydroxy EPA) or 22-hydroxydocosahexaenoic acid (22-HDoHE, ω-hydroxy DHA). We also found that both 20-HEPE and 22-HDoHE are more potent than 20-HETE to activate murine transient receptor potential vanilloid receptor1 (mTRPV1).

  5. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  6. Synthesis and structural characterisation of amides from picolinic acid and pyridine-2,6-dicarboxylic acid

    PubMed Central

    Devi, Prarthana; Barry, Sarah M.; Houlihan, Kate M.; Murphy, Michael J.; Turner, Peter; Jensen, Paul; Rutledge, Peter J.

    2015-01-01

    Coupling picolinic acid (pyridine-2-carboxylic acid) and pyridine-2,6-dicarboxylic acid with N-alkylanilines affords a range of mono- and bis-amides in good to moderate yields. These amides are of interest for potential applications in catalysis, coordination chemistry and molecular devices. The reaction of picolinic acid with thionyl chloride to generate the acid chloride in situ leads not only to the N-alkyl-N-phenylpicolinamides as expected but also the corresponding 4-chloro-N-alkyl-N-phenylpicolinamides in the one pot. The two products are readily separated by column chromatography. Chlorinated products are not observed from the corresponding reactions of pyridine-2,6-dicarboxylic acid. X-Ray crystal structures for six of these compounds are described. These structures reveal a general preference for cis amide geometry in which the aromatic groups (N-phenyl and pyridyl) are cis to each other and the pyridine nitrogen anti to the carbonyl oxygen. Variable temperature 1H NMR experiments provide a window on amide bond isomerisation in solution. PMID:25954918

  7. Reducing isozyme competition increases target fatty acid accumulation in seed triacylglycerols of transgenic Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One goal of green chemistry is the production of industrially useful fatty acids (FAs) in crop plants. We focus on the engineering of industrial FAs, specifically hydroxy fatty acids (HFA) and conjugated polyenoic fatty acids (a-eleostearic acid, ESA), using Arabidopsis (Arabidopsis thaliana) as a m...

  8. The Fas-FADD Death Domain Complex Structure Unravels Signalling by Receptor Clustering

    SciTech Connect

    Scott, F.; Stec, B; Pop, C; Dobaczewska, M; Lee, J; Monosov, E; Robinson, H; Salvesen, G; Schwarzenbacher, R; Riedl, S

    2009-01-01

    The death inducing signalling complex (DISC) formed by Fas receptor, FADD (Fas-associated death domain protein) and caspase 8 is a pivotal trigger of apoptosis1, 2, 3. The Fas-FADD DISC represents a receptor platform, which once assembled initiates the induction of programmed cell death. A highly oligomeric network of homotypic protein interactions comprised of the death domains of Fas and FADD is at the centre of DISC formation4, 5. Thus, characterizing the mechanistic basis for the Fas-FADD interaction is crucial for understanding DISC signalling but has remained unclear largely because of a lack of structural data. We have successfully formed and isolated the human Fas-FADD death domain complex and report the 2.7 A crystal structure. The complex shows a tetrameric arrangement of four FADD death domains bound to four Fas death domains. We show that an opening of the Fas death domain exposes the FADD binding site and simultaneously generates a Fas-Fas bridge. The result is a regulatory Fas-FADD complex bridge governed by weak protein-protein interactions revealing a model where the complex itself functions as a mechanistic switch. This switch prevents accidental DISC assembly, yet allows for highly processive DISC formation and clustering upon a sufficient stimulus. In addition to depicting a previously unknown mode of death domain interactions, these results further uncover a mechanism for receptor signalling solely by oligomerization and clustering events.

  9. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress.

  10. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    PubMed Central

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells. PMID:6965093

  11. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    PubMed

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells.

  12. Synthesis and anticoagulant activity of bioisosteric sulfonic-Acid analogues of the antithrombin-binding pentasaccharide domain of heparin.

    PubMed

    Herczeg, Mihály; Lázár, László; Bereczky, Zsuzsanna; Kövér, Katalin E; Timári, István; Kappelmayer, János; Lipták, András; Antus, Sándor; Borbás, Anikó

    2012-08-20

    Two pentasaccharide sulfonic acids that were related to the antithrombin-binding domain of heparin were prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic-acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic-acid esters were found to be excellent donors and acceptors in the glycosylation reactions. Throughout the synthesis, the hydroxy groups to be methylated were masked in the form of acetates and the hydroxy groups to be sulfated were masked with benzyl groups. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of these new sulfonic-acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic-acid moiety resulted in a notable decrease in the anti-Xa activity. The difference in the biological activity of the disulfonic- and trisulfonic-acid counterparts could be explained by the different conformation of their L-iduronic-acid residues.

  13. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.

    1986-01-01

    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  14. Amino acid metabolism and protein synthesis in lactating rats fed on a liquid diet.

    PubMed Central

    Barber, T; García de la Asunción, J; Puertes, I R; Viña, J R

    1990-01-01

    1. Amino acid metabolism was studied in control virgin rats, lactating rats and virgin rats protein-pair-fed with the lactating rats (high-protein virgin rats). 2. Urinary excretion of nitrogen and urea was higher in lactating than in control virgin rats, and in high-protein virgin rats it was higher than in lactating rats. 3. The activities of urea-cycle enzymes (units/g) were higher in high-protein virgin than in lactating rats, except for arginase. In lactating rats the activities of carbamoyl-phosphate synthase, ornithine carbamoyltransferase and argininosuccinate synthase were lower than in control virgin rats. When the liver size is considered, the activities in lactating rats were similar to those in high-protein virgin rats, except for arginase. 4. N-Acetylglutamate content was higher in high-protein virgin rats than in the other two groups. 5. The rate of urea synthesis from precursors by isolated hepatocytes was higher in high-protein virgin rats than in the other two groups. 6. The flooding-dose method (L-[4-3H]phenylalanine) for measuring protein synthesis was used. The absolute synthesis rates of mammary gland, liver and small-intestinal mucosa were higher in lactating rats than in the other two groups, and in high-protein virgin rats than in control virgin rats 7. These results show that the increased needs for amino acids during lactation are met by hyperphagia and by a nitrogen-sparing mechanism. PMID:2396994

  15. Synthesis of goethite in solutions of artificial seawater and amino acids: a prebiotic chemistry study

    NASA Astrophysics Data System (ADS)

    Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.

    2013-04-01

    This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was

  16. Polyamines are essential for the synthesis of 2-ricinoleoyl phosphatidic acid in developing seeds of castor.

    PubMed

    Tomosugi, Mitsuhiro; Ichihara, Ken'ichi; Saito, Kazumi

    2006-01-01

    The major fatty acid component of castor (Ricinus communis L.) oil is ricinoleic acid (12-hydroxy-cis-9-octadecenoic acid), and unsaturated hydroxy acid accounts for >85% of the total fatty acids in triacylglycerol (TAG). TAG had a higher ricinoleate content at position 2 than at positions 1 and 3. Although lysophosphatidic acid (LPA) acyltransferase (EC 2.3.1.51), which catalyzes acylation of LPA at position 2, was expected to utilize ricinoleoyl-CoA preferentially over other fatty acyl-CoAs, no activity was found for ricinoleoyl-CoA in vitro at concentrations at which other unsaturated acyl-CoAs were incorporated rapidly. However, activity for ricinoleoyl-CoA appeared with addition of polyamines (putrescine, spermidine, and spermine), while polyamines decreased the rates of incorporation of other acyl-CoAs into position 2. The order of effect of polyamines on LPA acyltransferase activity was spermine > spermidine > putrescine. At concentrations of spermine and spermidine of >0.1 mM, ricinoleoyl-CoA served as an effective substrate for LPA acyltransferase reaction. The concentrations of spermine and spermidine in the developing seeds were estimated at approximately 0.09 and approximately 0.63 mM, respectively. These stimulatory effects for incorporation of ricinoleate were specific to polyamines, but basic amino acids were ineffective as cations. In contrast, in microsomes from safflower seeds that do not contain ricinoleic acid, spermine and spermidine stimulated the LPA acyltransferase reaction for all acyl-CoAs tested, including ricinoleoyl-CoA. Although the fatty acid composition of TAG depends on both acyl-CoA composition in the cell and substrate specificity of acyltransferases, castor bean polyamines are crucial for incorporation of ricinoleate into position 2 of LPA. Polyamines are essential for synthesis of 2-ricinoleoyl phosphatidic acid in developing castor seeds.

  17. A strategy for the solution-phase parallel synthesis of N-(pyrrolidinylmethyl)hydroxamic acids.

    PubMed

    Takayanagi, M; Flessner, T; Wong, C H

    2000-06-16

    Both five- and six-membered iminocyclitols have proven to be useful transition-state analogue inhibitors of glycosidases. They also mimic the transition-state sugar moiety of the nucleoside phosphate sugar in glycosyltransferase-catalyzed reactions. Described here is the development of a general strategy toward the parallel synthesis of a five-membered iminocyclitol linked to a hydroxamic acid group designed to mimic the transition state of GDP-fucose complexed with Mn(II) in fucosyltransferase reactions. The iminocyclitol 8 containing a protected hydroxylamine unit was prepared from D-mannitol. The hydroxamic acid moiety was introduced via the reaction of 8 with various acid chlorides. The strategy is generally applicable to the construction of libraries for identification of glycosyltransferase inhibitors.

  18. Facile synthesis of PtAu alloy nanoparticles with high activity for formic acid oxidation

    SciTech Connect

    Zhang, Sheng; Shao, Yuyan; Yin, Geping; Lin, Yuehe

    2010-02-15

    We report the facile synthesis of carbon supported PtAu alloy nanoparticles with high electrocatalytic activity as the anode catalyst for direct formic acid fuel cells (DFAFCs). PtAu alloy nanopaticles are synthesized by co-reducing HAuCl4 and H2PtCl6 with NaBH4 in the presence of sodium citrate and then the nanoparticles are deposited on Vulcan XC-72R carbon support (PtAu/C). The obtained catalysts are characterized with X-ray diffraction (XRD) and transmission electron microscope (TEM), which reveal PtAu alloy formation with an average diameter of 4.6 nm. PtAu/C exhibits 8 times higher catalytic activity toward formic acid oxidation than Pt/C. The enhanced activity of PtAu/C catalyst is attributed to noncontinuous Pt sites formed in the presence of the neighbored Au sites, which promotes direct oxidation of formic acid by avoiding poison CO.

  19. A plausible simultaneous synthesis of amino acids and simple peptides on the primordial Earth.

    PubMed

    Parker, Eric T; Zhou, Manshui; Burton, Aaron S; Glavin, Daniel P; Dworkin, Jason P; Krishnamurthy, Ramanarayanan; Fernández, Facundo M; Bada, Jeffrey L

    2014-07-28

    Following his seminal work in 1953, Stanley Miller conducted an experiment in 1958 to study the polymerization of amino acids under simulated early Earth conditions. In the experiment, Miller sparked a gas mixture of CH4, NH3, and H2O, while intermittently adding the plausible prebiotic condensing reagent cyanamide. For unknown reasons, an analysis of the samples was not reported. We analyzed the archived samples for amino acids, dipeptides, and diketopiperazines by liquid chromatography, ion mobility spectrometry, and mass spectrometry. A dozen amino acids, 10 glycine-containing dipeptides, and 3 glycine-containing diketopiperazines were detected. Miller's experiment was repeated and similar polymerization products were observed. Aqueous heating experiments indicate that Strecker synthesis intermediates play a key role in facilitating polymerization. These results highlight the potential importance of condensing reagents in generating diversity within the prebiotic chemical inventory.

  20. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    PubMed

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism.