Science.gov

Sample records for acid synthesis genes

  1. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  2. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  3. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective. PMID:25055961

  4. Effects of Long Chain Fatty Acid Synthesis and Associated Gene Expression in Microalga Tetraselmis sp

    PubMed Central

    Adarme-Vega, T. Catalina; Thomas-Hall, Skye R.; Lim, David K. Y.; Schenk, Peer M.

    2014-01-01

    With the depletion of global fish stocks, caused by high demand and effective fishing techniques, alternative sources for long chain omega-3 fatty acids are required for human nutrition and aquaculture feeds. Recent research has focused on land-based cultivation of microalgae, the primary producers of omega-3 fatty acids in the marine food web. The effect of salinity on fatty acids and related gene expression was studied in the model marine microalga, Tetraselmis sp. M8. Correlations were found for specific fatty acid biosynthesis and gene expression according to salinity and the growth phase. Low salinity was found to increase the conversion of C18:4 stearidonic acid (SDA) to C20:4 eicosatetraenoic acid (ETA), correlating with increased transcript abundance of the Δ-6-elongase-encoding gene in salinities of 5 and 10 ppt compared to higher salinity levels. The expression of the gene encoding β-ketoacyl-coenzyme was also found to increase at lower salinities during the nutrient deprivation phase (Day 4), but decreased with further nutrient stress. Nutrient deprivation also triggered fatty acids synthesis at all salinities, and C20:5 eicosapentaenoic acid (EPA) increased relative to total fatty acids, with nutrient starvation achieving a maximum of 7% EPA at Day 6 at a salinity of 40 ppt. PMID:24901700

  5. Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

    PubMed Central

    2010-01-01

    Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD) 2 and fatty acid elongase (FAE) 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general development of C. sativa should

  6. Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus synthesizes two siderophores, staphyloferrin A and staphyloferrin B, that promote iron-restricted growth. Previous work on the biosynthesis of staphyloferrin B has focused on the role of the synthetase enzymes, encoded from within the sbnA-I operon, which build the siderophore from the precursor molecules citrate, alpha-ketoglutarate and L-2,3-diaminopropionic acid. However, no information yet exists on several other enzymes, expressed from the biosynthetic cluster, that are thought to be involved in the synthesis of the precursors (or synthetase substrates) themselves. Results Using mutants carrying insertions in sbnA and sbnB, we show that these two genes are essential for the synthesis of staphyloferrin B, and that supplementation of the growth medium with L-2,3-diaminopropionic acid can bypass the block in staphyloferrin B synthesis displayed by the mutants. Several mechanisms are proposed for how the enzymes SbnA, with similarity to cysteine synthase enzymes, and SbnB, with similarity to amino acid dehydrogenases and ornithine cyclodeaminases, function together in the synthesis of this unusual nonproteinogenic amino acid L-2,3-diaminopropionic acid. Conclusions Mutation of either sbnA or sbnB result in abrogation of synthesis of staphyloferrin B, a siderophore that contributes to iron-restricted growth of S. aureus. The loss of staphyloferrin B synthesis is due to an inability to synthesize the unusual amino acid L-2,3-diaminopropionic acid which is an important, iron-liganding component of the siderophore structure. It is proposed that SbnA and SbnB function together as an L-Dap synthase in the S. aureus cell. PMID:21906287

  7. Hydroxy fatty acid synthesis and lipid gene expression during seed development in Lesquerella fendleri (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella fendleri is a developing oilseed crop in U.S. Its seed oil is rich in hydroxy fatty acid (HFA), lesquerolate (C20:1OH), suitable as a raw material for many industrial applications. To understand regulatory mechanism underlying synthesis and accumulation of the lesquerolate, we have inves...

  8. Knockout of mouse Cyp3a gene enhances synthesis of cholesterol and bile acid in the liver[S

    PubMed Central

    Hashimoto, Mari; Kobayashi, Kaoru; Watanabe, Mio; Kazuki, Yasuhiro; Takehara, Shoko; Inaba, Asumi; Nitta, Shin-ichiro; Senda, Naoto; Oshimura, Mitsuo; Chiba, Kan

    2013-01-01

    Here, we studied the effects of cytochrome P450 (CYP)3A deficiency on the mRNA expression of genes encoding regulators of hepatic cholesterol levels using Cyp3a-knockout (Cyp3a−/−) mice. The mRNA expression levels of genes encoding enzymes involved in cholesterol biosynthesis in the livers of Cyp3a−/− mice were higher than those of wild-type (WT) mice. Nuclear levels of sterol regulatory element-binding protein-2 (SREBP-2), which enhances cholesterol biosynthesis, were also higher in the livers of Cyp3a−/− mice. Binding of SREBP-2 to the Hmgcs1 gene promoter was more abundant in the livers of Cyp3a−/− mice. These results suggest that deficiency of CYP3A enzymes enhances transcription of genes encoding enzymes involved in cholesterol biosynthesis via activation of SREBP-2. On the other hand, hepatic cholesterol levels in Cyp3a−/− mice were 20% lower than those in WT mice. The mRNA expression levels of genes encoding enzymes involved in bile acid synthesis, plasma levels of 7α-hydroxy-4-cholesten-3-one and hepatic levels of total bile acid were significantly higher in Cyp3a−/− mice than in WT mice. These findings suggest that reduction of hepatic total cholesterol in Cyp3a−/− mice would be the consequence of enhanced bile acid synthesis. Therefore, CYP3A enzymes appear to play roles in the synthesis of cholesterol and bile acid in vivo. PMID:23709690

  9. Novel Hydroxycinnamoyl-Coenzyme A Quinate Transferase Genes from Artichoke Are Involved in the Synthesis of Chlorogenic Acid1[W

    PubMed Central

    Sonnante, Gabriella; D'Amore, Rosalinda; Blanco, Emanuela; Pierri, Ciro L.; De Palma, Monica; Luo, Jie; Tucci, Marina; Martin, Cathie

    2010-01-01

    Artichoke (Cynara cardunculus subsp. scolymus) extracts have high antioxidant capacity, due primarily to flavonoids and phenolic acids, particularly chlorogenic acid (5-caffeoylquinic acid [CGA]), dicaffeoylquinic acids, and caffeic acid, which are abundant in flower bracts and bioavailable to humans in the diet. The synthesis of CGA can occur following different routes in plant species, and hydroxycinnamoyl-coenzyme A transferases are important enzymes in these pathways. Here, we report on the isolation and characterization of two novel genes both encoding hydroxycinnamoyl-coenzyme A quinate transferases (HQT) from artichoke. The recombinant proteins (HQT1 and HQT2) were assayed after expression in Escherichia coli, and both showed higher affinity for quinate over shikimate. Their preferences for acyl donors, caffeoyl-coenzyme A or p-coumaroyl-coenzyme A, were examined. Modeling and docking analyses were used to propose possible pockets and residues involved in determining substrate specificities in the HQT enzyme family. Quantitative real-time polymerase chain reaction analysis of gene expression indicated that HQT1 might be more directly associated with CGA content. Transient and stable expression of HQT1 in Nicotiana resulted in a higher production of CGA and cynarin (1,3-dicaffeoylquinic acid). These findings suggest that several isoforms of HQT contribute to the synthesis of CGA in artichoke according to physiological needs and possibly following various metabolic routes. PMID:20431089

  10. Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

    SciTech Connect

    Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.; Yankovskii, N.K.; Debabov, V.G.

    1989-01-01

    Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmids consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.

  11. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9. PMID:24184513

  12. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  13. Lipoprotein Lipase, Tissue Expression and Effects on Genes Related to Fatty Acid Synthesis in Goat Mammary Epithelial Cells

    PubMed Central

    Zhao, Wang-Sheng; Hu, Shi-Liang; Yu, Kang; Wang, Hui; Wang, Wei; Loor, Juan; Luo, Jun

    2014-01-01

    Lipoprotein lipase (LPL) serves as a central factor in hydrolysis of triacylglycerol and uptake of free fatty acids from the plasma. However, there are limited data concerning the action of LPL on the regulation of milk fat synthesis in goat mammary gland. In this investigation, we describe the cloning and sequencing of the LPL gene from Xinong Saanen dairy goat mammary gland, along with a study of its phylogenetic relationships. Sequence analysis showed that goat LPL shares similarities with other species including sheep, bovine, human and mouse. LPL mRNA expression in various tissues determined by RT-qPCR revealed the highest expression in white adipose tissue, with lower expression in heart, lung, spleen, rumen, small intestine, mammary gland, and kidney. Expression was almost undetectable in liver and muscle. The expression profiles of LPL gene in mammary gland at early, peak, mid, late lactation, and the dry period were also measured. Compared with the dry period, LPL mRNA expression was markedly greater at early lactation. However, compared with early lactation, the expression was lower at peak lactation and mid lactation. Despite those differences, LPL mRNA expression was still greater at peak, mid, and late lactation compared with the dry period. Using goat mammary epithelial cells (GMEC), the in vitro knockdown of LPL via shRNA or with Orlistat resulted in a similar degree of down-regulation of LPL (respectively). Furthermore, knockdown of LPL was associated with reduced mRNA expression of SREBF1, FASN, LIPE and PPARG but greater expression of FFAR3. There was no effect on ACACA expression. Orlistat decreased expression of LIPE, FASN, ACACA, and PPARG, and increased FFAR3 and SREBF1 expression. The pattern of LPL expression was similar to the changes in milk fat percentage in lactating goats. Taken together, results suggest that LPL may play a crucial role in fatty acid synthesis. PMID:25501331

  14. Chromosomal integration of hyaluronic acid synthesis (has) genes enhances the molecular weight of hyaluronan produced in Lactococcus lactis.

    PubMed

    Hmar, Rothangmawi Victoria; Prasad, Shashi Bala; Jayaraman, Guhan; Ramachandran, Kadathur B

    2014-12-01

    Microbial production of hyaluronic acid (HA) is an attractive substitute for extraction of this biopolymer from animal tissues. Natural producers such as Streptococcus zooepidemicus are potential pathogens; therefore, production of HA by recombinant bacteria that are generally recognized as safe (GRAS) organisms is a viable alternative that is being extensively explored. However, plasmid-based expression systems for HA production by recombinant bacteria have the inherent disadvantage of reduced productivity because of plasmid instability. To overcome this problem, the HA synthesis genes (hasA-hasB and hasA-hasB-hasC) from has-operon of S. zooepidemicus were integrated into the chromosome of Lactococcus lactis by site-directed, double-homologous recombination developing strains VRJ2AB and VRJ3ABC. The chromosomal integration stabilized the genes and obviated the instability observed in plasmid-expressed recombinant strains. The genome-integrated strains produced higher molecular weight (3.5-4 million Dalton [MDa]) HA compared to the plasmid-expressed strains (2 MDa). High molecular weight HA was produced when the intracellular concentration of uridine diphosphate N-acetylglucosamine (UDP-GlcNAc) and uridine diphosphate-glucuronic acid (UDP-GlcUA) was almost equal and hasA to hasB ratio was low. This work suggests an optimal approach to obtain high molecular weight HA in recombinant strains. PMID:25044639

  15. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  16. Collagen synthesis promoting pullulan-PEI-ascorbic acid conjugate as an efficient anti-cancer gene delivery vector.

    PubMed

    Ambattu, Lizebona August; Rekha, M R

    2015-08-01

    Cationized pullulan (pullulan-PEI; PP) was synthesized and further modified with an anti-oxidant molecule, ascorbic acid (PPAA) at various ratios. The nanoplexes formed at an optimum ratio of 4:1 was within a size of 150nm and had a zeta potential of 9-14mV. The nanoplexes at this ratio was used for further investigations. The cell internalization and transfection efficiency of these nanoplexes were determined in presence of serum. The internalization and transfection efficiency were found to be unaffected by the presence of fetal bovine serum. Another interesting observation was that this polymer was found to have collagen synthesis promoting property. The collagen synthesis effect of these polymers was quantified and observed that PPAA3 promoted the highest. Transfection efficiency was evaluated by assessing the p53 gene expression in C6 rat glioma cells and cell death was quantified to be 96% by flow cytometry, thus establishing the high efficacy of this polymer. PMID:25933522

  17. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei

    2009-01-01

    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  18. Inhibition of Mammalian Target of Rapamycin Complex 1 (mTORC1) Downregulates ELOVL1 Gene Expression and Fatty Acid Synthesis in Goat Fetal Fibroblasts

    PubMed Central

    Wang, Weipeng; He, Qiburi; Guo, Zhixin; Yang, Limin; Bao, Lili; Bao, Wenlei; Zheng, Xu; Wang, Yanfeng; Wang, Zhigang

    2015-01-01

    Elongation of very-long-chain fatty acids 1 (ELOVL1) is a ubiquitously expressed gene that belongs to the ELOVL family and regulates the synthesis of very-long-chain fatty acids (VLCFAs) and sphingolipids, from yeast to mammals. Mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of cell metabolism and is associated with fatty acids synthesis. In this study, we cloned the cDNA that encodes Cashmere goat (Capra hircus) ELOVL1 (GenBank Accession number KF549985) and investigated its expression in 10 tissues. ELOVL1 cDNA was 840 bp, encoding a deduced protein of 279 amino acids, and ELOVL1 mRNA was expressed in a wide range of tissues. Inhibition of mTORC1 by rapamycin decreased ELOVL1 expression and fatty acids synthesis in Cashmere goat fetal fibroblasts. These data show that ELOVL1 expression is regulated by mTORC1 and that mTORC1 has significant function in fatty acids synthesis in Cashmere goat. PMID:26204830

  19. Fibroblasts from patients with Diamond-Blackfan anaemia show abnormal expression of genes involved in protein synthesis, amino acid metabolism and cancer

    PubMed Central

    Avondo, Federica; Roncaglia, Paola; Crescenzio, Nicoletta; Krmac, Helena; Garelli, Emanuela; Armiraglio, Marta; Castagnoli, Carlotta; Campagnoli, Maria Francesca; Ramenghi, Ugo; Gustincich, Stefano; Santoro, Claudio; Dianzani, Irma

    2009-01-01

    Background Diamond-Blackfan anaemia (DBA) is a rare inherited red cell hypoplasia characterised by a defect in the maturation of erythroid progenitors and in some cases associated with malformations. Patients have an increased risk of solid tumors. Mutations have been found in several ribosomal protein (RP) genes, i.e RPS19, RPS24, RPS17, RPL5, RPL11, RPL35A. Studies in haematopoietic progenitors from patients show that haplo-insufficiency of an RP impairs rRNA processing and ribosome biogenesis. DBA lymphocytes show reduced protein synthesis and fibroblasts display abnormal rRNA processing and impaired proliferation. Results To evaluate the involvement of non-haematopoietic tissues in DBA, we have analysed global gene expression in fibroblasts from DBA patients compared to healthy controls. Microarray expression profiling using Affymetrix GeneChip Human Genome U133A 2.0 Arrays revealed that 421 genes are differentially expressed in DBA patient fibroblasts. These genes include a large cluster of ribosomal proteins and factors involved in protein synthesis and amino acid metabolism, as well as genes associated to cell death, cancer and tissue development. Conclusion This analysis reports for the first time an abnormal gene expression profile in a non-haematopoietic cell type in DBA. These data support the hypothesis that DBA may be due to a defect in general or specific protein synthesis. PMID:19765279

  20. Mechanism of Tissue-specific Farnesoid X Receptor in Suppressing the Expression of Genes in Bile-acid Synthesis in Mice

    PubMed Central

    Kong, Bo; Wang, Li; Chiang, John Y. L.; Zhang, Youcai; Klaassen, Curtis D.; Guo, Grace L.

    2012-01-01

    Activation of farnesoid X receptor (Fxr, Nr1h4) is a major mechanism in suppressing bile-acid synthesis by reducing the expression levels of genes encoding key bile-acid synthetic enzymes, CYP7A1/Cyp7a1 and CYP8B1/Cyp8b1. FXR-mediated induction of hepatic small heterodimer partner (SHP/Shp, Nr0b2) and intestinal fibroblast growth factor 15 (Fgf15, FGF19 in human) has been shown to be responsible for this suppression. However, the exact contribution of Shp/Fgf15 to this suppression and the associated cell signaling pathway is unclear. By using novel genetically modified mice, the current study showed that the intestinal Fxr/Fgf15 pathway was critical for suppressing both Cyp7a1 and Cyp8b1 gene expression, but the liver Fxr/Shp pathway was important for suppressing Cyp8b1 gene expression and had a minor role in suppressing Cyp7a1 gene expression. Furthermore, in vivo administration of Fgf15 protein to mice led to a strong activation of ERK, and to a smaller degree, JNK, in the liver. In addition, deficiency of either the ERK or JNK pathway in mouse livers reduced the basal, but not the Fgf15-mediated suppression, of Cyp7a1 and Cyp8b1 gene expression. However, deficiency of both ERK and JNK pathways prevented Fgf15-mediated suppression of Cyp7a1 and Cyp8b1 gene expression. Conclusion the current study clearly elucidates the underlying molecular mechanism of hepatic vs. intestinal Fxr in regulating the expression of genes critical for bile-acid synthesis and hydrophobicity in the liver. PMID:22467244

  1. The effect of gestational age on expression of genes involved in uptake, trafficking and synthesis of fatty acids in the rat placenta.

    PubMed

    Rodríguez-Cruz, Maricela; González, Raúl Sánchez; Maldonado, Jorge; López-Alarcón, Mardia; Bernabe-García, Mariela

    2016-10-15

    Gestation triggers a tight coordination among maternal tissues to provide fatty acids (FA) to the fetus through placental transport; however, there is insufficient evidence regarding regulation of proteins involved in placental transport of FA according to gestational age. The aim of this study was to determine the role of gestational age on the expression of genes involved in FA uptake, trafficking and synthesis in the rat placenta to support fetal demands. Gene expression of encoding proteins for placental transport and synthesis of FA was measured in placenta. Also, FA composition was measured in placenta, fetuses and newborns. mRNA expression of lipoprotein lipase (lpl) and fatp-1 (for uptake) was 4.4- and 1.43-fold higher, respectively, during late gestation than at P14, but expression of p-fabp-pm decreased 0.37-fold at late pregnancy in comparison with P14. Only mRNA fabp-4 member for trafficking of FA was 2.95-fold higher at late gestation than at P14. mRNA of fasn and elovl-6 participating in saturated FA and enzymes for the polyunsaturated FA synthesis were downregulated during late gestation and their regulator srebf-1c increased at P16. This study suggests that gestational age has an effect on expression of some genes involved in uptake, trafficking and synthesis of FA in the rat placenta; mRNA expression of lpl and, fatp-1 for uptake and fabp-4 implicated in trafficking was expressed at high levels at late gestation. In addition, placenta expresses the mRNAs involved in FA synthesis; these genes were expressed at low levels at late gestation. Additionally, mRNAs of Srebf-1c transcriptional regulator of desaturases and elongases was highly expressed during late gestation. Finally, these changes in the rat placenta allowed the placenta to partially supply saturated and monounsaturated FA to the fetus. PMID:27317891

  2. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  3. Transgenesis of humanized fat1 promotes n-3 polyunsaturated fatty acid synthesis and expression of genes involved in lipid metabolism in goat cells.

    PubMed

    Fan, Yixuan; Ren, Caifang; Wang, Zhibo; Jia, Ruoxin; Wang, Dan; Zhang, Yanli; Zhang, Guomin; Wan, Yongjie; Huang, Mingrui; Wang, Feng

    2016-01-15

    The n-3 fatty acid desaturase gene fat1 codes for the n-3 desaturase enzyme, which can convert n-6 polyunsaturated fatty acids (PUFAs) to n-3 PUFAs. The n-3 PUFAs are essential components required for normal cellular function and have preventive and therapeutic effects on many diseases. Goat is an important domestic animal for human consumption of meat and milk. To elevate the concentrations of n-3 PUFAs and examine the regulatory mechanism of fat1 in PUFA metabolism in goat cells, we successfully constructed a humanized fat1 expression vector and confirmed the efficient expression of fat1 in goat ear skin-derived fibroblast cells (GEFCs) by qRT-PCR and Western blot analysis. Fatty acid analysis showed that fat1 overexpression significantly increased the levels of total n-3 PUFAs and decreased the levels of total n-6 PUFAs in GEFCs. In addition, qRT-PCR results indicate that the FADS1 and FADS2 desaturase genes, ELOV2 and ELOV5 elongase genes, ACO and CPT1 oxidation genes, and PPARa and PPARγ transcription factors are up-regulated, and transcription factors of SREBP-1c gene are down-regulated in the fat1 transgenic goat cells. Overall, fat1-overexpression resulted in an increase in the n-3 fatty acids and altered expression of PUFA synthesis related genes in GEFCs. This work lays a foundation for both the production of fat1 transgenic goats and further study of the mechanism of fat1 function in the PUFAs metabolism. PMID:26474750

  4. MicroRNA-24 can control triacylglycerol synthesis in goat mammary epithelial cells by targeting the fatty acid synthase gene.

    PubMed

    Wang, H; Luo, J; Chen, Z; Cao, W T; Xu, H F; Gou, D M; Zhu, J J

    2015-12-01

    In nonruminants it has been demonstrated that microRNA-24 (miR-24) is involved in preadipocyte differentiation, hepatic lipid, and plasma triacylglycerol synthesis. However, its role in ruminant mammary gland remains unclear. In this study we measured miR-24 expression in goat mammary gland tissue at 4 different stages of lactation and observed that it had highest expression at peak lactation when compared with the dry period. Overexpression or downregulation of miR-24 in goat mammary epithelial cells (GMEC) strongly affected fatty acid profiles; in particular, miR-24 enhanced unsaturated fatty acid concentration. Additional effects of miR-24 included changes in triacylglycerol content and the expression of fatty acid synthase, sterol regulatory element binding transcription protein 1, stearoyl-CoA desaturase, glycerol-3-phosphate acyltransferase mitochondrial, and acetyl-CoA carboxylase. Luciferase reporter assay confirmed that fatty acid synthase is a target of miR-24. Taken together, these results not only highlight the physiological importance of miR-24 in fatty acid metabolism in GMEC, but also laid the foundation for further research on regulatory mechanisms among miR-24 and other microRNA expressed in GMEC. PMID:26476938

  5. Synthesis and evaluation of a glutamic acid-modified hPAMAM complex as a promising versatile gene carrier.

    PubMed

    Hemmati, Mohammad; Kazemi, Bahram; Najafi, Farhood; Zarebkohan, Amir; Shirkoohi, Reza

    2016-06-01

    Hyperbranched poly(amidoamine) (HPAMAM), structurally analogous to polyamidoamine dendrimer (PAMAM) dendrimers, has been suggested to be an effective carrier for gene delivery. In the present study, glutamic acid-modified hPAMAM was developed as a novel non-viral gene carrier for the first time. The hPAMAM was synthesized by using a modified one-pot method. DNA was found to be bound to hPAMAM at different weight ratios (WhPAMAM/WDNA). The resulting HPAMAM-Glu20 was able to efficiently protect the encapsulated-DNA against degradation for over 2 h. In addition to low cytotoxicity, the transfection efficiency of hPAMAM-Glu20 represented much higher (p < 0.05) than that of Lipofectamine 2000 in both MCF7 and MDA-MB231 cells. Cellular uptake of the hPAMAM-Glu20 in MDA-MB231 cells, 173.56 ± 1.37%, was significantly higher than that of MCF7 cells, 65.00 ± 1.73% (p < 0.05). The results indicated that hPAMAM-Glu20-mediated gene delivery to breast cancer cells is a feasible and effective strategy that may provide a new therapeutic avenue as a non-viral gene delivery carrier. In addition, it was found that hPAMAM-glutamic amino acid (Glu)-based gene delivery is an economical, effective and biocompatible method. PMID:26339844

  6. Synthesis and characterization of a PAMAM-OH derivative containing an acid-labile β-thiopropionate bond for gene delivery.

    PubMed

    Chen, Kang; Chen, Qing; Wang, Kuanglei; Zhu, Jia; Li, Weinan; Li, Wenpan; Qiu, Lipeng; Guan, Guannan; Qiao, Mingxi; Zhao, Xiuli; Hu, Haiyang; Chen, Dawei

    2016-07-25

    The present report describes the synthesis of a hydroxyl terminal PAMAM dendrimer (PAMAM-OH) derivative (PAMSPF). The hydroxyls of PAMAM-OH were attached to S-Methyl-l-cysteine (SMLC) via an acid-labile ester bond, named as β-thiopropionate bond, followed by modification with folic acid (FA) through a polyethylene glycol (PEG) linker. The degrees of attachment of SMLC and FA to the PAMAM-OH backbone were 83.9% and 12.8%, respectively. PAMSPF could condense DNA to form spherical nanoparticles with particle sizes of ∼200nm and remain stable in the presence of heparin and nuclease. The β-thiopropionate bond in PAMSPF was hydrolyzed completely and the DNA release rate was 95.8±3.3% after incubation under mildly acidic conditions at 37°C for 3h. PAMSPF/DNA was less cytotoxic to KB and HepG2 cells and exhibited a higher gene transfection efficiency than native PAMAM/DNA. The uptake assays showed that PAMSPF/DNA entered KB cells within 0.5h through folate receptor-mediated endocytosis and escaped from endosomes within 2h. In addition, PAMSPF/DNA displayed long circulation time along with excellent targeting of tumor sites in vivo. These findings demonstrate that PAMSPF is an excellent carrier for safe and effective gene delivery. PMID:27260132

  7. A novel amidase from Brevibacterium epidermidis ZJB-07021: gene cloning, refolding and application in butyrylhydroxamic acid synthesis.

    PubMed

    Ruan, Li-Tao; Zheng, Ren-Chao; Zheng, Yu-Guo

    2016-08-01

    A novel amidase gene (bami) was cloned from Brevibacterium epidermidis ZJB-07021 by combination of degenerate PCR and high-efficiency thermal asymmetric interlaced PCR (hiTAIL-PCR). The deduced amino acid sequence showed low identity (≤55 %) with other reported amidases. The bami gene was overexpressed in Escherichia coli, and the resultant inclusion bodies were refolded and purified to homogeneity with a recovery of 22.6 %. Bami exhibited a broad substrate spectrum towards aliphatic, aromatic and heterocyclic amides, and showed the highest acyl transfer activity towards butyramide with specific activity of 1331.0 ± 24.0 U mg(-1). Kinetic analysis demonstrated that purified Bami exhibited high catalytic efficiency (414.9 mM(-1) s(-1)) for acyl transfer of butyramide, with turnover number (K cat) of 3569.0 s(-1). Key parameters including pH, substrate/co-substrate concentration, reaction temperature and catalyst loading were investigated and the Bami showed maximum acyl transfer activity at 50 °C, pH 7.5. Enzymatic catalysis of 200 mM butyramide with 15 μg mL(-1) purified Bami was completed in 15 min with a BHA yield of 88.1 % under optimized conditions. The results demonstrated the great potential of Bami for the production of a variety of hydroxamic acids. PMID:27276936

  8. Improved ethyl caproate production of Chinese liquor yeast by overexpressing fatty acid synthesis genes with OPI1 deletion.

    PubMed

    Chen, Yefu; Luo, Weiwei; Gong, Rui; Xue, Xingxiang; Guan, Xiangyu; Song, Lulu; Guo, Xuewu; Xiao, Dongguang

    2016-09-01

    During yeast fermentation, ethyl esters play a key role in the development of the flavor profiles of Chinese liquor. Ethyl caproate, an ethyl ester eliciting apple-like flavor, is the characteristic flavor of strong aromatic liquor, which is the best selling liquor in China. In the traditional fermentation process, ethyl caproate is mainly produced at the later fermentation stage by aroma-producing yeast, bacteria, and mold in a mud pit instead of Saccharomyces cerevisiae at the expense of grains and fermentation time. To improve the production of ethyl caproate by Chinese liquor yeast (S. cerevisiae) with less food consumption and shorter fermentation time, we constructed three recombinant strains, namely, α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 by overexpressing acetyl-CoA carboxylase (ACC1), fatty acid synthase 1 (FAS1), and fatty acid synthase 2 (FAS2) with OPI1 (an inositol/choline-mediated negative regulatory gene) deletion, respectively. In the liquid fermentation of corn hydrolysate, the contents of ethyl caproate produced by α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 increased by 0.40-, 1.75-, and 0.31-fold, correspondingly, compared with the initial strain α5. The contents of other fatty acid ethyl esters (FAEEs) (C8:0, C10:0, C12:0) also increased. In comparison, the content of FAEEs produced by α5-FAS1ΔOPI1 significantly improved. Meanwhile, the contents of acetyl-CoA and ethyl acetate were enhanced by α5-FAS1ΔOPI1. Overall, this study offers a promising platform for the development of pure yeast culture fermentation of Chinese strong aromatic liquor without the use of a mud pit. PMID:27344573

  9. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  10. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  11. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  12. Hydroxamic acids in asymmetric synthesis.

    PubMed

    Li, Zhi; Yamamoto, Hisashi

    2013-02-19

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  13. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  14. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  15. Dynamic regions within and horizontal transfer of an otherwise stable gene cluster responsible for synthesis of the Fusarium mycotoxin fusaric acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Fusarium mycotoxin fusaric acid is toxic to plants as well as animals, but its function in the biology of the fungus is not known. Here, we used genome sequencing to survey multiple species in 18 lineages (species complexes) of Fusarium for the presence of the fusaric acid biosynthetic gene (FUB...

  16. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  17. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.

    2012-01-01

    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  18. Synthesis of new polysialic acid derivatives.

    PubMed

    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke

    2010-09-01

    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  19. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  20. Total synthesis of (+)-zaragozic acid C.

    PubMed

    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G

    2000-10-20

    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  1. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  2. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  3. Association Between Seed Dormancy and Pericarp Color Is Controlled by a Pleiotropic Gene That Regulates Abscisic Acid and Flavonoid Synthesis in Weedy Red Rice

    PubMed Central

    Gu, Xing-You; Foley, Michael E.; Horvath, David P.; Anderson, James V.; Feng, Jiuhuan; Zhang, Lihua; Mowry, Chase R.; Ye, Heng; Suttle, Jeffrey C.; Kadowaki, Koh-ichi; Chen, Zongxiang

    2011-01-01

    Seed dormancy has been associated with red grain color in cereal crops for a century. The association was linked to qSD7-1/qPC7, a cluster of quantitative trait loci for seed dormancy/pericarp color in weedy red rice. This research delimited qSD7-1/qPC7 to the Os07g11020 or Rc locus encoding a basic helix-loop-helix family transcription factor by intragenic recombinants and provided unambiguous evidence that the association arises from pleiotropy. The pleiotropic gene expressed in early developing seeds promoted expression of key genes for biosynthesis of abscisic acid (ABA), resulting in an increase in accumulation of the dormancy-inducing hormone; activated a conserved network of eight genes for flavonoid biosynthesis to produce the pigments in the lower epidermal cells of the pericarp tissue; and enhanced seed weight. Thus, the pleiotropic locus most likely controls the dormancy and pigment traits by regulating ABA and flavonoid biosynthetic pathways, respectively. The dormancy effect could be eliminated by a heat treatment, but could not be completely overcome by gibberellic acid or physical removal of the seed maternal tissues. The dormancy-enhancing alleles differentiated into two groups basically associated with tropical and temperate ecotypes of weedy rice. Of the pleiotropic effects, seed dormancy could contribute most to the weed adaptation. Pleiotropy prevents the use of the dormancy gene to improve resistance of white pericarp cultivars against pre-harvest sprouting through conventional breeding approaches. PMID:21954164

  4. Race-Specific Elicitors of Cladosporium fulvum Induce Changes in Cell Morphology and the Synthesis of Ethylene and Salicylic Acid in Tomato Plants Carrying the Corresponding Cf Disease Resistance Gene.

    PubMed Central

    Hammond-Kosack, K. E.; Silverman, P.; Raskin, I.; Jones, JDG.

    1996-01-01

    Defense responses mediated by the genetically unlinked Cf-9 and Cf-2 genes were compared with those involving no Cf gene (Cf0). Compatible tomato (Lycopersicon esculentum)-Cladosporium fulvum intercellular washing fluids were injected into tomato cotyledons, and the kinetics of responses was monitored under conditions of 70 and 98% relative humidity. The latter conditions suppressed the normal macroscopic responses. For the Cf-9-Avr9 interaction, stomatal opening was induced within 3 to 4 h and after 9 h mesophyll cell death commenced. A burst of ethylene production occurred between 9 and 12.5 h and remained elevated. Free salicylic acid levels increased after 12 h, peaked at 24 h, and thereafter declined. For the Cf-2-Avr2 interaction, stomata became plugged after 8 h, and salicylic acid and ethylene levels increased by 12 and 18 h, respectively, and thereafter declined. Host cell death commenced around vascular tissue by 24 h. Cell death in both incompatible interactions was frequently preceded by cell enlargement. For Cf0-injected plants, no significant responses were detected. High humidity delayed and reduced the Cf-Avr-gene-dependent cell death and ethylene synthesis, whereas induced salicylic acid levels were unaffected for Cf-2-Avr2 and reduced in magnitude only for Cf-9-Avr9. PMID:12226268

  5. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  6. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  7. Hyperosmotic stress induces aquaporin-dependent cell shrinkage, polyphosphate synthesis, amino acid accumulation, and global gene expression changes in Trypanosoma cruzi.

    PubMed

    Li, Zhu-Hong; Alvarez, Vanina E; De Gaudenzi, Javier G; Sant'Anna, Celso; Frasch, Alberto C C; Cazzulo, Juan J; Docampo, Roberto

    2011-12-23

    The protist parasite Trypanosoma cruzi has evolved the ability to transit between completely different hosts and to replicate in adverse environments. In particular, the epimastigote form, the replicative stage inside the vector, is subjected to nutritional and osmotic stresses during its development. In this work, we describe the biochemical and global gene expression changes of epimastigotes under hyperosmotic conditions. Hyperosmotic stress resulted in cell shrinking within a few minutes. Depending on the medium osmolarity, this was followed by lack of volume recovery for at least 2 h or by slow recovery. Experiments with inhibitors, or with cells in which an aquaporin gene (TcAQP1) was knocked down or overexpressed, revealed its importance for the cellular response to hyperosmotic stress. Furthermore, the adaptation to this new environment was shown to involve the regulation of the polyphosphate polymerization state as well as changes in amino acid catabolism to generate compatible osmolytes. A genome-wide transcriptional analysis of stressed parasites revealed down-regulation of genes belonging to diverse functional categories and up-regulation of genes encoding trans-sialidase-like and ribosomal proteins. Several of these changes were confirmed by Northern blot analyses. Sequence analysis of the 3'UTRs of up- and down-regulated genes allowed the identification of conserved structural RNA motifs enriched in each group, suggesting that specific ribonucleoprotein complexes could be of great importance in the adaptation of this parasite to different environments through regulation of transcript abundance. PMID:22039054

  8. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  9. Enantioselective Total Synthesis of Secalonic Acid E.

    PubMed

    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F

    2015-11-16

    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  10. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  11. Transcriptional regulation of delta-aminolevulinic acid dehydratase synthesis by oxygen in Bradyrhizobium japonicum and evidence for developmental control of the hemB gene.

    PubMed Central

    Chauhan, S; O'Brian, M R

    1997-01-01

    An increased demand for cytochromes is associated with symbiotic development and microaerobic metabolism in the bacterium Bradyrhizobium japonicum, and evidence suggests that hemB, rather than hemA, is the first essential bacterial heme synthesis gene in symbiosis with soybean. Steady-state levels of mRNA and protein encoded by hemB were strongly and rapidly induced by O2 deprivation as determined by RNase protection and immunoblot analyses, but hemH message was not induced. Oxygen limitation resulted in a greater-than-10-fold increase in the rate of hemB mRNA synthesis as determined by transcriptional runoff experiments, whereas hemH transcription was unaffected by the O2 status. Thus, hemB is a regulated gene in B. japonicum and is transcriptionally controlled by O2. Unlike the expression in parent strain I110, hemB expression was not affected by O2 in the fixJ strain 7360, and O2-limited cultures of the mutant contained quantities of hemB mRNA and protein that were comparable to uninduced levels found in aerobic cells. In addition, spectroscopic analysis of cell extracts showed that increases in b- and c-type cytochromes and the disappearance of cytochrome aa3 in response to microaerobic growth in wild-type cells were not observed in the fixJ mutant. FixJ is a key transcriptional regulator that mediates O2-dependent differentiation in rhizobia, and therefore hemB expression is under developmental control. Furthermore, the data suggest a global control of cytochrome expression and heme biosynthesis in response to the cellular O2 status. PMID:9171420

  12. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  13. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  14. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  15. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  16. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H

    1988-01-01

    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  17. Inhibition of de novo Palmitate Synthesis by Fatty Acid Synthase Induces Apoptosis in Tumor Cells by Remodeling Cell Membranes, Inhibiting Signaling Pathways, and Reprogramming Gene Expression

    PubMed Central

    Ventura, Richard; Mordec, Kasia; Waszczuk, Joanna; Wang, Zhaoti; Lai, Julie; Fridlib, Marina; Buckley, Douglas; Kemble, George; Heuer, Timothy S.

    2015-01-01

    Inhibition of de novo palmitate synthesis via fatty acid synthase (FASN) inhibition provides an unproven approach to cancer therapy with a strong biological rationale. FASN expression increases with tumor progression and associates with chemoresistance, tumor metastasis, and diminished patient survival in numerous tumor types. TVB-3166, an orally-available, reversible, potent, and selective FASN inhibitor induces apoptosis, inhibits anchorage-independent cell growth under lipid-rich conditions, and inhibits in-vivo xenograft tumor growth. Dose-dependent effects are observed between 20–200 nM TVB-3166, which agrees with the IC50 in biochemical FASN and cellular palmitate synthesis assays. Mechanistic studies show that FASN inhibition disrupts lipid raft architecture, inhibits biological pathways such as lipid biosynthesis, PI3K–AKT–mTOR and β-catenin signal transduction, and inhibits expression of oncogenic effectors such as c-Myc; effects that are tumor-cell specific. Our results demonstrate that FASN inhibition has anti-tumor activities in biologically diverse preclinical tumor models and provide mechanistic and pharmacologic evidence that FASN inhibition presents a promising therapeutic strategy for treating a variety of cancers, including those expressing mutant K-Ras, ErbB2, c-Met, and PTEN. The reported findings inform ongoing studies to link mechanisms of action with defined tumor types and advance the discovery of biomarkers supporting development of FASN inhibitors as cancer therapeutics. Research in context Fatty acid synthase (FASN) is a vital enzyme in tumor cell biology; the over-expression of FASN is associated with diminished patient prognosis and resistance to many cancer therapies. Our data demonstrate that selective and potent FASN inhibition with TVB-3166 leads to selective death of tumor cells, without significant effect on normal cells, and inhibits in vivo xenograft tumor growth at well-tolerated doses. Candidate biomarkers for

  18. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  19. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  20. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  1. Synthesis of carbon-13-labeled tetradecanoic acids.

    PubMed

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  2. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  3. Docosahexaenoic acid prevents trans-10, cis-12 conjugated linoleic acid-induced non-alcoholic fatty liver disease in mice by altering expression of hepatic genes regulating fatty acid synthesis and oxidation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Concomitant supplementation with docosahexaenoic acid (22:6 n-3; DHA) prevented t10, c12- conjugated linoleic acid (CLA)-induced non-alcoholic fatty liver disease (NAFLD) and insulin resistance. Effective dose of DHA and mechanisms involved are poorly understood. Methods: We examined abi...

  4. Effect of the “Ribonucleic Acid Control” Locus in Escherichia coli on T4 Bacteriophage-Specific Ribonucleic Acid Synthesis

    PubMed Central

    Sköld, Ola

    1970-01-01

    Amino acid control of ribonucleic acid (RNA) synthesis in bacteria is known to be governed genetically by the rel locus. We investigated whether the rel gene of the host would also exert its effect on the regulation of phage-specific RNA synthesis in T4 phage-infected Escherichia coli cells. Since T-even phage infection completely shuts off host macromolecular synthesis, phage RNA synthesis could be followed specifically by the cumulative incorporation of radioactivity from labeled precursors into RNA of infected cells. Labeled uracil was shown to accumulate in phage-specific RNA for 30 to 35 min after infection, a phenomenon which probably reflects an expansion of the labile phage-RNA pool. Amino acid starvation was effected by the use of auxotrophic bacterial strains or thienylalanine. The latter substance is an amino acid analogue which induces a chemical auxotrophy by inhibiting the biosynthesis of phenylalanine, tyrosine, and tryptophan. Phage RNA synthesis was strictly dependent on the presence of amino acids, whereas phage deoxyribonucleic acid synthesis was not. By the use of several pairs of bacterial strains which were isogenic except for the rel gene, it was demonstrated that amino acid dependence was related to the allelic state of this gene. If the rel gene was mutated, amino acid starvation did not restrict phage RNA synthesis. PMID:4914097

  5. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2014-05-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  6. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2008-09-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  7. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  8. Amino acid regulation of gene expression.

    PubMed Central

    Fafournoux, P; Bruhat, A; Jousse, C

    2000-01-01

    The impact of nutrients on gene expression in mammals has become an important area of research. Nevertheless, the current understanding of the amino acid-dependent control of gene expression is limited. Because amino acids have multiple and important functions, their homoeostasis has to be finely maintained. However, amino-acidaemia can be affected by certain nutritional conditions or various forms of stress. It follows that mammals have to adjust several of their physiological functions involved in the adaptation to amino acid availability by regulating the expression of numerous genes. The aim of the present review is to examine the role of amino acids in regulating mammalian gene expression and protein turnover. It has been reported that some genes involved in the control of growth or amino acid metabolism are regulated by amino acid availability. For instance, limitation of several amino acids greatly increases the expression of the genes encoding insulin-like growth factor binding protein-1, CHOP (C/EBP homologous protein, where C/EBP is CCAAT/enhancer binding protein) and asparagine synthetase. Elevated mRNA levels result from both an increase in the rate of transcription and an increase in mRNA stability. Several observations suggest that the amino acid regulation of gene expression observed in mammalian cells and the general control process described in yeast share common features. Moreover, amino acid response elements have been characterized in the promoters of the CHOP and asparagine synthetase genes. Taken together, the results discussed in the present review demonstrate that amino acids, by themselves, can, in concert with hormones, play an important role in the control of gene expression. PMID:10998343

  9. A simple, universal, efficient PCR-based gene synthesis method: sequential OE-PCR gene synthesis.

    PubMed

    Zhang, Pingping; Ding, Yingying; Liao, Wenting; Chen, Qiuli; Zhang, Huaqun; Qi, Peipei; He, Ting; Wang, Jinhong; Deng, Songhua; Pan, Tianyue; Ren, Hao; Pan, Wei

    2013-07-25

    Herein we present a simple, universal, efficient gene synthesis method based on sequential overlap extension polymerase chain reactions (OE-PCRs). This method involves four key steps: (i) the design of paired complementary 54-mer oligonucleotides with 18 bp overlaps, (ii) the utilisation of sequential OE-PCR to synthesise full-length genes, (iii) the cloning and sequencing of four positive T-clones of the synthesised genes and (iv) the resynthesis of target genes by OE-PCR with correct templates. Mispriming and secondary structure were found to be the principal obstacles preventing successful gene synthesis and were easily identified and solved in this method. Compensating for the disadvantages of being laborious and time-consuming, this method has many attractive advantages, such as the ability to guarantee successful gene synthesis in most cases and good allowance for Taq polymerase, oligonucleotides, PCR conditions and a high error rate. Thus, this method provides an alternative tool for individual gene synthesis without strict needs of the high-specialised experience. PMID:23597923

  10. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  11. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  12. Gene Activation in Eukaryotes: Are Nuclear Acidic Proteins the Cause or the Effect?

    PubMed Central

    Pederson, Thoru

    1974-01-01

    Nuclear acidic proteins have been implicated in the positive control of gene transcription in eukaryotes. This hypothesis was examined in greater detail by analysis of these proteins during experimental gene activation by a technique for fractionating nuclei into chromatin and the ribonucleoprotein particles that contain heterogeneous nuclear RNA. When synthesis of rat-liver heterogeneous nuclear RNA was stimulated by administration of hydrocortisone, there was a parallel increase in the labeling of acidic proteins in ribonucleoprotein particles. However, there was no detectable effect on the labeling of either acidic chromatin proteins or histones. Thus, the nuclear acidic proteins that respond to the hormone are concerned with a post-transcriptional event, namely the assembly and processing of ribonucleoprotein particles that contain heterogeneous RNA, rather than with direct gene activation. Increases in synthesis of “chromatin” acidic proteins during gene activation observed by others may reflect the presence of these ribonucleoprotein particles in crude chromatin preparations. Images PMID:4522777

  13. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  14. Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins

    NASA Astrophysics Data System (ADS)

    Tang, Nicholas C.; Chilkoti, Ashutosh

    2016-04-01

    Most genes are synthesized using seamless assembly methods that rely on the polymerase chain reaction (PCR). However, PCR of genes encoding repetitive proteins either fails or generates nonspecific products. Motivated by the need to efficiently generate new protein polymers through high-throughput gene synthesis, here we report a codon-scrambling algorithm that enables the PCR-based gene synthesis of repetitive proteins by exploiting the codon redundancy of amino acids and finding the least-repetitive synonymous gene sequence. We also show that the codon-scrambling problem is analogous to the well-known travelling salesman problem, and obtain an exact solution to it by using De Bruijn graphs and a modern mixed integer linear programme solver. As experimental proof of the utility of this approach, we use it to optimize the synthetic genes for 19 repetitive proteins, and show that the gene fragments are amenable to PCR-based gene assembly and recombinant expression.

  15. Polyunsaturated fatty acids and gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Purpose of review. This review focuses on the effect(s) of n-3 polyunsaturated fatty acids (PUFA) on gene transcription as determined from data generated using cDNA microarrays. Introduced within the past decade, this methodology allows detection of the expression of thousands of genes simultaneo...

  16. Hyaluronic acid lipoate: synthesis and physicochemical properties.

    PubMed

    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco

    2013-03-01

    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  17. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  18. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  19. Cationic liposome–nucleic acid complexes for gene delivery and gene silencing

    PubMed Central

    Ewert, Kai K.; Majzoub, Ramsey N.; Leal, Cecília

    2014-01-01

    Cationic liposomes (CLs) are studied worldwide as carriers of DNA and short interfering RNA (siRNA) for gene delivery and gene silencing, and related clinical trials are ongoing. Optimization of transfection efficiency and silencing efficiency by cationic liposome carriers requires a comprehensive understanding of the structures of CL–nucleic acid complexes and the nature of their interactions with cell membranes as well as events leading to release of active nucleic acids within the cytoplasm. Synchrotron x-ray scattering has revealed that CL–nucleic acid complexes spontaneously assemble into distinct liquid crystalline phases including the lamellar, inverse hexagonal, hexagonal, and gyroid cubic phases, and fluorescence microscopy has revealed CL–DNA pathways and interactions with cells. The combining of custom synthesis with characterization techniques and gene expression and silencing assays has begun to unveil structure–function relations in vitro. As a recent example, this review will briefly describe experiments with surface-functionalized PEGylated CL–DNA nanoparticles. The functionalization, which is achieved through custom synthesis, is intended to address and overcome cell targeting and endosomal escape barriers to nucleic acid delivery faced by PEGylated nanoparticles designed for in vivo applications. PMID:25587216

  20. Development of a specific real-time PCR assay targeting the poly-γ-glutamic acid synthesis gene, pgsB, for the quantification of Bacillus amyloliquefaciens in solid-state fermentation.

    PubMed

    Yong, Xiaoyu; Zhang, Ruifu; Zhang, Nan; Chen, Yilu; Huang, Xinqi; Zhao, Jun; Shen, Qirong

    2013-02-01

    A TaqMan real-time PCR procedure was developed for specific detection and quantification of strains belonging to Bacillus amyloliquefaciens group. The primer pair pgsB726-f/pgsB791-r and the pgsB-probe were designed from one of the poly-γ-glutamic acid synthesis gene (pgsB) of B. amyloliquefaciens. The detection limit was approximately between 10(2)-10(3) cells/mL. A linear correlation between the log10 input pMD-pgsB plasmid DNA copies and the threshold cycle values were observed with a magnitude of linearity in the range of 9.415×10(3)-10(7) copies/mL for the standard curve, which exhibited a slope of -3.35 and an R2 value of 99.8%. Results of validation of this method with artificially contaminated and natural solid-state fermentation samples showed that it was suitable for specific and sensitive detection and quantification for the target strains in solid-state fermentation samples. This could be more useful to understand the fermentation starting strain and the final microbiological properties of fermentation products. PMID:23266849

  1. Rapid synthesis of the 7-deoxy zaragozic acid core.

    PubMed

    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J

    2002-01-24

    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  2. First total synthesis of prasinic acid and its anticancer activity.

    PubMed

    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt

    2012-11-01

    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  3. Molecular evolution of the lysophosphatidic acid acyltransferase (LPAAT) gene family.

    PubMed

    Körbes, Ana Paula; Kulcheski, Franceli Rodrigues; Margis, Rogério; Margis-Pinheiro, Márcia; Turchetto-Zolet, Andreia Carina

    2016-03-01

    Lysophosphatidic acid acyltransferases (LPAATs) perform an essential cellular function by controlling the production of phosphatidic acid (PA), a key intermediate in the synthesis of membrane, signaling and storage lipids. Although LPAATs have been extensively explored by functional and biotechnological studies, little is known about their molecular evolution and diversification. We performed a genome-wide analysis using data from several plants and animals, as well as other eukaryotic and prokaryotic species, to identify LPAAT genes and analyze their evolutionary history. We used phylogenetic and molecular evolution analysis to test the hypothesis of distinct origins for these genes. The reconstructed phylogeny supported the ancient origin of some isoforms (plant LPAAT1 and LPAATB; animal AGPAAT1/2), while others emerged more recently (plant LPAAT2/3/4/5; AGPAAT3/4/5/8). Additionally, the hypothesis of endosymbiotic origin of the plastidic isoform LPAAT1 was confirmed. LPAAT genes from plants and animals mainly experienced strong purifying selection pressures with limited functional divergence after the species-specific duplications. Gene expression analyses of LPAAT isoforms in model plants demonstrated distinct LPAAT expression patterns in these organisms. The results showed that distinct origins followed by diversification of the LPAAT genes shaped the evolution of TAG biosynthesis. The expression pattern of individual genes may be responsible for adaptation into multiple ecological niches. PMID:26721558

  4. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  5. Effect of rate of weight gain of steers during the stocker phase. IV. Rumen fermentation characteristics and expression of genes involved in substrate utilization for fatty acid synthesis in adipose tissues of growing-finishing beef cattle.

    PubMed

    Lancaster, P A; Sharman, E D; Horn, G W; Krehbiel, C R; Dillwith, J W; Starkey, J D

    2015-06-01

    The objective of this study was to determine the impact of stocker production systems differing in growth rate on rumen fermentation characteristics and utilization of substrates for fatty acid synthesis in intramuscular (IM), subcutaneous (SC), and perirenal (PR) adipose tissues. Angus steers were assigned to 4 stocker cattle production systems in 2 consecutive years: 1) 1.0 kg/d of 40% CP cottonseed meal–based supplement while grazing dormant native range (CON), 2) ground corn/soybean meal–based supplement while grazing dormant native range fed at 1% of BW (CORN), 3) grazing wheat pasture at a high stocking rate to achieve a low rate of BW gain (LGWP), and 4) grazing wheat pasture at a low stocking rate for a high rate of BW gain (HGWP). Eight ruminally cannulated steers were used to determine rumen fermentation characteristics. Steers were harvested during the stocker phase at similar age (different carcass weight) in Exp. 1 (3 steers/treatment) or at similar carcass weight in Exp. 2 (4 steers/treatment). Adipose tissues were analyzed for mRNA expression of genes involved in glucose (solute carrier family 2, member 4 [GLUT4], glucose-6-phosphate dehydrogenase [G6PDH], phosphofructokinase, muscle [PFKM], and pyruvate kinase 2, muscle [PK2]), lactate (lactate dehydrogenase B [LDHB]), and acetate (acetyl-CoA synthetase, cytosol [ACSS2]) utilization for fatty acid synthesis. The acetate:propionate ratio was least (P < 0.05) for HGWP steers, intermediate for CORN and LGWP steers, and greatest for CON steers. At similar age, LGWP and HGWP steers tended (F-test; P < 0.15) to have greater (P < 0.10) G6PDH and ACSS2 mRNA expression than CON and CORN steers in SC and PR but not IM adipose tissue. Expression of PFKM and PK2 mRNA tended (F-test; P < 0.15) to be greater (P < 0.10) in HGWP than CON and LGWP steers in IM but not SC or PR adipose tissue. At similar HCW, expression of GLUT4 and G6PDH mRNA were greater (P < 0.10) in SC adipose tissue of LGWP and HGWP steers

  6. Role of Malic Enzyme during Fatty Acid Synthesis in the Oleaginous Fungus Mortierella alpina

    PubMed Central

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao

    2014-01-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi. PMID:24532075

  7. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  8. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  9. Synthesis and scavenging role of furan fatty acids

    PubMed Central

    Lemke, Rachelle A. S.; Peterson, Amelia C.; Ziegelhoffer, Eva C.; Westphall, Michael S.; Tjellström, Henrik; Coon, Joshua J.; Donohue, Timothy J.

    2014-01-01

    Fatty acids play important functional and protective roles in living systems. This paper reports on the synthesis of a previously unidentified 19 carbon furan-containing fatty acid, 10,13-epoxy-11-methyl-octadecadienoate (9-(3-methyl-5-pentylfuran-2-yl)nonanoic acid) (19Fu-FA), in phospholipids from Rhodobacter sphaeroides. We show that 19Fu-FA accumulation is increased in cells containing mutations that increase the transcriptional response of this bacterium to singlet oxygen (1O2), a reactive oxygen species generated by energy transfer from one or more light-excited donors to molecular oxygen. We identify a previously undescribed class of S-adenosylmethionine-dependent methylases that convert a phospholipid 18 carbon cis unsaturated fatty acyl chain to a 19 carbon methylated trans unsaturated fatty acyl chain (19M-UFA). We also identify genes required for the O2-dependent conversion of this 19M-UFA to 19Fu-FA. Finally, we show that the presence of 1O2 leads to turnover of 19Fu-Fa in vivo. We propose that furan-containing fatty acids like 19Fu-FA can act as a membrane-bound scavenger of 1O2, which is naturally produced by integral membrane enzymes of the R. sphaeroides photosynthetic apparatus. PMID:25092314

  10. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  11. Gene therapy for aromatic L-amino acid decarboxylase deficiency.

    PubMed

    Hwu, Wuh-Liang; Muramatsu, Shin-ichi; Tseng, Sheng-Hong; Tzen, Kai-Yuan; Lee, Ni-Chung; Chien, Yin-Hsiu; Snyder, Richard O; Byrne, Barry J; Tai, Chun-Hwei; Wu, Ruey-Meei

    2012-05-16

    Aromatic L-amino acid decarboxylase (AADC) is required for the synthesis of the neurotransmitters dopamine and serotonin. Children with defects in the AADC gene show compromised development, particularly in motor function. Drug therapy has only marginal effects on some of the symptoms and does not change early childhood mortality. Here, we performed adeno-associated viral vector-mediated gene transfer of the human AADC gene bilaterally into the putamen of four patients 4 to 6 years of age. All of the patients showed improvements in motor performance: One patient was able to stand 16 months after gene transfer, and the other three patients achieved supported sitting 6 to 15 months after gene transfer. Choreic dyskinesia was observed in all patients, but this resolved after several months. Positron emission tomography revealed increased uptake by the putamen of 6-[(18)F]fluorodopa, a tracer for AADC. Cerebrospinal fluid analysis showed increased dopamine and serotonin levels after gene transfer. Thus, gene therapy targeting primary AADC deficiency is well tolerated and leads to improved motor function. PMID:22593174

  12. Chemical synthesis of a gene for human epidermal growth factor urogastrone and its expression in yeast.

    PubMed Central

    Urdea, M S; Merryweather, J P; Mullenbach, G T; Coit, D; Heberlein, U; Valenzuela, P; Barr, P J

    1983-01-01

    We have chemically synthesized and expressed in yeast a gene coding for human epidermal growth factor (urogastrone), a 53-amino-acid polypeptide that has been shown to promote epithelial cell proliferation and to inhibit gastric acid secretion. The synthetic gene, consisting of 170 base pairs, was designed with yeast-preferred codons and assembled by enzymatic ligation of synthetic fragments produced by phosphoramidite chemistry. The DNA synthesis protocol used allows for facile synthesis of oligonucleotides larger than 50 bases. Yeast cells were transformed with plasmids containing the synthetic gene under control of a yeast glyceraldehyde-3-phosphate dehydrogenase gene promoter and were shown to synthesize a biologically active human epidermal growth factor. Images PMID:6369317

  13. Transcriptome analysis and identification of genes associated with ¿-3 fatty acid biosynthesis in Perilla frutescens (L.) var. frutescens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Perilla (Perilla frutescens (L.) var frutescens) produces high levels of a-linolenic acid (ALA), a '-3 fatty acid important to health and development. To uncover key genes involved in fatty acid (FA) and triacylglycerol (TAG) synthesis in perilla, we conducted deep sequencing of cDNAs f...

  14. Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

    PubMed Central

    Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

    2009-01-01

    In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

  15. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  16. Total synthesis and complete stereostructure of gambieric acid A.

    PubMed

    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto

    2012-07-25

    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  17. Synthesis of fatty acids in the perused mouse liver.

    PubMed

    Salmon, D M; Bowen, N L; Hems, D A

    1974-09-01

    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  18. A symmetry-based formal synthesis of zaragozic acid A.

    PubMed

    Freeman-Cook, K D; Halcomb, R L

    2000-09-22

    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  19. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.

    PubMed

    Papadopoulos, Giorgos N; Kokotos, Christoforos G

    2016-05-10

    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  20. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  1. Accurate multiplex gene synthesis from programmable DNA microchips

    NASA Astrophysics Data System (ADS)

    Tian, Jingdong; Gong, Hui; Sheng, Nijing; Zhou, Xiaochuan; Gulari, Erdogan; Gao, Xiaolian; Church, George

    2004-12-01

    Testing the many hypotheses from genomics and systems biology experiments demands accurate and cost-effective gene and genome synthesis. Here we describe a microchip-based technology for multiplex gene synthesis. Pools of thousands of `construction' oligonucleotides and tagged complementary `selection' oligonucleotides are synthesized on photo-programmable microfluidic chips, released, amplified and selected by hybridization to reduce synthesis errors ninefold. A one-step polymerase assembly multiplexing reaction assembles these into multiple genes. This technology enabled us to synthesize all 21 genes that encode the proteins of the Escherichia coli 30S ribosomal subunit, and to optimize their translation efficiency in vitro through alteration of codon bias. This is a significant step towards the synthesis of ribosomes in vitro and should have utility for synthetic biology in general.

  2. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  3. Physiology and molecular genetics of poly(beta-hydroxy-alkanoic acid) synthesis in Alcaligenes eutrophus.

    PubMed

    Steinbüchel, A; Schlegel, H G

    1991-03-01

    The Alcaligenes eutrophus genes for beta-ketothiolase, NADPH-dependent acetoacetyl-CoA reductase and poly(beta-hydroxybutyric acid) synthase (PHB synthase) which comprise the three-step PHB-biosynthetic pathway, were cloned. Molecular studies revealed that these genes are organized in a single operon. The A. eutrophus PHB-biosynthetic genes are readily expressed in other bacteria, and DNA fragments harbouring the operon can be used as a cartridge to confer to other bacteria the ability to synthesize PHB from acetyl-CoA. The biochemical and physiological capabilities of A. eutrophus for the synthesis of a wide variety of polyhydroxyalkanoates are discussed. PMID:2046547

  4. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  5. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  6. Cationic liposome-nucleic acid nanoparticle assemblies with applications in gene delivery and gene silencing.

    PubMed

    Majzoub, Ramsey N; Ewert, Kai K; Safinya, Cyrus R

    2016-07-28

    Cationic liposomes (CLs) are synthetic carriers of nucleic acids in gene delivery and gene silencing therapeutics. The introduction will describe the structures of distinct liquid crystalline phases of CL-nucleic acid complexes, which were revealed in earlier synchrotron small-angle X-ray scattering experiments. When mixed with plasmid DNA, CLs containing lipids with distinct shapes spontaneously undergo topological transitions into self-assembled lamellar, inverse hexagonal, and hexagonal CL-DNA phases. CLs containing cubic phase lipids are observed to readily mix with short interfering RNA (siRNA) molecules creating double gyroid CL-siRNA phases for gene silencing. Custom synthesis of multivalent lipids and a range of novel polyethylene glycol (PEG)-lipids with attached targeting ligands and hydrolysable moieties have led to functionalized equilibrium nanoparticles (NPs) optimized for cell targeting, uptake or endosomal escape. Very recent experiments are described with surface-functionalized PEGylated CL-DNA NPs, including fluorescence microscopy colocalization with members of the Rab family of GTPases, which directly reveal interactions with cell membranes and NP pathways. In vitro optimization of CL-DNA and CL-siRNA NPs with relevant primary cancer cells is expected to impact nucleic acid therapeutics in vivo. This article is part of the themed issue 'Soft interfacial materials: from fundamentals to formulation'. PMID:27298431

  7. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  8. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.

    PubMed

    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D

    2016-05-01

    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  9. Induction of cellular deoxyribonucleic acid synthesis in butyrate-treated cells by simian virus 40 deoxyribonucleic acid

    SciTech Connect

    Kawasaki, S.; Diamond, L.; Baserga, R.

    1981-11-01

    Sodium butyrate (3mM) inhibited the entry into the S phase of quiescent 3T3 cells stimulated by serum, but had no effect on the accumulation of cellular ribonucleic acid. Simian virus 40 infection or manual microinjection of cloned fragments from the simian virus 40 A gene caused quiescent 3T3 cells to enter the S phase even in the presence of butyrate. NGI cells, a line of 3T3 cells transformed by simian virus 40, grew vigorously in 3 mM butyrate. Homokaryons were formed between G/sub 1/ and S-phase 3T3 cells. Butyrate inhibited the induction of deoxyribonucleic acid synthesis that usually occurs in G/sub 1/ nuclei when G/sub 1/ cells are fused with S-phase cells. However, when G/sub 1/ 3T3 cells were fused with exponentially growing NGI cells, the 3T3 nuclei were induced to enter deoxyribonucleic acid synthesis. In tsAF8 cells, a ribonucleic acid polymerase II mutant that stops in the G/sub 1/ phase of the cell cycle, no temporal sequence was demonstrated between the butyrate block and the temperature-sensitive block. These results confirm previous reports that certain virally coded proteins can induce cell deoxyribonucleic acid synthesis in the absence of cellular functions that are required by serum-stimulated cells. The author's interpretation of these data is that butyrate inhibited cell growth by inhibiting the expression of genes required for the G/sub o/ ..-->.. G/sub 1/ ..-->.. S transition and that the product of the simian virus 40 A gene overrode this inhibition by providing all of the necessary functions for the entry into the S phase.

  10. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  11. Influence of light on the free amino acid content and γ-aminobutyric acid synthesis in Brassica juncea seedlings.

    PubMed

    Li, Xiaohua; Kim, Yeon Bok; Uddin, Md Romij; Lee, Sanghyun; Kim, Sun-Ju; Park, Sang Un

    2013-09-11

    Glutamate decarboxylase (GAD; EC 4.1.1.15) is an important enzyme in γ-aminobutyric acid (GABA) biosynthesis. Here we report the influence of light on amino acid accumulation and investigate the molecular mechanism by which light influences GABA biosynthesis at the seedling stage of two mustard (Brassica juncea) cultivars (green-leaf and purple-leaf). Gene expression profiles of four GAD-encoding genes (GAD1, GAD2, GAD4a, and GAD4b) and their impact on GABA biosynthesis were analyzed. Light exerted an obvious influence on amino acid accumulation in mustard seedlings. GAD gene expression was also significantly regulated by light/dark or dark treatment, which differentially regulated GABA biosynthesis in B. juncea seedlings. High-performance liquid chromatography (HPLC) revealed that the seeds of purple cultivars contain a higher amount of free amino acids and GABA than do the seeds of green cultivars. After seed germination, however, the accumulation of free amino acids peaked in dark-treated seedlings on day 9 in both cultivars, whereas GABA synthesis peaked at 9 days under light conditions. This study may provide a foundation for understanding the effect of light on amino acids, particularly GABA biosynthesis in Brassica plants. PMID:23909820

  12. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  13. Regulation of Brome Mosaic Virus Gene Expression by Restriction of Initiation of Protein Synthesis

    PubMed Central

    Chroboczek, Jadwiga; Puchkova, Ludmiła; Zagórski, Włodzimierz

    1980-01-01

    The translation of total and individual brome mosaic virus (BMV) RNAs was examined in a wheat germ cell-free system in the presence of various inhibitors. Inhibitors of the initiation of polypeptide synthesis, e.g., potassium ions, 7-methylguanosine 5′ -monophosphate, and aurintricarboxylic acid, were shown not only to inhibit overall BMV protein synthesis but also to change the ratio of BMV polypeptides synthesized. Under conditions restrictive for initiation, the translation of nonstructural BMV genes was suppressed, but coat protein synthesis proceeded at a high rate. A similar discrimination among BMV messengers was exerted by a regulatory protein kinase isolated from wheat germ. These results suggest that the regulation of the expression of BMV genes is based on a difference in the mechanism of formation of initiation complexes for individual BMV messages. Images PMID:16789194

  14. Functional expression of a Δ12 fatty acid desaturase gene from spinach in transgenic pigs

    PubMed Central

    Saeki, Kazuhiro; Matsumoto, Kazuya; Kinoshita, Mikio; Suzuki, Iwane; Tasaka, Yasushi; Kano, Koichiro; Taguchi, Yoshitomo; Mikami, Koji; Hirabayashi, Masumi; Kashiwazaki, Naomi; Hosoi, Yoshihiko; Murata, Norio; Iritani, Akira

    2004-01-01

    Linoleic acid (18:2n-6) and α-linolenic acid (18:3n-3) are polyunsaturated fatty acids that are essential for mammalian nutrition, because mammals lack the desaturases required for synthesis of Δ12 (n-6) and n-3 fatty acids. Many plants can synthesize these fatty acids and, therefore, to examine the effects of a plant desaturase in mammals, we generated transgenic pigs that carried the fatty acid desaturation 2 gene for a Δ12 fatty acid desaturase from spinach. Levels of linoleic acid (18:2n-6) in adipocytes that had differentiated in vitro from cells derived from the transgenic pigs were ≈10 times higher than those from wild-type pigs. In addition, the white adipose tissue of transgenic pigs contained ≈20% more linoleic acid (18:2n-6) than that of wild-type pigs. These results demonstrate the functional expression of a plant gene for a fatty acid desaturase in mammals, opening up the possibility of modifying the fatty acid composition of products from domestic animals by transgenic technology, using plant genes for fatty acid desaturases. PMID:15067141

  15. Total synthesis of legionaminic acid as basis for serological studies.

    PubMed

    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H

    2015-03-01

    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  16. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  17. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  18. d-Amino Acids Indirectly Inhibit Biofilm Formation in Bacillus subtilis by Interfering with Protein Synthesis

    PubMed Central

    Leiman, Sara A.; May, Janine M.; Lebar, Matthew D.; Kahne, Daniel; Kolter, Roberto

    2013-01-01

    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of d-leucine, d-methionine, d-tryptophan, and d-tyrosine and was reported to inhibit biofilm formation via the incorporation of these d-amino acids into the cell wall. Here, we show that l-amino acids were able to specifically reverse the inhibitory effects of their cognate d-amino acids. We also show that d-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding d-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of d-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of d-amino acids without losing the ability to incorporate at least one noncanonical d-amino acid, d-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of d-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  19. D-amino acids indirectly inhibit biofilm formation in Bacillus subtilis by interfering with protein synthesis.

    PubMed

    Leiman, Sara A; May, Janine M; Lebar, Matthew D; Kahne, Daniel; Kolter, Roberto; Losick, Richard

    2013-12-01

    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of D-leucine, D-methionine, D-tryptophan, and D-tyrosine and was reported to inhibit biofilm formation via the incorporation of these D-amino acids into the cell wall. Here, we show that L-amino acids were able to specifically reverse the inhibitory effects of their cognate D-amino acids. We also show that D-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding D-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of D-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of D-amino acids without losing the ability to incorporate at least one noncanonical D-amino acid, D-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of D-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  20. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  1. Transcription of the Escherichia coli Fatty Acid Synthesis Operon fabHDG Is Directly Activated by FadR and Inhibited by ppGpp

    PubMed Central

    My, Laetitia; Rekoske, Brian; Lemke, Justin J.; Viala, Julie P.; Gourse, Richard L.

    2013-01-01

    In Escherichia coli, FadR and FabR are transcriptional regulators that control the expression of fatty acid degradation and unsaturated fatty acid synthesis genes, depending on the availability of fatty acids. In this report, we focus on the dual transcriptional regulator FadR. In the absence of fatty acids, FadR represses the transcription of fad genes required for fatty acid degradation. However, FadR is also an activator, stimulating transcription of the products of the fabA and fabB genes responsible for unsaturated fatty acid synthesis. In this study, we show that FadR directly activates another fatty acid synthesis promoter, PfabH, which transcribes the fabHDG operon, indicating that FadR is a global regulator of both fatty acid degradation and fatty acid synthesis. We also demonstrate that ppGpp and its cofactor DksA, known primarily for their role in regulation of the synthesis of the translational machinery, directly inhibit transcription from the fabH promoter. ppGpp also inhibits the fadR promoter, thereby reducing transcription activation of fabH by FadR indirectly. Our study shows that both ppGpp and FadR have direct roles in the control of fatty acid promoters, linking expression in response to both translation activity and fatty acid availability. PMID:23772072

  2. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.

    1982-05-01

    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  3. Light-induced expression of fatty acid desaturase genes

    PubMed Central

    Kis, Mihály; Zsiros, Otto; Farkas, Tibor; Wada, Hajime; Nagy, Ferenc; Gombos, Zoltán

    1998-01-01

    In cyanobacterial cells, fatty acid desaturation is one of the crucial steps in the acclimation processes to low-temperature conditions. The expression of all the four acyl lipid desaturase genes of Synechocystis PCC 6803 was studied as a function of temperature and separately as a function of light. We used cells grown at 25°C in light-activated heterotrophic growth conditions. In these cells, the production of α-linolenic acid and 18:4 fatty acids was negligible and the synthesis of γ-linolenic acid was remarkably suppressed compared with those of the cells grown photoautotrophically. The cells grown in the light in the presence of glucose showed no difference in fatty acid composition compared with cells grown photoautotrophically. The level of desC mRNA for Δ9 desaturase was not affected by either the temperature or the light. It was constitutively expressed at 25°C with and without illumination. The level of desB transcripts was negligible in the dark-grown cells and was enhanced about 10-fold by exposure of the cells to light. The maximum level of expression occurred within 15 min. The level of desA and desD mRNAs was higher in dark-grown cells than that of desB mRNA for ω3 desaturase. However, the induction of both desA and desD mRNAs for Δ12 and Δ6 desaturases, respectively, was enhanced by light about 10-fold. Rifampicin, chloramphenicol, and 3-(3,4-dichlorophenyl)-1,1-dimethylurea completely blocked the induction of the expression of desA, desB, and desD. Consequently, we suggest the regulatory role of light via photosynthetic processes in the induction of the expression of acyl lipid desaturases. PMID:9539715

  4. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  5. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  6. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  7. The biosynthetic gene cluster for coronamic acid, an ethylcyclopropyl amino acid, contains genes homologous to amino acid-activating enzymes and thioesterases.

    PubMed Central

    Ullrich, M; Bender, C L

    1994-01-01

    Coronamic acid (CMA), an ethylcyclopropyl amino acid derived from isoleucine, functions as an intermediate in the biosynthesis of coronatine, a chlorosis-inducing phytotoxin produced by Pseudomonas syringae pv. glycinea PG4180. The DNA required for CMA biosynthesis (6.9 kb) was sequenced, revealing three distinct open reading frames (ORFs) which share a common orientation for transcription. The deduced amino acid sequence of a 2.7-kb ORF designated cmaA contained six core sequences and two conserved motifs which are present in a variety of amino acid-activating enzymes, including nonribosomal peptide synthetases. Furthermore, CmaA contained a spatial arrangement of histidine, aspartate, and arginine residues which are conserved in the ferrous active site of some nonheme iron(II) enzymes which catalyze oxidative cyclizations. The deduced amino acid sequence of a 1.2-kb ORF designated cmaT was related to thioesterases of both procaryotic and eucaryotic origins. These data suggest that CMA assembly is similar to the thiotemplate mechanism of nonribosomal peptide synthesis. No significant similarities between a 0.9-kb ORF designated cmaU and other database entries were found. The start sites of two transcripts required for CMA biosynthesis were identified in the present study. pRG960sd, a vector containing a promoterless glucuronidase gene, was used to localize and study the promoter regions upstream of the two transcripts. Data obtained in the present study indicate that CMA biosynthesis is regulated at the transcriptional level by temperature. Images PMID:8002582

  8. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  9. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  10. Enantioselective synthesis of isotopically labeled homocitric acid lactone.

    PubMed

    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T

    2013-11-15

    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  11. Archaeal Lipid Genes: Clues to Life in Acid and the Evolution of Membranes

    NASA Astrophysics Data System (ADS)

    Macalady, J. L.; Croft, L.; Vestling, M. M.; Harms, A. C.; Zheng, L.; Baumler, D. J.; Kaspar, C. W.; Banfield, J. F.

    2002-12-01

    Microorganisms living in acid mine drainage environments face extraordinary challenges. Acid-loving archaea such as Ferroplasma acidarmanus maintain pH gradients of 4 to 5 pH units across their membranes and thrive in hot, extremely low pH (0-1), metal-rich, solutions. New lipid analyses for two extremely acidophilic archaea, F. acidarmanus and F. acidiphilum, reveal that all known archaeal acidophiles have cell membranes composed primarily of tetraether-linked lipids. Because tetraether lipids assemble in rigid monolayers that exclude protons and metals, we suggest that tetraether synthesis genes are essential for archaeal survival in acid. Fusion of two diether-linked lipids to form a tetraether-linked lipid is a distinctive biochemical reaction with no analogy in bacteria and eukaryotes. In addition to archaeal acidophiles, tetraethers are present in members of every archaeal lineage except halophiles. Genes responsible for tetraether synthesis and subsequent biochemical steps which "tune" membrane lipid properties in response to environmental changes have not been identified to date. Comparative genomic analyses using the newly completed genome of F. acidarmanus and available genomes from Bacteria, Archaea and Eukarya have generated candidate tetraether synthase genes found only in archaea. Because tetraether-linked lipids are advantageous for acid-loving and possibly also for heat-loving archaea, the phylogeny of these genes has the potential to shed new light on role of hot, acid environments in early evolution.

  12. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  13. Multiple inputs control sulfur-containing amino acid synthesis in Saccharomyces cerevisiae

    PubMed Central

    Sadhu, Meru J.; Moresco, James J.; Zimmer, Anjali D.; Yates, John R.; Rine, Jasper

    2014-01-01

    In Saccharomyces cerevisiae, transcription of the MET regulon, which encodes the proteins involved in the synthesis of the sulfur-containing amino acids methionine and cysteine, is repressed by the presence of either methionine or cysteine in the environment. This repression is accomplished by ubiquitination of the transcription factor Met4, which is carried out by the SCF(Met30) E3 ubiquitin ligase. Mutants defective in MET regulon repression reveal that loss of Cho2, which is required for the methylation of phosphatidylethanolamine to produce phosphatidylcholine, leads to induction of the MET regulon. This induction is due to reduced cysteine synthesis caused by the Cho2 defects, uncovering an important link between phospholipid synthesis and cysteine synthesis. Antimorphic mutants in S-adenosyl-methionine (SAM) synthetase genes also induce the MET regulon. This effect is due, at least in part, to SAM deficiency controlling the MET regulon independently of SAM's contribution to cysteine synthesis. Finally, the Met30 protein is found in two distinct forms whose relative abundance is controlled by the availability of sulfur-containing amino acids. This modification could be involved in the nutritional control of SCF(Met30) activity toward Met4. PMID:24648496

  14. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk

    2008-10-01

    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  15. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  16. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  17. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  18. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  19. MicroRNA-26a/b and their host genes synergistically regulate triacylglycerol synthesis by targeting the INSIG1 gene.

    PubMed

    Wang, Hui; Luo, Jun; Zhang, Tianying; Tian, Huibin; Ma, Yue; Xu, Huifen; Yao, Dawei; Loor, Juan J

    2016-05-01

    The microRNA-26 (miR-26) family is known to control adipogenesis in non-ruminants. The genomic loci of miR-26a and miR-26b have been localized in the introns of genes encoding for the proteins of the C-terminal domain RNA polymerase II polypeptide A small phosphatase (CTDSP) family. Insulin-induced gene 1 (INSIG1) encodes a protein with a key role in the regulation of lipogenesis in rodent liver. In the present study, we investigated the synergistic function of the miR-26 family and their host genes in goat mammary epithelial cells (GMEC). Downregulation of miR-26a/b and their host genes in GMEC decreased the expression of genes relate to fatty acid synthesis (PPARG, LXRA, SREBF1, FASN, ACACA, GPAM, LPIN1, DGAT1 and SCD1), triacylglycerol accumulation and unsaturated fatty acid synthesis. Luciferase reporter assays confirmed INSIG1 as a direct target of miR-26a/b. Furthermore, inhibition of the CTDSP family also downregulated the expression of INSIG1. Taken together, our findings highlight a functional association of miR-26a/b, their host genes and INSIG1, and provide new insights into the regulatory network controlling milk fat synthesis in GMEC. The data indicate that targeting this network via nutrition might be important for regulating milk fat synthesis in ruminants. PMID:27002347

  20. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.

    1981-01-01

    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  1. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  2. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease.

    PubMed

    Lake, April D; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D; Lu, Zhenqiang; Lehman-McKeeman, Lois D; Cherrington, Nathan J

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the 'classical' (neutral) and 'alternative' (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. PMID:23391614

  3. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  4. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.

    1971-01-01

    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  5. Molecular genetic and molecular evolutionary studies on the bacteriochlorophyll synthesis genes of Rhodobacter capsulatus

    SciTech Connect

    Burke-Agueero, D.H.

    1992-08-01

    Rhodobacter capsulatus, purple bacterium capable of either aerobic or photosynthetic growth, has proven to be very useful in genetic studies of photosynthesis. Forty-four genes clustered together within a 46 kilobase region are required to establish photosynthetic ability in R. capsulatus. Approximately twenty of these genes are involved in bacteriochlorophyll synthesis of which eight ``bch`` genes are the subject of this thesis. Six of these genes were found to code for the two ring reductases. The first converts protochlorophyllide (PChlide) into a chlorin, the immediate precursor to chlorophyll a, and then into a bacteriochlorin. Each reductase is shown to be made up of three subunits. PChlide reductase is coded by the genes bchN, bchB, and bchL. Proteins with amino acid sequences markedly similar to those of bchN and bchL have been shown in other organisms to be required for chlorophyll synthesis; hence, their designation as chlN and chlB. A third chloroplast-encoded gene of heretofore unknown function shares amino acid identities with bchB and is probably the third subunit of the plant PChlide reductase. The bchA locus, which encodes the chlorin reductase, is found to be made up of three separate, translationally coupled genes, referred to as bchX, bchY, and bchZ. Amino acid similarities between bchX, bchL, and the nitrogenase reductase protein nifH suggest that all three classes of proteins share certain three-dimensional structural features, including elements that are central to the enzymatic mechanism of nifH. PChlide reductase and chlorin reductase are clearly derived from a common ancestor. Several lines of analysis suggests the ancestor of both enzyme systems reduced PChlide twice to produce bacteriochlorophyll supporting the concept bacteriochlorophyll as the ancestral reaction center pigment.

  6. Molecular genetic and molecular evolutionary studies on the bacteriochlorophyll synthesis genes of Rhodobacter capsulatus

    SciTech Connect

    Burke-Agueero, D.H.

    1992-08-01

    Rhodobacter capsulatus, purple bacterium capable of either aerobic or photosynthetic growth, has proven to be very useful in genetic studies of photosynthesis. Forty-four genes clustered together within a 46 kilobase region are required to establish photosynthetic ability in R. capsulatus. Approximately twenty of these genes are involved in bacteriochlorophyll synthesis of which eight bch'' genes are the subject of this thesis. Six of these genes were found to code for the two ring reductases. The first converts protochlorophyllide (PChlide) into a chlorin, the immediate precursor to chlorophyll a, and then into a bacteriochlorin. Each reductase is shown to be made up of three subunits. PChlide reductase is coded by the genes bchN, bchB, and bchL. Proteins with amino acid sequences markedly similar to those of bchN and bchL have been shown in other organisms to be required for chlorophyll synthesis; hence, their designation as chlN and chlB. A third chloroplast-encoded gene of heretofore unknown function shares amino acid identities with bchB and is probably the third subunit of the plant PChlide reductase. The bchA locus, which encodes the chlorin reductase, is found to be made up of three separate, translationally coupled genes, referred to as bchX, bchY, and bchZ. Amino acid similarities between bchX, bchL, and the nitrogenase reductase protein nifH suggest that all three classes of proteins share certain three-dimensional structural features, including elements that are central to the enzymatic mechanism of nifH. PChlide reductase and chlorin reductase are clearly derived from a common ancestor. Several lines of analysis suggests the ancestor of both enzyme systems reduced PChlide twice to produce bacteriochlorophyll supporting the concept bacteriochlorophyll as the ancestral reaction center pigment.

  7. De novo gene synthesis design using TmPrime software.

    PubMed

    Li, Mo-Huang; Bode, Marcus; Huang, Mo Chao; Cheong, Wai Chye; Lim, Li Shi

    2012-01-01

    This chapter presents TmPrime, a computer program to design oligonucleotide for both ligase chain reaction (LCR)- and polymerase chain reaction (PCR)-based de novo gene synthesis. The program divides a long input DNA sequence based on user-specified melting temperatures and assembly conditions, and dynamically optimizes the length of oligonucleotides to achieve homologous melting temperatures. The output reports the melting temperatures, oligonucleotide sequences, and potential formation of secondary structures in a PDF file, which will be sent to the user via e-mail. The program also provides functions on sequence pooling to separate long genes into smaller pieces for multipool assembly and codon optimization for expression based on the highest organism-specific codon frequency. This software has been successfully used in the design and synthesis of various genes with total length >20 kbp. This program is freely available at http://prime.ibn.a-star.edu.sg. PMID:22328437

  8. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  9. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  10. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  11. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  12. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  13. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  14. Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis.

    PubMed

    Cleary, Michele A; Kilian, Kristopher; Wang, Yanqun; Bradshaw, Jeff; Cavet, Guy; Ge, Wei; Kulkarni, Amit; Paddison, Patrick J; Chang, Kenneth; Sheth, Nihar; Leproust, Eric; Coffey, Ernest M; Burchard, Julja; McCombie, W Richard; Linsley, Peter; Hannon, Gregory J

    2004-12-01

    Generation of complex libraries of defined nucleic acid sequences can greatly aid the functional analysis of protein and gene function. Previously, such studies relied either on individually synthesized oligonucleotides or on cellular nucleic acids as the starting material. As each method has disadvantages, we have developed a rapid and cost-effective alternative for construction of small-fragment DNA libraries of defined sequences. This approach uses in situ microarray DNA synthesis for generation of complex oligonucleotide populations. These populations can be recovered and either used directly or immortalized by cloning. From a single microarray, a library containing thousands of unique sequences can be generated. As an example of the potential applications of this technology, we have tested the approach for the production of plasmids encoding short hairpin RNAs (shRNAs) targeting numerous human and mouse genes. We achieved high-fidelity clone retrieval with a uniform representation of intended library sequences. PMID:15782200

  15. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  16. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.

    PubMed

    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei

    2010-06-01

    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  17. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  18. Strategies for the Total Synthesis of Clavicipitic Acid.

    PubMed

    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori

    2016-04-11

    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  19. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.

    2015-01-01

    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  20. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  1. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  2. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  3. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.

    PubMed Central

    Brandl, M T; Lindow, S E

    1996-01-01

    Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cultures supplemented with L-tryptophan. The deduced amino acid sequence of the gene product has high similarity to that of the indolepyruvate decarboxylase of Enterobacter cloacae. Regions within pyruvate decarboxylases of various fungal and plant species also exhibited considerable homology to portions of this gene. This gene therefore presumably encodes an indolepyruvate decarboxylase (IpdC) which catalyzes the conversion of indole-3-pyruvic acid to indole-3-acetaldehyde. Insertions of Tn3-spice within ipdC abolished the ability of strain 299R to synthesize indole-3-acetaldehyde and tryptophol and reduced its IAA production in tryptophan-supplemented minimal medium by approximately 10-fold, thus providing genetic evidence for the role of the indolepyruvate pathway in IAA synthesis in this strain. An ipdC probe hybridized strongly with the genomic DNA of all E. herbicola strains tested in Southern hybridization studies, suggesting that the indolepyruvate pathway is common in this species. Maximum parsimony analysis revealed that the ipdC gene is highly conserved within this group and that strains of diverse geographic origin were very similar with respect to ipdC. PMID:8900003

  4. Gene dosage effects on the synthesis of maltase in yeast.

    PubMed Central

    Mowshowitz, D B

    1979-01-01

    Inbred strains of Saccharomyces cerevisiae carrying MAL1, MAL2, or MAL6 in a common background were used to construct (i) homo- or heterozygous diploids carrying one or two active alleles of a single MAL locus (MAL1, MAL2, or MAL6) and (ii) triploids carrying one, two, or three active alleles of MAL2. The diploid and triploid strains were used to investigate gene dosage effects of the differential rate of maltase synthesis (delta enzyme activity/delta growth) and the kinetics of induction (for MAL2). All three MAL loci exhibited a gene dosage effect on the differential rate of maltase synthesis; MAL2 also exhibited a gene dosage effect on the kinetics of induction. The dosage effects of the MAL1 and MAL6 loci were additive, but the effects of the MAL2 locus were not; the magnitude of the MAL2 gene dosage effect decreased with increasing dosage. These results are compatible with the current genetic evidence that the MAL genes are regulatory loci if the product(s) of the MAL1 and MAL6 locus is produced in limiting amounts but the product(s) of the MAL2 locus is produced in excess, except at very low genes dosages. PMID:374342

  5. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John

    2002-01-01

    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  6. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  7. Identification of genes and gene clusters involved in mycotoxin synthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Research methods to identify and characterize genes involved in mycotoxin biosynthetic pathways have evolved considerably over the years. Before whole genome sequences were available (e.g. pre-genomics), work focused primarily on chemistry, biosynthetic mutant strains and molecular analysis of sing...

  8. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.

    PubMed

    Lem, N W; Stumpf, P K

    1984-01-01

    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  9. Ascorbic acid intake and oxalate synthesis.

    PubMed

    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P

    2016-08-01

    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  10. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  11. Leaf Ests from Stevia rebaudiana: a resource for gene discovery in diterpene synthesis.

    PubMed

    Brandle, J E; Richman, A; Swanson, A K; Chapman, B P

    2002-11-01

    Expressed sequence tags (ESTs) are providing a new approach to gene discovery in plant secondary metabolism. Stevia rebaudiana Bert. leaves produce high concentrations of diterpene steviol glycosides and should be a rich source of transcripts involved in diterpene synthesis. In order to create a resource for gene discovery and increase our understanding of steviol glycoside biosynthesis, we sequenced 5,548 ESTs from a S. rebaudiana leaf cDNA library. The EST collection was fully annotated based on database search results. ESTs involved in diterpene synthesis were identified using published sequences as electronic probes, by keyword searches of search results, and by differential representation. A significant portion of the ESTs were specific for standard leaf metabolic pathways; energy and primary metabolism represented 17.6% and 13.1% of total transcripts respectively. Diterpene metabolism in S. rebaudiana represented 1.1% of total transcripts. This study identified candidate genes for 70% of the known steps in the steviol glycoside pathway. One candidate, kaurene oxidase, was the 8th most abundant EST in the collection. Identification of many candidate genes specific to the I -deoxyxylulose 5-phosphate pathway suggests that the primary source of isopentenyl diphosphate, a precursor of geranylgeranyl diphosphate, is via the non-mevalonic acid pathway. The use of ESTs has greatly facilitated the identification of candidate genes and increased our understanding of diterpene metabolism. PMID:12374295

  12. Suppressing Sorbitol Synthesis Substantially Alters the Global Expression Profile of Stress Response Genes in Apple (Malus domestica) Leaves.

    PubMed

    Wu, Ting; Wang, Yi; Zheng, Yi; Fei, Zhangjun; Dandekar, Abhaya M; Xu, Kenong; Han, Zhenhai; Cheng, Lailiang

    2015-09-01

    Sorbitol is a major product of photosynthesis in apple (Malus domestica) that is involved in carbohydrate metabolism and stress tolerance. However, little is known about how the global transcript levels in apple leaves respond to decreased sorbitol synthesis. In this study we used RNA sequencing (RNA-seq) profiling to characterize the transcriptome of leaves from transgenic lines of the apple cultivar 'Greensleeves' exhibiting suppressed expression of aldose-6-phosphate reductase (A6PR) to gain insights into sorbitol function and the consequences of decreased sorbitol synthesis on gene expression. We observed that, although the leaves of the low sorbitol transgenic lines accumulate higher levels of various primary metabolites, only very limited changes were found in the levels of transcripts associated with primary metabolism. We suggest that this is indicative of post-transcriptional and/or post-translational regulation of primary metabolite accumulation and central carbon metabolism. However, we identified significantly enriched gene ontology terms belonging to the 'stress related process' category in the antisense lines (P-value < 0.05). These include genes involved in the synthesis/degradation of abscisic acid, salicylic acid and jasmonic acid, nucleotide-binding site leucine-rich repeat (NBS-LRR) disease resistance genes and ATP-binding cassette (ABC) transporter genes. This suggests that sorbitol plays a role in the responses of apple trees to abiotic and biotic stresses. PMID:26076968

  13. An Arabidopsis Gene Regulatory Network for Secondary Cell Wall Synthesis

    PubMed Central

    Taylor-Teeples, M; Lin, L; de Lucas, M; Turco, G; Toal, TW; Gaudinier, A; Young, NF; Trabucco, GM; Veling, MT; Lamothe, R; Handakumbura, PP; Xiong, G; Wang, C; Corwin, J; Tsoukalas, A; Zhang, L; Ware, D; Pauly, M; Kliebenstein, DJ; Dehesh, K; Tagkopoulos, I; Breton, G; Pruneda-Paz, JL; Ahnert, SE; Kay, SA; Hazen, SP; Brady, SM

    2014-01-01

    Summary The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. Here, we present a protein-DNA network between Arabidopsis transcription factors and secondary cell wall metabolic genes with gene expression regulated by a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. These interactions will serve as a foundation for understanding the regulation of a complex, integral plant component. PMID:25533953

  14. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  15. Exopolysaccharide (EPS) synthesis by Oenococcus oeni: from genes to phenotypes.

    PubMed

    Dimopoulou, Maria; Vuillemin, Marlène; Campbell-Sills, Hugo; Lucas, Patrick M; Ballestra, Patricia; Miot-Sertier, Cécile; Favier, Marion; Coulon, Joana; Moine, Virginie; Doco, Thierry; Roques, Maryline; Williams, Pascale; Petrel, Melina; Gontier, Etienne; Moulis, Claire; Remaud-Simeon, Magali; Dols-Lafargue, Marguerite

    2014-01-01

    Oenococcus oeni is the bacterial species which drives malolactic fermentation in wine. The analysis of 50 genomic sequences of O. oeni (14 already available and 36 newly sequenced ones) provided an inventory of the genes potentially involved in exopolysaccharide (EPS) biosynthesis. The loci identified are: two gene clusters named eps1 and eps2, three isolated glycoside-hydrolase genes named dsrO, dsrV and levO, and three isolated glycosyltransferase genes named gtf, it3, it4. The isolated genes were present or absent depending on the strain and the eps gene clusters composition diverged from one strain to another. The soluble and capsular EPS production capacity of several strains was examined after growth in different culture media and the EPS structure was determined. Genotype to phenotype correlations showed that several EPS biosynthetic pathways were active and complementary in O. oeni. Can be distinguished: (i) a Wzy-dependent synthetic pathway, allowing the production of heteropolysaccharides made of glucose, galactose and rhamnose, mainly in a capsular form, (ii) a glucan synthase pathway (Gtf), involved in β-glucan synthesis in a free and a cell-associated form, giving a ropy phenotype to growth media and (iii) homopolysaccharide synthesis from sucrose (α-glucan or β-fructan) by glycoside-hydrolases of the GH70 and GH68 families. The eps gene distribution on the phylogenetic tree was examined. Fifty out of 50 studied genomes possessed several genes dedicated to EPS metabolism. This suggests that these polymers are important for the adaptation of O. oeni to its specific ecological niche, wine and possibly contribute to the technological performance of malolactic starters. PMID:24901216

  16. Exopolysaccharide (EPS) Synthesis by Oenococcus oeni: From Genes to Phenotypes

    PubMed Central

    Dimopoulou, Maria; Vuillemin, Marlène; Campbell-Sills, Hugo; Lucas, Patrick M.; Ballestra, Patricia; Miot-Sertier, Cécile; Favier, Marion; Coulon, Joana; Moine, Virginie; Doco, Thierry; Roques, Maryline; Williams, Pascale; Petrel, Melina; Gontier, Etienne; Moulis, Claire; Remaud-Simeon, Magali; Dols-Lafargue, Marguerite

    2014-01-01

    Oenococcus oeni is the bacterial species which drives malolactic fermentation in wine. The analysis of 50 genomic sequences of O. oeni (14 already available and 36 newly sequenced ones) provided an inventory of the genes potentially involved in exopolysaccharide (EPS) biosynthesis. The loci identified are: two gene clusters named eps1 and eps2, three isolated glycoside-hydrolase genes named dsrO, dsrV and levO, and three isolated glycosyltransferase genes named gtf, it3, it4. The isolated genes were present or absent depending on the strain and the eps gene clusters composition diverged from one strain to another. The soluble and capsular EPS production capacity of several strains was examined after growth in different culture media and the EPS structure was determined. Genotype to phenotype correlations showed that several EPS biosynthetic pathways were active and complementary in O. oeni. Can be distinguished: (i) a Wzy -dependent synthetic pathway, allowing the production of heteropolysaccharides made of glucose, galactose and rhamnose, mainly in a capsular form, (ii) a glucan synthase pathway (Gtf), involved in β-glucan synthesis in a free and a cell-associated form, giving a ropy phenotype to growth media and (iii) homopolysaccharide synthesis from sucrose (α-glucan or β-fructan) by glycoside-hydrolases of the GH70 and GH68 families. The eps gene distribution on the phylogenetic tree was examined. Fifty out of 50 studied genomes possessed several genes dedicated to EPS metabolism. This suggests that these polymers are important for the adaptation of O. oeni to its specific ecological niche, wine and possibly contribute to the technological performance of malolactic starters. PMID:24901216

  17. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  18. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.

    PubMed

    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A

    2015-10-01

    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  19. The fatty acid desaturase 2 (FADS2) gene product catalyzes Δ4 desaturation to yield n-3 docosahexaenoic acid and n-6 docosapentaenoic acid in human cells

    PubMed Central

    Park, Hui Gyu; Park, Woo Jung; Kothapalli, Kumar S. D.; Brenna, J. Thomas

    2015-01-01

    Docosahexaenoic acid (DHA) is a Δ4-desaturated C22 fatty acid and the limiting highly unsaturated fatty acid (HUFA) in neural tissue. The biosynthesis of Δ4-desaturated docosanoid fatty acids 22:6n-3 and 22:5n-6 are believed to proceed via a circuitous biochemical pathway requiring repeated use of a fatty acid desaturase 2 (FADS2) protein to perform Δ6 desaturation on C24 fatty acids in the endoplasmic reticulum followed by 1 round of β-oxidation in the peroxisomes. We demonstrate here that the FADS2 gene product can directly Δ4-desaturate 22:5n-3→22:6n-3 (DHA) and 22:4n-6→22:5n-6. Human MCF-7 cells lacking functional FADS2-mediated Δ6-desaturase were stably transformed with FADS2, FADS1, or empty vector. When incubated with 22:5n-3 or 22:4n-6, FADS2 stable cells produce 22:6n-3 or 22:5n-6, respectively. Similarly, FADS2 stable cells when incubated with d5-18:3n-3 show synthesis of d5-22:6n-3 with no labeling of 24:5n-3 or 24:6n-3 at 24 h. Further, both C24 fatty acids are shown to be products of the respective C22 fatty acids via elongation. Our results demonstrate that the FADS2 classical transcript mediates direct Δ4 desaturation to yield 22:6n-3 and 22:5n-6 in human cells, as has been widely shown previously for desaturation by fish and many other organisms.—Park, H. G., Park, W. J., Kothapalli, K. S. D., Brenna, J. T. The fatty acid desaturase 2 (FADS2) gene product catalyzes Δ4 desaturation to yield n-3 docosahexaenoic acid and n-6 docosapentaenoic acid in human cells. PMID:26065859

  20. Fatty acid regulates gene expression and growth of human prostate cancer PC-3 cells

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Chen, Y.; Tjandrawinata, R. R.

    2001-01-01

    It has been proposed that the omega-6 fatty acids increase the rate of tumor growth. Here we test that hypothesis in the PC-3 human prostate tumor. We found that the essential fatty acids, linoleic acid (LA) and arachidonic acid (AA), and the AA metabolite PGE(2) stimulate tumor growth while oleic acid (OA) and the omega-3 fatty acid, eicosapentaenoic acid (EPA) inhibited growth. In examining the role of AA in growth response, we extended our studies to analyze changes in early gene expression induced by AA. We demonstrate that c-fos expression is increased within minutes of addition in a dose-dependent manner. Moreover, the immediate early gene cox-2 is also increased in the presence of AA in a dose-dependent manner, while the constitutive cox-1 message was not increased. Three hours after exposure to AA, the synthesis of PGE(2) via COX-2 was also increased. Previous studies have demonstrated that AA was primarily delivered by low density lipoprotein (LDL) via its receptor (LDLr). Since it is known that hepatomas, acute myelogenous leukemia and colorectal tumors lack normal cholesterol feedback, we examined the role of the LDLr in growth regulation of the PC-3 prostate cancer cells. Analysis of ldlr mRNA expression and LDLr function demonstrated that human PC-3 prostate cancer cells lack normal feedback regulation. While exogenous LDL caused a significant stimulation of cell growth and PGE(2) synthesis, no change was seen in regulation of the LDLr by LDL. Taken together, these data show that normal cholesterol feedback of ldlr message and protein is lost in prostate cancer. These data suggest that unregulated over-expression of LDLr in tumor cells would permit increased availability of AA, which induces immediate early genes c-fos and cox-2 within minutes of uptake.

  1. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W

    1993-01-01

    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  2. Comparison of Bacillus monooxygenase genes for unique fatty acid production

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This paper reviews Bacillus genes encoding monooxygenase enzymes producing unique fatty acid metabolites. Specifically, it examines standard monooxygenase electron transfer schemes and related domain structures of these fused domain enzymes on route to understanding the observed oxygenase activiti...

  3. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  4. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco

    1972-01-01

    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  5. [Cephalosporin-Acid Synthetase of Escherichia coli Strain VKPM B-10182: Genomic Context, Gene Identification, Producer Strain Production].

    PubMed

    Eldarov M, A; Sklyarenko, A V; Mardanov, A V; Beletsky, A V; Zhgun, A A; Dumina, M V; Medvedeva, N V; Satarova, D E; Ravin, N V; Yarockii, S V

    2015-01-01

    An enzyme of cephalosporin-acid synthetase produced by the E. coli strain VKPM B-10182 has specificity for the synthesis of β-lactam antibiotics of the cephalosporin acids class (cefazolin, cefalotin, cefezole etc.). A comparison of the previously determined genomic sequence of E. coli VKPM B-10182 with a genome of the parent E. coli strain ATCC 9637 was performed. Multiple mutations indicating the long selection history of the strain were detected, including mutations in the genes of RNase and β-lactamases that could enhance the level of enzyme synthesis and reduce the degree of degradation of the synthesized cephalosporin acids. The CASA gene--a direct homolog of the penicillin G-acylase gene--was identified by bioinformatics methods. The homology of the gene was confirmed by gene cloning and the expression and determination of its enzymatic activity in the reaction of cefazolin synthesis. The CASA gene was isolated and cloned into the original expression vector, resulting in an effective E. coli BL2l(DE3) pMD0107 strain producing CASA. PMID:26596082

  6. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  7. Synthesis and evaluation of colletoic acid core derivatives.

    PubMed

    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima

    2016-03-01

    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  8. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  9. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.

    PubMed

    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu

    2015-10-20

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  10. Influence of phenolic acids on indole acetic acid production and on the type III secretion system gene transcription in food-associated Pseudomonas fluorescens KM05.

    PubMed

    Myszka, Kamila; Schmidt, Marcin T; Olejnik-Schmidt, Agnieszka K; Leja, Katarzyna; Czaczyk, Katarzyna

    2014-12-01

    The purpose of these investigations was to evaluate the reduction capability of phenolic acids (ferulic, chlorogenic, gallic, and p-coumaric acids) on indole acetic acid synthesis by food-associated Pseudomonas fluorescens KM05. Specific genetic primer for the type III secretion system (TTSS) in P. fluorescens KM05 was designed and the influence of phenolic acids on its expression was investigated. In the work the ferulic and chlorogenic acids at the concentration of 0.02 and 0.04 μg/ml affected on bacterial growth pattern and the signal molecules production. The phenolic acids, that were appreciable effective against P. fluorescens KM05 indole acetic acid production, significantly suppressed TTSS gene. PMID:24994472

  11. Reassessment of the Genetic Regulation of Fatty Acid Synthesis in Escherichia coli: Global Positive Control by the Dual Functional Regulator FadR

    PubMed Central

    My, L.; Ghandour Achkar, N.; Viala, J. P.

    2015-01-01

    ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator

  12. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  13. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids. PMID:25796392

  14. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  15. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  16. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  17. Synthesis of all nineteen appropriately protected chiral alpha-hydroxy acid equivalents of the alpha-amino acids for Boc solid-phase depsi-peptide synthesis.

    PubMed

    Deechongkit, Songpon; You, Shu-Li; Kelly, Jeffery W

    2004-02-19

    [reaction: see text] The preparation of depsi-peptides, amide-to-ester-substituted peptides used to probe the role of hydrogen bonding in protein folding energetics, is accomplished by replacing specific l-alpha-amino acid residues by their alpha-hydroxy acid counterparts in a solid-phase synthesis employing a t-Boc strategy. Herein we describe the efficient stereoselective synthesis of all 19 appropriately protected alpha-hydroxy acid equivalents of the l-alpha-amino acids, employing commercially available materials, expanding the number of available alpha-hydroxy acids from 9 to 19. PMID:14961607

  18. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.

    PubMed

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-08-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  19. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc. PMID:19441565

  20. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  1. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  2. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.

    1987-01-01

    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  3. Novel acid resistance genes from the metagenome of the Tinto River, an extremely acidic environment.

    PubMed

    Guazzaroni, María-Eugenia; Morgante, Verónica; Mirete, Salvador; González-Pastor, José E

    2013-04-01

    Microorganisms that thrive in acidic environments are endowed with specialized molecular mechanisms to survive under this extremely harsh condition. In this work, we performed functional screening of six metagenomic libraries from planktonic and rhizosphere microbial communities of the Tinto River, an extremely acidic environment, to identify genes involved in acid resistance. This approach has revealed 15 different genes conferring acid resistance to Escherichia coli, most of which encoding putative proteins of unknown function or previously described proteins not known to be related to acid resistance. Moreover, we were able to assign function to one unknown and three hypothetical proteins. Among the recovered genes were the ClpXP protease, the transcriptional repressor LexA and nucleic acid-binding proteins such as an RNA-binding protein, HU and Dps. Furthermore, nine of the retrieved genes were cloned and expressed in Pseudomonas putida and Bacillus subtilis and, remarkably, most of them were able to expand the capability of these bacteria to survive under severe acid stress. From this set of genes, four presented a broad-host range as they enhance the acid resistance of the three different organisms tested. These results expand our knowledge about the different strategies used by microorganisms to survive under extremely acid conditions. PMID:23145860

  4. Energy, genes and evolution: introduction to an evolutionary synthesis.

    PubMed

    Lane, Nick; Martin, William F; Raven, John A; Allen, John F

    2013-07-19

    Life is the harnessing of chemical energy in such a way that the energy-harnessing device makes a copy of itself. No energy, no evolution. The 'modern synthesis' of the past century explained evolution in terms of genes, but this is only part of the story. While the mechanisms of natural selection are correct, and increasingly well understood, they do little to explain the actual trajectories taken by life on Earth. From a cosmic perspective-what is the probability of life elsewhere in the Universe, and what are its probable traits?-a gene-based view of evolution says almost nothing. Irresistible geological and environmental changes affected eukaryotes and prokaryotes in very different ways, ones that do not relate to specific genes or niches. Questions such as the early emergence of life, the morphological and genomic constraints on prokaryotes, the singular origin of eukaryotes, and the unique and perplexing traits shared by all eukaryotes but not found in any prokaryote, are instead illuminated by bioenergetics. If nothing in biology makes sense except in the light of evolution, nothing in evolution makes sense except in the light of energetics. This Special Issue of Philosophical Transactions examines the interplay between energy transduction and genome function in the major transitions of evolution, with implications ranging from planetary habitability to human health. We hope that these papers will contribute to a new evolutionary synthesis of energetics and genetics. PMID:23754807

  5. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  6. AMINO ACIDS AUGMENT MUSCLE PROTEIN SYNTHESIS IN NEONATAL PIGS DURING ENDOTOXEMIA BY MODULATING TRANSLATION INITIATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In adults, sepsis reduces protein synthesis in skeletal muscle by restraining translation. The effect of sepsis on amino acid-stimulated muscle protein synthesis has not been determined in neonates, a population who is highly anabolic and whose muscle protein synthesis rates are uniquely sensitive ...

  7. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173. PMID:15543522

  8. Total synthesis of the squalene synthase inhibitor zaragozic acid C.

    PubMed

    Nakamura, Seiichi

    2005-01-01

    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219

  9. Analysis of ldh genes in Lactobacillus casei BL23: role on lactic acid production.

    PubMed

    Rico, Juan; Yebra, María Jesús; Pérez-Martínez, Gaspar; Deutscher, Josef; Monedero, Vicente

    2008-06-01

    Lactobacillus casei is a lactic acid bacterium that produces L-lactate as the main product of sugar fermentation via L-lactate dehydrogenase (Ldh1) activity. In addition, small amounts of the D-lactate isomer are produced by the activity of a D-hydroxycaproate dehydrogenase (HicD). Ldh1 is the main L-lactate producing enzyme, but mutation of its gene does not eliminate L-lactate synthesis. A survey of the L. casei BL23 draft genome sequence revealed the presence of three additional genes encoding Ldh paralogs. In order to study the contribution of these genes to the global lactate production in this organism, individual, as well as double mutants (ldh1 ldh2, ldh1 ldh3, ldh1 ldh4 and ldh1 hicD) were constructed and lactic acid production was assessed in culture supernatants. ldh2, ldh3 and ldh4 genes play a minor role in lactate production, as their single mutation or a mutation in combination with an ldh1 deletion had a low impact on L-lactate synthesis. A Deltaldh1 mutant displayed an increased production of D-lactate, which was probably synthesized via the activity of HicD, as it was abolished in a Deltaldh1 hicD double mutant. Contrarily to HicD, no Ldh1, Ldh2, Ldh3 or Ldh4 activities could be detected by zymogram assays. In addition, these assays revealed the presence of extra bands exhibiting D-/L-lactate dehydrogenase activity, which could not be attributed to any of the described genes. These results suggest that L. casei BL23 possesses a complex enzymatic system able to reduce pyruvic to lactic acid. PMID:18231816

  10. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. PMID:27012633

  11. Identification and functional characterization of genes encoding omega-3 polyunsaturated fatty acid biosynthetic activities from unicellular microalgae.

    PubMed

    Vaezi, Royah; Napier, Johnathan A; Sayanova, Olga

    2013-12-01

    In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative "front-end" desaturases (Δ6 and Δ4) from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs) in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15). These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) in marine microalgae. PMID:24351909

  12. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    PubMed Central

    Vaezi, Royah; Napier, Johnathan A.; Sayanova, Olga

    2013-01-01

    In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4) from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs) in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15). These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) in marine microalgae. PMID:24351909

  13. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  14. [Synthesis of GnRH analogs and their application in targeted gene delivery systems].

    PubMed

    Iablokova, T V; Chelushkin, P S; Dorosh, M Iu; Efremov, A M; Orlov, S V; Burov, S V

    2012-01-01

    A set of GnRH analogues containing nuclear localization signal (NLS) of SV-40 virus large T-antigen have been synthesized using solid phase peptide synthesis and chemical ligation technique. Selective chemical ligation was achieved as a result of hydrazone formation in the course of interaction between NLS hydrazide and GnRH analog modified by pyruvic acid. The efficiency of synthesized peptide carriers was demonstrated in experiments with human cancer cells transfected by reporter luciferase and beta-galactosidase genes or suicide HSV-1 thymidine kinase gene. It was shown that selectivity of action on cancer cells can be achieved as a result of peptide/DNA complex penetration through the cell membrane by GnRH receptor-mediated endocytosis pathway. PMID:22792703

  15. Gene Composer: database software for protein construct design, codon engineering, and gene synthesis

    PubMed Central

    Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance

    2009-01-01

    Background To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. Results An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. Conclusion We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis

  16. Functional investigation of a gene encoding pteridine glycosyltransferase for cyanopterin synthesis in Synechocystis sp. PCC 6803.

    PubMed

    Hwang, Yoon Kyung; Kang, Ji Youn; Woo, Hyun Joo; Choi, Yong Kee; Park, Young Shik

    2002-03-15

    A gene (slr1166) putatively encoding pteridine glycosyltransferase was disrupted with a kanamycin resistance cassette in Synechocystis sp. PCC 6803, which produces cyanopterin. The deduced polypeptide from slr1166 consisted of 354 amino acid residues sharing 45% sequence identity with UDP-glucose:tetrahydrobiopterin alpha-glucosyltransferase (BGluT) isolated previously from Synechococcus sp. PCC 7942. The knockout mutant was unable to produce cyanopterin but only 6-hydroxymethylpterin-beta-galactoside, verifying that slr1166 encodes a pteridine glycosyltransferase, which is responsible for transfer of the second sugar glucuronic acid in cyanopterin synthesis. The mutant was affected in its intracellular pteridine content and growth rate, which were 74% and 80%, respectively, of wild type, demonstrating that the second sugar residue is still required for quantitative maintenance of cyanopterin. This supports the previous suggestion that glycosylation may contribute to high cellular concentration of pteridine compounds. PMID:11985899

  17. Activation of the Constitutive Androstane Receptor Inhibits Gluconeogenesis without Affecting Lipogenesis or Fatty Acid Synthesis in Human Hepatocytes

    PubMed Central

    Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

    2014-01-01

    Objective Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods Ligand-based structure-activity models were used for virtual screening of the Specs database (www.specs.net) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. PMID:24878338

  18. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved. PMID:17511507

  19. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  20. Extensive horizontal gene transfer, duplication, and loss of chlorophyll synthesis genes in the algae

    DOE PAGESBeta

    Hunsperger, Heather M.; Randhawa, Tejinder; Cattolico, Rose Ann

    2015-02-10

    Two non-homologous, isofunctional enzymes catalyze the penultimate step of chlorophyll a synthesis in oxygenic photosynthetic organisms such as cyanobacteria, eukaryotic algae and land plants: the light independent (LIPOR) and light-dependent (POR) protochlorophyllide oxidoreductases. Whereas the distribution of these enzymes in cyanobacteria and land plants is well understood, the presence, loss, duplication, and replacement of these genes have not been surveyed in the polyphyletic and remarkably diverse eukaryotic algal lineages.

  1. Highly expressed amino acid biosynthesis genes revealed by global gene expression analysis of Salmonella enterica serovar Enteritidis during growth in whole egg are not essential for this growth.

    PubMed

    Jakočiūnė, Džiuginta; Herrero-Fresno, Ana; Jelsbak, Lotte; Olsen, John Elmerdahl

    2016-05-01

    Salmonella enterica serovar Enteritidis (S. Enteritidis) is the most common cause of egg borne salmonellosis in many parts of the world. This study analyzed gene expression of this bacterium during growth in whole egg, and whether highly expressed genes were essential for the growth. High quality RNA was extracted from S. Enteritidis using a modified RNA-extraction protocol. Global gene expression during growth in whole egg was compared to growth in LB-medium using DNA array method. Twenty-six genes were significantly upregulated during growth in egg; these belonged to amino acid biosynthesis, di/oligopeptide transport system, biotin synthesis, ferrous iron transport system, and type III secretion system. Significant downregulation of 15 genes related to formate hydrogenlyase (FHL) and trehalose metabolism was observed. The results suggested that S. Enteritidis is starved for amino-acids, biotin and iron when growing in egg. However, site specific mutation of amino acid biosynthesis genes asnA (17.3 fold upregulated), asnB (18.6 fold upregulated), asnA/asnB and, serA (12.0 fold upregulated) and gdhA (3.7 fold upregulated), did not result in growth attenuation, suggesting that biosynthesis using the enzymes encoded from these genes may represent the first choice for S. Enteritidis when growing in egg, but when absent, the bacterium could use alternative ways to obtain the amino acids. PMID:26945769

  2. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    SciTech Connect

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  3. Detection of genes involved in fatty acid elongation and desaturation in thraustochytrid marine eukaryotes.

    PubMed

    Nagano, Naoki; Sakaguchi, Keishi; Taoka, Yousuke; Okita, Yuji; Honda, Daiske; Ito, Makoto; Hayashi, Masahiro

    2011-01-01

    Heterotrophic marine protists known as thraustochytrids can synthesize polyunsaturated fatty acids (PUFAs) such as docosahexaenoic acid (DHA). The biosynthetic pathways of PUFAs in thraustochytrids are poorly understood, however. In this study, we attempted to reveal the enzymes involved in DHA synthesis in thraustochytrids. Nine thraustochytrid strains representing 3 genera (Aurantiochytrium, Schizochytrium, and Thraustochytrium) were used for PCR-based detection of the genes encoding Δ5-elongase and Δ4-desaturase and for fatty acid analysis. The degenerate primers were designed to amplify the Δ5-elongase and Δ4-desaturase genes, and the partial sequences of the enzymes were obtained from the genera Thraustochytrium and Schizochytrium. These fragments were identical to those of known Δ5-elongase and Δ4-desaturase. Neither Δ5-elongase nor Δ4-desaturase was detected in the strains belonging to the genus Aurantiochytrium, however, suggesting that this group likely synthesizes DHA not via the elongation/desaturation pathway but via an alternate pathway such as the polyketide synthase pathway. The fatty acid profiles of thraustochytrids were consistent with the presence of genes involved in PUFA biosynthesis in thraustochytrid genera. Thus, our findings suggest that two biosynthetic pathways for PUFAs exist in these organisms. PMID:21852747

  4. Production of γ-linolenic acid and stearidonic acid by Synechococcus sp. PCC7002 containing cyanobacterial fatty acid desaturase genes

    NASA Astrophysics Data System (ADS)

    Dong, Xuewei; He, Qingfang; Peng, Zhenying; Yu, Jinhui; Bian, Fei; Li, Youzhi; Bi, Yuping

    2015-11-01

    Genetic modification is useful for improving the nutritional qualities of cyanobacteria. To increase the total unsaturated fatty acid content, along with the ratio of ω-3/ω-6 fatty acids, genetic engineering can be used to modify fatty acid metabolism. Synechococcus sp. PCC7002, a fast-growing cyanobacterium, does not contain a Δ6 desaturase gene and is therefore unable to synthesize γ-linolenic acid (GLA) and stearidonic acid (SDA), which are important in human health. In this work, we constructed recombinant vectors Syd6D, Syd15D and Syd6Dd15D to express the Δ15 desaturase and Δ6 desaturase genes from Synechocystis PCC6803 in Synechococcus sp. PCC7002, with the aim of expressing polyunsaturated fatty acids. Overexpression of the Δ15 desaturase gene in Synechococcus resulted in 5.4 times greater accumulation of α-linolenic acid compared with the wild-type while Δ6 desaturase gene expression produced both GLA and SDA. Co-expression of the two genes resulted in low-level accumulation of GLA but much larger amounts of SDA, accounting for as much to 11.64% of the total fatty acid content.

  5. Production of γ-linolenic acid and stearidonic acid by Synechococcus sp. PCC7002 containing cyanobacterial fatty acid desaturase genes

    NASA Astrophysics Data System (ADS)

    Dong, Xuewei; He, Qingfang; Peng, Zhenying; Yu, Jinhui; Bian, Fei; Li, Youzhi; Bi, Yuping

    2016-07-01

    Genetic modification is useful for improving the nutritional qualities of cyanobacteria. To increase the total unsaturated fatty acid content, along with the ratio of ω-3/ω-6 fatty acids, genetic engineering can be used to modify fatty acid metabolism. Synechococcus sp. PCC7002, a fast-growing cyanobacterium, does not contain a Δ6 desaturase gene and is therefore unable to synthesize γ-linolenic acid (GLA) and stearidonic acid (SDA), which are important in human health. In this work, we constructed recombinant vectors Syd6D, Syd15D and Syd6Dd15D to express the Δ15 desaturase and Δ6 desaturase genes from Synechocystis PCC6803 in Synechococcus sp. PCC7002, with the aim of expressing polyunsaturated fatty acids. Overexpression of the Δ15 desaturase gene in Synechococcus resulted in 5.4 times greater accumulation of α-linolenic acid compared with the wild-type while Δ6 desaturase gene expression produced both GLA and SDA. Co-expression of the two genes resulted in low-level accumulation of GLA but much larger amounts of SDA, accounting for as much to 11.64% of the total fatty acid content.

  6. Transcriptional profiling of canola developing embryo and identification of the important roles of BnDof5.6 in embryo development and fatty acids synthesis.

    PubMed

    Deng, Wei; Yan, Fang; Zhang, Xiaolan; Tang, Yuwei; Yuan, Yujin

    2015-08-01

    Canola is an important vegetable oil crop globally, and the understanding of the molecular mechanism underlying fatty acids biosynthesis during seed embryo development is an important research goal. Here we report the transcriptional profiling analysis of developing canola embryos using RNA-sequencing (RNA-Seq) method. RNA-Seq analysis generated 58,579,451 sequence reads aligned with 32,243 genes. It was found that a total of 55 differential expression genes (DEGs) encoding 28 enzymes function in carbon flow to fatty acids of storage TAG. Most of the DEGs encoding above enzymes showed similar expression pattern, indicating the DEGs are cooperatively involved in carbon flow into fatty acids. In addition, 41 DEGs associated with signal transductions, transport and metabolic processing of auxin, gibberellin, abscisic acid, cytokinin and salicylic acids were found in the RNA-Seq database, which indicates the important roles of the phytohormones in controlling embryo development and fatty acids synthesis. 122 DEGs encoding transcriptional factor family members were found in developing canola embryos. Furthermore, BnDOF5.6, a zinc finger transcriptional factor gene, found in RNA-Seq database was down-regulated in developing canola embryos. The transgenic plants displayed reduced embryo sizes, decreased fatty acids contents and altered seed fatty acids composition in canola. Down-regulated of BnDof5.6 also changed the expression levels of genes involved in fatty acids synthesis and desaturation. Our results indicate that BnDof5.6 is required for embryo development and fatty acids synthesis in canola. Overall this study presents new information on the global expression patterns of genes during embryo development and will expand our understanding of the complex molecular mechanism of carbon flow into fatty acids and embryo development in canola. PMID:26092973

  7. Differential Contribution of Endoplasmic Reticulum and Chloroplast ω-3 Fatty Acid Desaturase Genes to the Linolenic Acid Content of Olive (Olea europaea) Fruit.

    PubMed

    Hernández, M Luisa; Sicardo, M Dolores; Martínez-Rivas, José M

    2016-01-01

    Linolenic acid is a polyunsaturated fatty acid present in plant lipids, which plays key roles in plant metabolism as a structural component of storage and membrane lipids, and as a precursor of signaling molecules. The synthesis of linolenic acid is catalyzed by two different ω-3 fatty acid desaturases, which correspond to microsomal- (FAD3) and chloroplast- (FAD7 and FAD8) localized enzymes. We have investigated the specific contribution of each enzyme to the linolenic acid content in olive fruit. With that aim, we isolated two different cDNA clones encoding two ω-3 fatty acid desaturases from olive (Olea europaea cv. Picual). Sequence analysis indicates that they code for microsomal (OepFAD3B) and chloroplast (OepFAD7-2) ω-3 fatty acid desaturase enzymes, different from the previously characterized OekFAD3A and OekFAD7-1 genes. Functional expression in yeast of the corresponding OepFAD3A and OepFAD3B cDNAs confirmed that they encode microsomal ω-3 fatty acid desaturases. The linolenic acid content and transcript levels of olive FAD3 and FAD7 genes were measured in different tissues of Picual and Arbequina cultivars, including mesocarp and seed during development and ripening of olive fruit. Gene expression and lipid analysis indicate that FAD3A is the gene mainly responsible for the linolenic acid present in the seed, while FAD7-1 and FAD7-2 contribute mostly to the linolenic acid present in the mesocarp and, therefore, in the olive oil. These results also indicate the relevance of lipid trafficking between the endoplasmic reticulum and chloroplast in determining the linolenic acid content of membrane and storage lipids in oil-accumulating photosynthetic tissues. PMID:26514651

  8. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected. PMID:10841936

  9. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  10. Structure and expression of the Drosophila ubiquitin-80-amino-acid fusion-protein gene.

    PubMed Central

    Barrio, R; del Arco, A; Cabrera, H L; Arribas, C

    1994-01-01

    In the fruitfly Drosophila, as in all eukaryotes examined so far, some ubiquitin-coding sequences appear fused to unrelated open reading frames. Two of these fusion genes have been previously described (the homologues of UBI1-UBI2 and UBI4 in yeast), and we report here the organization and expression of a third one, the DUb80 gene (the homologue of UBI3 in yeast). This gene encodes a ubiquitin monomer fused to an 80-amino-acid extension which is homologous with the ribosomal protein encoded by the UB13 gene. The 5' regulatory region of DUb80 shares common features with another ubiquitin fusion gene, DUb52, and with the ribosomal protein genes of Drosophila, Xenopus and mouse. We also find helix-loop-helix protein-binding sequences (E-boxes). The DUb80 gene is transcribed to a 0.9 kb mRNA which is particularly abundant under conditions of high protein synthesis, such as in ovaries and exponentially growing cells. Images Figure 3 Figure 4 PMID:8068011

  11. Effects of oral eicosapentaenoic acid versus docosahexaenoic acid on human peripheral blood mononuclear cell gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objective: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have beneficial effects on inflammation and cardiovascular disease (CVD). Our aim was to assess the effect of a six-week supplementation with either olive oil, EPA, or DHA on gene expression in peripheral blood mononuclear cells (...

  12. Identification of a Geranylgeranyl reductase gene for chlorophyll synthesis in rice.

    PubMed

    Wang, Pingyu; Li, Chunmei; Wang, Yang; Huang, Rui; Sun, Changhui; Xu, Zhengjun; Zhu, Jianqing; Gao, Xiaoling; Deng, Xiaojian; Wang, Pingrong

    2014-01-01

    Geranylgeranyl reductase (CHL P) catalyzes the reduction of geranylgeranyl diphosphate to phytyl diphosphate, and provides phytol for both Chlorophyll (Chl) and tocopherol synthesis. In this study, we isolated a yellow-green leaf mutant, 502ys, in rice (Oryza sativa). The mutant exhibited reduced level of Chls, arrested development of chloroplasts, and retarded growth rate. The phenotype of the 502ys mutant was controlled by by a recessive mutation in a nuclear gene on the long arm of rice chromosome 2. Map-based cloning of the mutant resulted in the identification of an OsChl P gene (LOC_Os02g51080). In the 502ys mutant, a single base pair mutation was detected at residue 1279 in DNA sequence of the gene, resulting in an amino acid change (Gly-206 to Ser) in the encoded protein. HPLC analysis of Chls indicated that the majority of Chl molecules are conjugated with an unsaturated geranylgeraniol side chain, in addition to small amount of normal Chls in the mutant. Furthermore, the mutant phenotype was complemented by transformation with the wild-type gene. Therefore, this study has confirmed the 502ys mutant resulted from a single base pair mutation in OsChl P gene. PMID:24809003

  13. Chlamydia trachomatis Scavenges Host Fatty Acids for Phospholipid Synthesis via an Acyl-Acyl Carrier Protein Synthetase.

    PubMed

    Yao, Jiangwei; Dodson, V Joshua; Frank, Matthew W; Rock, Charles O

    2015-09-01

    The obligate intracellular parasite Chlamydia trachomatis has a reduced genome but relies on de novo fatty acid and phospholipid biosynthesis to produce its membrane phospholipids. Lipidomic analyses showed that 8% of the phospholipid molecular species synthesized by C. trachomatis contained oleic acid, an abundant host fatty acid that cannot be made by the bacterium. Mass tracing experiments showed that isotopically labeled palmitic, myristic, and lauric acids added to the medium were incorporated into C. trachomatis-derived phospholipid molecular species. HeLa cells did not elongate lauric acid, but infected HeLa cell cultures elongated laurate to myristate and palmitate. The elongated fatty acids were incorporated exclusively into C. trachomatis-produced phospholipid molecular species. C. trachomatis has adjacent genes encoding the separate domains of the bifunctional acyl-acyl carrier protein (ACP) synthetase/2-acylglycerolphosphoethanolamine acyltransferase gene (aas) of Escherichia coli. The CT775 gene encodes an acyltransferase (LpaT) that selectively transfers fatty acids from acyl-ACP to the 1-position of 2-acyl-glycerophospholipids. The CT776 gene encodes an acyl-ACP synthetase (AasC) with a substrate preference for palmitic compared with oleic acid in vitro. Exogenous fatty acids were elongated and incorporated into phospholipids by Escherichia coli-expressing AasC, illustrating its function as an acyl-ACP synthetase in vivo. These data point to an AasC-dependent pathway in C. trachomatis that selectively scavenges host saturated fatty acids to be used for the de novo synthesis of its membrane constituents. PMID:26195634

  14. Synthesis of E. faecium wall teichoic acid fragments.

    PubMed

    van der Es, Daan; Groenia, Nadia A; Laverde, Diana; Overkleeft, Herman S; Huebner, Johannes; van der Marel, Gijsbert A; Codée, Jeroen D C

    2016-09-01

    The first synthesis of different Enterococcus faecium wall teichoic acid (WTA) fragments is presented. The structure of these major cell wall components was elucidated recently and it was shown that these glycerolphosphate (GroP) based polymers are built up from -6-(GalNAc-α(1-3)-GalNAc-β(1-2)-GroP)- repeating units. We assembled WTA fragments up to three repeating units in length, in two series that differ in the stereochemistry of the glycerolphosphate moiety. The key GalNAc-GalNAc-GroP synthons, required for the synthesis, were generated from galactosazide building blocks that were employed in highly stereoselective glycosylation reactions to furnish both the α- and β-configured linkages. By comparing the NMR spectra of the synthesized fragments with the isolated material it appears that the hereto undefined stereochemistry of the glycerol phosphate moiety is sn-glycerol-3-phosphate. The generated fragments will be valuable tools to study their immunological activity at the molecular level. PMID:26993744

  15. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  16. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  17. Intermediates in the Synthesis of Type 2 Adenovirus Deoxyribonucleic Acid

    PubMed Central

    Horwitz, Marshall S.

    1971-01-01

    Intermediates in the synthesis of adenovirus type 2 deoxyribonucleic acid (DNA) were studied in HeLa cells. Pieces of DNA smaller than the viral genome were demonstrated after labeling with 3H-thymidine for 10 to 240 sec. Intermediates as small as the Okazaki fragments (8 to 10S) do not predominate at any of the above times. No detectable addition of nucleotides to parental genome could be shown, nor was there any breakdown of recently synthesized viral DNA. The DNA intermediates were of viral origin for they hybridized to viral DNA and were made at a stage of the cell cycle (G2) when host DNA is not synthesized. PMID:5132696

  18. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis

    PubMed Central

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-01-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 − were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis. PMID:27162276

  19. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis.

    PubMed

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-04-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 (-) were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis. PMID:27162276

  20. Retinoid resistance and multifaceted impairment of retinoic acid synthesis in glioblastoma.

    PubMed

    Campos, Benito; Weisang, Sarah; Osswald, Florian; Ali, Ramadan; Sedlmeier, Georg; Bageritz, Josephine; Mallm, Jan-Philipp; Hartmann, Christian; von Deimling, Andreas; Popanda, Odillia; Goidts, Violaine; Plass, Christoph; Unterberg, Andreas; Schmezer, Peter; Burhenne, Jürgen; Herold-Mende, Christel

    2015-10-01

    Measuring concentrations of the differentiation-promoting hormone retinoic acid (RA) in glioblastoma tissues would help to understand the reason why RA treatment has been inefficient in clinical trials involving brain tumor patients. Here, we apply a recently established extraction and measurement protocol to screen glioblastoma tissues for the levels of the RA precursor retinol and biologically active RA. Combining this approach with mRNA analyses of 26 tumors and 8 normal brains, we identify a multifaceted disturbance of RA synthesis in glioblastoma, involving multiple aldehyde dehydrogenase 1 family and retinol dehydrogenase enzymes. Through database studies and methylation analyses, we narrow down chromosomal deletions and aberrant promoter hypermethylation as potential mechanisms accounting for these alterations. Employing chromatin immunoprecipitation analyses and cell-culture studies, we further show that chromatin at RA target genes is poised to RA substitution, but most glioblastoma cell cultures are completely resistant to RA treatment. This paradoxical RA response is unrelated to alternative RA signaling through the fatty acid-binding protein 5/peroxisome proliferator-activated receptor delta axis. Our data suggest a multifaceted disturbance of RA synthesis in glioblastoma and contribute to reconsider current RA treatment strategies. PMID:25944104

  1. Allyl isothiocyanate suppresses the proteolytic activation of sterol regulatory element-binding proteins and de novo fatty acid and cholesterol synthesis.

    PubMed

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2016-05-01

    Sterol regulatory element-binding proteins (SREBPs) are a family of transcription factors that regulate lipid homeostasis by controlling the expression of genes involved in fatty acid and cholesterol synthesis. In this study, we used a stable cell line that expresses a luciferase reporter gene driven by an SRE-containing fatty acid synthase promoter to identify allyl isothiocyanate (AITC), one of the major isothiocyanates in cruciferous vegetables, as a novel SREBP inactivator. We found that AITC downregulated the proteolytic processing of SREBPs and the expression of their target genes in human hepatoma Huh-7 cells. Furthermore, AITC reduced the de novo synthesis of both fatty acids and cholesterol. Our results indicate a novel physiological function of AITC in lipid metabolism regulation. PMID:26822063

  2. Identification of Nitrogen-Fixing Genes and Gene Clusters from Metagenomic Library of Acid Mine Drainage

    PubMed Central

    Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community. PMID:24498417

  3. Enhanced Acid Tolerance in Bifidobacterium longum by Adaptive Evolution: Comparison of the Genes between the Acid-Resistant Variant and Wild-Type Strain.

    PubMed

    Jiang, Yunyun; Ren, Fazheng; Liu, Songling; Zhao, Liang; Guo, Huiyuan; Hou, Caiyun

    2016-03-28

    Acid stress can affect the viability of probiotics, especially Bifidobacterium. This study aimed to improve the acid tolerance of Bifidobacterium longum BBMN68 using adaptive evolution. The stress response, and genomic differences of the parental strain and the variant strain were compared by acid stress. The highest acid-resistant mutant strain (BBMN68m) was isolated from more than 100 asexual lines, which were adaptive to the acid stress for 10(th), 20(th), 30(th), 40(th), and 50(th) repeats, respectively. The variant strain showed a significant increase in acid tolerance under conditions of pH 2.5 for 2 h (from 7.92 to 4.44 log CFU/ml) compared with the wildtype strain (WT, from 7.87 to 0 log CFU/ml). The surface of the variant strain was also smoother. Comparative whole-genome analysis showed that the galactosyl transferase D gene (cpsD, bbmn68_1012), a key gene involved in exopolysaccharide (EPS) synthesis, was altered by two nucleotides in the mutant, causing alteration in amino acids, pI (from 8.94 to 9.19), and predicted protein structure. Meanwhile, cpsD expression and EPS production were also reduced in the variant strain (p < 0.05) compared with WT, and the exogenous WT-EPS in the variant strain reduced its acid-resistant ability. These results suggested EPS was related to acid responses of BBMN68. PMID:26608165

  4. Mycobacterium tuberculosis SigM positively regulates Esx secreted protein and nonribosomal peptide synthetase genes and down regulates virulence-associated surface lipid synthesis.

    PubMed

    Raman, Sahadevan; Puyang, Xiaoling; Cheng, Tan-Yun; Young, David C; Moody, D Branch; Husson, Robert N

    2006-12-01

    The Mycobacterium tuberculosis genome encodes 12 alternative sigma factors, several of which regulate stress responses and are required for virulence in animal models of acute infection. In this work we investigated M. tuberculosis SigM, a member of the extracytoplasmic function subfamily of alternative sigma factors. This sigma factor is expressed at low levels in vitro and does not appear to function in stress response regulation. Instead, SigM positively regulates genes required for the synthesis of surface or secreted molecules. Among these are genes encoding two pairs of Esx secreted proteins, a multisubunit nonribosomal peptide synthetase operon, and genes encoding two members of the proline-proline-glutamate (PPE) family of proteins. Genes up regulated in a sigM mutant strain include a different PPE gene, as well as several genes involved in surface lipid synthesis. Among these are genes involved in synthesis of phthiocerol dimycocerosate (PDIM), a surface lipid critical for virulence during acute infection, and the kasA-kasB operon, which is required for mycolic acid synthesis. Analysis of surface lipids showed that PDIM synthesis is increased in a sigM-disrupted strain and is undetectable in a sigM overexpression strain. These findings demonstrate that SigM positively and negatively regulates cell surface and secreted molecules that are likely to function in host-pathogen interactions. PMID:17028284

  5. Energy, genes and evolution: introduction to an evolutionary synthesis

    PubMed Central

    Lane, Nick; Martin, William F.; Raven, John A.; Allen, John F.

    2013-01-01

    Life is the harnessing of chemical energy in such a way that the energy-harnessing device makes a copy of itself. No energy, no evolution. The ‘modern synthesis’ of the past century explained evolution in terms of genes, but this is only part of the story. While the mechanisms of natural selection are correct, and increasingly well understood, they do little to explain the actual trajectories taken by life on Earth. From a cosmic perspective—what is the probability of life elsewhere in the Universe, and what are its probable traits?—a gene-based view of evolution says almost nothing. Irresistible geological and environmental changes affected eukaryotes and prokaryotes in very different ways, ones that do not relate to specific genes or niches. Questions such as the early emergence of life, the morphological and genomic constraints on prokaryotes, the singular origin of eukaryotes, and the unique and perplexing traits shared by all eukaryotes but not found in any prokaryote, are instead illuminated by bioenergetics. If nothing in biology makes sense except in the light of evolution, nothing in evolution makes sense except in the light of energetics. This Special Issue of Philosophical Transactions examines the interplay between energy transduction and genome function in the major transitions of evolution, with implications ranging from planetary habitability to human health. We hope that these papers will contribute to a new evolutionary synthesis of energetics and genetics. PMID:23754807

  6. Cadmium induces retinoic acid signaling by regulating retinoic acid metabolic gene expression.

    PubMed

    Cui, Yuxia; Freedman, Jonathan H

    2009-09-11

    The transition metal cadmium is an environmental teratogen. In addition, cadmium and retinoic acid can act synergistically to induce forelimb malformations. The molecular mechanism underlying the teratogenicity of cadmium and the synergistic effect with retinoic acid has not been addressed. An evolutionarily conserved gene, beta,beta-carotene 15,15'-monooxygenase (BCMO), which is involved in retinoic acid biosynthesis, was studied in both Caenorhabditis elegans and murine Hepa 1-6 cells. In C. elegans, bcmo-1 was expressed in the intestine and was cadmium inducible. Similarly, in Hepa 1-6 cells, Bcmo1 was induced by cadmium. Retinoic acid-mediated signaling increased after 24-h exposures to 5 and 10 microm cadmium in Hepa 1-6 cells. Examination of gene expression demonstrated that the induction of retinoic acid signaling by cadmium may be mediated by overexpression of Bcmo1. Furthermore, cadmium inhibited the expression of Cyp26a1 and Cyp26b1, which are involved in retinoic acid degradation. These results indicate that cadmium-induced teratogenicity may be due to the ability of the metal to increase the levels of retinoic acid by disrupting the expression of retinoic acid-metabolizing genes. PMID:19556237

  7. Cadmium Induces Retinoic Acid Signaling by Regulating Retinoic Acid Metabolic Gene Expression*

    PubMed Central

    Cui, Yuxia; Freedman, Jonathan H.

    2009-01-01

    The transition metal cadmium is an environmental teratogen. In addition, cadmium and retinoic acid can act synergistically to induce forelimb malformations. The molecular mechanism underlying the teratogenicity of cadmium and the synergistic effect with retinoic acid has not been addressed. An evolutionarily conserved gene, β,β-carotene 15,15′-monooxygenase (BCMO), which is involved in retinoic acid biosynthesis, was studied in both Caenorhabditis elegans and murine Hepa 1–6 cells. In C. elegans, bcmo-1 was expressed in the intestine and was cadmium inducible. Similarly, in Hepa 1–6 cells, Bcmo1 was induced by cadmium. Retinoic acid-mediated signaling increased after 24-h exposures to 5 and 10 μm cadmium in Hepa 1–6 cells. Examination of gene expression demonstrated that the induction of retinoic acid signaling by cadmium may be mediated by overexpression of Bcmo1. Furthermore, cadmium inhibited the expression of Cyp26a1 and Cyp26b1, which are involved in retinoic acid degradation. These results indicate that cadmium-induced teratogenicity may be due to the ability of the metal to increase the levels of retinoic acid by disrupting the expression of retinoic acid-metabolizing genes. PMID:19556237

  8. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  9. Indole-3-butyric acid synthesis in ecotypes and mutants of Arabidopsis thaliana under different growth conditions.

    PubMed

    Ludwig-Müller, Jutta

    2007-01-01

    Although IBA is a naturally occurring auxin, its role in plant development is still under debate. In this study a set of Arabidopsis mutants was used to analyze the biosynthesis of IBA in vitro. The mutants chosen for this study can be classified as: (1) involvement in auxin metabolism, transport or synthesis (amt1, aux1, ilr1, nit1, rib1, sur1, trp1-100); (2) other hormones possibly involved in the regulation of IBA synthesis (aba1, aba3, eto2, fae1, hls1, jar1); (3) photomorphogenesis (det1, det2, det3); and (4) root architecture (cob1, cob2, scr1). In addition, two transgenic lines overexpressing the IAA glucose synthase (iaglu) gene from maize were analyzed. The ecotypes No-0 and Wassilewskija showed the highest IBA synthetase activity under control conditions, followed by Columbia, Enkheim and Landsberg erecta. In the mutant lines IBA synthetase activity differed in most cases from the wild type, however no particular pattern of up- or down-regulation, which could be correlated to their possible function, was found. For rib1 mutant seedlings it was tested whether reduced IBA synthetase activity correlates with the endogenous IBA levels. Free IBA differed only depending on the culture conditions, but gave no clear correlation with IBA synthetase activity compared to the wild type. Since drought and osmotic stress as well as abscisic acid (ABA) application enhanced IBA synthesis in maize, it was tested whether IBA synthetase from Arabidopsis is also inducible by drought stress conditions. This was confirmed for the two ecotypes Col and Ler which showed different IBA synthetase activity when cultivated with various degrees of drought stress. IBA synthetase was also determined in photomorphogenic mutants under different light regimes. Induction of IBA synthetase in det1 and det3 plants was found under short day plus a red light pulse or in the dark, respectively. The results are discussed with respect to the functions of the mutated genes. PMID:16325963

  10. Mutations in the Chinese hamster ovary cell GART gene of de novo purine synthesis

    PubMed Central

    Knox, Aaron J.; Graham, Christine; Bleskan, John; Brodsky, Gary; Patterson, David

    2009-01-01

    Mutations in several steps of de novo purine synthesis lead to human inborn errors of metabolism often characterized by mental retardation, hypotonia, sensorineural hearing loss, optic atrophy, and other features. In animals, the phosphoribosylglycinamide transformylase (GART) gene encodes a trifunctional protein carrying out 3 steps of de novo purine synthesis, phosphoribosylglycinamide synthase (GARS), phosphoribosylglycinamide transformylase (also abbreviated as GART), and phosphoribosylaminoimidazole synthetase (AIRS) and a smaller protein that contains only the GARS domain of GART as a functional protein. The GART gene is located on human chromosome 21 and is aberrantly regulated and overexpressed in individuals with Down syndrome (DS), and may be involved in the phenotype of DS. The GART activity of GART requires 10-formyltetrahydrofolate and has been a target for anti-cancer drugs. Thus, a considerable amount of information is available about GART, while less is known about the GARS and AIRS domains. Here we demonstrate that the amino acid residue glu75 is essential for the activity of the GARS enzyme and that the gly684 residue is essential for the activity of the AIRS enzyme by analysis of mutations in the Chinese hamster ovary (CHO-K1) cell that require purines for growth. We report the effects of these mutations on mRNA and protein content for GART and GARS. Further, we discuss the likely mechanisms by which mutations inactivating the GART protein might arise in CHO-K1 cells. PMID:19007868

  11. Sugar-mediated semidian oscillation of gene expression in the cassava storage root regulates starch synthesis

    SciTech Connect

    Jansson, Christer; Baguma, Yona; Sun, Chuanxin; Boren, Mats; Olsson, Helena; Rosenqvist, Sara; Mutisya, Joel; Rubaihayo, Patrick R.; Jansson, Christer

    2008-01-15

    Starch branching enzyme (SBE) activity in the cassava storage root exhibited a diurnal fluctuation, dictated by a transcriptional oscillation of the corresponding SBE genes. The peak of SBE activity coincided with the onset of sucrose accumulation in the storage, and we conclude that the oscillatory mechanism keeps the starch synthetic apparatus in the storage root sink in tune with the flux of sucrose from the photosynthetic source. When storage roots were uncoupled from the source, SBE expression could be effectively induced by exogenous sucrose. Turanose, a sucrose isomer that cannot be metabolized by plants, mimicked the effect of sucrose, demonstrating that downstream metabolism of sucrose was not necessary for signal transmission. Also glucose and glucose-1-P induced SBE expression. Interestingly, induction by sucrose, turanose and glucose but not glucose-1-P sustained an overt semidian (12-h) oscillation in SBE expression and was sensitive to the hexokinase (HXK) inhibitor glucosamine. These results suggest a pivotal regulatory role for HXK during starch synthesis. Abscisic acid (ABA) was another potent inducer of SBE expression. Induction by ABA was similar to that of glucose-1-P in that it bypassed the semidian oscillator. Both the sugar and ABA signaling cascades were disrupted by okadaic acid, a protein phosphatase inhibitor. Based on these findings, we propose a model for sugar signaling in regulation of starch synthesis in the cassava storage root.

  12. Synthesis of methylphosphonic acid by marine microbes: a source for methane in the aerobic ocean

    PubMed Central

    Metcalf, William W.; Griffin, Benjamin M.; Cicchillo, Robert M.; Gao, Jiangtao; Janga, Sarath Chandra; Cooke, Heather A.; Circello, Benjamin T.; Evans, Bradley S.; Martens-Habbena, Willm; Stahl, David A.; van der Donk, Wilfred A.

    2012-01-01

    Relative to the atmosphere, much of the aerobic ocean is supersaturated with methane; however, the source of this important greenhouse gas remains enigmatic. Catabolism of methylphosphonic acid by phosphorus-starved marine microbes, with concomitant release of methane, has been suggested to explain this phenomenon, yet methylphosphonate is not a known natural product, nor has it been detected in natural systems. Further, its synthesis from known natural products would require unknown biochemistry. Here we show that the marine archaeon Nitrosopumilus maritimus encodes a pathway for methylphosphonate biosynthesis and that it produces cell-associated methylphosphonate esters. The abundance of a key gene in this pathway in metagenomic datasets suggests that methylphosphonate biosynthesis is relatively common in marine microbes, providing a plausible explanation for the methane paradox. PMID:22936780

  13. An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

    PubMed Central

    Carballeira, Néstor M.; Sanabria, David; Oyola, Delise

    2006-01-01

    An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

  14. Polymer production by Klebsiella pneumoniae 4-hydroxyphenylacetic acid hydroxylase genes cloned in Escherichia coli.

    PubMed Central

    Gibello, A; Ferrer, E; Sanz, J; Martin, M

    1995-01-01

    The expression of Klebsiella pneumoniae hpaA and hpaH genes, which code for 4-hydroxyphenylacetic acid hydroxylase in Escherichia coli K-12 derivative strains, is associated with the production of a dark brown pigment in the cultures. This pigment has been identified as a polymer which shows several of the characteristics reported for microbial melanins and results from the oxidative activity of 4-hydroxyphenylacetic acid hydroxylase on some dihydroxylated compounds to form o-quinones. A dibenzoquinone is formed from the oxidation of different mono- or dihydroxylated aromatic compounds by the enzyme prior to polymerization. We report a hydroxylase activity, other than tyrosinase, that is associated with the synthesis of a bacterial melanin. PMID:8534083

  15. A Δ-9 Fatty Acid Desaturase Gene in the Microalga Myrmecia incisa Reisigl: Cloning and Functional Analysis.

    PubMed

    Xue, Wen-Bin; Liu, Fan; Sun, Zheng; Zhou, Zhi-Gang

    2016-01-01

    The green alga Myrmecia incisa is one of the richest natural sources of arachidonic acid (ArA). To better understand the regulation of ArA biosynthesis in M. incisa, a novel gene putatively encoding the Δ9 fatty acid desaturase (FAD) was cloned and characterized for the first time. Rapid-amplification of cDNA ends (RACE) was employed to yield a full length cDNA designated as MiΔ9FAD, which is 2442 bp long in sequence. Comparing cDNA open reading frame (ORF) sequence to genomic sequence indicated that there are 8 introns interrupting the coding region. The deduced MiΔ9FAD protein is composed of 432 amino acids. It is soluble and localized in the chloroplast, as evidenced by the absence of transmembrane domains as well as the presence of a 61-amino acid chloroplast transit peptide. Multiple sequence alignment of amino acids revealed two conserved histidine-rich motifs, typical for Δ9 acyl-acyl carrier protein (ACP) desaturases. To determine the function of MiΔ9FAD, the gene was heterologously expressed in a Saccharomyces cerevisiae mutant strain with impaired desaturase activity. Results of GC-MS analysis indicated that MiΔ9FAD was able to restore the synthesis of monounsaturated fatty acids, generating palmitoleic acid and oleic acid through the addition of a double bond in the Δ9 position of palmitic acid and stearic acid, respectively. PMID:27438826

  16. A Δ-9 Fatty Acid Desaturase Gene in the Microalga Myrmecia incisa Reisigl: Cloning and Functional Analysis

    PubMed Central

    Xue, Wen-Bin; Liu, Fan; Sun, Zheng; Zhou, Zhi-Gang

    2016-01-01

    The green alga Myrmecia incisa is one of the richest natural sources of arachidonic acid (ArA). To better understand the regulation of ArA biosynthesis in M. incisa, a novel gene putatively encoding the Δ9 fatty acid desaturase (FAD) was cloned and characterized for the first time. Rapid-amplification of cDNA ends (RACE) was employed to yield a full length cDNA designated as MiΔ9FAD, which is 2442 bp long in sequence. Comparing cDNA open reading frame (ORF) sequence to genomic sequence indicated that there are 8 introns interrupting the coding region. The deduced MiΔ9FAD protein is composed of 432 amino acids. It is soluble and localized in the chloroplast, as evidenced by the absence of transmembrane domains as well as the presence of a 61-amino acid chloroplast transit peptide. Multiple sequence alignment of amino acids revealed two conserved histidine-rich motifs, typical for Δ9 acyl-acyl carrier protein (ACP) desaturases. To determine the function of MiΔ9FAD, the gene was heterologously expressed in a Saccharomyces cerevisiae mutant strain with impaired desaturase activity. Results of GC-MS analysis indicated that MiΔ9FAD was able to restore the synthesis of monounsaturated fatty acids, generating palmitoleic acid and oleic acid through the addition of a double bond in the Δ9 position of palmitic acid and stearic acid, respectively. PMID:27438826

  17. Process parameter optimization for hydantoinase-mediated synthesis of optically pure carbamoyl amino acids of industrial value using Pseudomonas aeruginosa resting cells.

    PubMed

    Engineer, Anupama S; Dhakephalkar, Anita P; Gaikaiwari, Raghavendra P; Dhakephalkar, Prashant K

    2013-12-01

    Hydantoinase-mediated enzymatic synthesis of optically pure carbamoyl amino acids was investigated as an environmentally friendly, energy-efficient alternative to the otherwise energy-intensive, polluting chemical synthesis. Hydantoinase-producing bacterial strain was identified as Pseudomonas aeruginosa by 16S rRNA gene sequencing and biochemical profiling using the BIOLOG Microbial Identification System. Hydantoinase activity was assessed using hydantoin analogs and 5-monosubstituted hydantoins as substrates in a colorimetric assay. The hydantoinase gene was PCR amplified using gene-specific primers and sequenced on an automated gene analyzer. Hydantoinase gene sequence of P. aeruginosa MCM B-887 revealed maximum homology of only 87 % with proven hydantoinase gene sequences in GenBank. MCM B-887 resting cells converted >99 % of substrate into N-carbamoyl amino acids under optimized condition at 42 °C, pH 8.0, and 100 mM substrate concentration in <120 min. Hydantoin hydrolyzing activity was D-selective and included broad substrate profile of 5-methyl hydantoin, 5-phenyl hydantoin, 5-hydroxyphenyl hydantoin, o-chlorophenyl hydantoin, as well as hydantoin analogs such as allantoin, dihydrouracil, etc. MCM B-887 resting cells may thus be suitable for bio-transformations leading to the synthesis of optically pure, unnatural carbamoyl amino acids of industrial importance. PMID:24065358

  18. Synthesis of novel acid electrolytes for phosphoric acid fuel cells. Final report, May 1985-October 1988

    SciTech Connect

    Adcock, J.L.

    1988-11-01

    Construction of a 40-millimole-per-hour-scale aerosol direct-fluorination reactor was completed June 26, 1986. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4-methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy-1-propene, 18 grams of F-3-(2-methoxy.ethoxy)-1-propene, and 37 grams of F-3,3-dimethyl-1-butene. Eighteen grams of F-2,2-dimethyl-1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy-1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy)-1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other GRI contractors for synthesis of perfluorinated sulfur(VI) and phosphorous(V) acids.

  19. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  20. Sinorhizobium meliloti Functionally Replaces 3-Oxoacyl-Acyl Carrier Protein Reductase (FabG) by Overexpressing NodG During Fatty Acid Synthesis.

    PubMed

    Mao, Ya-Hui; Li, Feng; Ma, Jin-Cheng; Hu, Zhe; Wang, Hai-Hong

    2016-06-01

    In Sinorhizobium meliloti, the nodG gene is located in the nodFEG operon of the symbiotic plasmid. Although strong sequence similarity (53% amino acid identities) between S. meliloti NodG and Escherichia coli FabG was reported in 1992, it has not been determined whether S. meliloti NodG plays a role in fatty acid synthesis. We report that expression of S. meliloti NodG restores the growth of the E. coli fabG temperature-sensitive mutant CL104 under nonpermissive conditions. Using in vitro assays, we demonstrated that NodG is able to catalyze the reduction of the 3-oxoacyl-ACP intermediates in E. coli fatty acid synthetic reaction. Moreover, although deletion of the S. meliloti nodG gene does not cause any growth defects, upon overexpression of nodG from a plasmid, the S. meliloti fabG gene encoding the canonical 3-oxoacyl-ACP reductase (OAR) can be disrupted without any effects on growth or fatty acid composition. This indicates that S. meliloti nodG encodes an OAR and can play a role in fatty acid synthesis when expressed at sufficiently high levels. Thus, a bacterium can simultaneously possess two or more OARs that can play a role in fatty acid synthesis. Our data also showed that, although SmnodG increases alfalfa nodulation efficiency, it is not essential for alfalfa nodulation. PMID:26975437

  1. Tomato ABSCISIC ACID STRESS RIPENING (ASR) Gene Family Revisited

    PubMed Central

    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy

    2014-01-01

    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding. PMID:25310287

  2. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited.

    PubMed

    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy

    2014-01-01

    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding. PMID:25310287

  3. Identification of csrR/csrS, a genetic locus that regulates hyaluronic acid capsule synthesis in group A Streptococcus.

    PubMed

    Levin, J C; Wessels, M R

    1998-10-01

    The hyaluronic acid capsule of group A Streptococcus (GAS) is an important virulence factor, but little is known about mechanisms that regulate capsule expression. Transposon Tn916 mutagenesis of the poorly encapsulated M-type 3 GAS strain DLS003 produced a transconjugant that exhibited a mucoid colony morphology, reflecting increased hyaluronic acid capsule production. Analysis of chromosomal DNA sequence immediately downstream of the transposon insertion identified two open reading frames, designated csrR and csrS, which exhibited sequence similarity to bacterial two-component regulatory systems. We constructed an in-frame deletion mutation within csrR, which encodes the putative response component. Replacement of the native csrR gene in the DLS003 chromosome with the mutant allele resulted in a sixfold increase in capsule production and a corresponding increase in transcription of the has operon, which contains the essential genes for hyaluronic acid synthesis. Increased capsule production by the csrR mutant strain was associated with enhanced resistance to complement-mediated opsonophagocytic killing in vitro and with a 500-fold increase in virulence in mice. These results establish CsrR as a negative regulator of hyaluronic acid capsule synthesis and suggest that it is part of a two-component regulatory system that influences capsule expression and virulence. PMID:9786197

  4. Synthesis of hyaluronic acid oligosaccharides and exploration of a fluorous-assisted approach.

    PubMed

    Macchione, Giuseppe; de Paz, José L; Nieto, Pedro M

    2014-07-23

    The synthesis of hyaluronic acid oligomers (tri- and tetrasaccharide) is described. We have followed a pre-glycosylation oxidation strategy. Glucuronic acid units were directly employed in coupling reactions with suitably protected glucosamine derivatives. In order to simplify the purification of synthetic intermediates, a fluorous-assisted strategy has been also explored. Using this approach, a hyaluronic acid trisaccharide was prepared. PMID:24930061

  5. Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.

    PubMed

    Dacquin, J P; Lee, A F; Pirez, C; Wilson, K

    2012-01-01

    Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. PMID:22089025

  6. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  7. Activation of the constitutive androstane receptor inhibits gluconeogenesis without affecting lipogenesis or fatty acid synthesis in human hepatocytes

    SciTech Connect

    Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

    2014-08-15

    Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches. • The role

  8. Dihydrolipoic acid activates oligomycin-sensitive thiol groups and increases ATP synthesis in mitochondria.

    PubMed

    Zimmer, G; Mainka, L; Krüger, E

    1991-08-01

    Investigations with dihydrolipoic acid in rat heart mitochondria and mitoplasts reveal an activation of ATP-synthase up to 45%, whereas ATPase activities decrease by 36%. In parallel with an increase in ATP synthesis oligomycin-sensitive mitochondrial -SH groups are activated at 2-4 nmol dihydrolipoic acid/mg protein. ATPase activation by the uncouplers carbonylcyanide-p-trifluoromethoxyphenylhydrazone and oleate is diminished by dihydrolipoic acid, and ATP synthesis depressed by oleate is partially restored. No such efficiency of dihydrolipoic acid is seen with palmitate-induced ATPase activation or decrease of ATP synthesis. This indicates different interference of oleate and palmitate with mitochondria. In addition to its known coenzymatic properties dihydrolipoic acid may act as a substitute for coenzyme A, thereby diminishing the uncoupling efficiency of oleate. Furthermore, dihydrolipoic acid is a very potent antioxidant, shifting the -SH-S-S- equilibrium in mitochondria to the reduced state and improving the energetic state of cells. PMID:1832845

  9. Abscisic acid represses the transcription of chloroplast genes*

    PubMed Central

    Yamburenko, Maria V.; Zubo, Yan O.; Börner, Thomas

    2013-01-01

    Numerous studies have shown effects of abscisic acid (ABA) on nuclear genes encoding chloroplast-localized proteins. ABA effects on the transcription of chloroplast genes, however, have not been investigated yet thoroughly. This work, therefore, studied the effects of ABA (75 μM) on transcription and steady-state levels of transcripts in chloroplasts of basal and apical segments of primary leaves of barley (Hordeum vulgare L.). Basal segments consist of young cells with developing chloroplasts, while apical segments contain the oldest cells with mature chloroplasts. Exogenous ABA reduced the chlorophyll content and caused changes of the endogenous concentrations not only of ABA but also of cytokinins to different extents in the basal and apical segments. It repressed transcription by the chloroplast phage-type and bacteria-type RNA polymerases and lowered transcript levels of most investigated chloroplast genes drastically. ABA did not repress the transcription of psbD and a few other genes and even increased psbD mRNA levels under certain conditions. The ABA effects on chloroplast transcription were more pronounced in basal vs. apical leaf segments and enhanced by light. Simultaneous application of cytokinin (22 μM 6-benzyladenine) minimized the ABA effects on chloroplast gene expression. These data demonstrate that ABA affects the expression of chloroplast genes differentially and points to a role of ABA in the regulation and coordination of the activities of nuclear and chloroplast genes coding for proteins with functions in photosynthesis. PMID:24078671

  10. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  11. Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Gurvitz, Aner; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2008-08-01

    We describe the physiological function of heterologously expressed Mycobacterium tuberculosis InhA during de novo lipoic acid synthesis in yeast (Saccharomyces cerevisiae) mitochondria. InhA, representing 2-trans-enoyl-acyl carrier protein reductase and the target for the front-line antituberculous drug isoniazid, is involved in the activity of dissociative type 2 fatty acid synthase (FASII) that extends associative type 1 fatty acid synthase (FASI)-derived C(20) fatty acids to form C(60)-to-C(90) mycolic acids. Mycolic acids are major constituents of the protective layer around the pathogen that contribute to virulence and resistance to certain antimicrobials. Unlike FASI, FASII is thought to be incapable of de novo biosynthesis of fatty acids. Here, the genes for InhA (Rv1484) and four similar proteins (Rv0927c, Rv3485c, Rv3530c, and Rv3559c) were expressed in S. cerevisiae etr1Delta cells lacking mitochondrial 2-trans-enoyl-thioester reductase activity. The phenotype of the yeast mutants includes the inability to produce sufficient levels of lipoic acid, form mitochondrial cytochromes, respire, or grow on nonfermentable carbon sources. Yeast etr1Delta cells expressing mitochondrial InhA were able to respire, grow on glycerol, and produce lipoic acid. Commensurate with a role in mitochondrial de novo fatty acid biosynthesis, InhA could accept in vivo much shorter acyl-thioesters (C(4) to C(8)) than was previously thought (>C(12)). Moreover, InhA functioned in the absence of AcpM or protein-protein interactions with its native FASII partners KasA, KasB, FabD, and FabH. None of the four proteins similar to InhA complemented the yeast mutant phenotype. We discuss the implications of our findings with reference to lipoic acid synthesis in M. tuberculosis and the potential use of yeast FASII mutants for investigating the physiological function of drug-targeted pathogen enzymes involved in fatty acid biosynthesis. PMID:18552191

  12. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  13. An Alkyne Diboration/6π-Electrocyclization Strategy for the Synthesis of Pyridine Boronic Acid Derivatives.

    PubMed

    Mora-Radó, Helena; Bialy, Laurent; Czechtizky, Werngard; Méndez, María; Harrity, Joseph P A

    2016-05-01

    A new and efficient synthesis of pyridine-based heteroaromatic boronic acid derivatives is reported through a novel diboration/6π-electrocyclization strategy. This method delivers a range of functionalized heterocycles from readily available starting materials. PMID:27059895

  14. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  15. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  16. The GLUT9 Gene Is Associated with Serum Uric Acid Levels in Sardinia and Chianti Cohorts

    PubMed Central

    Maschio, Andrea; Busonero, Fabio; Usala, Gianluca; Mulas, Antonella; Lai, Sandra; Dei, Mariano; Orrù, Marco; Albai, Giuseppe; Bandinelli, Stefania; Schlessinger, David; Lakatta, Edward; Scuteri, Angelo; Najjar, Samer S; Guralnik, Jack; Naitza, Silvia; Crisponi, Laura; Cao, Antonio; Abecasis, Gonçalo; Ferrucci, Luigi; Uda, Manuela; Chen, Wei-Min; Nagaraja, Ramaiah

    2007-01-01

    High serum uric acid levels elevate pro-inflammatory–state gout crystal arthropathy and place individuals at high risk for cardiovascular morbidity and mortality. Genome-wide scans in the genetically isolated Sardinian population identified variants associated with serum uric acid levels as a quantitative trait. They mapped within GLUT9, a Chromosome 4 glucose transporter gene predominantly expressed in liver and kidney. SNP rs6855911 showed the strongest association (p = 1.84 × 10−16), along with eight others (p = 7.75 × 10−16 to 6.05 × 10−11). Individuals homozygous for the rare allele of rs6855911 (minor allele frequency = 0.26) had 0.6 mg/dl less uric acid than those homozygous for the common allele; the results were replicated in an unrelated cohort from Tuscany. Our results suggest that polymorphisms in GLUT9 could affect glucose metabolism and uric acid synthesis and/or renal reabsorption, influencing serum uric acid levels over a wide range of values. PMID:17997608

  17. The Pseudomonas aeruginosa rhlG Gene Encodes an NADPH-Dependent β-Ketoacyl Reductase Which Is Specifically Involved in Rhamnolipid Synthesis

    PubMed Central

    Campos-García, Jesús; Caro, Alma Delia; Nájera, Rebeca; Miller-Maier, Raina M.; Al-Tahhan, Ragheb A.; Soberón-Chávez, Gloria

    1998-01-01

    A Pseudomonas aeruginosa gene homologous to the fabG gene, which encodes the NADPH-dependent β-ketoacyl-acyl carrier protein (ACP) reductase required for fatty acid synthesis, was identified. The insertional mutation of this fabG homolog (herein called rhlG) produced no apparent effect on the growth rate and total lipid content of P. aeruginosa cells, but the production of rhamnolipids was completely abrogated. These results suggest that the synthetic pathway for the fatty acid moiety of rhamnolipids is separate from the general fatty acid synthetic pathway, starting with a specific ketoacyl reduction step catalyzed by the RhlG protein. In addition, the synthesis of poly-β-hydroxyalkanoate (PHA) is delayed in this mutant, suggesting that RhlG participates in PHA synthesis, although it is not the only reductase involved in this pathway. Traits regulated by the quorum-sensing response, other than rhamnolipid production, including production of proteases, pyocyanine, and the autoinducer butanoyl-homoserine lactone (PAI-2), were not affected by the rhlG mutation. We conclude that the P. aeruginosa rhlG gene encodes an NADPH-dependent β-ketoacyl reductase absolutely required for the synthesis of the β-hydroxy acid moiety of rhamnolipids and that it has a minor role in PHA production. Expression of rhlG mRNA under different culture conditions is consistent with this conclusion. PMID:9721281

  18. Combinations of mutant FAD2 and FAD3 genes to produce high oleic acid and low linolenic acid soybean oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High oleic acid soybeans were produced by combining a mutant FAD2-1A and a mutant FAD2-1B gene. Despite having a high oleic acid content, the linolenic acid content of these soybeans was in the range of 4-6%. Therefore, a study was conducted to incorporate one or two mutant FAD3 genes into the high ...

  19. Participation of fad and mbt Genes in Synthesis of Mycobactin in Mycobacterium smegmatis

    PubMed Central

    LaMarca, B. Babbette D.; Zhu, Wenming; Arceneaux, Jean E. L.; Rowe Byers, B.; Lundrigan, Michael D.

    2004-01-01

    Colonies of Mycobacterium smegmatis LR222 on iron-limiting (0.1 μM Fe) minimal medium agar fluoresce under UV light due to the accumulation in the cells of the deferri form of the siderophore mycobactin. Two mutants with little or no fluorescence, designated LUN8 and LUN9, were isolated by screening colonies of transposon (Tn611)-mutagenized M. smegmatis. Ferrimycobactin prepared from iron-restricted cells of the wild type had an Rf of 0.62 on high-performance thin-layer chromatography (HPTLC) and a characteristic visible absorption spectrum with a peak near 450 nm. Similar extracts from LUN8 cells contained a small amount of ferrimycobactin with an Rf of 0.58 on HPTLC and an absorption spectrum with the peak shifted to a wavelength lower than that of the wild-type ferrimycobactin. Nuclear magnetic resonance spectroscopy studies suggested that the LUN8 mycobactin may have an altered fatty acid side chain. Mutant strain LUN9 produced no detectable mycobactin. Neither mutant strain produced measurable amounts of excreted mycobactin, although both excreted exochelin (the mycobacterial peptido-hydroxamate siderophore), and both mutants were more sensitive than the wild-type strain to growth inhibition by the iron chelator ethylenediamine-di(o-hydroxyphenylacetic acid). The transposon insertion sites were identified, and sequence analyses of the cloned flanking chromosome regions showed that the mutated gene in LUN9 was an orthologue of the Mycobacterium tuberculosis mycobactin biosynthetic gene mbtE. The mutated gene in LUN8 had homology with M. tuberculosis fadD33 (Rv1345), a gene that may encode an acyl-coenzyme A synthase and which previously was not known to participate in synthesis of mycobactin. PMID:14702306

  20. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  1. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed. PMID:18618391

  2. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  3. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  4. Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.

    PubMed

    Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang

    2015-09-01

    Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. PMID:25605585

  5. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  6. Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

    SciTech Connect

    Standaert, Robert F; Park, Dr Seung Bum

    2006-01-01

    Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

  7. Identification of a fourth gene involved in dTDP-rhamnose synthesis in Streptococcus mutans.

    PubMed Central

    Tsukioka, Y; Yamashita, Y; Nakano, Y; Oho, T; Koga, T

    1997-01-01

    We had isolated three genes (rmlA, rmlB, and rmlC) involved in dTDP-rhamnose synthesis in Streptococcus mutans and found that three genes were insufficient for dTDP-rhamnose synthesis (Y. Tsukioka, Y. Yamashita, T. Oho, Y. Nakano, and T. Koga, J. Bacteriol. 179:1126-1134, 1997). The rmlD gene of S. mutans, encoding the enzyme which catalyzes the last step of dTDP-rhamnose synthesis, has been cloned and sequenced. The cell extract of Escherichia coli expressing the rmlD gene of S. mutans exhibited enzymatic activity corresponding to its counterpart in Shigella flexneri, a gram-negative bacterium. Rhamnose was not detected in the cell wall preparation purified from the mutant in which the cloned gene was insertionally inactivated. Rabbit antiserum against S. mutans serotype c-specific antigen did not react with autoclaved extracts from the mutant. The rmlD gene product of S. mutans compensated for the incompleteness of dTDP-rhamnose synthesis by the three previously isolated genes. These results indicate that the rmlD gene product is indispensable for the dTDP-rhamnose pathway and subsequently for the synthesis of serotype-specific antigen in S. mutans. Furthermore, conservation of the rmlD gene in Streptococcus species was demonstrated by Southern blot analysis. PMID:9209063

  8. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  9. A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

    PubMed Central

    Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S

    1989-01-01

    The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other alpha-amylases, such as Taka-amylase A. The 48-kilodalton (kDa) amylase isolated from B. polymyxa was proven to have alpha-amylase activity. The amino acid sequences of the peptides generated from the 48-kDa amylase showed complete agreement with the predicted amino acid sequence of the C-terminal portion. The B. polymyxa amylase gene was therefore concluded to contain in-phase beta- and alpha-amylase-coding sequences in the 5' and 3' regions, respectively. A precursor protein, a 130-kDa amylase, directed by a plasmid, pYN520, carrying the entire amylase gene, had both beta- and alpha-amylase activities. This represents the first report of a single protein precursor in procaryotes that gives rise to two enzymes. Images PMID:2464578

  10. Respiratory CO(2) as Carbon Source for Nocturnal Acid Synthesis at High Temperatures in Three Species Exhibiting Crassulacean Acid Metabolism.

    PubMed

    Winter, K; Schröppel-Meier, G; Caldwell, M M

    1986-06-01

    TEMPERATURE EFFECTS ON NOCTURNAL CARBON GAIN AND NOCTURNAL ACID ACCUMULATION WERE STUDIED IN THREE SPECIES OF PLANTS EXHIBITING CRASSULACEAN ACID METABOLISM: Mamillaria woodsii, Opuntia vulgaris, and Kalanchoë daigremontiana. Under conditions of high soil moisture, nocturnal CO(2) gain and acid accumulation had temperature optima at 15 to 20 degrees C. Between 5 and 15 degrees C, uptake of atmospheric CO(2) largely accounted for acid accumulation. At higher tissue temperatures, acid accumulation exceeded net carbon gain indicating that acid synthesis was partly due to recycling of respiratory CO(2). When plants were kept in CO(2)-free air, acid accumulation based on respiratory CO(2) was highest at 25 to 35 degrees C. Net acid synthesis occurred up to 45 degrees C, although the nocturnal carbon balance became largely negative above 25 to 35 degrees C. Under conditions of water stress, net CO(2) exchange and nocturnal acid accumulation were reduced. Acid accumulation was proportionally more decreased at low than at high temperatures. Acid accumulation was either similar over the whole temperature range (5-45 degrees C) or showed an optimum at high temperatures, although net carbon balance became very negative with increasing tissue temperatures. Conservation of carbon by recycling respiratory CO(2) was temperature dependent. At 30 degrees C, about 80% of the dark respiratory CO(2) was conserved by dark CO(2) fixation, in both well irrigated and water stressed plants. PMID:16664827

  11. Design, synthesis and in vitro evaluation of a novel "stealth" polymeric gene vector.

    PubMed

    Guosen, He; Min, Feng; Xin, Luo; Venkatraman, Subbu

    2008-02-28

    We report on the synthesis of a novel gene carrier that has low interaction with serum components, as well as low cytotoxicity. Cationic copolymers composing branched poly(ethylenimine) (PEI) grafted with hydrophilic poly(ethylene glycol) (PEG) and poly(l-lactic acid) (PLLA) or small-molecule oleoyl were synthesized and evaluated as novel gene carriers in this study. The copolymers were complexed with plasmid DNA and the resulting polyplexes were approximately 140nm in diameter and had a positive surface potential (zeta=+13.8mV) at the N/P ratio of 10/1. The experiments showed that copolymers with the oleoyl moiety were superior to the other two copolymers (with PLLA), in terms of in vitro gene transfection efficiency. Safety studies using MTT assay indicated much lower cytotoxicity of the oleoyl polyplexes than the pDNA/PEI complexes. The intracellular behavior of the polyplexes was monitored by confocal laser scanning microscopy, and it was found that the polyplexes were internalized into HeLa cells very effectively. At the same time, the plasmid DNA carried by the oleoyl-containing copolymers was found to localize in the nucleus of the recipient cells. One experiment comparing serum-free and serum-containing media indicated that the oleoyl polyplexes may be able to evade the reticulo-endothelial system (RES) better than the PEI-pDNA complex. PMID:17928176

  12. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.

    PubMed

    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc

    2015-09-01

    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica. PMID:25959598

  13. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  14. Benzoic Acid-Inducible Gene Expression in Mycobacteria

    PubMed Central

    Dragset, Marte S.; Barczak, Amy K.; Kannan, Nisha; Mærk, Mali; Flo, Trude H.; Valla, Svein; Rubin, Eric J.; Steigedal, Magnus

    2015-01-01

    Conditional expression is a powerful tool to investigate the role of bacterial genes. Here, we adapt the Pseudomonas putida-derived positively regulated XylS/Pm expression system to control inducible gene expression in Mycobacterium smegmatis and Mycobacterium tuberculosis, the causative agent of human tuberculosis. By making simple changes to a Gram-negative broad-host-range XylS/Pm-regulated gene expression vector, we prove that it is possible to adapt this well-studied expression system to non-Gram-negative species. With the benzoic acid-derived inducer m-toluate, we achieve a robust, time- and dose-dependent reversible induction of Pm-mediated expression in mycobacteria, with low background expression levels. XylS/Pm is thus an important addition to existing mycobacterial expression tools, especially when low basal expression is of particular importance. PMID:26348349

  15. Identification of genes regulated by UV/salicylic acid.

    SciTech Connect

    Paunesku, T.; Chang-Liu, C.-M.; Shearin-Jones, P.; Watson, C.; Milton, J.; Oryhon, J.; Salbego, D.; Milosavljevic, A.; Woloschak, G. E.; CuraGen Corp.

    2000-02-01

    Purpose : Previous work from the authors' group and others has demonstrated that some of the effects of UV irradiation on gene expression are modulated in response to the addition of salicylic acid to irradiated cells. The presumed effector molecule responsible for this modulation is NF-kappaB. In the experiments described here, differential-display RT-PCR was used to identify those cDNAs that are differentially modulated by UV radiation with and without the addition of salicylic acid. Materials and methods : Differential-display RT-PCR was used to identify differentially expressed genes. Results : Eight such cDNAs are presented: lactate dehydrogenase (LDH-beta), nuclear encoded mitochondrial NADH ubiquinone reductase 24kDa (NDUFV2), elongation initiation factor 4B (eIF4B), nuclear dots protein SP100, nuclear encoded mitochondrial ATPase inhibitor (IF1), a cDNA similar to a subunit of yeast CCAAT transcription factor HAP5, and two expressed sequence tags (AA187906 and AA513156). Conclusions : Sequences of four of these genes contained NF-kappaB DNA binding sites of the type that may attract transrepressor p55/p55 NF-kappaB homodimers. Down-regulation of these genes upon UV irradiation may contribute to increased cell survival via suppression of p53 independent apoptosis.

  16. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis.

    PubMed

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a "GRAS" (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  17. Comparison of gene expression methods to identify genes responsive to perfluorooctane sulfonic acid.

    PubMed

    Hu, Wenyue; Jones, Paul D; Decoen, Wim; Newsted, John L; Giesy, John P

    2005-01-01

    Genome-wide expression techniques are being increasingly used to assess the effects of environmental contaminants. Oligonucleotide or cDNA microarray methods make possible the screening of large numbers of known sequences for a given model species, while differential display analysis makes possible analysis of the expression of all the genes from any species. We report a comparison of two currently popular methods for genome-wide expression analysis in rat hepatoma cells treated with perfluorooctane sulfonic acid. The two analyses provided 'complimentary' information. Approximately 5% of the 8000 genes analyzed by the GeneChip array, were altered by a factor of three or greater. Differential display results were more difficult to interpret, since multiple gene products were present in most gel bands so a probabilistic approach was used to determine which pathways were affected. The mechanistic interpretation derived from these two methods was in agreement, both showing similar alterations in a specific set of genes. PMID:21783471

  18. Analysis of porcine adipose tissue transcriptome reveals differences in de novo fatty acid synthesis in pigs with divergent muscle fatty acid composition

    PubMed Central

    2013-01-01

    Background In pigs, adipose tissue is one of the principal organs involved in the regulation of lipid metabolism. It is particularly involved in the overall fatty acid synthesis with consequences in other lipid-target organs such as muscles and the liver. With this in mind, we have used massive, parallel high-throughput sequencing technologies to characterize the porcine adipose tissue transcriptome architecture in six Iberian x Landrace crossbred pigs showing extreme phenotypes for intramuscular fatty acid composition (three per group). Results High-throughput RNA sequencing was used to generate a whole characterization of adipose tissue (backfat) transcriptome. A total of 4,130 putative unannotated protein-coding sequences were identified in the 20% of reads which mapped in intergenic regions. Furthermore, 36% of the unmapped reads were represented by interspersed repeats, SINEs being the most abundant elements. Differential expression analyses identified 396 candidate genes among divergent animals for intramuscular fatty acid composition. Sixty-two percent of these genes (247/396) presented higher expression in the group of pigs with higher content of intramuscular SFA and MUFA, while the remaining 149 showed higher expression in the group with higher content of PUFA. Pathway analysis related these genes to biological functions and canonical pathways controlling lipid and fatty acid metabolisms. In concordance with the phenotypic classification of animals, the major metabolic pathway differentially modulated between groups was de novo lipogenesis, the group with more PUFA being the one that showed lower expression of lipogenic genes. Conclusions These results will help in the identification of genetic variants at loci that affect fatty acid composition traits. The implications of these results range from the improvement of porcine meat quality traits to the application of the pig as an animal model of human metabolic diseases. PMID:24289474

  19. Identification of a conserved protein involved in anaerobic unsaturated fatty acid synthesis in Neiserria gonorrhoeae: implications for facultative and obligate anaerobes that lack FabA.

    PubMed

    Isabella, Vincent M; Clark, Virginia L

    2011-10-01

    Transcriptome analysis of the facultative anaerobe, Neisseria gonorrhoeae, revealed that many genes of unknown function were induced under anaerobic conditions. Mutation of one such gene, NGO1024, encoding a protein belonging to the 2-nitropropane dioxygenase-like superfamily of proteins, was found to result in an inability of gonococci to grow anaerobically. Anaerobic growth of an NG1024 mutant was restored upon supplementation with unsaturated fatty acids (UFA), but not with the saturated fatty acid palmitate. Gonococcal fatty acid profiles confirmed that NGO1024 was involved in UFA synthesis anaerobically, but not aerobically, demonstrating that gonococci contain two distinct pathways for the production of UFAs, with a yet unidentified aerobic mechanism, and an anaerobic mechanism involving NGO1024. Expression of genes involved in classical anaerobic UFA synthesis, fabA, fabM and fabB, was toxic in gonococci and unable to complement a NGO1024 mutation, suggesting that the chemistry involved in gonococcal anaerobic UFA synthesis is distinct from that of the classical pathway. NGO1024 homologues, which we suggest naming UfaA, form a distinct lineage within the 2-nitropropane dioxygenase-like superfamily, and are found in many facultative and obligate anaerobes that produce UFAs but lack fabA, suggesting that UfaA is part of a widespread pathway involved in UFA synthesis. PMID:21895795

  20. Overexpression of Cholesterol 7α-hydroxylase promotes hepatic bile acid synthesis and secretion and maintains cholesterol homeostasis

    PubMed Central

    Li, Tiangang; Matozel, Michelle; Boehme, Shannon; Kong, Bo; Nilsson, Lisa-Mari; Guo, Grace; Ellis, Ewa; Chiang, John Y. L.

    2011-01-01

    Summary We reported previously that mice overexpressing Cyp7a1 (Cyp7a1-tg) are protected against high fat diet-induced hypercholesterolemia, obesity and insulin resistance (1). Here we investigated the underlying mechanism of bile acid signaling in maintaining cholesterol homeostasis in Cyp7a1-tg mice. Cyp7a1-tg mice had 2-fold higher Cyp7a1 activity and bile acid pool than wild type mice. Gallbladder bile acid composition changed from predominantly cholic acid (57%) in wild type to chenodeoxycholic acid (54%) in Cyp7a1-tg mice. Cyp7a1-tg mice had higher biliary and fecal cholesterol and bile acid secretion rates than wild type mice. Surprisingly, hepatic de novo cholesterol synthesis was markedly induced in Cyp7a1-tg mice but intestine fractional cholesterol absorption in Cyp7a1-tg mice remained the same as wild type mice despite increased intestine bile acids. Interestingly, hepatic but not intestinal expression of several cholesterol (ABCG5/G8, SR-B1) and bile acid (ABCB11) transporters were significantly induced in Cyp7a1-tg mice. Treatment of mouse or human hepatocytes with a farnesoid X receptor (FXR) agonist GW4064 or bile acids induced hepatic Abcg5/g8 expression. A functional FXR binding site was identified in the Abcg5 gene promoter. Study of tissue-specific Fxr knockout mice demonstrated that loss of the Fxr gene in the liver attenuated bile acid induction of hepatic Abcg5/g8 and gallbladder cholesterol content, suggesting a role of FXR in the regulation of cholesterol transport. In summary, this study revealed a new mechanism by which increased Cyp7a1 activity expands the hydrophobic bile acid pool, stimulating hepatic cholesterol synthesis and biliary cholesterol secretion without increasing intestinal cholesterol absorption. This study demonstrated that Cyp7a1 plays a critical role in maintaining cholesterol homeostasis and underscores the importance of bile acid signaling in regulating overall cholesterol homeostasis. PMID:21319191

  1. A Robust and Versatile Method of Combinatorial Chemical Synthesis of Gene Libraries via Hierarchical Assembly of Partially Randomized Modules

    PubMed Central

    Popova, Blagovesta; Schubert, Steffen; Bulla, Ingo; Buchwald, Daniela; Kramer, Wilfried

    2015-01-01

    A major challenge in gene library generation is to guarantee a large functional size and diversity that significantly increases the chances of selecting different functional protein variants. The use of trinucleotides mixtures for controlled randomization results in superior library diversity and offers the ability to specify the type and distribution of the amino acids at each position. Here we describe the generation of a high diversity gene library using tHisF of the hyperthermophile Thermotoga maritima as a scaffold. Combining various rational criteria with contingency, we targeted 26 selected codons of the thisF gene sequence for randomization at a controlled level. We have developed a novel method of creating full-length gene libraries by combinatorial assembly of smaller sub-libraries. Full-length libraries of high diversity can easily be assembled on demand from smaller and much less diverse sub-libraries, which circumvent the notoriously troublesome long-term archivation and repeated proliferation of high diversity ensembles of phages or plasmids. We developed a generally applicable software tool for sequence analysis of mutated gene sequences that provides efficient assistance for analysis of library diversity. Finally, practical utility of the library was demonstrated in principle by assessment of the conformational stability of library members and isolating protein variants with HisF activity from it. Our approach integrates a number of features of nucleic acids synthetic chemistry, biochemistry and molecular genetics to a coherent, flexible and robust method of combinatorial gene synthesis. PMID:26355961

  2. Indole-3-acetic acid (IAA) induced changes in oil content, fatty acid profiles and expression of four fatty acid biosynthetic genes in Chlorella vulgaris at early stationary growth phase.

    PubMed

    Jusoh, Malinna; Loh, Saw Hong; Chuah, Tse Seng; Aziz, Ahmad; Cha, Thye San

    2015-03-01

    Microalgae lipids and oils are potential candidates for renewable biodiesel. Many microalgae species accumulate a substantial amount of lipids and oils under environmental stresses. However, low growth rate under these adverse conditions account for the decrease in overall biomass productivity which directly influence the oil yield. This study was undertaken to investigate the effect of exogenously added auxin (indole-3-acetic acid; IAA) on the oil content, fatty acid compositions, and the expression of fatty acid biosynthetic genes in Chlorella vulgaris (UMT-M1). Auxin has been shown to regulate growth and metabolite production of several microalgae. Results showed that oil accumulation was highest on days after treatment (DAT)-2 with enriched levels of palmitic (C16:0) and stearic (C18:0) acids, while the linoleic (C18:2) and α-linolenic (C18:3n3) acids levels were markedly reduced by IAA. The elevated levels of saturated fatty acids (C16:0 and C18:0) were consistent with high expression of the β-ketoacyl ACP synthase I (KAS I) gene, while low expression of omega-6 fatty acid desaturase (ω-6 FAD) gene was consistent with low production of C18:2. However, the increment of stearoyl-ACP desaturase (SAD) gene expression upon IAA induction did not coincide with oleic acid (C18:1) production. The expression of omega-3 fatty acid desaturase (ω-3 FAD) gene showed a positive correlation with the synthesis of PUFA and C18:3n3. PMID:25583439

  3. Identification of the genetic locus for the structural gene and a new regulatory gene for the synthesis of repressible alkaline phosphatase in Saccharomyces cerevisiae

    SciTech Connect

    Kaneko, Y.; Toh-e, A.; Oshima, Y.

    1982-02-01

    Two lines of evidence showed that the PHO8 gene encodes the structure of repressible, nonspecific alkaline phosphatase in Saccharomyces cerevisiae: (I) the enzyme produced by a temperature-sensitive pho8 mutant at the permissive temperature (25/sup 0/C) was more thermolabile than that of the wild-type strain, and (II) the PHO8 gene showed a gene dosage effect on the enzyme activity. The pho8 locus has been mapped on chromosome IV, 8 centimorgans distal to rna3. A new mutant carrying the pho9 gene was isolated which lacks repressible alkaline phosphatase, but has the normal phenotype for the synthesis of repressible acid phosphatase. The pho9 gene segregated independently of all known pho-regulatory genes and did not show the gene dosage effect on repressible alkaline phosphatase activity. The pho9/pho9 diploid hardly sporulated and showed no commitment to intragenic recombination when it was inoculated on sporulation medium. Hence the pho9 mutant has a phenotype similar to the pep4 mutant, which was isolated as a pleiotropic mutant with reduced levels of proteinases A and B carboxypeptidase Y. An allelism test indicated that pho9 and pep4 are allelic.

  4. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  5. T7 Endonuclease I Mediates Error Correction in Artificial Gene Synthesis.

    PubMed

    Sequeira, Ana Filipa; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A

    2016-09-01

    Efficacy of de novo gene synthesis largely depends on the quality of overlapping oligonucleotides used as template for PCR assembly. The error rate associated with current gene synthesis protocols limits the efficient and accurate production of synthetic genes, both in the small and large scales. Here, we analysed the ability of different endonuclease enzymes, which specifically recognize and cleave DNA mismatches resulting from incorrect impairments between DNA strands, to remove mutations accumulated in synthetic genes. The gfp gene, which encodes the green fluorescent protein, was artificially synthesized using an integrated protocol including an enzymatic mismatch cleavage step (EMC) following gene assembly. Functional and sequence analysis of resulting artificial genes revealed that number of deletions, insertions and substitutions was strongly reduced when T7 endonuclease I was used for mutation removal. This method diminished mutation frequency by eightfold relative to gene synthesis not incorporating an error correction step. Overall, EMC using T7 endonuclease I improved the population of error-free synthetic genes, resulting in an error frequency of 0.43 errors per 1 kb. Taken together, data presented here reveal that incorporation of a mutation-removal step including T7 endonuclease I can effectively improve the fidelity of artificial gene synthesis. PMID:27334914

  6. Differences in growth, fillet quality, and fatty acid metabolism-related gene expression between juvenile male and female rainbow trout.

    PubMed

    Manor, Meghan L; Cleveland, Beth M; Kenney, P Brett; Yao, Jianbo; Leeds, Tim

    2015-04-01

    Sexual maturation occurs at the expense of stored energy and nutrients, including lipids; however, little is known regarding sex effects on nutrient regulatory mechanisms in rainbow trout prior to maturity. Thirty-two, 14-month-old, male and female rainbow trout were sampled for growth, carcass yield, fillet composition, and gene expression of liver, white muscle, and visceral adipose tissue. Growth parameters, including gonadosomatic index, were not affected by sex. Females had higher percent separable muscle yield, but there were no sex effects on fillet proximate composition. Fillet shear force indicated females produce firmer fillets than males. Male livers had greater expression of three cofactors within the mTOR signaling pathway that act to inhibit TORC1 assembly; mo25, rictor, and pras40. Male liver also exhibited increased expression of β-oxidation genes cpt1b and ehhadh. These findings are indicative of increased mitochondrial β-oxidation in male liver. Females exhibited increased expression of the mTOR cofactor raptor in white muscle and had higher expression levels of several genes within the fatty acid synthesis pathway, including gpat, srebp1, scd1, and cd36. Female muscle also had increased expression of β-oxidation genes cpt1d and cpt2. Increased expression of both fatty acid synthesis and β-oxidation genes suggests female muscle may have greater fatty acid turnover. Differences between sexes were primarily associated with variation of gene expression within the mTOR signaling pathway. Overall, data suggest there is differential regulation of gene expression in male and female rainbow trout tissues prior to the onset of sexual maturity that may lead to nutrient repartitioning during maturation. PMID:25673423

  7. Inhibition of sterol but not fatty acid synthesis by valproate in developing rat brain in vivo.

    PubMed Central

    Bolaños, J P; Medina, J M; Williamson, D H

    1990-01-01

    The effect of administration of valproate on lipogenesis in the developing rat brain in vivo was studied. Valproate inhibited by 21-38% the rate of 3H2O incorporation into brain sterols, without significantly affecting fatty acid synthesis. Similarly, R-[2-14C]mevalonate incorporation into sterols was inhibited by 33-54%; the low rate of fatty acid synthesis under these conditions was not affected by valproate. Plasma ketone bodies decreased after treatment with valproate. Valproate inhibited (about 50%) both sterol and fatty acid synthesis in livers of weanling rats. It is concluded that valproate can specifically inhibit sterol synthesis in the brain during development, in part at a stage after mevalonate formation, and also by decreased exogenous precursor supply. PMID:2264830

  8. Cognitive and emotional information processing: protein synthesis and gene expression

    PubMed Central

    Sajikumar, Sreedharan; Navakkode, Sheeja; Korz, Volker; Frey, Julietta U

    2007-01-01

    Recent findings suggest that functional plasticity phenomena such as long-term potentiation (LTP) and long-term depression (LTD) – cellular processes underlying memory – are restricted to functional dendritic compartments. It was also shown, however, that a relatively strong activation of a synaptic input can abolish compartment restrictions. Our data support these findings and we present one cellular pathway responsible for uncompartmentalization of the normally localized plasticity processes by the action of rolipram, an inhibitor of type 4 phosphodiesterases. In contrast with compartment-restricted information processing, uncompartmentalization requires transcription. In the search for system relevance of compartmentalization versus uncompartmentalization we describe firstly data which show that more cognitive information processing in rats' behaviour may follow rules of compartmentalization, whereas stressful, more life-threatening, inputs abolish compartment-restricted information processing involving transcription. Our findings allow us to suggest that consolidation of processes which take place during the cognitive event most probably depend on local protein synthesis, whereas stress immediately induces gene expression in addition, resulting in a compartment-unspecific up-regulation of plasticity-related proteins (PRPs), providing the entire neuron with a higher level of ‘reactiveness’. These data would provide a specific functional cellular mechanism to respond differentially and effectively to behaviourally weighted inputs. PMID:17702813

  9. Cationic lioposomes with folic acid as targeting ligand for gene delivery.

    PubMed

    Cui, Shao-Hui; Zhi, De-Fu; Zhao, Yi-Nan; Chen, Hui-Ying; Meng, Yao; Zhang, Chuan-Min; Zhang, Shu-Biao

    2016-08-15

    In our previous Letter, we have carried out the synthesis of a novel DDCTMA cationic lipid which was formulated with DOPE for gene delivery. Herein, we used folic acid (FA) as targeting ligand and cholesterol (Chol) as helper lipid instead of DOPE for enhancing the stability of the liposomes. These liposomes were characterized by dynamic laser scattering (DLS), transmission electron microscopy (TEM) and agarose gel electrophoresis assays of pDNA binding affinity. The lipoplexes were prepared by using different weight ratios of DDCTMA/Chol (1:1, 2:1, 3:1, 4:1) liposomes and different concentrations of FA (50-200μg/mL) combining with pDNA. The transfection efficiencies of the lipoplexes were evaluated using pGFP-N2 and pGL3 plasmid DNA against NCI-H460 cells in vitro. Among them, the optimum gene transfection efficiency with DDCTMA/Chol (3:1)/FA (100μg/mL) was obtained. The results showed that FA could improve the gene transfection efficiencies of DDCTMA/Chol cationic liposome. Our results also convincingly demonstrated FA (100μg/mL)-coated DDCTMA/Chol (3:1) cationic liposome could serve as a promising candidate for the gene delivery. PMID:27426864

  10. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  11. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  12. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  13. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  14. Identification of a critical determinant that enables efficient fatty acid synthesis in oleaginous fungi

    PubMed Central

    Chen, Haiqin; Hao, Guangfei; Wang, Lei; Wang, Hongchao; Gu, Zhennan; Liu, Liming; Zhang, Hao; Chen, Wei; Chen, Yong Q.

    2015-01-01

    Microorganisms are valuable resources for lipid production. What makes one microbe but not the other able to efficiently synthesize and accumulate lipids is poorly understood. In the present study, global gene expression prior to and after the onset of lipogenesis was determined by transcriptomics using the oleaginous fungus Mortierella alpina as a model system. A core of 23 lipogenesis associated genes was identified and their expression patterns shared a high similarity among oleaginous microbes Chlamydomonas reinhardtii, Mucor circinelloides and Rhizopus oryzae but was dissimilar to the non-oleaginous Aspergillus nidulans. Unexpectedly, Glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) in the pentose phosphate pathway (PPP) were found to be the NADPH producers responding to lipogenesis in the oleaginous microbes. Their role in lipogenesis was confirmed by a knockdown experiment. Our results demonstrate, for the first time, that the PPP plays a significant role during fungal lipogenesis. Up-regulation of NADPH production by the PPP, especially G6PD, may be one of the critical determinants that enables efficiently fatty acid synthesis in oleaginous microbes. PMID:26059272

  15. Identification of a critical determinant that enables efficient fatty acid synthesis in oleaginous fungi.

    PubMed

    Chen, Haiqin; Hao, Guangfei; Wang, Lei; Wang, Hongchao; Gu, Zhennan; Liu, Liming; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2015-01-01

    Microorganisms are valuable resources for lipid production. What makes one microbe but not the other able to efficiently synthesize and accumulate lipids is poorly understood. In the present study, global gene expression prior to and after the onset of lipogenesis was determined by transcriptomics using the oleaginous fungus Mortierella alpina as a model system. A core of 23 lipogenesis associated genes was identified and their expression patterns shared a high similarity among oleaginous microbes Chlamydomonas reinhardtii, Mucor circinelloides and Rhizopus oryzae but was dissimilar to the non-oleaginous Aspergillus nidulans. Unexpectedly, Glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) in the pentose phosphate pathway (PPP) were found to be the NADPH producers responding to lipogenesis in the oleaginous microbes. Their role in lipogenesis was confirmed by a knockdown experiment. Our results demonstrate, for the first time, that the PPP plays a significant role during fungal lipogenesis. Up-regulation of NADPH production by the PPP, especially G6PD, may be one of the critical determinants that enables efficiently fatty acid synthesis in oleaginous microbes. PMID:26059272

  16. β-Ketoacyl-acyl Carrier Protein Synthase I (KASI) Plays Crucial Roles in the Plant Growth and Fatty Acids Synthesis in Tobacco

    PubMed Central

    Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong

    2016-01-01

    Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494

  17. β-Ketoacyl-acyl Carrier Protein Synthase I (KASI) Plays Crucial Roles in the Plant Growth and Fatty Acids Synthesis in Tobacco.

    PubMed

    Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong

    2016-01-01

    Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494

  18. Nucleic Acid Modifications in Regulation of Gene Expression.

    PubMed

    Chen, Kai; Zhao, Boxuan Simen; He, Chuan

    2016-01-21

    Nucleic acids carry a wide range of different chemical modifications. In contrast to previous views that these modifications are static and only play fine-tuning functions, recent research advances paint a much more dynamic picture. Nucleic acids carry diverse modifications and employ these chemical marks to exert essential or critical influences in a variety of cellular processes in eukaryotic organisms. This review covers several nucleic acid modifications that play important regulatory roles in biological systems, especially in regulation of gene expression: 5-methylcytosine (5mC) and its oxidative derivatives, and N(6)-methyladenine (6mA) in DNA; N(6)-methyladenosine (m(6)A), pseudouridine (Ψ), and 5-methylcytidine (m(5)C) in mRNA and long non-coding RNA. Modifications in other non-coding RNAs, such as tRNA, miRNA, and snRNA, are also briefly summarized. We provide brief historical perspective of the field, and highlight recent progress in identifying diverse nucleic acid modifications and exploring their functions in different organisms. Overall, we believe that work in this field will yield additional layers of both chemical and biological complexity as we continue to uncover functional consequences of known nucleic acid modifications and discover new ones. PMID:26933737

  19. NO synthesis from arginine is favored by α-linolenic acid in mice fed a high-fat diet.

    PubMed

    Hermier, Dominique; Guelzim, Najoua; Martin, Pascal G P; Huneau, Jean-François; Mathé, Véronique; Quignard-Boulangé, Annie; Lasserre, Frédéric; Mariotti, François

    2016-09-01

    Alterations in NO availability and signaling play a pivotal role at early stages of the metabolic syndrome (MetSynd). We hypothesized that dietary α-linolenic acid (ALA, 18:3 n-3) favors NO availability by modulating amino acid metabolism, with a specific impact on the arginine-NO pathway. Mice were fed a hyperlipidic diet (285 g lipid/kg, 51.1 % energy), rich in either saturated fatty acids (SFA, provided by palm oil, PALM group) or ALA (provided by linseed oil, LIN group). We measured whole-body NO synthesis and systemic arginine hydrolysis with a tracer-based method, plasma concentration of related metabolites, and hepatic mRNA level of related enzymes, and the study was completed by a transcriptomic analysis in the liver. As expected with this model, hyperlipidic diets resulted in increased adiposity and glycemia after 5 weeks. As compared to PALM mice, LIN mice had a higher plasma nitrite and nitrate concentration, a higher whole-body conversion of arginine into NO vs urea, and a similar plasma concentration of asymmetric dimethylarginine (ADMA), despite a higher expression of the liver dimethylargininase-1. In LIN mice, there was a higher expression of genes involved in PPARα signaling, but a little impact on gene expression related to amino acids and arginine metabolism. This effect cannot be directly ascribed to changes in arginase activity in the liver or ADMA metabolism, nor to direct regulation of the related target genes. In conclusion, dietary ALA favors NO synthesis, which could contribute to rescue NO availability when jeopardized by the nutritional conditions in relation with the initiation of the MetSynd. PMID:27178023

  20. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-01

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. PMID:27258673

  1. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  2. Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

    SciTech Connect

    Chander, A.; Gullo, J.; Reicherter, J.; Fisher, A.

    1987-05-01

    Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased only by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.

  3. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.

    PubMed

    van Ameijde, Jeroen; Liskamp, Rob M J

    2003-08-01

    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  4. Prolonged stimulation of muscle protein synthesis by leucine in neonates is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rise in amino acids and insulin after a meal independently stimulate protein synthesis in skeletal muscle of neonates by activating the intracellular signalling pathways that regulate mRNA translation. Leucine, in particular, is important in mediating the response to amino acids. Previously, w...

  5. Diesters from Oleic Acid: Synthesis, Low Temperature Properties, and Oxidation Stability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several diesters were prepared from commercially available oleic acid and common organic acids. The key step in the three step synthesis of oleochemical diesters entails a ring opening esterification of alkyl 9,10-epoxyoctadecanoates (alkyl: propyl, iso-propyl, octyl, 2-ethylhexyl) using propionic a...

  6. [The clinical evaluation of the hypocholesterolemic effects of an inhibitor of cholesterol synthesis: mevalonic acid].

    PubMed

    Del Nero, E; Aloe, N; Augeri, C; Avola, F; Carta, G; Cavagnaro, A; De Grandi, R; Gianfreda, M; Magro, G P; Mazzarello, G P

    1992-07-01

    Twenty eight patients with heterozygous familial hypercholesterolemia were treated with mevalonic acid (an inhibitor of cholesterol synthesis) for 45 days. Patients received a daily dose of 750 to 1500 mg mevalonic acid depending on plasma cholesterol levels. Results showed a significant reduction in cholesterol values whereas no significant difference was observed in HDL cholesterol and triglyceride levels. PMID:1505176

  7. Evolution of Mycolic Acid Biosynthesis Genes and Their Regulation during Starvation in Mycobacterium tuberculosis

    PubMed Central

    Jamet, Stevie; Quentin, Yves; Coudray, Coralie; Texier, Pauline; Laval, Françoise; Daffé, Mamadou

    2015-01-01

    ABSTRACT Mycobacterium tuberculosis, the etiological agent of tuberculosis, is a Gram-positive bacterium with a unique cell envelope composed of an essential outer membrane. Mycolic acids, which are very-long-chain (up to C100) fatty acids, are the major components of this mycomembrane. The enzymatic pathways involved in the biosynthesis and transport of mycolates are fairly well documented and are the targets of the major antituberculous drugs. In contrast, only fragmented information is available on the expression and regulation of the biosynthesis genes. In this study, we report that the hadA, hadB, and hadC genes, which code for the mycolate biosynthesis dehydratase enzymes, are coexpressed with three genes that encode proteins of the translational apparatus. Consistent with the well-established control of the translation potential by nutrient availability, starvation leads to downregulation of the hadABC genes along with most of the genes required for the synthesis, modification, and transport of mycolates. The downregulation of a subset of the biosynthesis genes is partially dependent on RelMtb, the key enzyme of the stringent response. We also report the phylogenetic evolution scenario that has shaped the current genetic organization, characterized by the coregulation of the hadABC operon with genes of the translational apparatus and with genes required for the modification of the mycolates. IMPORTANCE Mycobacterium tuberculosis infects one-third of the human population worldwide, and despite the available therapeutic arsenal, it continues to kill millions of people each year. There is therefore an urgent need to identify new targets and develop a better understanding of how the bacterium is adapting itself to host defenses during infection. A prerequisite of this understanding is knowledge of how this adaptive skill has been implanted by evolution. Nutrient scarcity is an environmental condition the bacterium has to cope with during infection. In many

  8. Pyrazinamide Induced Rat Cholestatic Liver Injury through Inhibition of FXR Regulatory Effect on Bile Acid Synthesis and Transport.

    PubMed

    Guo, Hong-Li; Hassan, Hozeifa M; Zhang, Yun; Dong, Si-Zhe; Ding, Ping-Ping; Wang, Tao; Sun, Li-Xin; Zhang, Lu-Yong; Jiang, Zhen-Zhou

    2016-08-01

    Pyrazinamide (PZA) is an indispensable first-line drug used for the treatment of tuberculosis which may cause serious hepatotoxicity; however, the mechanisms underlying these toxicities are poorly understood. Cholestasis plays an important role in drug-induced liver injury. Since there were no previous published works reported cholestasis and PZA hepatotoxicity relationship, this study aimed to identify whether PZA can induce liver injury with characterized evidences of cholestasis and to clarify expression changes of proteins related to both bile acid synthesis and transport in PZA-induced liver injury. PZA (2 g/kg) was administered for 7 consecutive days by oral gavage. Results showed there were 2-fold elevation in both ALT and AST serum levels in PZA-treated rats. In addition, a 10-fold increment in serum total bile acid was observed after PZA administration. The mRNA and protein expressions of bile acid synthesis and transport parameters were markedly altered, in which FXR, Bsep, Mrp2, Mdr2, Ostα/β, Oatp1a1, Oatp1b2, and Cyp8b1 were decreased (P < .05), while Mrp3, Ntcp, Oatp1a4, and Cyp7a1 were increased (P < .05). Moreover, treatment with the FXR agonist obeticholic acid (OCA) generated obvious reductions in serum ALT, AST, and TBA levels in PZA-treated rats. Those effects were due to transcriptional regulation of pre-mentioned target genes by OCA. Taken together, these results suggested that PZA-induced cholestatic liver injury was related to FXR inhibition, leading to the dysfunction in bile acid synthesis and transport. PMID:27255380

  9. L-amino acid ligase from Pseudomonas syringae producing tabtoxin can be used for enzymatic synthesis of various functional peptides.

    PubMed

    Arai, Toshinobu; Arimura, Yasuhiro; Ishikura, Shun; Kino, Kuniki

    2013-08-01

    Functional peptides are expected to be beneficial compounds that improve our quality of life. To address the growing need for functional peptides, we have examined peptide synthesis by using microbial enzymes. l-Amino acid ligase (Lal) catalyzes the condensation of unprotected amino acids in an ATP-dependent manner and is applicable to fermentative production. Hence, Lal is a promising enzyme to achieve cost-effective synthesis. To obtain a Lal with novel substrate specificity, we focused on the putative Lal involved in the biosynthesis of the dipeptidic phytotoxin designated tabtoxin. The tabS gene was cloned from Pseudomonas syringae NBRC14081 and overexpressed in Escherichia coli cells. The recombinant TabS protein produced showed the broadest substrate specificity of any known Lal; it detected 136 of 231 combinations of amino acid substrates when dipeptide synthesis was examined. In addition, some new substrate specificities were identified and unusual amino acids, e.g., l-pipecolic acid, hydroxy-l-proline, and β-alanine, were found to be acceptable substrates. Furthermore, kinetic analysis and monitoring of the reactions over a short time revealed that TabS showed distinct substrate selectivity at the N and C termini, which made it possible to specifically synthesize a peptide without by-products such as homopeptides and heteropeptides with the reverse sequence. TabS specifically synthesized the following functional peptides, including their precursors: l-arginyl-l-phenylalanine (antihypertensive effect; yield, 62%), l-leucyl-l-isoleucine (antidepressive effect; yield, 77%), l-glutaminyl-l-tryptophan (precursor of l-glutamyl-l-tryptophan, which has antiangiogenic activity; yield, 54%), l-leucyl-l-serine (enhances saltiness; yield, 83%), and l-glutaminyl-l-threonine (precursor of l-glutamyl-l-threonine, which enhances saltiness; yield, 96%). Furthermore, our results also provide new insights into tabtoxin biosynthesis. PMID:23770908

  10. An improved method of gene synthesis based on DNA works software and overlap extension PCR.

    PubMed

    Dong, Bingxue; Mao, Runqian; Li, Baojian; Liu, Qiuyun; Xu, Peilin; Li, Gang

    2007-11-01

    A bottleneck in recent gene synthesis technologies is the high cost of oligonucleotide synthesis and post-synthesis sequencing. In this article, a simple and rapid method for low-cost gene synthesis technology was developed based on DNAWorks program and an improved single-step overlap extension PCR (OE-PCR). This method enables any DNA sequence to be synthesized with few errors, then any mutated sites could be corrected by site-specific mutagenesis technology or PCR amplification-assembly method, which can amplify different DNA fragments of target gene followed by assembly into an entire gene through their overlapped region. Eventually, full-length DNA sequence without error was obtained via this novel method. Our method is simple, rapid and low-cost, and also easily amenable to automation based on a DNAWorks design program and defined set of OE-PCR reaction conditions suitable for different genes. Using this method, several genes including Manganese peroxidase gene (Mnp) of Phanerochaete chrysosporium (P. chrysosporium), Laccase gene (Lac) of Trametes versicolor (T. versicolor) and Cip1 peroxidase gene (cip 1) of Coprinus cinereus (C. cinereus) with sizes ranging from 1.0 kb to 1.5 kb have been synthesized successfully. PMID:17952664

  11. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  12. Aquatic contaminants alter genes involved in neurotransmitter synthesis and gonadotropin release in largemouth bass.

    PubMed

    Martyniuk, Christopher J; Sanchez, Brian C; Szabo, Nancy J; Denslow, Nancy D; Sepúlveda, Maria S

    2009-10-19

    Many aquatic contaminants potentially affect the central nervous system, however the underlying mechanisms of how toxicants alter normal brain function are not well understood. The objectives of this study were to compare the effects of emerging and prevalent environmental contaminants on the expression of brain transcripts with a role in neurotransmitter synthesis and reproduction. Adult male largemouth bass (Micropterus salmoides) were injected once for a 96 h duration with control (water or oil) or with one of two doses of a single chemical to achieve the following body burdens (microg/g): atrazine (0.3 and 3.0), toxaphene (10 and 100), cadmium (CdCl(2)) (0.000067 and 0.00067), polychlorinated biphenyl (PCB) 126 (0.25 and 2.5), and phenanthrene (5 and 50). Partial largemouth bass gene segments were cloned for enzymes involved in neurotransmitter (glutamic acid decarboxylase 65, GAD65; tyrosine hydroxylase) and estrogen (brain aromatase; CYP19b) synthesis for real-time PCR assays. In addition, neuropeptides regulating feeding (neuropeptide Y) and reproduction (chicken GnRH-II, cGnRH-II; salmon GnRH, sGnRH) were also investigated. Of the chemicals tested, only cadmium, PCB 126, and phenanthrene showed any significant effects on the genes tested, while atrazine and toxaphene did not. Cadmium (0.000067 microg/g) significantly increased cGnRH-II mRNA while PCB 126 (0.25 microg/g) decreased GAD65 mRNA. Phenanthrene decreased GAD65 and tyrosine hydroxylase mRNA levels at the highest dose (50 microg/g) but increased cGnRH-II mRNA at the lowest dose (5 microg/g). CYP19b, NPY, and sGnRH mRNA levels were unaffected by any of the treatments. A hierarchical clustering dendrogram grouped PCB 126 and phenanthrene more closely than other chemicals with respect to the genes tested. This study demonstrates that brain transcripts important for neurotransmitter synthesis neuroendocrine function are potential targets for emerging and prevalent aquatic contaminants. PMID:19781795

  13. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  14. Synthesis of zirconium carbide nanosized powders by pursed wire discharge in oleic acid

    NASA Astrophysics Data System (ADS)

    Sugashima, Kenta; Suzuki, Kazuma; Suzuki, Tsuneo; Nakayama, Tadachika; Suematsu, Hisayuki; Niihara, Koichi

    2016-01-01

    In this study, we propose novel PWD methods in inert gas mixed organic vapor and organic liquid which work as harmless carbon sources. Metal zirconium wire evaporation by PWD in organic vapor or liquid media was investigated. It was confirmed that in the PWD process using oleic acid liquid, single phase zirconium carbide nanopowders were synthesized by a reaction between Zr vapor and oleic acid. A new method for synthesis of carbide nanopowders was developed using the PWD in organic liquid. Therefore, the present result suggested that PWD method in oleic acid liquids is effective for the synthesis of carbide nanopowders.

  15. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives.

    PubMed

    Hayashi, N; Sugawara, T; Kato, S

    1991-01-01

    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4].Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  16. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives

    PubMed Central

    Hayashi, Nobuyoshi; Sugawara, Tohru; Kato, Shinji

    1991-01-01

    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4]. Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  17. Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer

    PubMed Central

    Getino, María; Sanabria-Ríos, David J.; Fernández-López, Raúl; Campos-Gómez, Javier; Sánchez-López, José M.; Fernández, Antonio; Carballeira, Néstor M.

    2015-01-01

    ABSTRACT Bacterial conjugation constitutes a major horizontal gene transfer mechanism for the dissemination of antibiotic resistance genes among human pathogens. Antibiotic resistance spread could be halted or diminished by molecules that interfere with the conjugation process. In this work, synthetic 2-alkynoic fatty acids were identified as a novel class of conjugation inhibitors. Their chemical properties were investigated by using the prototype 2-hexadecynoic acid and its derivatives. Essential features of effective inhibitors were the carboxylic group, an optimal long aliphatic chain of 16 carbon atoms, and one unsaturation. Chemical modification of these groups led to inactive or less-active derivatives. Conjugation inhibitors were found to act on the donor cell, affecting a wide number of pathogenic bacterial hosts, including Escherichia, Salmonella, Pseudomonas, and Acinetobacter spp. Conjugation inhibitors were active in inhibiting transfer of IncF, IncW, and IncH plasmids, moderately active against IncI, IncL/M, and IncX plasmids, and inactive against IncP and IncN plasmids. Importantly, the use of 2-hexadecynoic acid avoided the spread of a derepressed IncF plasmid into a recipient population, demonstrating the feasibility of abolishing the dissemination of antimicrobial resistances by blocking bacterial conjugation. PMID:26330514

  18. Chemical Synthesis of Uncommon Natural Bile Acids: The 9α-Hydroxy Derivatives of Chenodeoxycholic and Lithocholic Acids.

    PubMed

    Iida, Takashi; Namegawa, Kazunari; Nakane, Naoya; Iida, Kyoko; Hofmann, Alan Frederick; Omura, Kaoru

    2016-09-01

    The chemical synthesis of the 9α-hydroxy derivatives of chenodeoxycholic and lithocholic acids is reported. For initiating the synthesis of the 9α-hydroxy derivative of chenodeoxycholic acid, cholic acid was used; for the synthesis of the 9α-hydroxy derivative of lithocholic acid, deoxycholic acid was used. The principal reactions involved were (1) decarbonylation of conjugated 12-oxo-Δ(9(11))-derivatives using in situ generated monochloroalane (AlH2Cl) prepared from LiAlH4 and AlCl3, (2) epoxidation of the deoxygenated Δ(9(11))-enes using m-chloroperbenzoic acid catalyzed by 4,4'-thiobis-(6-tert-butyl-3-methylphenol), (3) subsequent Markovnikov 9α-hydroxylation of the Δ(9(11))-enes with AlH2Cl, and (4) selective oxidation of the primary hydroxyl group at C-24 in the resulting 3α,9α,24-triol and 3α,7α,9α,24-tetrol to the corresponding C-24 carboxylic acids using sodium chlorite (NaClO2) in the presence of a catalytic amount of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical (TEMPO) and sodium hypochlorite (NaOCl). The (1)H- and (13)C-NMR spectra are reported. The 3α,7α,9α-trihydroxy-5β-cholan-24-oic acid has been reported to be present in the bile of the Asian bear, and its 7-deoxy derivative is likely to be a bacterial metabolite. These bile acids are now available as authentic reference standards, permitting their identification in vertebrate bile acids. PMID:27319285

  19. Latency, duration and dose response relationships of amino acid effects on human muscle protein synthesis.

    PubMed

    Rennie, Michael J; Bohé, Julien; Wolfe, Robert R

    2002-10-01

    The components of the stimulatory effect of food on net deposition of protein are beginning to be identified and separated. One of the most important of these appears to be the effect of amino acids per se in stimulating muscle anabolism. Amino acids appear to have a linear stimulatory effect within the range of normal diurnal plasma concentrations from postabsorptive to postprandial. Within this range, muscle protein synthesis (measured by incorporation of stable isotope tracers of amino acids into biopsied muscle protein) appears to be stimulated approximately twofold; however, little further increase occurs when very high concentrations of amino acids (>2.5 times the normal postabsorptive plasma concentration) are made available. Amino acids provided in surfeit of the ability of the system to synthesize protein are disposed of by oxidation, ureagenesis and gluconeogenesis. The stimulatory effect of amino acids appears to be time dependent; a square wave increase in the availability of amino acids causes muscle protein synthesis to be stimulated and to fall back to basal values, despite continued amino acid availability. The relationship between muscle protein synthesis and insulin availability suggests that most of the stimulatory effects occur at low insulin concentrations, with large increases having no effect. These findings may have implications for our understanding of the body's requirements for protein. The maximal capacity for storage of amino acids as muscle protein probably sets an upper value on the extent to which amino acids can be stored after a single meal. PMID:12368422

  20. Associations between a fatty acid desaturase gene polymorphism and blood arachidonic acid compositions in Japanese elderly.

    PubMed

    Horiguchi, Sayaka; Nakayama, Kazuhiro; Iwamoto, Sadahiko; Ishijima, Akiko; Minezaki, Takayuki; Baba, Mamiko; Kontai, Yoshiko; Horikawa, Chika; Kawashima, Hiroshi; Shibata, Hiroshi; Kagawa, Yasuo; Kawabata, Terue

    2016-02-01

    We investigated whether the single nucleotide polymorphism rs174547 (T/C) of the fatty acid desaturase-1 gene, FADS1, is associated with changes in erythrocyte membrane and plasma phospholipid (PL) long-chain polyunsaturated fatty acid (LCPUFA) composition in elderly Japanese participants (n=124; 65 years or older; self-feeding and oral intake). The rs174547 C-allele carriers had significantly lower arachidonic acid (ARA; n-6 PUFA) and higher linoleic acid (LA, n-6 PUFA precursor) levels in erythrocyte membrane and plasma PL (15% and 6% ARA reduction, respectively, per C-allele), suggesting a low LA to ARA conversion rate in erythrocyte membrane and plasma PL of C-allele carriers. α-linolenic acid (n-3 PUFA precursor) levels were higher in the plasma PL of C-allele carriers, whereas levels of the n-3 LCPUFAs eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA) were unchanged in erythrocyte membrane and plasma PL. Thus, rs174547 genotypes were significantly associated with different ARA compositions of the blood of elderly Japanese. PMID:26869086

  1. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  2. Functional analysis of a tomato salicylic acid methyl transferase and its role in synthesis of the flavor volatile methyl salicylate.

    PubMed

    Tieman, Denise; Zeigler, Michelle; Schmelz, Eric; Taylor, Mark G; Rushing, Sarah; Jones, Jeffrey B; Klee, Harry J

    2010-04-01

    Methyl salicylate (MeSA) is a volatile plant secondary metabolite that is an important contributor to taste and scent of many fruits and flowers. It is synthesized from salicylic acid (SA), a phytohormone that contributes to plant pathogen defense. MeSA is synthesized by members of a family of O-methyltransferases. In order to elaborate the mechanism of MeSA synthesis in tomato, we screened a set of O-methyltransferases for activity against multiple substrates. An enzyme that specifically catalyzes methylation of SA, SlSAMT, as well as enzymes that act upon jasmonic acid and indole-3-acetic acid were identified. Analyses of transgenic over- and under-producing lines validated the function of SlSAMT in vivo. The SlSAMT gene was mapped to a position near the bottom of chromosome 9. Analysis of MeSA emissions from an introgression population derived from a cross with Solanum pennellii revealed a quantitative trait locus (QTL) linked to higher fruit methyl salicylate emissions. The higher MeSA emissions associate with significantly higher SpSAMT expression, consistent with SAMT gene expression being rate limiting for ripening-associated MeSA emissions. Transgenic plants that constitutively over-produce MeSA exhibited only slightly delayed symptom development following infection with the disease-causing bacterial pathogen, Xanthomonas campestris pv. vesicatoria (Xcv). Unexpectedly, pathogen-challenged leaves accumulated significantly higher levels of SA as well as glycosylated forms of SA and MeSA, indicating a disruption in control of the SA-related metabolite pool. Taken together, the results indicate that SlSAMT is critical for methyl salicylate synthesis and methyl salicylate, in turn, likely has an important role in controlling SA synthesis. PMID:20070566

  3. Effect of Poliovirus on Deoxyribonucleic Acid Synthesis in HeLa Cells

    PubMed Central

    Ackermann, W. W.; Cox, D. C.; Kurtz, H.; Powers, C. D.; Davies, S. J.

    1966-01-01

    Ackermann, W. W. (University of Michigan, Ann Arbor), D. C. Cox, H. Kurtz, C. D. Powers, and S. J. Davies. Effect of poliovirus on deoxyribonucleic acid synthesis in HeLa cells. J. Bacteriol. 91:1943–1952. 1966.—Both poliovirus and arginine stimulated deoxyribonucleic acid (DNA) synthesis in cultures of HeLa cells which were preconditioned by incubation in a medium deficient in arginine. However, the number of cells producing DNA was unaffected. DNA synthesis in such preconditioned cells was 10 to 20% of the maximal value obtained with a full complement of amino acids. Inhibition of DNA synthesis was produced in these cultures either by increasing the multiplicity of exposure above 40 plaque-forming units of virus per cell or by increasing the concentration of the deficient amino acid at the time of virus addition. Inhibition of DNA synthesis resulted from a reduction in the fraction of cells producing DNA. The concentration of arginine required for viral inhibition of DNA synthesis is greater than that for viral multiplication. PMID:4287076

  4. Resistance training suppresses intra-abdominal fatty acid synthesis in ovariectomized rats.

    PubMed

    Stotzer, U S; Rodrigues, M F C; Domingos, M M; Silva, G H G; Duarte, F O; Gatto, C V G; Duarte, A C G O; Shiguemoto, G E; Perez, S E A; Selistre-de-Araujo, H S

    2015-03-01

    Ovarian hormone loss is associated with a shift in fat distribution to intra-abdomin al adipose tissue (intra-AAT) depots and with lipid metabolism disorders, which predisposes individuals to developing insulin resistance. Resistance training (RT) prevents increases in intra-AAT after ovarian hormone loss. However, the molecular mechanisms underlying these changes remain unclear. We investigated the effects of ovariectomy and RT on gene expression related to lipogenesis and fat oxidation in the intra-AAT of ovariectomized rats. Sprague-Dawley rats (n=6/group) were divided into the groups: sham-sedentary, ovariectomized-sedentary, sham-RT and ovariectomized-RT. RT groups performed a 10-week climbing program on a ladder with progressive overload. Intra-AAT was subjected to morphometric and mRNA analysis. Ovariectomized-sedentary group had larger adipocytes and higher expression of peroxisome proliferator-activated receptor-γ (PPAR-γ), sterol regulatory element-binding protein-1c (SREBP-1c), stearoyl-CoA desaturase-1 (SCD-1), acetyl-CoA carboxylase (ACC), hormone-sensitive lipase (HSL) and lower expression of the oxidative carnitinepalmitoyltransferase-I (CPT-1). RT counteracted OVX-induced increases in PPAR-γ and SCD-1 and decreased SREBP-1c. ACC and HSL were downregulated in ovariectomized-RT compared with the ovariectomized-sedentary group. Ovariectomized-RT group had the highest CPT-1 gene expression. Adipocyte size decreased in ovariectomized-RT group. Results suggest that RT reduces intra-AAT adipocyte size in ovariectomized rats by suppressing intra-AAT fatty acid synthesis and enhancing fatty acid β-oxidation. PMID:25415388

  5. Organization of the Escherichia coli K-12 gene cluster responsible for production of the extracellular polysaccharide colanic acid.

    PubMed

    Stevenson, G; Andrianopoulos, K; Hobbs, M; Reeves, P R

    1996-08-01

    Colanic acid (CA) is an extracellular polysaccharide produced by most Escherichia coli strains as well as by other species of the family Enterobacteriaceae. We have determined the sequence of a 23-kb segment of the E. coli K-12 chromosome which includes the cluster of genes necessary for production of CA. The CA cluster comprises 19 genes. Two other sequenced genes (orf1.3 and galF), which are situated between the CA cluster and the O-antigen cluster, were shown to be unnecessary for CA production. The CA cluster includes genes for synthesis of GDP-L-fucose, one of the precursors of CA, and the gene for one of the enzymes in this pathway (GDP-D-mannose 4,6-dehydratase) was identified by biochemical assay. Six of the inferred proteins show sequence similarity to glycosyl transferases, and two others have sequence similarity to acetyl transferases. Another gene (wzx) is predicted to encode a protein with multiple transmembrane segments and may function in export of the CA repeat unit from the cytoplasm into the periplasm in a process analogous to O-unit export. The first three genes of the cluster are predicted to encode an outer membrane lipoprotein, a phosphatase, and an inner membrane protein with an ATP-binding domain. Since homologs of these genes are found in other extracellular polysaccharide gene clusters, they may have a common function, such as export of polysaccharide from the cell. PMID:8759852

  6. Gene cloning and molecular characterization of the Talaromyces thermophilus lipase catalyzed efficient hydrolysis and synthesis of esters.

    PubMed

    Romdhane, Ines Belhaj-Ben; Frikha, Fakher; Maalej-Achouri, Inès; Gargouri, Ali; Belghith, Hafedh

    2012-02-15

    A genomic bank from Talaromyces thermophilus fungus was constructed and screened using a previously isolated fragment lipase gene as probe. From several clones isolated, the nucleotide sequence of the lipase gene (TTL gene) was completed and sequenced. The TTL coding gene consists of an open reading frame (ORF) of 1083bp encoding a protein of 269 Aa with an estimated molecular mass of 30kDa. The TTL belongs to the same gene family as Thermomyces lanuginosus lipase (TLL, Lipolase®), a well known lipase with multiple applications. The promoter sequence of the TTL gene showed the conservation of known consensus sequences PacC, CreA, Hap2-3-4 and the existence of a particular sequence like the binding sites of Oleate Response Element (ORE) and Fatty acids Responsis Element (FARE) which are similar to that already found to be specific of lipolytic genes in Candida and Fusarium, respectively. Northern blot analysis showed that the TTL expression was much higher on wheat bran than on olive oil as sole carbon source. Compared to the Lipolase®, this enzyme was found to be more efficient for the hydrolysis and the synthesis of esters; and its synthetic efficiency even reached 91.6% from Waste Cooking Oil triglycerides. PMID:22178764

  7. Cloning, sequencing and overexpression of the gene for prokaryotic factor EF-P involved in peptide bond synthesis.

    PubMed Central

    Aoki, H; Adams, S L; Chung, D G; Yaguchi, M; Chuang, S E; Ganoza, M C

    1991-01-01

    A soluble protein EF-P (elongation factor P) from Escherichia coli has been purified and shown to stimulate efficient translation and peptide-bond synthesis on native or reconstituted 70S ribosomes in vitro. Based on the partial amino acid sequence of EF-P, 18- and 24-nucleotide DNA probes were synthesized and used to screen lambda phage clones from the Kohara Gene Bank. The entire EF-P gene was detected on lambda clone #650 which contains sequences from the 94 minute region of the E.coli genome. Two DNA fragments, 3.0 and 0.78 kilobases in length encompassing the gene, were isolated and cloned into pUC18 and pUC19. Partially purified extracts from cells transformed with these plasmids overrepresented a protein which co-migrates with EF-P upon SDS polyacrylamide gel electrophoresis, and also exhibited increased EF-P mediated peptide-bond synthetic activity. Based on DNA sequence analysis of this gene, the EF-P protein consists of 187 amino acids with a calculated molecular weight of 20,447. The sequence and chromosomal location of EF-P establishes it as a unique gene product. Images PMID:1956781

  8. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The reaction between epoxidized methyl oleate and the multifunctional carboxylic acid, levulinic acid, is shown to give two products of differing chemical reactivity. A branched alpha-hydroxy ester product which is acid stable, and a ketal product, which shows acid cleavability can be formed. The ...

  9. Inhibition of erythromycin synthesis by disruption of malonyl-coenzyme A decarboxylase gene eryM in Saccharopolyspora erythraea.

    PubMed Central

    Hsieh, Y J; Kolattukudy, P E

    1994-01-01

    Malonyl-coenzyme A (malonyl-CoA) decarboxylase is widely distributed in prokaryotes and eukaryotes. However, the biological function of this enzyme has not been established in any organism. To elucidate the structure and function of this enzyme, the malonyl-CoA decarboxylase gene from Saccharopolyspora erythraea (formerly Streptomyces erythreaus) was cloned and sequenced. This gene would encode a polypeptide of 417 amino acids. The deduced amino acid sequence matched the experimentally determined amino acid sequences of 25 N-terminal residues each of the enzyme and of an internal peptide obtained by proteolysis of the purified enzyme. This decarboxylase showed homology with aminoglycoside N6'-acetyltransferases of Pseudomonas aeruginosa, Serratia marcescens, and Klebsiella pneumoniae. Northern (RNA) blot analysis revealed a single transcript. The transcription initiation site was 220 bp upstream of the start codon. When expressed in Escherichia coli, the S. erythraea malonyl-CoA decarboxylase gene yielded a protein that cross-reacted with antiserum prepared against S. erythraea malonyl-CoA decarboxylase and catalyzed decarboxylation of [3-14C]malonyl-CoA to acetyl-CoA and 14CO2. The S. erythraea malonyl-CoA decarboxylase gene was disrupted by homologous recombination using an integrating vector pWHM3. The gene-disrupted transformant did not produce immunologically cross-reacting 45-kDa decarboxylase, lacked malonyl-CoA decarboxylase activity, and could not produce erythromycin. Exogenous propionate restored the ability to produce erythromycin. These results strongly suggest that the decarboxylase provides propionyl-CoA for erythromycin synthesis probably via decarboxylation of methylmalonyl-CoA derived from succinyl-CoA, and therefore the malonyl-CoA decarboxylase gene is designated eryM. The gene disrupted mutants also did not produce pigments. Images PMID:8300527

  10. Synthesis of multi-functional large pore mesoporous silica nanoparticles as gene carriers

    NASA Astrophysics Data System (ADS)

    Hartono, Sandy B.; Yu, Meihua; Gu, Wenyi; Yang, Jie; Strounina, Ekaterina; Wang, Xiaolin; Qiao, Shizhang; Yu, Chengzhong

    2014-02-01

    The development of functional nanocarriers that can enhance the cellular delivery of a variety of nucleic acid agents is important in many biomedical applications such as siRNA therapy. We report the synthesis of large pore mesoporous silica nanoparticles (LPMSN) loaded with iron oxide and covalently modified by polyethyleneimine (denoted PEI-Fe-LPMSN) as carriers for gene delivery. The LPMSN have a particle size of ˜200 nm and a large pore size of 11 nm. The large pore size is essential for the formation of large iron oxide nanoparticles to increase the magnetic properties and the adsorption capacity of siRNA molecules. The magnetic property facilitates the cellular uptake of nanocarriers under an external magnetic field. PEI is covalently grafted on the silica surface to enhance the nanocarriers’ affinity against siRNA molecules and to improve gene silencing performance. The PEI-Fe-LPMSN delivered siRNA-PLK1 effectively into osteosarcoma cancer cells, leading to cell viability inhibition of 80%, higher compared to the 50% reduction when the same dose of siRNA was delivered by a commercial product, oligofectamine.

  11. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  12. Higher transcription levels in ascorbic acid biosynthetic and recycling genes were associated with higher ascorbic acid accumulation in blueberry.

    PubMed

    Liu, Fenghong; Wang, Lei; Gu, Liang; Zhao, Wei; Su, Hongyan; Cheng, Xianhao

    2015-12-01

    In our preliminary study, the ripe fruits of two highbush blueberry (Vaccinium corymbosum L.) cultivars, cv 'Berkeley' and cv 'Bluecrop', were found to contain different levels of ascorbic acid. However, factors responsible for these differences are still unknown. In the present study, ascorbic acid content in fruits was compared with expression profiles of ascorbic acid biosynthetic and recycling genes between 'Bluecrop' and 'Berkeley' cultivars. The results indicated that the l-galactose pathway was the predominant route of ascorbic acid biosynthesis in blueberry fruits. Moreover, higher expression levels of the ascorbic acid biosynthetic genes GME, GGP, and GLDH, as well as the recycling genes MDHAR and DHAR, were associated with higher ascorbic acid content in 'Bluecrop' compared with 'Berkeley', which indicated that a higher efficiency ascorbic acid biosynthesis and regeneration was likely to be responsible for the higher ascorbic acid accumulation in 'Bluecrop'. PMID:26041210

  13. A gene network engineering platform for lactic acid bacteria

    PubMed Central

    Kong, Wentao; Kapuganti, Venkata S.; Lu, Ting

    2016-01-01

    Recent developments in synthetic biology have positioned lactic acid bacteria (LAB) as a major class of cellular chassis for applications. To achieve the full potential of LAB, one fundamental prerequisite is the capacity for rapid engineering of complex gene networks, such as natural biosynthetic pathways and multicomponent synthetic circuits, into which cellular functions are encoded. Here, we present a synthetic biology platform for rapid construction and optimization of large-scale gene networks in LAB. The platform involves a copy-controlled shuttle for hosting target networks and two associated strategies that enable efficient genetic editing and phenotypic validation. By using a nisin biosynthesis pathway and its variants as examples, we demonstrated multiplex, continuous editing of small DNA parts, such as ribosome-binding sites, as well as efficient manipulation of large building blocks such as genes and operons. To showcase the platform, we applied it to expand the phenotypic diversity of the nisin pathway by quickly generating a library of 63 pathway variants. We further demonstrated its utility by altering the regulatory topology of the nisin pathway for constitutive bacteriocin biosynthesis. This work demonstrates the feasibility of rapid and advanced engineering of gene networks in LAB, fostering their applications in biomedicine and other areas. PMID:26503255

  14. A gene network engineering platform for lactic acid bacteria.

    PubMed

    Kong, Wentao; Kapuganti, Venkata S; Lu, Ting

    2016-02-29

    Recent developments in synthetic biology have positioned lactic acid bacteria (LAB) as a major class of cellular chassis for applications. To achieve the full potential of LAB, one fundamental prerequisite is the capacity for rapid engineering of complex gene networks, such as natural biosynthetic pathways and multicomponent synthetic circuits, into which cellular functions are encoded. Here, we present a synthetic biology platform for rapid construction and optimization of large-scale gene networks in LAB. The platform involves a copy-controlled shuttle for hosting target networks and two associated strategies that enable efficient genetic editing and phenotypic validation. By using a nisin biosynthesis pathway and its variants as examples, we demonstrated multiplex, continuous editing of small DNA parts, such as ribosome-binding sites, as well as efficient manipulation of large building blocks such as genes and operons. To showcase the platform, we applied it to expand the phenotypic diversity of the nisin pathway by quickly generating a library of 63 pathway variants. We further demonstrated its utility by altering the regulatory topology of the nisin pathway for constitutive bacteriocin biosynthesis. This work demonstrates the feasibility of rapid and advanced engineering of gene networks in LAB, fostering their applications in biomedicine and other areas. PMID:26503255

  15. Abscisic acid enhances tolerance of wheat seedlings to drought and regulates transcript levels of genes encoding ascorbate-glutathione biosynthesis.

    PubMed

    Wei, Liting; Wang, Lina; Yang, Yang; Wang, Pengfei; Guo, Tiancai; Kang, Guozhang

    2015-01-01

    Glutathione (GSH) and ascorbate (ASA) are associated with the abscisic acid (ABA)-induced abiotic tolerance in higher plant, however, its molecular mechanism remains obscure. In this study, exogenous application (10 μM) of ABA significantly increased the tolerance of seedlings of common wheat (Triticum aestivum L.) suffering from 5 days of 15% polyethylene glycol (PEG)-stimulated drought stress, as demonstrated by increased shoot lengths and shoot and root dry weights, while showing decreased content of hydrogen peroxide (H2O2) and malondialdehyde (MDA). Under drought stress conditions, ABA markedly increased content of GSH and ASA in both leaves and roots of ABA-treated plants. Temporal and spatial expression patterns of eight genes encoding ASA and GSH synthesis-related enzymes were measured using quantitative real-time reverse transcription polymerase chain reaction (qPCR). The results showed that ABA temporally regulated the transcript levels of genes encoding ASA-GSH cycle enzymes. Moreover, these genes exhibited differential expression patterns between the root and leaf organs of ABA-treated wheat seedlings during drought stress. These results implied that exogenous ABA increased the levels of GSH and ASA in drought-stressed wheat seedlings in time- and organ-specific manners. Moreover, the transcriptional profiles of ASA-GSH synthesis-related enzyme genes in the leaf tissue were compared between ABA- and salicylic acid (SA)-treated wheat seedlings under PEG-stimulated drought stress, suggesting that they increased the content of ASA and GSH by differentially regulating expression levels of ASA-GSH synthesis enzyme genes. Our results increase our understanding of the molecular mechanism of ABA-induced drought tolerance in higher plants. PMID:26175737

  16. Abscisic acid enhances tolerance of wheat seedlings to drought and regulates transcript levels of genes encoding ascorbate-glutathione biosynthesis

    PubMed Central

    Wei, Liting; Wang, Lina; Yang, Yang; Wang, Pengfei; Guo, Tiancai; Kang, Guozhang

    2015-01-01

    Glutathione (GSH) and ascorbate (ASA) are associated with the abscisic acid (ABA)-induced abiotic tolerance in higher plant, however, its molecular mechanism remains obscure. In this study, exogenous application (10 μM) of ABA significantly increased the tolerance of seedlings of common wheat (Triticum aestivum L.) suffering from 5 days of 15% polyethylene glycol (PEG)-stimulated drought stress, as demonstrated by increased shoot lengths and shoot and root dry weights, while showing decreased content of hydrogen peroxide (H2O2) and malondialdehyde (MDA). Under drought stress conditions, ABA markedly increased content of GSH and ASA in both leaves and roots of ABA-treated plants. Temporal and spatial expression patterns of eight genes encoding ASA and GSH synthesis-related enzymes were measured using quantitative real-time reverse transcription polymerase chain reaction (qPCR). The results showed that ABA temporally regulated the transcript levels of genes encoding ASA-GSH cycle enzymes. Moreover, these genes exhibited differential expression patterns between the root and leaf organs of ABA-treated wheat seedlings during drought stress. These results implied that exogenous ABA increased the levels of GSH and ASA in drought-stressed wheat seedlings in time- and organ-specific manners. Moreover, the transcriptional profiles of ASA-GSH synthesis-related enzyme genes in the leaf tissue were compared between ABA- and salicylic acid (SA)-treated wheat seedlings under PEG-stimulated drought stress, suggesting that they increased the content of ASA and GSH by differentially regulating expression levels of ASA-GSH synthesis enzyme genes. Our results increase our understanding of the molecular mechanism of ABA-induced drought tolerance in higher plants. PMID:26175737

  17. Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon activator.

    PubMed Central

    James, D W; Lim, E; Keller, J; Plooy, I; Ralston, E; Dooner, H K

    1995-01-01

    The FATTY ACID ELONGATION1 (FAE1) gene of Arabidopsis is required for the synthesis of very long chain fatty acids in the seed. The product of the FAE1 gene is presumed to be a condensing enzyme that extends the chain length of fatty acids from C18 to C20 and C22. We report here the cloning of FAE1 by directed transposon tagging with the maize element Activator (Ac). An unstable fae1 mutant was isolated in a line carrying Ac linked to the FAE1 locus on chromosome 4. Cosegregation and reversion analyses established that the new mutant was tagged by Ac. A DNA fragment flanking Ac was cloned by inverse polymerase chain reaction and used to isolate FAE1 genomic clones and a cDNA clone from a library made from immature siliques. The predicted amino acid sequence of the FAE1 protein shares homology with those of other condensing enzymes (chalcone synthase, stilbene synthases, and beta-ketoacyl-acyl carrier protein synthase III), supporting the notion that FAE1 is the structural gene for a synthase or condensing enzyme. FAE1 is expressed in developing seed, but not in leaves, as expected from the effect of the fae1 mutation on the fatty acid compositions of those tissues. PMID:7734965

  18. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  19. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  20. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  1. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.

    2008-01-01

    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  2. T-box binding protein type two (TBX2) is an immediate early gene target in retinoic-acid-treated B16 murine melanoma cells.

    PubMed

    Boskovic, Goran; Niles, Richard M

    2004-05-01

    Retinoic acid induces growth arrest and differentiation in B16 mouse melanoma cells. Using gene arrays, we identified several early response genes whose expression is altered by retinoic acid. One of the genes, tbx2, is a member of T-box nuclear binding proteins that are important morphogens in developing embryos. Increased TBX2 mRNA is seen within 2 h after addition of retinoic acid to B16 cells. The effect of retinoic acid on gene expression is direct since it does not require any new protein synthesis. We identified a degenerate retinoic acid response element (RARE) between -186 and -163 in the promoter region of the tbx2 gene. A synthetic oligonucleotide spanning this region was able to drive increased expression of a luciferase reporter gene in response to retinoic acid; however, this induction was lost when a point mutation was introduced into the RARE. This oligonucleotide also specifically bound RAR in nuclear extracts from B16 cells. TBX2 expression and its induction by retinoic acid was also observed in normal human and nonmalignant mouse melanocytes. PMID:15093729

  3. Identification of Cell Wall Synthesis Regulatory Genes Controlling Biomass Characteristics and Yield in Rice (Oryza Sativa)

    SciTech Connect

    Peng, Zhaohua PEng; Ronald, Palmela; Wang, Guo-Liang

    2013-04-26

    This project aims to identify the regulatory genes of rice cell wall synthesis pathways using a cell wall removal and regeneration system. We completed the gene expression profiling studies following the time course from cell wall removal to cell wall regeneration in rice suspension cells. We also completed, total proteome, nuclear subproteome and histone modification studies following the course from cell wall removal and cell wall regeneration process. A large number of differentially expressed regulatory genes and proteins were identified. Meanwhile, we generated RNAi and over-expression transgenic rice for 45 genes with at least 10 independent transgenic lines for each gene. In addition, we ordered T-DNA and transposon insertion mutants for 60 genes from Korea, Japan, and France and characterized the mutants. Overall, we have mutants and transgenic lines for over 90 genes, exceeded our proposed goal of generating mutants for 50 genes. Interesting Discoveries a) Cell wall re-synthesis in protoplasts may involve a novel cell wall synthesis mechanism. The synthesis of the primary cell wall is initiated in late cytokinesis with further modification during cell expansion. Phragmoplast plays an essential role in cell wall synthesis. It services as a scaffold for building the cell plate and formation of a new cell wall. Only one phragmoplast and one new cell wall is produced for each dividing cell. When the cell wall was removed enzymatically, we found that cell wall re-synthesis started from multiple locations simultaneously, suggesting that a novel mechanism is involved in cell wall re-synthesis. This observation raised many interesting questions, such as how the starting sites of cell wall synthesis are determined, whether phragmoplast and cell plate like structures are involved in cell wall re-synthesis, and more importantly whether the same set of enzymes and apparatus are used in cell wall re-synthesis as during cytokinesis. Given that many known cell wall

  4. Cell Division During Inhibition of Deoxyribonucleic Acid Synthesis in Escherichia coli

    PubMed Central

    Helmstetter, Charles E.; Pierucci, Olga

    1968-01-01

    When cultures of Escherichia coli B/r growing at various rates were exposed to ultraviolet light, mitomycin C, or nalidixic acid, deoxyribonucleic acid (DNA) synthesis stopped but cell division continued for at least 20 min. The chromosome configurations in the cells which divided were estimated by determining the rate of DNA synthesis during the division cycle. The cultures were pulse-labeled with 14C-thymidine, and the amount of label incorporated into cells of different ages was found by measuring the radioactivity in cells born subsequent to the labeling period. The cells which divided in the absence of DNA synthesis were those which had completed a round of chromosome replication prior to the treatments. It was concluded that completion of a round of replication is a necessary and sufficient condition of DNA synthesis for cell division. PMID:4870278

  5. Associations between variants of FADS genes and omega-3 and omega-6 milk fatty acids of Canadian Holstein cows

    PubMed Central

    2014-01-01

    Background Fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes code respectively for the enzymes delta-5 and delta-6 desaturases which are rate limiting enzymes in the synthesis of polyunsaturated omega-3 and omega-6 fatty acids (FAs). Omega-3 and-6 FAs as well as conjugated linoleic acid (CLA) are present in bovine milk and have demonstrated positive health effects in humans. Studies in humans have shown significant relationships between genetic variants in FADS1 and 2 genes with plasma and tissue concentrations of omega-3 and-6 FAs. The aim of this study was to evaluate the extent of sequence variations within these two genes in Canadian Holstein cows as well as the association between sequence variants and health promoting FAs in milk. Results Thirty three SNPs were detected within the studied regions of genes including a synonymous mutation (FADS1-07, rs42187261, 306Tyr > Tyr) in exon 8 of FADS1, a non-synonymous mutation (FADS2-14, rs211580559, 294Ala > Val) within FADS2 exon 7, a splice site SNP (FADS2-05, rs211263660), a 3′UTR SNP (FADS2-23, rs109772589), and another 3′UTR SNP with an effect on a microRNA binding site within FADS2 gene (FADS2-19, rs210169303). Association analyses showed significant relations between three out of seven tested SNPs and several FAs. Significant associations (FDR P < 0.05) were recorded between FADS2-23 (rs109772589) and two omega-6 FAs (dihomogamma linolenic acid [C20:3n6] and arachidonic acid [C20:4n6]), FADS1-07 (rs42187261) and one omega-3 FA (eicosapentaenoic acid, C20:5n3) and tricosanoic acid (C23:0), and one intronic SNP, FADS1-01 (rs136261927) and C20:3n6. Conclusion Our study has demonstrated positive associations between three SNPs within FADS1 and FADS2 genes (a SNP within the 3’UTR, a synonymous SNP and an intronic SNP), with three milk PUFAs of Canadian Holstein cows thus suggesting possible involvement of synonymous and non-coding region variants in FA synthesis. These SNPs may serve as

  6. Clustered Genes Involved in Cyclopiazonic Acid Production are Next to the Aflatoxin Biosynthesis Gene Cluster in Aspergillus flavus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cyclopiazonic acid (CPA), an indole-tetramic acid toxin, is produced by many species of Aspergillus and Penicillium. In addition to CPA Aspergillus flavus produces polyketide-derived carcinogenic aflatoxins (AFs). AF biosynthesis genes form a gene cluster in a subtelomeric region. Isolates of A. fla...

  7. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  8. Synthesis and proteinase inhibitory properties of diphenyl phosphonate analogues of aspartic and glutamic acids.

    PubMed

    Hamilton, R; Walker, B; Walker, B J

    1998-07-01

    The synthesis of diphenyl phosphonate analogues of aspartic and glutamic acid, and their inhibitory activity against S. aureus V8 protease and granzyme B, is described. The study has revealed difficulties with protecting group compatibility in the synthesis of these analogues. Two analogues, Acetyl. AspP (OPh)2 and Acetyl.GluP (OPh)2 were found to function as irreversible inactivators of V8 proteinase, yet exhibit no activity against granzyme B. PMID:9873408

  9. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.

    PubMed

    Klisch, M; Häder, D-P

    2002-02-01

    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption. PMID:11849984

  10. Mechanism of Shope Fibroma Virus-Induced Suppression of Host Deoxyribonucleic Acid Synthesis

    PubMed Central

    Chan, James C.; Hodes, M. E.

    1973-01-01

    The effects of treatment with live or inactivated Shope fibroma virus on host cell deoxyribonucleic acid (DNA) synthesis were determined. The incorporation of 3H-thymidine into nuclear DNA was suppressed by both active and inactivated virus, although live virus was more effective. During the early phase of infection, stimulation of host nuclear DNA synthesis of up to 240% of control value was observed in cells infected with active virus. Inhibition of DNA synthesis began at about the 8th h and was maximal by 12 h postinfection. Virus inactivated by ultraviolet-irradiation or heat treatment did not induce viral DNA synthesis but was, nevertheless, able to suppress host DNA synthesis. PMID:4202660

  11. Conversion of 5-formyltetrahydrofolic acid to 5-methyltetrahydrofolic acid is unimpaired in folate-adequate persons homozygous for the C677T mutation in the methylenetetrahydrofolate reductase gene.

    PubMed

    Stern, L L; Bagley, P J; Rosenberg, I H; Selhub, J

    2000-09-01

    Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolic acid (5-CH(3)-H(4) folic acid), the methyl donor for the formation of methionine from homocysteine. A common C677T transition in the MTHFR gene results in a variant with a lower specific activity and a greater sensitivity to heat than the normal enzyme, as measured in vitro. This study was undertaken to determine the capacity of homozygotes for the MTHFR C677T transition to convert 5-formyltetrahydrofolic acid (5-HCO-H(4) folic acid) to 5-CH(3)-H(4) folic acid, a process that requires the action of MTHFR. Six subjects homozygous for the C677T transition (T/T) and 6 subjects with wild-type MTHFR (C/C) were given a 5-mg oral dose of (6R:,S:)-5-HCO-H(4) folic acid. Plasma and urine were analyzed for 5-CH(3)-H(4) folic acid concentrations using affinity/HPLC coupled with fluorescence or UV detection. The mean areas under the curves created by the rise and fall of plasma 5-CH(3)-H(4) folic acid after the oral dose did not differ between the two genotypes, 424.5 +/- 140.3 (T/T) vs. 424.1+/- 202.4 h.nmol/L (C/C). There also was no significant difference in the mean cumulative 7-h urinary excretion of 5-CH(3)-H(4) folic acid between the T/T (2.5 +/- 1.4 micromol) and C/C (1.9 +/- 1.0 micromol) genotypes. Under the conditions employed, the conversion of oral 5-HCO-H(4) folic acid to 5-CH(3)-H(4) folic acid is not impaired in persons with the T/T MTHFR genotype. Possible reasons for these findings are discussed. PMID:10958818

  12. Whole body synthesis rates of DHA from α-linolenic acid are greater than brain DHA accretion and uptake rates in adult rats[S

    PubMed Central

    Domenichiello, Anthony F.; Chen, Chuck T.; Trepanier, Marc-Olivier; Stavro, P. Mark; Bazinet, Richard P.

    2014-01-01

    Docosahexaenoic acid (DHA) is important for brain function, however, the exact amount required for the brain is not agreed upon. While it is believed that the synthesis rate of DHA from α-linolenic acid (ALA) is low, how this synthesis rate compares with the amount of DHA required to maintain brain DHA levels is unknown. The objective of this work was to assess whether DHA synthesis from ALA is sufficient for the brain. To test this, rats consumed a diet low in n-3 PUFAs, or a diet containing ALA or DHA for 15 weeks. Over the 15 weeks, whole body and brain DHA accretion was measured, while at the end of the study, whole body DHA synthesis rates, brain gene expression, and DHA uptake rates were measured. Despite large differences in body DHA accretion, there was no difference in brain DHA accretion between rats fed ALA and DHA. In rats fed ALA, DHA synthesis and accretion was 100-fold higher than brain DHA accretion of rats fed DHA. Also, ALA-fed rats synthesized approximately 3-fold more DHA than the DHA uptake rate into the brain. This work indicates that DHA synthesis from ALA may be sufficient to supply the brain. PMID:24212299

  13. Mutations in a delta9-Stearoyl-ACP-Desaturase Gene Are Associated with Enhanced Stearic Acid Levels in Soybean Seeds

    SciTech Connect

    Zhang, P.; Shanklin, J.; Burton, J. W.; Upchurch, R. G.; Whittle, E.; Dewey, R. E.

    2008-11-01

    Stearic acid (18:0) is typically a minor component of soybean [Glycine max (L.) Merr.] oil, accounting for only 2 to 4% of the total fatty acid content. Increasing stearic acid levels of soybean oil would lead to enhanced oxidative stability, potentially reducing the need for hydrogenation, a process leading to the formation of undesirable trans fatty acids. Although mutagenesis strategies have been successful in developing soybean germplasm with elevated 18:0 levels in the seed oil, the specific gene mutations responsible for this phenotype were not known. We report a newly identified soybean gene, designated SACPD-C, that encodes a unique isoform of {Delta}{sup 9}-stearoyl-ACP-desaturase, the enzyme responsible for converting stearic acid to oleic acid (18:1). High levels of SACPD-C transcript were only detected in developing seed tissue, suggesting that the encoded desaturase functions to enhance oleic acid biosynthetic capacity as the immature seed is actively engaged in triacylglycerol production and storage. The participation of SACPD-C in storage triacylglycerol synthesis is further supported by the observation of mutations in this gene in two independent sources of elevated 18:0 soybean germplasm, A6 (30% 18:0) and FAM94-41 (9% 18:0). A molecular marker diagnostic for the FAM94-41 SACPD-C gene mutation strictly associates with the elevated 18:0 phenotype in a segregating population, and could thus serve as a useful tool in the development of cultivars with oils possessing enhanced oxidative stability.

  14. The Riia Gene of Bacteriophage T4. II. Regulation of Its Messenger RNA Synthesis

    PubMed Central

    Daegelen, P.; Brody, E.

    1990-01-01

    When the rII genes are first introduced into cells which had been previously infected by T4 phage deleted for these genes, the kinetics of synthesis of rIIA and rIIB RNA are rapid and identical. We show that this rapid synthesis depends on a functional motA gene for rIIB, but not for rIIA, RNA synthesis. By primer-extension mapping of T4 messenger RNA, we find three promoters close to the rIIA gene. One of them is an early promoter just before the rIIA.1 gene; it is used under all conditions tested. Another is in the coding portion of the rIIA.1 gene; it is weak, primarily because of a 19-bp spacing between the -10 and -35 elements, and its use is stimulated by T4 functions. The third is a motA-dependent (middle) promoter which has an unusual CCCGCTT box at -33. We present results which suggest that none of these promoters is likely to be the site at which the motB and motC gene products exercise their major influence on rIIA RNA synthesis. PMID:2379818

  15. The expression of genes involved in jejunal lipogenesis and lipoprotein synthesis is altered in morbidly obese subjects with insulin resistance.

    PubMed

    Gutierrez-Repiso, Carolina; Rodriguez-Pacheco, Francisca; Garcia-Arnes, Juan; Valdes, Sergio; Gonzalo, Montserrat; Soriguer, Federico; Moreno-Ruiz, Francisco J; Rodriguez-Cañete, Alberto; Gallego-Perales, Jose L; Alcain-Martinez, Guillermo; Vazquez-Pedreño, Luis; Lopez-Enriquez, Soledad; Garcia-Serrano, Sara; Garrido-Sanchez, Lourdes; Garcia-Fuentes, Eduardo

    2015-12-01

    The dyslipidemia associated with type 2 diabetes mellitus (T2DM) is an important risk factor for atherosclerotic cardiovascular disease. However, until now little attention has been paid to the role that the intestine might have. The aim of this research was to determine the relation between insulin resistance and intestinal de novo lipogenesis/lipoprotein synthesis in morbidly obese subjects and to study the effect of insulin on these processes. Jejunal mRNA expression of the different genes involved in the intestinal de novo lipogenesis/lipoprotein synthesis was analyzed in three groups of morbidly obese subjects: Group 1 with low insulin resistance (MO-low-IR), group 2 with high insulin resistance (MO-high-IR), and group 3 with T2DM and treatment with metformin (MO-metf-T2DM). In addition, intestinal epithelial cells (IECs) from MO-low-IR were incubated with different doses of insulin/glucose. In Group 2 (MO-high-IR), the jejunal mRNA expression levels of apo A-IV, ATP-citrate lyase (ACLY), pyruvate dehydrogenase (lipoamide) beta (PDHB), and sterol regulatory element-binding protein-1c (SREBP-1c) were significantly higher and acetyl-CoA carboxylase alpha (ACC1) and fatty-acid synthase lower than in Group 1 (MO-low-IR). In Group 3 (MO-metf-T2DM), only the ACLY and PDHB mRNA expressions were significantly higher than in Group 1 (MO-low-IR). The mRNA expression of most of the genes studied was significantly linked to insulin and glucose levels. The incubation of IEC with different doses of insulin and glucose produced a higher expression of diacylglycerol acyltransferase 2, microsomal triglyceride transfer protein, apo A-IV, SREBP-1c, and ACC1 when both, glucose and insulin, were at a high concentration. However, with only high insulin levels, there were higher apo A-IV, PDHB and SREBP-1c expressions, and a lower ACLY expression. In conclusion, the jejunum of MO-high-IR has a decreased mRNA expression of genes involved in de novo fatty-acid synthesis and an

  16. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )

    1989-12-01

    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  17. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  18. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.

    PubMed

    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György

    2016-01-01

    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  19. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  20. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  1. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  2. [Gene cloning and bioinformatics analysis of new gene for chlorogenic acid biosynthesis of Lonicera hypoglauca].

    PubMed

    Yu, Shu-lin; Huang, Lu-qi; Yuan, Yuan; Qi, Lin-jie; Liu, Da-hui

    2015-03-01

    To obtain the key genes for chlorogenic acid biosynthesis of Lonicera hypoglauca, four new genes ware obtained from the our dataset of L. hypoglauca. And we also predicted the structure and function of LHPAL4, LHHCT1 , LHHCT2 and LHHCT3 proteins. The phylogenetic tree showed that LHPAL4 was closely related with LHPAL1, LHHCT1 was closely related with LHHCT3, LHHCT2 clustered into a single group. By Real-time PCR to detect the gene expressed level in different organs of L. hypoglauca, we found that the transcripted level of LHPAL4, LHHCT1 and LHHCT3 was the highest in defeat flowers, and the transcripted level of LHHCT2 was the highest in leaves. These result provided a basis to further analysis the mechanism of active ingredients in different organs, as well as the element for in vitro biosynthesis of active ingredients. PMID:26087546

  3. Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...

  4. PREECLAMPSIA IS ASSOCIATED WITH COMPROMISED MATERNAL SYNTHESIS OF LONG CHAIN POLYUNSATURATED FATTY ACIDS LEADING TO OFFSPRING DEFICIENCY

    PubMed Central

    Mackay, Vanessa A; Huda, Shahzya S; Stewart, Frances M; Tham, Kahmeng; McKenna, Louise A; Martin, Iain; Jordan, Fiona; Brown, E Ann; Hodson, Leanne; Greer, Ian A; Meyer, Barbara J; Freeman, Dilys J

    2013-01-01

    Obesity and excessive lipolysis are implicated in preeclampsia. Intrauterine growth restriction is associated with low maternal body mass index and decreased lipolysis. Our aim was to assess how maternal and offspring fatty acid metabolism is altered in mothers in the third trimester of pregnancy with preeclampsia (n=62) or intrauterine growth restriction (n=23) compared to healthy pregnancies (n=164). Markers of lipid metabolism and erythrocyte fatty acid concentrations were measured. Maternal adipose tissue fatty acid composition and mRNA expression of adipose tissue fatty acid metabolizing enzymes and placental fatty acid transporters were compared. Mothers with preeclampsia had higher plasma triglyceride (21%, p<0.001) and non-esterified fatty acid (50%, p<0.001) concentrations than Controls. Concentrations of major n-6 and n-3 long chain polyunsaturated fatty acids in erythrocytes were 23-60% lower (all p<0.005) in preeclampsia and intrauterine growth restriction mothers and offspring compared to Controls. Subcutaneous adipose tissue Δ-5 and Δ-6 desaturase and very long chain fatty acid elongase mRNA expression was lower in preeclampsia than Controls [Control 3.38(2.96) vs preeclampsia 1.83(1.91), p=0.030; 3.33(2.25) vs 1.03(0.96), p<0.001; 0.40 (0.81) vs 0.00 (0.00), p=0.038 (square root) expression relative to control gene respectively]. Low maternal and fetal long chain polyunsaturated fatty acid concentrations in preeclampsia may be the result of decreased maternal synthesis. PMID:22949531

  5. The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry ▿

    PubMed Central

    Keller, Ullrich; Lang, Manuel; Crnovcic, Ivana; Pfennig, Frank; Schauwecker, Florian

    2010-01-01

    A gene cluster was identified which contains genes involved in the biosynthesis of actinomycin encompassing 50 kb of contiguous DNA on the chromosome of Streptomyces chrysomallus. It contains 28 genes with biosynthetic functions and is bordered on both sides by IS elements. Unprecedentedly, the cluster consists of two large inverted repeats of 11 and 13 genes, respectively, with four nonribosomal peptide synthetase genes in the middle. Nine genes in each repeat have counterparts in the other, in the same arrangement but in the opposite orientation, suggesting an inverse duplication of one of the arms during the evolution of the gene cluster. All of the genes appear to be organized into operons, each corresponding to a functional section of actinomycin biosynthesis, such as peptide assembly, regulation, resistance, and biosynthesis of the precursor of the actinomycin chromophore 4-methyl-3-hydroxyanthranilic acid (4-MHA). For 4-MHA synthesis, functional analysis revealed genes that encode pathway-specific isoforms of tryptophan dioxygenase, kynurenine formamidase, and hydroxykynureninase, which are distinct from the corresponding enzyme activities of cellular tryptophan catabolism in their regulation and in part in their substrate specificity. Phylogenetic analysis indicates that the pathway-specific tryptophan metabolism in Streptomyces most probably evolved divergently from the normal pathway of tryptophan catabolism to provide an extra or independent supply of building blocks for the synthesis of tryptophan-derived secondary metabolites. PMID:20304989

  6. Modulation of medium-chain fatty acid synthesis in Synechococcus sp. PCC 7002 by replacing FabH with a Chaetoceros Ketoacyl-ACP synthase

    DOE PAGESBeta

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-05-26

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less

  7. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase

    PubMed Central

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  8. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase.

    PubMed

    Gu, Huiya; Jinkerson, Robert E; Davies, Fiona K; Sisson, Lyle A; Schneider, Philip E; Posewitz, Matthew C

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  9. The prebiotic synthesis of amino acids - interstellar vs. atmospheric mechanisms

    NASA Astrophysics Data System (ADS)

    Meierhenrich, U. J.; Muñoz Caro, G. M.; Schutte, W. A.; Barbier, B.; Arcones Segovia, A.; Rosenbauer, H.; Thiemann, W. H.-P.; Brack, A.

    2002-11-01

    Until very recently, prebiotic amino acids were believed to have been generated in the atmosphere of the early Earth, as successfully simulated by the Urey-Miller experiments. Two independent studies now identified ice photochemistry in the interstellar medium as a possible source of prebiotic amino acids. Ultraviolet irradiation of ice mixtures containing identified interstellar molecules (such as H2O, CO2, CO, CH3OH, and NH3) in the conditions of vacuum and low temperature found in the interstellar medium generated amino acid structures including glycine, alanine, serine, valine, proline, and aspartic acid. After warmup, hydrolysis and derivatization, our team was able to identify 16 amino acids as well as furans and pyrroles. Enantioselective analyses of the amino acids showed racemic mixtures. A prebiotic interstellar origin of amino acid structures is now discussed to be a plausible alternative to the Urey-Miller mechanism.

  10. Synthesis of new optically active propargylic fluorides and application to the enantioselective synthesis of monofluorinated analogues of fatty acid metabolites.

    PubMed

    Prakesch, M; Grée, D; Grée, R

    2001-05-01

    A new approach to obtain optically active unsaturated or polyunsaturated systems with a single fluorine atom in an allylic or propargylic position is reported. Central to this strategy is the high regio- and stereocontrol observed during the fluorination of propargylic alcohols allowing a short and efficient synthesis of 1. Further, simple functional group transformations gave the enals 2 and 3. These three key intermediates were used for the preparation of optically active monofluorinated analogues of fatty acid metabolites. PMID:11325281

  11. Putting Synthesis into Biology – A Viral View of Genetic Engineering Through de novo Gene and Genome synthesis

    PubMed Central

    Mueller, Steffen; Coleman, J. Robert; Wimmer, Eckard

    2009-01-01

    The rapid improvements in DNA synthesis technology hold the potential to revolutionize biosciences in the near future. Traditional genetic engineering methods are template dependent and make extensive but laborious use of site-directed mutagenesis to explore the impact of small variations on an existing sequence “theme”. De novo gene and genome synthesis frees the investigator from the restrictions of the pre-existing template and allows for the rational design of any conceivable new sequence theme. Viruses, being amongst the simplest replicating entities, have been at the forefront of the advancing biosciences since the dawn of molecular biology. Viral genomes, especially those of RNA viruses, are relatively short, often less than 10,000 bases long, making them amenable to whole genome synthesis with the currently available technology. For this reason viruses are once again poised to lead the way in the budding field of synthetic biology – for better or worse. PMID:19318214

  12. Identification and expression of a stearoyl-ACP desaturase gene responsible for oleic acid accumulation in Xanthoceras sorbifolia seeds.

    PubMed

    Zhao, Na; Zhang, Yuan; Li, Qiuqi; Li, Rufang; Xia, Xinli; Qin, Xiaowei; Guo, Huihong

    2015-02-01

    Xanthoceras sorbifolia Bunge is an oilseed tree that grows well on barren lands in dry climate. Its seeds contain a large amount of oil rich in oleic acid (18:1(Δ9)) and linoleic acid (18:2(Δ9, 12)). However, the molecular regulation of oil biosynthesis in X. sorbifolia seeds is poorly understood. Stearoyl-ACP desaturase (SAD, EC 1.14.99.6) is a plastid-localized soluble desaturase that catalyzes the conversion of stearic acid (18:0) to oleic acid, which plays a key role in determining the ratio of saturated to unsaturated fatty acids. In this study, a full-length cDNA of XsSAD was isolated from developing X. sorbifolia embryos. The XsSAD open reading frame had 1194-bp, encoding a polypeptide of 397 amino acids. XsSAD expression in Escherichia coli cells resulted in increased 18:1(Δ9) level, confirming the biological activity of the enzyme encoded by XsSAD. XsSAD expression in Arabidopsis ssi2 mutants partially restored the morphological phenotype and effectively increased the 18:1(Δ9) level. The levels of other unsaturated fatty acids synthesized with 18:1(Δ9) as the substrate also increased to some degree. XsSAD in X. sorbifolia had a much higher expression in embryos than in leaves and petals. XsSAD expression also correlated well with the oleic acid, unsaturated fatty acid, and total fatty acid levels in developing embryos. These data suggested that XsSAD determined the synthesis of oleic acid and contributed to the accumulation of unsaturated fatty acid and total oil in X. sorbifolia seeds. A preliminary tobacco rattle virus-based virus-induced gene silencing system established in X. sorbifolia can also be helpful for further analyzing the functions of XsSAD and other oil synthesis-related genes in woody plants. PMID:25528221

  13. Interrelated effects of dihomo-γ-linolenic and arachidonic acids, and sesamin on hepatic fatty acid synthesis and oxidation in rats.

    PubMed

    Ide, Takashi; Ono, Yoshiko; Kawashima, Hiroshi; Kiso, Yoshinobu

    2012-12-14

    Interrelated effects of dihomo-γ-linolenic acid (DGLA) and arachidonic acid (ARA), and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined in rats. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin), containing 100 g/kg of maize oil or fungal oil rich in DGLA or ARA for 16 d. Among the groups fed sesamin-free diets, oils rich in DGLA or ARA, especially the latter, compared with maize oil strongly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin, irrespective of the type of fat, reduced the parameters of lipogenic enzymes except for malic enzyme. The type of dietary fat was rather irrelevant in affecting hepatic fatty acid oxidation among rats fed the sesamin-free diets. Sesamin increased the activities of enzymes involved in fatty acid oxidation in all groups of rats given different fats. The extent of the increase depended on the dietary fat type, and the values became much higher with a diet containing sesamin and oil rich in ARA in combination than with a diet containing lignan and maize oil. Analyses of mRNA levels revealed that the combination of sesamin and oil rich in ARA compared with the combination of lignan and maize oil markedly increased the gene expression of various peroxisomal fatty acid oxidation enzymes but not mitochondrial enzymes. The enhancement of sesamin action on hepatic fatty acid oxidation was also confirmed with oil rich in DGLA but to a lesser extent. PMID:22370182

  14. Synthesis and antimycobacterial evaluation of new trans-cinnamic acid hydrazide derivatives.

    PubMed

    Carvalho, Samir A; da Silva, Edson F; de Souza, Marcus V N; Lourenço, Maria C S; Vicente, Felipe R

    2008-01-15

    In this work, we report the synthesis and the antimycobacterial evaluation of new trans-cinnamic acid derivatives of isonicotinic acid series (5) and benzoic acid series (6), designed by exploring the molecular hybridization approach between isoniazid (1) and trans-cinnamic acid derivative (3). The minimum inhibitory concentration (MIC) of the compounds 5a-d and 6c exhibited activity between 3.12 and 12.5 microg/mL and could be a good start point to find new lead compounds against multi-drug resistant tuberculosis. PMID:18068364

  15. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  16. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

  17. Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

  18. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  19. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  20. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials. PMID:27482849

  1. Enhanced production of shikimic acid using a multi-gene co-expression system in Escherichia coli.

    PubMed

    Liu, Xiang-Lei; Lin, Jun; Hu, Hai-Feng; Zhou, Bin; Zhu, Bao-Quan

    2016-04-01

    Shikimic acid (SA) is the key synthetic material for the chemical synthesis of Oseltamivir, which is prescribed as the front-line treatment for serious cases of influenza. Multi-gene expression vector can be used for expressing the plurality of the genes in one plasmid, so it is widely applied to increase the yield of metabolites. In the present study, on the basis of a shikimate kinase genetic defect strain Escherichia coli BL21 (ΔaroL/aroK, DE3), the key enzyme genes aroG, aroB, tktA and aroE of SA pathway were co-expressed and compared systematically by constructing a series of multi-gene expression vectors. The results showed that different gene co-expression combinations (two, three or four genes) or gene orders had different effects on the production of SA. SA production of the recombinant BL21-GBAE reached to 886.38 mg·L(-1), which was 17-fold (P < 0.05) of the parent strain BL21 (ΔaroL/aroK, DE3). PMID:27114316

  2. BASIC AMINO ACID CARRIER 2 gene expression modulates arginine and urea content and stress recovery in Arabidopsis leaves

    PubMed Central

    Planchais, Séverine; Cabassa, Cécile; Toka, Iman; Justin, Anne-Marie; Renou, Jean-Pierre; Savouré, Arnould; Carol, Pierre

    2014-01-01

    In plants, basic amino acids are important for the synthesis of proteins and signaling molecules and for nitrogen recycling. The Arabidopsis nuclear gene BASIC AMINO ACID CARRIER 2 (BAC2) encodes a mitochondria-located carrier that transports basic amino acids in vitro. We present here an analysis of the physiological and genetic function of BAC2 in planta. When BAC2 is overexpressed in vivo, it triggers catabolism of arginine, a basic amino acid, leading to arginine depletion and urea accumulation in leaves. BAC2 expression was known to be strongly induced by stress. We found that compared to wild type plants, bac2 null mutants (bac2-1) recover poorly from hyperosmotic stress when restarting leaf expansion. The bac2-1 transcriptome differs from the wild-type transcriptome in control conditions and under hyperosmotic stress. The expression of genes encoding stress-related transcription factors (TF), arginine metabolism enzymes, and transporters is particularly disturbed in bac2-1, and in control conditions, the bac2-1 transcriptome has some hallmarks of a wild-type stress transcriptome. The BAC2 carrier is therefore involved in controlling the balance of arginine and arginine-derived metabolites and its associated amino acid metabolism is physiologically important in equipping plants to respond to and recover from stress. PMID:25076951

  3. Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in s...

  4. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  5. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  6. EFFECTS OF ETHYLENE CHLOROHYDRIN ON FATTY ACID SYNTHESIS

    EPA Science Inventory

    Male chicks weighing 700 to 900 g. received an acute or eight doses IG of 60 or 40 mg/kg ethylene chlorohydrin (ECH) respectively and were sacrificed eighteen hours after the last dose. Mitochondrial elongation of fatty acids was decreased significantly while fatty acid synthetas...

  7. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  8. EFFECT OF LEAD ON GAMMA AMINO BUTYRIC ACID SYNTHESIS

    EPA Science Inventory

    The project studies the inhibitory effect of lead on the enzymatic activity of brain glutamic amino acid decarboxylase (GADC). The enzyme is responsible for the catalytic formation of gamma amino butyric acid (GABA) inhibitory neurons which is believed to be involved with the tra...

  9. Mutational analysis of nucleoside diphosphate kinase from Pseudomonas aeruginosa: characterization of critical amino acid residues involved in exopolysaccharide alginate synthesis.

    PubMed Central

    Sundin, G W; Shankar, S; Chakrabarty, A M

    1996-01-01

    We report the utilization of site-directed and random mutagenesis procedures in the gene encoding nucleoside diphosphate kinase (ndk) from Pseudomonas aeruginosa in order to examine the role of Ndk in the production of alginate by this organism. Cellular levels of the 16-kDa form of the Ndk enzyme are greatly reduced in P. aeruginosa 8830 with a knockout mutation in the algR2 gene (8830R2::Cm); this strain is also defective in the production of the exopolysaccharide alginate. In this study, we isolated four mutations in ndk (Ala-14-->Pro [Ala14Pro], Gly21Val, His117Gln, and Ala125Arg) which resulted in the loss of Ndk biochemical activity; hyperexpression of any of these four mutant genes did not restore alginate production to 8830R2::Cm. We identified six additional amino acid residues (Ser-43, Ala-56, Ser-69, Glu-80, Gly-91, and Asp-135) whose alteration resulted in the inability of Ndk to complement alginate production. After hyperproduction in 8830R2::Cm, it was determined that each of these six mutant Ndks was biochemically active. However, in four cases, the in vivo levels of Ndk were reduced, which consequently affected the growth of 8830R2::Cm in the presence of Tween 20. Two mutant Ndk proteins which could not complement the alginate synthesis defect in 8830R2::Cm were not affected in any characteristic examined in the present study. All of the mutant Ndks characterized which were still biochemically active formed membrane complexes with Pk, resulting in GTP synthesis. Two of the four Ndk activity mutants (His117Gln and Ala125Arg) identified were capable of being truncated to 12 kDa and formed a membrane complex with Pk; however, the complexes formed were inactive for GTP synthesis. The other two Ndk activity mutants could be truncated to 12 kDa but were not detected in membrane fractions. These results further our understanding of the role of Ndk in alginate synthesis and identify amino acid residues in Ndk which have not previously been studied as

  10. Hybrubins: Bipyrrole Tetramic Acids Obtained by Crosstalk between a Truncated Undecylprodigiosin Pathway and Heterologous Tetramic Acid Biosynthetic Genes.

    PubMed

    Zhao, Zhilong; Shi, Ting; Xu, Min; Brock, Nelson L; Zhao, Yi-Lei; Wang, Yemin; Deng, Zixin; Pang, Xiuhua; Tao, Meifeng

    2016-02-01

    Heterologous expression of bacterial artificial chromosome (BAC) clones from the genomic library of Streptomyces variabilis Snt24 in Streptomyces lividans SBT5 which carried a truncated undecylprodigiosin biosynthetic gene cluster led to the identification of hybrubins A-C. The hybrubins represent a new carbon skeleton in which a tetramic acid moiety is fused to a 2,2'-dipyrrole building block. Gene knockout experiments confirmed that hybrubins are derived from two convergent biosynthetic pathways including the remaining genomic red genes of S. lividans SBT5 as well as the BAC encoded hbn genes for the production of 5-ethylidenetetramic acid. A possible biosynthetic pathway was also proposed. PMID:26800378

  11. Fatty acid transport and activation and the expression patterns of genes involved in fatty acid trafficking.

    PubMed

    Sandoval, Angel; Fraisl, Peter; Arias-Barrau, Elsa; Dirusso, Concetta C; Singer, Diane; Sealls, Whitney; Black, Paul N

    2008-09-15

    These studies defined the expression patterns of genes involved in fatty acid transport, activation and trafficking using quantitative PCR (qPCR) and established the kinetic constants of fatty acid transport in an effort to define whether vectorial acylation represents a common mechanism in different cell types (3T3-L1 fibroblasts and adipocytes, Caco-2 and HepG2 cells and three endothelial cell lines (b-END3, HAEC, and HMEC)). As expected, fatty acid transport protein (FATP)1 and long-chain acyl CoA synthetase (Acsl)1 were the predominant isoforms expressed in adipocytes consistent with their roles in the transport and activation of exogenous fatty acids destined for storage in the form of triglycerides. In cells involved in fatty acid processing including Caco-2 (intestinal-like) and HepG2 (liver-like), FATP2 was the predominant isoform. The patterns of Acsl expression were distinct between these two cell types with Acsl3 and Acsl5 being predominant in Caco-2 cells and Acsl4 in HepG2 cells. In the endothelial lines, FATP1 and FATP4 were the most highly expressed isoforms; the expression patterns for the different Acsl isoforms were highly variable between the different endothelial cell lines. The transport of the fluorescent long-chain fatty acid C(1)-BODIPY-C(12) in 3T3-L1 fibroblasts and 3T3-L1 adipocytes followed typical Michaelis-Menten kinetics; the apparent efficiency (k(cat)/K(T)) of this process increases over 2-fold (2.1 x 10(6)-4.5 x 10(6)s(-1)M(-1)) upon adipocyte differentiation. The V(max) values for fatty acid transport in Caco-2 and HepG2 cells were essentially the same, yet the efficiency was 55% higher in Caco-2 cells (2.3 x 10(6)s(-1)M(-1) versus 1.5 x 10(6)s(-1)M(-1)). The kinetic parameters for fatty acid transport in three endothelial cell types demonstrated they were the least efficient cell types for this process giving V(max) values that were nearly 4-fold lower than those defined form 3T3-L1 adipocytes, Caco-2 cells and HepG2 cells. The

  12. Concurrent synthesis and release of nod-gene-inducing flavonoids from alfalfa roots. [Medicago sativa L. ; Rhizobium meliloti

    SciTech Connect

    Maxwell, C.A.; Phillips, D.A. )

    1990-08-01

    Flavonoid signals from alfalfa (Medicago sativa L.) induce transcription of nodulation (nod) genes in Rhizobium meliloti. Alfalfa roots release three major nod-gene inducers: 4{prime},7-dihydroxyflavanone, 4{prime},7-dihydroxyflavone, and 4,4{prime}-dihydroxy-2{prime}-methoxychalcone. The objective of the present study was to define temporal relationships between synthesis and exudation for those flavonoids. Requirements for concurrent flavonoid biosynthesis were assessed by treating roots of intact alfalfa seedlings with (U-{sup 14}C)-L-phenylalanine in the presence or absence of the phenylalanine ammonia-lyase inhibitor L-2-aminoxy-3-phenylpropionic acid (AOPP). In the absence of AOPP, each of the three flavonoids in exudates contained {sup 14}C. In the presence of AOPP, {sup 14}C labeling and release of all the exuded nod-gene inducers were reduced significantly. AOPP inhibited labeling and release of the strongest nod-gene inducer, methoxychalcone, by more than 90%. The release process responsible for exudation of nod-gene inducers appears to be specific rather than a general phenomenon such as a sloughing off of cells during root growth.

  13. Role of GlnR in Acid-Mediated Repression of Genes Encoding Proteins Involved in Glutamine and Glutamate Metabolism in Streptococcus mutans▿ †

    PubMed Central

    Chen , Pei-Min; Chen, Yi-Ywan M.; Yu, Sung-Liang; Sher, Singh; Lai, Chern-Hsiung; Chia, Jean-San

    2010-01-01

    The acid tolerance response (ATR) is one of the major virulence traits of Streptococcus mutans. In this study, the role of GlnR in acid-mediated gene repression that affects the adaptive ATR in S. mutans was investigated. Using a whole-genome microarray and in silico analyses, we demonstrated that GlnR and the GlnR box (ATGTNAN7TNACAT) were involved in the transcriptional repression of clusters of genes encoding proteins involved in glutamine and glutamate metabolism under acidic challenge. Reverse transcription-PCR (RT-PCR) analysis revealed that the coordinated regulation of the GlnR regulon occurred 5 min after acid treatment and that prolonged acid exposure (30 min) resulted in further reduction in expression. A lower level but consistent reduction in response to acidic pH was also observed in chemostat-grown cells, confirming the negative regulation of GlnR. The repression by GlnR through the GlnR box in response to acidic pH was further confirmed in the citBZC operon, containing genes encoding the first three enzymes in the glutamine/glutamate biosynthesis pathway. The survival rate of the GlnR-deficient mutant at pH 2.8 was more than 10-fold lower than that in the wild-type strain 45 min after acid treatment, suggesting that the GlnR regulon participates in S. mutans ATR. It is hypothesized that downregulation of the synthesis of the amino acid precursors in response to acid challenge would promote citrate metabolism to pyruvate, with the consumption of H+ and potential ATP synthesis. Such regulation will ensure an optimal acid adaption in S. mutans. PMID:20173059

  14. A Synthesis Method of Gene Networks Having Cyclic Expression Pattern Sequences by Network Learning

    NASA Astrophysics Data System (ADS)

    Mori, Yoshihiro; Kuroe, Yasuaki

    Recently, synthesis of gene networks having desired functions has become of interest to many researchers because it is a complementary approach to understanding gene networks, and it could be the first step in controlling living cells. There exist several periodic phenomena in cells, e.g. circadian rhythm. These phenomena are considered to be generated by gene networks. We have already proposed synthesis method of gene networks based on gene expression. The method is applicable to synthesizing gene networks possessing the desired cyclic expression pattern sequences. It ensures that realized expression pattern sequences are periodic, however, it does not ensure that their corresponding solution trajectories are periodic, which might bring that their oscillations are not persistent. In this paper, in order to resolve the problem we propose a synthesis method of gene networks possessing the desired cyclic expression pattern sequences together with their corresponding solution trajectories being periodic. In the proposed method the persistent oscillations of the solution trajectories are realized by specifying passing points of them.

  15. [Cloning of structural genes involved in riboflavin synthesis of the yeast Candida famata].

    PubMed

    Dmytruk, K V; Abbas, C A; Voronovsky, A Y; Kshanovska, B V; Sybirna, K A; Sybirny, A A

    2004-01-01

    The riboflavin overproducing mutants of the flavinogenic yeast Candida famata isolated by conventional selection methods are used for the industrial production of vitamin B2. Recently, a transformation system was developed for C. famata using the leu2 mutant as a recipient strain and Saccharomyces cerevislae LEU2 gene as a selective marker. In this paper the cloning of C. famata genes for riboflavin synthesis on the basis of developed transformation system for this yeast species is described. Riboflavin autotrophic mutants were isolated from a previously selected C. famata leu2 strain. C. famata genomic DNA library was constructed and used for cloning of the corresponding structural genes for riboflavin synthesis by complementation of the growth defects on a medium without leucine and riboflavin. As a result, the DNA fragments harboring genes RIB1, RIB2, RIB5, RIB6 and RIB7 encoding GTP cyclohydrolase, reductase, dimethylribityllumazine synthase, dihydroxybutanone phosphate synthase and riboflavin synthase, were isolated and subsequently subcloned to the smallest possible fragments. The plasmids with these genes successfully complemented riboflavin auxotrophies of the corresponding mutants of another flavinogenic yeast Pichia guilliermondii. This suggested that C. famata structural genes for riboflavin synthesis and not some of the supressor genes were cloned. PMID:15909421

  16. Phylogenetic distribution of compatible solute synthesis genes support a freshwater origin for cyanobacteria.

    PubMed

    Blank, Carrine E

    2013-10-01

    Previous work using ancestral state reconstruction of habitat salinity preference proposed that the early cyanobacteria likely lived in a freshwater environment. The aim of this study was to test that hypothesis by performing phylogenetic analyses of the genes underlying salinity preferences in the cyanobacteria. Phylogenetic analysis of compatible solute genes shows that sucrose synthesis genes were likely ancestral in the cyanobacteria, and were also likely inherited during the cyanobacterial endosymbiosis and into the photosynthetic algae and land plants. In addition, the genes for the synthesis of compatible solutes that are necessary for survival in marine and hypersaline environments (such as glucosylglycerol, glucosylglycerate, and glycine betaine) were likely acquired independently high up (i.e., more recently) in the cyanobacterial tree. Because sucrose synthesis is strongly associated with growth in a low salinity environment, this independently supports a freshwater origin for the cyanobacteria. It is also consistent with geologic evidence showing that the early oceans were much warmer and saltier than modern oceans-sucrose synthesis alone would have been insufficient for early cyanobacteria to have colonized early Precambrian oceans that had a higher ionic strength. Indeed, the acquisition of an expanded set of new compatible solute genes may have enabled the historical colonization of marine and hypersaline environments by cyanobacteria, midway through their evolutionary history. PMID:27007313

  17. Synthesis and characterization of hydrogen-bond acidic functionalized graphene

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Han, Qiang; Pan, Yong; Cao, Shuya; Ding, Mingyu

    2014-05-01

    Hexafluoroisopropanol phenyl group functionalized materials have great potential in the application of gas-sensitive materials for nerve agent detection, due to the formation of strong hydrogen-bonding interactions between the group and the analytes. In this paper, take full advantage of ultra-large specific surface area and plenty of carbon-carbon double bonds and hexafluoroisopropanol phenyl functionalized graphene was synthesized through in situ diazonium reaction between -C=C- and p-hexafluoroisopropanol aniline. The identity of the as-synthesis material was confirmed by transmission electron microscopy, Raman spectroscopy, ultraviolet visible spectroscopy, X-ray photoelectron spectroscopy and thermo gravimetric analysis. The synthesis method is simply which retained the excellent physical properties of original graphene. In addition, the novel material can be assigned as an potential candidate for gas sensitive materials towards organophosphorus nerve agent detection.

  18. cGMP Is Required for Gibberellic Acid-Induced Gene Expression in Barley Aleurone.

    PubMed Central

    Penson, S. P.; Schuurink, R. C.; Fath, A.; Gubler, F.; Jacobsen, J. V.; Jones, R. L.

    1996-01-01

    The occurrence and roles of cGMP were investigated in aleurone layers and protoplasts isolated from barley (cv Himalaya) grain. Levels of cGMP in freshly isolated barley aleurone layers ranged from 0.065 to 0.08 pmol/g fresh weight of tissue, and cGMP levels increased transiently after incubation in gibberellic acid (GA). Abscisic acid (ABA) did not increase cGMP levels in aleurone layers. LY 83583 (LY), an inhibitor of guanylyl cyclase, prevented the GA-induced increase in cGMP and inhibited GA-induced [alpha]-amylase synthesis and secretion. The inhibitory effects of LY could be overcome by membrane-permeant analogs of cGMP. LY also prevented GA-induced accumulation of [alpha]-amylase and GAMYB mRNAs. cGMP alone was not sufficient to induce the accumulation of [alpha]-amylase or GAMYB mRNA. LY had a less dramatic effect on the accumulation of mRNAs encoding the ABA-responsive gene Rab21. We conclude that cGMP plays an important role in GA, but not ABA, signaling in the barley aleurone cell. PMID:12239379

  19. Effects of sexual maturation and feeding level on fatty acid metabolism gene expression in muscle, liver, and visceral adipose tissue of diploid and triploid rainbow trout, Oncorhynchus mykiss.

    PubMed

    Manor, Meghan L; Cleveland, Beth M; Weber, Gregory M; Kenney, P Brett

    2015-01-01

    In many cultured fish species, such as salmonids, gonadal development occurs at the expense of stored energy and nutrients, including lipids. However, mechanisms regulating nutrient repartitioning during sexual maturation are not well understood. This study compared sexually maturing diploid (2N) and sterile triploid (3N) female rainbow trout to investigate effects of sexual maturation on expression of 35 genes involved in fatty acid metabolism, including genes within fatty acid synthesis, β-oxidation, and cofactors of the mTOR and PPAR signaling pathways, in liver, white muscle, and visceral adipose tissue. Diploid fish were fed at different rations (0.25% and 0.50% tank biomass, and satiation) to determine effects of ration on gene expression. Gene expression was affected by ration level only in white muscle; erk and acat2 had higher expression in fish fed higher rations. On the other hand, sexual maturation affected gene expression across all three tissue types. Data indicate 2N fish have higher expression of β-oxidation genes within white muscle and within visceral adipose tissue. These findings support enhanced fatty acid mobilization within these tissues during sexual maturation. Higher expression of fatty acid synthesis genes in 3N female liver is associated with higher expression of mTOR cofactors and pparγ, which reflects continued deposition of lipids in these fish. Furthermore, greater expression of genes involved in β-oxidation pathways across ration levels in 2N females suggests that sexual maturation and the associated maturation-related signals are stronger regulators of lipid metabolism-related genes rather the rations applied in the current study. PMID:25242626

  20. Stimulation of muscle protein synthesis by leucine is dependent on plasma amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that a physiological increase in plasma leucine increased translation initiation factor activity during 60- and 120-min leucine infusion. Muscle protein synthesis was stimulated at 60 min but not at 120 min, perhaps due to the decrease (-50%) in plasma essential amino acids (AA). ...

  1. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  2. Tandem Ru-alkylidene-catalysed cross metathesis/hydrogenation: synthesis of lipophilic amino acids.

    PubMed

    Wang, Zhen J; Spiccia, Nicolas D; Jackson, W Roy; Robinson, Andrea J

    2013-08-01

    Highly efficient synthesis of lipidic amino acids can be achieved via Ru-alkylidene-catalysed cross metathesis of long chain alkenes with commercially available allylglycine. The resultant unsaturated analogues can be then optionally hydrogenated under mild reaction conditions by using the spent metathesis catalyst. PMID:23733491

  3. One-Pot Synthesis of Arylketones from Aromatic Acids via Palladium-Catalyzed Suzuki Coupling.

    PubMed

    Wu, Hongxiang; Xu, Baiping; Li, Yue; Hong, Fengying; Zhu, Dezhao; Jian, Junsheng; Pu, Xiaoer; Zeng, Zhuo

    2016-04-01

    A palladium-catalyzed one-pot procedure for the synthesis of aryl ketones has been developed. Triazine esters when coupled with aryl boronic acids provided aryl ketones in moderate to excellent yields (up to 95%) in the presence of 1 mol % Pd(PPh3)2Cl2 for 30 min. PMID:26949103

  4. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  5. Synthesis and bioactivity of novel caffeic acid esters from Zuccagnia punctata.

    PubMed

    Ramachandra, M S; Subbaraju, G V

    2006-12-01

    Synthesis of novel caffeic acid esters (1 and 2) was accomplished starting from appropriately substituted benzaldehydes (3 and 9). While compound 2 exhibited potent anti-oxidative activity in both the nitroblue tetrazolium and 1,1-diphenyl-2-picrylhydrazyl radical-scavenging models, compound 1 showed moderate 5-lipoxygenase inhibitory activity. PMID:17145655

  6. Templated synthesis of nylon nucleic acids and characterization by nuclease digestion

    PubMed Central

    Liu, Yu; Wang, Risheng; Ding, Liang; Sha, Roujie

    2012-01-01

    Nylon nucleic acids containing oligouridine nucleotides with pendent polyamide linkers and flanked by unmodified heteronucleotide sequences were prepared by DNA templated synthesis. Templation was more efficient than the single-stranded synthesis: Coupling step yields were as high as 99.2%, with up to 7 amide linkages formed in the synthesis of a molecule containing 8 modified nucleotides. Controlled digestion by calf spleen phosphodiesterase enabled the mapping of modified nucleotides in the sequences. A combination of complete degradation of nylon nucleic acids by snake venom phosphodiesterase and dephosphorylation of the resulting nucleotide fragments by bacterial alkaline phosphatase, followed by LCMS analysis, clarified the linear structure of the oligo-amide linkages. The templated synthesis strategy afforded nylon nucleic acids in the target structure and was compatible with the presence heteronucleotides. The complete digestion procedure produced a new species of DNA analogues, nylon ribonucleosides, which display nucleosides attached via a 2′-alkylthio linkage to each diamine and dicarboxylate repeat unit of the original nylon nucleic acids. The binding affinity of a nylon ribonucleoside octamer to the complementary DNA was evaluated by thermal denaturing experiments. The octamer was found to form stable duplexes with an inverse dependence on salt concentration, in contrast to the salt-dependent DNA control. PMID:23125913

  7. Insulin and amino acids stimulate whole body protein synthesis in neonates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Insulin and amino acids (AA) stimulate muscle protein synthesis in neonatal pigs. To determine the effects of insulin and AA on whole body protein turnover, hyperinsulinemic (0 and 100 ng/(kg[0.66]/min))-euglycemic-AA clamps were performed during euaminoacidemia or hyperaminoacidemia in fasted 7-d-...

  8. Synthesis of selenium-containing amino acid analogues and their biological study.

    PubMed

    Abdel-Hafez, S H; Saad, H A; Aly, M R E

    2011-01-01

    Synthesis of selenium-containing amino acid analogues is described. These compounds were prepared in a concise and short synthetic route in good yields by nucleophilic substitution reaction of pyridineselenol and quinolineselenol derivatives with N-phthaloylglycyl chloride followed by hydrazinolysis. The newly synthesized compounds were screened against different strains of bacteria and fungi. PMID:21899043

  9. De novo fatty acid synthesis at the mitotic exit is required to complete cellular division

    PubMed Central

    Scaglia, Natalia; Tyekucheva, Svitlana; Zadra, Giorgia; Photopoulos, Cornelia; Loda, Massimo

    2014-01-01

    Although the regulation of the cell cycle has been extensively studied, much less is known about its coordination with the cellular metabolism. Using mass spectrometry we found that lysophospholipid levels decreased drastically from G2/M to G1 phase, while de novo phosphatidylcholine synthesis, the main phospholipid in mammalian cells, increased, suggesting that enhanced membrane production was concomitant to a decrease in its turnover. In addition, fatty acid synthesis and incorporation into membranes was increased upon cell division. The rate-limiting reaction for de novo fatty acid synthesis is catalyzed by acetyl-CoA carboxylase. As expected, its inhibiting phosphorylation decreased prior to cytokinesis initiation. Importantly, the inhibition of fatty acid synthesis arrested the cells at G2/M despite the presence of abundant fatty acids in the media. Our results suggest that de novo lipogenesis is essential for cell cycle completion. This “lipogenic checkpoint” at G2/M may be therapeutically exploited for hyperproliferative diseases such as cancer. PMID:24418822

  10. Synthesis of polyacrylic-acid-based thermochromic polymers

    NASA Astrophysics Data System (ADS)

    Srivastava, Jyoti; Alam, Sarfaraz; Mathur, G. N.

    2003-10-01

    Smart materials respond to environmental stimuli with particular changes in some variables (for example temperature, pressure and electric field etc), for that reason they are often called responsive materials. In the present work, we have synthesized thermochromic polymer based on poly acrylic acid cobalt chloride (CoCl2) and phosphoric acid (H3PO4) that visually and reversibly changes color in the temperature range (70 - 130°C). These thermochromic materials can be used as visual sensors of temperature. Thermochromic polymers are based on polyacrylic acid and CoCl2 complex.

  11. Synthesis of α,β-unsaturated esters via a chemo-enzymatic chain elongation approach by combining carboxylic acid reduction and Wittig reaction

    PubMed Central

    Duan, Yitao; Yao, Peiyuan; Du, Yuncheng; Feng, Jinhui

    2015-01-01

    Summary α,β-Unsaturated esters are versatile building blocks for organic synthesis and of significant importance for industrial applications. A great variety of synthetic methods have been developed, and quite a number of them use aldehydes as precursors. Herein we report a chemo-enzymatic chain elongation approach to access α,β-unsaturated esters by combining an enzymatic carboxylic acid reduction and Wittig reaction. Recently, we have found that Mycobacterium sp. was able to reduce phenylacetic acid (1a) to 2-phenyl-1-ethanol (1c) and two sequences in the Mycobacterium sp. genome had high identity with the carboxylic acid reductase (CAR) gene from Nocardia iowensis. These two putative CAR genes were cloned, overexpressed in E. coli and one of two proteins could reduce 1a. The recombinant CAR was purified and characterized. The enzyme exhibited high activity toward a variety of aromatic and aliphatic carboxylic acids, including ibuprofen. The Mycobacterium CAR catalyzed carboxylic acid reduction to give aldehydes, followed by a Wittig reaction to afford the products α,β-unsaturated esters with extension of two carbon atoms, demonstrating a new chemo-enzymatic method for the synthesis of these important compounds. PMID:26664647

  12. Synthesis and biological evaluation of novel lipoamino acid derivatives.

    PubMed

    Kaki, Shiva Shanker; Arukali, Sammaiah; Korlipara, Padmaja V; Prasad, R B N; Yedla, Poornachandra; Ganesh Kumar, C

    2016-01-01

    Seven novel lipoamino acid conjugates were synthesized from methyl oleate and amino acids. Methyl oleate was grafted to different amino acids using thioglycolic acid as a spacer group. Seven derivatives (3a-g) were prepared and characterized by spectral data (NMR, IR and MS spectral studies). All the derivatives were studied for their antimicrobial, anti-biofilm and anticancer activities. Among all the derivatives, it was found that compound 3b was the most potent antibacterial compound which showed good activity against four Gram positive bacterial strains and also exhibited excellent antifungal activity against a fungal strain. In the anti-biofilm assay, compound 3b showed promising activity with IC50 value of 2.8μM against Bacillus subtilis MTCC 121. All the compounds showed anticancer activities with 3c showing promising anticancer activity (IC50=15.3-22.4μM) against the four cell lines tested. PMID:26586599

  13. The PH gene determines fruit acidity and contributes to the evolution of sweet melons.

    PubMed

    Cohen, Shahar; Itkin, Maxim; Yeselson, Yelena; Tzuri, Galil; Portnoy, Vitaly; Harel-Baja, Rotem; Lev, Shery; Sa'ar, Uzi; Davidovitz-Rikanati, Rachel; Baranes, Nadine; Bar, Einat; Wolf, Dalia; Petreikov, Marina; Shen, Shmuel; Ben-Dor, Shifra; Rogachev, Ilana; Aharoni, Asaph; Ast, Tslil; Schuldiner, Maya; Belausov, Eduard; Eshed, Ravit; Ophir, Ron; Sherman, Amir; Frei, Benedikt; Neuhaus, H Ekkehard; Xu, Yimin; Fei, Zhangjun; Giovannoni, Jim; Lewinsohn, Efraim; Tadmor, Yaakov; Paris, Harry S; Katzir, Nurit; Burger, Yosef; Schaffer, Arthur A

    2014-01-01

    Taste has been the subject of human selection in the evolution of agricultural crops, and acidity is one of the three major components of fleshy fruit taste, together with sugars and volatile flavour compounds. We identify a family of plant-specific genes with a major effect on fruit acidity by map-based cloning of C. melo PH gene (CmPH) from melon, Cucumis melo taking advantage of the novel natural genetic variation for both high and low fruit acidity in this species. Functional silencing of orthologous PH genes in two distantly related plant families, cucumber and tomato, produced low-acid, bland tasting fruit, showing that PH genes control fruit acidity across plant families. A four amino-acid duplication in CmPH distinguishes between primitive acidic varieties and modern dessert melons. This fortuitous mutation served as a preadaptive antecedent to the development of sweet melon cultigens in Central Asia over 1,000 years ago. PMID:24898284

  14. Synthesis and Functionalization of Cyclic Sulfonimidamides: A Novel Chiral Heterocyclic Carboxylic Acid Bioisostere

    PubMed Central

    2012-01-01

    An efficient synthesis of aryl substituted cyclic sulfonimidamides designed as chiral nonplanar heterocyclic carboxylic acid bioisosteres is described. The cyclic sulfonimidamide ring system could be prepared in two steps from a trifluoroacetyl protected sulfinamide and methyl ester protected amino acids. By varying the amino acid, a range of different C-3 substituted sulfonimidamides could be prepared. The compounds could be further derivatized in the aryl ring using standard cross-coupling reactions to yield highly substituted cyclic sulfonimidamides in excellent yields. The physicochemical properties of the final compounds were examined and compared to those of the corresponding carboxylic acid and tetrazole derivatives. The unique nonplanar shape in combination with the relatively strong acidity (pKa 5–6) and the ease of modifying the chemical structure to fine-tune the physicochemical properties suggest that this heterocycle can be a valuable addition to the range of available carboxylic acid isosteres. PMID:24900513

  15. Synthesis of a bicyclic delta-amino acid as a constrained Gly-Asn dipeptide isostere.

    PubMed

    Trabocchi, A; Menchi, G; Danieli, E; Guarna, A

    2008-06-01

    Delta-amino acids are very attractive in drug discovery, especially in the peptidomimetic area, because of their capability to act as dipeptide isosteres and reverse turn mimetics. Herein we report the synthesis of a rigid delta-amino acid constrained by a 3-aza-6,8-dioxabicyclo[3.2.1]octane-based scaffold, which can be considered as a Gly-Asn dipeptide mimetic. Key steps are the condensation of glycidol and tartaric acid derivatives, and the intramolecular trans-acetalization of the oxidized adduct to give the bicyclic delta-amino acid. Starting from L-tartaric acid derivative, it was achieved the corresponding Gly-D-Asn isostere, whereas from the enantiomeric D-tartaric acid derivative the corresponding Gly-L-Asn isostere could be obtained, thus giving access to both enantiomeric dipeptide sequences. PMID:18235990

  16. Synthesis and properties of coumaric acid derivative homo-polymers.

    PubMed

    Thi, Tran Hang; Matsusaki, Michiya; Shi, Dongjian; Kaneko, Tatsuo; Akashi, Mitsuru

    2008-01-01

    Poly(4-hydroxycinnamic acid) (P4HCA), poly(3-hydroxycinnamic acid) (P3HCA), poly(3-methoxy-4-hydroxycinnamic acid) (PMHCA) and poly(3,4-dihydroxycinnamic acid) (PDHCA) were synthesized by the thermal poly-condensation of the corresponding monomers, which are lignin precursors, coumaric acid derivatives consisting of cinnamoyl groups and different position and number of OH groups. The solubility of the homo-polymers in organic solvents decreased in the order of P3HCA > PDHCA > P4HCA > PMHCA. The wide angle X-ray diffraction (WAXD) results indicated that P4HCA or PMHCA with p-OH group had higher crystallinity, in contrast to P3HCA or PDHCA with m-OH group which had lower crystallinity. Crossed-polarizing microscopy suggested that P4HCA had the nematic liquid crystal properties at 220 degrees C and PDHCA showed birefringence properties at 200 degrees C. In cell-adhesion tests, PDHCA showed the highest cell adhesion (ca. 70%), whereas P3HCA, P4HCA and PMHCA had 50, 18 and 10% cell adhesion, respectively. The coumaric acid derivative homo-polymers can be useful as cell adhesion controllable thermotropic polymers for biomedical and environmental fields. PMID:18177555

  17. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  18. Starch Synthesis in Arabidopsis Is Achieved by Spatial Cotranscription of Core Starch Metabolism Genes1[W][OA

    PubMed Central

    Tsai, Huang-Lung; Lue, Wei-Ling; Lu, Kuan-Jen; Hsieh, Ming-Hsiun; Wang, Shue-Mei; Chen, Jychian

    2009-01-01

    Starch synthesis and degradation require the participation of many enzymes, occur in both photosynthetic and nonphotosynthetic tissues, and are subject to environmental and developmental regulation. We examine the distribution of starch in vegetative tissues of Arabidopsis (Arabidopsis thaliana) and the expression of genes encoding core enzymes for starch synthesis. Starch is accumulated in plastids of epidermal, mesophyll, vascular, and root cap cells but not in root proper cells. We also identify cells that can synthesize starch heterotrophically in albino mutants. Starch synthesis in leaves is regulated by developmental stage and light. Expression of gene promoter-β-glucuronidase fusion constructs in transgenic seedlings shows that starch synthesis genes are transcriptionally active in cells with starch synthesis and are inactive in root proper cells except the plastidial phosphoglucose isomerase. In addition, ADG2 (for ADPG PYROPHOSPHORYLASE2) is not required for starch synthesis in root cap cells. Expression profile analysis reveals that starch metabolism genes can be clustered into two sets based on their tissue-specific expression patterns. Starch distribution and expression pattern of core starch synthesis genes are common in Arabidopsis and rice (Oryza sativa), suggesting that the regulatory mechanism for starch metabolism genes may be conserved evolutionarily. We conclude that starch synthesis in Arabidopsis is achieved by spatial coexpression of core starch metabolism genes regulated by their promoter activities and is fine-tuned by cell-specific endogenous and environmental controls. PMID:19759345

  19. Synthesis of novel conjugates of a saccharide, amino acids, nucleobase and the evaluation of their cell compatibility.

    PubMed

    Yuan, Dan; Du, Xuewen; Shi, Junfeng; Zhou, Ning; Baoum, Abdulgader Ahmed; Xu, Bing

    2014-01-01

    This article reports the synthesis of a novel type of conjugate of three fundamental biological build blocks (i.e., saccharide, amino acids, and nucleobase) and their cell compatibility. The facile synthesis starts with the synthesis of nucleobase and saccharide derivatives, then uses solid-phase peptide synthesis (SPPS) to build the peptide segment (Phe-Arg-Gly-Asp or naphthAla-Phe-Arg-Gly-Asp with fully protected groups), and later, an amidation reaction in liquid phase connects these three parts together. The overall yield of these multiple step synthesis is about 34%. Besides exhibiting excellent solubility, these conjugates of saccharide-amino acids-nucleobase (SAN), like the previously reported conjugates of nucleobase-amino acids-saccharide (NAS) and nucleobase-saccharide-amino acids (NSA), are mammalian cell compatible. PMID:25383110

  20. Synthesis of phosphoramidites of isoGNA, an isomer of glycerol nucleic acid

    PubMed Central

    Kim, Keunsoo; Punna, Venkateshwarlu; Karri, Phaneendrasai

    2014-01-01

    Summary IsoGNA, an isomer of glycerol nucleic acid GNA, is a flexible (acyclic) nucleic acid with bases directly attached to its linear backbone. IsoGNA exhibits (limited) base-pairing properties which are unique compared to other known flexible nucleic acids. Herein, we report on the details of the preparation of isoGNA phosphoramidites and an alternative route for the synthesis of the adenine derivative. The synthetic improvements described here enable an easy access to isoGNA and allows for the further exploration of this structural unit in oligonucleotide chemistry thereby spurring investigations of its usefulness and applicability. PMID:25246971

  1. Tunable and Diastereoselective Brønsted Acid Catalyzed Synthesis of β-Enaminones.

    PubMed

    Kang, Ye-Won; Cho, Yu Jin; Han, Seung Jin; Jang, Hye-Young

    2016-01-15

    The Brønsted acid catalyzed Meyer-Schuster reaction of hemiaminals was studied for the stereoselective synthesis of β-enaminones. Hemiaminals were formed from propargyl aldehydes (or the oxidation of propargyl alcohols) and amines in the presence of Brønsted acids. A critical step to control the stereochemistry of the products is the protonation of the corresponding allenol intermediate, which is dictated by the Brønsted acid used, the steric effect of the amine, and the electronic effect of the propargyl aldehyde. PMID:26741050

  2. Chemoenzymatic synthesis of CMP-N-acetyl-7-fluoro-7-deoxy-neuraminic acid.

    PubMed

    Hartlieb, Sina; Günzel, Almut; Gerardy-Schahn, Rita; Münster-Kühnel, Anja K; Kirschning, Andreas; Dräger, Gerald

    2008-08-11

    7-Fluoro sialic acid was prepared and activated as cytidine monophosphate (CMP) ester. The synthesis started with d-glucose, which was efficiently converted into N-acetyl-4-fluoro-4-deoxy-d-mannosamine. Aldolase catalyzed transformation yielded the corresponding fluorinated sialic acid which was activated as CMP ester using three different synthetases in the presence as well as in the absence of pyrophosphatase which possesses inhibitory properties. Finally, conditions were optimized to perform a one-pot reaction starting from fluorinated mannosamine, which yielded the 7-fluoro-7-deoxy-CMP-sialic acid by incubation with three enzymes. PMID:18353292

  3. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  4. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases. PMID:25282359

  5. Nature's Starships: Amino Acid Synthesis, Frequency, and Delivery to Earth via Meteorites

    NASA Astrophysics Data System (ADS)

    Cobb, Alyssa; Pudritz, Ralph

    2013-07-01

    Understanding the origin of organic molecules on Earth is vital to our understanding of the origins of life. One proposed mechanism for the introduction of organic material to our planet is via meteorite impacts. Meteoritic parent bodies contain organic material and water ice, which, given radionuclide decay in their interiors, cause the ice to melt and the parent bodies to undergo a process called aqueous alteration. An example of this internal chemistry is Strecker synthesis, a process resulting in the production of various amino acids. Our work summarizes recent discoveries regarding amino acid synthesis and concentration data. We present the amino acid concentrations collated from a variety of meteorites (~20) covering a range of meteorite classes. We can use the dependence of amino acid frequency on variables such as temperature and pressure to model Strecker synthesis inside a theoretical parent body. Our modeling software takes a set of chemical species and outputs their relative frequencies based on a minimization of their Gibbs free energies. The goal of this work is to predict and quantify the presence of amino acids on a foreign landscape using thermodynamic principles.

  6. Supplementation of essential fatty acids to Holstein calves during late uterine life and first month of life alters hepatic fatty acid profile and gene expression.

    PubMed

    Garcia, M; Greco, L F; Lock, A L; Block, E; Santos, J E P; Thatcher, W W; Staples, C R

    2016-09-01

    Linoleic acid is an essential dietary fatty acid (FA). However, how the supplementation of linoleic acid during uterine and early life may modify the FA profile and transcriptome regulation of the liver, and performance of preweaned dairy calves is unknown. Our objective was to evaluate the effect of supplementation of essential FA to Holstein calves during late uterine and early life on their hepatic FA profile and global gene expression at 30 d of age. During the last 8 wk of pregnancy, Holstein cattle (n=96) were fed either no fat supplement (control), a saturated FA supplement enriched with C18:0, or an unsaturated FA supplement enriched with linoleic acid. Male calves (n=40) born from these dams were fed a milk replacer (MR) with either low (LLA) or high linoleic acid (HLA) concentration as the sole feedstuff during the first 30 d. Liver biopsy was performed at 30 d of age, and microarray analysis was performed on 18 liver samples. Total concentration of FA in liver were greater in calves fed LLA compared with those fed HLA MR (8.2 vs. 7.1%), but plasma concentrations of total FA did not differ due to MR diets. The FA profiles of plasma and liver of calves were affected differently by the prepartum diets. Specifically, the FA profile in liver was affected moderately by the feeding of fat prepartum, but the profiles did not differ due to the type of FA fed prepartum. The type of MR fed during the first 30 d of life had major effects on both plasma and liver FA profiles, resembling the type of fat fed. Plasma and liver of calves fed LLA MR had greater percentage of medium-chain FA (C12:0 and C14:0), whereas plasma and liver from calves fed HLA MR had greater percentages of linoleic and α-linolenic acids. Dams fed fat or a specific type of FA modified the expression of some genes in liver of calves, particularly those genes involved in biological functions and pathways related to upregulation of lipid metabolism and downregulation of inflammatory responses

  7. The sequence diversity and expression among genes of the folic acid biosynthesis pathway in industrial Saccharomyces strains.

    PubMed

    Goncerzewicz, Anna; Misiewicz, Anna

    2015-01-01

    Folic acid is an important vitamin in human nutrition and its deficiency in pregnant women's diets results in neural tube defects and other neurological damage to the fetus. Additionally, DNA synthesis, cell division and intestinal absorption are inhibited in case of adults. Since this discovery, governments and health organizations worldwide have made recommendations concerning folic acid supplementation of food for women planning to become pregnant. In many countries this has led to the introduction of fortifications, where synthetic folic acid is added to flour. It is known that Saccharomyces strains (brewing and bakers' yeast) are one of the main producers of folic acid and they can be used as a natural source of this vitamin. Proper selection of the most efficient strains may enhance the folate content in bread, fermented vegetables, dairy products and beer by 100% and may be used in the food industry. The objective of this study was to select the optimal producing yeast strain by determining the differences in nucleotide sequences in the FOL2, FOL3 and DFR1 genes of folic acid biosynthesis pathway. The Multitemperature Single Strand Conformation Polymorphism (MSSCP) method and further nucleotide sequencing for selected strains were applied to indicate SNPs in selected gene fragments. The RT qPCR technique was also applied to examine relative expression of the FOL3 gene. Furthermore, this is the first time ever that industrial yeast strains were analysed regarding genes of the folic acid biosynthesis pathway. It was observed that a correlation exists between the folic acid amount produced by industrial yeast strains and changes in the nucleotide sequence of adequate genes. The most significant changes occur in the DFR1 gene, mostly in the first part, which causes major protein structure modifications in KKP 232, KKP 222 and KKP 277 strains. Our study shows that the large amount of SNP contributes to impairment of the selected enzymes and S. cerevisiae and S

  8. Templated synthesis of peptide nucleic acids via sequence-selective base-filling reactions.

    PubMed

    Heemstra, Jennifer M; Liu, David R

    2009-08-19

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  9. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    PubMed Central

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  10. Mutation and gene transfer of neutral amino acid transport System L genes in mammalian cells

    SciTech Connect

    El-Gewely, M.R.; Collarini, E.J.; Campbell, G.S.; Oxender, D.L.

    1987-05-01

    The authors are attempting to clone the genes coding for amino acid transport System L. Chinese hamster ovary (CHO) cell mutants that are temperature sensitive in their leucyl-tRNA synthetase show temperature-dependent regulation of System L. Temperature resistant mutants isolated from these cells have constitutively derepressed System L activity. Somatic cell fusion studies using these mutants have suggested that a trans-acting element controls regulation of System L. Mutants with reduced transport activity were isolated by a TH-suicide selection. The growth of these mutant cells is limited by the transport defect. CHO mutants were transformed with a human cosmid library, followed by selection at high temperatures and low leucine concentrations. Some transformants have increased levels of System L activity, suggesting that human genes coding for leucine transport have been incorporated into the CHO genome. Human sequences were rescued by a lambda in vitro packaging system. These sequences hybridize to vector and total human DNA. Experiments are being done to confirm that these sequences indeed code for transport System L. They are also attempting to label membrane components of amino acid transporters by group-specific modifying reagents.

  11. The rice OsLpa1 gene encodse a novel protein involved in phytic acid metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rice low phytic acid 1 (OsLpa1) gene was originally identified using a forward genetics approach. Mutation of this gene resulted in a 45% reduction in rice seed phytic acid with a molar-equivalent increase in inorganic phosphorus; however, the rice lpa1 mutant does not appear to differ significa...

  12. Identifying and assessing the impact of wine acid-related genes in yeast.

    PubMed

    Chidi, Boredi S; Rossouw, Debra; Bauer, Florian F

    2016-02-01

    Saccharomyces cerevisiae strains used for winemaking show a wide range of fermentation phenotypes, and the genetic background of individual strains contributes significantly to the organoleptic properties of wine. This strain-dependent impact extends to the organic acid composition of the wine, an important quality parameter. However, little is known about the genes which may impact on organic acids during grape must fermentation. To generate novel insights into the genetic regulation of this metabolic network, a subset of genes was identified based on a comparative analysis of the transcriptomes and organic acid profiles of different yeast strains showing different production levels of organic acids. These genes showed significant inter-strain differences in their transcription levels at one or more stages of fermentation and were also considered likely to influence organic acid metabolism based on existing functional annotations. Genes selected in this manner were ADH3, AAD6, SER33, ICL1, GLY1, SFC1, SER1, KGD1, AGX1, OSM1 and GPD2. Yeast strains carrying deletions for these genes were used to conduct fermentations and determine organic acid levels at various stages of alcoholic fermentation in synthetic grape must. The impact of these deletions on organic acid profiles was quantified, leading to novel insights and hypothesis generation regarding the role/s of these genes in wine yeast acid metabolism under fermentative conditions. Overall, the data contribute to our understanding of the roles of selected genes in yeast metabolism in general and of organic acid metabolism in particular. PMID:26040556

  13. Synthesis and properties of synthetic fulvic acid derived from hematoxylin

    NASA Astrophysics Data System (ADS)

    Litvin, Valentina A.; Minaev, Boris F.; Baryshnikov, Gleb V.

    2015-04-01

    A model fulvic acid (FA) was synthesized from a natural dye, hematoxylin, in a slow oxidative polymerization/condensation reaction catalysed by OH- at pH ca. 12. The resulting dark-brown product, acidified to pH ca. 2, did not precipitate from the reaction solution. It was isolated and purified by cation-exchange resin. Its physicochemical and spectroscopic properties, as determined by means of elemental analysis, molecular weight analyses, Fourier transform infra red (FTIR) and ultraviolet-visible (UV-VIS) spectroscopy, X-ray diffraction and electron paramagnetic resonance (EPR) spectroscopy, showed a close resemblance to natural FA. The similarity and differences between synthetic fulvic acids derived from hematoxylin and the natural fulvic acids substances are discussed. Quantum-chemical calculations of the supposed primary oxidation products of hematoxylin are performed and compared with observations.

  14. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  15. Amino acids in a Fischer Tropsch type synthesis

    NASA Technical Reports Server (NTRS)

    Brown, D. L.; Lawless, J. G.

    1974-01-01

    One postulation is described for the presence of organic compounds in meteorites which states that they were formed during the condensation of the solar nebula. A viable laboratory simulation of these conditions can be modeled after the industrial Fischer Tropsch reaction, which is known to produce organic compounds called hydrocarbons. In this simulation, a mixture of carbon monoxide, hydrogen and ammonia is heated in the presence of iron meteorite. The reaction products for amino acids, a class of organic compounds important to life, were examined. A large number of these compounds is found in meteorites and other chemical evolution experiments, but only small quantities of a few amino acids were found in the present simulation work. These results are at odds with the existing literature in which many amino acids were reported.

  16. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  17. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  18. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  19. Branched-chain-amino-acid biosynthesis in plants: molecular cloning and characterization of the gene encoding acetohydroxy acid isomeroreductase (ketol-acid reductoisomerase) from Arabidopsis thaliana (thale cress).

    PubMed Central

    Dumas, R; Curien, G; DeRose, R T; Douce, R

    1993-01-01

    Towards the goal of gaining a better understanding of the molecular mechanisms controlling branched-chain-amino-acid biosynthesis in plants, we have isolated, sequenced and characterized a gene encoding acetohydroxy acid isomero-reductase (ketol-acid reductoisomerase) from Arabidopsis thaliana (thale cress). Comparison between the acetohydroxy acid isomeroreductase cDNA and the genomic sequence has allowed us to determine the exon structure of the coding region. The isolated acetohydroxy acid isomeroreductase gene is distributed over approx. 4.5 kbp and contains nine introns (79-347 bp). The transcriptional start site was found to be 52 bp upstream of the translational initiation site. Southern-blot analysis of A. thaliana genomic DNA shows that the acetohydroxy acid isomeroreductase is encoded by a single-copy gene. Images Figure 3 Figure 5 PMID:8379936

  20. Amino Acids Involved in Polyphosphate Synthesis and Its Mobilization Are Distinct in Polyphosphate Kinase-1 from Mycobacterium tuberculosis

    PubMed Central

    Mittal, Payal; Karthikeyan, Subramanian; Chakraborti, Pradip K.

    2011-01-01

    Background In bacteria polyphosphates (poly-P) are involved in cellular metabolism and development especially during stress. The enzyme, principally involved in polyphosphate biosynthesis and its mobilization leading to generation of NTPs, is known as polyphosphate kinase (PPK). Principal Findings Among two genes of polyphosphate kinases present in Mycobacterium tuberculosis, we cloned and expressed PPK1 in Escherichia coli as histidine-tagged protein. This ∼86 kDa protein is capable of autophosphorylation and synthesis of poly-P as well as NTP. Among 22 conserved histidine residues, we found only His-491 is autophosphorylated and crucial for any enzymatic activity. Substitution of His-510 caused mPPK1 protein deficient but not defective in autophosphorylation, thereby contrary to earlier reports negating any role of this residue in the process. However, mutation of His-510 with either Ala or Gln affected ATP or poly-P synthesis depending on the substitution; while such effects were severe with H510A but mild with H510Q. Furthermore, mPPK1 also renders auxiliary nucleotide diphosphate kinase function by synthesizing virtually all NTPs/dNTPs from their cognate NDPs/dNDPs by utilizing poly-P as the phosphate donor albeit with varied efficiency. To assess the influence of other catalytic domain residues of mPPK1 towards its functionality, we designed mutations based on E. coli PPK1 crystal structure since it owes 68% amino acid sequence similarity with mPPK1. Interestingly, our results revealed that mutations in mPPK1 affecting poly-P synthesis always affected its ATP synthesizing ability; however, the reverse may not be true. Conclusions/Significance We conclude that amino acid residues involved in poly-P and ATP synthesizing activities of mPPK1 are distinct. Considering conserved nature of PPK1, it seems our observations have broader implications and not solely restricted to M. tuberculosis only. PMID:22110640

  1. Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S

    PubMed Central

    Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats

    2014-01-01

    Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631

  2. Urinary excretion of mevalonic acid as an indicator of cholesterol synthesis.

    PubMed

    Lindenthal, B; Simatupang, A; Dotti, M T; Federico, A; Lütjohann, D; von Bergmann, K

    1996-10-01

    Urinary excretion of mevalonic acid was investigated as an indicator of cholesterol synthesis. In normolipemic volunteers, excretion of mevalonic acid averaged 3.51 +/- 0.59 (SD) micrograms/kg x day1; (n = 24) and was not different from patients with hypercholesterolemia (3.30 +/- 0.92 micrograms/kg x day1; n = 24). In patients with cerebrotendineous xanthomatosis, the excretion was significantly higher (8.55 +/- 1.92 micrograms/kg x day1; n = 6, P < 0.001) but comparable to volunteers treated with cholestyramine (6.69 +/- 2.6 micrograms/kg x day1; n = 5). A significant correlation was found between 24-h excretion of mevalonic acid and cholesterol synthesis (r = 0.835; n = 35; P < 0.001). The coefficient of variation of excretion of mevalonic acid during 3 consecutive days was small (9.8%; n = 7). However, urinary output of mevalonic acid was significantly higher during the night (164 +/- 14 micrograms/12-h) than during the day (129 +/- 9 micrograms/12-h; n = 11; P < 0.05). In patients treated with simvastatin (40 mg/day) for 6 weeks, the ratio of mevalonic acid to creatinine in a morning urine sample decreased significantly compared to pretreatment values (110 +/- 25 micrograms/g vs. 66 +/- 25 micrograms/g; P < 0.001). Furthermore, the ratio of mevalonic acid to creatinine in a morning urine sample correlated with the ratio from the 24-h collection period (r = 0.714; n = 34; P < 0.001). The results indicate that the analysis of urinary mevalonic acid, either in 24-h collection or in a single morning sample, is an attractive method for evaluation of long and very short term changes of the rates of cholesterol synthesis. PMID:8906596

  3. Effect of α-linolenic acid and DHA intake on lipogenesis and gene expression involved in fatty acid metabolism in growing-finishing pigs.

    PubMed

    De Tonnac, A; Labussière, E; Vincent, A; Mourot, J

    2016-07-01

    The regulation of lipogenesis mechanisms related to consumption of n-3 PUFA is poorly understood. The aim of the present study was to find out whether α-linolenic acid (ALA) or DHA uptake can have an effect on activities and gene expressions of enzymes involved in lipid metabolism in the liver, subcutaneous adipose tissue and longissimus dorsi (LD) muscle of growing-finishing pigs. Six groups of ten pigs received one of six experimental diets supplemented with rapeseed oil in the control diet, extruded linseed, microalgae or a mixture of both to implement different levels of ALA and DHA with the same content in total n-3. Results were analysed for linear and quadratic effects of DHA intake. The results showed that activities of malic enzyme (ME) and fatty acid synthase (FAS) decreased linearly in the liver with dietary DHA. Although the expression of the genes of these enzymes and their activities were poorly correlated, ME and FAS expressions also decreased linearly with DHA intake. The intake of DHA down-regulates the expressions of other genes involved in fatty acid (FA) metabolism in some tissues of pigs, such as fatty acid desaturase 2 and sterol-regulatory element binding transcription factor 1 in the liver and 2,4-dienoyl CoA reductase 2 in the LD muscle. FA oxidation in the LD muscle and FA synthesis decreased in the liver with increasing amount of dietary DHA, whereas a retroconversion of DHA into EPA seems to be set up in this last tissue. PMID:27181335

  4. Effect of the ratios of unsaturated fatty acids on the expressions of genes related to fat and protein in the bovine mammary epithelial cells.

    PubMed

    Sheng, R; Yan, S M; Qi, L Z; Zhao, Y L

    2015-04-01

    The objective of this study was to evaluate the effects of the different ratios of unsaturated fatty acids (UFAs) (oleic acid, linoleic acid, and linolenic acid) on the cell viability and triacylglycerol (TAG) content, as well as the mRNA expression of the genes related to lipid and protein synthesis in bovine mammary epithelial cells (BMECs). Primary cells were isolated from the mammary glands of Holstein dairy cows and were passaged twice. Afterward, the cells were randomly allocated to six treatments, five UFA-treated groups, and one control group. For all of the treatments, the the fetal bovine serum in the culture solution was replaced with fatty acid-free BSA (1 g/L), and the cells were treated with different ratios of oleic, linoleic, and linolenic acids (0.75:4:1, 1.5:10:1, 2:13.3:1, 3:20:1, and 4:26.7:1) for 48 h, which were group 1 to group 5. The control culture solution contained only fatty acid-free BSA without UFAs (0 μM). The results indicated that the cell viability was not affected by adding different ratios of UFAs, but the accumulation of TAG was significantly influenced by supplementing with different ratios of UFAs. Adding different ratios of UFAs suppressed the expression of ACACA and FASN but had the opposite effect on the abundances of FABP3 and CD36 mRNA. The expression levels of PPARG, SPEBF1, CSN1S1, and CSN3 mRNA in the BMECs were affected significantly after adding different ratios of UFAs. Our results suggested that groups 1, 2, and 3 (0.75:4:1, 1.5:10:1, and 2:13.3:1) had stronger auxo-action on fat synthesis in the BMECs, where group 3 (2:13.3:1) was the best, followed by group 4 (3:20:1). However, group 5 (4:26.7:1) was the worst. Genes related to protein synthesis in the BMECs were better promoted in groups 2 and 3, and group 3 had the strongest auxo-action, whereas the present study only partly examined the regulation of protein synthesis at the transcriptional level; more studies on translation level are needed in the future

  5. Identification of a 12-gene fusaric acid biosynthetic gene cluster in Fusarium species through comparative and functional genomics

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In fungi, genes involved in biosynthesis of a secondary metabolite (SM) are often located adjacent to one another in the genome and are coordinately regulated. These SM biosynthetic gene clusters typically encode enzymes, one or more transcription factors, and a transport protein. Fusaric acid is a ...

  6. Novel Insights into Seed Fatty Acid Synthesis and Modification Pathways from Genetic Diversity and Quantitative Trait Loci Analysis of the Brassica C Genome1[OA

    PubMed Central

    Barker, Guy C.; Larson, Tony R.; Graham, Ian A.; Lynn, James R.; King, Graham J.

    2007-01-01

    Natural genetic variation in fatty acid synthesis and modification pathways determine the composition of vegetable oils, which are major components of human diet and renewable products. Based on known pathways we combined diversity and genetic analysis of metabolites to infer the existence of enzymes encoded by distinct loci, and associated these with specific elongation steps or subpathways. A total of 107 lines representing different Brassica genepools revealed considerable variation for 18 seed fatty acid products. The effect of genetic variation within a single biochemical step on subsequent products was demonstrated using a correlation matrix of scatterplots, and by calculating relative step yields. Surprisingly, diploid Brassica oleracea segregating populations had a similar range of variation for individual fatty acids as across the whole genepool. This allowed identification of 22 quantitative trait loci (QTL) associated with activity in the plastid, early stages of synthesis, desaturation, and elongases. Four QTL were assigned to early stages of synthesis, seven to subpathway specific or general elongase activity, one to ketoacyl acyl-carrier protein synthetase, and two each to fatty acid desaturase and either desaturase or fatty acyl-carrier protein thioesterase. An additional 10 QTL had distinct effects but were not assigned specific functions. Where contrasting behavior in more than one subpathway was detected, we inferred QTL specificity for particular combinations of substrate and product. The assignment of enzyme function to QTL was consistent with the known position of some Brassicaeae candidate genes and collinear regions of the Arabidopsis (Arabidopsis thaliana) genome. PMID:17573542

  7. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    PubMed Central

    Feagin, Trevor A.; Shah, Nirmal I.; Heemstra, Jennifer M.

    2012-01-01

    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  8. Convenient and scalable synthesis of fmoc-protected Peptide nucleic Acid backbone.

    PubMed

    Feagin, Trevor A; Shah, Nirmal I; Heemstra, Jennifer M

    2012-01-01

    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  9. Synthesis and phosphorylation of the glial fibrillary acidic protein during brain development: A tissue slice study

    SciTech Connect

    Noetzel, M.J. )

    1990-01-01

    Brain slices were incubated with either (3H) amino acids or (32P) orthophosphate in order to characterize the synthesis and phosphorylation of the glial fibrillary acidic protein (GFAP) in the rat nervous system. The incorporation of (3H) amino acids into GFAP was found to increase significantly during early postnatal development, reaching a peak of activity on day 5 of life and then declining over the next 2 weeks. Concomitant with this peak of synthetic activity the content of GFAP in rat brain was also observed to increase dramatically. GFAP continued to accumulate in brain through postnatal day 30 despite a decrease in the synthesis of the protein. These results indicate that the increase in GFAP during the first month of life cannot be ascribed solely to the rate of GFAP synthesis. The findings are consistent with the hypothesis that during later stages of astrocytic development the accumulation of GFAP may be primarily dependent upon a low rate of protein degradation. The pattern of GFAP phosphorylation in the developing rat brain differed from that observed for the incorporation of (3H) amino acids. The peak incorporation of 32P into GFAP occurred on postnatal day 10 at a time when synthesis of the protein had declined by 43%. These findings suggest that during development phosphorylation of GFAP is mediated by factors different from those directing its synthesis. In addition, phosphorylation of GFAP did not alter its solubility in cytoskeletal preparations indicating that GFAP phosphorylation is probably not a major regulatory mechanism in disassembly of the astroglial filaments.

  10. Antiproliferative Effect of Ascorbic Acid Is Associated with the Inhibition of Genes Necessary to Cell Cycle Progression

    PubMed Central

    Belin, Sophie; Kaya, Ferdinand; Duisit, Ghislaine; Giacometti, Sarah; Ciccolini, Joseph; Fontés, Michel

    2009-01-01

    Background Ascorbic acid (AA), or Vitamin C, is most well known as a nutritional supplement with antioxidant properties. Recently, we demonstrated that high concentrations of AA act on PMP22 gene expression and partially correct the Charcot-Marie-Tooth disease phenotype in a mouse model. This is due to the capacity of AA, but not other antioxidants, to down-modulate cAMP intracellular concentration by a competitive inhibition of the adenylate cyclase enzymatic activity. Because of the critical role of cAMP in intracellular signalling, we decided to explore the possibility that ascorbic acid could modulate the expression of other genes. Methods and Findings Using human pangenomic microarrays, we found that AA inhibited the expression of two categories of genes necessary for cell cycle progression, tRNA synthetases and translation initiation factor subunits. In in vitro assays, we demonstrated that AA induced the S-phase arrest of proliferative normal and tumor cells. Highest concentrations of AA leaded to necrotic cell death. However, quiescent cells were not susceptible to AA toxicity, suggesting the blockage of protein synthesis was mainly detrimental in metabolically-active cells. Using animal models, we found that high concentrations of AA inhibited tumor progression in nude mice grafted with HT29 cells (derived from human colon carcinoma). Consistently, expression of tRNA synthetases and ieF2 appeared to be specifically decreased in tumors upon AA treatment. Conclusions AA has an antiproliferative activity, at elevated concentration that could be obtained using IV injection. This activity has been observed in vitro as well in vivo and likely results from the inhibition of expression of genes involved in protein synthesis. Implications for a clinical use in anticancer therapies will be discussed. PMID:19197388

  11. Synthesis and antihyperlipidemic activity of piperic acid derivatives.

    PubMed

    A, Rong; Bao, Narisu; Sun, Zhaorigetu; Borjihan, Gereltu; Qiao, Yanjiang; Jin, Zhuang

    2015-02-01

    A series of piperic acid derivatives were designed and synthesized from piperine/piperlonguminine, and their antihyperlipidemic activities evaluated in diet-induced hyperlipidemic rats with respect to simvastatin. Two promising analogues 3 and 10 were discovered and their antihyperlipidemic activities were comparable to or better than those of simvastatin. PMID:25920263

  12. Design, synthesis and biological evaluation of novel betulinic acid derivatives

    PubMed Central

    2012-01-01

    Background Tumor, is one of the major reason for human death, due to its widespread occurrence. Betulinic acid derivatives have attracted considerable attention as cancer chemopreventive agents and also as cancer therapeutics. Many of its derivatives inhibit the growth of human cancer cell lines by triggering apoptosis. With this background, we planned to synthesize a series of betulinic acid derivatives to assess their antiproliferation efficacy on human cancer cell lines. Results A series of novel betulinic acid derivatives were designed and synthesized as highlighted by the preliminary antitumor evaluation against MGC-803, PC3, A375, Bcap-37 and A431 human cancer cell lines in vitro. The pharmacological results showed that some of the compounds displayed moderate to high levels of antitumor activities with most of new exhibiting higher inhibitory activities compared to BA. The IC50 values of compound 3c on the five cancer cell lines were 2.3, 4.6, 3.3, 3.6, and 4.3 μM, respectively. Subsequent fluorescence staining and flow cytometry analysis (FCM) indicated that compound 3c could induce apoptosis in MGC-803 and PC3 cell lines, and the apoptosis ratios reached the peak (37.38% and 33.74%) after 36 h of treatment at 10 μM. Conclusions This study suggests that most of betulinic acid derivatives could inhibit the growth of human cancer cell lines. Furthermore, compound 3c could induce apoptosis of cancer cells. PMID:23174002

  13. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  14. Isolation and characterization of a new mutant of Saccharomyces cerevisiae with altered synthesis of 5-aminolevulinic acid.

    PubMed Central

    Carvajal, E; Panek, A D; Mattoon, J R

    1990-01-01

    A new gene, RHM1, required for normal production of 5-aminolevulinic acid by Saccharomyces cerevisiae, was identified by a novel screening method. Ethyl methanesulfonate treatment of a fluorescent porphyric strain bearing the pop3-1 mutation produced nonfluorescent or weakly fluorescent mutants with defects in early stages of tetrapyrrole biosynthesis. Class I mutants defective in synthesis of 5-aminolevulinate regained fluorescence when grown on medium supplemented with 5-aminolevulinate, whereas class II mutants altered in later biosynthetic steps did not. Among six recessive class I mutants, at least three complementation groups were found. One mutant contained an allele of HEM1, the structural gene for 5-aminolevulinate synthase, and two mutants contained alleles of the regulatory gene CYC4. The remaining mutants contained genes complementary to both hem1 and cyc4. Mutant strain DA3-RS3/68 contained mutant gene rhm1, which segregated independently of hem1 and cyc4 during meiosis. 5-Aminolevulinate synthase activity of the rhm1 mutant was 35 to 40% of that of the parental pop3-1 strain, whereas intracellular 5-aminolevulinate concentration was only 3 to 4% of the parental value. Transformation of an rhm1 strain with a multicopy plasmid containing the cloned HEM1 gene restored normal levels of 5-aminolevulinate synthase activity, but intracellular 5-aminolevulinate was increased to only 9 to 10% of normal. We concluded that RHM1 could control either targeting of 5-aminolevulinate synthase to the mitochondrial matrix or the activity of the enzyme in vivo. PMID:2188943

  15. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  16. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2.

    PubMed

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru-Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  17. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  18. A Method for Multiplex Gene Synthesis Employing Error Correction Based on Expression

    PubMed Central

    Hsiau, Timothy H.-C.; Sukovich, David; Elms, Phillip; Prince, Robin N.; Stritmatter, Tobias; Ruan, Paul; Curry, Bo; Anderson, Paige; Sampson, Jeff; Anderson, J. Christopher

    2015-01-01

    Our ability to engineer organisms with new biosynthetic pathways and genetic circuits is limited by the availability of protein characterization data and the cost of synthetic DNA. With new tools for reading and writing DNA, there are opportunities for scalable assays that more efficiently and cost effectively mine for biochemical protein characteristics. To that end, we have developed the Multiplex Library Synthesis and Expression Correction (MuLSEC) method for rapid assembly, error correction, and expression characterization of many genes as a pooled library. This methodology enables gene synthesis from microarray-synthesized oligonucleotide pools with a one-pot technique, eliminating the need for robotic liquid handling. Post assembly, the gene library is subjected to an ampicillin based quality control selection, which serves as both an error correction step and a selection for proteins that are properly expressed and folded in E. coli. Next generation sequencing of post selection DNA enables quantitative analysis of gene expression characteristics. We demonstrate the feasibility of this approach by building and testing over 90 genes for empirical evidence of soluble expression. This technique reduces the problem of part characterization to multiplex oligonucleotide synthesis and deep sequencing, two technologies under extensive development with projected cost reduction. PMID:25790188

  19. A method for multiplex gene synthesis employing error correction based on expression.

    PubMed

    Hsiau, Timothy H-C; Sukovich, David; Elms, Phillip; Prince, Robin N; Strittmatter, Tobias; Stritmatter, Tobias; Ruan, Paul; Curry, Bo; Anderson, Paige; Sampson, Jeff; Anderson, J Christopher

    2015-01-01

    Our ability to engineer organisms with new biosynthetic pathways and genetic circuits is limited by the availability of protein characterization data and the cost of synthetic DNA. With new tools for reading and writing DNA, there are opportunities for scalable assays that more efficiently and cost effectively mine for biochemical protein characteristics. To that end, we have developed the Multiplex Library Synthesis and Expression Correction (MuLSEC) method for rapid assembly, error correction, and expression characterization of many genes as a pooled library. This methodology enables gene synthesis from microarray-synthesized oligonucleotide pools with a one-pot technique, eliminating the need for robotic liquid handling. Post assembly, the gene library is subjected to an ampicillin based quality control selection, which serves as both an error correction step and a selection for proteins that are properly expressed and folded in E. coli. Next generation sequencing of post selection DNA enables quantitative analysis of gene expression characteristics. We demonstrate the feasibility of this approach by building and testing over 90 genes for empirical evidence of soluble expression. This technique reduces the problem of part characterization to multiplex oligonucleotide synthesis and deep sequencing, two technologies under extensive development with projected cost reduction. PMID:25790188

  20. The effects of retinoic acid on immunoglobulin synthesis by human cord blood mononuclear cells.

    PubMed

    Israel, H; Odziemiec, C; Ballow, M

    1991-06-01

    Derivatives of vitamin A have attracted considerable attention as agents which have immune potentiating properties and possibly tumor-suppressive effects. Recent investigations have shown that retinoic acid (RA) can augment immunoglobulin production of B-cell hybridomas from patients with immune deficiency. In this study we examined the ability of RA to modify the mitogen-induced polyclonal immunoglobulin synthesis of cord blood mononuclear cells (CBMC). RA in concentrations ranging from 10(-5) to 10(-7) M augmented IgM synthesis of CBMC in response to formalinized Cowans I strain Staphylococcus aureus (SAC) up to 45.6-fold which was greater at suboptimal responses to SAC. There were no changes in IgG or IgA synthesis and minimal effects on SAC-induced proliferative responses. RA did not produce similar changes in IgM synthesis of SAC-stimulated adult peripheral blood mononuclear cells (PBMC), and RA had no effect on the immunoglobulin synthesis of Epstein-Barr virus (EBV)-stimulated CBMC or adult PBMC. Time course studies showed that peak enhancement occurred when RA was added between 4 and 24 hr after culture initiation and required prior activation by SAC for augmentation of IgM synthesis. Cell separation experiments showed that prior incubation (18 hr) of an enriched T-cell fraction with RA enhanced the IgM synthesis of a T-cell-depleted B-cell fraction. These experiments and the findings that RA-induced augmentation of IgM production in response to SAC, but not to EBV suggest that the immunoregulatory effects of RA may be mediated by either T cells or T-cell products. Further studies will be necessary to understand the mechanism by which RA augments IgM synthesis of CBMC. PMID:2029794

  1. Microsomal Omega-3 Fatty Acid Desaturase Genes in Low Linolenic Acid Soybean Line RG10 and Validation of Major Linolenic Acid QTL

    PubMed Central

    Reinprecht, Yarmilla; Pauls, K. Peter

    2016-01-01

    High levels of linolenic acid (80 g kg−1) are associated with the development of off-flavors and poor stability in soybean oil. The development of low linolenic acid lines such as RG10 (20 g kg−1 linolenic acid) can reduce these problems. The level of linolenic acid in seed oil is determined by the activities of microsomal omega-3 fatty acid desaturases (FAD3). A major linolenic acid QTL (>70% of variation) on linkage group B2 (chromosome Gm14) was previously detected in a recombinant inbred line population from the RG10 × OX948 cross. The objectives of this study were to validate the major linolenic acid QTL in an independent population and characterize all the soybean FAD3 genes. Four FAD3 genes were sequenced and localized in RG10 and OX948 and compared to the genes in the reference Williams 82 genome. The FAD3A gene sequences mapped to the locus Glyma.14g194300 [on the chromosome Gm14 (B2)], which is syntenic to the FAD3B gene (locus Glyma.02g227200) on the chromosome Gm02 (D1b). The location of the FAD3A gene is the same as was previously determined for the fan allele, that conditions low linolenic acid content and several linolenic acid QTL, including Linolen 3-3, mapped previously with the RG10 × OX948 population and confirmed in the PI 361088B × OX948 population as Linolen-PO (FAD3A). The FAD3B gene-based marker, developed previously, was mapped to the chromosome Gm02 (D1b) in a region containing a newly detected linolenic acid QTL [Linolen-RO(FAD3B)] in the RG10 × OX948 genetic map and corresponds well with the in silico position of the FAD3B gene sequences. FAD3C and FAD3D gene sequences, mapped to syntenic regions on chromosomes Gm18 (locus Glyma.18g062000) and Gm11 (locus Glyma.11g227200), respectively. Association of linolenic acid QTL with the desaturase genes FAD3A and FAD3B, their validation in an independent population, and development of FAD3 gene-specific markers should simplify and accelerate breeding for low linolenic acid soybean

  2. Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis

    SciTech Connect

    Yu X. H.; Shanklin J.; Rawat, R.

    2011-05-01

    Cyclopropane fatty acids (CPA) have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE) are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA) distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model plant systems, it represents a strong candidate gene for

  3. Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis

    PubMed Central

    2011-01-01

    Background Cyclopropane fatty acids (CPA) have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE) are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Results Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA) distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. Conclusions In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model plant systems, it

  4. Identification of a novel operon in Lactococcus lactis encoding three enzymes for lactic acid synthesis: phosphofructokinase, pyruvate kinase, and lactate dehydrogenase.

    PubMed Central

    Llanos, R M; Harris, C J; Hillier, A J; Davidson, B E

    1993-01-01

    The discovery of a novel multicistronic operon that encodes phosphofructokinase, pyruvate kinase, and lactate dehydrogenase in the lactic acid bacterium Lactococcus lactis is reported. The three genes in the operon, designated pfk, pyk, and ldh, contain 340, 502, and 325 codons, respectively. The intergenic distances are 87 bp between pfk and pyk and 117 bp between pyk and ldh. Plasmids containing pfk and pyk conferred phosphofructokinase and pyruvate kinase activity, respectively, on their host. The identity of ldh was established previously by the same approach (R. M. Llanos, A. J. Hillier, and B. E. Davidson, J. Bacteriol. 174:6956-6964, 1992). Each of the genes is preceded by a potential ribosome binding site. The operon is expressed in a 4.1-kb transcript. The 5' end of the transcript was determined to be a G nucleotide positioned 81 bp upstream from the pfk start codon. The pattern of codon usage within the operon is highly biased, with 11 unused amino acid codons. This degree of bias suggests that the operon is highly expressed. The three proteins encoded on the operon are key enzymes in the Embden-Meyerhoff pathway, the central pathway of energy production and lactic acid synthesis in L. lactis. For this reason, we have called the operon the las (lactic acid synthesis) operon. Images PMID:8478320

  5. Direct Synthesis of 5-Aryl Barbituric Acids by Rhodium(II)-Catalyzed Reactions of Arenes with Diazo Compounds**

    PubMed Central

    Best, Daniel; Burns, David J; Lam, Hon Wai

    2015-01-01

    A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544

  6. Complestatin exerts antibacterial activity by the inhibition of fatty acid synthesis.

    PubMed

    Kwon, Yun-Ju; Kim, Hyun-Ju; Kim, Won-Gon

    2015-01-01

    Bacterial enoyl-acyl carrier protein (ACP) reductase has been confirmed as a novel target for antibacterial drug development. In the screening of inhibitors of Staphylococcus aureus enoyl-ACP reductase (FabI), complestatin was isolated as a potent inhibitor of S. aureus FabI together with neuroprotectin A and chloropeptin I from Streptomyces chartreusis AN1542. Complestatin and related compounds inhibited S. aureus FabI with IC₅₀ of 0.3-0.6 µM. They also prevented the growth of S. aureus as well as methicillin-resistance S. aureus (MRSA) and quinolone-resistant S. aureus (QRSA), with minimum inhibitory concentrations (MICs) of 2-4 µg/mL. Consistent with its FabI-inhibition, complestatin selectively inhibited the intracellular fatty acid synthesis in S. aureus, whereas it did not affect the macromolecular biosynthesis of other cellular components, such as DNA, RNA, proteins, and the cell wall. Additionally, supplementation with exogenous fatty acids reversed the antibacterial effect of complestatin, demonstrating that it targets fatty acid synthesis. In this study, we reported that complestatin and related compounds showed potent antibacterial activity via inhibiting fatty acid synthesis. PMID:25947917

  7. Synthesis and characterization of a pH responsive folic acid functionalized polymeric drug delivery system.

    PubMed

    Li, Xia; McTaggart, Matt; Malardier-Jugroot, Cecile

    2016-01-01

    We report the computational analysis, synthesis and characterization of folate functionalized poly(styrene-alt-maleic anhydride), PSMA for drug delivery purpose. The selection of the proper linker between the polymer and the folic acid group was performed before conducting the synthesis using Density Functional Theory (DFT). The computational results showed the bio-degradable linker 2, 4-diaminobutyric acid, DABA as a good candidate allowing flexibility of the folic acid group while maintaining the pH sensitivity of PSMA, used as a trigger for drug release. The synthesis was subsequently carried out in multi-step experimental procedures. The functionalized polymer was characterized using InfraRed spectroscopy, Nuclear Magnetic Resonance and Dynamic Light Scattering confirming both the chemical structure and the pH responsiveness of PSMA-DABA-Folate polymers. This study provides an excellent example of how computational chemistry can be used in selection process for the functional materials and product characterization. The pH sensitive polymers are expected to be used in delivering anti-cancer drugs to solid tumors with overly expressed folic acid receptors. PMID:27183249

  8. Role of amidation in bile acid effect on DNA synthesis by regenerating mouse liver.

    PubMed

    Barbero, E R; Herrera, M C; Monte, M J; Serrano, M A; Marin, J J

    1995-06-01

    Effect of bile acids on DNA synthesis by the regenerating liver was investigated in mice in vivo after partial hepatectomy (PH). Radioactivity incorporation into DNA after [14C]thymidine intraperitoneal administration peaked at 48 h after PH. At this time a significant taurocholate-induced dose-dependent reduction in DNA synthesis without changes in total liver radioactivity content was found (half-maximal effect at approximately 0.1 mumol/g body wt). Effect of taurocholate (0.5 mumol/g body wt) was mimicked by chocolate, ursodeoxycholate, deoxycholate, dehydrocholate, tauroursodeoxycholate, taurochenodeoxycholate, and taurodeoxycholate. In contrast, chenodeoxycholate, glycocholate, glycochenodeoxycholate, glycoursodeoxycholate, glycodeoxycholate, 5 beta-cholestane, bromosulfophthalein, and free taurine lacked this effect. No relationship between hydrophobic-hydrophilic balance and inhibitory effect was observed. Analysis by high-performance liquid chromatography indicated that inhibition of thymidine incorporation into DNA was not accompanied by an accumulation of phosphorylated DNA precursors in the liver but rather by a parallel increase in nucleotide catabolism. Bile acid-induced modifications in DNA synthesis were observed in vivo even in the absence of changes in toxicity tests, which suggests that the inhibitory effect shared by most unconjugated and tauroconjugated bile acids but not by glycoconjugated bile acids should be accounted for by mechanisms other than nonselective liver cell injury. PMID:7611405

  9. The PH gene determines fruit acidity and contributes to the evolution of sweet melons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Acids are one of the three major components of fleshy fruit taste, together with sugars and volatile flavor compounds. However, the molecular-genetic control of acid accumulation in fruit is poorly understood and, to date, no genes responsible for acid accumulation in fleshy fruit have been function...

  10. Genome Wide Association Study Identifies 20 Novel Promising Genes Associated with Milk Fatty Acid Traits in Chinese Holstein

    PubMed Central

    Li, Cong; Sun, Dongxiao; Zhang, Shengli; Wang, Sheng; Wu, Xiaoping; Zhang, Qin; Liu, Lin; Li, Yanhua; Qiao, Lv

    2014-01-01

    Detecting genes associated with milk fat composition could provide valuable insights into the complex genetic networks of genes underling variation in fatty acids synthesis and point towards opportunities for changing milk fat composition via selective breeding. In this study, we conducted a genome-wide association study (GWAS) for 22 milk fatty acids in 784 Chinese Holstein cows with the PLINK software. Genotypes were obtained with the Illumina BovineSNP50 Bead chip and a total of 40,604 informative, high-quality single nucleotide polymorphisms (SNPs) were used. Totally, 83 genome-wide significant SNPs and 314 suggestive significant SNPs associated with 18 milk fatty acid traits were detected. Chromosome regions that affect milk fatty acid traits were mainly observed on BTA1, 2, 5, 6, 7, 9, 13, 14, 18, 19, 20, 21, 23, 26 and 27. Of these, 146 SNPs were associated with more than one milk fatty acid trait; most of studied fatty acid traits were significant associated with multiple SNPs, especially C18:0 (105 SNPs), C18 index (93 SNPs), and C14 index (84 SNPs); Several SNPs are close to or within the DGAT1, SCD1 and FASN genes which are well-known to affect milk composition traits of dairy cattle. Combined with the previously reported QTL regions and the biological functions of the genes, 20 novel promising candidates for C10:0, C12:0, C14:0, C14:1, C14 index, C18:0, C18:1n9c, C18 index, SFA, UFA and SFA/UFA were found, which composed of HTR1B, CPM, PRKG1, MINPP1, LIPJ, LIPK, EHHADH, MOGAT1, ECHS1, STAT1, SORBS1, NFKB2, AGPAT3, CHUK, OSBPL8, PRLR, IGF1R, ACSL3, GHR and OXCT1. Our findings provide a groundwork for unraveling the key genes and causal mutations affecting milk fatty acid traits in dairy cattle. PMID:24858810

  11. Biosynthesis of Essential Polyunsaturated Fatty Acids in Wheat Triggered by Expression of Artificial Gene.

    PubMed

    Mihálik, Daniel; Klčová, Lenka; Ondreičková, Katarína; Hudcovicová, Martina; Gubišová, Marcela; Klempová, Tatiana; Čertík, Milan; Pauk, János; Kraic, Ján

    2015-01-01

    The artificial gene D6D encoding the enzyme ∆⁶desaturase was designed and synthesized using the sequence of the same gene from the fungus Thamnidium elegans. The original start codon was replaced by the signal sequence derived from the wheat gene for high-molecular-weight glutenin subunit and the codon usage was completely changed for optimal expression in wheat. Synthesized artificial D6D gene was delivered into plants of the spring wheat line CY-45 and the gene itself, as well as transcribed D6D mRNA were confirmed in plants of T₀ and T₁ generations. The desired product of the wheat genetic modification by artificial D6D gene was the γ-linolenic acid. Its presence was confirmed in mature grains of transgenic wheat plants in the amount 0.04%-0.32% (v/v) of the total amount of fatty acids. Both newly synthesized γ-linolenic acid and stearidonic acid have been detected also in leaves, stems, roots, awns, paleas, rachillas, and immature grains of the T₁ generation as well as in immature and mature grains of the T₂ generation. Contents of γ-linolenic acid and stearidonic acid varied in range 0%-1.40% (v/v) and 0%-1.53% (v/v) from the total amount of fatty acids, respectively. This approach has opened the pathway of desaturation of fatty acids and production of essential polyunsaturated fatty acids in wheat. PMID:26694368

  12. Biosynthesis of Essential Polyunsaturated Fatty Acids in Wheat Triggered by Expression of Artificial Gene

    PubMed Central

    Mihálik, Daniel; Klčová, Lenka; Ondreičková, Katarína; Hudcovicová, Martina; Gubišová, Marcela; Klempová, Tatiana; Čertík, Milan; Pauk, János; Kraic, Ján

    2015-01-01

    The artificial gene D6D encoding the enzyme ∆6desaturase was designed and synthesized using the sequence of the same gene from the fungus Thamnidium elegans. The original start codon was replaced by the signal sequence derived from the wheat gene for high-molecular-weight glutenin subunit and the codon usage was completely changed for optimal expression in wheat. Synthesized artificial D6D gene was delivered into plants of the spring wheat line CY-45 and the gene itself, as well as transcribed D6D mRNA were confirmed in plants of T0 and T1 generations. The desired product of the wheat genetic modification by artificial D6D gene was the γ-linolenic acid. Its presence was confirmed in mature grains of transgenic wheat plants in the amount 0.04%–0.32% (v/v) of the total amount of fatty acids. Both newly synthesized γ-linolenic acid and stearidonic acid have been detected also in leaves, stems, roots, awns, paleas, rachillas, and immature grains of the T1 generation as well as in immature and mature grains of the T2 generation. Contents of γ-linolenic acid and stearidonic acid varied in range 0%–1.40% (v/v) and 0%–1.53% (v/v) from the total amount of fatty acids, respectively. This approach has opened the pathway of desaturation of fatty acids and production of essential polyunsaturated fatty acids in wheat. PMID:26694368

  13. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  14. Synthesis and biological activity of tetralone abscisic acid analogues.

    PubMed

    Nyangulu, James M; Nelson, Ken M; Rose, Patricia A; Gai, Yuanzhu; Loewen, Mary; Lougheed, Brenda; Quail, J Wilson; Cutler, Adrian J; Abrams, Suzanne R

    2006-04-01

    Bicyclic analogues of the plant hormone abscisic acid (ABA) were designed to incorporate the structural elements and functional groups of the parent molecule that are required for biological activity. The resulting tetralone analogues were predicted to have enhanced biological activity in plants, in part because oxidized products would not cyclize to forms corresponding to the inactive catabolite phaseic acid. The tetralone analogues were synthesized in seven steps from 1-tetralone and a range of analogues were accessible through a second route starting with 2-methyl-1-naphthol. Tetralone ABA 8 was found to have greater activity than ABA in two bioassays. The absolute configuration of (+)-8 was established by X-ray crystallography of a RAMP hydrazone derivative. The hydroxymethyl compounds 10 and 11, analogues for studying the roles of 8- and 9-hydroxy ABA 3 and 6, were also synthesized and found to be active. PMID:16557330

  15. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an