Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.
Manandhar, Miglena; Cronan, John E
2017-05-01
Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.
2013-01-01
Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes wemore » successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.« less
Jensen, Kristian K; Previs, Stephen F; Zhu, Lei; Herath, Kithsiri; Wang, Sheng-Ping; Bhat, Gowri; Hu, Guanghui; Miller, Paul L; McLaren, David G; Shin, Myung K; Vogt, Thomas F; Wang, Liangsu; Wong, Kenny K; Roddy, Thomas P; Johns, Douglas G; Hubbard, Brian K
2012-01-15
The liver is a crossroad for metabolism of lipid and carbohydrates, with acetyl-CoA serving as an important metabolic intermediate and a precursor for fatty acid and cholesterol biosynthesis pathways. A better understanding of the regulation of these pathways requires an experimental approach that provides both quantitative metabolic flux measurements and mechanistic insight. Under conditions of high carbohydrate availability, excess carbon is converted into free fatty acids and triglyceride for storage, but it is not clear how excessive carbohydrate availability affects cholesterol biosynthesis. To address this, C57BL/6J mice were fed either a low-fat, high-carbohydrate diet or a high-fat, carbohydrate-free diet. At the end of the dietary intervention, the two groups received (2)H(2)O to trace de novo fatty acid and cholesterol synthesis, and livers were collected for gene expression analysis. Expression of lipid and glucose metabolism genes was determined using a custom-designed pathway focused PCR-based gene expression array. The expression analysis showed downregulation of cholesterol biosynthesis genes and upregulation of fatty acid synthesis genes in mice receiving the high-carbohydrate diet compared with the carbohydrate-free diet. In support of these findings, (2)H(2)O tracer data showed that fatty acid synthesis was increased 10-fold and cholesterol synthesis was reduced by 1.6-fold in mice fed the respective diets. In conclusion, by applying gene expression analysis and tracer methodology, we show that fatty acid and cholesterol synthesis are differentially regulated when the carbohydrate intake in mice is altered.
Engineering Sialic Acid Synthesis Ability in Insect Cells.
Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J
2015-01-01
Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.
Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao
2011-01-01
Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122
Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi
2017-01-01
Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550
Sequeira, Ana Filipa; Brás, Joana L A; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A
2016-12-01
Gene synthesis is becoming an important tool in many fields of recombinant DNA technology, including recombinant protein production. De novo gene synthesis is quickly replacing the classical cloning and mutagenesis procedures and allows generating nucleic acids for which no template is available. In addition, when coupled with efficient gene design algorithms that optimize codon usage, it leads to high levels of recombinant protein expression. Here, we describe the development of an optimized gene synthesis platform that was applied to the large scale production of small genes encoding venom peptides. This improved gene synthesis method uses a PCR-based protocol to assemble synthetic DNA from pools of overlapping oligonucleotides and was developed to synthesise multiples genes simultaneously. This technology incorporates an accurate, automated and cost effective ligation independent cloning step to directly integrate the synthetic genes into an effective Escherichia coli expression vector. The robustness of this technology to generate large libraries of dozens to thousands of synthetic nucleic acids was demonstrated through the parallel and simultaneous synthesis of 96 genes encoding animal toxins. An automated platform was developed for the large-scale synthesis of small genes encoding eukaryotic toxins. Large scale recombinant expression of synthetic genes encoding eukaryotic toxins will allow exploring the extraordinary potency and pharmacological diversity of animal venoms, an increasingly valuable but unexplored source of lead molecules for drug discovery.
Nikitkova, Anna E.; Haase, Elaine M.; Vickerman, M. Margaret; Gill, Steven R.
2012-01-01
Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were differentially expressed in response to the binding of purified human salivary amylase versus exposure to purified heat-denatured amylase. Selected genes found to be differentially expressed were validated by quantitative reverse transcription-PCR (qRT-PCR). Five genes from the fatty acid synthesis (FAS) cluster were highly (10- to 35-fold) upregulated in S. gordonii CH1 cells treated with native amylase relative to those treated with denatured amylase. An abpA-deficient strain of S. gordonii exposed to amylase failed to show a response in FAS gene expression similar to that observed in the parental strain. Predicted phenotypic effects of amylase binding to S. gordonii strain CH1 (associated with increased expression of FAS genes, leading to changes in fatty acid synthesis) were noted; these included increased bacterial growth, survival at low pH, and resistance to triclosan. These changes were not observed in the amylase-exposed abpA-deficient strain, suggesting a role for AbpA in the amylase-induced phenotype. These results provide evidence that the binding of salivary amylase elicits a differential gene response in S. gordonii, resulting in a phenotypic adjustment that is potentially advantageous for bacterial survival in the oral environment. PMID:22247133
Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes
2010-01-01
Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD) 2 and fatty acid elongase (FAE) 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general development of C. sativa should
A Seven-Gene Locus for Synthesis of Phenazine-1-Carboxylic Acid by Pseudomonas fluorescens 2-79
Mavrodi, Dmitri V.; Ksenzenko, Vladimir N.; Bonsall, Robert F.; Cook, R. James; Boronin, Alexander M.; Thomashow, Linda S.
1998-01-01
Pseudomonas fluorescens 2-79 produces the broad-spectrum antibiotic phenazine-1-carboxylic acid (PCA), which is active against a variety of fungal root pathogens. In this study, seven genes designated phzABCDEFG that are sufficient for synthesis of PCA were localized within a 6.8-kb BglII-XbaI fragment from the phenazine biosynthesis locus of strain 2-79. Polypeptides corresponding to all phz genes were identified by analysis of recombinant plasmids in a T7 promoter/polymerase expression system. Products of the phzC, phzD, and phzE genes have similarities to enzymes of shikimic acid and chorismic acid metabolism and, together with PhzF, are absolutely necessary for PCA production. PhzG is similar to pyridoxamine-5′-phosphate oxidases and probably is a source of cofactor for the PCA-synthesizing enzyme(s). Products of the phzA and phzB genes are highly homologous to each other and may be involved in stabilization of a putative PCA-synthesizing multienzyme complex. Two new genes, phzX and phzY, that are homologous to phzA and phzB, respectively, were cloned and sequenced from P. aureofaciens 30-84, which produces PCA, 2-hydroxyphenazine-1-carboxylic acid, and 2-hydroxyphenazine. Based on functional analysis of the phz genes from strains 2-79 and 30-84, we postulate that different species of fluorescent pseudomonads have similar genetic systems that confer the ability to synthesize PCA. PMID:9573209
Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.
Matsuno, Koya; Fujimura, Tatsuhito
2014-03-01
A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Huang, Huan; McIntosh, Avery L.; Martin, Gregory G.; Petrescu, Anca D.; Landrock, Kerstin K.; Landrock, Danilo; Kier, Ann B.; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor-α (PPARα) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPARα transcription of the fatty acid β-oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPARα in the context of high glucose at levels similar to those in uncontrolled diabetes. PMID:23533380
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.
Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.
2014-01-01
SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260
Moire, Laurence; Rezzonico, Enea; Goepfert, Simon; Poirier, Yves
2004-01-01
Arabidopsis expressing the castor bean (Ricinus communis) oleate 12-hydroxylase or the Crepis palaestina linoleate 12-epoxygenase in developing seeds typically accumulate low levels of ricinoleic acid and vernolic acid, respectively. We have examined the presence of a futile cycle of fatty acid degradation in developing seeds using the synthesis of polyhydroxyalkanoate (PHA) from the intermediates of the peroxisomal beta-oxidation cycle. Both the quantity and monomer composition of the PHA synthesized in transgenic plants expressing the 12-epoxygenase and 12-hydroxylase in developing seeds revealed the presence of a futile cycle of degradation of the corresponding unusual fatty acids, indicating a limitation in their stable integration into lipids. The expression profile of nearly 200 genes involved in fatty acid biosynthesis and degradation has been analyzed through microarray. No significant changes in gene expression have been detected as a consequence of the activity of the 12-epoxygenase or the 12-hydroxylase in developing siliques. Similar results have also been obtained for transgenic plants expressing the Cuphea lanceolata caproyl-acyl carrier protein thioesterase and accumulating high amounts of caproic acid. Only in developing siliques of the tag1 mutant, deficient in the accumulation of triacylglycerols and shown to have a substantial futile cycling of fatty acids toward beta-oxidation, have some changes in gene expression been detected, notably the induction of the isocitrate lyase gene. These results indicate that analysis of peroxisomal PHA is a better indicator of the flux of fatty acid through beta-oxidation than the expression profile of genes involved in lipid metabolism.
Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M
2014-02-01
Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.
Biotin and Lipoic Acid: Synthesis, Attachment and Regulation
Cronan, John E.
2014-01-01
Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses
Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko
2014-09-01
Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.
Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S
1996-01-01
Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847
Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-07-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.
Moire, Laurence; Rezzonico, Enea; Goepfert, Simon; Poirier, Yves
2004-01-01
Arabidopsis expressing the castor bean (Ricinus communis) oleate 12-hydroxylase or the Crepis palaestina linoleate 12-epoxygenase in developing seeds typically accumulate low levels of ricinoleic acid and vernolic acid, respectively. We have examined the presence of a futile cycle of fatty acid degradation in developing seeds using the synthesis of polyhydroxyalkanoate (PHA) from the intermediates of the peroxisomal β-oxidation cycle. Both the quantity and monomer composition of the PHA synthesized in transgenic plants expressing the 12-epoxygenase and 12-hydroxylase in developing seeds revealed the presence of a futile cycle of degradation of the corresponding unusual fatty acids, indicating a limitation in their stable integration into lipids. The expression profile of nearly 200 genes involved in fatty acid biosynthesis and degradation has been analyzed through microarray. No significant changes in gene expression have been detected as a consequence of the activity of the 12-epoxygenase or the 12-hydroxylase in developing siliques. Similar results have also been obtained for transgenic plants expressing the Cuphea lanceolata caproyl-acyl carrier protein thioesterase and accumulating high amounts of caproic acid. Only in developing siliques of the tag1 mutant, deficient in the accumulation of triacylglycerols and shown to have a substantial futile cycling of fatty acids toward β-oxidation, have some changes in gene expression been detected, notably the induction of the isocitrate lyase gene. These results indicate that analysis of peroxisomal PHA is a better indicator of the flux of fatty acid through β-oxidation than the expression profile of genes involved in lipid metabolism. PMID:14671017
Liu, Q; Wang, C; Guo, G; Huo, W J; Zhang, S L; Pei, C X; Zhang, Y L; Wang, H
2018-02-12
Branched-chain volatile fatty acids (BCVFA) supplements could promote lactation performance and milk quality by improving ruminal fermentation and milk fatty acid synthesis. This study was conducted to evaluate the effects of BCVFA supplementation on milk performance, ruminal fermentation, nutrient digestibility and mRNA expression of genes related to fatty acid synthesis in mammary gland of dairy cows. A total of 36 multiparous Chinese Holstein cows averaging 606±4.7 kg of BW, 65±5.2 day in milk (DIM) with daily milk production of 30.6±0.72 kg were assigned to one of four groups blocked by lactation number, milk yield and DIM. The treatments were control, low-BCVFA (LBCVFA), medium-BCVFA (MBCVFA) and high-BCVFA (HBCVFA) with 0, 30, 60 and 90 g BCVFA per cow per day, respectively. Experimental periods were 105 days with 15 days of adaptation and 90 days of data collection. Dry matter (DM) intake tended to increase, but BW changes were similar among treatments. Yields of actual milk, 4% fat corrected milk, milk fat and true protein linearly increased, but feed conversion ratio (FCR) linearly decreased with increasing BCVFA supplementation. Milk fat content linearly increased, but true protein content tended to increase. Contents of C4:0, C6:0, C8:0, C10:0, C12:0, C14:0 and C15:0 fatty acids in milk fat linearly increased, whereas other fatty acids were not affected with increasing BCVFA supplementation. Ruminal pH, ammonia N concentration and propionate molar proportion linearly decreased, but total VFA production and molar proportions of acetate and butyrate linearly increased with increasing BCVFA supplementation. Consequently, acetate to propionate ratios linearly increased. Digestibilities of DM, organic matter, CP, NDF and ADF also linearly increased. In addition, mRNA expressions of peroxisome proliferator-activated receptor γ, sterol regulatory element-binding factor 1 and fatty acid-binding protein 3 linearly increased, mRNA expressions of acetyl
USDA-ARS?s Scientific Manuscript database
Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...
WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN
Browse, John
2016-01-01
Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047
Docosahexaenoic Acid (DHA) and Hepatic Gene Transcription1,3
Jump, Donald B.; Botolin, Daniela; Wang, Yun; Xu, Jinghua; Demeure, Olivier; Christian, Barbara
2008-01-01
The type and quantity of dietary fat ingested contributes to the onset and progression of chronic diseases, like diabetes and atherosclerosis. The liver plays a central role in whole body lipid metabolism and responds rapidly to changes in dietary fat composition. Polyunsaturated fatty acids (PUFA) play a key role in membrane composition and function, metabolism and the control of gene expression. Certain PUFA, like the n-3 PUFA, enhance hepatic fatty acid oxidation and inhibit fatty acid synthesis and VLDL secretion, in part, by regulating gene expression. Our studies have established that key transcription factors, like PPARα, SREBP-1, ChREBP and MLX, are regulated by n-3 PUFA, which in turn control levels of proteins involved in lipid and carbohydrate metabolism. Of the n-3 PUFA, 22:6,n-3 has recently been established as a key controller of hepatic lipid synthesis. 22:6,n-3 controls the 26S proteasomal degradation of the nuclear form of SREBP-1. SREBP-1 is a major transcription factor that controls the expression of multiple genes involved fatty acid synthesis and desaturation. 22:6,n-3 suppresses nuclear SREBP-1 which, in turn suppresses lipogenesis. This mechanism is achieved, in part, through control of the phosphorylation status of protein kinases. This review will examine both the general features of PUFA-regulated hepatic gene transcription and highlight the unique mechanisms by which 22:6,n-3 impacts gene expression. The outcome of this analysis will reveal that changes in hepatic 22:6,n-3 content has a major impact on hepatic lipid and carbohydrate metabolism. Moreover, the mechanisms involve 22:6,n-3 control of several well-known signaling pathways, such as Akt, Erk1/2, Gsk3β and PKC (novel or atypical). 22:6,n-3 control of these same signaling pathways in non-hepatic tissues may help explain the diverse actions of n-3 PUFA on such complex physiological processes as visual acuity and learning. PMID:18343222
Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-01-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326
NASA Astrophysics Data System (ADS)
Tang, Nicholas C.; Chilkoti, Ashutosh
2016-04-01
Most genes are synthesized using seamless assembly methods that rely on the polymerase chain reaction (PCR). However, PCR of genes encoding repetitive proteins either fails or generates nonspecific products. Motivated by the need to efficiently generate new protein polymers through high-throughput gene synthesis, here we report a codon-scrambling algorithm that enables the PCR-based gene synthesis of repetitive proteins by exploiting the codon redundancy of amino acids and finding the least-repetitive synonymous gene sequence. We also show that the codon-scrambling problem is analogous to the well-known travelling salesman problem, and obtain an exact solution to it by using De Bruijn graphs and a modern mixed integer linear programme solver. As experimental proof of the utility of this approach, we use it to optimize the synthetic genes for 19 repetitive proteins, and show that the gene fragments are amenable to PCR-based gene assembly and recombinant expression.
Total amino acid stabilization during cell-free protein synthesis reactions.
Calhoun, Kara A; Swartz, James R
2006-05-17
Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.
Overproduction of α-Lipoic Acid by Gene Manipulated Escherichia coli
Sun, Yirong; Zhang, Wenbin; Ma, Jincheng; Pang, Hongshen; Wang, Haihong
2017-01-01
Alpha-lipoic acid (LA) is an important enzyme cofactor widely used by organisms and is also a natural antioxidant for the treatment of pathologies driven by low levels of endogenous antioxidants. In order to establish a safer and more efficient process for LA production, we developed a new biological method for LA synthesis based on the emerging knowledge of lipoic acid biosynthesis. We first cloned the lipD gene, which encodes the lipoyl domain of the E2 subunit of pyruvate dehydrogenase, allowing high levels of LipD production. Plasmids containing genes for the biosynthesis of LA were subsequently constructed utilizing various vectors and promotors to produce high levels of LA. These plasmids were transformed into the Escherichia coli strain BL21. Octanoic acid (OA) was used as the substrate for LA synthesis. One transformant, YS61, which carried lipD, lplA, and lipA, produced LA at levels over 200-fold greater than the wild-type strain, showing that LA could be produced efficiently in E. coli using genetic engineering methods. PMID:28068366
My, L.; Ghandour Achkar, N.; Viala, J. P.
2015-01-01
ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator
In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.
Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup
2017-05-18
Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lake, April D.; Novak, Petr; Shipkova, Petia
2013-04-15
Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile
Xie, Peng; Wang, Xue-Ping; Bu, Zhu; Zou, Xiao-Ting
2017-10-01
1. The growth performance of squabs reared solely by male or female parent pigeons was measured, and the changes of lipid content of crop milk and the expression profiles of genes potentially involved in lipid accumulation by crop tissues of parent pigeons were evaluated during incubation and chick rearing. 2. Squabs increased in body weight during 25 d of rearing, whereas both male and female pigeons lost weight after finishing rearing chicks, and the weight loss of male pigeons was significantly greater than that of female parent pigeons. Lipid content of crop milk from both parent pigeons gradually decreased to the crude fat level in the formulated diet after 10 d (R10) of chick rearing. 3. The gene expression of fatty acid translocase (FAT/CD36), fatty acid-binding protein 5 (EFABP) and acyl-CoA-binding protein (ACBP) in male pigeon crop tissue were the greatest at 17 d (I17) of incubation. In female pigeons, FAT/CD36 expression was the highest at I14, and both EFABP and ACBP expression peaked at I14 and R7. The expression of acetyl-CoA carboxylase and fatty acid synthase in male pigeons reached the maximum level at R1, while they peaked at I14 and I17, respectively in female pigeons. The gene expression of peroxisome proliferators-activated receptor-gamma (PPARγ) was the greatest at I17 in the male, while it was at I14 in the female. However, no regular changing pattern was found in PPARα gene expression in male pigeons. 4. These results indicated that male and female pigeons may make different contributions in rearing squabs. The gene expression study suggested that fatty acids used in lipid biosynthesis of crop milk probably originated from both exogenous supply and de novo synthesis. The sex of the parent pigeon affected the lipid content of crop milk and the expression profiles of genes involved in fatty acid transportation and lipogenesis.
Janmeda, Mamta; Kharadi, Vishnu; Pandya, Gaurav; Brahmkshtri, Balkrishna; Ramani, Umed; Tyagi, Kuldeep
2017-01-01
Aim: Aim of the study was to study the relative gene expression of genes associated with fatty acid synthesis at 60 days postpartum (pp) in bovine mammary epithelial cells (MECs) of Surti and Jafarabadi buffaloes. Materials and Methods: A total of 10 healthy Surti and Jafarabadi buffaloes of each breed were selected at random from Livestock Research Station, Navsari and Cattle Breeding Farm, Junagadh, Gujarat, respectively, for this study. Milk sample was collected from each selected buffalo at day 60 pp from these two breeds to study relative gene expression of major milk fat genes using non-invasive approach of obtaining primary bovine MECs (pBMEC) from milk samples. Results: In this study overall, the relative expression of the six major milk lipogenic genes butyrophilin subfamily 1 member A1 (BTN1A1), stearoyl-CoA desaturase (SCD), lipoprotein lipase (LPL), glycerol-3-phosphate acyltransferase mitochondrial (GPAM), acetyl-coenzyme A carboxylase alpha (ACACA), and lipin (LPIN) did not show changes in expression patterns at 60th day of lactation in both Surti and Jafarabadi buffaloes. Conclusion: The pBMEC can be successfully recovered from 1500 ml of milk of Surti and Jafarabadi buffaloes using antibody-mediated magnetic bead separation and can be further used for recovering RNA for down step quantification of major milk lipogenic gene expression. The relative expression of the six major milk lipogenic genes BTN1A1, SCD, LPL, GPAM, ACACA, and LPIN did not show changes in expression patterns in both Surti and Jafarabadi buffaloes, suggesting expression levels of lipogenic genes are maintained almost uniform till peak lactation without any significant difference. PMID:28620248
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1998-01-01
Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.
Memory responses of jasmonic acid-associated Arabidopsis genes to a repeated dehydration stress.
Liu, Ning; Staswick, Paul E; Avramova, Zoya
2016-11-01
Dehydration stress activates numerous genes co-regulated by diverse signaling pathways. Upon repeated exposures, however, a subset of these genes does not respond maintaining instead transcription at their initial pre-stressed levels ('revised-response' genes). Most of these genes are involved in jasmonic acid (JA) biosynthesis, JA-signaling and JA-mediated stress responses. How these JA-associated genes are regulated to provide different responses to similar dehydration stresses is an enigma. Here, we investigate molecular mechanisms that contribute to this transcriptional behavior. The memory-mechanism is stress-specific: one exposure to dehydration stress or to abscisic acid (ABA) is required to prevent transcription in the second. Both ABA-mediated and JA-mediated pathways are critical for the activation of these genes, but the two signaling pathways interact differently during a single or multiple encounters with dehydration stress. Synthesis of JA during the first (S1) but not the second dehydration stress (S2) accounts for the altered transcriptional responses. We propose a model for these memory responses, wherein lack of MYC2 and of JA synthesis in S2 is responsible for the lack of expression of downstream genes. The similar length of the memory displayed by different memory-type genes suggests biological relevance for transcriptional memory as a gene-regulating mechanism during recurring bouts of drought. © 2016 John Wiley & Sons Ltd.
Tolerance to acetic acid is improved by mutations of the TATA-binding protein gene.
An, Jieun; Kwon, Hyeji; Kim, Eunjung; Lee, Young Mi; Ko, Hyeok Jin; Park, Hongjae; Choi, In-Geol; Kim, Sooah; Kim, Kyoung Heon; Kim, Wankee; Choi, Wonja
2015-03-01
Screening a library of overexpressing mutant alleles of the TATA-binding gene SPT15 yielded two Saccharomyces cerevisiae strains (MRRC 3252 and 3253) with enhanced tolerance to acetic acid. They were also tolerant to propionic acid and hydrogen peroxide. Transcriptome profile analysis identified 58 upregulated genes and 106 downregulated genes in MRRC 3252. Stress- and protein synthesis-related transcription factors were predominantly enriched in the upregulated and downregulated genes respectively. Eight deletion mutants for some of the highly downregulated genes were acetic acid-tolerant. The level of intracellular reactive oxygen species was considerably lessened in MRRC 3252 and 3253 upon exposure to acetic acid. Metabolome profile analysis revealed that intracellular concentrations of 5 and 102 metabolites were increased and decreased, respectively, in MRRC 3252, featuring a large increase of urea and a significant decrease of amino acids. The dur1/2Δmutant, in which the urea degradation gene DUR1/2 is deleted, displayed enhanced tolerance to acetic acid. Enhanced tolerance to acetic acid was also observed on the medium containing a low concentration of amino acids. Taken together, this study identified two SPT15 alleles, nine gene deletions and low concentration of amino acids in the medium that confer enhanced tolerance to acetic acid. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Meganathan, R; Bentley, R
1983-01-01
Cell-free extracts of various strains of Escherichia coli synthesize the menaquinone biosynthetic intermediate o-succinylbenzoic acid (OSB) when supplied with chorismic acid, 2-ketoglutaric acid, and thiamine pyrophosphate (TPP). To assay for OSB synthesis, 2-[U-14C]ketoglutaric acid was used as substrate, and the synthesized OSB was examined by radiogas chromatography (as the dimethyl ester). [U-14C]Shikimic acid also gave rise to radioactive OSB if the cofactors necessary for enzymatic conversion to chorismic acid were added. Use of 2-[1-14C]ketoglutaric acid does not give rise to labeled OSB. In the absence of TPP during the incubations, OSB synthesis was much reduced; these observations are consistent with the proposed role for the succinic semialdehyde-TPP anion as the reagent adding to chorismic acid. Extracts of cells from menC and menD mutants did not form OSB separately, but did so in combination. There was evidence for formation of a product, X, by extracts of a menC mutant incubated with chorismic acid, TPP, and 2-ketoglutaric acid; X was converted to OSB by extracts of a menD mutant. It appears that the intermediate, X, is formed by one gene product and converted to OSB by the second gene product. PMID:6337125
Champier, Jacques; Claustrat, Francine; Nazaret, Nicolas; Fèvre Montange, Michelle; Claustrat, Bruno
2012-02-01
Folate is essential for purine and thymidylate biosynthesis and in methyl transfer for DNA methylation. Folate deficiency alters the secretion of melatonin, a hormone involved in circadian rhythm entrainment, and causes hyperhomocysteinemia because of disruption of homocysteine metabolism. Adverse effects of homocysteine include the generation of free radicals, activation of proliferation or apoptosis, and alteration of gene expression. The liver is an important organ for folate metabolism, and its genome analysis has revealed numerous clock-regulated genes. The variations at the level of their expression during folate deficiency are not known. The aim of our study was to investigate the effects of folate deficiency on gene expression in the mouse liver. A control group receiving a synthetic diet and a folate-depleted group were housed for 4 weeks on a 12-hour/12-hour light/dark cycle. Three mice from each group were euthanized under dim red light at the beginning of the light cycle, and 3, at the beginning of the dark period. Gene expression was studied in a microarray analysis. Of the 53 genes showing modified daily expression in the controls, 52 showed a less marked or no difference after folate depletion. Only 1, lpin1, showed a more marked difference. Ten genes coding for proteins involved in lipid metabolism did not show a morning/evening difference in controls but did after folate depletion. This study shows that, in the mouse liver, dietary folate depletion leads to major changes in expression of several genes involved in fatty acid metabolism, DNA synthesis, and expression of circadian genes. Copyright © 2012 Elsevier Inc. All rights reserved.
Engineer, Anupama S; Dhakephalkar, Anita P; Gaikaiwari, Raghavendra P; Dhakephalkar, Prashant K
2013-12-01
Hydantoinase-mediated enzymatic synthesis of optically pure carbamoyl amino acids was investigated as an environmentally friendly, energy-efficient alternative to the otherwise energy-intensive, polluting chemical synthesis. Hydantoinase-producing bacterial strain was identified as Pseudomonas aeruginosa by 16S rRNA gene sequencing and biochemical profiling using the BIOLOG Microbial Identification System. Hydantoinase activity was assessed using hydantoin analogs and 5-monosubstituted hydantoins as substrates in a colorimetric assay. The hydantoinase gene was PCR amplified using gene-specific primers and sequenced on an automated gene analyzer. Hydantoinase gene sequence of P. aeruginosa MCM B-887 revealed maximum homology of only 87 % with proven hydantoinase gene sequences in GenBank. MCM B-887 resting cells converted >99 % of substrate into N-carbamoyl amino acids under optimized condition at 42 °C, pH 8.0, and 100 mM substrate concentration in <120 min. Hydantoin hydrolyzing activity was D-selective and included broad substrate profile of 5-methyl hydantoin, 5-phenyl hydantoin, 5-hydroxyphenyl hydantoin, o-chlorophenyl hydantoin, as well as hydantoin analogs such as allantoin, dihydrouracil, etc. MCM B-887 resting cells may thus be suitable for bio-transformations leading to the synthesis of optically pure, unnatural carbamoyl amino acids of industrial importance.
Ding, Zhen; Liu, Guo-Liang; Li, Xiang; Chen, Xue-Yan; Wu, Yi-Xia; Cui, Can-Can; Zhang, Xi; Yang, Guang; Xie, Lin
2016-06-01
The fatty acid desaturase (FADS) controls polyunsaturated fatty acid (PUFA) synthesis in human tissues and breast milk. Evaluate the influence of 10 single nucleotide polymorphisms (SNPs) and various haplotypes in the FADS gene cluster (FADS1, FADS2, FADS3) on PUFA concentration in the breast milk of 209 healthy Chinese women. PUFA concentrations were measured in breast milk using gas chromatography and genotyping was performed using the Sequenom Mass Array system. A SNP (rs1535) and 2-locus haplotypes (rs3834458-rs1535, rs1535-rs174575) in the FADS2 gene were associated with concentrations of γ-linoleic acid (GLA) and arachidonic acid (AA) in breast milk. Likewise, in the FADS1 gene, a 2-locus constructed haplotype (rs174547-rs174553) also affected GLA and AA concentration (P<0.05 for all). Minor allele carriers of the SNP and haplotypes described above had lower concentrations of GLA and AA. In the FADS2 gene, the 3-locus haplotype rs3834458-rs1535-rs174575, significantly affected concentrations of GLA but not AA. Pairwise comparison showed that individuals major homozygous for the SNP rs1000778 in the FADS3 gene had lower concentrations of ALA and linoleic acid (LA) in their breast milk. Polymorphisms in the FADS gene cluster influence PUFA concentrations in the breast milk of Chinese Han lactating women. Copyright © 2016 Elsevier Ltd. All rights reserved.
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
Energetics of amino acid synthesis in hydrothermal ecosystems
NASA Technical Reports Server (NTRS)
Amend, J. P.; Shock, E. L.
1998-01-01
Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.
Moeder, Wolfgang; Barry, Cornelius S.; Tauriainen, Airi A.; Betz, Christian; Tuomainen, Jaana; Utriainen, Merja; Grierson, Donald; Sandermann, Heinrich; Langebartels, Christian; Kangasjärvi, Jaakko
2002-01-01
We show that above a certain threshold concentration, ozone leads to leaf injury in tomato (Lycopersicon esculentum). Ozone-induced leaf damage was preceded by a rapid increase in 1-aminocyclopropane-1-carboxylic acid (ACC) synthase activity, ACC content, and ethylene emission. Changes in mRNA levels of specific ACC synthase, ACC oxidase, and ethylene receptor genes occurred within 1 to 5 h. Expression of the genes encoding components of ethylene biosynthesis and perception, and biochemistry of ethylene synthesis suggested that ozone-induced ethylene synthesis in tomato is under biphasic control. In transgenic plants containing an LE-ACO1 promoter-β-glucuronidase fusion construct, β-glucuronidase activity increased rapidly at the beginning of the O3 exposure and had a spatial distribution resembling the pattern of extracellular H2O2 production at 7 h, which coincided with the cell death pattern after 24 h. Ethylene synthesis and perception were required for active H2O2 production and cell death resulting in visible tissue damage. The results demonstrate a selective ozone response of ethylene biosynthetic genes and suggest a role for ethylene, in combination with the burst of H2O2 production, in regulating the spread of cell death. PMID:12481074
All-trans retinoic acid regulates hepatic bile acid homeostasis
Yang, Fan; He, Yuqi; Liu, Hui-Xin; Tsuei, Jessica; Jiang, Xiaoyue; Yang, Li; Wang, Zheng-Tao; Wan, Yu-Jui Yvonne
2014-01-01
Retinoic acid (RA) and bile acids share common roles in regulating lipid homeostasis and insulin sensitivity. In addition, the receptor for RA (retinoid x receptor) is a permissive partner of the receptor for bile acids, farnesoid x receptor (FXR/NR1H4). Thus, RA can activate the FXR-mediated pathway as well. The current study was designed to understand the effect of all-trans RA on bile acid homeostasis. Mice were fed an all-trans RA-supplemented diet and the expression of 46 genes that participate in regulating bile acid homeostasis was studied. The data showed that all-trans RA has a profound effect in regulating genes involved in synthesis and transport of bile acids. All-trans RA treatment reduced the gene expression levels of Cyp7a1, Cyp8b1, and Akr1d1, which are involved in bile acid synthesis. All-trans RA also decreased the hepatic mRNA levels of Lrh-1 (Nr5a2) and Hnf4α (Nr2a1), which positively regulate the gene expression of Cyp7a1 and Cyp8b1. Moreover, all-trans RA induced the gene expression levels of negative regulators of bile acid synthesis including hepatic Fgfr4, Fxr, and Shp (Nr0b2) as well as ileal Fgf15. All-trans RA also decreased the expression of Abcb11 and Slc51b, which have a role in bile acid transport. Consistently, all-trans RA reduced hepatic bile acid levels and the ratio of CA/CDCA, as demonstrated by liquid chromatography-mass spectrometry. The data suggest that all-trans RA-induced SHP may contribute to the inhibition of CYP7A1 and CYP8B1, which in turn reduces bile acid synthesis and affects lipid absorption in the gastrointestinal tract. PMID:25175738
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.
1989-01-01
Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmidsmore » consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.« less
Davis, J.W. Jr.
1979-09-21
A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Repa, J J; Lund, E G; Horton, J D; Leitersdorf, E; Russell, D W; Dietschy, J M; Turley, S D
2000-12-15
Sterol 27-hydroxylase (CYP27) participates in the conversion of cholesterol to bile acids. We examined lipid metabolism in mice lacking the Cyp27 gene. On normal rodent chow, Cyp27(-/-) mice have 40% larger livers, 45% larger adrenals, 2-fold higher hepatic and plasma triacylglycerol concentrations, a 70% higher rate of hepatic fatty acid synthesis, and a 70% increase in the ratio of oleic to stearic acid in the liver versus Cyp27(+/+) controls. In Cyp27(-/-) mice, cholesterol 7alpha-hydroxylase activity is increased 5-fold, but bile acid synthesis and pool size are 47 and 27%, respectively, of those in Cyp27(+/+) mice. Intestinal cholesterol absorption decreases from 54 to 4% in knockout mice, while fecal neutral sterol excretion increases 2.5-fold. A compensatory 2.5-fold increase in whole body cholesterol synthesis occurs in Cyp27(-/-) mice, principally in liver, adrenal, small intestine, lung, and spleen. The mRNA for the cholesterogenic transcription factor sterol regulatory element-binding protein-2 (SREBP-2) and mRNAs for SREBP-2-regulated cholesterol biosynthetic genes are elevated in livers of mutant mice. In addition, the mRNAs encoding the lipogenic transcription factor SREBP-1 and SREBP-1-regulated monounsaturated fatty acid biosynthetic enzymes are also increased. Hepatic synthesis of fatty acids and accumulation of triacylglycerols increases in Cyp27(-/-) mice and is associated with hypertriglyceridemia. Cholic acid feeding reverses hepatomegaly and hypertriglyceridemia but not adrenomegaly in Cyp27(-/-) mice. These studies confirm the importance of CYP27 in bile acid synthesis and they reveal an unexpected function of the enzyme in triacylglycerol metabolism.
Abscisic Acid Synthesis and Response
Finkelstein, Ruth
2013-01-01
Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463
Wu, Ting; Wang, Yi; Zheng, Yi; Fei, Zhangjun; Dandekar, Abhaya M; Xu, Kenong; Han, Zhenhai; Cheng, Lailiang
2015-09-01
Sorbitol is a major product of photosynthesis in apple (Malus domestica) that is involved in carbohydrate metabolism and stress tolerance. However, little is known about how the global transcript levels in apple leaves respond to decreased sorbitol synthesis. In this study we used RNA sequencing (RNA-seq) profiling to characterize the transcriptome of leaves from transgenic lines of the apple cultivar 'Greensleeves' exhibiting suppressed expression of aldose-6-phosphate reductase (A6PR) to gain insights into sorbitol function and the consequences of decreased sorbitol synthesis on gene expression. We observed that, although the leaves of the low sorbitol transgenic lines accumulate higher levels of various primary metabolites, only very limited changes were found in the levels of transcripts associated with primary metabolism. We suggest that this is indicative of post-transcriptional and/or post-translational regulation of primary metabolite accumulation and central carbon metabolism. However, we identified significantly enriched gene ontology terms belonging to the 'stress related process' category in the antisense lines (P-value < 0.05). These include genes involved in the synthesis/degradation of abscisic acid, salicylic acid and jasmonic acid, nucleotide-binding site leucine-rich repeat (NBS-LRR) disease resistance genes and ATP-binding cassette (ABC) transporter genes. This suggests that sorbitol plays a role in the responses of apple trees to abiotic and biotic stresses. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K
1995-05-20
In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.
USDA-ARS?s Scientific Manuscript database
Background: Perilla (Perilla frutescens (L.) var frutescens) produces high levels of a-linolenic acid (ALA), an omega-3 fatty acid important to health and development. To uncover key genes involved in fatty acid (FA) and triacylglycerol (TAG) synthesis in perilla, we conducted deep sequencing of cD...
Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.
Awasthi, Neeraj Praphulla; Singh, R P
2007-01-01
Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.
[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].
Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua
2016-03-01
Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.
Rincon, Gonzalo; Islas-Trejo, Alma; Castillo, Alejandro R; Bauman, Dale E; German, Bruce J; Medrano, Juan F
2012-02-01
Genes in the sterol regulatory element-binding protein-1 (SREBP1) pathway play a central role in regulation of milk fat synthesis, especially the de-novo synthesis of saturated fatty acids. SCD, a SREBP-responsive gene, is the key enzyme in the synthesis of monounsaturated fatty acids in the mammary gland. In the present study, we discovered SNP in candidate genes associated with this signalling pathway and SCD to identify genetic markers that can be used for genetic and metabolically directed selection in cattle. We resequenced six candidate genes in the SREBP1 pathway (SREBP1, SCAP, INSIG1, INSIG2, MBTPS1, MBTPS2) and two genes for SCD (SCD1 and SCD5) and discovered 47 Tag SNP that were used in a marker-trait association study. Milk and blood samples were collected from Holstein cows in their 1st or 2nd parity at 100-150 days of lactation. Individual fatty acids from C4 to C20, saturated fatty acid (SFA) content, monounsaturated fatty acid content, polyunsaturated fatty acid content and desaturase indexes were measured and used to perform the asociation analysis. Polymorphisms in the SCD5 and INSIG2 genes were the most representative markers associated with SFA/unsaturated fatty acid (UFA) ratio in milk. The analysis of desaturation activity determined that markers in the SCD1 and SCD5 genes showed the most significant effects. DGAT1 K232A marker was included in the study to examine the effect of this marker on the variation of milk fatty acids in our Holstein population. The percentage of variance explained by DGAT1 in the analysis was only 6% of SFA/UFA ratio. Milk fat depression was observed in one of the dairy herds and in this particular dairy one SNP in the SREBP1 gene (rs41912290) accounted for 40% of the phenotypic variance. Our results provide detailed SNP information for key genes in the SREBP1 signalling pathway and SCD that can be used to change milk fat composition by marker-assisted breeding to meet consumer demands regarding human health, as well
Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen
2017-04-01
Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Montagnani, Marco; Abrahamsson, Anna; Gälman, Cecilia; Eggertsen, Gösta; Marschall, Hanns-Ulrich; Ravaioli, Elisa; Einarsson, Curt; Dawson, Paul A
2006-01-01
The etiology of most cases of idiopathic bile acid malabsorption (IBAM) is unknown. In this study, a Swedish family with bile acid malabsorption in three consecutive generations was screened for mutations in the ileal apical sodium-bile acid cotransporter gene (ASBT; gene symbol, SLC10A2) and in the genes for several of the nuclear receptors known to be important for ASBT expression: the farnesoid X receptor (FXR) and peroxisome proliferator activated receptor alpha (PPARα). The patients presented with a clinical history of idiopathic chronic watery diarrhea, which was responsive to cholestyramine treatment and consistent with IBAM. Bile acid absorption was determined using 75Se-homocholic acid taurine (SeHCAT); bile acid synthesis was estimated by measuring the plasma levels of 7α-hydroxy-4-cholesten-3-one (C4). The ASBT, FXR, and PPARα genes in the affected and unaffected family members were analyzed using single stranded conformation polymorphism (SSCP), denaturing HPLC, and direct sequencing. No ASBT mutations were identified and the ASBT gene did not segregate with the bile acid malabsorption phenotype. Similarly, no mutations or polymorphisms were identified in the FXR or PPARα genes associated with the bile acid malabsorption phenotype. These studies indicate that the intestinal bile acid malabsorption in these patients cannot be attributed to defects in ASBT. In the absence of apparent ileal disease, alternative explanations such as accelerated transit through the small intestine may be responsible for the IBAM. PMID:17171805
Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing
2014-01-01
Objective Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods Ligand-based structure-activity models were used for virtual screening of the Specs database (www.specs.net) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. PMID:24878338
Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams
2016-01-01
Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lynch, Caitlin; Pan, Yongmei; Li, Linhao
Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluatedmore » in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches.
Ouellette, Catherine; Cormier, Hubert; Rudkowska, Iwona; Guénard, Frédéric; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude
2013-01-01
Marine omega-3 (n-3) polyunsaturated fatty acids (PUFA) reduce plasma triglyceride (TG) levels. Genetic factors such as single nucleotide polymorphisms (SNPs) could be responsible for the variability of the plasma TG response to n-3 PUFA supplementation. Previous studies have demonstrated that n-3 PUFA supplementation using fish oil modified the expression levels of three genes involved in the TG synthesis pathway (GPAM, AGPAT3 and AGPAT4) in peripheral blood mononuclear cells. A total of 210 subjects consumed 5 g/day of a fish oil supplement for 6 weeks. Plasma lipids were measured before and after the supplementation period. Three SNPs in GPAM, 13 SNPs in AGPAT3 and 35 SNPs in AGPAT4 were genotyped. In an ANOVA for repeated measures adjusted for age, sex and BMI, genotype effects on plasma TG levels were observed for rs1838452 in AGPAT3 as well as for rs746731 and rs2293286 in AGPAT4. Genotype × supplementation interaction effects on plasma TG levels were observed for rs2792751 and rs17129561 in GPAM as well as for rs3798943 and rs9458172 in AGPAT4 (p < 0.05). These results suggest that SNPs in genes involved in the TG synthesis pathway may influence plasma TG levels after n-3 PUFA supplementation. © 2014 S. Karger AG, Basel.
Cheng, Juanli; Ma, Jincheng; Lin, Jinshui; Fan, Zhen-Chuan; Cronan, John E.
2012-01-01
Ralstonia solanacearum, a major phytopathogenic bacterium, causes a bacterial wilt disease in diverse plants. Although fatty acid analyses of total membranes of R. solanacearum showed that they contain primarily palmitic (C16:0), palmitoleic (C16:1) and cis-vaccenic (C18:1) acids, little is known regarding R. solanacearum fatty acid synthesis. The R. solanacearum GMI1000 genome is unusual in that it contains four genes (fabF1, fabF2, fabF3, and fabF4) annotated as encoding 3-ketoacyl-acyl carrier protein synthase II homologues and one gene (fabB) annotated as encoding 3-ketoacyl-acyl carrier protein synthase I. We have analyzed this puzzling apparent redundancy and found that only one of these genes, fabF1, encoded a long-chain 3-ketoacyl-acyl carrier protein synthase, whereas the other homologues did not play roles in R. solanacearum fatty acid synthesis. Mutant strains lacking fabF1 are nonviable, and thus, FabF1 is essential for R. solanacearum fatty acid biosynthesis. Moreover, R. solanacearum FabF1 has the activities of both 3-ketoacyl-acyl carrier protein synthase II and 3-ketoacyl-acyl carrier protein synthase I. PMID:22194290
ERIC Educational Resources Information Center
Forster, Denis; DeKleva, Thomas W.
1986-01-01
Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)
Fatty acid regulates gene expression and growth of human prostate cancer PC-3 cells
NASA Technical Reports Server (NTRS)
Hughes-Fulford, M.; Chen, Y.; Tjandrawinata, R. R.
2001-01-01
It has been proposed that the omega-6 fatty acids increase the rate of tumor growth. Here we test that hypothesis in the PC-3 human prostate tumor. We found that the essential fatty acids, linoleic acid (LA) and arachidonic acid (AA), and the AA metabolite PGE(2) stimulate tumor growth while oleic acid (OA) and the omega-3 fatty acid, eicosapentaenoic acid (EPA) inhibited growth. In examining the role of AA in growth response, we extended our studies to analyze changes in early gene expression induced by AA. We demonstrate that c-fos expression is increased within minutes of addition in a dose-dependent manner. Moreover, the immediate early gene cox-2 is also increased in the presence of AA in a dose-dependent manner, while the constitutive cox-1 message was not increased. Three hours after exposure to AA, the synthesis of PGE(2) via COX-2 was also increased. Previous studies have demonstrated that AA was primarily delivered by low density lipoprotein (LDL) via its receptor (LDLr). Since it is known that hepatomas, acute myelogenous leukemia and colorectal tumors lack normal cholesterol feedback, we examined the role of the LDLr in growth regulation of the PC-3 prostate cancer cells. Analysis of ldlr mRNA expression and LDLr function demonstrated that human PC-3 prostate cancer cells lack normal feedback regulation. While exogenous LDL caused a significant stimulation of cell growth and PGE(2) synthesis, no change was seen in regulation of the LDLr by LDL. Taken together, these data show that normal cholesterol feedback of ldlr message and protein is lost in prostate cancer. These data suggest that unregulated over-expression of LDLr in tumor cells would permit increased availability of AA, which induces immediate early genes c-fos and cox-2 within minutes of uptake.
Fatty acid regulates gene expression and growth of human prostate cancer PC-3 cells.
Hughes-Fulford, M; Chen, Y; Tjandrawinata, R R
2001-05-01
It has been proposed that the omega-6 fatty acids increase the rate of tumor growth. Here we test that hypothesis in the PC-3 human prostate tumor. We found that the essential fatty acids, linoleic acid (LA) and arachidonic acid (AA), and the AA metabolite PGE(2) stimulate tumor growth while oleic acid (OA) and the omega-3 fatty acid, eicosapentaenoic acid (EPA) inhibited growth. In examining the role of AA in growth response, we extended our studies to analyze changes in early gene expression induced by AA. We demonstrate that c-fos expression is increased within minutes of addition in a dose-dependent manner. Moreover, the immediate early gene cox-2 is also increased in the presence of AA in a dose-dependent manner, while the constitutive cox-1 message was not increased. Three hours after exposure to AA, the synthesis of PGE(2) via COX-2 was also increased. Previous studies have demonstrated that AA was primarily delivered by low density lipoprotein (LDL) via its receptor (LDLr). Since it is known that hepatomas, acute myelogenous leukemia and colorectal tumors lack normal cholesterol feedback, we examined the role of the LDLr in growth regulation of the PC-3 prostate cancer cells. Analysis of ldlr mRNA expression and LDLr function demonstrated that human PC-3 prostate cancer cells lack normal feedback regulation. While exogenous LDL caused a significant stimulation of cell growth and PGE(2) synthesis, no change was seen in regulation of the LDLr by LDL. Taken together, these data show that normal cholesterol feedback of ldlr message and protein is lost in prostate cancer. These data suggest that unregulated over-expression of LDLr in tumor cells would permit increased availability of AA, which induces immediate early genes c-fos and cox-2 within minutes of uptake.
Zhang, Lin; Veres-Schalnat, Tracey A; Somogyi, Arpad; Pemberton, Jeanne E; Maier, Raina M
2012-12-01
Rhamnolipids have multiple potential applications as "green" surfactants for industry, remediation, and medicine. As a result, they have been intensively investigated to add to our understanding of their biosynthesis and improve yields. Several studies have noted that the addition of a fatty acid cosubstrate increases rhamnolipid yields, but a metabolic explanation has not been offered, partly because biosynthesis studies to date have used sugar or sugar derivatives as the carbon source. The objective of this study was to investigate the role of fatty acid cosubstrates in improving rhamnolipid biosynthesis. A combination of stable isotope tracing and gene expression assays was used to identify lipid precursors and potential lipid metabolic pathways used in rhamnolipid synthesis when fatty acid cosubstrates are present. To this end, we compared the rhamnolipids produced and their yields using either glucose alone or glucose and octadecanoic acid-d(35) as cosubstrates. Using a combination of sugar and fatty acids, the rhamnolipid yield was significantly higher (i.e., doubled) than when glucose was used alone. Two patterns of deuterium incorporation (either 1 or 15 deuterium atoms) in a single Rha-C(10) lipid chain were observed for octadecanoic acid-d(35) treatment, indicating that in the presence of a fatty acid cosubstrate, both de novo fatty acid synthesis and β-oxidation are used to provide lipid precursors for rhamnolipids. Gene expression assays showed a 200- to 600-fold increase in the expression of rhlA and rhlB rhamnolipid biosynthesis genes and a more modest increase of 3- to 4-fold of the fadA β-oxidation pathway gene when octadecanoic acid was present. Taken together, these results suggest that the simultaneous use of de novo fatty acid synthesis and β-oxidation pathways allows for higher production of lipid precursors, resulting in increased rhamnolipid yields.
Role of fatty-acid synthesis in dendritic cell generation and function.
Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George
2013-05-01
Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.
Regulation of protein synthesis by amino acids in muscle of neonates
Suryawan, Agus; Davis, Teresa A.
2011-01-01
The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Guseva, Natalya V; Rokhlin, Oskar W; Glover, Rebecca A; Cohen, Michael B
2011-07-01
A key player in prostate cancer development and progression is the androgen receptor (AR). Tumor-associated lipogenesis can protect cancer cells from carcinogenic- and therapeutic-associated treatments. Increased synthesis of fatty acids and cholesterol is regulated by androgens through induction of several genes in androgen-responsive cancer cells. Acetyl-CoA-carboxylase-α (ACCA) is a key enzyme in the regulation of fatty acids synthesis. Here we show that AR binds in vivo to intron regions of human ACCA gene. We also show that the level of ACCA protein in LNCaP depends on AR expression and that DHT treatment increases ACCA expression and fatty acid synthesis. Inhibition of ACCA by TOFA (5-tetradecyl-oxy-2-furoic acid) decreases fatty acid synthesis and induces caspase activation and cell death in most PCa cell lines. Our data suggest that TOFA can kill cells via the mitochondrial pathway since we found cytochrome c release after TOFA treatment in androgen sensitive cell lines. The results also imply that the pro-apoptotic effect of TOFA may be mediated via a decrease of neuropilin-1(NRP1) and Mcl-1expression. We have previously reported that Mcl-1 is under AR regulation and plays an important role in resistance to drug-induced apoptosis in prostate cancer cells, and NRP1 is known to regulate Mcl-1 expression. Here, we show for the first time that NRP1 expression is under AR control. Taken together, our data suggest that TOFA is a potent cell death inducing agent in prostate cancer cells.
Synthesis of new kojic acid based unnatural α-amino acid derivatives.
Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan
2015-11-01
An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.
Molla, Mijanur R; Böser, Alexander; Rana, Akshita; Schwarz, Karina; Levkin, Pavel A
2018-04-18
Efficient delivery of nucleic acids into cells is of great interest in the field of cell biology and gene therapy. Despite a lot of research, transfection efficiency and structural diversity of gene-delivery vectors are still limited. A better understanding of the structure-function relationship of gene delivery vectors is also essential for the design of novel and intelligent delivery vectors, efficient in "difficult-to-transfect" cells and in vivo clinical applications. Most of the existing strategies for the synthesis of gene-delivery vectors require multiple steps and lengthy procedures. Here, we demonstrate a facile, three-component one-pot synthesis of a combinatorial library of 288 structurally diverse lipid-like molecules termed "lipidoids" via a thiolactone ring opening reaction. This strategy introduces the possibility to synthesize lipidoids with hydrophobic tails containing both unsaturated bonds and reducible disulfide groups. The whole synthesis and purification are convenient, extremely fast, and can be accomplished within a few hours. Screening of the produced lipidoids using HEK293T cells without addition of helper lipids resulted in identification of highly stable liposomes demonstrating ∼95% transfection efficiency with low toxicity.
Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function
Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George
2013-01-01
Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633
Rewiring protein synthesis: From natural to synthetic amino acids.
Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang
2017-11-01
The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Transaminases for the synthesis of enantiopure beta-amino acids
2012-01-01
Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122
Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis
Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet
2011-01-01
Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689
Liu, Lili; Lin, Ye; Liu, Lixin; Wang, Lina; Bian, Yanjie; Gao, Xuejun; Li, Qingzhang
2016-12-01
Peroxisome proliferator-activated receptor gamma (PPARγ) participates in lipogenesis in rats, goats, and humans. However, the exact mechanism of PPARγ regulation on milk fat synthesis in dairy cow mammary epithelial cells (DCMECs) remains largely unexplored. The aim of this study was to investigate the role of PPARγ regarding milk fat synthesis in DCMECs and to ascertain whether milk fat precursor acetic acid and palmitic acid could interact with PPARγ signaling to regulate milk fat synthesis. For this study, we examined the effects of PPARγ overexpression and gene silencing on cell growth, triacylglycerol synthesis, and the messenger RNA (mRNA) and protein expression levels of genes involved in milk fat synthesis in DCMECs. In addition, we investigated the influences of acetic acid and palmitic acid on the mRNA and protein levels of milk lipogenic genes and triacylglycerol synthesis in DCMECs transfected with PPARγ small interfering RNA (siRNA) and PPARγ expression vector. The results showed that when PPARγ was silenced, cell viability, proliferation, and triacylglycerol secretion were obviously reduced. Gene silencing of PPARγ significantly downregulated the expression levels of milk fat synthesis-related genes in DCMECs. PPARγ overexpression improved cell viability, proliferation, and triacylglycerol secretion. The expression levels of milk lipogenic genes were significantly increased when PPARγ was overexpressed. Acetic acid and palmitic acid could markedly improve triacylglycerol synthesis and upregulate the expression levels of PPARγ and other lipogenic genes in DCMECs. These results suggest that PPARγ is a positive regulator of milk fat synthesis in DCMECs and that acetic acid and palmitic acid could partly regulate milk fat synthesis in DCMECs via PPARγ signaling.
Yao, Jiangwei; Dodson, V. Joshua; Frank, Matthew W.; Rock, Charles O.
2015-01-01
The obligate intracellular parasite Chlamydia trachomatis has a reduced genome but relies on de novo fatty acid and phospholipid biosynthesis to produce its membrane phospholipids. Lipidomic analyses showed that 8% of the phospholipid molecular species synthesized by C. trachomatis contained oleic acid, an abundant host fatty acid that cannot be made by the bacterium. Mass tracing experiments showed that isotopically labeled palmitic, myristic, and lauric acids added to the medium were incorporated into C. trachomatis-derived phospholipid molecular species. HeLa cells did not elongate lauric acid, but infected HeLa cell cultures elongated laurate to myristate and palmitate. The elongated fatty acids were incorporated exclusively into C. trachomatis-produced phospholipid molecular species. C. trachomatis has adjacent genes encoding the separate domains of the bifunctional acyl-acyl carrier protein (ACP) synthetase/2-acylglycerolphosphoethanolamine acyltransferase gene (aas) of Escherichia coli. The CT775 gene encodes an acyltransferase (LpaT) that selectively transfers fatty acids from acyl-ACP to the 1-position of 2-acyl-glycerophospholipids. The CT776 gene encodes an acyl-ACP synthetase (AasC) with a substrate preference for palmitic compared with oleic acid in vitro. Exogenous fatty acids were elongated and incorporated into phospholipids by Escherichia coli-expressing AasC, illustrating its function as an acyl-ACP synthetase in vivo. These data point to an AasC-dependent pathway in C. trachomatis that selectively scavenges host saturated fatty acids to be used for the de novo synthesis of its membrane constituents. PMID:26195634
Chen, Nanhua; LaCrue, Alexis N.; Teuscher, Franka; Waters, Norman C.; Gatton, Michelle L.; Kyle, Dennis E.
2014-01-01
Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. PMID:24913167
Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin
2014-08-01
Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.
The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less
Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; ...
2016-05-26
The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less
Genetics Home Reference: congenital bile acid synthesis defect type 1
... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...
Pathak, Preeti; Liu, Hailiang; Boehme, Shannon; Xie, Cen; Krausz, Kristopher W; Gonzalez, Frank; Chiang, John Y L
2017-06-30
The bile acid-activated receptors, nuclear farnesoid X receptor (FXR) and the membrane Takeda G-protein receptor 5 (TGR5), are known to improve glucose and insulin sensitivity in obese and diabetic mice. However, the metabolic roles of these two receptors and the underlying mechanisms are incompletely understood. Here, we studied the effects of the dual FXR and TGR5 agonist INT-767 on hepatic bile acid synthesis and intestinal secretion of glucagon-like peptide-1 (GLP-1) in wild-type, Fxr -/- , and Tgr5 -/- mice. INT-767 efficaciously stimulated intracellular Ca 2+ levels, cAMP activity, and GLP-1 secretion and improved glucose and lipid metabolism more than did the FXR-selective obeticholic acid and TGR5-selective INT-777 agonists. Interestingly, INT-767 reduced expression of the genes in the classic bile acid synthesis pathway but induced those in the alternative pathway, which is consistent with decreased taurocholic acid and increased tauromuricholic acids in bile. Furthermore, FXR activation induced expression of FXR target genes, including fibroblast growth factor 15, and unexpectedly Tgr5 and prohormone convertase 1/3 gene expression in the ileum. We identified an FXR-responsive element on the Tgr5 gene promoter. Fxr -/- and Tgr5 -/- mice exhibited reduced GLP-1 secretion, which was stimulated by INT-767 in the Tgr5 -/- mice but not in the Fxr -/- mice. Our findings uncovered a novel mechanism in which INT-767 activation of FXR induces Tgr5 gene expression and increases Ca 2+ levels and cAMP activity to stimulate GLP-1 secretion and improve hepatic glucose and lipid metabolism in high-fat diet-induced obese mice. Activation of both FXR and TGR5 may therefore represent an effective therapy for managing hepatic steatosis, obesity, and diabetes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Synthesis of alpha-amino acids
Davis, J.W. Jr.
1983-01-25
A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-01-01
Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-12-06
Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.
Wang, Jingxuan; Zhao, Peng; Li, Ying; Xu, Lida; Tian, Pingfang
2018-04-05
Klebsiella pneumoniae is a promising industrial species for bioproduction of bulk chemicals such as 1,3-propanediol, 2,3-butanediol and 3-hydroxypropionic acid (3-HP). However, lactic acid is a troublesome by-product when optimizing for 3-HP production. Therefore, it is highly desirable to minimize lactic acid. Here, we show that lactic acid synthesis can be largely blocked by an engineered CRISPR interference (CRISPRi) system in K. pneumoniae. EGFP was recruited as a reporter of this CRISPRi system. Fluorescence assay of this CRISPRi system showed that enhanced green fluorescent protein (EGFP) expression level was repressed by 85-90%. To further test this CRISPRi system, guide RNAs were designed to individually or simultaneously target four lactate-producing enzyme genes. Results showed that all lactate-producing enzyme genes were significantly repressed. Notably, D-lactate dehydrogenase (ldhA) was shown to be the most influential enzyme for lactic acid formation in micro-aerobic conditions, as inhibiting ldhA alone led to lactic acid level similar to simultaneously repressing four genes. In shake flask cultivation, the strain coexpressing puuC (an aldehyde dehydrogenase catalyzing 3-hydroxypropionaldehyde to 3-HP) and dCas9-sgRNA inhibiting ldhA produced 1.37-fold 3-HP relative to the reference strain. Furthermore, in bioreactor cultivation, this CRISPRi strain inhibiting ldhA produced 36.7 g/L 3-HP, but only generated 1 g/L lactic acid. Clearly, this engineered CRISPRi system largely simplified downstream separation of 3-HP from its isomer lactic acid, an extreme challenge for 3-HP bioprocess. This study offers a deep understanding of lactic acid metabolism in diverse species, and we believe that this CRISPRi system will facilitate biomanufacturing and functional genome studies of K. pneumoniae or beyond.
Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bai, Xupeng; Hong, Weipeng; Cai, Peiheng
Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the
Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver
Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.
1969-01-01
1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319
Ren, Dacheng; Zuo, Rongjun; González Barrios, Andrés F.; Bedzyk, Laura A.; Eldridge, Gary R.; Pasmore, Mark E.; Wood, Thomas K.
2005-01-01
After 13,000 samples of compounds purified from plants were screened, a new biofilm inhibitor, ursolic acid, has been discovered and identified. Using both 96-well microtiter plates and a continuous flow chamber with COMSTAT analysis, 10 μg of ursolic acid/ml inhibited Escherichia coli biofilm formation 6- to 20-fold when added upon inoculation and when added to a 24-h biofilm; however, ursolic acid was not toxic to E. coli, Pseudomonas aeruginosa, Vibrio harveyi, and hepatocytes. Similarly, 10 μg of ursolic acid/ml inhibited biofilm formation by >87% for P. aeruginosa in both complex and minimal medium and by 57% for V. harveyi in minimal medium. To investigate the mechanism of this nontoxic inhibition on a global genetic basis, DNA microarrays were used to study the gene expression profiles of E. coli K-12 grown with or without ursolic acid. Ursolic acid at 10 and 30 μg/ml induced significantly (P < 0.05) 32 and 61 genes, respectively, and 19 genes were consistently induced. The consistently induced genes have functions for chemotaxis and mobility (cheA, tap, tar, and motAB), heat shock response (hslSTV and mopAB), and unknown functions (such as b1566 and yrfHI). There were 31 and 17 genes repressed by 10 and 30 μg of ursolic acid/ml, respectively, and 12 genes were consistently repressed that have functions in cysteine synthesis (cysK) and sulfur metabolism (cysD), as well as unknown functions (such as hdeAB and yhaDFG). Ursolic acid inhibited biofilms without interfering with quorum sensing, as shown with the V. harveyi AI-1 and AI-2 reporter systems. As predicted by the differential gene expression, deleting motAB counteracts ursolic acid inhibition (the paralyzed cells no longer become too motile). Based on the differential gene expression, it was also discovered that sulfur metabolism (through cysB) affects biofilm formation (in the absence of ursolic acid). PMID:16000817
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
NASA Astrophysics Data System (ADS)
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
Eraso, Jesus M.; Olsen, Randall J.; Beres, Stephen B.; Kachroo, Priyanka; Porter, Adeline R.; Nasser, Waleed; Bernard, Paul E.; DeLeo, Frank R.
2016-01-01
To obtain new information about Streptococcus pyogenes intrahost genetic variation during invasive infection, we sequenced the genomes of 2,954 serotype M1 strains recovered from a nonhuman primate experimental model of necrotizing fasciitis. A total of 644 strains (21.8%) acquired polymorphisms relative to the input parental strain. The fabT gene, encoding a transcriptional regulator of fatty acid biosynthesis genes, contained 54.5% of these changes. The great majority of polymorphisms were predicted to deleteriously alter FabT function. Transcriptome-sequencing (RNA-seq) analysis of a wild-type strain and an isogenic fabT deletion mutant strain found that between 3.7 and 28.5% of the S. pyogenes transcripts were differentially expressed, depending on the growth temperature (35°C or 40°C) and growth phase (mid-exponential or stationary phase). Genes implicated in fatty acid synthesis and lipid metabolism were significantly upregulated in the fabT deletion mutant strain. FabT also directly or indirectly regulated central carbon metabolism genes, including pyruvate hub enzymes and fermentation pathways and virulence genes. Deletion of fabT decreased virulence in a nonhuman primate model of necrotizing fasciitis. In addition, the fabT deletion strain had significantly decreased survival in human whole blood and during phagocytic interaction with polymorphonuclear leukocytes ex vivo. We conclude that FabT mutant progeny arise during infection, constitute a metabolically distinct subpopulation, and are less virulent in the experimental models used here. PMID:27600505
[Chromosomal proteins: histones and acid proteins].
Salvini, M; Gabrielli, F
1976-01-01
Experimental data about the chemistry and the biology of chromosomal proteins are reviewed. Paragraphs include: aminoacid sequential data and post-translational covalent modications of histones, histone chemical differences in different tissues of the same species and in homologous organs of different species, histone synthesis subcellular localization and its association with DNA synthesis, histone synthesis transcriptional and translational control, histone synthesis during meiosis, oogenesis and early embryogenesis. The possible role of histones as controllers of gene expression is discussed and a model of primary structure of chromatine is proposed. The "acidic proteins" data concern the high tissue eterogenity of these proteins and their role in the steroid-hormon-controlled gene expression. The possible role of acidic proteins as general controllers of gene expression in eucariotic cells is discussed.
The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis
NASA Technical Reports Server (NTRS)
Morowitz, Harold; Peterson, Eta; Chang, Sherwood
1995-01-01
This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.
Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine
2016-01-01
Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725
Salzman, Ron A.; Brady, Jeff A.; Finlayson, Scott A.; Buchanan, Christina D.; Summer, Elizabeth J.; Sun, Feng; Klein, Patricia E.; Klein, Robert R.; Pratt, Lee H.; Cordonnier-Pratt, Marie-Michèle; Mullet, John E.
2005-01-01
We have conducted a large-scale study of gene expression in the C4 monocot sorghum (Sorghum bicolor) L. Moench cv BTx623 in response to the signaling compounds salicylic acid (SA), methyl jasmonate (MeJA), and the ethylene precursor aminocyclopropane carboxylic acid. Expression profiles were generated from seedling root and shoot tissue at 3 and 27 h, using a microarray containing 12,982 nonredundant elements. Data from 102 slides and quantitative reverse transcription-PCR data on mRNA abundance from 171 genes were collected and analyzed and are here made publicly available. Numerous gene clusters were identified in which expression was correlated with particular signaling compound and tissue combinations. Many genes previously implicated in defense responded to the treatments, including numerous pathogenesis-related genes and most members of the phenylpropanoid pathway, and several other genes that may represent novel activities or pathways. Genes of the octadecanoic acid pathway of jasmonic acid (JA) synthesis were induced by SA as well as by MeJA. The resulting hypothesis that increased SA could lead to increased endogenous JA production was confirmed by measurement of JA content. Comparison of responses to SA, MeJA, and combined SA+MeJA revealed patterns of one-way and mutual antagonisms, as well as synergistic effects on regulation of some genes. These experiments thus help further define the transcriptional results of cross talk between the SA and JA pathways and suggest that a subset of genes coregulated by SA and JA may comprise a uniquely evolved sector of plant signaling responsive cascades. PMID:15863699
Sayanova, Olga; Haslam, Richard P; Calerón, Monica Venegas; López, Noemi Ruiz; Worthy, Charlotte; Rooks, Paul; Allen, Michael J; Napier, Johnathan A
2011-05-01
The Prymnesiophyceae coccolithophore Emiliania huxleyi is one of the most abundant alga in our oceans and therefore plays a central role in marine foodwebs. E. huxleyi is notable for the synthesis and accumulation of the omega-3 long chain polyunsaturated fatty acid docosahexaenoic acid (DHA; 22:6Δ(4,7,10,13,16,19), n-3) which is accumulated in fish oils and known to have health-beneficial properties to humans, preventing cardiovascular disease and related pathologies. Here we describe the identification and functional characterisation of the five E. huxleyi genes which direct the synthesis of docosahexaenoic acid in this alga. Surprisingly, E. huxleyi does not use the conventional Δ6-pathway, instead using the alternative Δ8-desaturation route which has previously only been observed in a few unrelated microorganisms. Given that E. huxleyi accumulates significant levels of the Δ6-desaturated fatty acid stearidonic acid (18:4Δ(6,9,12,15), n-3), we infer that the biosynthesis of DHA is likely to be metabolically compartmentalised from the synthesis of stearidonic acid. Copyright © 2011 Elsevier Ltd. All rights reserved.
The spark discharge synthesis of amino acids from various hydrocarbons
NASA Technical Reports Server (NTRS)
Ring, D.; Miller, S. L.
1984-01-01
The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).
Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.
Hashimoto, F; Taira, S; Hayashi, H
2000-05-15
We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong
2016-01-01
Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494
Leake, Devin
2015-01-01
As scientists make strides toward the goal of developing a form of biological engineering that's as predictive and reliable as chemical engineering is for chemistry, one technology component has become absolutely critical: gene synthesis. Gene synthesis is the process of building stretches of deoxyribonucleic acid (DNA) to order--some stretches based on DNA that exists already in nature, some based on novel designs intended to accomplish new functions. This process is the foundation of synthetic biology, which is rapidly becoming the engineering counterpart to biology.
Yu, Man; Tong, Jian-Hua; Mao, Mao; Kan, Li-Xin; Liu, Meng-Min; Sun, Yi-Wu; Fu, Gang; Jing, Yong-Kui; Yu, Long; Lepaslier, Denis; Lanotte, Michel; Wang, Zhen-Yi; Chen, Zhu; Waxman, Samuel; Wang, Ya-Xin; Tan, Jia-Zhen; Chen, Sai-Juan
1997-01-01
In a cell line (NB4) derived from a patient with acute promyelocytic leukemia, all-trans-retinoic acid (ATRA) and interferon (IFN) induce the expression of a novel gene we call RIG-G (for retinoic acid-induced gene G). This gene codes for a 58-kDa protein containing 490 amino acids with several potential sites for post-translational modification. In untreated NB4 cells, the expression of RIG-G is undetectable. ATRA treatment induces the transcriptional expression of RIG-G relatively late (12–24 hr) in a protein synthesis-dependent manner, whereas IFN-α induces its expression early (30 min to 3 hr). Database search has revealed a high-level homology between RIG-G and several IFN-stimulated genes in human (ISG54K, ISG56K, and IFN-inducible and retinoic acid-inducible 58K gene) and some other species, defining a well conserved gene family. The gene is composed of two exons and has been mapped by fluorescence in situ hybridization to chromosome 10q24, where two other human IFN-stimulated gene members are localized. A synergistic induction of RIG-G expression in NB4 cells by combined treatment with ATRA and IFNs suggests that a collaboration exists between their respective signaling pathways. PMID:9207104
The evolution of the protein synthesis system. I - A model of a primitive protein synthesis system
NASA Technical Reports Server (NTRS)
Mizutani, H.; Ponnamperuma, C.
1977-01-01
A model is developed to describe the evolution of the protein synthesis system. The model is comprised of two independent autocatalytic systems, one including one gene (A-gene) and two activated amino acid polymerases (O and A-polymerases), and the other including the addition of another gene (N-gene) and a nucleotide polymerase. Simulation results have suggested that even a small enzymic activity and polymerase specificity could lead the system to the most accurate protein synthesis, as far as permitted by transitions to systems with higher accuracy.
Distribution, industrial applications, and enzymatic synthesis of D-amino acids.
Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang
2015-04-01
D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.
Manor, Meghan L; Cleveland, Beth M; Kenney, P Brett; Yao, Jianbo; Leeds, Tim
2015-04-01
Sexual maturation occurs at the expense of stored energy and nutrients, including lipids; however, little is known regarding sex effects on nutrient regulatory mechanisms in rainbow trout prior to maturity. Thirty-two, 14-month-old, male and female rainbow trout were sampled for growth, carcass yield, fillet composition, and gene expression of liver, white muscle, and visceral adipose tissue. Growth parameters, including gonadosomatic index, were not affected by sex. Females had higher percent separable muscle yield, but there were no sex effects on fillet proximate composition. Fillet shear force indicated females produce firmer fillets than males. Male livers had greater expression of three cofactors within the mTOR signaling pathway that act to inhibit TORC1 assembly; mo25, rictor, and pras40. Male liver also exhibited increased expression of β-oxidation genes cpt1b and ehhadh. These findings are indicative of increased mitochondrial β-oxidation in male liver. Females exhibited increased expression of the mTOR cofactor raptor in white muscle and had higher expression levels of several genes within the fatty acid synthesis pathway, including gpat, srebp1, scd1, and cd36. Female muscle also had increased expression of β-oxidation genes cpt1d and cpt2. Increased expression of both fatty acid synthesis and β-oxidation genes suggests female muscle may have greater fatty acid turnover. Differences between sexes were primarily associated with variation of gene expression within the mTOR signaling pathway. Overall, data suggest there is differential regulation of gene expression in male and female rainbow trout tissues prior to the onset of sexual maturity that may lead to nutrient repartitioning during maturation.
Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.
Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang
2016-01-01
Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.
Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko
2018-01-01
Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.
Increasing the fidelity of noncanonical amino acid incorporation in cell-free protein synthesis.
Gan, Qinglei; Fan, Chenguang
2017-11-01
Cell-free protein synthesis provides a robust platform for co-translational incorporation of noncanonical amino acid (ncAA) into proteins to facilitate biological studies and biotechnological applications. Recently, eliminating the activity of release factor 1 has been shown to increase ncAA incorporation in response to amber codons. However, this approach could promote mis-incorporation of canonical amino acids by near cognate suppression. We performed a facile protocol to remove near cognate tRNA isoacceptors of the amber codon from total tRNAs, and used the phosphoserine (Sep) incorporation system as validation. By manipulating codon usage of target genes and tRNA species introduced into the cell-free protein synthesis system, we increased the fidelity of Sep incorporation at a specific position. By removing three near cognate tRNA isoacceptors of the amber stop codon [tRNA Lys , tRNA Tyr , and tRNA Gln (CUG)] from the total tRNA, the near cognate suppression decreased by 5-fold without impairing normal protein synthesis in the cell-free protein synthesis system. Mass spectrometry analyses indicated that the fidelity of ncAA incorporation was improved. Removal of near cognate tRNA isoacceptors of the amber codon could increase ncAA incorporation fidelity towards the amber stop codon in release factor deficiency systems. We provide a general strategy to improve fidelity of ncAA incorporation towards stop, quadruplet and sense codons in cell-free protein synthesis systems. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2016 Elsevier B.V. All rights reserved.
Derivatives of diphosphonic acids: synthesis and biological activity
NASA Astrophysics Data System (ADS)
Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.
1993-07-01
The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.
Ibeagha-Awemu, Eveline M; Akwanji, Kingsley A; Beaudoin, Frédéric; Zhao, Xin
2014-02-17
Fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes code respectively for the enzymes delta-5 and delta-6 desaturases which are rate limiting enzymes in the synthesis of polyunsaturated omega-3 and omega-6 fatty acids (FAs). Omega-3 and-6 FAs as well as conjugated linoleic acid (CLA) are present in bovine milk and have demonstrated positive health effects in humans. Studies in humans have shown significant relationships between genetic variants in FADS1 and 2 genes with plasma and tissue concentrations of omega-3 and-6 FAs. The aim of this study was to evaluate the extent of sequence variations within these two genes in Canadian Holstein cows as well as the association between sequence variants and health promoting FAs in milk. Thirty three SNPs were detected within the studied regions of genes including a synonymous mutation (FADS1-07, rs42187261, 306Tyr > Tyr) in exon 8 of FADS1, a non-synonymous mutation (FADS2-14, rs211580559, 294Ala > Val) within FADS2 exon 7, a splice site SNP (FADS2-05, rs211263660), a 3'UTR SNP (FADS2-23, rs109772589), and another 3'UTR SNP with an effect on a microRNA binding site within FADS2 gene (FADS2-19, rs210169303). Association analyses showed significant relations between three out of seven tested SNPs and several FAs. Significant associations (FDR P < 0.05) were recorded between FADS2-23 (rs109772589) and two omega-6 FAs (dihomogamma linolenic acid [C20:3n6] and arachidonic acid [C20:4n6]), FADS1-07 (rs42187261) and one omega-3 FA (eicosapentaenoic acid, C20:5n3) and tricosanoic acid (C23:0), and one intronic SNP, FADS1-01 (rs136261927) and C20:3n6. Our study has demonstrated positive associations between three SNPs within FADS1 and FADS2 genes (a SNP within the 3'UTR, a synonymous SNP and an intronic SNP), with three milk PUFAs of Canadian Holstein cows thus suggesting possible involvement of synonymous and non-coding region variants in FA synthesis. These SNPs may serve as potential genetic markers in breeding programs to
Tamano, Koichi; Bruno, Kenneth S; Koike, Hideaki; Ishii, Tomoko; Miura, Ai; Umemura, Myco; Culley, David E; Baker, Scott E; Machida, Masayuki
2015-04-01
Fatty acids are attractive molecules as source materials for the production of biodiesel fuel. Previously, we attained a 2.4-fold increase in fatty acid production by increasing the expression of fatty acid synthesis-related genes in Aspergillus oryzae. In this study, we achieved an additional increase in the production of fatty acids by disrupting a predicted acyl-CoA synthetase gene in A. oryzae. The A. oryzae genome is predicted to encode six acyl-CoA synthetase genes and disruption of AO090011000642, one of the six genes, resulted in a 9.2-fold higher accumulation (corresponding to an increased production of 0.23 mmol/g dry cell weight) of intracellular fatty acid in comparison to the wild-type strain. Furthermore, by introducing a niaD marker from Aspergillus nidulans to the disruptant, as well as changing the concentration of nitrogen in the culture medium from 10 to 350 mM, fatty acid productivity reached 0.54 mmol/g dry cell weight. Analysis of the relative composition of the major intracellular free fatty acids caused by disruption of AO090011000642 in comparison to the wild-type strain showed an increase in stearic acid (7 to 26 %), decrease in linoleic acid (50 to 27 %), and no significant changes in palmitic or oleic acid (each around 20-25 %).
Seo, Kun-Ho; Bartley, Glenn E.; Tam, Christina; Kim, Hong-Seok; Kim, Dong-Hyeon; Chon, Jung-Whan; Yokoyama, Wallace
2016-01-01
To identify differentially expressed hepatic genes contributing to the improvement of high-fat (HF) diet-induced hepatic steatosis and insulin resistance following supplementation of partially defatted flavonoid-rich Chardonnay grape seed flour (ChrSd), diet-induced obese (DIO) mice were fed HF diets containing either ChrSd or microcrystalline cellulose (MCC, control) for 5 weeks. The 2-h insulin area under the curve was significantly lowered by ChrSd, indicating that ChrSd improved insulin sensitivity. ChrSd intake also significantly reduced body weight gain, liver and adipose tissue weight, hepatic lipid content, and plasma low-density lipoprotein (LDL)-cholesterol, despite a significant increase in food intake. Exon microarray analysis of hepatic gene expression revealed down-regulation of genes related to triglyceride and ceramide synthesis, immune response, oxidative stress, and inflammation and upregulation of genes related to fatty acid oxidation, cholesterol, and bile acid synthesis. In conclusion, the effects of ChrSd supplementation in a HF diet on weight gain, insulin resistance, and progression of hepatic steatosis in DIO mice were associated with modulation of hepatic genes related to oxidative stress, inflammation, ceramide synthesis, and lipid and cholesterol metabolism. PMID:27977712
PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.
Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G
2016-04-01
Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.
Abiotic synthesis of fatty acids
NASA Technical Reports Server (NTRS)
Leach, W. W.; Nooner, D. W.; Oro, J.
1978-01-01
The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
Mostarda, Serena; Passeri, Daniela; Carotti, Andrea; Cerra, Bruno; Colliva, Carolina; Benicchi, Tiziana; Macchiarulo, Antonio; Pellicciari, Roberto; Gioiello, Antimo
2018-01-20
Glucuronidation is considered an important detoxification pathway of bile acids especially in cholestatic conditions. Glucuronides are less toxic than the parent free forms and are more easily excreted in urine. However, the pathophysiological significance of bile acid glucuronidation is still controversial and debated among the scientific community. Progress in this field has been strongly limited by the lack of appropriate methods for the preparation of pure glucuronides in the amount needed for biological and pharmacological studies. In this work, we have developed a new synthesis of bile acid C3-glucuronides enabling the convenient preparation of gram-scale quantities. The synthesized compounds have been characterized in terms of physicochemical properties and abilities to modulate key nuclear receptors including the farnesoid X receptor (FXR). In particular, we found that C3-glucuronides of chenodeoxycholic acid and lithocholic acid, respectively the most abundant and potentially cytotoxic species formed in patients affected by cholestasis, behave as FXR agonists and positively regulate the gene expression of transporter proteins, the function of which is critical in human conditions related to imbalances of bile acid homeostasis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Zhang, T Y; Huang, J T; Tian, H B; Ma, Y; Chen, Z; Wang, J J; Shi, H P; Luo, J
2018-06-01
The trans-10,cis-12 isomer of conjugated linoleic acid (t10c12-CLA) is a biohydrogenation intermediate in the rumen and has been shown to cause milk fat depression in dairy goats. However, few studies have focused on the in vitro molecular mechanisms involved in the response of the goat mammary gland to t10c12-CLA. In the present study, RNA sequencing technology was used to investigate the effects of t10c12-CLA on goat mammary epithelial cells. From the data, 25,153 annotated transcripts were obtained, and differentially expressed genes were selected based on a false discovery rate <0.05. Candidate genes and potent cellular signaling pathways were identified through Gene Ontology (GO) and pathway analysis. Next, real-time quantitative PCR and Western blot analyses were used to verify the results of the RNA sequencing data. The results indicated that t10c12-CLA inhibits fatty acid synthesis through downregulation of genes involved in de novo fatty acid synthesis, and this process is likely correlated with the activation of the AMP-activated protein kinase signaling pathways. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Enzymatic routes for the synthesis of ursodeoxycholic acid.
Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner
2014-12-10
Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Jakočiūnė, Džiuginta; Herrero-Fresno, Ana; Jelsbak, Lotte; Olsen, John Elmerdahl
2016-05-02
Salmonella enterica serovar Enteritidis (S. Enteritidis) is the most common cause of egg borne salmonellosis in many parts of the world. This study analyzed gene expression of this bacterium during growth in whole egg, and whether highly expressed genes were essential for the growth. High quality RNA was extracted from S. Enteritidis using a modified RNA-extraction protocol. Global gene expression during growth in whole egg was compared to growth in LB-medium using DNA array method. Twenty-six genes were significantly upregulated during growth in egg; these belonged to amino acid biosynthesis, di/oligopeptide transport system, biotin synthesis, ferrous iron transport system, and type III secretion system. Significant downregulation of 15 genes related to formate hydrogenlyase (FHL) and trehalose metabolism was observed. The results suggested that S. Enteritidis is starved for amino-acids, biotin and iron when growing in egg. However, site specific mutation of amino acid biosynthesis genes asnA (17.3 fold upregulated), asnB (18.6 fold upregulated), asnA/asnB and, serA (12.0 fold upregulated) and gdhA (3.7 fold upregulated), did not result in growth attenuation, suggesting that biosynthesis using the enzymes encoded from these genes may represent the first choice for S. Enteritidis when growing in egg, but when absent, the bacterium could use alternative ways to obtain the amino acids. Copyright © 2016 Elsevier B.V. All rights reserved.
Fernández-Escalada, Manuel; Zulet-González, Ainhoa; Gil-Monreal, Miriam; Zabalza, Ana; Ravet, Karl; Gaines, Todd; Royuela, Mercedes
2017-01-01
A key enzyme of the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19), is the known target of the widely used herbicide glyphosate. Glyphosate resistance in Amaranthus palmeri, one of the most troublesome weeds in agriculture, has evolved through increased EPSPS gene copy number. The aim of this work was to study the pleiotropic effects of (i) EPSPS increased transcript abundance due to gene copy number variation (CNV) and of (ii) glyphosate application on the aromatic amino acid (AAA) and branched chain amino acid (BCAA) synthesis pathways. Hydroponically grown glyphosate sensitive (GS) and glyphosate resistant (GR) plants were treated with glyphosate 3 days after treatment. In absence of glyphosate treatment, high EPSPS gene copy number had only a subtle effect on transcriptional regulation of AAA and BCAA pathway genes. In contrast, glyphosate treatment provoked a general accumulation of the transcripts corresponding to genes of the AAA pathway leading to synthesis of chorismate in both GS and GR. After chorismate, anthranilate synthase transcript abundance was higher while chorismate mutase transcription showed a small decrease in GR and remained stable in GS, suggesting a regulatory branch point in the pathway that favors synthesis toward tryptophan over phenylalanine and tyrosine after glyphosate treatment. This was confirmed by studying enzyme activities in vitro and amino acid analysis. Importantly, this upregulation was glyphosate dose dependent and was observed similarly in both GS and GR populations. Glyphosate treatment also had a slight effect on the expression of BCAA genes but no general effect on the pathway could be observed. Taken together, our observations suggest that the high CNV of EPSPS in A. palmeri GR populations has no major pleiotropic effect on the expression of AAA biosynthetic genes, even in response to glyphosate treatment. This finding supports the idea that the fitness cost associated with EPSPS CNV
[Effects of SREBP-1 over-expression on fatty acid metabolism related genes expression in goats].
Xu, Huifen; Luo, Jun; Li, Fang; Yu, Kang; Shi, Hengbo; Li, Jun; Lin, Xianzi; Zhu, Jiangjiang
2012-11-01
The aim of the study was to construct a recombinant adenovirus overexpression vector for Sterol Regulatory Element Binding Protein-1 (SREBP-1) of Xinong Saanen dairy goat, and to detect its effect on genes related to fatty acid metabolism in goat mammary epithelial cells, to establish foundation for further study of its roles in metabolism of fatty acid synthesis and lactation. First, we designed primers based on the SREBP-1 gene sequence in GenBank for PCR amplification and inserted the sequence into shuttle vector pAdTrack-CMV. The recombinant plasmid pAdTrack-CMV-SREBP-1 linearized by Pme I was transformed into E. coli BJ5183 competence cell containing the backbone vector pAdEasy-1 to obtain recombinant vector pAd-SREBP-1 by homologous recombination. pAd-SREBP-1 was linearized by Pac I and transfected into HEK 293 cell. Then we infected goat mammary epithelial cells with recombinant adenovirus which was packaged in HEK 293 cell line. The results showed that the recombinant adenovirus vector containing SREBP-1 was successfully constructed, and the titer of virus was 10(9) U/mL. Compared with the control group, mRNA level of SREBP-1 increased by about 15 times after infected for 48 h and 30 times after infected for 72 h. Fatty acid synthase (FASN) and Acetyl-CoA carboxylase (ACC) was upregulated by almost 2 times. The expression level of Peroxisome proliferator activated receptorgamma (PPARgamma) increased by 1.5 times. Liver X receptoralpha (LXRalpha) and Adipose triglyceride lipase (ATGL) upregulated by 1.2 times compared with that of control. But Stearoyl-coenzyme A desaturase (SCD) had no obvious change. In conclusion, SREBP-1 can activate the expression of genes related to fatty acid synthesis in mammary epithelial cells of Xinong Saanen dairy goat, demonstrated a regulatory function on the fatty acid metabolism in goat mammary gland.
Smith, Stuart; Witkowski, Andrzej; Moghul, Ayesha; Yoshinaga, Yuko; Nefedov, Michael; de Jong, Pieter; Feng, Dejiang; Fong, Loren; Tu, Yiping; Hu, Yan; Young, Stephen G.; Pham, Thomas; Cheung, Carling; Katzman, Shana M.; Brand, Martin D.; Quinlan, Casey L.; Fens, Marcel; Kuypers, Frans; Misquitta, Stephanie; Griffey, Stephen M.; Tran, Son; Gharib, Afshin; Knudsen, Jens; Hannibal-Bach, Hans Kristian; Wang, Grace; Larkin, Sandra; Thweatt, Jennifer; Pasta, Saloni
2012-01-01
A mouse model with compromised mitochondrial fatty acid synthesis has been engineered in order to assess the role of this pathway in mitochondrial function and overall health. Reduction in the expression of mitochondrial malonyl CoA-acyl carrier protein transacylase, a key enzyme in the pathway encoded by the nuclear Mcat gene, was achieved to varying extents in all examined tissues employing tamoxifen-inducible Cre-lox technology. Although affected mice consumed more food than control animals, they failed to gain weight, were less physically active, suffered from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. The Mcat-deficient phenotype is attributed primarily to reduced synthesis, in several tissues, of the octanoyl precursors required for the posttranslational lipoylation of pyruvate and α-ketoglutarate dehydrogenase complexes, resulting in diminished capacity of the citric acid cycle and disruption of energy metabolism. The presence of an alternative lipoylation pathway that utilizes exogenous free lipoate appears restricted to liver and alone is insufficient for preservation of normal energy metabolism. Thus, de novo synthesis of precursors for the protein lipoylation pathway plays a vital role in maintenance of mitochondrial function and overall vigor. PMID:23077570
Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.
Halvorson, D L; McCune, S A
1984-11-01
The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.
Hernández, M Luisa; Sicardo, M Dolores; Martínez-Rivas, José M
2016-01-01
Linolenic acid is a polyunsaturated fatty acid present in plant lipids, which plays key roles in plant metabolism as a structural component of storage and membrane lipids, and as a precursor of signaling molecules. The synthesis of linolenic acid is catalyzed by two different ω-3 fatty acid desaturases, which correspond to microsomal- (FAD3) and chloroplast- (FAD7 and FAD8) localized enzymes. We have investigated the specific contribution of each enzyme to the linolenic acid content in olive fruit. With that aim, we isolated two different cDNA clones encoding two ω-3 fatty acid desaturases from olive (Olea europaea cv. Picual). Sequence analysis indicates that they code for microsomal (OepFAD3B) and chloroplast (OepFAD7-2) ω-3 fatty acid desaturase enzymes, different from the previously characterized OekFAD3A and OekFAD7-1 genes. Functional expression in yeast of the corresponding OepFAD3A and OepFAD3B cDNAs confirmed that they encode microsomal ω-3 fatty acid desaturases. The linolenic acid content and transcript levels of olive FAD3 and FAD7 genes were measured in different tissues of Picual and Arbequina cultivars, including mesocarp and seed during development and ripening of olive fruit. Gene expression and lipid analysis indicate that FAD3A is the gene mainly responsible for the linolenic acid present in the seed, while FAD7-1 and FAD7-2 contribute mostly to the linolenic acid present in the mesocarp and, therefore, in the olive oil. These results also indicate the relevance of lipid trafficking between the endoplasmic reticulum and chloroplast in determining the linolenic acid content of membrane and storage lipids in oil-accumulating photosynthetic tissues. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.
Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2017-08-01
Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.
Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M
2016-01-01
Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to
Corominas, Jordi; Ramayo-Caldas, Yuliaxis; Puig-Oliveras, Anna; Estellé, Jordi; Castelló, Anna; Alves, Estefania; Pena, Ramona N; Ballester, Maria; Folch, Josep M
2013-12-01
In pigs, adipose tissue is one of the principal organs involved in the regulation of lipid metabolism. It is particularly involved in the overall fatty acid synthesis with consequences in other lipid-target organs such as muscles and the liver. With this in mind, we have used massive, parallel high-throughput sequencing technologies to characterize the porcine adipose tissue transcriptome architecture in six Iberian x Landrace crossbred pigs showing extreme phenotypes for intramuscular fatty acid composition (three per group). High-throughput RNA sequencing was used to generate a whole characterization of adipose tissue (backfat) transcriptome. A total of 4,130 putative unannotated protein-coding sequences were identified in the 20% of reads which mapped in intergenic regions. Furthermore, 36% of the unmapped reads were represented by interspersed repeats, SINEs being the most abundant elements. Differential expression analyses identified 396 candidate genes among divergent animals for intramuscular fatty acid composition. Sixty-two percent of these genes (247/396) presented higher expression in the group of pigs with higher content of intramuscular SFA and MUFA, while the remaining 149 showed higher expression in the group with higher content of PUFA. Pathway analysis related these genes to biological functions and canonical pathways controlling lipid and fatty acid metabolisms. In concordance with the phenotypic classification of animals, the major metabolic pathway differentially modulated between groups was de novo lipogenesis, the group with more PUFA being the one that showed lower expression of lipogenic genes. These results will help in the identification of genetic variants at loci that affect fatty acid composition traits. The implications of these results range from the improvement of porcine meat quality traits to the application of the pig as an animal model of human metabolic diseases.
Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2016-08-01
Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M
2005-08-07
Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.
Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli
Broda, Paul
1968-01-01
Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126
A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.
Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L
2015-04-01
The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.
PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.
Feng, Youjun; Cronan, John E
2014-01-01
Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Synthesis and chirality of amino acids under interstellar conditions.
Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J
2013-01-01
Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.
2014-01-01
Background Fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes code respectively for the enzymes delta-5 and delta-6 desaturases which are rate limiting enzymes in the synthesis of polyunsaturated omega-3 and omega-6 fatty acids (FAs). Omega-3 and-6 FAs as well as conjugated linoleic acid (CLA) are present in bovine milk and have demonstrated positive health effects in humans. Studies in humans have shown significant relationships between genetic variants in FADS1 and 2 genes with plasma and tissue concentrations of omega-3 and-6 FAs. The aim of this study was to evaluate the extent of sequence variations within these two genes in Canadian Holstein cows as well as the association between sequence variants and health promoting FAs in milk. Results Thirty three SNPs were detected within the studied regions of genes including a synonymous mutation (FADS1-07, rs42187261, 306Tyr > Tyr) in exon 8 of FADS1, a non-synonymous mutation (FADS2-14, rs211580559, 294Ala > Val) within FADS2 exon 7, a splice site SNP (FADS2-05, rs211263660), a 3′UTR SNP (FADS2-23, rs109772589), and another 3′UTR SNP with an effect on a microRNA binding site within FADS2 gene (FADS2-19, rs210169303). Association analyses showed significant relations between three out of seven tested SNPs and several FAs. Significant associations (FDR P < 0.05) were recorded between FADS2-23 (rs109772589) and two omega-6 FAs (dihomogamma linolenic acid [C20:3n6] and arachidonic acid [C20:4n6]), FADS1-07 (rs42187261) and one omega-3 FA (eicosapentaenoic acid, C20:5n3) and tricosanoic acid (C23:0), and one intronic SNP, FADS1-01 (rs136261927) and C20:3n6. Conclusion Our study has demonstrated positive associations between three SNPs within FADS1 and FADS2 genes (a SNP within the 3’UTR, a synonymous SNP and an intronic SNP), with three milk PUFAs of Canadian Holstein cows thus suggesting possible involvement of synonymous and non-coding region variants in FA synthesis. These SNPs may serve as
Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester
NASA Technical Reports Server (NTRS)
Weber, A. L.
1986-01-01
The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.
Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.
Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan
2011-12-01
In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.
Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P
2016-09-01
Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Individual bile acids have differential effects on bile acid signaling in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Peizhen, E-mail: songacad@gmail.com; Rockwell, Cheryl E., E-mail: rockwelc@msu.edu; Cui, Julia Yue, E-mail: juliacui@uw.edu
2015-02-15
Bile acids (BAs) are known to regulate BA synthesis and transport by the farnesoid X receptor in the liver (FXR-SHP) and intestine (FXR-Fgf15). However, the relative importance of individual BAs in regulating these processes is not known. Therefore, mice were fed various doses of five individual BAs, including cholic acid (CA), chenodeoxycholic acid (CDCA), deoxoycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA) in their diets at various concentrations for one week to increase the concentration of one BA in the enterohepatic circulation. The mRNA of BA synthesis and transporting genes in liver and ileum were quantified. In themore » liver, the mRNA of SHP, which is the prototypical target gene of FXR, increased in mice fed all concentrations of BAs. In the ileum, the mRNA of the intestinal FXR target gene Fgf15 was increased at lower doses and to a higher extent by CA and DCA than by CDCA and LCA. Cyp7a1, the rate-limiting enzyme in BA synthesis, was decreased more by CA and DCA than CDCA and LCA. Cyp8b1, the enzyme that 12-hydroxylates BAs and is thus responsible for the synthesis of CA, was decreased much more by CA and DCA than CDCA and LCA. Surprisingly, neither a decrease in the conjugated BA uptake transporter (Ntcp) nor increase in BA efflux transporter (Bsep) was observed by FXR activation, but an increase in the cholesterol efflux transporter (Abcg5/Abcg8) was observed with FXR activation. Thus in conclusion, CA and DCA are more potent FXR activators than CDCA and LCA when fed to mice, and thus they are more effective in decreasing the expression of the rate limiting gene in BA synthesis Cyp7a1 and the 12-hydroxylation of BAs Cyp8b1, and are also more effective in increasing the expression of Abcg5/Abcg8, which is responsible for biliary cholesterol excretion. However, feeding BAs do not alter the mRNA or protein levels of Ntcp or Bsep, suggesting that the uptake or efflux of BAs is not regulated by FXR at physiological and
Myszka, Kamila; Schmidt, Marcin T; Białas, Wojciech; Olkowicz, Mariola; Leja, Katarzyna; Czaczyk, Katarzyna
2016-09-01
In the process of Pseudomonas fluorescens biofilm formation, N-acyl-l-homoserine lactone (AHL)-mediated flagella synthesis plays a key role. Inhibition of AHL production may attenuate P. fluorescens biofilm on solid surfaces. This work validated the anti-biofilm properties of p-coumaric and gallic acids via the ability of phenolics to suppress AHL synthesis in P. fluorescens KM120. The dependence between synthesis of AHL molecules, expression of flagella gene (flgA) and the ability of biofilm formation by P. fluorescens KM120 on a stainless steel surface (type 304L) was also investigated. Research was carried out in a purpose-built flow cell device. Limitations on AHL synthesis in P. fluorescens KM120 were observed at concentrations of 120 and 240 µmol L(-1) of phenolic acids in medium. At such levels of gallic and p-coumaric acids the ability of P. fluorescens KM120 to synthesize 3-oxo-C6-homoserine lactone (HSL) was not observed. These concentrations caused decreased expression of flgA gene in P. fluorescens KM120. The changes in expression of AHL-dependent flgA gene significantly decreased the rate of microorganism colonization on the stainless steel surface. Phenolic acids are able to inhibit biofilm formation. The results obtained in the work may help to develop alternative techniques for anti-biofilm treatment in the food industry. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.
1983-01-01
Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284
Sheng, R; Yan, S M; Qi, L Z; Zhao, Y L
2015-04-01
The objective of this study was to evaluate the effects of the different ratios of unsaturated fatty acids (UFAs) (oleic acid, linoleic acid, and linolenic acid) on the cell viability and triacylglycerol (TAG) content, as well as the mRNA expression of the genes related to lipid and protein synthesis in bovine mammary epithelial cells (BMECs). Primary cells were isolated from the mammary glands of Holstein dairy cows and were passaged twice. Afterward, the cells were randomly allocated to six treatments, five UFA-treated groups, and one control group. For all of the treatments, the the fetal bovine serum in the culture solution was replaced with fatty acid-free BSA (1 g/L), and the cells were treated with different ratios of oleic, linoleic, and linolenic acids (0.75:4:1, 1.5:10:1, 2:13.3:1, 3:20:1, and 4:26.7:1) for 48 h, which were group 1 to group 5. The control culture solution contained only fatty acid-free BSA without UFAs (0 μM). The results indicated that the cell viability was not affected by adding different ratios of UFAs, but the accumulation of TAG was significantly influenced by supplementing with different ratios of UFAs. Adding different ratios of UFAs suppressed the expression of ACACA and FASN but had the opposite effect on the abundances of FABP3 and CD36 mRNA. The expression levels of PPARG, SPEBF1, CSN1S1, and CSN3 mRNA in the BMECs were affected significantly after adding different ratios of UFAs. Our results suggested that groups 1, 2, and 3 (0.75:4:1, 1.5:10:1, and 2:13.3:1) had stronger auxo-action on fat synthesis in the BMECs, where group 3 (2:13.3:1) was the best, followed by group 4 (3:20:1). However, group 5 (4:26.7:1) was the worst. Genes related to protein synthesis in the BMECs were better promoted in groups 2 and 3, and group 3 had the strongest auxo-action, whereas the present study only partly examined the regulation of protein synthesis at the transcriptional level; more studies on translation level are needed in the future
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
Zhang, Yuanyuan; Jackson, Jonathan P; St Claire, Robert L; Freeman, Kimberly; Brouwer, Kenneth R; Edwards, Jeffrey E
2017-08-01
Farnesoid X receptor (FXR) is a master regulator of bile acid homeostasis through transcriptional regulation of genes involved in bile acid synthesis and cellular membrane transport. Impairment of bile acid efflux due to cholangiopathies results in chronic cholestasis leading to abnormal elevation of intrahepatic and systemic bile acid levels. Obeticholic acid (OCA) is a potent and selective FXR agonist that is 100-fold more potent than the endogenous ligand chenodeoxycholic acid (CDCA). The effects of OCA on genes involved in bile acid homeostasis were investigated using sandwich-cultured human hepatocytes. Gene expression was determined by measuring mRNA levels. OCA dose-dependently increased fibroblast growth factor-19 (FGF-19) and small heterodimer partner (SHP) which, in turn, suppress mRNA levels of cholesterol 7-alpha-hydroxylase (CYP7A1), the rate-limiting enzyme for de novo synthesis of bile acids. Consistent with CYP7A1 suppression, total bile acid content was decreased by OCA (1 μmol/L) to 42.7 ± 20.5% relative to control. In addition to suppressing de novo bile acids synthesis, OCA significantly increased the mRNA levels of transporters involved in bile acid homeostasis. The bile salt excretory pump (BSEP), a canalicular efflux transporter, increased by 6.4 ± 0.8-fold, and the basolateral efflux heterodimer transporters, organic solute transporter α (OST α ) and OST β increased by 6.4 ± 0.2-fold and 42.9 ± 7.9-fold, respectively. The upregulation of BSEP and OST α and OST β, by OCA reduced the intracellular concentrations of d 8 -TCA, a model bile acid, to 39.6 ± 8.9% relative to control. These data demonstrate that OCA does suppress bile acid synthesis and reduce hepatocellular bile acid levels, supporting the use of OCA to treat bile acid-induced toxicity observed in cholestatic diseases. © 2017 Intercept Pharmaceuticals. Pharmacology Research & Perspectives published by John Wiley & Sons Ltd, British Pharmacological Society and
Hind, Sarah R; Pulliam, Sarah E; Veronese, Paola; Shantharaj, Deepak; Nazir, Azka; Jacobs, Nekaiya S; Stratmann, Johannes W
2011-02-01
The COP9 signalosome (CSN) is a multi-protein complex that regulates the activities of cullin-RING E3 ubiquitin ligases (CRLs). CRLs ubiquitinate proteins in order to target them for proteasomal degradation. The CSN is required for proper plant development. Here we show that the CSN also has a profound effect on plant defense responses. Silencing of genes for CSN subunits in tomato plants resulted in a mild morphological phenotype and reduced expression of wound-responsive genes in response to mechanical wounding, attack by Manduca sexta larvae, and Prosystemin over-expression. In contrast, expression of pathogenesis-related genes was increased in a stimulus-independent manner in these plants. The reduced wound response in CSN-silenced plants corresponded with reduced synthesis of jasmonic acid (JA), but levels of salicylic acid (SA) were unaltered. As a consequence, these plants exhibited reduced resistance against herbivorous M. sexta larvae and the necrotrophic fungal pathogen Botrytis cinerea. In contrast, susceptibility to tobacco mosaic virus (TMV) was not altered in CSN-silenced plants. These data demonstrate that the CSN orchestrates not only plant development but also JA-dependent plant defense responses. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.
New hydrazones of ferulic acid: synthesis, characterization and biological activity.
Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa
2014-01-01
The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.
Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.
Jiang, Jianghui; Xu, Jiaxi
2017-04-16
4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.
Synthesis of monomethyl 5,5'-dehydrodiferulic acid
USDA-ARS?s Scientific Manuscript database
Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...
Carballeira, Néstor M.; Sanabria, David; Oyola, Delise
2006-01-01
An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032
Effect of the quality of dietary amino acids composition on the urea synthesis in rats.
Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2011-01-01
We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.
Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.
Lund, F; Telhag, H
1978-12-01
The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.
PROTEASOME INHIBITOR TREATMENT REDUCED FATTY ACID, TRIACYLGLYCEROL AND CHOLESTEROL SYNTHESIS
Oliva, Joan; French, Samuel W.; Li, Jun; Bardag-Gorce, Fawzia
2014-01-01
month and treated with PS-341, showed that proteasome inhibitor treatment significantly decreased ethanol-induced liver steatosis. SREBP-1c, FAS and ACC were increased by ethanol feeding alone, but were significantly decreased when proteasome inhibitor was administered to rats fed ethanol. Our results also show that both mRNA and protein levels of these lipogenic enzymes, up regulated by ethanol, were then down regulated when proteasome inhibitor was administered to rats fed ethanol. It was also confirmed that alcohol feeding caused an increase in AGPAT and DGAT, which was prevented by proteasome inhibitor treatment of the animal fed ethanol. Chronic alcohol feeding did not affect the gene expression of HMG-CoA synthase. However, PS341 administration significantly reduced the HMG-CoA synthase mRNA levels, confirming the results obtained with the microarray analysis. C/EBP transcription factors alpha (CCAAT/enhancer-binding protein alpha) has been shown to positively regulate SREBP-1c mRNA expression, thus regulating lipogenesis. Proteasome inhibition caused a decrease in C/EBP alpha mRNA expression, indicating that C/EBP down regulation may be the mechanism by which proteasome inhibitor treatment reduced lipogenesis. In conclusion, our results indicate that proteasome activity is not only involved in down regulating fatty acid synthesis and triacylglycerol synthesis, but also cholesterol synthesis and intestinal lipid adsorption. Proteasome inhibitor, administrated at a non-toxic low dose, played a beneficial role in reducing lipogenesis caused by chronic ethanol feeding and these beneficial effects are obtained because of the specificity and reversibility of the proteasome inhibitor used. PMID:22445925
Renouard, Sullivan; Corbin, Cyrielle; Lopez, Tatiana; Montguillon, Josiane; Gutierrez, Laurent; Lamblin, Frédéric; Lainé, Eric; Hano, Christophe
2012-01-01
Secoisolariciresinol diglucoside (SDG), the main phytoestrogenic lignan of Linum usitatissimum, is accumulated in the seed coat of flax during its development and pinoresinol-lariciresinol reductase (PLR) is a key enzyme in flax for its synthesis. The promoter of LuPLR1, a flax gene encoding a pinoresinol lariciresinol reductase, contains putative regulatory boxes related to transcription activation by abscisic acid (ABA). Gel mobility shift experiments evidenced an interaction of nuclear proteins extracted from immature flax seed coat with a putative cis-acting element involved in ABA response. As ABA regulates a number of physiological events during seed development and maturation we have investigated its involvement in the regulation of this lignan synthesis by different means. ABA and SDG accumulation time courses in the seed as well as LuPLR1 expression were first determined in natural conditions. These results showed that ABA timing and localization of accumulation in the flax seed coat could be correlated with the LuPLR1 gene expression and SDG biosynthesis. Experimental modulations of ABA levels were performed by exogenous application of ABA or fluridone, an inhibitor of ABA synthesis. When submitted to exogenous ABA, immature seeds synthesized 3-times more SDG, whereas synthesis of SDG was reduced in immature seeds treated with fluridone. Similarly, the expression of LuPLR1 gene in the seed coat was up-regulated by exogenous ABA and down-regulated when fluridone was applied. These results demonstrate that SDG biosynthesis in the flax seed coat is positively controlled by ABA through the transcriptional regulation of LuPLR1 gene.
Hemmati, Mohammad; Kazemi, Bahram; Najafi, Farhood; Zarebkohan, Amir; Shirkoohi, Reza
2016-01-01
Hyperbranched poly(amidoamine) (HPAMAM), structurally analogous to polyamidoamine dendrimer (PAMAM) dendrimers, has been suggested to be an effective carrier for gene delivery. In the present study, glutamic acid-modified hPAMAM was developed as a novel non-viral gene carrier for the first time. The hPAMAM was synthesized by using a modified one-pot method. DNA was found to be bound to hPAMAM at different weight ratios (WhPAMAM/WDNA). The resulting HPAMAM-Glu20 was able to efficiently protect the encapsulated-DNA against degradation for over 2 h. In addition to low cytotoxicity, the transfection efficiency of hPAMAM-Glu20 represented much higher (p < 0.05) than that of Lipofectamine 2000 in both MCF7 and MDA-MB231 cells. Cellular uptake of the hPAMAM-Glu20 in MDA-MB231 cells, 173.56 ± 1.37%, was significantly higher than that of MCF7 cells, 65.00 ± 1.73% (p < 0.05). The results indicated that hPAMAM-Glu20-mediated gene delivery to breast cancer cells is a feasible and effective strategy that may provide a new therapeutic avenue as a non-viral gene delivery carrier. In addition, it was found that hPAMAM-glutamic amino acid (Glu)-based gene delivery is an economical, effective and biocompatible method.
Stereoselective synthesis of unsaturated α-amino acids.
Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine
2015-06-01
Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.
Gene quantification by the NanoGene assay is resistant to inhibition by humic acids.
Kim, Gha-Young; Wang, Xiaofang; Ahn, Hosang; Son, Ahjeong
2011-10-15
NanoGene assay is a magnetic bead and quantum dot nanoparticles based gene quantification assay. It relies on a set of probe and signaling probe DNAs to capture the target DNA via hybridization. We have demonstrated the inhibition resistance of the NanoGene assay using humic acids laden genomic DNA (gDNA). At 1 μg of humic acid per mL, quantitiative PCR (qPCR) was inhibited to 0% of its quantification capability whereas NanoGene assay was able to maintain more than 60% of its quantification capability. To further increase the inhibition resistance of NanoGene assay at high concentration of humic acids, we have identified the specific mechanisms that are responsible for the inhibition. We examined five potential mechanisms with which the humic acids can partially inhibit our NanoGene assay. The mechanisms examined were (1) adsorption of humic acids on the particle surface; (2) particle aggregation induced by humic acids; (3) fluorescence quenching of quantum dots by humic acids during hybridization; (4) humic acids mimicking of target DNA; and (5) nonspecific binding between humic acids and target gDNA. The investigation showed that no adsorption of humic acids onto the particles' surface was observed for the humic acids' concentration. Particle aggregation and fluorescence quenching were also negligible. Humic acids also did not mimic the target gDNA except 1000 μg of humic acids per mL and hence should not contribute to the partial inhibition. Four of the above mechanisms were not related to the inhibition effect of humic acids particularly at the environmentally relevant concentrations (<100 μg/mL). However, a substantial amount of nonspecific binding was observed between the humic acids and target gDNA. This possibly results in lesser amount of target gDNA being captured by the probe and signaling DNA.
Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.
Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie
2016-04-01
The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rinker, Torri E.; Baker, Scott E.
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism.more » In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.« less
Donepudi, Ajay C.; Ferrell, Jessica M.; Boehme, Shannon; Choi, Hueng‐Sik
2017-01-01
Alcoholic fatty liver disease (AFLD) is a major risk factor for cirrhosis‐associated liver diseases. Studies demonstrate that alcohol increases serum bile acids in humans and rodents. AFLD has been linked to cholestasis, although the physiologic relevance of increased bile acids in AFLD and the underlying mechanism of increasing the bile acid pool by alcohol feeding are still unclear. In this study, we used mouse models either deficient of or overexpressing cholesterol 7α‐hydroxylase (Cyp7a1), the rate‐limiting and key regulatory enzyme in bile acid synthesis, to study the effect of alcohol drinking in liver metabolism and inflammation. Mice were challenged with chronic ethanol feeding (10 days) plus a binge dose of alcohol by oral gavage (5 g/kg body weight). Alcohol feeding reduced bile acid synthesis gene expression but increased the bile acid pool size, hepatic triglycerides and cholesterol, and inflammation and injury in wild‐type mice and aggravated liver inflammation and injury in Cyp7a1‐deficient mice. Interestingly, alcohol‐induced hepatic inflammation and injury were ameliorated in Cyp7a1 transgenic mice. Conclusion: Alcohol feeding alters hepatic bile acid and cholesterol metabolism to cause liver inflammation and injury, while maintenance of bile acid and cholesterol homeostasis protect against alcohol‐induced hepatic inflammation and injury. Our findings indicate that CYP7A1 plays a key role in protection against alcohol‐induced steatohepatitis. (Hepatology Communications 2018;2:99–112) PMID:29404516
Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D
2014-05-20
Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.
Domenichiello, Anthony F; Chen, Chuck T; Trepanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P
2014-01-01
Docosahexaenoic acid (DHA) is important for brain function, however, the exact amount required for the brain is not agreed upon. While it is believed that the synthesis rate of DHA from α-linolenic acid (ALA) is low, how this synthesis rate compares with the amount of DHA required to maintain brain DHA levels is unknown. The objective of this work was to assess whether DHA synthesis from ALA is sufficient for the brain. To test this, rats consumed a diet low in n-3 PUFAs, or a diet containing ALA or DHA for 15 weeks. Over the 15 weeks, whole body and brain DHA accretion was measured, while at the end of the study, whole body DHA synthesis rates, brain gene expression, and DHA uptake rates were measured. Despite large differences in body DHA accretion, there was no difference in brain DHA accretion between rats fed ALA and DHA. In rats fed ALA, DHA synthesis and accretion was 100-fold higher than brain DHA accretion of rats fed DHA. Also, ALA-fed rats synthesized approximately 3-fold more DHA than the DHA uptake rate into the brain. This work indicates that DHA synthesis from ALA may be sufficient to supply the brain.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.
Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip
2016-07-02
Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.
Yan, Jing; Liao, Kai; Wang, Tianjiao; Mai, Kangsen; Xu, Wei; Ai, Qinghui
2015-01-01
Ectopic lipid accumulation has been observed in fish fed a high-lipid diet. However, no information is available on the mechanism by which dietary lipid levels comprehensively regulate lipid transport, uptake, synthesis and catabolism in fish. Therefore, the present study aimed to gain further insight into how dietary lipids affect lipid deposition in the liver of large yellow croaker(Larimichthys crocea). Fish (150.00±4.95 g) were fed a diet with a low (6%), moderate (12%, the control diet) or high (18%) crude lipid content for 10 weeks. Growth performance, plasma biochemical indexes, lipid contents and gene expression related to lipid deposition, including lipoprotein assembly and clearance, fatty acid uptake and triacylglycerol synthesis and catabolism, were assessed. Growth performance was not significantly affected. However, the hepato-somatic and viscera-somatic indexes as well as plasma triacylglycerol, non-esterified fatty acids and LDL-cholesterol levels were significantly increased in fish fed the high-lipid diet. In the livers of fish fed the high-lipid diet, the expression of genes related to lipoprotein clearance (LDLR) and fatty acid uptake (FABP11) was significantly up-regulated, whereas the expression of genes involved in lipoprotein assembly (apoB100), triacylglycerol synthesis and catabolism (DGAT2, CPT I) was significantly down-regulated compared with fish fed the control diet, and hepatic lipid deposition increased. In fish fed the low-lipid diet, the expression of genes associated with lipoprotein assembly and clearance (apoB100, LDLR, LRP-1), fatty acid uptake (CD36, FATP1, FABP3) and triacylglycerol synthesis (FAS) was significantly increased, whereas the expression of triacylglycerol catabolism related genes (ATGL, CPT I) was reduced compared with fish fed the control diet. However, hepatic lipid content in fish fed the low-lipid diet decreased mainly due to low dietary lipid intake. In summary, findings of this study provide molecular
Yan, Jing; Liao, Kai; Wang, Tianjiao; Mai, Kangsen; Xu, Wei; Ai, Qinghui
2015-01-01
Ectopic lipid accumulation has been observed in fish fed a high-lipid diet. However, no information is available on the mechanism by which dietary lipid levels comprehensively regulate lipid transport, uptake, synthesis and catabolism in fish. Therefore, the present study aimed to gain further insight into how dietary lipids affect lipid deposition in the liver of large yellow croaker(Larimichthys crocea). Fish (150.00±4.95 g) were fed a diet with a low (6%), moderate (12%, the control diet) or high (18%) crude lipid content for 10 weeks. Growth performance, plasma biochemical indexes, lipid contents and gene expression related to lipid deposition, including lipoprotein assembly and clearance, fatty acid uptake and triacylglycerol synthesis and catabolism, were assessed. Growth performance was not significantly affected. However, the hepato-somatic and viscera-somatic indexes as well as plasma triacylglycerol, non-esterified fatty acids and LDL-cholesterol levels were significantly increased in fish fed the high-lipid diet. In the livers of fish fed the high-lipid diet, the expression of genes related to lipoprotein clearance (LDLR) and fatty acid uptake (FABP11) was significantly up-regulated, whereas the expression of genes involved in lipoprotein assembly (apoB100), triacylglycerol synthesis and catabolism (DGAT2, CPT I) was significantly down-regulated compared with fish fed the control diet, and hepatic lipid deposition increased. In fish fed the low-lipid diet, the expression of genes associated with lipoprotein assembly and clearance (apoB100, LDLR, LRP-1), fatty acid uptake (CD36, FATP1, FABP3) and triacylglycerol synthesis (FAS) was significantly increased, whereas the expression of triacylglycerol catabolism related genes (ATGL, CPT I) was reduced compared with fish fed the control diet. However, hepatic lipid content in fish fed the low-lipid diet decreased mainly due to low dietary lipid intake. In summary, findings of this study provide molecular
Do rice suspension-cultured cells treated with abscisic acid mimic developing seeds?
Matsuno, Koya; Fujimura, Tatsuhito
2015-08-01
Starch synthesis is activated in the endosperm during seed development and also in rice suspension cells cultured with abscisic acid. In the anticipation that the mechanisms of starch synthesis are similar between the endosperm and the suspension cells cultured with abscisic acid, expression of genes involved in starch synthesis was evaluated in the suspension cells after abscisic acid treatment. However, it was found that the regulatory mechanism of starch synthesis in the suspension cells cultured with abscisic acid was different from that in developing seeds. Expression analyses of genes involved in oil bodies, which accumulate in the embryo and aleurone layer, and seed storage proteins, which accumulate mainly in the endosperm, showed that the former were activated in the suspension cells cultured with abscisic acid, but the latter were not. Master regulators for embryogenesis, OsVP1 (homologue of AtABI3) and OsLFL1 (homologue of AtFUS3 or AtLFL2), were expressed in the suspension cells at levels comparable to those in the embryo. From these results, it is suggested that interactions between regulators and abscisic acid control the synthesis of phytic acid and oil bodies in the cultured cells and embryo. We suggest that the system of suspension cells cultured with abscisic acid helps to reveal the mechanisms of phytic acid and oil body synthesis in embryo.
Zhang, Xiaolei; Wu, Yan; Pan, Zongyou; Sun, Heng; Wang, Junjuan; Yu, Dongsheng; Zhu, Shouan; Dai, Jun; Chen, Yishan; Tian, Naifeng; Heng, Boon Chin; Coen, Noelle D; Xu, Huazi; Ouyang, Hongwei
2016-09-15
Poly (lactic-co-glycolic acid) (PLGA) and poly-l-lactate acid (PLLA) are biodegradable polymers widely utilized as scaffold materials for cartilage tissue engineering. Their acid degradation products have been widely recognized as being detrimental to cell function. However, the biological effects of lactate, rather than lactic acid, on chondrocytes have never been investigated. This is the major focus of this study. The amounts of lactate and the pH value (acid) of the PLGA and PLLA degradation medium were measured. The effects of PLGA and PLLA degradation medium, as well as different lactate concentrations and timing of exposure on chondrocytes proliferation and cartilage-specific matrix synthesis were investigated by various techniques including global gene expression profiling and gene knockdown experiments. It was shown that PLGA and PLLA degradation medium differentially regulated chondrocyte proliferation and matrix synthesis. Acidic pH caused by lactate inhibited chondrocyte proliferation and matrix synthesis. The effect of lactate on chondrocyte matrix synthesis was both time and dose dependent. A lactate concentration of 100mM and exposure duration of 8h significantly enhanced matrix synthesis. Lactate could also inhibit expression of cartilage matrix degradation genes in osteoarthritic chondrocytes, such as the major aggrecanase ADAMTS5, whilst promoting matrix synthesis simultaneously. Pulsed addition of lactate was shown to be more efficient in promoting COL2A1 expression. Global gene expression data and gene knock down experiments demonstrated that lactate promote matrix synthesis through up-regulation of HIF1A. These observed differential biological effects of lactate on chondrocytes would have implications for the future design of polymeric cartilage scaffolds. Lactic acid is a widely used substrate for polymers synthesis, PLGA and PLLA in particular. Although physical and biological modifications have been made on these polymers to make them be
Zhang, Rui-Qin; Zhu, Hong-Hui; Zhao, Hai-Quan; Yao, Qing
2013-01-01
Arbuscular mycorrhizal fungi can increase the host resistance to pathogens via promoted phenolic synthesis, however, the signaling pathway responsible for it still remains unclear. In this study, in order to reveal the signaling molecules involved in this process, we inoculated Trifolium repense L. with an arbuscular mycorrhizal fungus (AMF), Glomus mosseae, and monitored the contents of phenolics and signaling molecules (hydrogen peroxide (H(2)O(2)), salicylic acid (SA), and nitric oxide (NO)) in roots, measured the activities of l-phenylalanine ammonia-lyase (PAL) and nitric oxide synthase (NOS), and the expression of pal and chs genes. Results demonstrated that AMF colonization promoted the phenolic synthesis, in parallel with the increase in related enzyme activity and gene expression. Meanwhile, the accumulation of all three signaling molecules was also up-regulated by AMF. This study suggested that AMF increased the phenolic synthesis in roots probably via signaling pathways of H(2)O(2), SA and NO in a signaling cascade. Copyright © 2012 Elsevier GmbH. All rights reserved.
Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo
2015-01-01
We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.
Phosphatidic Acid Synthesis in Bacteria
Yao, Jiangwei; Rock, Charles O.
2012-01-01
Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714
Myrtle, J D; Beekman, A M; Barrow, R A
2016-09-21
A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).
Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.
1983-09-01
We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less
Fukuda, N; Ontko, J A
1984-08-01
In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of
Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.
2009-01-01
The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020
By-products of electrochemical synthesis of suberic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.
By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.
Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A
2007-11-01
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.
Fatty acid synthesis in Escherichia coli
Knivett, V. A.; Cullen, Julia
1967-01-01
1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364
Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R
2014-07-01
The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.
De Tonnac, A; Labussière, E; Vincent, A; Mourot, J
2016-07-01
The regulation of lipogenesis mechanisms related to consumption of n-3 PUFA is poorly understood. The aim of the present study was to find out whether α-linolenic acid (ALA) or DHA uptake can have an effect on activities and gene expressions of enzymes involved in lipid metabolism in the liver, subcutaneous adipose tissue and longissimus dorsi (LD) muscle of growing-finishing pigs. Six groups of ten pigs received one of six experimental diets supplemented with rapeseed oil in the control diet, extruded linseed, microalgae or a mixture of both to implement different levels of ALA and DHA with the same content in total n-3. Results were analysed for linear and quadratic effects of DHA intake. The results showed that activities of malic enzyme (ME) and fatty acid synthase (FAS) decreased linearly in the liver with dietary DHA. Although the expression of the genes of these enzymes and their activities were poorly correlated, ME and FAS expressions also decreased linearly with DHA intake. The intake of DHA down-regulates the expressions of other genes involved in fatty acid (FA) metabolism in some tissues of pigs, such as fatty acid desaturase 2 and sterol-regulatory element binding transcription factor 1 in the liver and 2,4-dienoyl CoA reductase 2 in the LD muscle. FA oxidation in the LD muscle and FA synthesis decreased in the liver with increasing amount of dietary DHA, whereas a retroconversion of DHA into EPA seems to be set up in this last tissue.
Arunima, Sakunthala; Rajamohan, Thankappan
2014-05-28
The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.
Inhibition of rotavirus replication by downregulation of fatty acid synthesis.
Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich
2013-06-01
Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.
The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan.
Mittal, Nitish; Guimaraes, Joao C; Gross, Thomas; Schmidt, Alexander; Vina-Vilaseca, Arnau; Nedialkova, Danny D; Aeschimann, Florian; Leidel, Sebastian A; Spang, Anne; Zavolan, Mihaela
2017-09-06
In Saccharomyces cerevisiae, deletion of large ribosomal subunit protein-encoding genes increases the replicative lifespan in a Gcn4-dependent manner. However, how Gcn4, a key transcriptional activator of amino acid biosynthesis genes, increases lifespan, is unknown. Here we show that Gcn4 acts as a repressor of protein synthesis. By analyzing the messenger RNA and protein abundance, ribosome occupancy and protein synthesis rate in various yeast strains, we demonstrate that Gcn4 is sufficient to reduce protein synthesis and increase yeast lifespan. Chromatin immunoprecipitation reveals Gcn4 binding not only at genes that are activated, but also at genes, some encoding ribosomal proteins, that are repressed upon Gcn4 overexpression. The promoters of repressed genes contain Rap1 binding motifs. Our data suggest that Gcn4 is a central regulator of protein synthesis under multiple perturbations, including ribosomal protein gene deletions, calorie restriction, and rapamycin treatment, and provide an explanation for its role in longevity and stress response.The transcription factor Gcn4 is known to regulate yeast amino acid synthesis. Here, the authors show that Gcn4 also acts as a repressor of protein biosynthesis in a range of conditions that enhance yeast lifespan, such as ribosomal protein knockout, calorie restriction or mTOR inhibition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, P.; Shanklin, J.; Burton, J. W.
2008-11-01
Stearic acid (18:0) is typically a minor component of soybean [Glycine max (L.) Merr.] oil, accounting for only 2 to 4% of the total fatty acid content. Increasing stearic acid levels of soybean oil would lead to enhanced oxidative stability, potentially reducing the need for hydrogenation, a process leading to the formation of undesirable trans fatty acids. Although mutagenesis strategies have been successful in developing soybean germplasm with elevated 18:0 levels in the seed oil, the specific gene mutations responsible for this phenotype were not known. We report a newly identified soybean gene, designated SACPD-C, that encodes a unique isoformmore » of {Delta}{sup 9}-stearoyl-ACP-desaturase, the enzyme responsible for converting stearic acid to oleic acid (18:1). High levels of SACPD-C transcript were only detected in developing seed tissue, suggesting that the encoded desaturase functions to enhance oleic acid biosynthetic capacity as the immature seed is actively engaged in triacylglycerol production and storage. The participation of SACPD-C in storage triacylglycerol synthesis is further supported by the observation of mutations in this gene in two independent sources of elevated 18:0 soybean germplasm, A6 (30% 18:0) and FAM94-41 (9% 18:0). A molecular marker diagnostic for the FAM94-41 SACPD-C gene mutation strictly associates with the elevated 18:0 phenotype in a segregating population, and could thus serve as a useful tool in the development of cultivars with oils possessing enhanced oxidative stability.« less
Kursu, V. A. Samuli; Pietikäinen, Laura P.; Fontanesi, Flavia; Aaltonen, Mari J.; Suomi, Fumi; Nair, Remya Raghavan; Schonauer, Melissa S.; Dieckmann, Carol L.; Barrientos, Antoni; Hiltunen, J. Kalervo; Kastaniotis, Alexander J.
2014-01-01
Summary Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild heme deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a coordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. PMID:24102902
Kursu, V A Samuli; Pietikäinen, Laura P; Fontanesi, Flavia; Aaltonen, Mari J; Suomi, Fumi; Raghavan Nair, Remya; Schonauer, Melissa S; Dieckmann, Carol L; Barrientos, Antoni; Hiltunen, J Kalervo; Kastaniotis, Alexander J
2013-11-01
Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild haem deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a co-ordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. © 2013 John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Dong, Xuewei; He, Qingfang; Peng, Zhenying; Yu, Jinhui; Bian, Fei; Li, Youzhi; Bi, Yuping
2016-07-01
Genetic modification is useful for improving the nutritional qualities of cyanobacteria. To increase the total unsaturated fatty acid content, along with the ratio of ω-3/ω-6 fatty acids, genetic engineering can be used to modify fatty acid metabolism. Synechococcus sp. PCC7002, a fast-growing cyanobacterium, does not contain a Δ6 desaturase gene and is therefore unable to synthesize γ-linolenic acid (GLA) and stearidonic acid (SDA), which are important in human health. In this work, we constructed recombinant vectors Syd6D, Syd15D and Syd6Dd15D to express the Δ15 desaturase and Δ6 desaturase genes from Synechocystis PCC6803 in Synechococcus sp. PCC7002, with the aim of expressing polyunsaturated fatty acids. Overexpression of the Δ15 desaturase gene in Synechococcus resulted in 5.4 times greater accumulation of α-linolenic acid compared with the wild-type while Δ6 desaturase gene expression produced both GLA and SDA. Co-expression of the two genes resulted in low-level accumulation of GLA but much larger amounts of SDA, accounting for as much to 11.64% of the total fatty acid content.
Mouse Vk gene classification by nucleic acid sequence similarity.
Strohal, R; Helmberg, A; Kroemer, G; Kofler, R
1989-01-01
Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.
Domenichiello, Anthony F.; Chen, Chuck T.; Trepanier, Marc-Olivier; Stavro, P. Mark; Bazinet, Richard P.
2014-01-01
Docosahexaenoic acid (DHA) is important for brain function, however, the exact amount required for the brain is not agreed upon. While it is believed that the synthesis rate of DHA from α-linolenic acid (ALA) is low, how this synthesis rate compares with the amount of DHA required to maintain brain DHA levels is unknown. The objective of this work was to assess whether DHA synthesis from ALA is sufficient for the brain. To test this, rats consumed a diet low in n-3 PUFAs, or a diet containing ALA or DHA for 15 weeks. Over the 15 weeks, whole body and brain DHA accretion was measured, while at the end of the study, whole body DHA synthesis rates, brain gene expression, and DHA uptake rates were measured. Despite large differences in body DHA accretion, there was no difference in brain DHA accretion between rats fed ALA and DHA. In rats fed ALA, DHA synthesis and accretion was 100-fold higher than brain DHA accretion of rats fed DHA. Also, ALA-fed rats synthesized approximately 3-fold more DHA than the DHA uptake rate into the brain. This work indicates that DHA synthesis from ALA may be sufficient to supply the brain. PMID:24212299
NASA Astrophysics Data System (ADS)
He, Christine; Gállego, Isaac; Laughlin, Brandon; Grover, Martha A.; Hud, Nicholas V.
2017-04-01
Many hypotheses concerning the nature of early life assume that genetic information was once transferred through the template-directed synthesis of RNA, before the emergence of coded enzymes. However, attempts to demonstrate enzyme-free, template-directed synthesis of nucleic acids have been limited by 'strand inhibition', whereby transferring information from a template strand in the presence of its complementary strand is inhibited by the stability of the template duplex. Here, we use solvent viscosity to circumvent strand inhibition, demonstrating information transfer from a gene-length template (>300 nt) within a longer (545 bp or 3 kb) duplex. These results suggest that viscous environments on the prebiotic Earth, generated periodically by water evaporation, could have facilitated nucleic acid replication—particularly of long, structured sequences such as ribozymes. Our approach works with DNA and RNA, suggesting that viscosity-mediated replication is possible for a range of genetic polymers, perhaps even for informational polymers that may have preceded RNA.
Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.
Dacquin, J P; Lee, A F; Pirez, C; Wilson, K
2012-01-07
Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012
Synthesis of acid-soluble spore proteins by Bacillus subtilis.
Leventhal, J M; Chambliss, G H
1982-12-01
The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.
NASA Astrophysics Data System (ADS)
Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele
2017-07-01
The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peng, Zhaohua PEng; Ronald, Palmela; Wang, Guo-Liang
This project aims to identify the regulatory genes of rice cell wall synthesis pathways using a cell wall removal and regeneration system. We completed the gene expression profiling studies following the time course from cell wall removal to cell wall regeneration in rice suspension cells. We also completed, total proteome, nuclear subproteome and histone modification studies following the course from cell wall removal and cell wall regeneration process. A large number of differentially expressed regulatory genes and proteins were identified. Meanwhile, we generated RNAi and over-expression transgenic rice for 45 genes with at least 10 independent transgenic lines for eachmore » gene. In addition, we ordered T-DNA and transposon insertion mutants for 60 genes from Korea, Japan, and France and characterized the mutants. Overall, we have mutants and transgenic lines for over 90 genes, exceeded our proposed goal of generating mutants for 50 genes. Interesting Discoveries a) Cell wall re-synthesis in protoplasts may involve a novel cell wall synthesis mechanism. The synthesis of the primary cell wall is initiated in late cytokinesis with further modification during cell expansion. Phragmoplast plays an essential role in cell wall synthesis. It services as a scaffold for building the cell plate and formation of a new cell wall. Only one phragmoplast and one new cell wall is produced for each dividing cell. When the cell wall was removed enzymatically, we found that cell wall re-synthesis started from multiple locations simultaneously, suggesting that a novel mechanism is involved in cell wall re-synthesis. This observation raised many interesting questions, such as how the starting sites of cell wall synthesis are determined, whether phragmoplast and cell plate like structures are involved in cell wall re-synthesis, and more importantly whether the same set of enzymes and apparatus are used in cell wall re-synthesis as during cytokinesis. Given that many known cell
Dietary fish oil regulates gene expression of cholesterol and bile acid transporters in mice.
Kamisako, Toshinori; Tanaka, Yuji; Ikeda, Takanori; Yamamoto, Kazuo; Ogawa, Hiroshi
2012-03-01
Fish oil rich in n-3 polyunsaturated fatty acids is known to affect hepatic lipid metabolism. Several studies have demonstrated that fish oil may affect the bile acid metabolism as well as lipid metabolism, whereas only scarce data are available. The aim of this study was to investigate the effect of fish oil on the gene expression of the transporters and enzymes related to bile acid as well as lipid metabolism in the liver and small intestine. Seven-week old male C57BL/6 mice were fed diets enriched in 10% soybean oil or 10% fish oil for 4 weeks. After 4 weeks, blood, liver and small intestine were obtained. Hepatic mRNA expression of lipids (Abcg5/8, multidrug resistance gene product 2) and bile acids transporters (bile salt export pump, multidrug resistance associated protein 2 and 3, organic solute transporter α) was induced in fish oil-fed mice. Hepatic Cyp8b1, Cyp27a1 and bile acid CoA : amino acid N-acyltransferase were increased in fish oil-fed mice compared with soybean-oil fed mice. Besides, intestinal cholesterol (Abcg5/8) and bile acid transporters (multidrug resistance associated protein 2 and organic solute transporter α) were induced in fish oil-fed mice. Fish oil induced the expression of cholesterol and bile acid transporters not only in liver but in intestine. The upregulation of Abcg5/g8 by fish oil is caused by an increase in cellular 27-HOC through Cyp27a1 induction. The hepatic induction of bile acid synthesis through Cyp27a1 may upregulate expression of bile acid transporters in both organs. © 2012 The Japan Society of Hepatology.
The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.
T Banaszak1 A; LaJeunesse; Trench
2000-06-28
We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.
Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A
2008-10-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.
Schwarz, Margrit; Wright, Angelique C.; Davis, Daphne L.; Nazer, Hisham; Björkhem, Ingemar; Russell, David W.
2000-01-01
We used expression cloning to isolate cDNAs encoding a microsomal 3β-hydroxy-Δ5-C27-steroid oxidoreductase (C27 3β-HSD) that is expressed predominantly in the liver. The predicted product shares 34% sequence identity with the C19 and C21 3β-HSD enzymes, which participate in steroid hormone metabolism. When transfected into cultured cells, the cloned C27 3β-HSD cDNA encodes an enzyme that is active against four 7α-hydroxylated sterols, indicating that a single C27 3β-HSD enzyme can participate in all known pathways of bile acid synthesis. The expressed enzyme did not metabolize several different C19/21 steroids as substrates. The levels of hepatic C27 3β-HSD mRNA in the mouse are not sexually dimorphic and do not change in response to dietary cholesterol or to changes in bile acid pool size. The corresponding human gene on chromosome 16p11.2-12 contains six exons and spans 3 kb of DNA, and we identified a 2-bp deletion in the C27 3β-HSD gene of a patient with neonatal progressive intrahepatic cholestasis. This mutation eliminates the activity of the enzyme in transfected cells. These findings establish the central role of C27 3β-HSD in the biosynthesis of bile acids and provide molecular tools for the diagnosis of a third type of neonatal progressive intrahepatic cholestasis associated with impaired bile acid synthesis. PMID:11067870
Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.
Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M
2012-03-27
In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society
Synthesis of new Cα-tetrasubstituted α-amino acids
Grauer, Andreas A
2009-01-01
Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341
ERIC Educational Resources Information Center
Barrelle, M.; And Others
1983-01-01
Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)
Ryan, P R; Tyerman, S D; Sasaki, T; Furuichi, T; Yamamoto, Y; Zhang, W H; Delhaize, E
2011-01-01
Acid soils restrict plant production around the world. One of the major limitations to plant growth on acid soils is the prevalence of soluble aluminium (Al(3+)) ions which can inhibit root growth at micromolar concentrations. Species that show a natural resistance to Al(3+) toxicity perform better on acid soils. Our understanding of the physiology of Al(3+) resistance in important crop plants has increased greatly over the past 20 years, largely due to the application of genetics and molecular biology. Fourteen genes from seven different species are known to contribute to Al(3+) tolerance and resistance and several additional candidates have been identified. Some of these genes account for genotypic variation within species and others do not. One mechanism of resistance which has now been identified in a range of species relies on the efflux of organic anions such as malate and citrate from roots. The genes controlling this trait are members of the ALMT and MATE families which encode membrane proteins that facilitate organic anion efflux across the plasma membrane. Identification of these and other resistance genes provides opportunities for enhancing the Al(3+) resistance of plants by marker-assisted breeding and through biotechnology. Most attempts to enhance Al(3+) resistance in plants with genetic engineering have targeted genes that are induced by Al(3+) stress or that are likely to increase organic anion efflux. In the latter case, studies have either enhanced organic anion synthesis or increased organic anion transport across the plasma membrane. Recent developments in this area are summarized and the structure-function of the TaALMT1 protein from wheat is discussed.
Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water
NASA Technical Reports Server (NTRS)
Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.
2017-01-01
Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing
Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam
2015-01-01
Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623
Synthesis of novel acid electrolytes for phosphoric acid fuel cells
NASA Astrophysics Data System (ADS)
Adcock, James L.
1988-11-01
A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.
Hong, Chenlu; Chen, Yangyang; Li, Lu; Chen, Shouwen; Wei, Xuetuan
2017-03-01
Natto as a fermented soybean product has many health benefits for human due to its rich nutritional and functional components. However, the unpleasant odor of natto, caused by the formation of branched-chain short fatty acids (BCFAs), prohibits the wide acceptance of natto products. This work is to identify the key gene of BCFAs formation and develop the guidance to reduce natto odor. Transcriptional analysis of BCFAs synthesis pathway genes was conducted in two Bacillus subtilis strains with obvious different BCFAs synthesis abilities. The transcriptional levels of bcd, bkdAA, and ptb in B. subtilis H-9 were 2.7-fold, 0.7-fold, and 8.9-fold higher than that of B. subtilis H-4, respectively. Therefore, the ptb gene with the highest transcriptional change was considered as the key gene in BCFAs synthesis. The ptb encoded enzyme Ptb was further characterized by inducible expression in Escherichia coli. The recombinant Ptb protein (about 32 kDa) was verified by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis analysis. The catalysis functions of Ptb were confirmed on substrates of isovaleryl-CoA and isobutyryl-CoA, and the higher catalysis efficiency of Ptb on isovaleryl-CoA explained the higher level of isovaleric acid in natto. The optimal activities of Ptb were observed at 50 °C and pH 8.0, and the enzymatic activity was inhibited by Ca 2+ , Zn 2+ , Ba 2+ , Mn 2+ , Cu 2+ , SDS, and EDTA. Collectively, this study reports a key gene responsible for BCFAs formation in natto fermentation and provides potential strategies to solve the odor problem.
Hsieh, En-Jung; Waters, Brian M.
2016-01-01
Iron (Fe) is an essential mineral that has low solubility in alkaline soils, where its deficiency results in chlorosis. Whether low Fe supply and alkaline pH stress are equivalent is unclear, as they have not been treated as separate variables in molecular physiological studies. Additionally, molecular responses to these stresses have not been studied in leaf and root tissues simultaneously. We tested how plants with the Strategy I Fe uptake system respond to Fe deficiency at mildly acidic and alkaline pH by measuring root ferric chelate reductase (FCR) activity and expression of selected Fe uptake genes and riboflavin synthesis genes. Alkaline pH increased cucumber (Cucumis sativus L.) root FCR activity at full Fe supply, but alkaline stress abolished FCR response to low Fe supply. Alkaline pH or low Fe supply resulted in increased expression of Fe uptake genes, but riboflavin synthesis genes responded to Fe deficiency but not alkalinity. Iron deficiency increased expression of some common genes in roots and leaves, but alkaline stress blocked up-regulation of these genes in Fe-deficient leaves. In roots of the melon (Cucumis melo L.) fefe mutant, in which Fe uptake responses are blocked upstream of Fe uptake genes, alkaline stress or Fe deficiency up-regulation of certain Fe uptake and riboflavin synthesis genes was inhibited, indicating a central role for the FeFe protein. These results suggest a model implicating shoot-to-root signaling of Fe status to induce Fe uptake gene expression in roots. PMID:27605716
Participation of fad and mbt Genes in Synthesis of Mycobactin in Mycobacterium smegmatis
LaMarca, B. Babbette D.; Zhu, Wenming; Arceneaux, Jean E. L.; Rowe Byers, B.; Lundrigan, Michael D.
2004-01-01
Colonies of Mycobacterium smegmatis LR222 on iron-limiting (0.1 μM Fe) minimal medium agar fluoresce under UV light due to the accumulation in the cells of the deferri form of the siderophore mycobactin. Two mutants with little or no fluorescence, designated LUN8 and LUN9, were isolated by screening colonies of transposon (Tn611)-mutagenized M. smegmatis. Ferrimycobactin prepared from iron-restricted cells of the wild type had an Rf of 0.62 on high-performance thin-layer chromatography (HPTLC) and a characteristic visible absorption spectrum with a peak near 450 nm. Similar extracts from LUN8 cells contained a small amount of ferrimycobactin with an Rf of 0.58 on HPTLC and an absorption spectrum with the peak shifted to a wavelength lower than that of the wild-type ferrimycobactin. Nuclear magnetic resonance spectroscopy studies suggested that the LUN8 mycobactin may have an altered fatty acid side chain. Mutant strain LUN9 produced no detectable mycobactin. Neither mutant strain produced measurable amounts of excreted mycobactin, although both excreted exochelin (the mycobacterial peptido-hydroxamate siderophore), and both mutants were more sensitive than the wild-type strain to growth inhibition by the iron chelator ethylenediamine-di(o-hydroxyphenylacetic acid). The transposon insertion sites were identified, and sequence analyses of the cloned flanking chromosome regions showed that the mutated gene in LUN9 was an orthologue of the Mycobacterium tuberculosis mycobactin biosynthetic gene mbtE. The mutated gene in LUN8 had homology with M. tuberculosis fadD33 (Rv1345), a gene that may encode an acyl-coenzyme A synthase and which previously was not known to participate in synthesis of mycobactin. PMID:14702306
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chander, A.; Gullo, J.; Reicherter, J.
1987-05-01
Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less
Synthesis and antituberculosis activity of new fatty acid amides.
D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes
2010-09-01
This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.
Amino acid metabolism in dairy cows and their regulation in milk synthesis.
Wang, Feiran; Shi, Haitao; Wang, Shuxiang; Wang, Yajing; Cao, Zhijun; Li, Shengli
2018-06-10
Reducing dietary crude protein (CP) and supplementing with certain amino acids (AAs) has been known as a potential solution to improve nitrogen (N) efficiency in dairy production. Thus understanding how AAs are utilized in various sites along the gut is critical. AA flow from the intestine to portal-drained viscera (PDV) and liver then to the mammary gland was elaborated in this article. Recoveries in individual AA in PDV and liver seem to share similar AA pattern with input: output ratio in mammary gland, which subdivides essential AA (EAA) into two groups, lysine (Lys) and branched-chain AA (BCAA) in group 1, input: output ratio > 1; methionine (Met), histidine (His), phenylalanine (Phe) etc. in group 2, input: output ratio close to 1. AAs in the mammary gland are either utilized for milk protein synthesis or retained as body tissue, or catabolized. The fractional removal of AAs and the number and activity of AA transporters together contribute to the ability of AAs going through mammary cells. Mammalian target of rapamycin (mTOR) pathway is closely related to milk protein synthesis and provides alternatives for AA regulation of milk protein synthesis, which connects AA with lactose synthesis via α-lactalbumin (gene: LALBA) and links with milk fat synthesis via sterol regulatory element-binding transcription protein 1 (SREBP1) and peroxisome proliferator-activated receptor (PPAR). Overall, AA flow across various tissues reveal AA metabolism and utilization in dairy cows on one hand. While the function of AA in the biosynthesis of milk protein, fat and lactose at both transcriptional and posttranscriptional level from another angle provides the possibility for us to regulate them for higher efficiency. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.
Evans, R M; Scholz, R W
1977-04-01
Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.
Synthesis of the sulfur amino acids: cysteine and methionine.
Wirtz, Markus; Droux, Michel
2005-12-01
This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.
Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo
2016-01-15
Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.
Sun, Xiaowen; Wu, Hefang; Zhao, Genhai; Li, Zhemin; Wu, Xihua; Liu, Hui; Zheng, Zhiming
2018-04-02
The mycelial morphology of Aspergillus niger, a major filamentous fungus used for citric acid production, is important for citric acid synthesis during submerged fermentation. To investigate the involvement of the chitin synthase gene, chsC, in morphogenesis and citric acid production in A. niger, an RNAi system was constructed to silence chsC and the morphological mutants were screened after transformation. The compactness of the mycelial pellets was obviously reduced in the morphological mutants, with lower proportion of dispersed mycelia. These morphological changes have caused a decrease in viscosity and subsequent improvement in oxygen and mass transfer efficiency, which may be conducive for citric acid accumulation. All the transformants exhibited improvements in citric acid production; in particular, chsC-3 showed 42.6% higher production than the original strain in the shake flask. Moreover, the high-yield strain chsC-3 exhibited excellent citric acid production potential in the scale-up process.The citric acid yield and the conversion rate of glucose of chsC-3 were both improved by 3.6%, when compared with that of the original strain in the stirred tank bioreactor.
Wang, Hualin; Cai, Yazheng; Shao, Yang; Zhang, Xifeng; Li, Na; Zhang, Hongyu; Liu, Zhiguo
2018-04-29
The present study aims to investigate the protective effects of ω-3 polyunsaturated fatty acids (ω-3PUFAs) against high-fat diet induced male mouse reproductive dysfunction and to explore circadian regulation mechanisms. Male C57BL/6 mice were randomly divided into three groups and fed a normal chow diet (control group, CON), a high-fat diet (HFD group) or a HFD supplemented with fish oil (FO group) for 12 weeks. After 12 weeks of feeding, the body weight and the ratio of perinephric and epididymal fat weight to body weight were significantly higher in the HFD group compared with the CON group. The supplement of fish oil rich in ω-3PUFAs only slightly reduced the HFD-induced obesity but remarkably ameliorated HFD-induced dyslipidemia, sexual hormones disorder, testicle lesions and germ cell apoptosis. Fish oil supplementation restored the expression of steroid synthesis associated genes in HFD fed mouse and flattened the HFD-induced oscillations in circadian genes' expression. Fish oil supplementation prevented HFD-induced male mouse reproductive dysfunction and modified the rhythmic expression of testosterone synthesis related genes.
Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.
Hansen, Alexandar L; Behrman, Edward J
2016-08-05
We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.
Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.
Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos
2016-08-29
α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.
Jones, J A; Blecher, M
1966-05-01
The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.
Janczarek, Monika; Rachwał, Kamila
2013-12-05
The symbiotic nitrogen-fixing bacterium Rhizobium leguminosarum bv. trifolii 24.2 secretes large amounts of acidic exopolysaccharide (EPS), which plays a crucial role in establishment of effective symbiosis with clover. The biosynthesis of this heteropolymer is conducted by a multi-enzymatic complex located in the bacterial inner membrane. PssA protein, responsible for the addition of glucose-1-phosphate to a polyprenyl phosphate carrier, is involved in the first step of EPS synthesis. In this work, we characterize R. leguminosarum bv. trifolii strain Rt270 containing a mini-Tn5 transposon insertion located in the 3'-end of the pssA gene. It has been established that a mutation in this gene causes a pleiotropic effect in rhizobial cells. This is confirmed by the phenotype of the mutant strain Rt270, which exhibits several physiological and symbiotic defects such as a deficiency in EPS synthesis, decreased motility and utilization of some nutrients, decreased sensitivity to several antibiotics, an altered extracellular protein profile, and failed host plant infection. The data of this study indicate that the protein product of the pssA gene is not only involved in EPS synthesis, but also required for proper functioning of Rhizobium leguminosarum bv. trifolii cells.
Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.
Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko
2016-09-01
Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions
NASA Astrophysics Data System (ADS)
Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.
1980-09-01
Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.
Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.
2008-01-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537
Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.
Galardon, Erwan; Lec, Jean-Chrstophe
2018-05-20
A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.
Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D
1980-06-01
The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.
Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S
2000-11-25
Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.
Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P
1990-02-01
During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.
DNA methylation of amino acid transporter genes in the human placenta.
Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K
2017-12-01
Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.
Grandvalet, Cosette; Assad-García, Juan Simón; Chu-Ky, Son; Tollot, Marie; Guzzo, Jean; Gresti, Joseph; Tourdot-Maréchal, Raphaëlle
2008-09-01
Cyclopropane fatty acid (CFA) synthesis was investigated in Oenococcus oeni. The data obtained demonstrated that acid-grown cells or cells harvested in the stationary growth phase showed changes in fatty acid composition similar to those of ethanol-grown cells. An increase of the CFA content and a decrease of the oleic acid content were observed. The biosynthesis of CFAs from unsaturated fatty acid phospholipids is catalysed by CFA synthases. Quantitative real-time-PCR experiments were performed on the cfa gene of O. oeni, which encodes a putative CFA synthase. The level of cfa transcripts increased when cells were harvested in stationary phase and when cells were grown in the presence of ethanol or at low pH, suggesting transcriptional regulation of the cfa gene under different stress conditions. In contrast to Escherichia coli, only one functional promoter was identified upstream of the cfa gene of O. oeni. The function of the cfa gene was confirmed by complementation of a cfa-deficient E. coli strain. Nevertheless, the complementation remained partial because the conversion percentage of unsaturated fatty acids into CFA of the complemented strain was much lower than that of the wild-type strain. Moreover, a prevalence of cycC19 : 0 was observed in the membrane of the complemented strain. This could be due to a specific affinity of the CFA synthase from O. oeni. In spite of this partial complementation, the complemented strain of E. coli totally recovered its viability after ethanol shock (10 %, v/v) whereas its viability was only partly recovered after an acid shock at pH 3.0.
Lee, Sunhee; Jeon, Eunyoung; Jung, Yeontae; Lee, Jinwon
2012-05-01
The goal of the present study was to increase the content of intracellular long-chain fatty acids in two bacterial strains, Pseudomonas aeruginosa PA14 and Escherichia coli K-12 MG1655, by co-overexpressing essential enzymes that are involved in the fatty acid synthesis metabolic pathway. Recently, microbial fatty acids and their derivatives have been receiving increasing attention as an alternative source of fuel. By introducing two genes (accA and fabD) of P. aeruginosa into the two bacterial strains and by co-expressing with them the fatty acyl-acyl carrier protein thioesterase gene of Streptococcus pyogenes (strain MGAS10270), we have engineered recombinant strains that are efficient producers of long-chain fatty acids (C16 and C18). The recombinant strains exhibit a 1.3-1.7-fold increase in the production of long-chain fatty acids over the wild-type strains. To enhance the production of total long-chain fatty acids, we researched the carbon sources for optimized culture conditions and results were used for post-culture incubation period. E. coli SGJS17 (containing the accA, fabD, and thioesterase genes) produced the highest content of intracellular total fatty acids; in particular, the unsaturated fatty acid content was about 20-fold higher than that in the wild-type E. coli.
Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.
Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide
2012-05-18
A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.
Hsieh, En-Jung; Waters, Brian M
2016-10-01
Iron (Fe) is an essential mineral that has low solubility in alkaline soils, where its deficiency results in chlorosis. Whether low Fe supply and alkaline pH stress are equivalent is unclear, as they have not been treated as separate variables in molecular physiological studies. Additionally, molecular responses to these stresses have not been studied in leaf and root tissues simultaneously. We tested how plants with the Strategy I Fe uptake system respond to Fe deficiency at mildly acidic and alkaline pH by measuring root ferric chelate reductase (FCR) activity and expression of selected Fe uptake genes and riboflavin synthesis genes. Alkaline pH increased cucumber (Cucumis sativus L.) root FCR activity at full Fe supply, but alkaline stress abolished FCR response to low Fe supply. Alkaline pH or low Fe supply resulted in increased expression of Fe uptake genes, but riboflavin synthesis genes responded to Fe deficiency but not alkalinity. Iron deficiency increased expression of some common genes in roots and leaves, but alkaline stress blocked up-regulation of these genes in Fe-deficient leaves. In roots of the melon (Cucumis melo L.) fefe mutant, in which Fe uptake responses are blocked upstream of Fe uptake genes, alkaline stress or Fe deficiency up-regulation of certain Fe uptake and riboflavin synthesis genes was inhibited, indicating a central role for the FeFe protein. These results suggest a model implicating shoot-to-root signaling of Fe status to induce Fe uptake gene expression in roots. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Martyniuk, Christopher J; Sanchez, Brian C; Szabo, Nancy J; Denslow, Nancy D; Sepúlveda, Maria S
2009-10-19
Many aquatic contaminants potentially affect the central nervous system, however the underlying mechanisms of how toxicants alter normal brain function are not well understood. The objectives of this study were to compare the effects of emerging and prevalent environmental contaminants on the expression of brain transcripts with a role in neurotransmitter synthesis and reproduction. Adult male largemouth bass (Micropterus salmoides) were injected once for a 96 h duration with control (water or oil) or with one of two doses of a single chemical to achieve the following body burdens (microg/g): atrazine (0.3 and 3.0), toxaphene (10 and 100), cadmium (CdCl(2)) (0.000067 and 0.00067), polychlorinated biphenyl (PCB) 126 (0.25 and 2.5), and phenanthrene (5 and 50). Partial largemouth bass gene segments were cloned for enzymes involved in neurotransmitter (glutamic acid decarboxylase 65, GAD65; tyrosine hydroxylase) and estrogen (brain aromatase; CYP19b) synthesis for real-time PCR assays. In addition, neuropeptides regulating feeding (neuropeptide Y) and reproduction (chicken GnRH-II, cGnRH-II; salmon GnRH, sGnRH) were also investigated. Of the chemicals tested, only cadmium, PCB 126, and phenanthrene showed any significant effects on the genes tested, while atrazine and toxaphene did not. Cadmium (0.000067 microg/g) significantly increased cGnRH-II mRNA while PCB 126 (0.25 microg/g) decreased GAD65 mRNA. Phenanthrene decreased GAD65 and tyrosine hydroxylase mRNA levels at the highest dose (50 microg/g) but increased cGnRH-II mRNA at the lowest dose (5 microg/g). CYP19b, NPY, and sGnRH mRNA levels were unaffected by any of the treatments. A hierarchical clustering dendrogram grouped PCB 126 and phenanthrene more closely than other chemicals with respect to the genes tested. This study demonstrates that brain transcripts important for neurotransmitter synthesis neuroendocrine function are potential targets for emerging and prevalent aquatic contaminants.
Reiness, G; Yang, H L; Zubay, G; Cashel, M
1975-01-01
A cell-free system derived from E. coli is described in which mature-sized 16S and 23S ribosomal RNAs (rRNA) are synthesized at a high relative rate, comprising 17-25% of the total transcription. The addition of guanosine tetraphosphate (ppGpp) to this system results in up to a 5-fold selective inhibition of rRNA accumulation. This effect is exerted at the level of synthesis rather than degradation. It is concluded that ppGpp, which is produced in large amounts by E. coli during amino-acid deprivation, could mediate the decrease in rRNA synthesis that accompanies such deprivation. The expression of other genes has also been investigated. No selective reduction of transfer RNA synthesis by ppGpp is observed. The trp and lac operons are found to be stimulated at the transcriptional level by the presence of this nucleotide. It is hypothesized that ppGpp interacts with the RNA polymerase in such a manner as to alter the affinity of the enzyme for promoters in an operon-specific fashion. PMID:1103124
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.
2017-01-01
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A
2017-04-14
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Synthesis and characterization of bis-thiourea having amino acid derivatives
NASA Astrophysics Data System (ADS)
Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah
2016-11-01
In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.
Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël
2009-11-07
The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.
USDA-ARS?s Scientific Manuscript database
The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...
Chemoselective synthesis of sialic acid 1,7-lactones.
Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario
2010-08-20
The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.
Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua
2017-06-15
N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E
2017-08-21
Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Pham, Anh-Tung; Shannon, J Grover; Bilyeu, Kristin D
2012-08-01
High oleic acid soybeans were produced by combining mutant FAD2-1A and FAD2-1B genes. Despite having a high oleic acid content, the linolenic acid content of these soybeans was in the range of 4-6 %, which may be high enough to cause oxidative instability of the oil. Therefore, a study was conducted to incorporate one or two mutant FAD3 genes into the high oleic acid background to further reduce the linolenic acid content. As a result, soybean lines with high oleic acid and low linolenic acid (HOLL) content were produced using different sources of mutant FAD2-1A genes. While oleic acid content of these HOLL lines was stable across two testing environments, the reduction of linolenic acid content varied depending on the number of mutant FAD3 genes combined with mutant FAD2-1 genes, on the severity of mutation in the FAD2-1A gene, and on the testing environment. Combination of two mutant FAD2-1 genes and one mutant FAD3 gene resulted in less than 2 % linolenic acid content in Portageville, Missouri (MO) while four mutant genes were needed to achieve the same linolenic acid in Columbia, MO. This study generated non-transgenic soybeans with the highest oleic acid content and lowest linolenic acid content reported to date, offering a unique alternative to produce a fatty acid profile similar to olive oil.
Dezfulian, Mohammad H; Foreman, Curtis; Jalili, Espanta; Pal, Mrinal; Dhaliwal, Rajdeep K; Roberto, Don Karl A; Imre, Kathleen M; Kohalmi, Susanne E; Crosby, William L
2017-04-07
Branched-chain amino acids (BCAAs) are synthesized by plants, fungi, bacteria, and archaea with plants being the major source of these amino acids in animal diets. Acetolactate synthase (ALS) is the first enzyme in the BCAA synthesis pathway. Although the functional contribution of ALS to BCAA biosynthesis has been extensively characterized, a comprehensive understanding of the regulation of this pathway at the molecular level is still lacking. To characterize the regulatory processes governing ALS activity we utilized several complementary approaches. Using the ALS catalytic protein subunit as bait we performed a yeast two-hybrid (Y2H) screen which resulted in the identification of a set of interacting proteins, two of which (denoted as ALS-INTERACTING PROTEIN1 and 3 [AIP1 and AIP3, respectively]) were found to be evolutionarily conserved orthologues of bacterial feedback-regulatory proteins and therefore implicated in the regulation of ALS activity. To investigate the molecular role AIPs might play in BCAA synthesis in Arabidopsis thaliana, we examined the functional contribution of aip1 and aip3 knockout alleles to plant patterning and development and BCAA synthesis under various growth conditions. Loss-of-function genetic backgrounds involving these two genes exhibited differential aberrant growth responses in valine-, isoleucine-, and sodium chloride-supplemented media. While BCAA synthesis is believed to be localized to the chloroplast, both AIP1 and AIP3 were found to localize to the peroxisome in addition to the chloroplast. Analysis of free amino acid pools in the mutant backgrounds revealed that they differ in the absolute amount of individual BCAAs accumulated and exhibit elevated levels of BCAAs in leaf tissues. Despite the phenotypic differences observed in aip1 and aip3 backgrounds, functional redundancy between these loci was suggested by the finding that aip1/aip3 double knockout mutants are severely developmentally compromised. Taken together the
Caarls, Lotte; Van der Does, Dieuwertje; Hickman, Richard; Jansen, Wouter; Verk, Marcel C Van; Proietti, Silvia; Lorenzo, Oscar; Solano, Roberto; Pieterse, Corné M J; Van Wees, Saskia C M
2017-02-01
Salicylic acid (SA) and jasmonic acid (JA) cross-communicate in the plant immune signaling network to finely regulate induced defenses. In Arabidopsis, SA antagonizes many JA-responsive genes, partly by targeting the ETHYLENE RESPONSE FACTOR (ERF)-type transcriptional activator ORA59. Members of the ERF transcription factor family typically bind to GCC-box motifs in the promoters of JA- and ethylene-responsive genes, thereby positively or negatively regulating their expression. The GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Here, we investigated whether SA-induced ERF-type transcriptional repressors, which may compete with JA-induced ERF-type activators for binding at the GCC-box, play a role in SA/JA antagonism. We selected ERFs that are transcriptionally induced by SA and/or possess an EAR transcriptional repressor motif. Several of the 16 ERFs tested suppressed JA-dependent gene expression, as revealed by enhanced JA-induced PDF1.2 or VSP2 expression levels in the corresponding erf mutants, while others were involved in activation of these genes. However, SA could antagonize JA-induced PDF1.2 or VSP2 in all erf mutants, suggesting that the tested ERF transcriptional repressors are not required for SA/JA cross-talk. Moreover, a mutant in the co-repressor TOPLESS, that showed reduction in repression of JA signaling, still displayed SA-mediated antagonism of PDF1.2 and VSP2. Collectively, these results suggest that SA-regulated ERF transcriptional repressors are not essential for antagonism of JA-responsive gene expression by SA. We further show that de novo SA-induced protein synthesis is required for suppression of JA-induced PDF1.2, pointing to SA-stimulated production of an as yet unknown protein that suppresses JA-induced transcription. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
A murC gene from coryneform bacteria.
Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K
1999-02-01
The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.
Synthesis of Triamino Acid Building Blocks with Different Lipophilicities
Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger
2015-01-01
To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040
Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment
NASA Technical Reports Server (NTRS)
Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.
Zhao, Ben; Li, Yafei; Li, Changling; Yang, Hailin; Wang, Wu
2018-03-01
Schizochytrium sp. accumulates valuable polyunsaturated fatty acid (PUFA), such as docosahexaenoic acid (DHA). In order to increase DHA synthesis in this microorganism, physical or chemical mutagenesis aided with powerful screening methods are still preferable, as its DHA synthetic pathway has not yet been clearly defined for gene manipulation. To breed this agglomerate microorganism of thick cell wall and rather large genome for increasing lipid content and DHA percentage, a novel strategy of atmospheric and room temperature plasma (ARTP) mutagenesis coupled with stepped malonic acid (MA) and zeocin resistance screening was developed. The final resulted mutant strain mz-17 was selected with 1.8-fold increased DHA production. Accompanied with supplementation of Fe 2+ in shake flask cultivation, DHA production of 14.0 g/L on average was achieved. This work suggests that ARTP mutation combined with stepped MA and zeocin resistance screening is an efficient method of breeding Schizochytrium sp. of high DHA production, and might be applied on other microorganisms for obtaining higher desired PUFA products.
Martins, Fabiane Ferreira; Bargut, Thereza Cristina Lonzetti; Aguila, Marcia Barbosa; Mandarim-de-Lacerda, Carlos Alberto
2017-03-01
Brown adipose tissue (BAT) is specialized in heat production, but its metabolism in ob/ob mice is still a matter of debate. We aimed to verify ob/ob mice BAT using C57Bl/6 male mice (as the wild-type, WT) and leptin-deficient ob/ob mice (on the C57Bl/6 background strain), at three months of age (n=10/group). At euthanasia, animals had their interscapular BAT weighed, and prepared for analysis (Western blot, and RT-qPCR). In comparison with the WT group, the ob/ob group showed reduced thermogenic signaling markers (gene expression of beta 3-adrenergic receptor, beta3-AR; PPARgamma coactivator 1 alpha, PGC1alpha, and uncoupling protein 1, UCP1). The ob/ob group also showed impaired gene expression for lipid utilization (perilipin was increased, while other markers were diminished: carnitine palmitoyltransferase-1b, CPT-1b; cluster of differentiation 36, CD36; fatty acid binding protein 4, FABP4; fatty acid synthase, FAS, and sterol regulatory element-binding protein 1c, SREBP1c), and altered protein expression of insulin signaling (diminished pAKT, TC10, and GLUT-4). Lastly, the ob/ob group showed increased gene expression of markers of inflammation (interleukin 1 beta, IL-1beta; IL-6, tumor necrosis factor alpha, TNFalpha; and monocyte chemotactic protein-1, MCP-1). In conclusion, the ob/ob mice have decreased thermogenic markers associated with reduced gene expression related to fatty acid synthesis, mobilization, and oxidation. There were also alterations in insulin signaling and protein and gene expressions of inflammation. The findings suggest that the lack of substrate for thermogenesis and the local inflammation negatively regulated thermogenic signaling in the ob/ob mice. Copyright © 2016 Elsevier GmbH. All rights reserved.
NASA Astrophysics Data System (ADS)
Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng
2014-03-01
MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.
Identification of candidate genes affecting Δ9-tetrahydrocannabinol biosynthesis in Cannabis sativa
Marks, M. David; Tian, Li; Wenger, Jonathan P.; Omburo, Stephanie N.; Soto-Fuentes, Wilfredo; He, Ji; Gang, David R.; Weiblen, George D.; Dixon, Richard A.
2009-01-01
RNA isolated from the glands of a Δ9-tetrahydrocannabinolic acid (THCA)-producing strain of Cannabis sativa was used to generate a cDNA library containing over 100 000 expressed sequence tags (ESTs). Sequencing of over 2000 clones from the library resulted in the identification of over 1000 unigenes. Candidate genes for almost every step in the biochemical pathways leading from primary metabolites to THCA were identified. Quantitative PCR analysis suggested that many of the pathway genes are preferentially expressed in the glands. Hexanoyl-CoA, one of the metabolites required for THCA synthesis, could be made via either de novo fatty acids synthesis or via the breakdown of existing lipids. qPCR analysis supported the de novo pathway. Many of the ESTs encode transcription factors and two putative MYB genes were identified that were preferentially expressed in glands. Given the similarity of the Cannabis MYB genes to those in other species with known functions, these Cannabis MYBs may play roles in regulating gland development and THCA synthesis. Three candidates for the polyketide synthase (PKS) gene responsible for the first committed step in the pathway to THCA were characterized in more detail. One of these was identical to a previously reported chalcone synthase (CHS) and was found to have CHS activity. All three could use malonyl-CoA and hexanoyl-CoA as substrates, including the CHS, but reaction conditions were not identified that allowed for the production of olivetolic acid (the proposed product of the PKS activity needed for THCA synthesis). One of the PKS candidates was highly and specifically expressed in glands (relative to whole leaves) and, on the basis of these expression data, it is proposed to be the most likely PKS responsible for olivetolic acid synthesis in Cannabis glands. PMID:19581347
Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S
Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats
2014-01-01
Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631
Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.
Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo
2017-01-01
Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhou, ZhongKai; Wang, Fang; Ren, XiaoChong; Wang, Yuyang; Blanchard, Chris
2015-04-01
The effect of resistant starch (RS) administration on biological parameters including blood glucose, lipids composition and oxidative stress of type 2 diabetic rats was investigated. The results showed blood glucose level, total cholesterol and triglycerides concentrations significantly reduced, and high-density lipoprotein cholesterol concentration was doubly increased in the rats of RS administration group compared to model control group (P<0.01). The analyses of genes involved in glucose and lipid metabolism pathways demonstrated that the expression levels of lipid oxidation gene Acox1, glycogen synthesis genes, GS2 and GYG1, and insulin-induced genes, Insig-1 and Insig-2, were significantly up-regulated (P<0.01). In contrast, fatty acids and triglycerides synthesis and metabolism-related gene SREBP-1, fatty acid synthesis gene Fads1 and gluconeogenesis gene G6PC1 were greatly down-regulated. The mechanism study shows that the lowering of blood glucose level in diabetic rats by feeding RS is regulated through promoting glycogen synthesis and inhibiting gluconeogenesis, and the increased lipid metabolism is modulated through promoting lipid oxidation and cholesterol homeostasis. Our study revealed for the first time that the regulation of hepatic genes expression involved in glucose and lipids metabolisms in diabetic rats could be achieved even at a moderate level of RS consumption. Copyright © 2015 Elsevier B.V. All rights reserved.
A Bacillus subtilis Gene Induced by Cold Shock Encodes a Membrane Phospholipid Desaturase
Aguilar, Pablo S.; Cronan, John E.; de Mendoza, Diego
1998-01-01
Bacillus subtilis grown at 37°C synthesizes saturated fatty acids with only traces of unsaturated fatty acids (UFAs). However, when cultures growing at 37°C are transferred to 20°C, UFA synthesis is induced. We report the identification and characterization of the gene encoding the fatty acid desaturase of B. subtilis. This gene, called des, was isolated by complementation of Escherichia coli strains with mutations in either of two different genes of UFA synthesis. The des gene encodes a polypeptide of 352 amino acid residues containing the three conserved histidine cluster motifs and two putative membrane-spanning domains characteristic of the membrane-bound desaturases of plants and cyanobacteria. Expression of the des gene in E. coli resulted in desaturation of palmitic acid moieties of the membrane phospholipids to give the novel mono-UFA cis-5-hexadecenoic acid, indicating that the B. subtilis des gene product is a Δ5 acyl-lipid desaturase. The des gene was disrupted, and the resulting null mutant strains were unable to synthesize UFAs upon a shift to low growth temperatures. The des null mutant strain grew as well as its congenic parent at 20 or 37°C but showed severely reduced survival during stationary phase. Analysis of operon fusions in which the des promoter directed the synthesis of a lacZ reporter gene showed that des expression is repressed at 37°C, but a shift of cultures from 37 to 20°C resulted in a 10- to 15-fold increase in transcription. This is the first report of a membrane phospholipid desaturase in a nonphotosynthetic organism and the first direct evidence for cold induction of a desaturase. PMID:9555904
Martin, Irene; Dohmen, Christian; Mas-Moruno, Carlos; Troiber, Christina; Kos, Petra; Schaffert, David; Lächelt, Ulrich; Teixidó, Meritxell; Günther, Michael; Kessler, Horst; Giralt, Ernest; Wagner, Ernst
2012-04-28
In the forthcoming era of cancer gene therapy, efforts will be devoted to the development of new efficient and non-toxic gene delivery vectors. In this regard, the use of Fmoc/Boc-protected oligo(ethane amino)acids as building blocks for solid-phase-supported assembly represents a novel promising approach towards fully controlled syntheses of effective gene vectors. Here we report on the synthesis of defined polymers containing the following: (i) a plasmid DNA (pDNA) binding domain of eight succinoyl-tetraethylenpentamine (Stp) units and two terminal cysteine residues; (ii) a central polyethylene glycol (PEG) chain (with twenty-four oxyethylene units) for shielding; and (iii) specific peptides for targeting towards cancer cells. Peptides B6 and c(RGDfK), which bind transferrin receptor and α(v)β(3) integrin, respectively, were chosen because of the high expression of these receptors in many tumoral cells. This study shows the feasibility of designing these kinds of fully controlled vectors and their success for targeted pDNA-based gene transfer. This journal is © The Royal Society of Chemistry 2012
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.
1989-04-01
We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less
Synthesis of Rosin Acid Starch Catalyzed by Lipase
Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin
2014-01-01
Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki
2017-01-01
Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321
Jang, Bora; Kim, Boyoung; Kim, Hyunsook; Kwon, Hyokyoung; Kim, Minjeong; Seo, Yunmi; Colas, Marion; Jeong, Hansaem; Jeong, Eun Hye; Lee, Kyuri; Lee, Hyukjin
2018-06-08
Enzymatic synthesis of RNA nanostructures is achieved by isothermal rolling circle transcription (RCT). Each arm of RNA nanostructures provides a functional role of Dicer substrate RNA inducing sequence specific RNA interference (RNAi). Three different RNAi sequences (GFP, RFP, and BFP) are incorporated within the three-arm junction RNA nanostructures (Y-RNA). The template and helper DNA strands are designed for the large-scale in vitro synthesis of RNA strands to prepare self-assembled Y-RNA. Interestingly, Dicer processing of Y-RNA is highly influenced by its physical structure and different gene silencing activity is achieved depending on its arm length and overhang. In addition, enzymatic synthesis allows the preparation of various Y-RNA structures using a single DNA template offering on demand regulation of multiple target genes.
Synthesis and properties of fatty acid starch esters.
Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik
2013-10-15
Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.
Popova, Blagovesta; Schubert, Steffen; Bulla, Ingo; Buchwald, Daniela; Kramer, Wilfried
2015-01-01
A major challenge in gene library generation is to guarantee a large functional size and diversity that significantly increases the chances of selecting different functional protein variants. The use of trinucleotides mixtures for controlled randomization results in superior library diversity and offers the ability to specify the type and distribution of the amino acids at each position. Here we describe the generation of a high diversity gene library using tHisF of the hyperthermophile Thermotoga maritima as a scaffold. Combining various rational criteria with contingency, we targeted 26 selected codons of the thisF gene sequence for randomization at a controlled level. We have developed a novel method of creating full-length gene libraries by combinatorial assembly of smaller sub-libraries. Full-length libraries of high diversity can easily be assembled on demand from smaller and much less diverse sub-libraries, which circumvent the notoriously troublesome long-term archivation and repeated proliferation of high diversity ensembles of phages or plasmids. We developed a generally applicable software tool for sequence analysis of mutated gene sequences that provides efficient assistance for analysis of library diversity. Finally, practical utility of the library was demonstrated in principle by assessment of the conformational stability of library members and isolating protein variants with HisF activity from it. Our approach integrates a number of features of nucleic acids synthetic chemistry, biochemistry and molecular genetics to a coherent, flexible and robust method of combinatorial gene synthesis. PMID:26355961
Popova, Blagovesta; Schubert, Steffen; Bulla, Ingo; Buchwald, Daniela; Kramer, Wilfried
2015-01-01
A major challenge in gene library generation is to guarantee a large functional size and diversity that significantly increases the chances of selecting different functional protein variants. The use of trinucleotides mixtures for controlled randomization results in superior library diversity and offers the ability to specify the type and distribution of the amino acids at each position. Here we describe the generation of a high diversity gene library using tHisF of the hyperthermophile Thermotoga maritima as a scaffold. Combining various rational criteria with contingency, we targeted 26 selected codons of the thisF gene sequence for randomization at a controlled level. We have developed a novel method of creating full-length gene libraries by combinatorial assembly of smaller sub-libraries. Full-length libraries of high diversity can easily be assembled on demand from smaller and much less diverse sub-libraries, which circumvent the notoriously troublesome long-term archivation and repeated proliferation of high diversity ensembles of phages or plasmids. We developed a generally applicable software tool for sequence analysis of mutated gene sequences that provides efficient assistance for analysis of library diversity. Finally, practical utility of the library was demonstrated in principle by assessment of the conformational stability of library members and isolating protein variants with HisF activity from it. Our approach integrates a number of features of nucleic acids synthetic chemistry, biochemistry and molecular genetics to a coherent, flexible and robust method of combinatorial gene synthesis.
Effect of Mild Acid on Gene Expression in Staphylococcus aureus
Weinrick, Brian; Dunman, Paul M.; McAleese, Fionnuala; Murphy, Ellen; Projan, Steven J.; Fang, Yuan; Novick, Richard P.
2004-01-01
During staphylococcal growth in glucose-supplemented medium, the pH of a culture starting near neutrality typically decreases by about 2 units due to the fermentation of glucose. Many species can comfortably tolerate the resulting mildly acidic conditions (pH, ∼5.5) by mounting a cellular response, which serves to defend the intracellular pH and, in principle, to modify gene expression for optimal performance in a mildly acidic infection site. In this report, we show that changes in staphylococcal gene expression formerly thought to represent a glucose effect are largely the result of declining pH. We examine the cellular response to mild acid by microarray analysis and define the affected gene set as the mild acid stimulon. Many of the genes encoding extracellular virulence factors are affected, as are genes involved in regulation of virulence factor gene expression, transport of sugars and peptides, intermediary metabolism, and pH homeostasis. Key results are verified by gene fusion and Northern blot hybridization analyses. The results point to, but do not define, possible regulatory pathways by which the organism senses and responds to a pH stimulus. PMID:15576791
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, C.A.; Phillips, D.A.
Flavonoid signals from alfalfa (Medicago sativa L.) induce transcription of nodulation (nod) genes in Rhizobium meliloti. Alfalfa roots release three major nod-gene inducers: 4{prime},7-dihydroxyflavanone, 4{prime},7-dihydroxyflavone, and 4,4{prime}-dihydroxy-2{prime}-methoxychalcone. The objective of the present study was to define temporal relationships between synthesis and exudation for those flavonoids. Requirements for concurrent flavonoid biosynthesis were assessed by treating roots of intact alfalfa seedlings with (U-{sup 14}C)-L-phenylalanine in the presence or absence of the phenylalanine ammonia-lyase inhibitor L-2-aminoxy-3-phenylpropionic acid (AOPP). In the absence of AOPP, each of the three flavonoids in exudates contained {sup 14}C. In the presence of AOPP, {sup 14}C labeling and releasemore » of all the exuded nod-gene inducers were reduced significantly. AOPP inhibited labeling and release of the strongest nod-gene inducer, methoxychalcone, by more than 90%. The release process responsible for exudation of nod-gene inducers appears to be specific rather than a general phenomenon such as a sloughing off of cells during root growth.« less
Uncovering co-expression gene network modules regulating fruit acidity in diverse apples.
Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Zhong, Gan-Yuan; Xu, Kenong
2015-08-16
Acidity is a major contributor to fruit quality. Several organic acids are present in apple fruit, but malic acid is predominant and determines fruit acidity. The trait is largely controlled by the Malic acid (Ma) locus, underpinning which Ma1 that putatively encodes a vacuolar aluminum-activated malate transporter1 (ALMT1)-like protein is a strong candidate gene. We hypothesize that fruit acidity is governed by a gene network in which Ma1 is key member. The goal of this study is to identify the gene network and the potential mechanisms through which the network operates. Guided by Ma1, we analyzed the transcriptomes of mature fruit of contrasting acidity from six apple accessions of genotype Ma_ (MaMa or Mama) and four of mama using RNA-seq and identified 1301 fruit acidity associated genes, among which 18 were most significant acidity genes (MSAGs). Network inferring using weighted gene co-expression network analysis (WGCNA) revealed five co-expression gene network modules of significant (P < 0.001) correlation with malate. Of these, the Ma1 containing module (Turquoise) of 336 genes showed the highest correlation (0.79). We also identified 12 intramodular hub genes from each of the five modules and 18 enriched gene ontology (GO) terms and MapMan sub-bines, including two GO terms (GO:0015979 and GO:0009765) and two MapMap sub-bins (1.3.4 and 1.1.1.1) related to photosynthesis in module Turquoise. Using Lemon-Tree algorithms, we identified 12 regulator genes of probabilistic scores 35.5-81.0, including MDP0000525602 (a LLR receptor kinase), MDP0000319170 (an IQD2-like CaM binding protein) and MDP0000190273 (an EIN3-like transcription factor) of greater interest for being one of the 18 MSAGs or one of the 12 intramodular hub genes in Turquoise, and/or a regulator to the cluster containing Ma1. The most relevant finding of this study is the identification of the MSAGs, intramodular hub genes, enriched photosynthesis related processes, and regulator genes in a
Engineering of EPA/DHA omega-3 fatty acid production by Lactococcus lactis subsp. cremoris MG1363.
Amiri-Jami, Mitra; Lapointe, Gisele; Griffiths, Mansel W
2014-04-01
Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been shown to be of major importance in human health. Therefore, these essential polyunsaturated fatty acids have received considerable attention in both human and farm animal nutrition. Currently, fish and fish oils are the main dietary sources of EPA/DHA. To generate sustainable novel sources for EPA and DHA, the 35-kb EPA/DHA synthesis gene cluster was isolated from a marine bacterium, Shewanella baltica MAC1. To streamline the introduction of the genes into food-grade microorganisms such as lactic acid bacteria, unnecessary genes located upstream and downstream of the EPA/DHA gene cluster were deleted. Recombinant Escherichia coli harboring the 20-kb gene cluster produced 3.5- to 6.1-fold more EPA than those carrying the 35-kb DNA fragment coding for EPA/DHA synthesis. The 20-kb EPA/DHA gene cluster was cloned into a modified broad-host-range low copy number vector, pIL252m (4.7 kb, Ery) and expressed in Lactococcus lactis subsp. cremoris MG1363. Recombinant L. lactis produced DHA (1.35 ± 0.5 mg g(-1) cell dry weight) and EPA (0.12 ± 0.04 mg g(-1) cell dry weight). This is believed to be the first successful cloning and expression of EPA/DHA synthesis gene cluster in lactic acid bacteria. Our findings advance the future use of EPA/DHA-producing lactic acid bacteria in such applications as dairy starters, silage adjuncts, and animal feed supplements.
Characterization and Expression Analysis of Genes Directing Galactomannan Synthesis in Coffee
Pré, Martial; Caillet, Victoria; Sobilo, Julien; McCarthy, James
2008-01-01
Background and Aims Galactomannans act as storage reserves for the seeds in some plants, such as guar (Cyamopsis tetragonoloba) and coffee (Coffea arabica and Coffea canephora). In coffee, the galactomannans can represent up to 25 % of the mass of the mature green coffee grain, and they exert a significant influence on the production of different types of coffee products. The objective of the current work was to isolate and characterize cDNA encoding proteins responsible for galactomannan synthesis in coffee and to study the expression of the corresponding transcripts in the developing coffee grain from C. arabica and C. canephora, which potentially exhibit slight galactomannan variations. Comparative gene expression analysis was also carried out for several other tissues of C. arabica and C. canephora. Methods cDNA banks, RACE-PCR and genome walking were used to generate full-length cDNA for two putative coffee mannan synthases (ManS) and two galactomannan galactosyl transferases (GMGT). Gene-specific probe-primer sets were then generated and used to carry out comparative expression analysis of the corresponding genes in different coffee tissues using quantitative RT-PCR Key Results Two of the putative galactomannan biosynthetic genes, ManS1 and GMGT1, were demonstrated to have very high expression in the developing coffee grain of both Coffea species during endosperm development, consistent with our proposal that these two genes are responsible for the production of the majority of the galactomannans found in the grain. In contrast, the expression data presented indicates that the ManS2 gene product is probably involved in the synthesis of the galactomannans found in green tissue. Conclusions The identification of genes implicated in galactomannan synthesis in coffee are presented. The data obtained will enable more detailed studies on the biosynthesis of this important component of coffee grain and contribute to a better understanding of some functional
Parsons, Joshua B.; Frank, Matthew W.; Jackson, Pamela; Subramanian, Chitra; Rock, Charles O.
2014-01-01
Summary Acyl-CoA and acyl-acyl carrier protein (ACP) synthetases activate exogenous fatty acids for incorporation into phospholipids in Gram-negative bacteria. However, Gram-positive bacteria utilize an acyltransferase pathway for the biogenesis of phosphatidic acid that begins with the acylation of sn-glycerol-3-phosphate by PlsY using an acyl-phosphate (acyl-PO4) intermediate. PlsX generates acyl-PO4 from the acyl-ACP end-products of fatty acid synthesis. The plsX gene of Staphylococcus aureus was inactivated and the resulting strain was both a fatty acid auxotroph and required de novo fatty acid synthesis for growth. Exogenous fatty acids were only incorporated into the 1-position and endogenous acyl groups were channeled into the 2-position of the phospholipids in strain PDJ39 (ΔplsX). Extracellular fatty acids were not elongated. Removal of the exogenous fatty acid supplement led to the rapid accumulation of intracellular acyl-ACP and the abrupt cessation of fatty acid synthesis. Extracts from the ΔplsX strain exhibited an ATP-dependent fatty acid kinase activity, and the acyl-PO4 was converted to acyl-ACP when purified PlsX is added. These data reveal the existence of a novel fatty acid kinase pathway for the incorporation of exogenous fatty acids into S. aureus phospholipids. PMID:24673884
Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli
Luzzati, Denise
1966-01-01
Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402
Marini, A; Grether-Beck, S; Jaenicke, T; Weber, M; Burki, C; Formann, P; Brenden, H; Schönlau, F; Krutmann, J
2012-01-01
In recent years there has been an increasing interest in the use of nutritional supplements to benefit human skin. Molecular evidence substantiating such effects, however, is scarce. In the present study we investigated whether nutritional supplementation of women with the standardized pine bark extract Pycnogenol® will improve their cosmetic appearance and relate these effects to expression of corresponding molecular markers of their skin. For this purpose 20 healthy postmenopausal women were supplemented with Pycnogenol for 12 weeks. Before, during and after supplementation, their skin condition was assessed (i) by employing non-invasive, biophysical methods including corneometry, cutometry, visioscan and ultrasound analyses and (ii) by taking biopsies and subsequent PCR for gene expression analyses related to extracellular matrix homeostasis. Pycnogenol supplementation was well tolerated in all volunteers. Pycnogenol significantly improved hydration and elasticity of skin. These effects were most pronounced in women presenting with dry skin conditions prior to the start of supplementation. The skin-physiological improvement was accompanied by a significant increase in the mRNA expression of hyaluronic acid synthase-1 (HAS-1), an enzyme critically involved in the synthesis of hyaluronic acid, and a noticeable increase in gene expression involved in collagen de novo synthesis. This study provides skin-physiological and for the first time molecular evidence that Pycnogenol supplementation benefits human skin by increasing skin hydration and skin elasticity. These effects are most likely due to an increased synthesis of extracellular matrix molecules such as hyaluronic acid and possibly collagen. Pycnogenol supplementation may thus be useful to counteract the clinical signs of skin aging. Copyright © 2012 S. Karger AG, Basel.
Nicotinic acid modulates Legionella pneumophila gene expression and induces virulence traits.
Edwards, Rachel L; Bryan, Andrew; Jules, Matthieu; Harada, Kaoru; Buchrieser, Carmen; Swanson, Michele S
2013-03-01
In response to environmental fluctuations or stresses, bacteria can activate transcriptional and phenotypic programs to coordinate an adaptive response. The intracellular pathogen Legionella pneumophila converts from a noninfectious replicative form to an infectious transmissive form when the bacterium encounters alterations in either amino acid concentrations or fatty acid biosynthesis. Here, we report that L. pneumophila differentiation is also triggered by nicotinic acid, a precursor of the central metabolite NAD(+). In particular, when replicative L. pneumophila are treated with 5 mM nicotinic acid, the bacteria induce numerous transmissive-phase phenotypes, including motility, cytotoxicity toward macrophages, sodium sensitivity, and lysosome avoidance. Transcriptional profile analysis determined that nicotinic acid induces the expression of a panel of genes characteristic of transmissive-phase L. pneumophila. Moreover, an additional 213 genes specific to nicotinic acid treatment were altered. Although nearly 25% of these genes lack an assigned function, the gene most highly induced by nicotinic acid treatment encodes a putative major facilitator superfamily transporter, Lpg0273. Indeed, lpg0273 protects L. pneumophila from toxic concentrations of nicotinic acid as judged by analyzing the growth of the corresponding mutant. The broad utility of the nicotinic acid pathway to couple central metabolism and cell fate is underscored by this small metabolite's modulation of gene expression by diverse microbes, including Candida glabrata, Bordetella pertussis, Escherichia coli, and L. pneumophila.
One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.
Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef
2018-04-01
Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.
Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent
USDA-ARS?s Scientific Manuscript database
Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...
SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,
The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters
Yin, Jing; Ren, Chun-Lin; Zhan, Ya-Guang; Li, Chun-Xiao; Xiao, Jia-Lei; Qiu, Wei; Li, Xin-Yu; Peng, Hong-Mei
2012-03-01
Betulin and oleanolic acids (pentacyclic triterpenoid secondary metabolites) have broad pharmacological activities and can be potentially used for the development of anti-cancer and anti-AIDS drugs. In this study, we detected the accumulation and the distribution characteristics of betulin and oleanolic acid in various organs of white birch at different ages. We also determined the expression of 4 OSC genes (LUS, β-AS, CAS1 and CAS2) involved in the triterpenoid synthesis pathways by real time RT-PCR. The result showed that the 1-year old birch can synthesize betulin and oleanolic acid. In addition, betulin and oleanolic acids were mainly distributed in the bark, while the content in the root skin and leaf was very low. The content of betulin and oleanolic acid in birch varied in different seasons. The content of betulin and oleanolic acid and their corresponding LUS and β-AS gene expression were very low in 1-year old birch. With increasing age of birch, betulin content was increased, while oleanolic acid was decreased. Similar changes were also observed for their corresponding synthesis genes LUS and β-AS. In the leaf of 1-year old plant, the highest expression of CAS1 and CAS2 occurred at end of September, while expression of LUS and the β-AS was low from June to October. In the stem skin,high expression of β-AS and the LUS genes occurred from the end of July to September. In the root, high expression of the β-AS gene was observed at the end of October. These results indicated that triterpenoid gene expression was similar to the triterpene accumulation. Expression of LUS gene and β-AS gene in birch with different ages were corresponding to the betulinic and oleanolic acid accumulation. Expression of CAS1 and CAS2 genes were elevated with increasing age of birch. This study provides molecular mechanisms of triterpenes synthesis in birch plants.
Kanoh, H.; Lindsay, D. B.
1972-01-01
1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795
Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.
Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra
2016-09-01
α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.
Higgins, Michael L.; Daneo-Moore, Lolita
1972-01-01
The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926
Rao, Reeta Prusty; Hunter, Ally; Kashpur, Olga; Normanly, Jennifer
2010-01-01
Many plant-associated microbes synthesize the auxin indole-3-acetic acid (IAA), and several IAA biosynthetic pathways have been identified in microbes and plants. Saccharomyces cerevisiae has previously been shown to respond to IAA by inducing pseudohyphal growth. We observed that IAA also induced hyphal growth in the human pathogen Candida albicans and thus may function as a secondary metabolite signal that regulates virulence traits such as hyphal transition in pathogenic fungi. Aldehyde dehydrogenase (Ald) is required for IAA synthesis from a tryptophan (Trp) precursor in Ustilago maydis. Mutant S. cerevisiae with deletions in two ALD genes are unable to convert radiolabeled Trp to IAA, yet produce IAA in the absence of exogenous Trp and at levels higher than wild type. These data suggest that yeast may have multiple pathways for IAA synthesis, one of which is not dependent on Trp. PMID:20233857
Bacterial synthesis of N-hydroxycinnamoyl phenethylamines and tyramines.
Sim, Geun Young; Yang, So-Mi; Kim, Bong Gyu; Ahn, Joong-Hoon
2015-10-13
Hydroxycinnamic acids (HCAs) including cinnamic acid, p-coumaric acid, caffeic acid, and ferulic acid, are C6-C3 phenolic compounds that are synthesized via the phenylpropanoid pathway. HCAs serve as precursors for the synthesis of lignins, flavonoids, anthocyanins, stilbenes and other phenolic compounds. HCAs can also be conjugated with diverse compounds including quinic acid, hydroxyl acids, and amines. Hydroxycinnamoyl (HC) amine conjugates such as N-HC tyramines and N-HC phenethylamines have been considered as potential starting materials to develop antiviral and anticancer drugs. We synthesized N-HC tyramines and N-HC phenethylamines using three different approaches in Escherichia coli. Five N-HC phenethylamines and eight N-HC tyramines were synthesized by feeding HCAs and phenethylamine or tyramine to E. coli harboring 4CL (encoding 4-coumarate CoA:ligase) and either SHT (encoding phenethylamine N-HC transferase) or THT (encoding tyramine N-HC transferase). Also, N-(p-coumaroyl) phenethylamine and N-(p-coumaroyl) tyramine were synthesized from p-coumaric acid using E. coli harboring an additional gene, PDC (encoding phenylalanine decarboxylase) or TDC (encoding tyrosine decarboxylase). Finally, we synthesized N-(p-coumaroyl) phenethylamine and N-(p-coumaroyl) tyramine from glucose by reconstructing the metabolic pathways for their synthesis in E. coli. Productivity was maximized by optimizing the cell concentration and incubation temperature. We reconstructed the metabolic pathways for synthesis of N-HC tyramines and N-HC phenethylamines by expressing several genes including 4CL, TST or SHT, PDC or TDC, and TAL (encoding tyrosine ammonia lyase) and engineering the shikimate metabolic pathway to increase endogenous tyrosine concentration in E. coli. Approximately 101.9 mg/L N-(p-coumaroyl) phenethylamine and 495.4 mg/L N-(p-coumaroyl) tyramine were synthesized from p-coumaric acid. Furthermore, 152.5 mg/L N-(p-coumaroyl) phenethylamine and 94.7 mg/L N
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reich, I.L.; Reich, H.J.; Menahan, L.A.
1987-01-01
Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.
Yin, Jing; Li, Xin; Zhan, Yaguang; Li, Ying; Qu, Ziyue; Sun, Lu; Wang, Siyao; Yang, Jie; Xiao, Jialei
2017-11-21
Birch (Betula platyphylla Suk.) contains triterpenoids with anti-HIV and anti-tumor pharmacological activities. However, the natural abundance of these triterpenoids is low, and their chemical synthesis is costly. Transcription factors have the ability to regulate the metabolite pathways of triterpenoids via multi-gene control, thereby improving metabolite yield. Thus, transcription factors have the potential to facilitate the production of birch triterpenoids. Plant bHLH (basic helix-loop-helix) transcription factors play important roles in stress response and secondary metabolism. In this study, we cloned two genes, BpMYC4 and BpbHLH9, that encode bHLH transcription factors in Betula platyphylla Suk. The open reading frame (ORF) of BpMYC4 was 1452 bp and encoded 483 amino acids, while the ORF of BpbHLH9 was 1140 bp and encoded 379 amino acids. The proteins of BpMYC4 and BpbHLH9 were localized in the cell membrane and nucleus. The tissue-specific expression patterns revealed that BpMYC4 expression in leaves was similar to that in the stem and higher than in the roots. The expression of BpbHLH9 was higher in the leaves than in the root and stem. The expressions of BpMYC4 and BpbHLH9 increased after treatment with abscisic acid, methyl jasmonate, and gibberellin and decreased after treatment with ethephon. The promoters of BpMYC4 and BpbHLH9 were isolated using a genome walking approach, and 900-bp and 1064-bp promoter sequences were obtained for BpMYC4 and BpbHLH9, respectively. The ORF of BpbHLH9 was ligated into yeast expression plasmid pYES3 and introduced into INVScl and INVScl1-pYES2-SS yeast strains. The squalene and total triterpenoid contents in the different INVScl1 transformants decreased in the following order INVScl1-pYES-SS-bHLH9 > INVScl1-pYES3-bHLH9 > INVScl1-pYES2- BpSS > INVScl-pYES2. In BpbHLH9 transgenic birch, the relative expression of the genes that encodes for enzymes critical for triterpenoid synthesis showed a different level of up
Dennis, P P
1977-01-01
The fraction of the total ribonucleic acid (RNA) synthesis rate that is messenger RNA (mRNA) for ribosomal protein (r-protein) and ribosomal RNA (rRNA) has been estimated in valS(Ts) rel+ stringent and valS(Ts) relA1 relaxed strains of Escherichia coli during a partial inhibition of valyl-transfer RNA aminoacylation. The partial inhibition was accomplished by shifting the strains from the permissive growth temperature of 29.5 degrees C to the semipermissive temperature of 35.5 degrees C. The RNA synthesized at the elevated temperature was pulse labeled with [3H]uracil. The fraction of the total incorpoarted 3H radioactivity in r-protein mRNA or in rRNA was estimated by specific hybridization to the transducing phages gammaspc1, which carries about 15 r-protein genes and lambdailv5, which carries an rRNA transcription unit. The results clearly demonstrate that the rel gene influences the fraction of the total RNA synthesis rate that is r protein mRNA and rRNA; in the rel+ strain they are significantly increased relative to control cultures. This indicates that the expression of the genes coding for the RNA and protein component of the ribosome are most likely regulated at the level of transcription. Furthermore, it appears that the distribution of functioning RNA polymerase between rRNA genes, r-protein genes, and other types of genes is influenced by the rel gene control system; presumably this influence is mediated through the unusual nucleotide guanosine tetraphosphate. PMID:320185
Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.
Knipprath, W G; Stein, R A
1966-01-01
Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.
Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.
Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco
2002-07-01
We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.
Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J
2013-08-19
Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.
Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij
2016-08-01
The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).
Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.
Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D
1995-01-01
The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.
Organochloride pesticides modulated gut microbiota and influenced bile acid metabolism in mice.
Liu, Qian; Shao, Wentao; Zhang, Chunlan; Xu, Cheng; Wang, Qihan; Liu, Hui; Sun, Haidong; Jiang, Zhaoyan; Gu, Aihua
2017-07-01
Organochlorine pesticides (OCPs) can persistently accumulate in body and threaten human health. Bile acids and intestinal microbial metabolism have emerged as important signaling molecules in the host. However, knowledge on which intestinal microbiota and bile acids are modified by OCPs remains unclear. In this study, adult male C57BL/6 mice were exposed to p, p'-dichlorodiphenyldichloroethylene (p, p'-DDE) and β-hexachlorocyclohexane (β-HCH) for 8 weeks. The relative abundance and composition of various bacterial species were analyzed by 16S rRNA gene sequencing. Bile acid composition was analyzed by metabolomic analysis using UPLC-MS. The expression of genes involved in hepatic and enteric bile acids metabolism was measured by real-time PCR. Expression of genes in bile acids synthesis and transportation were measured in HepG2 cells incubated with p, p'-DDE and β-HCH. Our findings showed OCPs changed relative abundance and composition of intestinal microbiota, especially in enhanced Lactobacillus with bile salt hydrolase (BSH) activity. OCPs affected bile acid composition, enhanced hydrophobicity, decreased expression of genes on bile acid reabsorption in the terminal ileum and compensatory increased expression of genes on synthesis of bile acids in the liver. We demonstrated that chronic exposure of OCPs could impair intestinal microbiota; as a result, hepatic and enteric bile acid profiles and metabolism were influenced. The findings in this study draw our attention to the hazards of chronic OCPs exposure in modulating bile acid metabolism that might cause metabolic disorders and their potential to cause related diseases in human. Copyright © 2017 Elsevier Ltd. All rights reserved.
Gonçalves, Ana Teresa; Farlora, Rodolfo; Gallardo-Escárate, Cristian
2014-10-01
The goal of this study was to identify and analyze the lipid metabolic pathways involved in energy production and ecdysteroid synthesis in the ectoparasite copepod Caligus rogercresseyi. Massive transcriptome sequencing analysis was performed during the infectious copepodid larval stage, during the attached chalimus larval stage, and also in female and male adults. Thirty genes were selected for describing the pathways, and these were annotated for proteins or enzymes involved in lipid digestion, absorption, and transport; fatty acid degradation; the synthesis and degradation of ketone bodies; and steroid and ecdysteroid syntheses. Differential expression of these genes was analyzed by ontogenic stage and discussed considering each stage's feeding habits and energetic needs. Copepodids showed a low expression of fatty acid digestion genes, reflected by a non-feeding behavior, and the upregulation of genes involved in steroid biosynthesis, which was consistent with a pathway for cholesterol synthesis during ecdysis. The chalimus stage showed an upregulation of genes related to fatty acid digestion, absorption, and transport, as well as to fatty acid degradation and the synthesis of ketone bodies, therefore suggesting that lipids ingested from the mucus and skin of the host fish are metabolized as important sources of energy. Adult females also showed a pattern of high lipid metabolism for energy supply and mobilization in relation to reproduction and vitellogenesis. Adult females and males revealed different lipid metabolism patterns that reflected different energetic needs. This study reports for the first time the probable lipid metabolic pathways involved in the energy production and ecdysteroid synthesis of C. rogercresseyi. Copyright © 2014 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jansson, Christer; Baguma, Yona; Sun, Chuanxin
Starch branching enzyme (SBE) activity in the cassava storage root exhibited a diurnal fluctuation, dictated by a transcriptional oscillation of the corresponding SBE genes. The peak of SBE activity coincided with the onset of sucrose accumulation in the storage, and we conclude that the oscillatory mechanism keeps the starch synthetic apparatus in the storage root sink in tune with the flux of sucrose from the photosynthetic source. When storage roots were uncoupled from the source, SBE expression could be effectively induced by exogenous sucrose. Turanose, a sucrose isomer that cannot be metabolized by plants, mimicked the effect of sucrose, demonstratingmore » that downstream metabolism of sucrose was not necessary for signal transmission. Also glucose and glucose-1-P induced SBE expression. Interestingly, induction by sucrose, turanose and glucose but not glucose-1-P sustained an overt semidian (12-h) oscillation in SBE expression and was sensitive to the hexokinase (HXK) inhibitor glucosamine. These results suggest a pivotal regulatory role for HXK during starch synthesis. Abscisic acid (ABA) was another potent inducer of SBE expression. Induction by ABA was similar to that of glucose-1-P in that it bypassed the semidian oscillator. Both the sugar and ABA signaling cascades were disrupted by okadaic acid, a protein phosphatase inhibitor. Based on these findings, we propose a model for sugar signaling in regulation of starch synthesis in the cassava storage root.« less
Transcriptional regulation of genes involved in retinoic acid metabolism in Senegalese sole larvae.
Boglino, Anaïs; Ponce, Marian; Cousin, Xavier; Gisbert, Enric; Manchado, Manuel
2017-01-01
The aim of this study was the characterization of transcriptional regulatory pathways mediated by retinoic acid (RA) in Senegalese sole larvae. For this purpose, pre-metamorphic larvae were treated with a low concentration of DEAB, an inhibitor of RALDH enzyme, until the end of metamorphosis. No differences in growth, eye migration or survival were observed. Nevertheless, gene expression analysis revealed a total of 20 transcripts differentially expressed during larval development and only six related with DEAB treatments directly involved in RA metabolism and actions (rdh10a, aldh1a2, crbp1, igf2r, rarg and cyp26a1) to adapt to a low-RA environment. In a second experiment, post-metamorphic larvae were exposed to the all-trans RA (atRA) observing an opposite regulation for those genes involved in RA synthesis and degradation (rdh10a, aldh1a2, crbp1 and cyp26a1) as well as other related with thyroid- (dio2) and IGF-axes (igfbp1, igf2r and igfbp5) to balance RA levels. In a third experiment, DEAB-pretreated post-metamorphic larvae were exposed to atRA and TTNPB (a specific RAR agonist). Both drugs down-regulated rdh10a and aldh1a2 and up-regulated cyp26a1 expression demonstrating their important role in RA homeostasis. Moreover, five retinoic receptors that mediate RA actions, the thyroid receptor thrb, and five IGF binding proteins changed differentially their expression. Overall, this study demonstrates that exogenous RA modulates the expression of some genes involved in the RA synthesis, degradation and cellular transport through RAR-mediated regulatory pathways establishing a negative feedback regulatory mechanism necessary to balance endogenous RA levels and gradients. Copyright © 2016 Elsevier Inc. All rights reserved.
Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang
2015-09-01
Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.
Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid
NASA Technical Reports Server (NTRS)
Nakashima, T.; Fox, S. W.
1980-01-01
The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.
Yin, Qian; Yin, Lichen; Wang, Hua; Cheng, Jianjun
2015-07-21
Poly(α-hydroxy acids) (PAHAs) are a class of biodegradable and biocompatible polymers that are widely used in numerous applications. One drawback of these conventional polymers, however, is their lack of side-chain functionalities, which makes it difficult to conjugate active moieties to PAHA or to fine-tune the physical and chemical properties of PAHA-derived materials through side-chain modifications. Thus, extensive efforts have been devoted to the development of methodology that allows facile preparation of PAHAs with controlled molecular weights and a variety of functionalities for widespread utilities. However, it is highly challenging to introduce functional groups into conventional PAHAs derived from ring-opening polymerization (ROP) of lactides and glycolides to yield functional PAHAs with favorable properties, such as tunable hydrophilicity/hydrophobicity, facile postpolymerization modification, and well-defined physicochemical properties. Amino acids are excellent resources for functional polymers because of their low cost, availability, and structural as well as stereochemical diversity. Nevertheless, the synthesis of functional PAHAs using amino acids as building blocks has been rarely reported because of the difficulty of preparing large-scale monomers and poor yields during the synthesis. The synthesis of functionalized PAHAs from O-carboxyanhydrides (OCAs), a class of five-membered cyclic anhydrides derived from amino acids, has proven to be one of the most promising strategies and has thus attracted tremendous interest recently. In this Account, we highlight the recent progress in our group on the synthesis of functional PAHAs via ROP of OCAs and their self-assembly and biomedical applications. New synthetic methodologies that allow the facile preparation of PAHAs with controlled molecular weights and various functionalities through ROP of OCAs are reviewed and evaluated. The in vivo stability, side-chain functionalities, and/or trigger
Identification of Conflicting Selective Effects on Highly Expressed Genes
Higgs, Paul G.; Hao, Weilong; Golding, G. Brian
2007-01-01
Many different selective effects on DNA and proteins influence the frequency of codons and amino acids in coding sequences. Selection is often stronger on highly expressed genes. Hence, by comparing high- and low-expression genes it is possible to distinguish the factors that are selected by evolution. It has been proposed that highly expressed genes should (i) preferentially use codons matching abundant tRNAs (translational efficiency), (ii) preferentially use amino acids with low cost of synthesis, (iii) be under stronger selection to maintain the required amino acid content, and (iv) be selected for translational robustness. These effects act simultaneously and can be contradictory. We develop a model that combines these factors, and use Akaike’s Information Criterion for model selection. We consider pairs of paralogues that arose by whole-genome duplication in Saccharmyces cerevisiae. A codon-based model is used that includes asymmetric effects due to selection on highly expressed genes. The largest effect is translational efficiency, which is found to strongly influence synonymous, but not non-synonymous rates. Minimization of the cost of amino acid synthesis is implicated. However, when a more general measure of selection for amino acid usage is used, the cost minimization effect becomes redundant. Small effects that we attribute to selection for translational robustness can be identified as an improvement in the model fit on top of the effects of translational efficiency and amino acid usage. PMID:19430600
One-step synthesis of gene carrier via gamma irradiation and its application in tumor gene therapy
Kim, Eun-Ji; Heo, Hun; Park, Jong-Seok; Gwon, Hui-Jeong; Lim, Youn-Mook; Jang, Mi-Kyeong
2018-01-01
Introduction Although numerous studies have been conducted with the aim of developing drug-delivery systems, chemically synthesized gene carriers have shown limited applications in the biomedical fields due to several problems, such as low-grafting yields, undesirable reactions, difficulties in controlling the reactions, and high-cost production owing to multi-step manufacturing processes. Materials and methods We developed a 1-step synthesis process to produce 2-aminoethyl methacrylate-grafted water-soluble chitosan (AEMA-g-WSC) as a gene carrier, using gamma irradiation for simultaneous synthesis and sterilization, but no catalysts or photoinitiators. We analyzed the AEMA graft site on WSC using 2-dimensional nuclear magnetic resonance spectroscopy (2D NMR; 1H and 13C NMR), and assayed gene transfection effects in vitro and in vivo. Results We revealed selective grafting of AEMA onto C6-OH groups of WSC. AEMA-g-WSC effectively condensed plasmid DNA to form polyplexes in the size range of 170 to 282 nm. AEMA-g-WSC polyplexes in combination with psi-hBCL2 (a vector expressing short hairpin RNA against BCL2 mRNA) inhibited tumor cell proliferation and tumor growth in vitro and in vivo, respectively, by inducing apoptosis. Conclusion The simple grafting process mediated via gamma irradiation is a promising method for synthesizing gene carriers. PMID:29416333
Banik, Mitali; Duguid, Scott; Cloutier, Sylvie
2011-06-01
Three genes encoding fatty acid desaturase 3 (fad3a, fad3b, and a novel fad3c) were cloned from four flax genotypes varying in linolenic acid content. Real-time PCR was used to quantify expression levels of the three fad3 genes during seed development. High amounts of both fad3a and fad3b transcripts were observed and reached their peak levels at 20 days after anthesis, except for fad3a from SP2047 where only low level expression was observed throughout seed development. Transcript accumulation of the novel fad3c gene was at similar background levels. The fatty acid composition was analysed for all genotypes and stages of development and compared with the fad3 gene expression patterns. α-Linolenic acid gradually accumulated during seed development, while linoleic acid was transient and decreased in M5791, UGG5-5, and AC McDuff. In contrast, the linolenic acid present in the early stages of development nearly completely disappeared in SP2047, while linoleic acid steadily accumulated. fad3a of the low linolenic acid line SP2047 encoded a truncated protein caused by a premature stop codon resulting from a single point mutation, and the low level of transcript accumulation in this genotype is likely due to nonsense-mediated mRNA decay caused by the premature termination of translation as a result of this early stop codon. Although substantial amounts of transcript accumulation occurred with fad3b of SP2047 genotype, cloning of the gene revealed a mutation in the first histidine box causing an amino acid change. Heterologous expression in yeast of the SP2047 and UGG5-5 fad3b genes showed that the mutation in the histidine box in SP2047 caused the enzyme inactivity. Taken together, these results showed that fad3a and fad3b are responsible for linolenic acid accumulation in flax seeds but did not support a major role for the novel fad3c. These observations were further supported by phenotypic and genotypic assessment of a doubled haploid population. Expression patterns
Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata
2014-04-01
Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance
2009-04-21
To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease
Gene Composer: database software for protein construct design, codon engineering, and gene synthesis
Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance
2009-01-01
Background To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. Results An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. Conclusion We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis
Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.
Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song
2018-04-01
Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.
USDA-ARS?s Scientific Manuscript database
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...
[Discovery of the target genes inhibited by formic acid in Candida shehatae].
Cai, Peng; Xiong, Xujie; Xu, Yong; Yong, Qiang; Zhu, Junjun; Shiyuan, Yu
2014-01-04
At transcriptional level, the inhibitory effects of formic acid was investigated on Candida shehatae, a model yeast strain capable of fermenting xylose to ethanol. Thereby, the target genes were regulated by formic acid and the transcript profiles were discovered. On the basis of the transcriptome data of C. shehatae metabolizing glucose and xylose, the genes responsible for ethanol fermentation were chosen as candidates by the combined method of yeast metabolic pathway analysis and manual gene BLAST search. These candidates were then quantitatively detected by RQ-PCR technique to find the regulating genes under gradient doses of formic acid. By quantitative analysis of 42 candidate genes, we finally identified 10 and 5 genes as markedly down-regulated and up-regulated targets by formic acid, respectively. With regard to gene transcripts regulated by formic acid in C. shehatae, the markedly down-regulated genes ranking declines as follows: xylitol dehydrogenase (XYL2), acetyl-CoA synthetase (ACS), ribose-5-phosphate isomerase (RKI), transaldolase (TAL), phosphogluconate dehydrogenase (GND1), transketolase (TKL), glucose-6-phosphate dehydrogenase (ZWF1), xylose reductase (XYL1), pyruvate dehydrogenase (PDH) and pyruvate decarboxylase (PDC); and a declining rank for up-regulated gens as follows: fructose-bisphosphate aldolase (ALD), glucokinase (GLK), malate dehydrogenase (MDH), 6-phosphofructokinase (PFK) and alcohol dehydrogenase (ADH).
Formal synthesis of berkelic acid: a lesson in α-alkylation chemistry.
McLeod, Michael C; Wilson, Zoe E; Brimble, Margaret A
2012-01-06
The full details of our enantioselective formal synthesis of the biologically active natural product berkelic acid are described. The insertion of the C-18 methyl group proved challenging, with three different approaches investigated to install the correct stereochemistry. Our initial Horner-Wadsworth-Emmons/oxa-Michael approach to the berkelic acid core proved unsuccessful upon translation to the natural product itself. However, addition of a silyl enol ether to an oxonium ion, followed by a one-pot debenzylation/spiroketalisation/thermodynamic equilibration procedure, afforded the tetracyclic structure of the berkelic acid core as a single diastereoisomer.
Wellberg, Elizabeth A; Rudolph, Michael C; Lewis, Andrew S; Padilla-Just, Nuria; Jedlicka, Paul; Anderson, Steven M
2014-12-04
Spot14 (S14), encoded by the THRSP gene, regulates de novo fatty acid synthesis in the liver, adipose, and lactating mammary gland. We recently showed that S14 stimulated fatty acid synthase (FASN) activity in vitro, and increased the synthesis of fatty acids in mammary epithelial cells in vivo. Elevated de novo fatty acid synthesis is a distinguishing feature of many solid tumors compared with adjacent normal tissue. This characteristic is thought to be acquired during tumor progression, as rapidly proliferating cells have a heightened requirement for membrane phospholipids. Further, overexpression of FASN is sufficient to stimulate cell proliferation. While many studies have focused on the FASN enzyme in cancer biology, few studies have addressed the roles of proteins that modify FASN activity, such as S14. Tumor fatty acids were modulated using two mouse models, mouse mammary tumor virus (MMTV)-neu mice overexpressing S14 and MMTV-polyomavirus middle T antigen (PyMT) mice lacking S14, and associations between elevated or impaired fatty acid synthesis on tumor latency, growth, metastasis, and signaling pathways were investigated. We evaluated S14-dependent gene expression profiles in mouse tumors by microarray and used publicly available microarray datasets of human breast tumors. S14 overexpression in the MMTV-Neu transgenic model is associated with elevated medium-chain fatty acids, increased proliferation and a shorter tumor latency, but reduced tumor metastasis compared to controls. Loss of S14 in the MMTV-PyMT model decreased FASN activity and the synthesis of medium-chain fatty acids but did not alter tumor latency. Impaired fatty acid synthesis was associated with reduced solid tumor cell proliferation, the formation of cystic lesions in some animals, and decreased phosphorylation of Src and protein kinase B (Akt). Analysis of gene expression in these mouse and human tumors revealed a relationship between S14 status and the expression of genes associated
Qiao, Liang; Cao, Minghao; Zheng, Jian; Zhao, Yihong; Zheng, Zhi-Liang
2017-10-30
The ratio of sugars to organic acids, two of the major metabolites in fleshy fruits, has been considered the most important contributor to fruit sweetness. Although accumulation of sugars and acids have been extensively studied, whether plants evolve a mechanism to maintain, sense or respond to the fruit sugar/acid ratio remains a mystery. In a prior study, we used an integrated systems biology tool to identify a group of 39 acid-associated genes from the fruit transcriptomes in four sweet orange varieties (Citrus sinensis L. Osbeck) with varying fruit acidity, Succari (acidless), Bingtang (low acid), and Newhall and Xinhui (normal acid). We reanalyzed the prior sweet orange fruit transcriptome data, leading to the identification of 72 genes highly correlated with the fruit sugar/acid ratio. The majority of these sugar/acid ratio-related genes are predicted to be involved in regulatory functions such as transport, signaling and transcription or encode enzymes involved in metabolism. Surprisingly, only three of these sugar/acid ratio-correlated genes are weakly correlated with sugar level and none of them overlaps with the acid-associated genes. Weighted Gene Coexpression Network Analysis (WGCNA) has revealed that these genes belong to four modules, Blue, Grey, Brown and Turquoise, with the former two modules being unique to the sugar/acid ratio control. Our results indicate that orange fruits contain a possible mechanistically distinct class of genes that may potentially be involved in maintaining fruit sugar/acid ratios and/or responding to the cellular sugar/acid ratio status. Therefore, our analysis of orange transcriptomes provides an intriguing insight into the potentially novel genetic or molecular mechanisms controlling the sugar/acid ratio in fruits.
Liu, Taibo; Huang, Binbin; Chen, Lin; Xian, Zhiqiang; Song, Shiwei; Chen, Riyuan; Hao, Yanwei
2018-06-30
Polyamines (PAs), including putrescine (Put), spermidine (Spd), spermine (Spm), and thermospermine (T-Spm), play key roles in plant development, including fruit setting and ripening, morphogenesis, and abiotic/biotic stress. Their functions appear to be intimately related to their synthesis, which occurs via arginine/ornithine decarboxylase (ADC/ODC), Spd synthase (SPDS), Spm synthase (SPMS), and Acaulis5 (ACL5), respectively. Unfortunately, the expression and function of these PA synthesis-relate genes during specific developmental process or under stress have not been fully elucidated. Here, we present the results of a genome-wide analysis of the PA synthesis genes (ADC, ODC, SPDS, SPMS, ACL5) in the tomato (Solanum lycopersicum). In total, 14 PA synthesis-related genes were identified. Further analysis of their structures, conserved domains, phylogenetic trees, predicted subcellular localization, and promoter cis-regulatory elements were analyzed. Furthermore, we also performed experiments to evaluate their tissue expression patterns and under hormone and various stress treatments. To our knowledge, this is the first study to elucidate the mechanisms underlying PA function in this variety of tomato. Taken together, these data provide valuable information for future functional characterization of specific genes in the PA synthesis pathway in this and other plant species. Although additional research is required, the insight gained by this and similar studies can be used to improve our understanding of PA metabolism ultimately leading to more effective and consistent plant cultivation. Copyright © 2018 Elsevier B.V. All rights reserved.
Ro, Dae-Kyun; Ouellet, Mario; Paradise, Eric M; Burd, Helcio; Eng, Diana; Paddon, Chris J; Newman, Jack D; Keasling, Jay D
2008-11-04
Due to the global occurrence of multi-drug-resistant malarial parasites (Plasmodium falciparum), the anti-malarial drug most effective against malaria is artemisinin, a natural product (sesquiterpene lactone endoperoxide) extracted from sweet wormwood (Artemisia annua). However, artemisinin is in short supply and unaffordable to most malaria patients. Artemisinin can be semi-synthesized from its precursor artemisinic acid, which can be synthesized from simple sugars using microorganisms genetically engineered with genes from A. annua. In order to develop an industrially competent yeast strain, detailed analyses of microbial physiology and development of gene expression strategies are required. Three plant genes coding for amorphadiene synthase, amorphadiene oxidase (AMO or CYP71AV1), and cytochrome P450 reductase, which in concert divert carbon flux from farnesyl diphosphate to artemisinic acid, were expressed from a single plasmid. The artemisinic acid production in the engineered yeast reached 250 microg mL(-1) in shake-flask cultures and 1 g L(-1) in bio-reactors with the use of Leu2d selection marker and appropriate medium formulation. When plasmid stability was measured, the yeast strain synthesizing amorphadiene alone maintained the plasmid in 84% of the cells, whereas the yeast strain synthesizing artemisinic acid showed poor plasmid stability. Inactivation of AMO by a point-mutation restored the high plasmid stability, indicating that the low plasmid stability is not caused by production of the AMO protein but by artemisinic acid synthesis or accumulation. Semi-quantitative reverse-transcriptase (RT)-PCR and quantitative real time-PCR consistently showed that pleiotropic drug resistance (PDR) genes, belonging to the family of ATP-Binding Cassette (ABC) transporter, were massively induced in the yeast strain producing artemisinic acid, relative to the yeast strain producing the hydrocarbon amorphadiene alone. Global transcriptional analysis by yeast
Zhu, Guiming; Saleh, Abdulmomen Ali Mohammed; Bahwal, Said Ahmed; Wang, Kunfu; Wang, Mingfu; Wang, Didi; Ge, Tangdong; Sun, Jie
2014-09-01
Three long-chain polyunsaturated fatty acids, docosahexaenoic acid (DHA, 22:6n-3), eicosapentaenoic acid (EPA, 20:5n-3) and arachidonic acid (ARA, 20:4n-6), are the most biologically active polyunsaturated fatty acids in the body. They are important in developing and maintaining the brain function, and in preventing and treating many diseases such as cardiovascular disease, inflammation and cancer. Although mammals can biosynthesize these long-chain polyunsaturated fatty acids, the efficiency is very low and dietary intake is needed to meet the requirement. In this study, a multiple-genes expression vector carrying mammalian A6/A5 fatty acid desaturases and multiple-genes expression vector carrying mammalian Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases coding genes was used to transfect HEK293T cells, then the overexpression of the target genes was detected. GC-MS analysis shows that the biosynthesis efficiency and level of DHA, EPA and ARA were significantly increased in cells transfected with the multiple-genes expression vector. Particularly, DHA level in these cells was 2.5 times higher than in the control cells. This study indicates mammal possess a certain mechanism for suppression of high level of biosynthesis of long chain polyunsaturated fatty acids, and the overexpression of Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases broke this suppression mechanism so that the level of DHA, EPA and ARA was significantly increased. This study also provides a basis for potential applications of this gene construct in transgenic animal to produce high level of these long-chain polyunsaturated fatty acid.
Ruggles, Kelly V.; Garbarino, Jeanne; Liu, Ying; Moon, James; Schneider, Kerry; Henneberry, Annette; Billheimer, Jeff; Millar, John S.; Marchadier, Dawn; Valasek, Mark A.; Joblin-Mills, Aidan; Gulati, Sonia; Munkacsi, Andrew B.; Repa, Joyce J.; Rader, Dan; Sturley, Stephen L.
2014-01-01
The toxic subcellular accumulation of lipids predisposes several human metabolic syndromes, including obesity, type 2 diabetes, and some forms of neurodegeneration. To identify pathways that prevent lipid-induced cell death, we performed a genome-wide fatty acid sensitivity screen in Saccharomyces cerevisiae. We identified 167 yeast mutants as sensitive to 0.5 mm palmitoleate, 45% of which define pathways that were conserved in humans. 63 lesions also impacted the status of the lipid droplet; however, this was not correlated to the degree of fatty acid sensitivity. The most liposensitive yeast strain arose due to deletion of the “ARE2 required for viability” (ARV1) gene, encoding an evolutionarily conserved, potential lipid transporter that localizes to the endoplasmic reticulum membrane. Down-regulation of mammalian ARV1 in MIN6 pancreatic β-cells or HEK293 cells resulted in decreased neutral lipid synthesis, increased fatty acid sensitivity, and lipoapoptosis. Conversely, elevated expression of human ARV1 in HEK293 cells or mouse liver significantly increased triglyceride mass and lipid droplet number. The ARV1-induced hepatic triglyceride accumulation was accompanied by up-regulation of DGAT1, a triglyceride synthesis gene, and the fatty acid transporter, CD36. Furthermore, ARV1 was identified as a transcriptional of the protein peroxisome proliferator-activated receptor α (PPARα), a key regulator of lipid homeostasis whose transcriptional targets include DGAT1 and CD36. These results implicate ARV1 as a protective factor in lipotoxic diseases due to modulation of fatty acid metabolism. In conclusion, a lipotoxicity-based genetic screen in a model microorganism has identified 75 human genes that may play key roles in neutral lipid metabolism and disease. PMID:24273168
Effects of Titanium Dioxide Nanoparticles on the Synthesis of Fibroin in Silkworm (Bombyx mori).
Ni, Min; Li, FanChi; Tian, JiangHai; Hu, JingSheng; Zhang, Hua; Xu, KaiZun; Wang, BinBin; Li, YangYang; Shen, WeiDe; Li, Bing
2015-08-01
Silkworm (Bombyx mori) is an economically important insect, and its silk production capacity largely depends on its ability to synthesize fibroin. While breeding of B. mori varieties has been a key strategy to improve silk production, little improvement of B. mori silk production has been achieved to date. As a result, the development of sericulture economy has not progressed well, pointing to the need of new ways for improvement of B. mori silk production. Titanium dioxide nanoparticles (TiO2 NPs), a food additive widely used for livestock, have been shown to promote animal growth and increase the protein synthesis in animals. However, no studies on effect of TiO2 NPs on fibroin synthesis in B. mori have been available. In this study, the differential expression profiles of genes and proteins in the silk gland of B. mori fed without or with TiO2 NPs (5 μg ml(-1)) were analyzed and compared using digital gene expression (DGE), reverse transcription quantitative polymerase chain reaction (RT-qPCR), semi-qPCR, and Western blot analysis. The effects of TiO2 NPs feeding on the activity of proteases in the midgut and the synthesis and transportation of amino acids in hemolymph were also investigated. DGE analyses showed that among a total of 4,741 genes detected, 306 genes were differentially expressed after the TiO2 NPs feeding, of which 137 genes were upregulated whereas 169 genes were downregulated. 106 genes were shown to be involved in fibroin synthesis, of which 97 genes, including those encoding cuticular protein glycine-rich 10, serine protease inhibitor 28, aspartate aminotransferase, lysyl-tRNA synthetase, and splicing factor arginine/serine-rich 6, and silk gland factor-1 (SGF-1), were upregulated with the maximum induction of 8.52-folds, whereas nine genes, including those encoding aspartylglucosaminidase, the cathepsin L in Tribolium castaneum, and similar to SPRY domain-containing SOCS box protein 3, were downregulated with the maximum reduction of 8
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-05-09
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.
Sanchez, Erica L; Pulliam, Thomas H; Dimaio, Terri A; Thalhofer, Angel B; Delgado, Tracie; Lagunoff, Michael
2017-05-15
Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of Kaposi's sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including the glycolysis, glutaminolysis, and fatty acid synthesis (FAS) pathways, for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis, and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and, interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription, while glutaminolysis is necessary for early gene translation but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are noninfectious, indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication, providing novel therapeutic avenues for KS tumors. IMPORTANCE KSHV is the etiologic agent of Kaposi's sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state, during which there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation. Our
Sanchez, Erica L.; Pulliam, Thomas H.; Dimaio, Terri A.; Thalhofer, Angel B.; Delgado, Tracie
2017-01-01
ABSTRACT Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of Kaposi's sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including the glycolysis, glutaminolysis, and fatty acid synthesis (FAS) pathways, for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis, and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and, interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription, while glutaminolysis is necessary for early gene translation but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are noninfectious, indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication, providing novel therapeutic avenues for KS tumors. IMPORTANCE KSHV is the etiologic agent of Kaposi's sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state, during which there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation
5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group
Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude
1999-01-01
The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.
A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development
Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David
2013-01-01
SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300
USDA-ARS?s Scientific Manuscript database
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...
Human nutrigenomics of gene regulation by dietary fatty acids.
Afman, Lydia A; Müller, Michael
2012-01-01
Nutrigenomics employs high-throughput genomics technologies to unravel how nutrients modulate gene and protein expression and ultimately influence cellular and organism metabolism. The most often-applied genomics technique so far is transcriptomics, which allows quantifying genome-wide changes in gene expression of thousands of genes at the same time in one sample. The performance of gene expression quantification requires sufficient high-quality homogenous cellular material, therefore research in healthy volunteers is restricted to biopsies from easy accessible tissues such as subcutaneous adipose tissue, skeletal muscle and intestinal biopsies or even more easily accessible cells such as peripheral blood mononuclear cells from blood. There is now significant evidence that fatty acids, in particular unsaturated fatty acids, exert many of their effects through modulation of gene transcription by regulating the activity of numerous transcription factors, including nuclear receptors such as peroxisome proliferator activated receptors, liver X receptor and sterol regulatory binding proteins. This review evaluates the human nutrigenomics studies performed on dietary fat since the initiation of nutrigenomics research around 10 years ago. Although the number of studies is still limited, all studies clearly suggest that changes in dietary fatty acids intake and composition can have a significant impact on cellular adaptive response capacity by gene transcription changes in humans. This adds important knowledge to our understanding of the strong effects that various fatty acids can have on numerous metabolic and inflammatory pathways, signaling routes and homeostatic control in the cell and ultimately on whole body health. It is important to use and integrate nutrigenomics in all future nutrition studies to build up the necessary framework for evidence-based nutrition in near future. Copyright © 2011 Elsevier Ltd. All rights reserved.
Huang, You-Jun; Zhou, Qin; Huang, Jian-Qin; Zeng, Yan-Ru; Wang, Zheng-Jia; Zhang, Qi-Xiang; Zhu, Yi-Hang; Shen, Chen; Zheng, Bing-Song
2015-06-01
Hickory (Carya cathayensis Sarg.) seed has one of the highest oil content and is rich in polyunsaturated fatty acids (PUFAs), which kernel is helpful to human health, particularly to human brain function. A better elucidation of lipid accumulation mechanism would help to improve hickory production and seed quality. DDRT-PCR analysis was used to examine gene expression in hickory at thirteen time points during seed development process. A total of 67 unique genes involved in seed development were obtained, and those expression patterns were further confirmed by semi-quantitative RT-PCR and real time RT-PCR analysis. Of them, the genes with known functions were involved in signal transduction, amino acid metabolism, nuclear metabolism, fatty acid metabolism, protein metabolism, carbon metabolism, secondary metabolism, oxidation of fatty acids and stress response, suggesting that hickory underwent a complex metabolism process in seed development. Furthermore, 6 genes related to fatty acid synthesis were explored, and their functions in seed development process were further discussed. The data obtained here would provide the first clues for guiding further functional studies of fatty acid synthesis in hickory. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Huang, Xiaoyun; Zang, Xiaonan; Wu, Fei; Jin, Yuming; Wang, Haitao; Liu, Chang; Ding, Yating; He, Bangxiang; Xiao, Dongfang; Song, Xinwei; Liu, Zhu
2017-01-01
Gracilariopsis lemaneiformis (aka Gracilaria lemaneiformis) is a red macroalga rich in phycoerythrin, which can capture light efficiently and transfer it to photosystemⅡ. However, little is known about the synthesis of optically active phycoerythrinin in G. lemaneiformis at the molecular level. With the advent of high-throughput sequencing technology, analysis of genetic information for G. lemaneiformis by transcriptome sequencing is an effective means to get a deeper insight into the molecular mechanism of phycoerythrin synthesis. Illumina technology was employed to sequence the transcriptome of two strains of G. lemaneiformis- the wild type and a green-pigmented mutant. We obtained a total of 86915 assembled unigenes as a reference gene set, and 42884 unigenes were annotated in at least one public database. Taking the above transcriptome sequencing as a reference gene set, 4041 differentially expressed genes were screened to analyze and compare the gene expression profiles of the wild type and green mutant. By GO and KEGG pathway analysis, we concluded that three factors, including a reduction in the expression level of apo-phycoerythrin, an increase of chlorophyll light-harvesting complex synthesis, and reduction of phycoerythrobilin by competitive inhibition, caused the reduction of optically active phycoerythrin in the green-pigmented mutant.
Chen, Cong; Han, Xiao; Zou, Xuan; Li, Yuan; Yang, Liang; Cao, Ke; Xu, Jie; Long, Jiangang; Liu, Jiankang; Feng, Zhihui
2014-01-01
4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid (C75) is a synthetic fatty-acid synthase (FASN) inhibitor with potential therapeutic effects in several cancer models. Human mitochondrial β-ketoacyl-acyl carrier protein synthase (HsmtKAS) is a key enzyme in the newly discovered mitochondrial fatty acid synthesis pathway that can produce the substrate for lipoic acid (LA) synthesis. HsmtKAS shares conserved catalytic domains with FASN, which are responsible for binding to C75. In our study, we explored the possible effect of C75 on HsmtKAS and mitochondrial function. C75 treatment decreased LA content, impaired mitochondrial function, increased reactive oxygen species content, and reduced cell viability. HsmtKAS but not FASN knockdown had an effect that was similar to C75 treatment. In addition, an LA supplement efficiently inhibited C75-induced mitochondrial dysfunction and oxidative stress. Overexpression of HsmtKAS showed cellular protection against low dose C75 addition, whereas there was no protective effect upon high dose C75 addition. In summary, the mitochondrial fatty acid synthesis pathway has a vital role in mitochondrial function. Besides FASN, C75 might also inhibit HsmtKAS, thereby reducing LA production, impairing mitochondrial function, and potentially having toxic effects. LA supplements sufficiently ameliorated the toxicity of C75, showing that a combination of C75 and LA may be a reliable cancer treatment. PMID:24784139
Matsuo, Ichiro; Kim, Sunhwa; Yamamoto, Yuichi; Ajisaka, Katsumi; Maruyama, Jun-ich; Nakajima, Harushi; Kitamoto, Katsuhiko
2003-03-01
We isolated a beta-N-acetylglucosaminidase encoding gene from the filamentous fungus Aspergillus oryzae, and designated it nagA. The nagA gene encoded a polypeptide of 600 amino acids with significant similarity to glucosaminidases and hexosaminidases of various eukaryotes. A. oryzae strain carrying the nagA gene under the control of the improved glaA promoter produced large amounts of beta-N-acetylglucosaminidase in a wheat bran solid culture. The beta-N-acetylglucosaminidase was purified from crude extracts of the solid culture by column chromatographies on Q-Sepharose and Sephacryl S-200. This enzyme was used for synthesis of lacto-N-triose II, which is contained in human milk. By reverse hydrolysis reaction, lacto-N-triose II and its positional isomer were synthesized from lactose and D-N-acetylglucosamine in 0.21% and 0.15% yield, respectively.
Lipase-catalyzed synthesis of fattythioic acids from palm oil.
Al-Mulla, Emad A Jaffar
2011-01-01
The present work focuses on the synthesis of fattythioic acids (FTAs) by a one-step lipase catalyzed reaction of palm oil with carbonothioic S,S-acid using Lipozyme. The product was characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The effects of various reaction parameters such as reaction time, temperature, amount of enzyme, molar ratio of substrates, and various organic solvents of the reaction system were investigated. The optimum conditions to produce FTAs were respectively, incubation time, 20 h, temperature, 40°C, amount of enzyme, 0.05 g and molar ratio of carbonothioic S,S-acid to palm oil, 5.0:1.0. Hexane was the best solvent for this reaction. The conversion of the products at optimum conditions was around 91%.
Synthesis of glyceryl ferulate by immobilized ferulic acid esterase.
Matsuo, Takemasa; Kobayashi, Takashi; Kimura, Yukitaka; Tsuchiyama, Moriyasu; Oh, Tadanobu; Sakamoto, Tatsuji; Adachi, Shuji
2008-12-01
Glyceryl ferulate was synthesized by the condensation of ferulic acid with glycerol using Pectinase PL "Amano" from Aspergillus niger, which contained ferulic acid esterase, to improve the water-solubility of ferulic acid. The optimum reaction medium was glycerol/0.1 M acetate buffer, pH 4.0, (98:2 v/v). The enzyme immobilized onto Chitopearl BCW3003 exhibited the highest activity among the those immobilized onto various kinds of Chitopearl BCW resins. The optimum temperature for the immobilized enzyme was 50 degrees C, and it could be reused at least five times without a significant loss in activity for the synthesis of glyceryl ferulate in batch reaction. Storage of the reaction mixture at 25 degrees C improved the molar fraction of glyceryl ferulate relative to the dissolved ferulic residues.
Ashton, Anna; Stoney, Patrick N; Ransom, Jemma; McCaffery, Peter
2018-03-08
Vitamin A is important for the circadian timing system; deficiency disrupts daily rhythms in activity and clock gene expression, and reduces the nocturnal peak in melatonin in the pineal gland. However, it is currently unknown how these effects are mediated. Vitamin A primarily acts via the active metabolite, retinoic acid (RA), a transcriptional regulator with emerging non-genomic activities. We investigated whether RA is subject to diurnal variation in synthesis and signaling in the rat pineal gland. Its involvement in two key molecular rhythms in this gland was also examined: kinase activation and induction of Aanat, which encodes the rhythm-generating melatonin synthetic enzyme. We found diurnal changes in expression of several genes required for RA signaling, including a RA receptor and synthetic enzymes. The RA-responsive gene Cyp26a1 was found to change between day and night, suggesting diurnal changes in RA activity. This corresponded to changes in RA synthesis, suggesting rhythmic production of RA. Long-term RA treatment in vitro upregulated Aanat transcription, while short-term treatment had no effect. RA was also found to rapidly downregulate extracellular signal-regulated kinase (ERK) 1/2 phosphorylation, suggesting a rapid non-genomic action which may be involved in driving the molecular rhythm in ERK1/2 activation in this gland. These results demonstrate that there are diurnal changes in RA synthesis and activity in the rat pineal gland which are partially under circadian control. These may be key to the effects of vitamin A on circadian rhythms, therefore providing insight into the molecular link between this nutrient and the circadian system.
Scanlon, K J; Jiao, L; Funato, T; Wang, W; Tone, T; Rossi, J J; Kashani-Sabet, M
1991-01-01
The c-fos gene product Fos has been implicated in many cellular processes, including signal transduction, DNA synthesis, and resistance to antineoplastic agents. A fos ribozyme (catalytic RNA) was designed to evaluate the effects of suppressing Fos protein synthesis on expression of enzymes involved in DNA synthesis, DNA repair, and drug resistance. DNA encoding the fos ribozyme (fosRb) was cloned into the pMAMneo expression plasmid, and the resultant vector was transfected into A2780DDP cells resistant to the chemotherapeutic agent cisplatin. The parental drug-sensitive A2780S cells were transfected with the pMMV vector containing the c-fos gene. Morphological alterations were accompanied by significant changes in pharmacological sensitivity in both c-fos- and fosRb-transfected cells. pMAMneo fosRb transfectants revealed decreased c-fos gene expression, concomitant with reduced thymidylate (dTMP) synthase, DNA polymerase beta, topoisomerase I, and metallothionein IIA mRNAs. In contrast, c-myc expression was elevated after fos ribozyme action. Insertion of a mutant ribozyme, mainly capable of antisense activity, into A2780DDP cells resulted in smaller reductions in c-fos gene expression and in cisplatin resistance than the active ribozyme. These studies establish a role for c-fos in drug resistance and in mediating DNA synthesis and repair processes by modulating expression of genes such as dTMP synthase, DNA polymerase beta, and topoisomerase I. These studies also suggest the utility of ribozymes in the analysis of cellular gene expression. Images PMID:1660142
Liu, Fenghong; Wang, Lei; Gu, Liang; Zhao, Wei; Su, Hongyan; Cheng, Xianhao
2015-12-01
In our preliminary study, the ripe fruits of two highbush blueberry (Vaccinium corymbosum L.) cultivars, cv 'Berkeley' and cv 'Bluecrop', were found to contain different levels of ascorbic acid. However, factors responsible for these differences are still unknown. In the present study, ascorbic acid content in fruits was compared with expression profiles of ascorbic acid biosynthetic and recycling genes between 'Bluecrop' and 'Berkeley' cultivars. The results indicated that the l-galactose pathway was the predominant route of ascorbic acid biosynthesis in blueberry fruits. Moreover, higher expression levels of the ascorbic acid biosynthetic genes GME, GGP, and GLDH, as well as the recycling genes MDHAR and DHAR, were associated with higher ascorbic acid content in 'Bluecrop' compared with 'Berkeley', which indicated that a higher efficiency ascorbic acid biosynthesis and regeneration was likely to be responsible for the higher ascorbic acid accumulation in 'Bluecrop'. Copyright © 2015 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hempel, K.
1962-01-01
New methods for synthesis of tritium-labeled amino acids with high specific activity (1000 mc/m mole and above) are described. Changes in tritium- labeled amino acids during storage are studied. An absorbed BETA energy of 10/ sup 5/ rad results in radiochemical disintegration of 1.5%. Autoradiographic studies were made with several amino acids. It was demonstrated that protein production is 2 to 3 times higher in butter-vellux, tumors than in liver tissue. Synthesis of melanine was studied in vivo with melanineproducing tumors. (Gmelin Inst.)
Alves Martins, Dulce; Rocha, Filipa; Martínez-Rodríguez, Gonzalo; Bell, Gordon; Morais, Sofia; Castanheira, Filipa; Bandarra, Narcisa; Coutinho, Joana; Yúfera, Manuel; Conceição, Luís E C
2012-09-01
Dietary fatty acid supply can affect stress response in fish during early development. Although knowledge on the mechanisms involved in fatty acid regulation of stress tolerance is scarce, it has often been hypothesised that eicosanoid profiles can influence cortisol production. Genomic cortisol actions are mediated by cytosolic receptors which may respond to cellular fatty acid signalling. An experiment was designed to test the effects of feeding gilthead sea-bream larvae with four microdiets, containing graded arachidonic acid (ARA) levels (0·4, 0·8, 1·5 and 3·0 %), on the expression of genes involved in stress response (steroidogenic acute regulatory protein, glucocorticoid receptor and phosphoenolpyruvate carboxykinase), lipid and, particularly, eicosanoid metabolism (hormone-sensitive lipase, PPARα, phospholipase A2, cyclo-oxygenase-2 and 5-lipoxygenase), as determined by real-time quantitative PCR. Fish fatty acid phenotypes reflected dietary fatty acid profiles. Growth performance, survival after acute stress and similar whole-body basal cortisol levels suggested that sea-bream larvae could tolerate a wide range of dietary ARA levels. Transcription of all genes analysed was significantly reduced at dietary ARA levels above 0·4 %. Nonetheless, despite practical suppression of phospholipase A2 transcription, higher leukotriene B4 levels were detected in larvae fed 3·0 % ARA, whereas a similar trend was observed regarding PGE2 production. The present study demonstrates that adaptation to a wide range of dietary ARA levels in gilthead sea-bream larvae involves the modulation of the expression of genes related to eicosanoid synthesis, lipid metabolism and stress response. The roles of ARA, other polyunsaturates and eicosanoids as signals in this process are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hunsperger, Heather M.; Randhawa, Tejinder; Cattolico, Rose Ann
Two non-homologous, isofunctional enzymes catalyze the penultimate step of chlorophyll a synthesis in oxygenic photosynthetic organisms such as cyanobacteria, eukaryotic algae and land plants: the light independent (LIPOR) and light-dependent (POR) protochlorophyllide oxidoreductases. Whereas the distribution of these enzymes in cyanobacteria and land plants is well understood, the presence, loss, duplication, and replacement of these genes have not been surveyed in the polyphyletic and remarkably diverse eukaryotic algal lineages.
Hunsperger, Heather M.; Randhawa, Tejinder; Cattolico, Rose Ann
2015-02-10
Two non-homologous, isofunctional enzymes catalyze the penultimate step of chlorophyll a synthesis in oxygenic photosynthetic organisms such as cyanobacteria, eukaryotic algae and land plants: the light independent (LIPOR) and light-dependent (POR) protochlorophyllide oxidoreductases. Whereas the distribution of these enzymes in cyanobacteria and land plants is well understood, the presence, loss, duplication, and replacement of these genes have not been surveyed in the polyphyletic and remarkably diverse eukaryotic algal lineages.
Carballeira, N M; Emiliano, A; Hernández-Alonso, N; González, F A
1998-12-01
The total synthesis of the naturally occurring (Z)-2-methoxy-5-hexadecenoic acid and (Z)-2-methoxy-6-hexadecenoic acid was accomplished using as a key step Mukaiyama's trimethylsilyl cyanide addition to 4- and 5-pentadecenal, respectively. These syntheses further confirm the structures of the natural marine fatty acids and corroborate their cis double-bond stereochemistry. The title compounds were antimicrobial against the Gram-positive bacteria Staphylococcus aureus (MIC 0.35 micromol/mL) and Streptococcus faecalis (MIC 0.35 micromol/mL).
Li, Yang
2011-01-01
We have accomplished an asymmetric synthesis of each enantiomer of 4,4-difluoroglutamic acid. This α-amino acid has been of interest in medicinal chemistry circles. Key features of the synthesis include highly scalable procedures, a Reformatsky-based coupling reaction, and straightforward functional group manipulations to make the parent amino acid. Enantioenrichment derives from an enzymatic resolution of the synthetic material. Conversion of the optically enriched compounds to orthogonally protected forms allows selective formation of peptide bonds. 4,4- Difluoroglutamic acid, in a suitably protected form, is also shown to exhibit enhanced catalytic activity in both an oxidation reaction and a reduction reaction, in comparison to the analogous glutamic acid derivative. PMID:22039908
Huang, Jianqin; Zhang, Tong; Zhang, Qixiang; Chen, Ming; Wang, Zhengjia; Zheng, Bingsong; Xia, Guohua; Yang, Xianyou; Huang, Chunying; Huang, Youjun
2016-02-16
Hickory (Carya cathayensis Sarg.) accumulates more than 70% oil and 90% unsaturated fatty acids with considerably high oleic acid in its mature embryo. The concurrent global trancriptomic and lipidomic analyses provided a framework for better understanding of glycerolipid biosynthesis and metabolism in the hickory nut. The synthetical regulation of numerous leading lipid-related genes harmonized with the oil accumulation and fatty acid conversion in embryo development. The high level of ACCase correlated positively with fatty acids de novo synthesis, and the synergy of DGAT2 and PDAT promoted the TAG assembly, and oleosins, caleosins and steroleosins were transcribed considerably high for timely energy reserve in oil body. Glycolysis possibly provided sufficient precursors and energy for lipid synthesis. The perfect harmonization of the high level of SAD with low level of FAD2 facilitated the oleic acid accumulation. And the ratio of FATA/FATB or SAD/FATB was proposed for determining the saturated degree of oil. The gene multi-copy event was generated probably for accommodating various survival environments. A thermotolerant defense system including TAG hydrolysis determinants, heat shock proteins, and high ratio of MUFA to PUFA constrained the lipid degradation and provided a guarantee for high lipid content. A batch of potential genes recruited from the co-expression network helps us to understand the lipid synthesis and the response to high temperature better. The high transcriptional levels of key genes in lipid synthesis promoted the oil accumulation, and the harmonious expression of key ones for unsaturated fatty acids led oleic acid to high levels.
Yang, Xu; Hang, Xiaomin; Tan, Jing; Yang, Hong
2015-06-01
Bifidobacteria are common inhabitants of the human gastrointestinal tract, and their application has increased dramatically in recent years due to their health-promoting effects. The ability of bifidobacteria to tolerate acidic environments is particularly important for their function as probiotics because they encounter such environments in food products and during passage through the gastrointestinal tract. In this study, we generated a derivative, Bifidobacterium breve BB8dpH, which displayed a stable, acid-resistant phenotype. To investigate the possible reasons for the higher acid tolerance of B. breve BB8dpH, as compared with its parental strain B. breve BB8, a combined transcriptome and physiological approach was used to characterize differences between the two strains. An analysis of the transcriptome by RNA-sequencing indicated that the expression of 121 genes was increased by more than 2-fold, while the expression of 146 genes was reduced more than 2-fold, in B. breve BB8dpH. Validation of the RNA-sequencing data using real-time quantitative PCR analysis demonstrated that the RNA-sequencing results were highly reliable. The comparison analysis, based on differentially expressed genes, suggested that the acid tolerance of B. breve BB8dpH was enhanced by regulating the expression of genes involved in carbohydrate transport and metabolism, energy production, synthesis of cell envelope components (peptidoglycan and exopolysaccharide), synthesis and transport of glutamate and glutamine, and histidine synthesis. Furthermore, an analysis of physiological data showed that B. breve BB8dpH displayed higher production of exopolysaccharide and lower H(+)-ATPase activity than B. breve BB8. The results presented here will improve our understanding of acid tolerance in bifidobacteria, and they will lead to the development of new strategies to enhance the acid tolerance of bifidobacterial strains. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cao, Jing; Dong, Shuding; Jiang, Delu; Zhu, Peiyu; Zhang, Han; Li, Rui; Li, Zhanyi; Wang, Xuanyu; Tang, Weifang; Du, Ding
2017-04-21
β-Functionalization of indolin-2-one-derived aliphatic acids has been applied in formal [3 + 2] annualtions for catalyst-free and divergent synthesis of two series of structurally interesting 3,3'-spirooxindole γ-butyrolactones that may be attractive for potential drug discovery. These findings also pave the way for further diversity-oriented synthesis of spirooxindoles starting from indolin-2-one-derived aliphatic acids or their derivatives.
Guo, Yichen; Shen, Ouxi; Han, Jingjing; Duan, Hongyu; Yang, Siyuan; Zhu, Zhenghong; Tong, Jian; Zhang, Jie
2017-01-01
Fenvalerate (Fen), a widely used pesticide, is known to impair male reproductive functions by mechanisms that remain to be elucidated. Recent studies indicated that circadian clock genes may play an important role in successful male reproduction. The aim of this study was to determine the effects of Fen on circadian clock genes involved in the biosynthesis of testosterone using TM3 cells derived from mouse Leydig cells. Data demonstrated that the circadian rhythm of testosterone synthesis in TM3 cells was disturbed following Fen treatment as evidenced by changes in the circadian rhythmicity of core clock genes (Bmal1, Rev-erbα, Rorα). Further, the observed altered rhythms were accompanied by increased intracellular Ca 2+ levels and modified steroidogenic acute regulatory (StAR) mRNA expression. Thus, data suggested that Fen inhibits testosterone synthesis via pathways involving intracellular Ca 2+ and clock genes (Bmal1, Rev-Erbα, Rorα) as well as StAR mRNA expression in TM3 cells.
Mavraganis, Ioannis; Meesapyodsuk, Dauenpen; Vrinten, Patricia; Smith, Mark; Qiu, Xiao
2010-02-01
Claviceps purpurea, the fungal pathogen that causes the cereal disease ergot, produces glycerides that contain high levels of ricinoleic acid [(R)-12-hydroxyoctadec-cis-9-enoic acid] in its sclerotia. Recently, a fatty acid hydroxylase (C. purpurea FAH [CpFAH]) involved in the biosynthesis of ricinoleic acid was identified from this fungus (D. Meesapyodsuk and X. Qiu, Plant Physiol. 147:1325-1333, 2008). Here, we describe the cloning and biochemical characterization of a C. purpurea type II diacylglycerol acyltransferase (CpDGAT2) involved in the assembly of ricinoleic acid into triglycerides. The CpDGAT2 gene was cloned by degenerate RT-PCR (reverse transcription-PCR). The expression of this gene restored the in vivo synthesis of triacylglycerol (TAG) in the quadruple mutant strain Saccharomyces cerevisiae H1246, in which all four TAG biosynthesis genes (DGA1, LRO1, ARE1, and ARE2) are disrupted. In vitro enzymatic assays using microsomal preparations from the transformed yeast strain indicated that CpDGAT2 prefers ricinoleic acid as an acyl donor over linoleic acid, oleic acid, or linolenic acid, and it prefers 1,2-dioleoyl-sn-glycerol over 1,2-dipalmitoyl-sn-glycerol as an acyl acceptor. The coexpression of CpFAH with CpDGAT2 in yeast resulted in an increased accumulation of ricinoleic acid compared to the coexpression of CpFAH with the native yeast DGAT2 (S. cerevisiae DGA1 [ScDGA1]) or the expression of CpFAH alone. Northern blot analysis indicated that CpFAH is expressed solely in sclerotium cells, with no transcripts of this gene being detected in mycelium or conidial cells. CpDGAT2 was more widely expressed among the cell types examined, although expression was low in conidiospores. The high expression of CpDGAT2 and CpFAH in sclerotium cells, where high levels of ricinoleate glycerides accumulate, provided further evidence supporting the roles of CpDGAT2 and CpFAH as key enzymes for the synthesis and assembly of ricinoleic acid in C. purpurea.
Silverman, Andrew M; Qiao, Kangjian; Xu, Peng; Stephanopoulos, Gregory
2016-04-01
Single cell oil (SCO) is an attractive energy source due to scalability, utilization of low-cost renewable feedstocks, and type of product(s) made. Engineering strains capable of producing high lipid titers and yields is crucial to the economic viability of these processes. However, lipid synthesis in cells is a complex phenomenon subject to multiple layers of regulation, making gene target identification a challenging task. In this study, we aimed to identify genes in the oleaginous yeast Yarrowia lipolytica whose overexpression enhances lipid production by this organism. To this end, we examined the effect of the overexpression of a set of 44 native genes on lipid production in Y. lipolytica, including those involved in glycerolipid synthesis, fatty acid synthesis, central carbon metabolism, NADPH generation, regulation, and metabolite transport and characterized each resulting strain's ability to produce lipids growing on both glucose and acetate as a sole carbon source. Our results suggest that a diverse subset of genes was effective at individually influencing lipid production in Y. lipolytica, sometimes in a substrate-dependent manner. The most productive strain on glucose overexpressed the diacylglycerol acyltransferase DGA2 gene, increasing lipid titer, cellular content, and yield by 236, 165, and 246 %, respectively, over our control strain. On acetate, our most productive strain overexpressed the acylglycerol-phosphate acyltransferase SLC1 gene, with a lipid titer, cellular content, and yield increase of 99, 91, and 151 %, respectively, over the control strain. Aside from genes encoding enzymes that directly catalyze the reactions of lipid synthesis, other ways by which lipogenesis was increased in these cells include overexpressing the glycerol-3-phosphate dehydrogenase (GPD1) gene to increase production of glycerol head groups and overexpressing the 6-phosphogluconolactonase (SOL3) gene from the oxidative pentose phosphate pathway to increase NADPH
Patel, Unisha; Chauhan, Kishor; Gupte, Shilpa
2018-04-01
In the present work, magnetic nanoparticles (MNPs) were prepared by chemical precipitation of trivalent and divalent iron ions which were functionalized using citric acid. The bacterial isolate Staphylococcus epidermidis KX781317 was isolated from oil-contaminated site. The isolate produced lipase, which was purified and immobilized on magnetic nanoparticles (MNPs) for ester synthesis from waste frying oil (WFO). The characterization of MNPs employed conventional TEM, XRD and FTIR techniques. TEM analysis of MNPs showed the particle size in the range of 20-50 nm. FTIR spectra revealed the binding of citric acid to Fe 3 O 4 and lipase on citric acid-coated MNPs. The citric acid-coated MNPs and lipase-conjugated citric acid-coated MNPs had similar XRD patterns which indicate MNPs could preserve their magnetic properties. The maximum immobilization efficiency 98.21% of lipase-containing citric acid-coated MNPs was observed at ratio 10:1 of Cit-MNPs:lipase. The pH and temperature optima for lipase conjugated with Cit-MNPs were 7 and 35 °C, respectively. Isobutanol was found to be an effective solvent for ester synthesis and 1:2 ratio of oil:alcohol observed significant for ester formation. The ester formation was determined using TLC and the % yield of ester conversion was calculated. The rate of ester formation is directly proportional to the enzyme load. Formed esters were identified as isobutyl laurate ester and isobutyl myristate ester through GC-MS analysis.
Umezawa, Masakazu; Nakamura, Masayuki; El-Ghoneimy, Ashraf A; Onoda, Atsuto; Shaheen, Hazem M; Hori, Hiroshi; Shinkai, Yusuke; El-Sayed, Yasser S; El-Far, Ali H; Takeda, Ken
2018-01-01
Exposure to diesel exhaust (DE) exacerbates non-alcoholic fatty liver disease, and may systemically affect lipid metabolism. Omega-3 polyunsaturated fatty acids (n-3 PUFA) have anti-inflammatory activity and suppresses hepatic triacylglycerol accumulation, but many daily diets are deficient in this nutrient. Therefore, the effect of DE exposure in mice fed n-3 PUFA-deficient diet was investigated. Mice were fed control chow or n-3 PUFA-deficient diet for 4 weeks, then exposed to clean air or DE by inhalation for further 4 weeks. Liver histology, plasma parameters, and expression of fatty acid synthesis-related genes were evaluated. N-3 PUFA-deficient diet increased hepatic lipid droplets accumulation and expression of genes promoting fatty acid synthesis: Acaca, Acacb, and Scd1. DE further increased the plasma leptin and the expression of fatty acid synthesis-related genes: Acacb, Fasn, and Scd1. N-3 PUFA-deficient diet and DE exposure potentially enhanced hepatic fatty acid synthesis and subsequently accumulation of lipid droplets. The combination of low-dose DE exposure and intake of n-3 PUFA-deficient diet may be an additional risk factor for the incidence of non-alcoholic fatty liver disease. The present study suggests an important mechanism for preventing toxicity of DE on the liver through the incorporation of n-3 PUFAs in the diet. Copyright © 2017 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T
2012-01-01
Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contentsmore » were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.« less
USDA-ARS?s Scientific Manuscript database
Cyclopiazonic acid (CPA), an indole-tetramic acid toxin, is produced by many species of Aspergillus and Penicillium. In addition to CPA Aspergillus flavus produces polyketide-derived carcinogenic aflatoxins (AFs). AF biosynthesis genes form a gene cluster in a subtelomeric region. Isolates of A. fla...
Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies
Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa
2014-01-01
In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356
Wang, Song; Wang, Jian; Zhang, Xiaonan; Hu, Linlin; Fang, Zhijia; Huang, Zhiwei; Shi, Ping
2016-10-01
Trivalent chromium [Cr(III)] has been shown as an essential trace element for human health. Previous studies depict that Cr(III) plays important roles in maintaining normal glucose and lipid metabolism, whereas its effect on the hepatic lipid metabolism is still unknown. In the present study, we investigated the effects and underlying mechanisms of Cr on hepatic steatosis induced by oleic acid (OA) in human hepatoma SMMC-7721 cells. Hepatic steatosis model was co-administered with Cr. Indexes of lipid accumulation were determined and associated genes expression were analyzed. The data showed that OA could induce lipid accumulation and triglyceride (TG) content in SMMC-7721 cells, and significantly increase the expression of cluster of differentiation 36 (CD36) and diacylglycerol acyltransferase 2 (DGAT2). This steatosis effect of OA was ameliorated by Cr. The TG accumulation and up-regulation of CD36 and DGAT2 genes followed steatosis induction were inhibited by Cr. After the treatment of Cr, excessive intracellular OA content was also attenuated. Furthermore, Cr still performed inhibitory effect of DGAT2 expression at the presence of DGAT2 agonist or inhibitor, which indicated that the inhibitory effect of Cr on lipogenesis is associated with the downregulation of DGAT2 expression. These findings demonstrate that Cr alleviates hepatic steatosis via suppressing CD36 expression to prevent fatty acid uptake, as well as suppressing DGAT2 expression to inhibit TG synthesis. It suggests that CD36 and DGAT2 might become the novel drug targets for their properties in hepatic steatosis. Most importantly, Cr may be a potential anti-steatosis candidate to offer protective effects against liver damage.
N-3 polyunsaturated fatty acid regulation of hepatic gene transcription
Jump, Donald B.
2009-01-01
Purpose of review The liver plays a central role in whole body lipid metabolism and adapts rapidly to changes in dietary fat composition. This adaption involves changes in the expression of genes involved in glycolysis, de-novo lipogenesis, fatty acid elongation, desaturation and oxidation. This review brings together metabolic and molecular studies that help explain n-3 (omega-3) polyunsaturated fatty acid regulation of hepatic gene transcription. Recent findings Dietary n-3 polyunsaturated fatty acid regulates hepatic gene expression by targeting three major transcriptional regulatory networks: peroxisome proliferator-activated receptor α, sterol regulatory element binding protein-1 and the carbohydrate regulatory element binding protein/Max-like factor X heterodimer. 22 : 6,n-3, the most prominent n-3 polyunsaturated fatty acid in tissues, is a weak activator of peroxisome proliferator-activated receptor α. Hepatic metabolism of 22 : 6,n-3, however, generates 20 : 5,n-3, a strong peroxisome proliferator-activated receptor α activator. In contrast to peroxisome proliferator-activated receptor α, 22 : 6,n-3 is the most potent fatty acid regulator of hepatic sterol regulatory element binding protein-1. 22 : 6,n-3 suppresses sterol regulatory element binding protein-1 gene expression while enhancing degradation of nuclear sterol regulatory element binding protein-1 through 26S proteasome and Erk1/2-dependent mechanisms. Both n-3 and n-6 polyunsaturated fatty acid suppress carbohydrate regulatory element binding protein and Max-like factor X nuclear abundance and interfere with glucose-regulated hepatic metabolism. Summary These studies have revealed unique mechanisms by which specific polyunsaturated fatty acids control peroxisome proliferator activated receptor α, sterol regulatory element binding protein-1 and carbohydrate regulatory element binding protein/Max-like factor X function. As such, specific metabolic and signal transduction pathways contribute
Baila-Rueda, L; Cenarro, A; Lamiquiz-Moneo, I; Mateo-Gallego, R; Bea, A M; Perez-Calahorra, S; Marco-Benedi, V; Civeira, F
2017-05-01
Some oxysterols are precursors of bile acid synthesis and play an important role in cholesterol homeostasis. However, if they are involved in the pathogeny of genetic hypercholesterolemia has not been previously explored. We have studied non-cholesterol sterol markers of cholesterol synthesis (lanosterol and desmosterol) and oxysterols (7α-hydroxy-4-cholesten-3-one, 24S-hydroxycholesterol and 27-hydroxycholesterol) in 200 affected subjects with primary hypercholesterolemia of genetic origin, negative for mutations in LDLR, APOB, PCSK9 and APOE genes (non-FH GH) and 100 normolipemic controls. All studied oxysterols and cholesterol synthesis markers were significantly higher in affected subjects than controls (P<0.001). Ratios of oxysterols to total cholesterol were higher in non-FH GH than in controls, although only 24S-hydroxycholesterol showed statistical significance (P<0.001). Cholesterol synthesis markers had a positive correlation with BMI, triglycerides, cholesterol and apoB in control population. However, these correlations disappeared in non-FH GH with the exception of a weak positive correlation for non-HDL cholesterol and apoB. The same pattern was observed for oxysterols with high positive correlation in controls and absence of correlation for non-FH GH, except non-HDL cholesterol for 24S-hydroxycholesterol and 27-hydroxycholesterol and apoB for 27-hydroxycholesterol. All non-cholesterol sterols had positive correlation among them in patients and in controls. A total of 65 (32.5%) and 35 (17.5%) affected subjects presented values of oxysterols ratios to total cholesterol above the 95th percentile of the normal distribution (24S-hydroxycholesterol and 27-hydroxycholesterol, respectively). Those patients with the highest levels of 24S-hydroxycholesterol associated an increase in the carotid intima media thickness. These results suggest that bile acid metabolism is affected in some patients with primary hypercholesterolemia of genetic origin, negative for
Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis.
Wagner, Alexander J; Zubarev, Dmitry Yu; Aspuru-Guzik, Alán; Blackmond, Donna G
2017-04-26
Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins.
Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis
2017-01-01
Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins. PMID:28470050
Jamet, Stevie; Quentin, Yves; Coudray, Coralie; Texier, Pauline; Laval, Françoise; Daffé, Mamadou
2015-01-01
ABSTRACT Mycobacterium tuberculosis, the etiological agent of tuberculosis, is a Gram-positive bacterium with a unique cell envelope composed of an essential outer membrane. Mycolic acids, which are very-long-chain (up to C100) fatty acids, are the major components of this mycomembrane. The enzymatic pathways involved in the biosynthesis and transport of mycolates are fairly well documented and are the targets of the major antituberculous drugs. In contrast, only fragmented information is available on the expression and regulation of the biosynthesis genes. In this study, we report that the hadA, hadB, and hadC genes, which code for the mycolate biosynthesis dehydratase enzymes, are coexpressed with three genes that encode proteins of the translational apparatus. Consistent with the well-established control of the translation potential by nutrient availability, starvation leads to downregulation of the hadABC genes along with most of the genes required for the synthesis, modification, and transport of mycolates. The downregulation of a subset of the biosynthesis genes is partially dependent on RelMtb, the key enzyme of the stringent response. We also report the phylogenetic evolution scenario that has shaped the current genetic organization, characterized by the coregulation of the hadABC operon with genes of the translational apparatus and with genes required for the modification of the mycolates. IMPORTANCE Mycobacterium tuberculosis infects one-third of the human population worldwide, and despite the available therapeutic arsenal, it continues to kill millions of people each year. There is therefore an urgent need to identify new targets and develop a better understanding of how the bacterium is adapting itself to host defenses during infection. A prerequisite of this understanding is knowledge of how this adaptive skill has been implanted by evolution. Nutrient scarcity is an environmental condition the bacterium has to cope with during infection. In many
Sale, Julian E.; Batters, Christopher; Edmunds, Charlotte E.; Phillips, Lara G.; Simpson, Laura J.; Szüts, Dávid
2008-01-01
By temporarily deferring the repair of DNA lesions encountered during replication, the bypass of DNA damage is critical to the ability of cells to withstand genomic insults. Damage bypass can be achieved either by recombinational mechanisms that are generally accurate or by a process called translesion synthesis. Translesion synthesis involves replacing the stalled replicative polymerase with one of a number of specialized DNA polymerases whose active sites are able to tolerate a distorted or damaged DNA template. While this property allows the translesion polymerases to synthesize across damaged bases, it does so with the trade-off of an increased mutation rate. The deployment of these enzymes must therefore be carefully regulated. In addition to their important role in general DNA damage tolerance and mutagenesis, the translesion polymerases play a crucial role in converting the products of activation induced deaminase-catalysed cytidine deamination to mutations during immunoglobulin gene somatic hypermutation. In this paper, we specifically consider the control of translesion synthesis in the context of the timing of lesion bypass relative to replication fork progression and arrest at sites of DNA damage. We then examine how recent observations concerning the control of translesion synthesis might help refine our view of the mechanisms of immunoglobulin gene somatic hypermutation. PMID:19008194
Ebrahimi, Mahdi; Rajion, Mohamed Ali; Goh, Yong Meng
2014-01-01
Alteration of the lipid content and fatty acid (FA) composition of foods can result in a healthier product. The aim of this study was to determine the effect of flaxseed oil or sunflower oil in the goat diet on fatty acid composition of muscle and expression of lipogenic genes in the semitendinosus (ST) muscle. Twenty-one entire male Boer kid goats were fed diets containing different levels of linoleic acid (LA) and α-linolenic acid (LNA) for 100 days. Inclusion of flaxseed oil increased (p < 0.05) the α-linolenic acid (C18:3n-3) concentration in the ST muscle. The diet high in α-linolenic acid (p < 0.05) decreased the arachidonic acid (C20:4n-6) and conjugated linolenic acid (CLA) c-9 t-11 content in the ST muscle. There was a significant (p < 0.05) upregulation of PPARα and PPARγ gene expression and downregulation of stearoyl-CoA desaturase (SCD) gene in the ST muscle for the high α-linolenic acid group compared with the low α-linolenic acid group. The results of the present study show that flaxseed oil as a source of α-linolenic acid can be incorporated into the diets of goats to enrich goat meat with n-3 fatty acids, upregulate the PPARα and PPARγ, and downregulate the SCD gene expression. PMID:25255382
Ebrahimi, Mahdi; Rajion, Mohamed Ali; Goh, Yong Meng
2014-09-24
Alteration of the lipid content and fatty acid (FA) composition of foods can result in a healthier product. The aim of this study was to determine the effect of flaxseed oil or sunflower oil in the goat diet on fatty acid composition of muscle and expression of lipogenic genes in the semitendinosus (ST) muscle. Twenty-one entire male Boer kid goats were fed diets containing different levels of linoleic acid (LA) and α-linolenic acid (LNA) for 100 days. Inclusion of flaxseed oil increased (p < 0.05) the α-linolenic acid (C18:3n-3) concentration in the ST muscle. The diet high in α-linolenic acid (p < 0.05) decreased the arachidonic acid (C20:4n-6) and conjugated linolenic acid (CLA) c-9 t-11 content in the ST muscle. There was a significant (p < 0.05) upregulation of PPARα and PPARγ gene expression and downregulation of stearoyl-CoA desaturase (SCD) gene in the ST muscle for the high α-linolenic acid group compared with the low α-linolenic acid group. The results of the present study show that flaxseed oil as a source of α-linolenic acid can be incorporated into the diets of goats to enrich goat meat with n-3 fatty acids, upregulate the PPARα and PPARγ, and downregulate the SCD gene expression.
Holen, Elisabeth; He, Juyun; Espe, Marit; Chen, Liqiou; Araujo, Pedro
2015-08-01
Future feed for farmed fish are based on untraditional feed ingredients, which will change nutrient profiles compared to traditional feed based on marine ingredients. To understand the impact of oils from different sources on fish health, n-6 and n-3 polyunsaturated fatty acids (PUFAs) were added to salmon head kidney cells, in a fully crossed design, to monitor their individual and combined effects on gene expression. Exposing salmon head kidney cells to single fatty acids, arachidonic acid (AA) or decosahexaenoic acid (DHA), resulted in down-regulation of cell signaling pathway genes and specific fatty acid metabolism genes as well as reduced prostaglandin E2 (PGE2) secretion. Eicosapentaenoic acid (EPA) had no impact on gene transcription in this study, but reduced the cell secretion of PGE2. The combined effect of AA + EPA resulted in up-regulation of eicosanoid pathway genes and the pro-inflammatory cytokine, tumor necrosis factor alpha (TNF-α), Bclx (an inducer of apoptosis) and fatty acid translocase (CD36) as well as increased cell secretion of PGE2 into the media. Adding single fatty acids to salmon head kidney cells decreased inflammation markers in this model. The combination AA + EPA acted differently than the rest of the fatty acid combinations by increasing the inflammation markers in these cells. The concentration of fatty acid used in this experiment did not induce any lipid peroxidation responses. Copyright © 2015 Elsevier Ltd. All rights reserved.
Zhang, Chao; Zhang, Lin; Zhang, Sheng; Zhu, Shuang; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2015-01-21
Physic nut (Jatropha curcas L.) is a small perennial tree or large shrub, which is well-adapted to semi-arid regions and is considered to have potential as a crop for biofuel production. It is now regarded as an excellent model for studying biofuel plants. However, our knowledge about the molecular responses of this species to drought stress is currently limited. In this study, genome-wide transcriptional profiles of roots and leaves of 8-week old physic nut seedlings were analyzed 1, 4 and 7 days after withholding irrigation. We observed a total of 1533 and 2900 differentially expressed genes (DEGs) in roots and leaves, respectively. Gene Ontology analysis showed that the biological processes enriched in droughted plants relative to unstressed plants were related to biosynthesis, transport, nucleobase-containing compounds, and cellular protein modification. The genes found to be up-regulated in roots were related to abscisic acid (ABA) synthesis and ABA signal transduction, and to the synthesis of raffinose. Genes related to ABA signal transduction, and to trehalose and raffinose synthesis, were up-regulated in leaves. Endoplasmic reticulum (ER) stress response genes were significantly up-regulated in leaves under drought stress, while a number of genes related to wax biosynthesis were also up-regulated in leaves. Genes related to unsaturated fatty acid biosynthesis were down-regulated and polyunsaturated fatty acids were significantly reduced in leaves 7 days after withholding irrigation. As drought stress increased, genes related to ethylene synthesis, ethylene signal transduction and chlorophyll degradation were up-regulated, and the chlorophyll content of leaves was significantly reduced by 7 days after withholding irrigation. This study provides us with new insights to increase our understanding of the response mechanisms deployed by physic nut seedlings under drought stress. The genes and pathways identified in this study also provide much information of
Yamburenko, Maria V; Zubo, Yan O; Börner, Thomas
2015-06-01
Abscisic acid (ABA) represses the transcriptional activity of chloroplast genes (determined by run-on assays), with the exception of psbD and a few other genes in wild-type Arabidopsis seedlings and mature rosette leaves. Abscisic acid does not influence chloroplast transcription in the mutant lines abi1-1 and abi2-1 with constitutive protein phosphatase 2C (PP2C) activity, suggesting that ABA affects chloroplast gene activity by binding to the pyrabactin resistance (PYR)/PYR1-like or regulatory component of ABA receptor protein family (PYR/PYL/RCAR) and signaling via PP2Cs and sucrose non-fermenting protein-related kinases 2 (SnRK2s). Further we show by quantitative PCR that ABA enhances the transcript levels of RSH2, RSH3, PTF1 and SIG5. RelA/SpoT homolog 2 (RSH2) and RSH3 are known to synthesize guanosine-3'-5'-bisdiphosphate (ppGpp), an inhibitor of the plastid-gene-encoded chloroplast RNA polymerase. We propose, therefore, that ABA leads to an inhibition of chloroplast gene expression via stimulation of ppGpp synthesis. On the other hand, sigma factor 5 (SIG5) and plastid transcription factor 1 (PTF1) are known to be necessary for the transcription of psbD from a specific light- and stress-induced promoter (the blue light responsive promoter, BLRP). We demonstrate that ABA activates the psbD gene by stimulation of transcription initiation at BLRP. Taken together, our data suggest that ABA affects the transcription of chloroplast genes by a PP2C-dependent activation of nuclear genes encoding proteins involved in chloroplast transcription. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
An interactional network of genes involved in chitin synthesis in Saccharomyces cerevisiae.
Lesage, Guillaume; Shapiro, Jesse; Specht, Charles A; Sdicu, Anne-Marie; Ménard, Patrice; Hussein, Shamiza; Tong, Amy Hin Yan; Boone, Charles; Bussey, Howard
2005-02-16
In S. cerevisiae the beta-1,4-linked N-acetylglucosamine polymer, chitin, is synthesized by a family of 3 specialized but interacting chitin synthases encoded by CHS1, CHS2 and CHS3. Chs2p makes chitin in the primary septum, while Chs3p makes chitin in the lateral cell wall and in the bud neck, and can partially compensate for the lack of Chs2p. Chs3p requires a pathway of Bni4p, Chs4p, Chs5p, Chs6p and Chs7p for its localization and activity. Chs1p is thought to have a septum repair function after cell separation. To further explore interactions in the chitin synthase family and to find processes buffering chitin synthesis, we compiled a genetic interaction network of genes showing synthetic interactions with CHS1, CHS3 and genes involved in Chs3p localization and function and made a phenotypic analysis of their mutants. Using deletion mutants in CHS1, CHS3, CHS4, CHS5, CHS6, CHS7 and BNI4 in a synthetic genetic array analysis we assembled a network of 316 interactions among 163 genes. The interaction network with CHS3, CHS4, CHS5, CHS6, CHS7 or BNI4 forms a dense neighborhood, with many genes functioning in cell wall assembly or polarized secretion. Chitin levels were altered in 54 of the mutants in individually deleted genes, indicating a functional relationship between them and chitin synthesis. 32 of these mutants triggered the chitin stress response, with elevated chitin levels and a dependence on CHS3. A large fraction of the CHS1-interaction set was distinct from that of the CHS3 network, indicating broad roles for Chs1p in buffering both Chs2p function and more global cell wall robustness. Based on their interaction patterns and chitin levels we group interacting mutants into functional categories. Genes interacting with CHS3 are involved in the amelioration of cell wall defects and in septum or bud neck chitin synthesis, and we newly assign a number of genes to these functions. Our genetic analysis of genes not interacting with CHS3 indicate expanded
An interactional network of genes involved in chitin synthesis in Saccharomyces cerevisiae
Lesage, Guillaume; Shapiro, Jesse; Specht, Charles A; Sdicu, Anne-Marie; Ménard, Patrice; Hussein, Shamiza; Tong, Amy Hin Yan; Boone, Charles; Bussey, Howard
2005-01-01
Background In S. cerevisiae the β-1,4-linked N-acetylglucosamine polymer, chitin, is synthesized by a family of 3 specialized but interacting chitin synthases encoded by CHS1, CHS2 and CHS3. Chs2p makes chitin in the primary septum, while Chs3p makes chitin in the lateral cell wall and in the bud neck, and can partially compensate for the lack of Chs2p. Chs3p requires a pathway of Bni4p, Chs4p, Chs5p, Chs6p and Chs7p for its localization and activity. Chs1p is thought to have a septum repair function after cell separation. To further explore interactions in the chitin synthase family and to find processes buffering chitin synthesis, we compiled a genetic interaction network of genes showing synthetic interactions with CHS1, CHS3 and genes involved in Chs3p localization and function and made a phenotypic analysis of their mutants. Results Using deletion mutants in CHS1, CHS3, CHS4, CHS5, CHS6, CHS7 and BNI4 in a synthetic genetic array analysis we assembled a network of 316 interactions among 163 genes. The interaction network with CHS3, CHS4, CHS5, CHS6, CHS7 or BNI4 forms a dense neighborhood, with many genes functioning in cell wall assembly or polarized secretion. Chitin levels were altered in 54 of the mutants in individually deleted genes, indicating a functional relationship between them and chitin synthesis. 32 of these mutants triggered the chitin stress response, with elevated chitin levels and a dependence on CHS3. A large fraction of the CHS1-interaction set was distinct from that of the CHS3 network, indicating broad roles for Chs1p in buffering both Chs2p function and more global cell wall robustness. Conclusion Based on their interaction patterns and chitin levels we group interacting mutants into functional categories. Genes interacting with CHS3 are involved in the amelioration of cell wall defects and in septum or bud neck chitin synthesis, and we newly assign a number of genes to these functions. Our genetic analysis of genes not interacting with
Growth inhibitory effects of anthranilic acid and its derivatives against Legionella pneumophila.
Sasaki, Takahide; Mizuguchi, Satoru; Honda, Kohsuke
2012-06-01
Legionella pneumophila is the principal etiologic agent of Legionnaires' disease. We found that the growth of L. pneumophila was markedly inhibited by its own cell lysate and the inhibitory effect was abolished by heat-treatment of the lysate. The genomic library of L. pneumophila was constructed in Escherichia coli and screened to determine the gene involved in the growth inhibition. A clone harboring the gene encoding anthranilate synthase (TrpE), which is involved in tryptophan biosynthesis, exhibited an inhibitory effect on the growth of L. pneumophila. Anthranilic acid exogenously added also exhibited antibacterial activity against L. pneumophila. A series of single-gene-knockout mutants of L. pneumophila lacking tryptophan synthesis genes were constructed and assessed for their susceptibility to anthranilic acid. Although the growth of mutants deficient in anthranilate phosphoribosyltransferase (TrpD) and N-(5'-phosphoribosyl)anthranilate isomerase (TrpF) was not affected by exogenous anthranilic acid, the indole-3-glycerophosphate synthase (TrpC) deficient mutant exhibited an increased susceptibility compared with the parent strain. These observations strongly indicate that 1-(2-carboxyphenylamino)-1'-deoxyribulose-5'-phosphate (CPADR-5'-P), which is an intermediate of tryptophan synthesis from anthranilic acid, is responsible for the growth inhibition of L. pneumophila. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
2010-06-11
the cinnamic acid phenyl ring. Although compound 4c proved to be very cytotoxic in HUVEC over a 24 h period, the toxicity is less apparent over a 5 h...drug development process, as it determines how much of the initial dose actually reaches the target site. Cinnamic acid -derived amides are known to...Synthesis of a series of caffeic acid phenethyl amide (CAPA) fluorinated derivatives: Comparison of cytoprotective effects to caffeic acid phenethyl
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu X. H.; Shanklin J.; Rawat, R.
Cyclopropane fatty acids (CPA) have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE) are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants frommore » herbivory. Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA) distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model plant systems, it represents a strong candidate
Nuclear Synthesis of Cytoplasmic Ribonucleic Acid in Amoeba proteus
Prescott, David M.
1959-01-01
The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells. PMID:14434750
Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.
PRESCOTT, D M
1959-10-01
The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.
Velasco-Lozano, Susana; da Silva, Eunice S; Llop, Jordi; López-Gallego, Fernando
2018-02-16
The enzymatic synthesis of α-amino acids is a sustainable and efficient alternative to chemical processes, through which achieving enantiopure products is difficult. To more address this synthesis efficiently, a hierarchical architecture that irreversibly co-immobilises an amino acid dehydrogenase with polyethyleneimine on porous agarose beads has been designed and fabricated. The cationic polymer acts as an irreversible anchoring layer for the formate dehydrogenase. In this architecture, the two enzymes and polymer colocalise across the whole microstructure of the porous carrier. This multifunctional heterogeneous biocatalyst was kinetically characterised and applied to the enantioselective synthesis of a variety of canonical and noncanonical α-amino acids in both discontinuous (batch) and continuous modes. The co-immobilised bienzymatic system conserves more than 50 % of its initial effectiveness after five batch cycles and 8 days of continuous operation. Additionally, the environmental impact of this process has been semiquantitatively calculated and compared with the state of the art. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ryan, Veronica H; Primiani, Christopher T; Rao, Jagadeesh S; Ahn, Kwangmi; Rapoport, Stanley I; Blanchard, Helene
2014-01-01
The polyunsaturated arachidonic and docosahexaenoic acids (AA and DHA) participate in cell membrane synthesis during neurodevelopment, neuroplasticity, and neurotransmission throughout life. Each is metabolized via coupled enzymatic reactions within separate but interacting metabolic cascades. AA and DHA pathway genes are coordinately expressed and underlie cascade interactions during human brain development and aging. The BrainCloud database for human non-pathological prefrontal cortex gene expression was used to quantify postnatal age changes in mRNA expression of 34 genes involved in AA and DHA metabolism. Expression patterns were split into Development (0 to 20 years) and Aging (21 to 78 years) intervals. Expression of genes for cytosolic phospholipases A2 (cPLA2), cyclooxygenases (COX)-1 and -2, and other AA cascade enzymes, correlated closely with age during Development, less so during Aging. Expression of DHA cascade enzymes was less inter-correlated in each period, but often changed in the opposite direction to expression of AA cascade genes. Except for the PLA2G4A (cPLA2 IVA) and PTGS2 (COX-2) genes at 1q25, highly inter-correlated genes were at distant chromosomal loci. Coordinated age-related gene expression during the brain Development and Aging intervals likely underlies coupled changes in enzymes of the AA and DHA cascades and largely occur through distant transcriptional regulation. Healthy brain aging does not show upregulation of PLA2G4 or PTGS2 expression, which was found in Alzheimer's disease.
Cheng, Jie; Huang, Yuding; Mi, Le; Chen, Wujiu; Wang, Dan; Wang, Qinhong
2018-05-10
Deficiency in petroleum resources and increasing environmental concerns have pushed a bio-based economy to be built, employing a highly reproducible, metal contaminant free, sustainable and green biomanufacturing method. Here, a chiral drug intermediate L-pipecolic acid has been synthesized from biomass-derived lysine. This artificial bioconversion system involves the coexpression of four functional genes, which encode L-lysine α-oxidase from Scomber japonicus, glucose dehydrogenase from Bacillus subtilis, Δ 1 -piperideine-2-carboxylase reductase from Pseudomonas putida, and lysine permease from Escherichia coli. Besides, a lysine degradation enzyme has been knocked out to strengthen the process in this microbe. The overexpression of LysP improved the L-pipecolic acid titer about 1.6-folds compared to the control. This engineered microbial factory showed the highest L-pipecolic acid production of 46.7 g/L reported to date and a higher productivity of 2.41 g/L h and a yield of 0.89 g/g. This biotechnological L-pipecolic acid production is a simple, economic, and green technology to replace the presently used chemical synthesis.
USDA-ARS?s Scientific Manuscript database
The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....
Lopez, Adam M; Chuang, Jen-Chieh; Posey, Kenneth S; Turley, Stephen D
2017-01-01
Mutations in the X-linked gene methyl-CpG-binding protein 2 (MECP2) are the principal cause of Rett syndrome, a progressive neurodevelopmental disorder afflicting 1 in 10,000 to 15,000 females. Studies using hemizygous Mecp2 mouse models have revealed disruptions to some aspects of their lipid metabolism including a partial suppression of cholesterol synthesis in the brains of mature Mecp2 mutants. The present studies investigated whether this suppression is evident from early neonatal life, or becomes manifest at a later stage of development. We measured the rate of cholesterol synthesis, in vivo, in the brains of male Mecp2 - /y and their Mecp2 +/y littermates at 7, 14, 21, 28, 42 and 56 days of age. Brain weight was consistently lower in the Mecp2 -/y mice than in their Mecp2 +/y controls except at 7 days of age. In the 7- and 14-day-old mice there was no genotypic difference in the rate of brain cholesterol synthesis but, from 21 days and later, it was always marginally lower in the Mecp2 -/y mice than in age-matched Mecp2 +/y littermates. At no age was a genotypic difference detected in either the rate of fatty acid synthesis or cholesterol concentration in the brain. Cholesterol synthesis rates in the liver and lungs of 56-day-old Mecp2 -/y mice were normal. The onset of lower rates of brain cholesterol synthesis at about the time closure of the blood brain barrier purportedly occurs might signify a disruption to mechanism(s) that dictate intracellular levels of cholesterol metabolites including oxysterols known to exert a regulatory influence on the cholesterol biosynthetic pathway. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc
2015-09-01
The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica. Copyright © 2015. Published by Elsevier B.V.
Genes Required for Vacuolar Acidity in Saccharomyces Cerevisiae
Preston, R. A.; Reinagel, P. S.; Jones, E. W.
1992-01-01
Mutations that cause loss of acidity in the vacuole (lysosome) of Saccharomyces cerevisiae were identified by screening colonies labeled with the fluorescent, pH-sensitive, vacuolar labeling agent, 6-carboxyfluorescein. Thirty nine vacuolar pH (Vph(-)) mutants were identified. Four of these contained mutant alleles of the previously described PEP3, PEP5, PEP6 and PEP7 genes. The remaining mutants defined eight complementation groups of vph mutations. No alleles of the VAT2 or TFP1 genes (known to encode subunits of the vacuolar H(+)-ATPase) were identified in the Vph(-) screen. Strains bearing mutations in any of six of the VPH genes failed to grow on medium buffered at neutral pH; otherwise, none of the vph mutations caused notable growth inhibition on standard yeast media. Expression of the vacuolar protease, carboxypeptidase Y, was defective in strains bearing vph4 mutations but was apparently normal in strains bearing any of the other vph mutations. Defects in vacuolar morphology at the light microscope level were evident in all Vph(-) mutants. Strains that contained representative mutant alleles of the 17 previously described PEP genes were assayed for vacuolar pH; mutations in seven of the PEP genes (including PEP3, PEP5, PEP6 and PEP7) caused loss of vacuolar acidity. PMID:1628805
Moon, Jiyun M; Aronoff, David M; Capra, John A; Abbot, Patrick; Rokas, Antonis
2018-03-28
Sialic acids are nine carbon sugars ubiquitously found on the surfaces of vertebrate cells and are involved in various immune response-related processes. In humans, at least 58 genes spanning diverse functions, from biosynthesis and activation to recycling and degradation, are involved in sialic acid biology. Because of their role in immunity, sialic acid biology genes have been hypothesized to exhibit elevated rates of evolutionary change. Consistent with this hypothesis, several genes involved in sialic acid biology have experienced higher rates of non-synonymous substitutions in the human lineage than their counterparts in other great apes, perhaps in response to ancient pathogens that infected hominins millions of years ago (paleopathogens). To test whether sialic acid biology genes have also experienced more recent positive selection during the evolution of the modern human lineage, reflecting adaptation to contemporary cosmopolitan or geographically-restricted pathogens, we examined whether their protein-coding regions showed evidence of recent hard and soft selective sweeps. This examination involved the calculation of four measures that quantify changes in allele frequency spectra, extent of population differentiation, and haplotype homozygosity caused by recent hard and soft selective sweeps for 55 sialic acid biology genes using publicly available whole genome sequencing data from 1,668 humans from three ethnic groups. To disentangle evidence for selection from confounding demographic effects, we compared the observed patterns in sialic acid biology genes to simulated sequences of the same length under a model of neutral evolution that takes into account human demographic history. We found that the patterns of genetic variation of most sialic acid biology genes did not significantly deviate from neutral expectations and were not significantly different among genes belonging to different functional categories. Those few sialic acid biology genes that
Fatty acid metabolism in breast cancer subtypes
Monaco, Marie E.
2017-01-01
Dysregulation of fatty acid metabolism is recognized as a component of malignant transformation in many different cancers, including breast; yet the potential for targeting this pathway for prevention and/or treatment of cancer remains unrealized. Evidence indicates that proteins involved in both synthesis and oxidation of fatty acids play a pivotal role in the proliferation, migration and invasion of breast cancer cells. The following essay summarizes data implicating specific fatty acid metabolic enzymes in the genesis and progression of breast cancer, and further categorizes the relevance of specific metabolic pathways to individual intrinsic molecular subtypes of breast cancer. Based on mRNA expression data, the less aggressive luminal subtypes appear to rely on a balance between de novo fatty acid synthesis and oxidation as sources for both biomass and energy requirements, while basal-like, receptor negative subtypes overexpress genes involved in the utilization of exogenous fatty acids. With these differences in mind, treatments may need to be tailored to individual subtypes. PMID:28412757
Malcher-Lopes, Renato; Franco, Alier; Tasker, Jeffrey G.
2008-01-01
Glucocorticoids are capable of exerting both genomic and non-genomic actions in target cells of multiple tissues, including the brain, which trigger an array of electrophysiological, metabolic, secretory and inflammatory regulatory responses. Here, we have attempted to show how glucocorticoids may generate a rapid anti-inflammatory response by promoting arachidonic acid-derived endocannabinoid biosynthesis. According to our hypothesized model, non-genomic action of glucocorticoids results in the global shift of membrane lipid metabolism, subverting metabolic pathways toward the synthesis of the anti-inflammatory endocannabinoids, anandamide (AEA) and 2-arachidonoyl-glycerol (2-AG), and away from arachidonic acid production. Post-transcriptional inhibition of cyclooxygenase-2 (COX2) synthesis by glucocorticoids assists this mechanism by suppressing the synthesis of pro-inflammatory prostaglandins as well as endocannabinoid-derived prostanoids. In the central nervous system (CNS) this may represent a major neuroprotective system, which may cross-talk with leptin signaling in the hypothalamus allowing for the coordination between energy homeostasis and the inflammatory response. PMID:18295199
Selection in Europeans on Fatty Acid Desaturases Associated with Dietary Changes
Buckley, Matthew T.; Racimo, Fernando; Allentoft, Morten E.; Jensen, Majken K.; Jonsson, Anna; Huang, Hongyan; Hormozdiari, Farhad; Sikora, Martin; Marnetto, Davide; Eskin, Eleazar; Jørgensen, Marit E.; Grarup, Niels; Pedersen, Oluf; Hansen, Torben; Kraft, Peter; Willerslev, Eske
2017-01-01
Abstract FADS genes encode fatty acid desaturases that are important for the conversion of short chain polyunsaturated fatty acids (PUFAs) to long chain fatty acids. Prior studies indicate that the FADS genes have been subjected to strong positive selection in Africa, South Asia, Greenland, and Europe. By comparing FADS sequencing data from present-day and Bronze Age (5–3k years ago) Europeans, we identify possible targets of selection in the European population, which suggest that selection has targeted different alleles in the FADS genes in Europe than it has in South Asia or Greenland. The alleles showing the strongest changes in allele frequency since the Bronze Age show associations with expression changes and multiple lipid-related phenotypes. Furthermore, the selected alleles are associated with a decrease in linoleic acid and an increase in arachidonic and eicosapentaenoic acids among Europeans; this is an opposite effect of that observed for selected alleles in Inuit from Greenland. We show that multiple SNPs in the region affect expression levels and PUFA synthesis. Additionally, we find evidence for a gene–environment interaction influencing low-density lipoprotein (LDL) levels between alleles affecting PUFA synthesis and PUFA dietary intake: carriers of the derived allele display lower LDL cholesterol levels with a higher intake of PUFAs. We hypothesize that the selective patterns observed in Europeans were driven by a change in dietary composition of fatty acids following the transition to agriculture, resulting in a lower intake of arachidonic acid and eicosapentaenoic acid, but a higher intake of linoleic acid and α-linolenic acid. PMID:28333262
Leber, Christopher; Choi, Jin Wook; Polson, Brian; Da Silva, Nancy A
2016-04-01
Biologically derived fatty acids have gained tremendous interest as an alternative to petroleum-derived fuels and chemical precursors. We previously demonstrated the synthesis of short chain fatty acids in Saccharomyces cerevisiae by introduction of the Homo sapiens fatty acid synthase (hFAS) with heterologous phosphopantetheine transferases and heterologous thioesterases. In this study, short chain fatty acid production was improved by combining a variety of novel enzyme and metabolic engineering strategies. The use of a H. sapiens-derived thioesterase and phosphopantetheine transferase were evaluated. In addition, strains were engineered to disrupt either the full β-oxidation (by deleting FAA2, PXA1, and POX1) or short chain-specific β-oxidation (by deleting FAA2, ANT1, and PEX11) pathways. Prohibiting full β-oxidation increased hexanoic and octanoic acid levels by 8- and 79-fold relative to the parent strain expressing hFAS. However, by targeting only short chain β-oxidation, hexanoic and octanoic acid levels increased further to 31- and 140-fold over the parent. In addition, an optimized hFAS gene increased hexanoic, octanoic, decanoic and total short chain fatty acid levels by 2.9-, 2.0-, 2.3-, and 2.2-fold, respectively, relative to the non-optimized counterpart. By combining these unique enzyme and metabolic engineering strategies, octanoic acid was increased more than 181-fold over the parent strain expressing hFAS. © 2015 Wiley Periodicals, Inc.
Desaturase and elongase-limiting endogenous long-chain polyunsaturated fatty acid biosynthesis.
Zhang, Ji Yao; Kothapalli, Kumar S D; Brenna, J Thomas
2016-03-01
Endogenous synthesis of the long-chain polyunsaturated fatty acids (LCPUFAs) is mediated by the fatty acid desaturase (FADS) gene cluster (11q12-13.1) and elongation of very long-chain fatty acids 2 (ELOVL2) (6p24.2) and ELOVL5 (6p12.1). Although older biochemical work identified the product of one gene, FADS2, rate limiting for LCPUFA synthesis, recent studies suggest that polymorphisms in any of these genes can limit accumulation of product LCPUFA. Genome-wide association study (GWAS) of Greenland Inuit shows strong adaptation signals within FADS gene cluster, attributed to high omega-3 fatty acid intake, while GWAS found ELOVL2 associated with sleep duration, age and DNA methylation. ELOVL5 coding mutations cause spinocerebellar ataxia 38, and epigenetic marks were associated with depression and suicide risk. Two sterol response element binding sites were found on ELOVL5, a SREBP-1c target gene. Minor allele carriers of a 3 single nucleotide polymorphism (SNP) haplotype in ELOVL2 have decreased 22 : 6n-3 levels. Unequivocal molecular evidence shows mammalian FADS2 catalyzes direct Δ4-desaturation to yield 22 : 6n-3 and 22 : 5n-6. An SNP near FADS1 influences the levels of 5-lipoxygenase products and epigenetic alteration. Genetic polymorphisms within FADS and ELOVL can limit LCPUFA product accumulation at any step of the biosynthetic pathway.
Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria.
Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Sharma, Sandeep; Verslues, Paul E
2016-10-01
Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1 pro :LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1 pro :LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1 pro :LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1 pro :LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4 These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. © 2016 American Society of Plant Biologists. All Rights Reserved.
Hashim, Puziah
2014-03-01
Centella asiatica (Linn.) Urban is well known in promoting wound healing and provides significant benefits in skin care and therapeutic products formulation. Glycolic acid and vitamins also play a role in the enhancement of collagen and fibronectin synthesis. Here, we evaluate the specific effect of Centella asiatica (CA), vitamins, glycolic acid and their mixture preparations to stimulate collagen and fibronectin synthesis in cultured human fibroblast cells. The fibroblast cells are incubated with CA, glycolic acid, vitamins and their mixture preparations for 48 h. The cell lysates were analyzed for protein content and collagen synthesis by direct binding enzyme immunoassay. The fibronectin of the cultured supernatant was measured by sandwich enzyme immunoassay. The results showed that CA, glycolic acid, vitamins A, E and C significantly stimulate collagen and fibronectin synthesis in the fibroblast. Addition of glycolic acid and vitamins to CA further increased the levels of collagen and fibronectin synthesis to 8.55 and 23.75 μg/100 μg, respectively. CA, glycolic acid, vitamins A, E, and C, and their mixtures demonstrated stimulatory effect on both extra-cellular matrix synthesis of collagen and fibronectin in in vitro studies on human foreskin fibroblasts, which is beneficial to skin care and therapeutic products formulation.
Choi, Woon Yong; Kim, Ji Seon; Park, Sung Jin; Ma, Choong Je; Lee, Hyeon Yong
2014-04-08
In this study, the effect of Codonopsis lanceolata fermented by lactic acid on controlling gene expression levels related to obesity was observed in an oligonucleotide chip microarray. Among 8170 genes, 393 genes were up regulated and 760 genes were down regulated in feeding the fermented C. lanceolata (FCL). Another 374 genes were up regulated and 527 genes down regulated without feeding the sample. The genes were not affected by the FCL sample. It was interesting that among those genes, Chytochrome P450, Dmbt1, LOC76487, and thyroid hormones, etc., were mostly up or down regulated. These genes are more related to lipid synthesis. We could conclude that the FCL possibly controlled the gene expression levels related to lipid synthesis, which resulted in reducing obesity. However, more detailed protein expression experiments should be carried out.
NASA Astrophysics Data System (ADS)
Li, Li; Liu, Jianbo; Yang, Xiaohai; Huang, Jin; He, Dinggeng; Guo, Xi; Wan, Lan; He, Xiaoxiao; Wang, Kemin
2016-03-01
Amino acid-dithiocarbamate (amino acid-DTC) was developed as both the reductant and ligand stabilizer for biomimetic synthesis of gold nanoparticles (AuNPs), which served as an excellent surface-enhanced Raman scattering (SERS) contrast nanoprobe for cell imaging. Glycine (Gly), glutamic acid (Glu), and histidine (His) with different isoelectric points were chosen as representative amino acid candidates to synthesize corresponding amino acid-DTC compounds through mixing with carbon disulfide (CS2), respectively. The pyrogenic decomposition of amino acid-DTC initiated the reduction synthesis of AuNPs, and the strong coordinating dithiocarbamate group of amino acid-DTC served as a stabilizer that grafted onto the surface of the AuNPs, which rendered the as-prepared nanoparticles a negative surface charge and high colloidal stability. MTT cell viability assay demonstrated that the biomimetic AuNPs possessed neglectful toxicity to the human hepatoma cell, which guaranteed them good biocompatibility for biomedical application. Meanwhile, the biomimetic AuNPs showed a strong SERS effect with an enhancement factor of 9.8 × 105 for the sensing of Rhodamine 6G, and two distinct Raman peaks located at 1363 and 1509 cm-1 could be clearly observed in the cell-imaging experiments. Therefore, biomimetic AuNPs can be explored as an excellent SERS contrast nanoprobe for biomedical imaging, and the amino acid-DTC mediated synthesis of the AuNPs has a great potential in bio-engineering and biomedical imaging applications.
Gu, Yanyan; Wang, Xiaomeng; Yang, Chao; Geng, Weitao; Feng, Jun; Wang, Yuanyuan; Wang, Shufang; Song, Cunjiang
2016-04-01
ε-Poly-L-lysine (ε-PL) is a widely used natural food preservative. To test the effects of the Vitreoscilla hemoglobin (VHb) and S-adenosylmethionine (SAM) on ε-PL synthesis in Streptomyces albulus NK660, the heterologous VHb gene (vgb) and SAM synthetase gene (metK) were inserted into the S. albulus NK660 chromosome under the control of the constitutive ermE* promoter. CO-difference spectrum analysis showed S. albulus NK660-VHb strain could express functional VHb. S. albulus NK660-VHb produced 26.67 % higher ε-PL and 14.57 % higher biomass than the wild-type control, respectively. Reversed-phase high-pressure liquid chromatography (RP-HPLC) results showed the overexpression of the metK gene resulted in increased intracellular SAM synthesis in S. albulus NK660-SAM, which caused increases of biomass as well as the transcription level of ε-PL synthetase gene (pls). Results indicated that the expression of vgb and metK gene improved on ε-PL synthesis and biomass for S. albulus NK660, respectively.
Ibeagha-Awemu, Eveline M; Li, Ran; Ammah, Adolf A; Dudemaine, Pier-Luc; Bissonnette, Nathalie; Benchaar, Chaouki; Zhao, Xin
2016-02-09
Nutritional strategies can decrease saturated fatty acids (SFAs) and increase health beneficial fatty acids (FAs) in bovine milk. The pathways/genes involved in these processes are not properly defined. Next-generation RNA-sequencing was used to investigate the bovine mammary gland transcriptome following supplemental feeding with 5% linseed oil (LSO) or 5% safflower oil (SFO). Holstein cows in mid-lactation were fed a control diet for 28 days (control period) followed by supplementation with 5% LSO (12 cows) or 5% SFO (12 cows) for 28 days (treatment period). Milk and mammary gland biopsies were sampled on days-14 (control period), +7 and +28 (treatment period). Milk was used to measure fat(FP)/protein(PP) percentages and individual FAs while RNA was subjected to sequencing. Milk FP was decreased by 30.38% (LSO) or 32.42% (SFO) while PP was unaffected (LSO) or increased (SFO). Several beneficial FAs were increased by LSO (C18:1n11t, CLA:10t12c, CLA:9c11t, C20:3n3, C20:5n3, C22:5n3) and SFO (C18:1n11t, CLA:10t12c, C20:1c11, C20:2, C20:3n3) while several SFAs (C4:0, C6:0, C8:0, C14:0, C16:0, C17:0, C24:0) were decreased by both treatments (P < 0.05). 1006 (460 up- and 546 down-regulated) and 199 (127 up- and 72 down-regulated) genes were significantly differentially regulated (DE) by LSO and SFO, respectively. Top regulated genes (≥ 2 fold change) by both treatments (FBP2, UCP2, TIEG2, ANGPTL4, ALDH1L2) are potential candidate genes for milk fat traits. Involvement of SCP2, PDK4, NQO1, F2RL1, DBI, CPT1A, CNTFR, CALB1, ACADVL, SPTLC3, PIK3CG, PIGZ, ADORA2B, TRIB3, HPGD, IGFBP2 and TXN in FA/lipid metabolism in dairy cows is being reported for the first time. Functional analysis indicated similar and different top enriched functions for DE genes. DE genes were predicted to significantly decrease synthesis of FA/lipid by both treatments and FA metabolism by LSO. Top canonical pathways associated with DE genes of both treatments might be involved in lipid
Hypolipidemic effect of dietary pea proteins: Impact on genes regulating hepatic lipid metabolism.
Rigamonti, Elena; Parolini, Cinzia; Marchesi, Marta; Diani, Erika; Brambilla, Stefano; Sirtori, Cesare R; Chiesa, Giulia
2010-05-01
Controversial data on the lipid-lowering effect of dietary pea proteins have been provided and the mechanisms behind this effect are not completely understood. The aim of the study was to evaluate a possible hypolipidemic activity of a pea protein isolate and to determine whether pea proteins could affect the hepatic lipid metabolism through regulation of genes involved in cholesterol and fatty acid homeostasis. Rats were fed Nath's hypercholesterolemic diets for 28 days, the protein sources being casein or a pea protein isolate from Pisum sativum. After 14 and 28 days of dietary treatment, rats fed pea proteins had markedly lower plasma cholesterol and triglyceride levels than rats fed casein (p<0.05). Pea protein-fed rats displayed higher hepatic mRNA levels of LDL receptor versus those fed casein (p<0.05). Hepatic mRNA concentration of genes involved in fatty acids synthesis, such as fatty acid synthase and stearoyl-CoA desaturase, was lower in pea protein-fed rats than in rats fed casein (p<0.05). In conclusion, the present study demonstrates a marked cholesterol and triglyceride-lowering activity of pea proteins in rats. Moreover, pea proteins appear to affect cellular lipid homeostasis by upregulating genes involved in hepatic cholesterol uptake and by downregulating fatty acid synthesis genes.
Craig, Sandra
2011-01-01
Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855
Mihálik, Daniel; Klčová, Lenka; Ondreičková, Katarína; Hudcovicová, Martina; Gubišová, Marcela; Klempová, Tatiana; Čertík, Milan; Pauk, János; Kraic, Ján
2015-01-01
The artificial gene D6D encoding the enzyme ∆6desaturase was designed and synthesized using the sequence of the same gene from the fungus Thamnidium elegans. The original start codon was replaced by the signal sequence derived from the wheat gene for high-molecular-weight glutenin subunit and the codon usage was completely changed for optimal expression in wheat. Synthesized artificial D6D gene was delivered into plants of the spring wheat line CY-45 and the gene itself, as well as transcribed D6D mRNA were confirmed in plants of T0 and T1 generations. The desired product of the wheat genetic modification by artificial D6D gene was the γ-linolenic acid. Its presence was confirmed in mature grains of transgenic wheat plants in the amount 0.04%–0.32% (v/v) of the total amount of fatty acids. Both newly synthesized γ-linolenic acid and stearidonic acid have been detected also in leaves, stems, roots, awns, paleas, rachillas, and immature grains of the T1 generation as well as in immature and mature grains of the T2 generation. Contents of γ-linolenic acid and stearidonic acid varied in range 0%–1.40% (v/v) and 0%–1.53% (v/v) from the total amount of fatty acids, respectively. This approach has opened the pathway of desaturation of fatty acids and production of essential polyunsaturated fatty acids in wheat. PMID:26694368
RETINOIC ACID SYNTHESIS AND DEGRADATION
Kedishvili, Natalia Y.
2017-01-01
Retinoic acid was identified as the biologically active form of vitamin A almost 70 years ago, but the exact enzymes and control mechanisms that regulate its biosynthesis and degradation are yet to be fully defined. The currently accepted model postulates that RA is produced in two sequential oxidative steps: first, retinol is oxidized reversibly to retinaldehyde, and then retinaldehyde is oxidized irreversibly to RA, which is inactivated by conversion to hydroxylated derivatives. This chapter describes the history, development and recent advances in our understanding of the enzymatic pathways and mechanisms that control the rate of RA production and degradation. Gene knockout studies provided strong evidence that the members of the short chain dehydrogenase reductase superfamily of proteins play indispensable roles in retinoic acid biosynthesis during development. Furthermore, recent finding that two of these proteins regulate the rate of retinoic acid biosynthesis by mutually activating each other provided a novel insight into the mechanism of this regulation. Despite significant progress made since the middle of the 20th century many unanswered questions still remain, and there is much to be learned, especially about trafficking of the hydrophobic retinoid substrates between membrane bound and cytosolic enzymes and the roles of the retinoid binding proteins. PMID:27830503
Hansen, H O; Grunnet, I; Knudsen, J
1984-01-01
Goat mammary-gland microsomal fraction by itself induces synthesis of medium-chain-length fatty acids by goat mammary fatty acid synthetase and incorporates short- and medium-chain fatty acids into triacylglycerol. Addition of ATP in the absence or presence of Mg2+ totally inhibits triacylglycerol synthesis from short- and medium-chain fatty acids, and severely inhibits synthesis de novo of medium-chain fatty acids. The inhibition by ATP of fatty acid synthesis and triacylglycerol synthesis de novo can be relieved by glycerol 3-phosphate. The effect of ATP could not be mimicked by the non-hydrolysable ATP analogue, adenosine 5'-[beta,gamma-methylene]triphosphate and could not be shown to be caused by inhibition of the diacylglycerol acyltransferase by a phosphorylation reaction. Possible explanations for the mechanism of the inhibition by ATP are discussed, and a hypothetical model for its action is outlined. PMID:6547605
The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.
ERIC Educational Resources Information Center
Simmonds, Richard J.
1987-01-01
Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)
Genome-wide identification of Saccharomyces cerevisiae genes required for tolerance to acetic acid.
Mira, Nuno P; Palma, Margarida; Guerreiro, Joana F; Sá-Correia, Isabel
2010-10-25
Acetic acid is a byproduct of Saccharomyces cerevisiae alcoholic fermentation. Together with high concentrations of ethanol and other toxic metabolites, acetic acid may contribute to fermentation arrest and reduced ethanol productivity. This weak acid is also a present in lignocellulosic hydrolysates, a highly interesting non-feedstock substrate in industrial biotechnology. Therefore, the better understanding of the molecular mechanisms underlying S. cerevisiae tolerance to acetic acid is essential for the rational selection of optimal fermentation conditions and the engineering of more robust industrial strains to be used in processes in which yeast is explored as cell factory. The yeast genes conferring protection against acetic acid were identified in this study at a genome-wide scale, based on the screening of the EUROSCARF haploid mutant collection for susceptibility phenotypes to this weak acid (concentrations in the range 70-110 mM, at pH 4.5). Approximately 650 determinants of tolerance to acetic acid were identified. Clustering of these acetic acid-resistance genes based on their biological function indicated an enrichment of genes involved in transcription, internal pH homeostasis, carbohydrate metabolism, cell wall assembly, biogenesis of mitochondria, ribosome and vacuole, and in the sensing, signalling and uptake of various nutrients in particular iron, potassium, glucose and amino acids. A correlation between increased resistance to acetic acid and the level of potassium in the growth medium was found. The activation of the Snf1p signalling pathway, involved in yeast response to glucose starvation, is demonstrated to occur in response to acetic acid stress but no evidence was obtained supporting the acetic acid-induced inhibition of glucose uptake. Approximately 490 of the 650 determinants of tolerance to acetic acid identified in this work are implicated, for the first time, in tolerance to this weak acid. These are novel candidate genes for genetic
An Arabidopsis Gene Regulatory Network for Secondary Cell Wall Synthesis
Taylor-Teeples, M; Lin, L; de Lucas, M; Turco, G; Toal, TW; Gaudinier, A; Young, NF; Trabucco, GM; Veling, MT; Lamothe, R; Handakumbura, PP; Xiong, G; Wang, C; Corwin, J; Tsoukalas, A; Zhang, L; Ware, D; Pauly, M; Kliebenstein, DJ; Dehesh, K; Tagkopoulos, I; Breton, G; Pruneda-Paz, JL; Ahnert, SE; Kay, SA; Hazen, SP; Brady, SM
2014-01-01
Summary The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. Here, we present a protein-DNA network between Arabidopsis transcription factors and secondary cell wall metabolic genes with gene expression regulated by a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. These interactions will serve as a foundation for understanding the regulation of a complex, integral plant component. PMID:25533953
An Arabidopsis gene regulatory network for secondary cell wall synthesis
Taylor-Teeples, M.; Lin, L.; de Lucas, M.; ...
2014-12-24
The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. In this paper, we present a protein–DNA network between Arabidopsis thaliana transcription factors and secondary cell wall metabolic genes with gene expression regulated bymore » a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. Finally, these interactions will serve as a foundation for understanding the regulation of a complex, integral plant component.« less
Stevenson, G; Andrianopoulos, K; Hobbs, M; Reeves, P R
1996-01-01
Colanic acid (CA) is an extracellular polysaccharide produced by most Escherichia coli strains as well as by other species of the family Enterobacteriaceae. We have determined the sequence of a 23-kb segment of the E. coli K-12 chromosome which includes the cluster of genes necessary for production of CA. The CA cluster comprises 19 genes. Two other sequenced genes (orf1.3 and galF), which are situated between the CA cluster and the O-antigen cluster, were shown to be unnecessary for CA production. The CA cluster includes genes for synthesis of GDP-L-fucose, one of the precursors of CA, and the gene for one of the enzymes in this pathway (GDP-D-mannose 4,6-dehydratase) was identified by biochemical assay. Six of the inferred proteins show sequence similarity to glycosyl transferases, and two others have sequence similarity to acetyl transferases. Another gene (wzx) is predicted to encode a protein with multiple transmembrane segments and may function in export of the CA repeat unit from the cytoplasm into the periplasm in a process analogous to O-unit export. The first three genes of the cluster are predicted to encode an outer membrane lipoprotein, a phosphatase, and an inner membrane protein with an ATP-binding domain. Since homologs of these genes are found in other extracellular polysaccharide gene clusters, they may have a common function, such as export of polysaccharide from the cell. PMID:8759852
Synthesis and antimycobacterial activity of isoniazid derivatives from renewable fatty acids.
Rodrigues, Marieli O; Cantos, Jéssica B; D'Oca, Caroline R Montes; Soares, Karina L; Coelho, Tatiane S; Piovesan, Luciana A; Russowsky, Dennis; da Silva, Pedro A; D'Oca, Marcelo G Montes
2013-11-15
This work describes the synthesis of a series of fatty acid hydrazide derivatives of isoniazid (INH). The compounds were tested against Mycobacterium tuberculosis H37Rv (ATCC 27294) as well as INH-resistant (ATCC 35822 and 1896 HF) and rifampicin-resistant (ATCC 35338) M. tuberculosis strains. The fatty acid derivatives of INH showed high antimycobacterial potency against the studied strains, which is desirable for a pharmaceutical compound, suggesting that the increased lipophilicity of isoniazid plays an important role in its antimycobacterial activity. Copyright © 2013 Elsevier Ltd. All rights reserved.
l-Tartaric acid synthesis from vitamin C in higher plants
DeBolt, Seth; Cook, Douglas R.; Ford, Christopher M.
2006-01-01
The biosynthetic pathway of l-tartaric acid, the form most commonly encountered in nature, and its catabolic ties to vitamin C, remain a challenge to plant scientists. Vitamin C and l-tartaric acid are plant-derived metabolites with intrinsic human value. In contrast to most fruits during development, grapes accumulate l-tartaric acid, which remains within the berry throughout ripening. Berry taste and the organoleptic properties and aging potential of wines are intimately linked to levels of l-tartaric acid present in the fruit, and those added during vinification. Elucidation of the reactions relating l-tartaric acid to vitamin C catabolism in the Vitaceae showed that they proceed via the oxidation of l-idonic acid, the proposed rate-limiting step in the pathway. Here we report the use of transcript and metabolite profiling to identify candidate cDNAs from genes expressed at developmental times and in tissues appropriate for l-tartaric acid biosynthesis in grape berries. Enzymological analyses of one candidate confirmed its activity in the proposed rate-limiting step of the direct pathway from vitamin C to tartaric acid in higher plants. Surveying organic acid content in Vitis and related genera, we have identified a non-tartrate-forming species in which this gene is deleted. This species accumulates in excess of three times the levels of vitamin C than comparably ripe berries of tartrate-accumulating species, suggesting that modulation of tartaric acid biosynthesis may provide a rational basis for the production of grapes rich in vitamin C. PMID:16567629
Shirata, Noriko; Ikeda, Motoko; Kobayashi, Michihiro
2010-03-15
We previously demonstrated that Bombyx mori nucleopolyhedrovirus (BmNPV) multiplication is restricted in permissive BmN-4 cells upon coinfection with Hyphantria cunea NPV (HycuNPV). Here, we show that HycuNPV-encoded hycu-ep32 gene is responsible for the restricted BmNPV multiplication in HycuNPV-coinfected BmN-4 cells. The only homologue for hycu-ep32 is in Orgyia pseudotsugata NPV. hycu-ep32 could encode a polypeptide of 312 amino acids, and it contains no characteristic domains or motifs to suggest its possible functions. hycu-ep32 is an early gene, and Hycu-EP32 expression reaches a maximum by 6 h postinfection. hycu-ep32-defective HycuNPV, vHycuDeltaep32, was generated, indicating that hycu-ep32 is nonessential in permissive SpIm cells. In BmN-4 cells, HycuNPV infection resulted in a severe global protein synthesis shutdown, while vHycuDeltaep32 did not cause any specific protein synthesis shutdown. These results indicate that the restriction of BmNPV multiplication by HycuNPV is caused by a global protein synthesis shutdown induced by hycu-ep32 upon coinfection with HycuNPV. Copyright 2009 Elsevier Inc. All rights reserved.
Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K
2015-10-10
Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. Copyright © 2015 Elsevier B.V. All rights reserved.
Li, C; Sun, D; Zhang, S; Liu, L; Alim, M A; Zhang, Q
2016-08-01
GWAS and demonstrate that variants in the SCD gene are significantly associated with milk fatty acid composition in dairy cattle, which provides clear evidence for an increased understanding of milk fatty acid synthesis and enhances opportunities to improve milk-fat composition in dairy cattle. © 2016 Stichting International Foundation for Animal Genetics.
Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes
Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A
2016-01-01
Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357
Parsons, Joshua B.; Frank, Matthew W.; Subramanian, Chitra; Saenkham, Panatda; Rock, Charles O.
2011-01-01
The rationale for the pursuit of bacterial type 2 fatty acid synthesis (FASII) as a target for antibacterial drug discovery in Gram-positive organisms is being debated vigorously based on their ability to incorporate extracellular fatty acids. The regulation of FASII by extracellular fatty acids was examined in Staphylococcus aureus and Streptococcus pneumoniae, representing two important groups of pathogens. Both bacteria use the same enzymatic tool kit for the conversion of extracellular fatty acids to acyl-acyl carrier protein, elongation, and incorporation into phospholipids. Exogenous fatty acids completely replace the endogenous fatty acids in S. pneumoniae but support only 50% of phospholipid synthesis in S. aureus. Fatty acids overcame FASII inhibition in S. pneumoniae but not in S. aureus. Extracellular fatty acids strongly suppress malonyl-CoA levels in S. pneumoniae but not in S. aureus, showing a feedback regulatory system in S. pneumoniae that is absent in S. aureus. Fatty acids overcame either a biochemical or a genetic block at acetyl-CoA carboxylase (ACC) in S. aureus, confirming that regulation at the ACC step is the key difference between these two species. Bacteria that possess a stringent biochemical feedback inhibition of ACC and malonyl-CoA formation triggered by environmental fatty acids are able to circumvent FASII inhibition. However, if exogenous fatty acids do not suppress malonyl-CoA formation, FASII inhibitors remain effective in the presence of fatty acid supplements. PMID:21876172
Xiong, Ai-Sheng; Yao, Quan-Hong; Peng, Ri-He; Li, Xian; Fan, Hui-Qin; Cheng, Zong-Ming; Li, Yi
2004-07-07
Chemical synthesis of DNA sequences provides a powerful tool for modifying genes and for studying gene function, structure and expression. Here, we report a simple, high-fidelity and cost-effective PCR-based two-step DNA synthesis (PTDS) method for synthesis of long segments of DNA. The method involves two steps. (i) Synthesis of individual fragments of the DNA of interest: ten to twelve 60mer oligonucleotides with 20 bp overlap are mixed and a PCR reaction is carried out with high-fidelity DNA polymerase Pfu to produce DNA fragments that are approximately 500 bp in length. (ii) Synthesis of the entire sequence of the DNA of interest: five to ten PCR products from the first step are combined and used as the template for a second PCR reaction using high-fidelity DNA polymerase pyrobest, with the two outermost oligonucleotides as primers. Compared with the previously published methods, the PTDS method is rapid (5-7 days) and suitable for synthesizing long segments of DNA (5-6 kb) with high G + C contents, repetitive sequences or complex secondary structures. Thus, the PTDS method provides an alternative tool for synthesizing and assembling long genes with complex structures. Using the newly developed PTDS method, we have successfully obtained several genes of interest with sizes ranging from 1.0 to 5.4 kb.
Efficient synthesis of anacardic acid analogues and their antibacterial activities.
Mamidyala, Sreeman K; Ramu, Soumya; Huang, Johnny X; Robertson, Avril A B; Cooper, Matthew A
2013-03-15
Anacardic acid derivatives exhibit a broad range of biological activities. In this report, an efficient method for the synthesis of anacardic acid derivatives was explored, and a small set of salicylic acid variants synthesised retaining a constant hydrophobic element (a naphthyl tail). The naphthyl side chain was introduced via Wittig reaction and the aldehyde installed using directed ortho-metalation reaction of the substituted o-anisic acids. The failure of ortho-metalation using unprotected carboxylic acid group compelled us to use directed ortho-metalation in which a tertiary amide was used as a strong ortho-directing group. In the initial route, tertiary amide cleavage during final step was challenging, but cleaving the tertiary amide before Wittig reaction was beneficial. The Wittig reaction with protected carboxylic group (methyl ester) resulted in side-products whereas using sodium salt resulted in higher yields. The novel compounds were screened for antibacterial activity and cytotoxicity. Although substitution on the salicylic head group enhanced antibacterial activities they also enhanced cytotoxicity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Synthesis and Anti-microbial Activity of Novel Phosphatidylethanolamine-N-amino Acid Derivatives.
Vijeetha, Tadla; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Surya Koppeswara Rao, Bhamidipati Venkata; Prasad, Rachapudi Badari Narayana; Kumar, Koochana Pranay; Surya Narayana Murthy, Upadyaula
2015-01-01
The study involved synthesis of five novel amino acid derivatives of phosphatidylethanolamine isolated from egg yolk lecithin employing a three step procedure i) N-protection of L-amino acids with BOC anhydride in alkaline medium ii) condensation of - CO2H group of N-protected amino acid with free -NH2 of PE by a peptide linkage and iii) deprotection of N-protected group of amino acids to obtain phosphatidylethanolamine-N-amino acid derivatives in 60-75% yield. The five L-amino acids used were L glycine, L-valine, L-leucine, L-isoleucine and L-phenylalanine. The amino acid derivatives were screened for anti-baterial activity against B. subtilis, S. aureus, P. aeroginosa and E. coli taking Streptomycin as reference compound and anti-fungal activity against C. albicans, S. cervisiae, A. niger taking AmphotericinB as reference compound. All the amino acid derivatives exhibited extraordinary anti-bacterial activities about 3 folds or comparable to Streptomycin and moderate or no anti-fungal activity against Amphotericin-B.
Liu, Guoyu; Wu, Yufang; Xu, Mengjun; Gao, Tian; Wang, Pengfei; Wang, Lina; Guo, Tiancai; Kang, Guozhang
2016-09-23
The function of a wheat starch regulator 1 (TaRSR1) in regulating the synthesis of grain storage starch was determined using the barley stripe mosaic virus-virus induced gene-silencing (BSMV-VIGS) method in field experiments. Chlorotic stripes appeared on the wheat spikes infected with barley stripe mosaic virus-virus induced gene-silencing- wheat starch regulator 1 (BSMV-VIGS-TaRSR1) at 15 days after anthesis, at which time the transcription levels of the TaRSR1 gene significantly decreased. Quantitative real-time PCR was also used to measure the transcription levels of 26 starch synthesis-related enzyme genes in the grains of BSMV-VIGS-TaRSR1-silenced wheat plants at 20, 27, and 31 days after anthesis. The results showed that the transcription levels of some starch synthesis-related enzyme genes were markedly induced at different sampling time points: TaSSI, TaSSIV, TaBEIII, TaISA1, TaISA3, TaPHOL, and TaDPE1 genes were induced at each of the three sampling time points and TaAGPS1-b, TaAGPL1, TaAGPL2, TaSSIIb, TaSSIIc, TaSSIIIb, TaBEI, TaBEIIa, TaBEIIb, TaISA2, TaPHOH, and TaDPE2 genes were induced at one sampling time point. Moreover, both the grain starch contents, one thousand kernel weights, grain length and width of BSMV-VIGS-TaRSR1-infected wheat plants significantly increased. These results suggest that TaRSR1 acts as a negative regulator and plays an important role in starch synthesis in wheat grains by temporally regulating the expression of specific starch synthesis-related enzyme genes.
Liu, Guoyu; Wu, Yufang; Xu, Mengjun; Gao, Tian; Wang, Pengfei; Wang, Lina; Guo, Tiancai; Kang, Guozhang
2016-01-01
The function of a wheat starch regulator 1 (TaRSR1) in regulating the synthesis of grain storage starch was determined using the barley stripe mosaic virus—virus induced gene-silencing (BSMV-VIGS) method in field experiments. Chlorotic stripes appeared on the wheat spikes infected with barley stripe mosaic virus-virus induced gene-silencing- wheat starch regulator 1 (BSMV-VIGS-TaRSR1) at 15 days after anthesis, at which time the transcription levels of the TaRSR1 gene significantly decreased. Quantitative real-time PCR was also used to measure the transcription levels of 26 starch synthesis-related enzyme genes in the grains of BSMV-VIGS-TaRSR1-silenced wheat plants at 20, 27, and 31 days after anthesis. The results showed that the transcription levels of some starch synthesis-related enzyme genes were markedly induced at different sampling time points: TaSSI, TaSSIV, TaBEIII, TaISA1, TaISA3, TaPHOL, and TaDPE1 genes were induced at each of the three sampling time points and TaAGPS1-b, TaAGPL1, TaAGPL2, TaSSIIb, TaSSIIc, TaSSIIIb, TaBEI, TaBEIIa, TaBEIIb, TaISA2, TaPHOH, and TaDPE2 genes were induced at one sampling time point. Moreover, both the grain starch contents, one thousand kernel weights, grain length and width of BSMV-VIGS-TaRSR1-infected wheat plants significantly increased. These results suggest that TaRSR1 acts as a negative regulator and plays an important role in starch synthesis in wheat grains by temporally regulating the expression of specific starch synthesis-related enzyme genes. PMID:27669224
Huang, Ruimin; Huang, Youjun; Sun, Zhichao; Huang, Jianqin; Wang, Zhengjia
2017-05-24
Pecan (Carya illinoinensis) is an important woody tree species because of the high content of healthy oil in its nut. Thus far, the pathways and key genes related to oil biosynthesis in developing pecan seeds remain largely unclear. Our analyses revealed that mature pecan embryo accumulated more than 80% oil, in which 90% was unsaturated fatty acids with abundant oleic acid. RNA sequencing generated 84,643 unigenes in three cDNA libraries prepared from pecan embryos collected at 105, 120, and 165 days after flowering (DAF). We identified 153 unigenes associated with lipid biosynthesis, including 107 unigenes for fatty acid biosynthesis, 34 for triacylglycerol biosynthesis, 7 for oil bodies, and 5 for transcription factors involved in oil synthesis. The genes associated with fatty acid synthesis were the most abundantly expressed genes at 120 DAF. Additionally, the biosynthesis of oil began to increase while crude fat contents increased from 16.61 to 74.45% (165 DAF). We identified four SAD, two FAD2, one FAD6, two FAD7, and two FAD8 unigenes responsible for unsaturated fatty acid biosynthesis. However, FAD3 homologues were not detected. Consequently, we inferred that the linolenic acid in developing pecan embryos is generated by FAD7 and FAD8 in plastids rather than FAD3 in endoplasmic reticula. During pecan embryo development, different unigenes are expressed for plastidial and cytosolic glycolysis. Plastidial glycolysis is more relevant to lipid synthesis than cytosolic glycolysis. The 18 most important genes associated with lipid biosynthesis were evaluated in five stages of developing embryos using quantitative PCR (qPCR). The qPCR data were well consistent with their expression in transcriptomic analyses. Our data would be important for the metabolic engineering of pecans to increase oil contents and modify fatty acid composition.
Modak, Sohan P.; Setlow, Jane K.
1969-01-01
Synthesis of deoxyribonucleic acid (DNA) has been measured as a function of ultraviolet (UV) radiation dose in wild-type and seven UV-sensitive strains of Haemophilus influenzae. At the UV doses used, all strains were able to resume DNA synthesis, even those which are unable to excise pyrimidine dimers from their DNA. These excisionless strains showed longer UV-induced delays in DNA synthesis than all but one of the other strains. The longest delay was shown by DB117, a strain which can excise dimers but which is recombination deficient and unable to rejoin X ray-induced single-strand breaks. All strains showed a progressive decrease in sensitivity as they approached the stationary phase. PMID:5305934
Fu, Jilagamazhi; Sharma, Parveen; Spicer, Vic; Krokhin, Oleg V.; Zhang, Xiangli; Fristensky, Brian; Cicek, Nazim; Sparling, Richard; Levin, David. B.
2015-01-01
Transcriptomes and proteomes of Pseudomonas putida LS46 cultured with biodiesel-derived waste glycerol or waste free fatty acids, as sole carbon sources, were compared under conditions that were either permissive or non-permissive for synthesis of medium chain length polyhydroxyalkanoates (mcl-PHA). The objectives of this study were to elucidate mechanisms that influence activation of biopolymer synthesis, intra-cellular accumulation, and monomer composition, and determine if these were physiologically specific to the carbon sources used for growth of P. putida LS46. Active mcl-PHA synthesis by P. putida LS46 was associated with high expression levels of key mcl-PHA biosynthesis genes and/or gene products including monomer-supplying proteins, PHA synthases, and granule-associated proteins. ‘Omics data suggested that expression of these genes were regulated by different genetic mechanisms in P. putida LS46 cells in different physiological states, when cultured on the two waste carbon sources. Optimal polymer production by P. putida LS46 was primarily limited by less efficient glycerol metabolism during mcl-PHA synthesis on waste glycerol. Mapping the ‘Omics data to the mcl-PHA biosynthetic pathway revealed significant variations in gene expression, primarily involved in: 1) glycerol transportation; 2) enzymatic reactions that recycle reducing equivalents and produce key mcl-PHA biosynthesis pathway intermediates (e.g. NADH/NADPH, acetyl-CoA). Active synthesis of mcl-PHAs was observed during exponential phase in cultures with waste free fatty acids, and was associated with the fatty acid beta-oxidation pathway. A putative Thioesterase in the beta-oxidation pathway that may regulate the level of fatty acid beta-oxidation intermediates, and thus carbon flux to mcl-PHA biosynthesis, was highly up-regulated. Finally, the data suggested that differences in expression of selected fatty acid metabolism and mcl-PHA monomer-supplying enzymes may play a role in determining
The use of solid supports to generate nucleic acid carriers.
Unciti-Broceta, Asier; Díaz-Mochón, Juan José; Sánchez-Martín, Rosario M; Bradley, Mark
2012-07-17
Nucleic acids are the foundation stone of all cellular processes. Consequently, the use of DNA or RNA to treat genetic and acquired disorders (so called gene therapy) offers enormous potential benefits. The restitution of defective genes or the suppression of malignant genes could target a range of diseases, including cancers, inherited diseases (cystic fibrosis, muscular dystrophy, etc.), and viral infections. However, this strategy has a major barrier: the size and charge of nucleic acids largely restricts their transit into eukaryotic cells. Potential strategies to solve this problem include the use of a variety of natural and synthetic nucleic acid carriers. Driven by the aim and ambition of translating this promising therapeutic approach into the clinic, researchers have been actively developing advanced delivery systems for nucleic acids for more than 20 years. A decade ago we began our investigations of solid-phase techniques to construct families of novel nucleic acid carriers for transfection. We envisaged that the solid-phase synthesis of polycationic dendrimers and derivatized polyamimes would offer distinct advantages over solution phase techniques. Notably in solid phase synthesis we could take advantage of mass action and streamlined purification procedures, while simplifying the handling of compounds with high polarities and plurality of functional groups. Parallel synthesis methods would also allow rapid access to libraries of compounds with improved purities and yields over comparable solution methodologies and facilitate the development of structure activity relationships. We also twisted the concept of the solid-phase support on its head: we devised miniaturized solid supports that provided an innovative cell delivery vehicle in their own right, carrying covalently conjugated cargos (biomolecules) into cells. In this Account, we summarize the main outcomes of this series of chemically related projects.
Ledinko, Nada; Fong, Caroline K. Y.
1969-01-01
Infection of human embryonic kidney (HEK) cell cultures with adenovirus types 2 or 12 resulted in an initial drop in the rate of incorporation of 3H-thymidine into deoxyribonucleic acid (DNA) during the early latent period of virus growth, followed by a marked rise in label uptake. It was shown by cesium chloride isopycnic centrifugation that, after adenovirus 2 infection, there was a decrease in the rate of incorporation of thymidine into cellular DNA. Moreover, DNA-DNA hybridization experiments revealed that, by 28 to 32 hr after infection with either adenovirus 2 or 12, the amount of isolated pulse-labeled DNA capable of hybridizing with HEK cell DNA was reduced by approximately 60 to 70%. Autoradiographic measurements showed that the inhibition of cellular DNA synthesis was due to a decrease in the ability of an infected cell to synthesize DNA. The adenovirus-induced inhibition of host cell DNA synthesis was not due to degradation of cellular DNA. 3H-thymidine incorporated into cellular DNA at the time of infection remained acid-precipitable, and labeled material was not incorporated into viral DNA. Furthermore, when zone sedimentation through neutral or alkaline sucrose density gradients was employed, no detectable change was observed in the sedimentation rate of this cellular DNA at various times after infection with adenovirus 2 or 12. In addition, there was no increase in deoxyribonuclease activity in cells infected with either virus. Cultures infected for 38 hr with adenovirus 2 or 12 incorporated three to four times as much 3H-uridine into ribonucleic acid (RNA) as did non-infected cultures. Furthermore, the net RNA synthesized by infected cultures substantially exceeded that of control cultures. The activity of thymidine kinase was induced, but there was no stimulation of uridine kinase. PMID:5806981
CO- and HCl-free synthesis of acid chlorides from unsaturated hydrocarbons via shuttle catalysis
NASA Astrophysics Data System (ADS)
Fang, Xianjie; Cacherat, Bastien; Morandi, Bill
2017-11-01
The synthesis of carboxylic acid derivatives from unsaturated hydrocarbons is an important process for the preparation of polymers, pharmaceuticals, cosmetics and agrochemicals. Despite its industrial relevance, the traditional Reppe-type carbonylation reaction using pressurized CO is of limited applicability to laboratory-scale synthesis because of: (1) the safety hazards associated with the use of CO, (2) the need for special equipment to handle pressurized gas, (3) the low reactivity of several relevant nucleophiles and (4) the necessity to employ different, often tailor-made, catalytic systems for each nucleophile. Herein we demonstrate that a shuttle-catalysis approach enables a CO- and HCl-free transfer process between an inexpensive reagent, butyryl chloride, and a wide range of unsaturated substrates to access the corresponding acid chlorides in good yields. This new transformation provides access to a broad range of carbonyl-containing products through the in situ transformation of the reactive acid chloride intermediate. In a broader context, this work demonstrates that isodesmic shuttle-catalysis reactions can unlock elusive catalytic reactions.
A Dual-Promoter Gene Orchestrates the Sucrose-Coordinated Synthesis of Starch and Fructan in Barley
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jin, Yunkai; Fei, Mingliang; Rosenquist, Sara
Starch and fructan are two important carbohydrates in many flowering plants and in human diets. Understanding how plants allocate photosynthates and how they prioritize synthesis of different carbohydrates during development is essential in efforts to improve cereals for increased stress tolerance and for desirable carbohydrate compositions in food and feed. We report the coordinated synthesis of starch and fructan in barley, orchestrated by two functionally opposing transcription factors encoded from two alternative promoters, one intronic/exonic, harbored on a single gene. . This dual-transcription factor system employs an autoregulatory, antagonsitic mechanism in sensing sucrose at one promoter, potentially via sucrose/glucose/fructose/trehalose 6-phosphatemore » signaling, and conduct a coordinated synthesis of starch and fructan synthesis by competitive transcription factor binding to the second promoter The finding of an intron/exon-spanning promoter in a hosting gene, resulting in proteins with distinct functions, contributes to our appreciation of the complexity of the plant genome As a case in point for the physiological role of the antagonistic transcription factor system, we have demonstrated that it can be exploited in breeding barley with tailored amounts of fructan for production of specialty food ingredients.« less
Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng
2013-01-01
There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979
Peng, Tangjian; Ma, Liyuan; Feng, Xue; Tao, Jiemeng; Nan, Meihua; Liu, Yuandong; Li, Jiaokun; Shen, Li; Wu, Xueling; Yu, Runlan; Liu, Xueduan; Qiu, Guanzhou; Zeng, Weimin
2017-01-01
Acidithiobacillus ferrivorans is an acidophile that often occurs in low temperature acid mine drainage, e.g., that located at high altitude. Being able to inhabit the extreme environment, the bacterium must possess strategies to copy with the survival stress. Nonetheless, information on the strategies is in demand. Here, genomic and transcriptomic assays were performed to illuminate the adaptation mechanisms of an A. ferrivorans strain YL15, to the alpine acid mine drainage environment in Yulong copper mine in southwest China. Genomic analysis revealed that strain has a gene repertoire for metal-resistance, e.g., genes coding for the mer operon and a variety of transporters/efflux proteins, and for low pH adaptation, such as genes for hopanoid-synthesis and the sodium:proton antiporter. Genes for various DNA repair enzymes and synthesis of UV-absorbing mycosporine-like amino acids precursor indicated hypothetical UV radiation-resistance mechanisms in strain YL15. In addition, it has two types of the acquired immune system-type III-B and type I-F CRISPR/Cas modules against invasion of foreign genetic elements. RNA-seq based analysis uncovered that strain YL15 uses a set of mechanisms to adapt to low temperature. Genes involved in protein synthesis, transmembrane transport, energy metabolism and chemotaxis showed increased levels of RNA transcripts. Furthermore, a bacterioferritin Dps gene had higher RNA transcript counts at 6°C, possibly implicated in protecting DNA against oxidative stress at low temperature. The study represents the first to comprehensively unveil the adaptation mechanisms of an acidophilic bacterium to the acid mine drainage in alpine regions.
Ma, Liyuan; Feng, Xue; Tao, Jiemeng; Nan, Meihua; Liu, Yuandong; Li, Jiaokun; Shen, Li; Wu, Xueling; Yu, Runlan; Liu, Xueduan; Qiu, Guanzhou; Zeng, Weimin
2017-01-01
Acidithiobacillus ferrivorans is an acidophile that often occurs in low temperature acid mine drainage, e.g., that located at high altitude. Being able to inhabit the extreme environment, the bacterium must possess strategies to copy with the survival stress. Nonetheless, information on the strategies is in demand. Here, genomic and transcriptomic assays were performed to illuminate the adaptation mechanisms of an A. ferrivorans strain YL15, to the alpine acid mine drainage environment in Yulong copper mine in southwest China. Genomic analysis revealed that strain has a gene repertoire for metal-resistance, e.g., genes coding for the mer operon and a variety of transporters/efflux proteins, and for low pH adaptation, such as genes for hopanoid-synthesis and the sodium:proton antiporter. Genes for various DNA repair enzymes and synthesis of UV-absorbing mycosporine-like amino acids precursor indicated hypothetical UV radiation—resistance mechanisms in strain YL15. In addition, it has two types of the acquired immune system–type III-B and type I-F CRISPR/Cas modules against invasion of foreign genetic elements. RNA-seq based analysis uncovered that strain YL15 uses a set of mechanisms to adapt to low temperature. Genes involved in protein synthesis, transmembrane transport, energy metabolism and chemotaxis showed increased levels of RNA transcripts. Furthermore, a bacterioferritin Dps gene had higher RNA transcript counts at 6°C, possibly implicated in protecting DNA against oxidative stress at low temperature. The study represents the first to comprehensively unveil the adaptation mechanisms of an acidophilic bacterium to the acid mine drainage in alpine regions. PMID:28542527
Sundram, Kalyana; French, Margaret A; Clandinin, M Thomas
2003-08-01
Partial hydrogenation of oil results in fats containing unusual isomeric fatty acids characterized by cis and trans configurations. Hydrogenated fats containing trans fatty acids increase plasma total cholesterol (TC) and LDL-cholesterol while depressing HDL-cholesterol levels. Identifying the content of trans fatty acids by food labeling is overshadowed by a reluctance of health authorities to label saturates and trans fatty acids separately. Thus, it is pertinent to compare the effects of trans to saturated fatty acids using stable isotope methodology to establish if the mechanism of increase in TC and LDL-cholesterol is due to the increase in the rate of endogenous synthesis of cholesterol. Ten healthy normocholesterolemic female subjects consumed each of two diets containing approximately 30% of energy as fat for a fourweek period. One diet was high in palmitic acid (10.6% of energy) from palm olein and the other diet exchanged 5.6% of energy as partially hydrogenated fat for palmitic acid. This fat blend resulted in monounsaturated fatty acids decreasing by 4.9 % and polyunsaturated fats increasing by 2.7%. The hydrogenated fat diet treatment provided 3.1% of energy as elaidic acid. For each dietary treatment, the fractional synthesis rates for cholesterol were measured using deuterium-labeling procedures and blood samples were obtained for blood lipid and lipoprotein measurements. Subjects exhibited a higher total cholesterol and LDL-cholesterol level when consuming the diet containing trans fatty acids while also depressing the HDL-cholesterol level. Consuming the partially hydrogenated fat diet treatment increased the fractional synthesis rate of free cholesterol. Consumption of hydrogenated fats containing trans fatty acids in comparison to a mixtur e of palmitic and oleic acids increase plasma cholesterol levels apparently by increasing endogenous synthesis of cholesterol.
Ryan, Veronica H.; Primiani, Christopher T.; Rao, Jagadeesh S.; Ahn, Kwangmi; Rapoport, Stanley I.; Blanchard, Helene
2014-01-01
Background The polyunsaturated arachidonic and docosahexaenoic acids (AA and DHA) participate in cell membrane synthesis during neurodevelopment, neuroplasticity, and neurotransmission throughout life. Each is metabolized via coupled enzymatic reactions within separate but interacting metabolic cascades. Hypothesis AA and DHA pathway genes are coordinately expressed and underlie cascade interactions during human brain development and aging. Methods The BrainCloud database for human non-pathological prefrontal cortex gene expression was used to quantify postnatal age changes in mRNA expression of 34 genes involved in AA and DHA metabolism. Results Expression patterns were split into Development (0 to 20 years) and Aging (21 to 78 years) intervals. Expression of genes for cytosolic phospholipases A2 (cPLA2), cyclooxygenases (COX)-1 and -2, and other AA cascade enzymes, correlated closely with age during Development, less so during Aging. Expression of DHA cascade enzymes was less inter-correlated in each period, but often changed in the opposite direction to expression of AA cascade genes. Except for the PLA2G4A (cPLA2 IVA) and PTGS2 (COX-2) genes at 1q25, highly inter-correlated genes were at distant chromosomal loci. Conclusions Coordinated age-related gene expression during the brain Development and Aging intervals likely underlies coupled changes in enzymes of the AA and DHA cascades and largely occur through distant transcriptional regulation. Healthy brain aging does not show upregulation of PLA2G4 or PTGS2 expression, which was found in Alzheimer's disease. PMID:24963629
NASA Astrophysics Data System (ADS)
Rahmayetty, Sukirno, Prasetya, Bambang; Gozan, Misri
2017-02-01
Lactide is the monomer for the polymer polylactic acid (PLA) from lactic acid through polycondensation and depolymerization process. The properties of PLA strongly depend on the quality of the lactide monomer from which it is synthesized. Optical purity of lactide produced in depolymerization process confirmed to be L-lactide. The highest yield of crude lactide was 38.5% at temperature 210 °C with average molecular weight (Mn) of oligomer was 2389. Ring opening polymerization of lactide using Candida rugosa lipase as biocatalyst to PLLA synthesis has been achieved to generate useful biomedical materials free from heavy metal.
One-step synthesis of hydrothermally stable mesoporous aluminosilicates with strong acidity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang Dongjiang; School of Physical and Chemical Sciences, Queensland University of Technology, Brisbane, QLD 4001; Xu Yao
2008-09-15
Using tetraethylorthosilicate (TEOS), polymethylhydrosiloxane (PMHS) and aluminium isopropoxide (AIP) as the reactants, through a one-step nonsurfactant route based on PMHS-TEOS-AIP co-polycondensation, hydrothermally stable mesoporous aluminosilicates with different Si/Al molar ratios were successfully prepared. All samples exclusively showed narrow pore size distribution centered at 3.6 nm. To assess the hydrothermal stability, samples were subjected to 100 deg. C distilled water for 300 h. The boiled mesoporous aluminosilicates have nearly the same N{sub 2} adsorption-desorption isotherms and the same pore size distributions as those newly synthesized ones, indicating excellent hydrothermal stability. The {sup 29}Si MAS NMR spectra confirmed that PMHS and TEOSmore » have jointly condensed and CH{sub 3} groups have been introduced into the materials. The {sup 27}Al MAS NMR spectra indicated that Al atoms have been incorporated in the mesopore frameworks. The NH{sub 3} temperature-programmed desorption showed strong acidity. Due to the existence of large amount of CH{sub 3} groups, the mesoporous aluminosilicates obtained good hydrophobicity. Owing to the relatively large pore and the strong acidity provided by the uniform four-coordinated Al atoms, the excellent catalytic performance for 1,3,5-triisopropylbenzene cracking was acquired easily. The materials may be a profitable complement for the synthesis of solid acid catalysts. - Graphical abstract: Based on the nonsurfactant method, a facile one-step synthesis route has been developed to prepare methyl-modified mesoporous aluminosilicates that possessed hydrothermal stability and strong acidity.« less
Liver X receptor alpha regulates fatty acid synthase expression in chicken.
Demeure, O; Duby, C; Desert, C; Assaf, S; Hazard, D; Guillou, H; Lagarrigue, S
2009-12-01
Liver X receptor alpha (LXRalpha), also referred to as nuclear receptor subfamily 1, group H, member 3 is a member of the nuclear hormone receptor superfamily, and has recently been shown to act as a master transcription factor governing hepatic lipogenesis in mammals. Liver X receptor alpha directly regulates both the expression of other lipogenic transcription factors and the expression of lipogenic enzymes, thereby enhancing hepatic fatty acid synthesis (FASN). In birds, like in humans, fatty acid synthesis primarily occurs in the liver. Whether LXRalpha is involved in hepatic regulation of lipogenic genes remained to be investigated in this species. Here we show that fatty acid synthase and the expression of other lipogenic genes (sterol regulatory element binding protein 1 and steroyl coenzyme A desaturase 1) are induced in chicken hepatoma cells in response to a pharmacological liver X receptor agonist, T0901317. A detailed analysis of the chicken FASN promoter revealed a functional liver X response element. These data define the chicken FASN gene as a direct target of LXRalpha and further expand the role of LXRalpha as a regulator of lipid metabolism in this species.
Sites of abscisic acid synthesis and metabolism in Ricinus communis L
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zeevaart, J.A.D.
1977-05-01
The sites of abscisic acid (ABA) synthesis and metabolism in Ricinus communis L. were investigated by analyzing the levels of ABA and its two metabolites phaseic acid (PA) and dihydrophaseic acid (DPA) in the shoot tips, mature leaves, and phloem sap of stressed and nonstressed plants. Water stress increased the concentration of ABA, PA, and DPA in phloem exudate and also increased the levels of all three compounds in mature leaves and in shoot tips. The latter had a very high DPA content (18.7 ..mu..g/g fresh weight) even in plants not subjected to water stress. When young and mature leavesmore » were excised and allowed to wilt, the level of ABA increased in both, demonstrating that leaves at an early stage of development have the capacity to produce ABA. These results have been interpreted to mean that in mature leaves of nonstressed Ricinus plants, ABA is synthesized and metabolized, and that ABA itself, as well as its metabolites, are translocated in the phloem to the shoot tips (sinks). Since DPA, but not ABA, accumulates in the shoot tips, it follows that ABA is metabolized rapidly in the apical region. To what extent ABA present in young leaves of nonstressed plants is the consequence of synthesis in situ and of import from older leaves remains to be determined.« less
MICROARRAY ANALYSIS OF DICHLOROACETIC ACID-INDUCED CHANGES IN GENE EXPRESSION
MICROARRAY ANALYSIS OF DICHLOROACETIC ACID-INDUCED CHANGES IN GENE EXPRESSION
Dichloroacetic acid (DCA) is a major by-product of water disinfection by chlorination. Several studies have demonstrated the hepatocarcinogenicity of DCA in rodents when administered in dri...
Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P
2001-07-01
Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.
Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids
Cativiela, Carlos; Ordóñez, Mario
2010-01-01
The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486
Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei
2010-02-01
We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.
Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments
NASA Astrophysics Data System (ADS)
Kitadai, Norio
2015-12-01
Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.
Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.
Kitadai, Norio
2015-12-01
Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.
Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids
Matthessen, Roman; Fransaer, Jan; Binnemans, Koen
2014-01-01
Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120
Muto, Masaki; Kubota, Chihiro; Tanaka, Masayoshi; Satoh, Akira; Matsumoto, Mitsufumi; Yoshino, Tomoko; Tanaka, Tsuyoshi
2013-01-01
Oleaginous microalgae are one of the promising resource of nonedible biodiesel fuel (BDF) feed stock alternatives. Now a challenge task is the decrease of the long-chain polyunsaturated fatty acids (PUFAs) content affecting on the BDF oxidative stability by using gene manipulation techniques. However, only the limited knowledge has been available concerning the fatty acid and PUFA synthesis pathways in microalgae. Especially, the function of Δ9 desaturase, which is a key enzyme in PUFA synthesis pathway, has not been determined in diatom. In this study, 4 Δ(9) desaturase genes (fD9desA, fD9desB, fD9desC and fD9desD) from the oleaginous diatom Fistulifera were newly isolated and functionally characterized. The putative Δ(9) acyl-CoA desaturases in the endoplasmic reticulum (ER) showed 3 histidine clusters that are well-conserved motifs in the typical Δ(9) desaturase. Furthermore, the function of these Δ(9) desaturases was confirmed in the Saccharomyces cerevisiae ole1 gene deletion mutant (Δole1). All the putative Δ(9) acyl-CoA desaturases showed Δ(9) desaturation activity for C16∶0 fatty acids; fD9desA and fD9desB also showed desaturation activity for C18∶0 fatty acids. This study represents the first functional analysis of Δ(9) desaturases from oleaginous microalgae and from diatoms as the first enzyme to introduce a double bond in saturated fatty acids during PUFA synthesis. The findings will provide beneficial insights into applying metabolic engineering processes to suppressing PUFA synthesis in this oleaginous microalgal strain.
McCune, S A; Durant, P J; Harris, R A
1984-02-01
Hepatocytes were isolated from 3 and 5 month old female genetically obese Zucker rats and their lean littermate controls. An age-dependent loss in sensitivity of fatty acid synthesis to inhibition by both glucagon and dibutyryl cyclic AMP was observed with hepatocytes from the obese rats. Hepatocytes from lean animals were much more sensitive to these agents, regardless of age. Low concentrations of glucagon and dibutyryl cyclic AMP actually produced some stimulation of fatty acid synthesis with hepatocytes prepared from the older obese rats. 5-Tetradecyloxy-2-furoic acid, a compound which inhibits fatty acid synthesis, was a very effective inhibitor of fatty acid synthesis by hepatocytes isolated from all rats used in the study. An inhibition of lactate plus pyruvate accumulation and a strong stimulation of glycogenolysis occurred in response to both glucagon and dibutyryl cyclic AMP with hepatocytes from both age groups of lean and obese rats. The results suggest that with aging of the obese female Zucker rat some step of hepatic fatty acid synthesis becomes progressively less sensitive to inhibition by glucagon and dibutyryl cyclic AMP. This may play an important role in maintenance of obesity in these animals.
Lathe, R
1977-09-01
The firA (Ts)200 mutation not only eliminates the resistance to rifampin of certain genetically resistant strains, but, moreover, renders ribonucleic acid synthesis thermolabile. The firA gene has been mapped by P1 tranduction and is located extremely close to the structural gene for deoxyribonucleic acid polymerase III at 4 min on the Escherichia coli linkage map.
Biocomputional construction of a gene network under acid stress in Synechocystis sp. PCC 6803.
Li, Yi; Rao, Nini; Yang, Feng; Zhang, Ying; Yang, Yang; Liu, Han-ming; Guo, Fengbiao; Huang, Jian
2014-01-01
Acid stress is one of the most serious threats that cyanobacteria have to face, and it has an impact at all levels from genome to phenotype. However, very little is known about the detailed response mechanism to acid stress in this species. We present here a general analysis of the gene regulatory network of Synechocystis sp. PCC 6803 in response to acid stress using comparative genome analysis and biocomputational prediction. In this study, we collected 85 genes and used them as an initial template to predict new genes through co-regulation, protein-protein interactions and the phylogenetic profile, and 179 new genes were obtained to form a complete template. In addition, we found that 11 enriched pathways such as glycolysis are closely related to the acid stress response. Finally, we constructed a regulatory network for the intricate relationship of these genes and summarize the key steps in response to acid stress. This is the first time a bioinformatic approach has been taken systematically to gene interactions in cyanobacteria and the elaboration of their cell metabolism and regulatory pathways under acid stress, which is more efficient than a traditional experimental study. The results also provide theoretical support for similar research into environmental stresses in cyanobacteria and possible industrial applications. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Cobessi, David; Dumas, Renaud; Pautre, Virginie; Meinguet, Céline; Ferrer, Jean-Luc; Alban, Claude
2012-01-01
Diaminopelargonic acid aminotransferase (DAPA-AT) and dethiobiotin synthetase (DTBS) catalyze the antepenultimate and the penultimate steps, respectively, of biotin synthesis. Whereas DAPA-AT and DTBS are encoded by distinct genes in bacteria, in biotin-synthesizing eukaryotes (plants and most fungi), both activities are carried out by a single enzyme encoded by a bifunctional gene originating from the fusion of prokaryotic monofunctional ancestor genes. In few angiosperms, including Arabidopsis thaliana, this chimeric gene (named BIO3-BIO1) also produces a bicistronic transcript potentially encoding separate monofunctional proteins that can be produced following an alternative splicing mechanism. The functional significance of the occurrence of a bifunctional enzyme in biotin synthesis pathway in eukaryotes and the relative implication of each of the potential enzyme forms (bifunctional versus monofunctional) in the plant biotin pathway are unknown. In this study, we demonstrate that the BIO3-BIO1 fusion protein is the sole protein form produced by the BIO3-BIO1 locus in Arabidopsis. The enzyme catalyzes both DAPA-AT and DTBS reactions in vitro and is targeted to mitochondria in vivo. Our biochemical and kinetic characterizations of the pure recombinant enzyme show that in the course of the reaction, the DAPA intermediate is directly transferred from the DAPA-AT active site to the DTBS active site. Analysis of several structures of the enzyme crystallized in complex with and without its ligands reveals key structural elements involved for acquisition of bifunctionality and brings, together with mutagenesis experiments, additional evidences for substrate channeling. PMID:22547782
USDA-ARS?s Scientific Manuscript database
Objective: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have beneficial effects on inflammation and cardiovascular disease (CVD). Our aim was to assess the effect of a six-week supplementation with either olive oil, EPA, or DHA on gene expression in peripheral blood mononuclear cells (...
Neugart, Susanne; Krumbein, Angelika; Zrenner, Rita
2016-01-01
Light intensity and temperature are very important signals for the regulation of plant growth and development. Plants subjected to less favorable light or temperature conditions often respond with accumulation of secondary metabolites. Some of these metabolites have been identified as bioactive compounds, considered to exert positive effects on human health when consumed regularly. In order to test a typical range of growth parameters for the winter crop Brassica oleracea var. sabellica, plants were grown either at 400 μmol m(-2) s(-1) or 100 μmol m(-2) s(-1) at 10°C, or at 400 μmol m(-2) s(-1) with 5 or 15°C. The higher light intensity overall increased flavonol content of leaves, favoring the main quercetin glycosides, a caffeic acid monoacylated kaempferol triglycoside, and disinapoyl-gentiobiose. The higher temperature mainly increased the hydroxycinnamic acid derivative disinapoyl-gentiobiose, while at lower temperature synthesis is in favor of very complex sinapic acid acylated flavonol tetraglycosides such as kaempferol-3-O-sinapoyl-sophoroside-7-O-diglucoside. A global analysis of light and temperature dependent alterations of gene expression in B. oleracea var. sabellica leaves was performed with the most comprehensive Brassica microarray. When compared to the light experiment much less genes were differentially expressed in kale leaves grown at 5 or 15°C. A structured evaluation of differentially expressed genes revealed the expected enrichment in the functional categories of e.g. protein degradation at different light intensities or phytohormone metabolism at different temperature. Genes of the secondary metabolism namely phenylpropanoids are significantly enriched with both treatments. Thus, the genome of B. oleracea was screened for predicted genes putatively involved in the biosynthesis of flavonoids and hydroxycinnamic acid derivatives. All identified B. oleracea genes were analyzed for their most specific 60-mer oligonucleotides present on the
Neugart, Susanne; Krumbein, Angelika; Zrenner, Rita
2016-01-01
Light intensity and temperature are very important signals for the regulation of plant growth and development. Plants subjected to less favorable light or temperature conditions often respond with accumulation of secondary metabolites. Some of these metabolites have been identified as bioactive compounds, considered to exert positive effects on human health when consumed regularly. In order to test a typical range of growth parameters for the winter crop Brassica oleracea var. sabellica, plants were grown either at 400 μmol m−2 s−1 or 100 μmol m−2 s−1 at 10°C, or at 400 μmol m−2 s−1 with 5 or 15°C. The higher light intensity overall increased flavonol content of leaves, favoring the main quercetin glycosides, a caffeic acid monoacylated kaempferol triglycoside, and disinapoyl-gentiobiose. The higher temperature mainly increased the hydroxycinnamic acid derivative disinapoyl-gentiobiose, while at lower temperature synthesis is in favor of very complex sinapic acid acylated flavonol tetraglycosides such as kaempferol-3-O-sinapoyl-sophoroside-7-O-diglucoside. A global analysis of light and temperature dependent alterations of gene expression in B. oleracea var. sabellica leaves was performed with the most comprehensive Brassica microarray. When compared to the light experiment much less genes were differentially expressed in kale leaves grown at 5 or 15°C. A structured evaluation of differentially expressed genes revealed the expected enrichment in the functional categories of e.g. protein degradation at different light intensities or phytohormone metabolism at different temperature. Genes of the secondary metabolism namely phenylpropanoids are significantly enriched with both treatments. Thus, the genome of B. oleracea was screened for predicted genes putatively involved in the biosynthesis of flavonoids and hydroxycinnamic acid derivatives. All identified B. oleracea genes were analyzed for their most specific 60-mer oligonucleotides present on the
Regulation of Lipid Synthesis in Soybeans by Two Benzoic Acid Herbicides 1
Muslih, Raad K.; Linscott, Dean L.
1977-01-01
The effects of 3-nitro-2,5-dichlorobenzoic acid (dinoben) and 3-amino-2,4-dichlorobenzoic acid (chloramben) on lipid formation and on the incorporation of various substrates into lipids by intact seeds and subcellular fractions of germinating soybean (Glycine max [L.] Merr. `Amsoy') were studied. Dinoben (20 μg/ml) inhibited synthesis of total lipids 67%, neutral lipids 73%, glycolipids 51%, and phospholipids 39% in germinating seeds. When polar lipids were analyzed further, inhibition of individual lipid classes was also observed. Chloramben (20 μg/ml) stimulated total lipid synthesis 25%. With the exception of the mitochondrial fraction where malonate thiokinase was absent, dinoben inhibited up to 99% the incorporation of acetate and malonate into lipids, but did not inhibit acetyl-CoA and malonyl-CoA incorporation. Chloramben stimulated the incorporation of all substrates tested into lipids by all fractions except the mitochondrial fraction when malonate was the substrate. When dinoben and chloramben were used in combinations, chloramben did not reverse the inhibitory effect of dinoben. It is concluded that the dinoben inhibitory effect is specific and is associated with the acetate and malonate thiokinase systems. The chloramben effect is stimulatory to either acetyl-CoA carboxylase or fatty acid synthetase or both. PMID:16660173
USDA-ARS?s Scientific Manuscript database
The branched-chain amino acid, leucine, acts as a nutrient signal to stimulate protein synthesis in skeletal muscle of young pigs. However, the chemical structure responsible for this effect has not been identified. We have shown that the other branched-chain amino acids, isoleucine and valine, are ...
Engineering of Saccharomyces cerevisiae for the synthesis of short chain fatty acids.
Leber, Christopher; Da Silva, Nancy A
2014-02-01
Carbon feedstocks from fossilized sources are being rapidly depleted due to rising demand for industrial and commercial applications. Many petroleum-derived chemicals can be directly or functionally substituted with chemicals derived from renewable feedstocks. Several short chain organic acids may fulfill this role using their functional groups as a target for chemical catalysis. Saccharomyces cerevisiae was engineered to produce short chain carboxylic acids (C6 to C10 ) from glucose using the heterologous Homo sapiens type I fatty acid synthase (hFAS). This synthase was activated by phosphopantetheine transfereases AcpS and Sfp from Escherichia coli and Bacillus subtilis, respectively, both in vitro and in vivo. hFAS was produced in the holo-form and produced carboxylic acids in vitro, confirmed by NADPH and ADIFAB assays. Overexpression of hFAS in a yeast FAS2 knockout strain, deficient in de novo fatty acid synthesis, demonstrated the full functional replacement of the native fungal FAS by hFAS. Two active heterologous short chain thioesterases (TEs) from Cuphea palustris (CpFatB1) and Rattus norvegicus (TEII) were evaluated for short chain fatty acid (SCFA) synthesis in vitro and in vivo. Three hFAS mutants were constructed: a mutant deficient in the native TE domain, a mutant with a linked CpFatB1 TE and a mutant with a linked TEII TE. Using the native yeast fatty acid synthase for growth, the overexpression of the hFAS mutants and the short-chain TEs (linked or plasmid-based) increased in vivo caprylic acid and total SCFA production up to 64-fold (63 mg/L) and 52-fold (68 mg/L), respectively, over the native yeast levels. Combined over-expression of the phosphopantetheine transferase with the hFAS mutant resulted in C8 titers of up to 82 mg/L and total SCFA titers of up to 111 mg/L. © 2013 Wiley Periodicals, Inc.
Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus
2012-10-01
Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. Copyright © 2012 Elsevier B.V. All rights reserved.
Peng, Pai; Xiong, Jin-Feng; Mo, Guang-Zhen; Zheng, Jia-Li; Chen, Ren-Hong; Chen, Xiao-Yun; Wang, Zhao-Yang
2014-10-01
An efficient method for the synthesis of aminomethyl benzimidazoles is developed by using a one-pot batch reaction between amino acids and o-phenylenediamines. This reaction proceeds smoothly in an unmodified household microwave oven, even though scale-up is to 10 g. A desirable method for the quick synthesis of benzimidazoles, which are used as a kind of important intermediates in drug synthesis, is provided by the scale-up utilization of amino acid resource.
Semino, C E; Specht, C A; Raimondi, A; Robbins, P W
1996-05-14
The Xenopus developmental gene DG42 is expressed during early embryonic development, between the midblastula and neurulation stages. The deduced protein sequence of Xenopus DG42 shows similarity to Rhizobium Nod C, Streptococcus Has A, and fungal chitin synthases. Previously, we found that the DG42 protein made in an in vitro transcription/translation system catalyzed synthesis of an array of chitin oligosaccharides. Here we show that cell extracts from early Xenopus and zebrafish embryos also synthesize chitooligosaccharides. cDNA fragments homologous to DG42 from zebrafish and mouse were also cloned and sequenced. Expression of these homologs was similar to that described for Xenopus based on Northern and Western blot analysis. The Xenopus anti-DG42 antibody recognized a 63-kDa protein in extracts from zebrafish embryos that followed a similar developmental expression pattern to that previously described for Xenopus. The chitin oligosaccharide synthase activity found in extracts was inactivated by a specific DG42 antibody; synthesis of hyaluronic acid (HA) was not affected under the conditions tested. Other experiments demonstrate that expression of DG42 under plasmid control in mouse 3T3 cells gives rise to chitooligosaccharide synthase activity without an increase in HA synthase level. A possible relationship between our results and those of other investigators, which show stimulation of HA synthesis by DG42 in mammalian cell culture systems, is provided by structural analyses to be published elsewhere that suggest that chitin oligosaccharides are present at the reducing ends of HA chains. Since in at least one vertebrate system hyaluronic acid formation can be inhibited by a pure chitinase, it seems possible that chitin oligosaccharides serve as primers for hyaluronic acid synthesis.
Hashimoto, F; Taira, S; Hayashi, H
1998-11-01
We studied whether the peroxisomal proliferation, induction of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) and activation of cholesterol synthesis by gemfibrozil shown in whole body (Hashimoto F., Ishikawa T., Hamada S. and Hayashi H., Biochemical. Pharm., 49, 1213-1221 (1995)) is also detected at a culture cell level, and we made a comparative analysis of the effects of clofibric acid. Gemfibrozil at 0.25 mM increased the activity of some peroxisomal enzymes (catalase and the cyanide-insensitive fatty acyl-CoA oxidizing system) after incubation for 72 h. However, contrary to whole body experiments, gemfibrozil decreased the activity of HMG-CoA reductase and cholesterol synthesis from [14C]acetate. At 1 mM, gemfibrozil decreased not only the activity of HMG-CoA reductase and cholesterol synthesis, but also the protein content of the cells and peroxisomal enzyme activity, indicating nonspecific inhibition at this concentration. Clofibric acid (0.25 and 1 mM) increased the activity of peroxisomal enzymes, but decreased the activity of HMG-CoA reductase and cholesterol synthesis. With respect to the direct effect on HMG-CoA reductase in the cell homogenate, gemfibrozil at 0.25 mm did not affect the activity, but it clearly inhibited the activity at 2 mM and above. Clofibric acid at 2 mM hardly affected the activity, but it clearly decreased the activity at 5 mM and over. That is, gemfibrozil directly inhibited the activity more strongly than clofibric acid. The direct inhibition of the enzyme itself required higher concentrations of both agents than did inhibition at the culture cell level. These results suggest that the cytotoxicity of gemfibrozil is greater than that of clofibric acid, and that gemfibrozil, as well as clofibric acid, can induce peroxisomal enzymes in the culture cell level. In contrast to whole body results, gemfibrozil may suppress cholesterol synthesis from [14C]acetate through the inhibition of HMG-CoA reductase at the culture
Ancestral gene reconstruction and synthesis of ancient rhodopsins in the laboratory.
Chang, Belinda S W
2003-08-01
Laboratory synthesis of ancestral proteins offers an intriguing opportunity to study the past directly. The development of Bayesian methods to infer ancestral sequences, combined with advances in models of molecular evolution, and synthetic gene technology make this an increasingly promising approach in evolutionary studies of molecular function. Visual pigments form the first step in the biochemical cascade of events in the retina in all animals known to possess visual capabilities. In vertebrates, the necessity of spanning a dynamic range of light intensities of many orders of magnitude has given rise to two different types of photoreceptors, rods specialized for dim-light conditions, and cones for daylight and color vision. These photoreceptors contain different types of visual pigment genes. Reviewed here are methods of inferring ancestral sequences, chemical synthesis of artificial ancestral genes in the laboratory, and applications to the evolution of vertebrate visual systems and the experimental recreation of an archosaur rod visual pigment. The ancestral archosaurs gave rise to several notable lineages of diapsid reptiles, including the birds and the dinosaurs, and would have existed over 200 MYA. What little is known of their physiology comes from fossil remains, and inference based on the biology of their living descendants. Despite its age, an ancestral archosaur pigment was successfully recreated in the lab, and showed interesting properties of its wavelength sensitivity that may have implications for the visual capabilities of the ancestral archosaurs in dim light.
ERIC Educational Resources Information Center
Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis
2004-01-01
The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…
Misra, Ashish; Conway, Matthew F.; Johnnie, Joseph; Qureshi, Tabish M.; Lige, Bao; Derrick, Anne M.; Agbo, Eddy C.; Sriram, Ganesh
2013-01-01
Synthetic biology enables metabolic engineering of industrial microbes to synthesize value-added molecules. In this, a major challenge is the efficient redirection of carbon to the desired metabolic pathways. Pinpointing strategies toward this goal requires an in-depth investigation of the metabolic landscape of the organism, particularly primary metabolism, to identify precursor and cofactor availability for the target compound. The potent antimalarial therapeutic artemisinin and its precursors are promising candidate molecules for production in microbial hosts. Recent advances have demonstrated the production of artemisinin precursors in engineered yeast strains as an alternative to extraction from plants. We report the application of in silico and in vivo metabolic pathway analyses to identify metabolic engineering targets to improve the yield of the direct artemisinin precursor dihydroartemisinic acid (DHA) in yeast. First, in silico extreme pathway (ExPa) analysis identified NADPH-malic enzyme and the oxidative pentose phosphate pathway (PPP) as mechanisms to meet NADPH demand for DHA synthesis. Next, we compared key DHA-synthesizing ExPas to the metabolic flux distributions obtained from in vivo 13C metabolic flux analysis of a DHA-synthesizing strain. This comparison revealed that knocking out ethanol synthesis and overexpressing glucose-6-phosphate dehydrogenase in the oxidative PPP (gene YNL241C) or the NADPH-malic enzyme ME2 (YKL029C) are vital steps toward overproducing DHA. Finally, we employed in silico flux balance analysis and minimization of metabolic adjustment on a yeast genome-scale model to identify gene knockouts for improving DHA yields. The best strategy involved knockout of an oxaloacetate transporter (YKL120W) and an aspartate aminotransferase (YKL106W), and was predicted to improve DHA yields by 70-fold. Collectively, our work elucidates multiple non-trivial metabolic engineering strategies for improving DHA yield in yeast. PMID:23898325
Bi, Hongkai; Wang, Haihong; Cronan, John E.
2015-01-01
SUMMARY In the classical anaerobic pathway of unsaturated fatty acid biosynthesis, that of Escherichia coli, the double bond is introduced into the growing acyl chain by the FabA dehydratase/isomerase. Another dehydratase, FabZ, functions in the chain elongation cycle. In contrast, Aerococcus viridans has only a single FabA/FabZ homolog we designate FabQ. FabQ can not only replace the function of E. coli FabZ in vivo, but it also catalyzes the isomerization required for unsaturated fatty acid biosynthesis. Most strikingly, FabQ in combination with E. coli FabB imparts the surprising ability to bypass reduction of the trans-2-acyl-ACP intermediates of classical fatty acid synthesis. FabQ allows elongation by progressive isomerization reactions to form the polyunsaturated fatty acid, 3-hydroxy-cis-5, 7-hexadecadienoic acid, both in vitro and in vivo. FabQ therefore provides a potential pathway for bacterial synthesis of polyunsaturated fatty acids. PMID:23972938
A Dual-Promoter Gene Orchestrates the Sucrose-Coordinated Synthesis of Starch and Fructan in Barley
Jin, Yunkai; Fei, Mingliang; Rosenquist, Sara; ...
2017-11-07
Sequential carbohydrate synthesis is important for plant survival because it guarantees energy supplies for growth and development during plant ontogeny and reproduction. Starch and fructan are two important carbohydrates in many flowering plants and in human diets. Understanding this coordinated starch and fructan synthesis and unraveling how plants allocate photosynthates and prioritize different carbohydrate synthesis for survival could lead to improvements to cereals in agriculture for the purposes of greater food security and production quality. Here, we report a system from a single gene in barley employing two alternative promoters, one intronic/exonic, to generate two sequence-overlapping but functionally opposing transcriptionmore » factors, in sensing sucrose, potentially via sucrose/glucose/fructose/trehalose 6-phosphate signaling. The system employs an autoregulatory mechanism in perceiving a sucrose-controlled trans activity on one promoter and orchestrating the coordinated starch and fructan synthesis by competitive transcription factor binding on the other promoter. As a case in point for the physiological roles of the system, we have demonstrated that this multitasking system can be exploited in breeding barley with tailored amounts of fructan to produce healthy food ingredients. The identification of an intron/exon-spanning promoter in a hosting gene, resulting in proteins with distinct functions, adds to the complexity of plant genomes.« less
A Dual-Promoter Gene Orchestrates the Sucrose-Coordinated Synthesis of Starch and Fructan in Barley
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jin, Yunkai; Fei, Mingliang; Rosenquist, Sara
Sequential carbohydrate synthesis is important for plant survival because it guarantees energy supplies for growth and development during plant ontogeny and reproduction. Starch and fructan are two important carbohydrates in many flowering plants and in human diets. Understanding this coordinated starch and fructan synthesis and unraveling how plants allocate photosynthates and prioritize different carbohydrate synthesis for survival could lead to improvements to cereals in agriculture for the purposes of greater food security and production quality. Here, we report a system from a single gene in barley employing two alternative promoters, one intronic/exonic, to generate two sequence-overlapping but functionally opposing transcriptionmore » factors, in sensing sucrose, potentially via sucrose/glucose/fructose/trehalose 6-phosphate signaling. The system employs an autoregulatory mechanism in perceiving a sucrose-controlled trans activity on one promoter and orchestrating the coordinated starch and fructan synthesis by competitive transcription factor binding on the other promoter. As a case in point for the physiological roles of the system, we have demonstrated that this multitasking system can be exploited in breeding barley with tailored amounts of fructan to produce healthy food ingredients. The identification of an intron/exon-spanning promoter in a hosting gene, resulting in proteins with distinct functions, adds to the complexity of plant genomes.« less
Yao, Jiangwei; Rock, Charles O.
2015-01-01
Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887
Catalá, Angel
2013-01-01
I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074
Crown, Scott B; Marze, Nicholas; Antoniewicz, Maciek R
2015-01-01
The branched chain amino acids (BCAA) valine, leucine and isoleucine have been implicated in a number of diseases including obesity, insulin resistance, and type 2 diabetes mellitus, although the mechanisms are still poorly understood. Adipose tissue plays an important role in BCAA homeostasis by actively metabolizing circulating BCAA. In this work, we have investigated the link between BCAA catabolism and fatty acid synthesis in 3T3-L1 adipocytes using parallel 13C-labeling experiments, mass spectrometry and model-based isotopomer data analysis. Specifically, we performed parallel labeling experiments with four fully 13C-labeled tracers, [U-13C]valine, [U-13C]leucine, [U-13C]isoleucine and [U-13C]glutamine. We measured mass isotopomer distributions of fatty acids and intracellular metabolites by GC-MS and analyzed the data using the isotopomer spectral analysis (ISA) framework. We demonstrate that 3T3-L1 adipocytes accumulate significant amounts of even chain length (C14:0, C16:0 and C18:0) and odd chain length (C15:0 and C17:0) fatty acids under standard cell culture conditions. Using a novel GC-MS method, we demonstrate that propionyl-CoA acts as the primer on fatty acid synthase for the production of odd chain fatty acids. BCAA contributed significantly to the production of all fatty acids. Leucine and isoleucine contributed at least 25% to lipogenic acetyl-CoA pool, and valine and isoleucine contributed 100% to lipogenic propionyl-CoA pool. Our results further suggest that low activity of methylmalonyl-CoA mutase and mass action kinetics of propionyl-CoA on fatty acid synthase result in high rates of odd chain fatty acid synthesis in 3T3-L1 cells. Overall, this work provides important new insights into the connection between BCAA catabolism and fatty acid synthesis in adipocytes and underscores the high capacity of adipocytes for metabolizing BCAA.
Cell-free protein synthesis and assembly on a biochip
NASA Astrophysics Data System (ADS)
Heyman, Yael; Buxboim, Amnon; Wolf, Sharon G.; Daube, Shirley S.; Bar-Ziv, Roy H.
2012-06-01
Biologically active complexes such as ribosomes and bacteriophages are formed through the self-assembly of proteins and nucleic acids. Recapitulating these biological self-assembly processes in a cell-free environment offers a way to develop synthetic biodevices. To visualize and understand the assembly process, a platform is required that enables simultaneous synthesis, assembly and imaging at the nanoscale. Here, we show that a silicon dioxide grid, used to support samples in transmission electron microscopy, can be modified into a biochip to combine in situ protein synthesis, assembly and imaging. Light is used to pattern the biochip surface with genes that encode specific proteins, and antibody traps that bind and assemble the nascent proteins. Using transmission electron microscopy imaging we show that protein nanotubes synthesized on the biochip surface in the presence of antibody traps efficiently assembled on these traps, but pre-assembled nanotubes were not effectively captured. Moreover, synthesis of green fluorescent protein from its immobilized gene generated a gradient of captured proteins decreasing in concentration away from the gene source. This biochip could be used to create spatial patterns of proteins assembled on surfaces.
Modulation of gene expression in heart and liver of hibernating black bears (Ursus americanus)
2011-01-01
Background Hibernation is an adaptive strategy to survive in highly seasonal or unpredictable environments. The molecular and genetic basis of hibernation physiology in mammals has only recently been studied using large scale genomic approaches. We analyzed gene expression in the American black bear, Ursus americanus, using a custom 12,800 cDNA probe microarray to detect differences in expression that occur in heart and liver during winter hibernation in comparison to summer active animals. Results We identified 245 genes in heart and 319 genes in liver that were differentially expressed between winter and summer. The expression of 24 genes was significantly elevated during hibernation in both heart and liver. These genes are mostly involved in lipid catabolism and protein biosynthesis and include RNA binding protein motif 3 (Rbm3), which enhances protein synthesis at mildly hypothermic temperatures. Elevated expression of protein biosynthesis genes suggests induction of translation that may be related to adaptive mechanisms reducing cardiac and muscle atrophies over extended periods of low metabolism and immobility during hibernation in bears. Coordinated reduction of transcription of genes involved in amino acid catabolism suggests redirection of amino acids from catabolic pathways to protein biosynthesis. We identify common for black bears and small mammalian hibernators transcriptional changes in the liver that include induction of genes responsible for fatty acid β oxidation and carbohydrate synthesis and depression of genes involved in lipid biosynthesis, carbohydrate catabolism, cellular respiration and detoxification pathways. Conclusions Our findings show that modulation of gene expression during winter hibernation represents molecular mechanism of adaptation to extreme environments. PMID:21453527
Kent, R S; Diedrich, S L; Whorton, A R
1983-01-01
To address the hypothesis that metabolites of arachidonic acid are important regulators of prostaglandin (PG) synthesis in intact vascular tissue, we studied arachidonate metabolism in rabbit aortas in response to a continuous infusion of arachidonic acid, 10 micrograms/ml. Prostacyclin (PGI2; measured as 6-keto-PGF1 alpha) production rate accelerated during the first 2 min, reached peak velocity at 2 min, and then progressively decelerated. The velocity profile of PGI2 production was similar to that previously reported for cyclooxygenase holoenzyme assayed in vitro, and was consistent with progressive inactivation of the enzymes leading to PGI2 synthesis. We determined the specific inhibition of cyclooxygenase and prostacyclin synthetase by measuring PGI2 and PGE2 production rates and by infusing cyclic endoperoxides. Our results indicate preferential inactivation of cyclooxygenase during arachidonate metabolism, most likely due to cyclooxygenase-derived oxidative intermediates. This was a dose-dependent response and resulted in a progressive decrease in the 6-keto-PGF1 alpha/PGE2 ratio. Exogenously added 15-hydroperoxy eicosatetraenoic acid, on the other hand, actually stimulated cyclooxygenase activity at low doses, while markedly inhibiting prostacyclin synthetase. This finding, along with the accelerating nature of arachidonate metabolism, is consistent with the concept of "peroxide tone" as a mediator of cyclooxygenase activity in this system. These results demonstrate that arachidonate metabolites regulate PG synthesis in intact blood vessels. The progressive enzymatic inhibition intrinsic to arachidonate metabolism may be a model for similar changes occurring in states of enhanced lipid peroxidation. These metabolic alterations might greatly influence the numerous vascular functions known to involve arachidonic acid metabolism. PMID:6409932
Heinrich, Daniel; Raberg, Matthias; Fricke, Philipp; Kenny, Shane T.; Morales-Gamez, Laura; Babu, Ramesh P.; O'Connor, Kevin E.
2016-01-01
ABSTRACT The purple nonsulfur alphaproteobacterium Rhodospirillum rubrum S1 was genetically engineered to synthesize a heteropolymer of mainly 3-hydroxydecanoic acid and 3-hydroxyoctanoic acid [P(3HD-co-3HO)] from CO- and CO2-containing artificial synthesis gas (syngas). For this, genes from Pseudomonas putida KT2440 coding for a 3-hydroxyacyl acyl carrier protein (ACP) thioesterase (phaG), a medium-chain-length (MCL) fatty acid coenzyme A (CoA) ligase (PP_0763), and an MCL polyhydroxyalkanoate (PHA) synthase (phaC1) were cloned and expressed under the control of the CO-inducible promoter PcooF from R. rubrum S1 in a PHA-negative mutant of R. rubrum. P(3HD-co-3HO) was accumulated to up to 7.1% (wt/wt) of the cell dry weight by a recombinant mutant strain utilizing exclusively the provided gaseous feedstock syngas. In addition to an increased synthesis of these medium-chain-length PHAs (PHAMCL), enhanced gene expression through the PcooF promoter also led to an increased molar fraction of 3HO in the synthesized copolymer compared with the Plac promoter, which regulated expression on the original vector. The recombinant strains were able to partially degrade the polymer, and the deletion of phaZ2, which codes for a PHA depolymerase most likely involved in intracellular PHA degradation, did not reduce mobilization of the accumulated polymer significantly. However, an amino acid exchange in the active site of PhaZ2 led to a slight increase in PHAMCL accumulation. The accumulated polymer was isolated; it exhibited a molecular mass of 124.3 kDa and a melting point of 49.6°C. With the metabolically engineered strains presented in this proof-of-principle study, we demonstrated the synthesis of elastomeric second-generation biopolymers from renewable feedstocks not competing with human nutrition. IMPORTANCE Polyhydroxyalkanoates (PHAs) are natural biodegradable polymers (biopolymers) showing properties similar to those of commonly produced petroleum-based nondegradable
Liu, Hongyun; Zhao, Ke; Liu, Jianxin
2013-01-01
As the main precursor for lactose synthesis, large amounts of glucose are required by lactating dairy cows. Milk yield greatly depends on mammary lactose synthesis due to its osmoregulatory property for mammary uptake of water. Thus, glucose availability to the mammary gland could be a potential regulator of milk production. In the present study, the effect of glucose availability on expression of the key genes involved in synthesis of milk fat, lactose and glucose metabolism in vitro was investigated. Bovine mammary epithelial cells (BMEC) were treated for 12 h with various concentrations of glucose (2.5, 5, 10 or 20 mmol/L). The higher concentrations of glucose (10-20 mmol/L) did not affect the mRNA expression of acetyl-CoA carboxylase, diacyl glycerol acyl transferase, glycerol-3 phosphate acyl transferase and α-lactalbumin, whereas fatty acid synthase, sterol regulatory element binding protein-1 and beta-1, 4-galactosyl transferase mRNA expression increased at 10 mmol/L and then decreased at 20 mmol/L. The content of lactose synthase increased with increasing concentration of glucose, with addition of highest value at 20 mmol/L of glucose. Moreover, the increased glucose concentration stimulated the activities of pyruvate kinase and glucose-6-phosphate dehydrogenase, and elevated the energy status of the BMEC. Therefore, it was deduced that after increasing glucose availability, the extra absorbed glucose was partitioned to entering the synthesis of milk fat and lactose by the regulation of the mRNA expression of key genes, promoting glucose metabolism by glycolysis and pentose phosphate pathway as well as energy status. These results indicated that the sufficient availability of glucose in BMEC may promote glucose metabolism, and affect the synthesis of milk composition.
Amino acid homeostasis and signalling in mammalian cells and organisms
Bröer, Angelika
2017-01-01
Cells have a constant turnover of proteins that recycle most amino acids over time. Net loss is mainly due to amino acid oxidation. Homeostasis is achieved through exchange of essential amino acids with non-essential amino acids and the transfer of amino groups from oxidised amino acids to amino acid biosynthesis. This homeostatic condition is maintained through an active mTORC1 complex. Under amino acid depletion, mTORC1 is inactivated. This increases the breakdown of cellular proteins through autophagy and reduces protein biosynthesis. The general control non-derepressable 2/ATF4 pathway may be activated in addition, resulting in transcription of genes involved in amino acid transport and biosynthesis of non-essential amino acids. Metabolism is autoregulated to minimise oxidation of amino acids. Systemic amino acid levels are also tightly regulated. Food intake briefly increases plasma amino acid levels, which stimulates insulin release and mTOR-dependent protein synthesis in muscle. Excess amino acids are oxidised, resulting in increased urea production. Short-term fasting does not result in depletion of plasma amino acids due to reduced protein synthesis and the onset of autophagy. Owing to the fact that half of all amino acids are essential, reduction in protein synthesis and amino acid oxidation are the only two measures to reduce amino acid demand. Long-term malnutrition causes depletion of plasma amino acids. The CNS appears to generate a protein-specific response upon amino acid depletion, resulting in avoidance of an inadequate diet. High protein levels, in contrast, contribute together with other nutrients to a reduction in food intake. PMID:28546457
Kaiser, Julienne C; King, Alyssa N; Grigg, Jason C; Sheldon, Jessica R; Edgell, David R; Murphy, Michael E P; Brinsmade, Shaun R; Heinrichs, David E
2018-01-01
Staphylococcus aureus requires branched-chain amino acids (BCAAs; isoleucine, leucine, valine) for protein synthesis, branched-chain fatty acid synthesis, and environmental adaptation by responding to their availability via the global transcriptional regulator CodY. The importance of BCAAs for S. aureus physiology necessitates that it either synthesize them or scavenge them from the environment. Indeed S. aureus uses specialized transporters to scavenge BCAAs, however, its ability to synthesize them has remained conflicted by reports that it is auxotrophic for leucine and valine despite carrying an intact BCAA biosynthetic operon. In revisiting these findings, we have observed that S. aureus can engage in leucine and valine synthesis, but the level of BCAA synthesis is dependent on the BCAA it is deprived of, leading us to hypothesize that each BCAA differentially regulates the biosynthetic operon. Here we show that two mechanisms of transcriptional repression regulate the level of endogenous BCAA biosynthesis in response to specific BCAA availability. We identify a trans-acting mechanism involving isoleucine-dependent repression by the global transcriptional regulator CodY and a cis-acting leucine-responsive attenuator, uncovering how S. aureus regulates endogenous biosynthesis in response to exogenous BCAA availability. Moreover, given that isoleucine can dominate CodY-dependent regulation of BCAA biosynthesis, and that CodY is a global regulator of metabolism and virulence in S. aureus, we extend the importance of isoleucine availability for CodY-dependent regulation of other metabolic and virulence genes. These data resolve the previous conflicting observations regarding BCAA biosynthesis, and reveal the environmental signals that not only induce BCAA biosynthesis, but that could also have broader consequences on S. aureus environmental adaptation and virulence via CodY.
Synthesis of guanidinoacetate and creatine from amino acids by rat pancreas.
da Silva, Robin P; Clow, Kathy; Brosnan, John T; Brosnan, Margaret E
2014-02-01
Creatine is an important molecule involved in cellular energy metabolism. Creatine is spontaneously converted to creatinine at a rate of 1·7% per d; creatinine is lost in the urine. Creatine can be obtained from the diet or synthesised from endogenous amino acids via the enzymes arginine:glycine amidinotransferase (AGAT) and guanidinoacetate N-methyltransferase (GAMT). The liver has high GAMT activity and the kidney has high AGAT activity. Although the pancreas has both AGAT and GAMT activities, its possible role in creatine synthesis has not been characterised. In the present study, we examined the enzymes involved in creatine synthesis in the pancreas as well as the synthesis of guanidinoacetate (GAA) and creatine by isolated pancreatic acini. We found significant AGAT activity and somewhat lower GAMT activity in the pancreas and that pancreatic acini had measurable activities of both AGAT and GAMT and the capacity to synthesise GAA and creatine from amino acids. Creatine supplementation led to a decrease in AGAT activity in the pancreas, though it did not affect its mRNA or protein abundance. This was in contrast with the reduction of AGAT activity and mRNA and protein abundance in the kidney, suggesting that the regulatory mechanisms that control the expression of this enzyme in the pancreas are different from those in the kidney. Dietary creatine increased the concentrations of GAA, creatine and phosphocreatine in the pancreas. Unexpectedly, creatine supplementation decreased the concentrations of S-adenosylmethionine, while those of S-adenosylhomocysteine were not altered significantly.
Kelkar, Mandar A; Gogate, Parag R; Pandit, Aniruddha B
2008-03-01
Cavitation results in conditions of turbulence and liquid circulation in the reactor which can aid in eliminating mass transfer resistances. The present work illustrates the use of cavitation for intensification of biodiesel synthesis (esterification) reaction, which is mass transfer limited reaction considering the immiscible nature of the reactants, i.e., fatty acids and alcohol. Esterification of fatty acid (FA) odour cut (C(8)-C(10)) with methanol in the presence of concentrated H(2)SO(4) as a catalyst has been studied in hydrodynamic cavitation reactor as well as in the sonochemical reactor. The different reaction operating parameters such as molar ratio of acid to alcohol, catalyst quantity have been optimized under acoustic as well as hydrodynamic cavitating conditions in addition to the optimization of the geometry of the orifice plate in the case of hydrodynamic cavitation reactors. Few experiments have also been carried out with other acid (lower and higher)/methanol combination viz. caprylic acid and capric acids with methanol with an aim of investigating the efficacy of cavitation for giving the desired yields and also to quantify the degree of process intensification that can be achieved using the same. It has been observed that ambient operating conditions of temperature and pressure and reaction times of <3h, for all the different combinations of acid (lower and higher)/methanol studied in the present work, was sufficient for giving >90% conversion (mol%). This clearly establishes the efficacy of cavitation as an excellent way to achieve process intensification of the biodiesel synthesis process.
NASA Astrophysics Data System (ADS)
Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.
2013-04-01
This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was
Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Standaert, Robert F; Park, Dr Seung Bum
2006-01-01
Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A inmore » the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.« less
Francis, Brian R.
2015-01-01
Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and
Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives
Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A
2011-01-01
Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bayne, M.L.; Cascieri, M.A.; Kelder, B.
1987-05-01
A synthetic gene encoding human insulin-like growth factor I (hIGF-I) was assembled and inserted into an expression vector containing the cytomegalovirus immediate early (CMV-IE) transcriptional regulatory region and portions of the bovine growth hormone gene. The recombinant plasmid encodes a 97 amino acid fusion protein containing the first 27 amino acids of the bovine growth hormone precursor and the 70 amino acids of hIGF-I. This plasmid, when transiently introduced into cultured mouse fibroblasts, directs synthesis of the fusion protein, subsequent proteolytic removal of the bovine growth hormone signal peptide, and secretion of hIGF-I into the culture medium. Conditioned medium frommore » transfected cells inhibits binding of /sup 125/I-labeled IGF-I to type I IGF receptors on human placental membranes and to acid-stable human serum carrier proteins. The recombinant hIGF-I produced is biologically active, as monitored by the stimulation of DNA synthesis in vascular smooth muscle cells.« less
Lathe, R
1977-01-01
The firA (Ts)200 mutation not only eliminates the resistance to rifampin of certain genetically resistant strains, but, moreover, renders ribonucleic acid synthesis thermolabile. The firA gene has been mapped by P1 tranduction and is located extremely close to the structural gene for deoxyribonucleic acid polymerase III at 4 min on the Escherichia coli linkage map. PMID:330494
Clinical Relevance of Type II Fatty Acid Synthesis Bypass in Staphylococcus aureus
Guillemet, Mélanie; Soler, Charles; Morvan, Claire; Halpern, David; Pourcel, Christine; Vu Thien, Hoang; Lamberet, Gilles
2017-01-01
ABSTRACT The need for new antimicrobials to treat bacterial infections has led to the use of type II fatty acid synthesis (FASII) enzymes as front-line targets. However, recent studies suggest that FASII inhibitors may not work against the opportunist pathogen Staphylococcus aureus, as environmental fatty acids favor emergence of multi-anti-FASII resistance. As fatty acids are abundant in the host and one FASII inhibitor, triclosan, is widespread, we investigated whether fatty acid pools impact resistance in clinical and veterinary S. aureus isolates. Simple addition of fatty acids to the screening medium led to a 50% increase in triclosan resistance, as tested in 700 isolates. Moreover, nonculturable triclosan-resistant fatty acid auxotrophs, which escape detection under routine conditions, were uncovered in primary patient samples. FASII bypass in selected isolates correlated with polymorphisms in the acc and fabD loci. We conclude that fatty-acid-dependent strategies to escape FASII inhibition are common among S. aureus isolates and correlate with anti-FASII resistance and emergence of nonculturable variants. PMID:28193654
NASA Technical Reports Server (NTRS)
Lin, B. L.; Raghavan, V.
1991-01-01
The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.
Inhibition of fatty acid synthesis decreases very low density lipoprotein secretion in the hamster.
Arbeeny, C M; Meyers, D S; Bergquist, K E; Gregg, R E
1992-06-01
The hamster was developed as a model to study very low density lipoprotein (VLDL) metabolism, since, as is the case in humans, the hamster liver was found to synthesize apoB-100 and not apoB-48. The effect of inhibiting fatty acid synthesis on the hepatic secretion of VLDL triglyceride (TG) and apolipoprotein (apo) B-100 in this model was then investigated. In an in vivo study, hamsters were fed a chow diet containing 0.15% TOFA (5-tetradecyloxy-2-furancarboxylic acid), an inhibitor of acetyl-CoA carboxylase. After 6 days of treatment, plasma triglyceride and cholesterol levels were decreased by 30.2% and 11.6%, respectively. When the secretion of VLDL-TG by the liver was measured in vivo after injection of Triton WR 1339, TOFA treatment was found to decrease VLDL-TG secretion by 40%. In subsequent in vitro studies utilizing cultured primary hamster hepatocytes, incubation with 20 microM TOFA for 4 h resulted in 98% and 76% inhibition in fatty acid and triglyceride synthesis, respectively; VLDL-TG secretion was decreased by 90%. When hepatocytes were pulsed with [3H]leucine, incubation with TOFA resulted in a 50% decrease in the incorporation of radiolabel into secreted VLDL apoB-100. The results of this study indicate that inhibition of intracellular triglyceride synthesis decreases the secretion of VLDL-TG and apoB-100, and does not result in the secretion of a dense, triglyceride-depleted lipoprotein.
Hwang, Su Jung; Jun, Sang Hui; Park, Yohan; Cha, Song-Hyun; Yoon, Minho; Cho, Seonho; Lee, Hyo-Jong; Park, Youmie
2015-10-01
Here we developed a novel green synthesis method for gold nanoparticles (CGA-AuNPs) using chlorogenic acid (CGA) as reductants without the use of other chemicals and validated the anti-inflammatory efficacy of CGA-AuNPs in vitro and in vivo. The resulting CGA-AuNPs appeared predominantly spherical in shape with an average diameter of 22.25±4.78nm. The crystalline nature of the CGA-AuNPs was confirmed by high-resolution X-ray diffraction and by selected-area electron diffraction analyses. High-resolution liquid chromatography/electrospray ionization mass spectrometry revealed that the caffeic acid moiety of CGA forms quinone structure through a two-electron oxidation causing the reduction of Au(3+) to Au(0). When compared to CGA, CGA-AuNPs exhibited enhanced anti-inflammatory effects on NF-κB-mediated inflammatory network, as well as cell adhesion. Collectively, green synthesis of CGA-AuNPs using bioactive reductants and mechanistic studies based on mass spectrometry may open up new directions in nanomedicine and CGA-AuNPs can be an anti-inflammatory nanomedicine for future applications. Gold nanoparticles (Au NPs) have been shown to be very useful in many applications due to their easy functionalization capability. In this article, the authors demonstrated a novel method for the synthesis of gold nanoparticles using chlorogenic acid (CGA) as reductants. In-vitro experiments also confirmed biological activity of the resultant gold nanoparticles. Further in-vivo studies are awaited. Copyright © 2015 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Glycerine and levulinic acid were used alone and in combination for the fermentative synthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHB/V) biopolymers. Shake-flask cultures of Pseudomonas oleovorans NRRL B-14682 containing different glycerine:levulinic acid ratios (1%, w/v total carbon ...
Mertz, J R; Wallman, J
2000-04-01
Research over the past two decades has shown that the growth of young eyes is guided by vision. If near- or far-sightedness is artificially imposed by spectacle lenses, eyes of primates and chicks compensate by changing their rate of elongation, thereby growing back to the pre-lens optical condition. Little is known about what chemical signals might mediate between visual effects on the retina and alterations of eye growth. We present five findings that point to choroidal retinoic acid possibly being such a mediator. First, the chick choroid can convert retinol into all-trans-retinoic acid at the rate of 11 +/- 3 pmoles mg protein(-1) hr(-1), compared to 1.3 +/- 0.3 for retina/RPE and no conversion for sclera. Second, those visual conditions that cause increased rates of ocular elongation (diffusers or negative lens wear) produce a sharp decrease in all-trans-retinoic acid synthesis to levels barely detectable with our assay. In contrast, visual conditions which result in decreased rates of ocular elongation (recovery from diffusers or positive lens wear) produce a four- to five-fold increase in the formation of all-trans-retinoic acid. Third, the choroidal retinoic acid is found bound to a 28-32 kD protein. Fourth, a large fraction of the choroidal retinoic acid synthesized in culture is found in a nucleus-enriched fraction of sclera. Finally, application of retinoic acid to cultured sclera at physiological concentrations produced an inhibition of proteoglycan production (as assessed by measuring sulfate incorporation) with a EC50 of 8 x 10(-7) M. These results show that the synthesis of choroidal retinoic acid is modulated by those visual manipulations that influence ocular elongation and that this retinoic acid may reach the sclera in concentrations adequate to modulate scleral proteoglycan formation.
Miyazato, Minoru; Sugaya, Kimio; Goins, William F.; Goss, James R.; Chancellor, Michael B.; de Groat, William C.; Glorioso, Joseph C.; Yoshimura, Naoki
2010-01-01
We examined whether replication-defective herpes simplex virus (HSV) vectors encoding the 67 Kd form of the glutamic acid decarboxylase (GAD67) gene product, the gamma-aminobutyric acid (GABA) synthesis enzyme, can suppress detrusor overactivity (DO) in spinal cord injury (SCI) rats. One week after spinalization, HSV vectors expressing GAD and green fluorescent protein (GFP) (HSV-GAD) were injected into the bladder wall. SCI rats without HSV injection (HSV-untreated) and those injected with lacZ-encoding reporter gene HSV vectors (HSV-LacZ) were used as controls. Three weeks after viral injection, continuous cystometry was performed under awake conditions in all three groups. In the HSV-GAD group, the number and amplitude of non-voiding contractions (NVCs) were significantly decreased (40–45% and 38–40%, respectively) along with an increase in voiding efficiency, compared with HSV-untreated and HSV-LacZ groups, but micturition pressure was not different among the three groups. Intrathecal application of bicuculline partly reversed the decreased number and amplitude of NVCs, and decreased voiding efficiency in the HSV-GAD group. In the HSV-GAD group, GAD67 mRNA and protein levels were significantly increased in L6-S1 dorsal root ganglia (DRG) compared with the HSV-LacZ group while 57% of DRG cells were GFP-positive, and these neurons showed increased GAD67-like immunoreactivity compared with the HSV-LacZ group. These results indicate that GAD gene therapy effectively suppresses DO following SCI predominantly via activation of spinal GABAA receptors. Thus, HSV-based GAD gene transfer to bladder afferent pathways may represent a novel approach for the treatment of neurogenic DO. PMID:19225548
Best, Daniel; Burns, David J; Lam, Hon Wai
2015-01-01
A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544
Synthesis of molecular imprinting polymers for extraction of gallic acid from urine.
Bhawani, Showkat Ahmad; Sen, Tham Soon; Ibrahim, Mohammad Nasir Mohammad
2018-02-21
The molecularly imprinted polymers for gallic acid were synthesized by precipitation polymerization. During the process of synthesis a non-covalent approach was used for the interaction of template and monomer. In the polymerization process, gallic acid was used as a template, acrylic acid as a functional monomer, ethylene glycol dimethacrylate as a cross-linker and 2,2'-azobisisobutyronitrile as an initiator and acetonitrile as a solvent. The synthesized imprinted and non-imprinted polymer particles were characterized by using Fourier-transform infrared spectroscopy and scanning electron microscopy. The rebinding efficiency of synthesized polymer particles was evaluated by batch binding assay. The highly selective imprinted polymer for gallic acid was MIPI1 with a composition (molar ratio) of 1:4:20, template: monomer: cross-linker, respectively. The MIPI1 showed highest binding efficiency (79.50%) as compared to other imprinted and non-imprinted polymers. The highly selective imprinted polymers have successfully extracted about 80% of gallic acid from spiked urine sample.
Liu, Jun; Guo, Ting; Shen, Xiaoning; Xu, Jiahui; Wang, Junzhi; Wang, Yanyan; Liu, Dong; Niu, Huanqing; Liang, Lei; Ying, Hanjie
2016-07-10
A mutant strain of Clostridium beijerinckii NCIMB 8052, C. beijerinckii M11, which exhibited ferulic acid tolerance up to 0.9g/L, was generated using atmospheric pressure glow discharge and high-throughput screening. Comparative genomic analysis revealed that this strain harbored a mutation of the Cbei_4693 gene, which encodes a hypothetical protein suspected to be an NADPH-dependent FMN reductase. After disrupting the Cbei_4693 gene in C. beijerinckii NCIMB 8052 using the ClosTron group II intron-based gene inactivation system, we obtained the Cbei_4693 gene inactivated mutant strain, C. beijerinckii 4693::int. Compared with C. beijerinckii NCIMB 8052, 6.23g/L of butanol was produced in P2 medium containing 0.5g/L of ferulic acid by 4693::int, and the ferulic acid tolerance was also significantly increased up to 0.8g/L. These data showed, for the first time, that the Cbei_4693 gene plays an important role in regulating ferulic acid tolerance in ABE fermentation by C. beijerinckii. Copyright © 2016 Elsevier B.V. All rights reserved.
Bile acid metabolism and signaling in cholestasis, inflammation and cancer
Apte, Udayan
2015-01-01
Bile acids are synthesized from cholesterol in the liver. Some cytochrome P450 (CYP) enzymes play key roles in bile acid synthesis. Bile acids are physiological detergent molecules, so are highly cytotoxic. They undergo enterohepatic circulation and play important roles in generating bile flow and facilitating biliary secretion of endogenous metabolites and xenobiotics and intestinal absorption of dietary fats and lipid soluble vitamins. Bile acid synthesis, transport and pool size are therefore tightly regulated under physiological conditions. In cholestasis, impaired bile flow leads to accumulation of bile acids in the liver, causing hepatocyte and biliary injury and inflammation. Chronic cholestasis is associated with fibrosis, cirrhosis and eventually liver failure. Chronic cholestasis also increases the risk of developing hepatocellular or cholangiocellular carcinomas. Extensive research in the last two decades has shown that bile acids act as signaling molecules that regulate various cellular processes. The bile acid-activated nuclear receptors are ligand-activated transcriptional factors that play critical roles in the regulation of bile acid, drug and xenobiotic metabolism. In cholestasis, these bile acid-activated receptors regulate a network of genes involved in bile acid synthesis, conjugation, transport and metabolism to alleviate bile acid-induced inflammation and injury. Additionally, bile acids are known to regulate cell growth and proliferation, and altered bile acid levels in diseased conditions have been implicated in liver injury/regeneration and tumorigenesis. We will cover the mechanisms that regulate bile acid homeostasis and detoxification during cholestasis, and the roles of bile acids in the initiation and regulation of hepatic inflammation, regeneration and carcinogenesis. PMID:26233910
NASA Astrophysics Data System (ADS)
Siebert, Agnieszka; Cholewiński, Grzegorz; Garwolińska, Dorota; Olejnik, Adrian; Rachoń, Janusz; Chojnacki, Jarosław
2018-01-01
The synthesis of a potential immunosuppressant, i.e. dimethyl ester of N-mycophenoyl malonic acid was optimized in the reaction of mycophenolic acid (MPA) with amino malonic dimethyl ester in the presence of propanephosphonic anhydride (T3P) as a coupling reagent. The structural properties of the obtained MPA derivative were investigated by NMR, MS and single crystal X-ray diffraction methods. Theoretical considerations of conformational flexibility based on DFT calculations are presented.
Influence of EARLI1-like genes on flowering time and lignin synthesis of Arabidopsis thaliana.
Shi, Y; Zhang, X; Xu, Z-Y; Li, L; Zhang, C; Schläppi, M; Xu, Z-Q
2011-09-01
EARLI1 encodes a 14.7 kDa protein in the cell wall, is a member of the PRP (proline-rich protein) family and has multiple functions, including resistance to low temperature and fungal infection. RNA gel blot analyses in the present work indicated that expression of EARLI1-like genes, EARLI1, At4G12470 and At4G12490, was down-regulated in Col-FRI-Sf2 RNAi plants derived from transformation with Agrobacterium strain ABI, which contains a construct encoding a double-strand RNA targeting 8CM of EARLI1. Phenotype analyses revealed that Col-FRI-Sf2 RNAi plants of EARLI1 flowered earlier than Col-FRI-Sf2 wild-type plants. The average bolting time of Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants was 39.7 and 19.4 days, respectively, under a long-day photoperiod. In addition, there were significant differences in main stem length, internode number and rosette leaf number between Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants. RT-PCR showed that EARLI1-like genes might delay flowering time through the autonomous and long-day photoperiod pathways by maintaining the abundance of FLC transcripts. In Col-FRI-Sf2 RNAi plants, transcription of FLC was repressed, while expression of SOC1 and FT was activated. Microscopy observations showed that EARLI1-like genes were also associated with morphogenesis of leaf cells in Arabidopsis. Using histochemical staining, EARLI1-like genes were found to be involved in regulation of lignin synthesis in inflorescence stems, and Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants had 9.67% and 8.76% dry weight lignin, respectively. Expression analysis revealed that cinnamoyl-CoA reductase, a key enzyme in lignin synthesis, was influenced by EARLI1-like genes. These data all suggest that EARLI1-like genes could control the flowering process and lignin synthesis in Arabidopsis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.
Beena, P S; Basheer, Soorej M; Bhat, Sarita G; Bahkali, Ali H; Chandrasekaran, M
2011-07-01
Marine Aspergillus awamori BTMFW032, recently reported by us, produce acidophilic tannase as extracellular enzyme. Here, we report the application of this enzyme for synthesis of propyl gallate by direct transesterification of tannic acid and in tea cream solubilisation besides the simultaneous production of gallic acid along with tannase under submerged fermentation by this fungus. This acidophilic tannase enabled synthesis of propyl gallate by direct transesterification of tannic acid using propanol as organic reaction media under low water conditions. The identity of the product was confirmed with thin layer chromatography and Fourier transform infrared spectroscopy. It was noted that 699 U/ml of enzyme could give 60% solubilisation of tea cream within 1 h. Enzyme production medium was optimized adopting Box-Behnken design for simultaneous synthesis of tannase and gallic acid. Process variables including tannic acid, sodium chloride, ferrous sulphate, dipotassium hydrogen phosphate, incubation period and agitation were recognized as the critical factors that influenced tannase and gallic acid production. The model obtained predicted 4,824.61 U/ml of tannase and 136.206 μg/ml gallic acid after 48 h of incubation, whereas optimized medium supported 5,085 U/ml tannase and 372.6 μg/ml of gallic acid production after 36 and 84 h of incubation, respectively, with a 15-fold increase in both enzyme and gallic acid production. Results indicated scope for utilization of this acidophilic tannase for transesterification of tannic acid into propyl gallate, tea cream solubilisation and simultaneous production of gallic acid along with tannase.
Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.
2016-01-01
Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016
Photoredox activation of carbon dioxide for amino acid synthesis in continuous flow
NASA Astrophysics Data System (ADS)
Seo, Hyowon; Katcher, Matthew H.; Jamison, Timothy F.
2017-05-01
Although carbon dioxide (CO2) is highly abundant, its low reactivity has limited its use in chemical synthesis. In particular, methods for carbon-carbon bond formation generally rely on two-electron mechanisms for CO2 activation and require highly activated reaction partners. Alternatively, radical pathways accessed via photoredox catalysis could provide new reactivity under milder conditions. Here we demonstrate the direct coupling of CO2 and amines via the single-electron reduction of CO2 for the photoredox-catalysed continuous flow synthesis of α-amino acids. By leveraging the advantages of utilizing gases and photochemistry in flow, a commercially available organic photoredox catalyst effects the selective α-carboxylation of amines that bear various functional groups and heterocycles. The preliminary mechanistic studies support CO2 activation and carbon-carbon bond formation via single-electron pathways, and we expect that this strategy will inspire new perspectives on using this feedstock chemical in organic synthesis.
Kim, Eun Ju; Jin, Xing-Ji; Kim, Yeon Kyung; Oh, In Kyung; Kim, Ji Eun; Park, Chi-Hyun; Chung, Jin Ho
2010-01-01
Although fatty acids are known to be important in various skin functions, their roles on photoaging in human skin are poorly understood. We investigated the alteration of lipid metabolism in the epidermis by photoaging and acute UV irradiation in human skin. UV irradiated young volunteers (21-33 years, n=6) and elderly volunteers (70-75 years, n=7) skin samples were obtained by punch biopsy. Then the epidermis was separated from dermis and lipid metabolism was investigated. We observed that the amounts of free fatty acids (FFA) and triglycerides (TG) in the epidermis of photoaged or acutely UV irradiated human skin were significantly decreased. The expressions of genes related to lipid synthesis, including acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), stearoyl-CoA desaturase (SCD), sterol regulatory element binding proteins (SREBPs), and peroxisome proliferator-activated receptors (PPARgamma) were also markedly decreased. To elucidate the significance of these changes of epidermal lipids in human skin, we investigated the effects of TG or various inhibitors for the enzymes involved in TG synthesis on the expression of matrix metalloproteinase-1 (MMP-1) in cultured human epidermal keratinocytes. We demonstrated that triolein (TG) reduced basal and UV-induced MMP-1 mRNA expression. In addition, each inhibitor for various lipid synthesis enzymes, such as TOFA (ACC inhibitor), cerulenin (FAS inhibitor) and trans-10, cis-12-CLA (SCD inhibitor), increased the MMP-1 expression significantly in a dose-dependent manner. We also demonstrated that triolein could inhibit cerulenin-induced MMP-1 expression. Furthermore, topical application of triolein (10%) significantly prevented UV-induced MMP-13, COX-2, and IL-1beta expression in hairless mice. Our results suggest that TG and FFA may play important roles in photoaging of human skin. Copyright 2009 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
2014-01-01
Background The disaccharide trehalose is a major component of fungal spores and is released upon germination. Moreover, the sugar is well known for is protective functions, e.g. against thermal stress and dehydration. The properties and synthesis of trehalose have been well investigated in the bakers’ yeast Saccharomyces cerevisiae. In filamentous fungi, such knowledge is limited, although several gene products have been identified. Results Using Aspergillus niger as a model fungus, the aim of this study was to provide an overview of all genes involved in trehalose synthesis. This fungus has three potential trehalose-6-phosphate synthase encoding genes, tpsA-C, and three putative trehalose phosphate phosphatase encoding genes, tppA-C, of which two have not previously been identified. Expression of all six genes was confirmed using real-time PCR, and conserved orthologs could be identified in related Aspergilli. Using a two-hybrid approach, there is a strong indication that four of the proteins physically interact, as has previously been shown in S. cerevisiae. When creating null mutants of all the six genes, three of them, ΔtpsA, ΔtppA and ΔtppB, had lower internal trehalose contents. The only mutant with a pronounced morphological difference was ΔtppA, in which sporulation was severely reduced with abnormal conidiophores. This was also the only mutant with accumulated levels of trehalose-6-phosphate, indicating that the encoded protein is the main phosphatase under normal conditions. Besides ΔtppA, the most studied deletion mutant in this work was ΔtppB. This gene encodes a protein conserved in filamentous Ascomycota. The ΔtppB mutant displayed a low, but not depleted, internal trehalose content, and conidia were more susceptible to thermal stress. Conclusion A. niger contains at least 6 genes putatively involved in trehalose synthesis. Gene expressions related to germination have been quantified and deletion mutants characterized: Mutants lacking tps
Li, Lian; Wang, Yiru; Li, Chengmin; Wang, Genlin
2017-12-01
Heat stress can play a negative effect on milk yield and composition of dairy cattle, leading to immeasurable economic loss. The basic components of the mammary gland are the alveoli; these alveolar mammary epithelial cells reflect the milk producing ability of dairy cows. In this study, we exposed bovine mammary epithelial cells to heat stress and compared them to a control group using isobaric tags for relative and absolute quantitation combined with liquid chromatography coupled with tandem mass spectrometry. Compared with a control group, 104 differentially elevated proteins (>1.3-fold) and 167 decreased proteins (<0.77-fold) were identified in the heat treatment group. Gene Ontology analysis identified a majority of the differentially expressed proteins are associated in cell-substrate junction assembly, catabolic processes and metabolic processes. Some of these significantly regulated proteins were related to the synthesis and secretion of milk, such as milk protein and fat. This finding was further supported by the results obtained from the reduced β-casein expression through the system of plasminogen activator - plasminogen - plasmin and decreased fatty acid synthase could partly explain why milk fat synthesis ability of dairy cows decreased under heat stress. Our results highlight the effects of heat stress on synthesis of milk protein and fat, thus providing additional clues for further studies of heat stress on dairy milk production. © 2017 Japanese Society of Animal Science.
Chen, Quanmei; Liu, Xinyu; Zhao, Ping; Sun, Yanhui; Zhao, Xinjie; Xiong, Ying; Xu, Guowang; Xia, Qingyou
2015-02-01
Metabolic profiling of silkworm, especially the factors that affect silk synthesis at the metabolic level, is little known. Herein, metabolomic method based on gas chromatography-mass spectrometry was applied to identify key metabolic changes in silk synthesis deficient silkworms. Forty-six differential metabolites were identified in Nd group with the defect of silk synthesis. Significant changes in the levels of glycine and uric acid (up-regulation), carbohydrates and free fatty acids (down-regulation) were observed. The further metabolomics of silk synthesis deficient silkworms by decreasing silk proteins synthesis using knocking out fibroin heavy chain gene or extirpating silk glands operation showed that the changes of the metabolites were almost consistent with those of the Nd group. Furthermore, the increased silk yields by supplying more glycine or its related metabolite confirmed that glycine is a key metabolite to regulate silk synthesis. These findings provide important insights into the regulation between metabolic profiling and silk synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Kennedy, David A; Vembu, Nagarajan; Fronczek, Frank R; Devocelle, Marc
2011-12-02
Reported is the synthesis of azo mutual prodrugs of the nonsteroidal anti-inflammatory agents (NSAIDs) 4-aminophenylacetic acid (4-APAA) or 5-aminosalicylic acid (5-ASA) with peptides, including an antibiotic peptide temporin analogue modified at the amino terminal by an α-aminoisobutyric acid (Aib) residue. These prodrugs are designed for colonic delivery of two agents to treat infection and inflammation by the bacterial pathogen Clostridium difficile . © 2011 American Chemical Society
Synthesis of [ 18F]arenes via the copper-mediated [ 18F]fluorination of boronic acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mossine, Andrew V.; Brooks, Allen F.; Makaravage, Katarina J.
Here, a copper-mediated radiofluorination of aryl- and vinylboronic acids with K 18F is described. This method exhibits high functional group tolerance and is effective for the radiofluorination of a range of electron-deficient, -neutral, and -rich aryl-, heteroaryl-, and vinylboronic acids. This method has been applied to the synthesis of [ 18F]FPEB, a PET radiotracer for quantifying metabotropic glutamate 5 receptors.