Science.gov

Sample records for acid synthesis genes

  1. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  2. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  3. Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

    PubMed Central

    2010-01-01

    Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD) 2 and fatty acid elongase (FAE) 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general development of C. sativa should

  4. Promoter strength of folic acid synthesis genes affects sulfa drug resistance in Saccharomyces cerevisiae.

    PubMed

    Iliades, Peter; Berglez, Janette; Meshnick, Steven; Macreadie, Ian

    2003-01-01

    The enzyme dihydropteroate synthase (DHPS) is an important target for sulfa drugs in both prokaryotic and eukaryotic microbes. However, the understanding of DHPS function and the action of antifolates in eukaryotes has been limited due to technical difficulties and the complexity of DHPS being a part of a bifunctional or trifunctional protein that comprises the upstream enzymes involved in folic acid synthesis (FAS). Here, yeast strains have been constructed to study the effects of FOL1 expression on growth and sulfa drug resistance. A DHPS knockout yeast strain was complemented by yeast vectors expressing the FOL1 gene under the control of promoters of different strengths. An inverse relationship was observed between the growth rate of the strains and FOL1 expression levels. The use of stronger promoters to drive FOL1 expression led to increased sulfamethoxazole resistance when para-aminobenzoic acid (pABA) levels were elevated. However, high FOL1 expression levels resulted in increased susceptibility to sulfamethoxazole in pABA free media. These data suggest that up-regulation of FOL1 expression can lead to sulfa drug resistance in Saccharomyces cerevisiae.

  5. Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus synthesizes two siderophores, staphyloferrin A and staphyloferrin B, that promote iron-restricted growth. Previous work on the biosynthesis of staphyloferrin B has focused on the role of the synthetase enzymes, encoded from within the sbnA-I operon, which build the siderophore from the precursor molecules citrate, alpha-ketoglutarate and L-2,3-diaminopropionic acid. However, no information yet exists on several other enzymes, expressed from the biosynthetic cluster, that are thought to be involved in the synthesis of the precursors (or synthetase substrates) themselves. Results Using mutants carrying insertions in sbnA and sbnB, we show that these two genes are essential for the synthesis of staphyloferrin B, and that supplementation of the growth medium with L-2,3-diaminopropionic acid can bypass the block in staphyloferrin B synthesis displayed by the mutants. Several mechanisms are proposed for how the enzymes SbnA, with similarity to cysteine synthase enzymes, and SbnB, with similarity to amino acid dehydrogenases and ornithine cyclodeaminases, function together in the synthesis of this unusual nonproteinogenic amino acid L-2,3-diaminopropionic acid. Conclusions Mutation of either sbnA or sbnB result in abrogation of synthesis of staphyloferrin B, a siderophore that contributes to iron-restricted growth of S. aureus. The loss of staphyloferrin B synthesis is due to an inability to synthesize the unusual amino acid L-2,3-diaminopropionic acid which is an important, iron-liganding component of the siderophore structure. It is proposed that SbnA and SbnB function together as an L-Dap synthase in the S. aureus cell. PMID:21906287

  6. Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

    PubMed Central

    Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

    2011-01-01

    Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

  7. An apparent Bacillus subtilis folic acid biosynthetic operon containing pab, an amphibolic trpG gene, a third gene required for synthesis of para-aminobenzoic acid, and the dihydropteroate synthase gene.

    PubMed Central

    Slock, J; Stahly, D P; Han, C Y; Six, E W; Crawford, I P

    1990-01-01

    McDonald and Burke (J. Bacteriol. 149:391-394, 1982) previously cloned a sulfanilamide-resistance gene, sul, residing on a 4.9-kb segment of Bacillus subtilis chromosomal DNA, into plasmid pUB110. In this study we determined the nucleotide sequence of the entire 4.9-kb fragment. Genes identified on the fragment include pab, trpG, pabC, sul, one complete unidentified open reading frame, and one incomplete unidentified open reading frame. The first three of these genes, pab, trpG, and pabC, are required for synthesis of p-aminobenzoic acid. The trpG gene encodes an amphibolic glutamine amidotransferase required for synthesis of both p-aminobenzoate and anthranilate, the latter an intermediate in the tryptophan biosynthetic pathway. The pabC gene may encode a B. subtilis analog of enzyme X, an enzyme needed for p-aminobenzoate synthesis in Escherichia coli. The sul gene probably encodes dihydropteroate synthase, the enzyme responsible for formation of 7,8-dihydropteroate, the immediate precursor of folic acid. All six of the cloned genes are arranged in a single operon. Since all four of the identified genes are needed for folate biosynthesis, we refer to this operon as a folic acid operon. Expression of the trpG gene is known to be negatively controlled by tryptophan. We propose that this regulation is at the level of translation. This hypothesis is supported by the finding of an apparent Mtr-binding site which overlaps with the trpG ribosome-binding site. PMID:2123867

  8. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  9. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  10. Ascorbic acid formation and profiling of genes expressed in its synthesis and recycling in apple leaves of different ages.

    PubMed

    Li, Mingjun; Ma, Fengwang; Guo, Chunmiao; Liu, Jun

    2010-04-01

    Ascorbic acid (AsA), as a unique antioxidant and enzyme cofactor, has multiple roles in plants. However, there is very limited information on the mechanism of AsA accumulation and controlling in leaves. In this study, we determined AsA accumulation levels, analyzed expression patterns of the genes involved in synthesizing via l-galactose pathway and recycling as well as enzyme activities in apple (Malus domestica Borkh) leaves with different age. AsA content was found to increase with leaf development, reaching the highest level in 20-day-old leaves. This level was maintained in mature leaves until the dropping in senescent leaves. Comparing with young and senescent leaves, mature leaves had higher capability for AsA synthesis with high expression levels and activity of l-galactose dehydrogenase and l-galactono-1,4-lactone dehydrogenase. The mRNA expression of genes involved in AsA synthesis also showed highest abundance in 20-day-old leaves, though GDP-mannose-3',5'-epimerase and l-galactose-1-phosphate phosphatase expression reached the highest levels before 20 days old. These results suggest that AsA accumulation in apple leaves mainly occurs during the transition phase from young to mature leaves with high rates of synthesis and recycling, and that l-galactose-1-phosphate phosphatase could play an important role in regulating AsA biosynthesis via the l-galactose pathway.

  11. Effects of retinoids on iodine metabolism, thyroid peroxidase gene expression, and deoxyribonucleic acid synthesis in porcine thyroid cells in culture.

    PubMed

    Arai, M; Tsushima, T; Isozaki, O; Shizume, K; Emoto, N; Demura, H; Miyakawa, M; Onoda, N

    1991-12-01

    Effects of retinoids on DNA synthesis, iodine metabolism, and thyroid peroxidase messenger RNA levels were studied in cultured porcine thyroid cells. Retinol (10(-8)-10(-5) M) alone did not affect DNA synthesis but potentiated that induced by epidermal growth factor or insulin-like growth factor-I without changes in the number or affinity of receptors for the growth factors, suggesting that retinol stimulates postreceptor events responsible for DNA synthesis. Retinol was an inhibitor of TSH-stimulated iodine metabolism. Iodide uptake and release of organified iodine stimulated by TSH or forskolin were inhibited dose dependently by treatment with retinol. The inhibition was detected at 10(-8) M and was approximately 50% at 10(-6) M. The potency of retinoic acid was comparable to that of retinol. The inhibitory effect of retinol was detected after treatments of thyroid cells for 24 h, and the maximal effect occurred after 48 h incubation. The cAMP accumulation in cultures treated with TSH plus retinol was lower than that of control cultures treated with TSH alone. However, iodide uptake stimulated by 8-bromo-cAMP was also inhibited by retinoids. Retinol reduced TSH- or 8-bromo-cAMP-stimulated gene expression of thyroid peroxidase. Thus, the data suggest that retinoids inhibit TSH-stimulated iodine metabolism by reducing cAMP accumulation and also by acting on the steps subsequent to cAMP production.

  12. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  13. The potential of dietary polyunsaturated fatty acids to modulate eicosanoid synthesis and reproduction in Daphnia magna: a gene expression approach.

    PubMed

    Schlotz, Nina; Sørensen, Jesper Givskov; Martin-Creuzburg, Dominik

    2012-08-01

    Nutritional ecology of the aquatic model genus Daphnia has received much attention in past years in particular with regard to dietary polyunsaturated fatty acids (PUFAs) which are crucial for growth and reproduction. Besides their significant role as membrane components, C20 PUFAs serve as precursors for eicosanoids, hormone-like mediators of reproduction, immunity and ion transport physiology. In the present study we investigate transcriptomic changes in Daphnia magna in response to different algal food organisms substantially differing in their PUFA composition using quantitative real-time PCR and relate them to concomitantly documented life history data. The selection of target genes includes representatives that have previously been shown to be responsive to the eicosanoid biosynthesis inhibitor ibuprofen. The beneficial effect of C20 PUFA-rich food on reproduction and population growth rates was accompanied by an increased vitellogenin (DmagVtg1) gene expression in D. magna. Additionally, genes involved in eicosanoid signaling were particularly influenced by dietary C20 PUFA availability. For example, the cyclooxygenase gene (Cox), coding for a central enzyme in the eicosanoid pathway, was highly responsive to the food treatments. Our results suggest that dietary PUFAs are fundamental in D. magna physiology as substrate for eicosanoid synthesis and that these eicosanoids are important for D. magna reproduction.

  14. Chromosomal integration of hyaluronic acid synthesis (has) genes enhances the molecular weight of hyaluronan produced in Lactococcus lactis.

    PubMed

    Hmar, Rothangmawi Victoria; Prasad, Shashi Bala; Jayaraman, Guhan; Ramachandran, Kadathur B

    2014-12-01

    Microbial production of hyaluronic acid (HA) is an attractive substitute for extraction of this biopolymer from animal tissues. Natural producers such as Streptococcus zooepidemicus are potential pathogens; therefore, production of HA by recombinant bacteria that are generally recognized as safe (GRAS) organisms is a viable alternative that is being extensively explored. However, plasmid-based expression systems for HA production by recombinant bacteria have the inherent disadvantage of reduced productivity because of plasmid instability. To overcome this problem, the HA synthesis genes (hasA-hasB and hasA-hasB-hasC) from has-operon of S. zooepidemicus were integrated into the chromosome of Lactococcus lactis by site-directed, double-homologous recombination developing strains VRJ2AB and VRJ3ABC. The chromosomal integration stabilized the genes and obviated the instability observed in plasmid-expressed recombinant strains. The genome-integrated strains produced higher molecular weight (3.5-4 million Dalton [MDa]) HA compared to the plasmid-expressed strains (2 MDa). High molecular weight HA was produced when the intracellular concentration of uridine diphosphate N-acetylglucosamine (UDP-GlcNAc) and uridine diphosphate-glucuronic acid (UDP-GlcUA) was almost equal and hasA to hasB ratio was low. This work suggests an optimal approach to obtain high molecular weight HA in recombinant strains.

  15. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  16. Glucagon and cAMP inhibit cholesterol 7alpha-hydroxylase (CYP7A1) gene expression in human hepatocytes: discordant regulation of bile acid synthesis and gluconeogenesis.

    PubMed

    Song, Kwang-Hoon; Chiang, John Y L

    2006-01-01

    The gene encoding cholesterol 7alpha-hydroxylase (CYP7A1) is tightly regulated to control bile acid synthesis and maintain lipid homeostasis. Recent studies in mice suggest that bile acid synthesis is regulated by the fasted-to-fed cycle, and fasting induces CYP7A1 gene expression in parallel to the induction of peroxisome proliferators-activated receptor gamma co-activator 1alpha (PGC-1alpha) and phosphoenolpyruvate carboxykinase (PEPCK). How glucagon regulates CYP7A1 gene expression in the human liver is not clear. Here we show that glucagon and cyclic adenosine monophosphate (cAMP) strongly repressed CYP7A1 mRNA expression in human primary hepatocytes. Reporter assays confirmed that cAMP and protein kinase A (PKA) inhibited human CYP7A1 gene transcription, in contrast to their stimulation of the PEPCK gene. Mutagenesis analysis identified a PKA-responsive region located within the previously identified HNF4alpha binding site in the human CYP7A1 promoter. Glucagon and cAMP increased HNF4alpha phosphorylation and reduced the amount of HNF4alpha present in CYP7A1 chromatin. Our findings suggest that glucagon inhibited CYP7A1 gene expression via PKA phosphorylation of HNF4alpha, which lost its ability to bind the CYP7A1 gene and resulted in inhibition of human CYP7A1 gene transcription. In conclusion, this study unveils a species difference in nutrient regulation of the human and mouse CYP7A1 gene and suggests a discordant regulation of bile acid synthesis and gluconeogenesis by glucagon in human livers during fasting.

  17. The effect of gestational age on expression of genes involved in uptake, trafficking and synthesis of fatty acids in the rat placenta.

    PubMed

    Rodríguez-Cruz, Maricela; González, Raúl Sánchez; Maldonado, Jorge; López-Alarcón, Mardia; Bernabe-García, Mariela

    2016-10-15

    Gestation triggers a tight coordination among maternal tissues to provide fatty acids (FA) to the fetus through placental transport; however, there is insufficient evidence regarding regulation of proteins involved in placental transport of FA according to gestational age. The aim of this study was to determine the role of gestational age on the expression of genes involved in FA uptake, trafficking and synthesis in the rat placenta to support fetal demands. Gene expression of encoding proteins for placental transport and synthesis of FA was measured in placenta. Also, FA composition was measured in placenta, fetuses and newborns. mRNA expression of lipoprotein lipase (lpl) and fatp-1 (for uptake) was 4.4- and 1.43-fold higher, respectively, during late gestation than at P14, but expression of p-fabp-pm decreased 0.37-fold at late pregnancy in comparison with P14. Only mRNA fabp-4 member for trafficking of FA was 2.95-fold higher at late gestation than at P14. mRNA of fasn and elovl-6 participating in saturated FA and enzymes for the polyunsaturated FA synthesis were downregulated during late gestation and their regulator srebf-1c increased at P16. This study suggests that gestational age has an effect on expression of some genes involved in uptake, trafficking and synthesis of FA in the rat placenta; mRNA expression of lpl and, fatp-1 for uptake and fabp-4 implicated in trafficking was expressed at high levels at late gestation. In addition, placenta expresses the mRNAs involved in FA synthesis; these genes were expressed at low levels at late gestation. Additionally, mRNAs of Srebf-1c transcriptional regulator of desaturases and elongases was highly expressed during late gestation. Finally, these changes in the rat placenta allowed the placenta to partially supply saturated and monounsaturated FA to the fetus.

  18. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  19. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  20. Postprandial response and tissue distribution of the bile acid synthesis-related genes, cyp7a1, cyp8b1 and shp, in rainbow trout Oncorhynchus mykiss.

    PubMed

    Murashita, Koji; Yoshiura, Yasutoshi; Chisada, Shin-ichi; Furuita, Hirofumi; Sugita, Tsuyoshi; Matsunari, Hiroyuki; Yamamoto, Takeshi

    2013-10-01

    In mammals, cholesterol 7α-hydroxylase (CYP7A1) and sterol 12α-hydroxylase (CYP8B1) are rate-limiting enzymes in bile acid synthesis. In addition, a small heterodimer partner (SHP) is also known to inhibit bile acid synthesis via the suppression of CYP7A1 and CYP8B1 expression. However, little information is currently available regarding primary structure of the genes involved in bile acid synthesis in fish. We therefore cloned cyp7a1, cyp8b1 and shp genes from rainbow trout and obtained cDNAs encoding two isoforms each of Cyp7a1 (-1 and -2), Cyp8b1 (-1 and -2) and Shp (-1 and -2). Both cyp7a1-1 and -2 encoded proteins of 512 amino acids. Trout cyp7a1-1 was expressed not only primarily in the kidney, pyloric caecum and mid-gut, but also weakly in the liver, eye, gill and ovary. cyp7a1-2 was highly expressed in the liver, pyloric caecum and mid-gut. cyp8b1-1 and -2, which encoded proteins of 512 and 509 amino acids, respectively, were principally expressed in the liver. Both shp-1 and -2, which encoded proteins of 288 and 290 amino acids, respectively, were strongly expressed in the liver, but shp-2 was also highly expressed in the gallbladder and digestive tract. The temporal changes in the expression of cyp7a1-1/-2, cyp8b1-1/-2 and shp-1/-2 in the liver were assessed after consumption of a single meal. Expression of cyp7a1-1/-2 and cyp8b1-1/-2 increased within 3h post feeding (hpf) when the stomach was still approximately 84% full and the gallbladder was almost completely empty. Although the expression of shp-1 did not change after feeding, the expression pattern of shp-2 was inversely related to the expression patterns of cyp7a1-1/-2 and cyp8b1-1/-2. Specifically, shp-2 expression decreased until 3 hpf before returning to initial levels at 24 hpf. These findings suggest that Cyp7a1s/8b1s and Shp-2 function antagonistically in bile acid synthesis in rainbow trout.

  1. Synthesis and evaluation of a glutamic acid-modified hPAMAM complex as a promising versatile gene carrier.

    PubMed

    Hemmati, Mohammad; Kazemi, Bahram; Najafi, Farhood; Zarebkohan, Amir; Shirkoohi, Reza

    2016-01-01

    Hyperbranched poly(amidoamine) (HPAMAM), structurally analogous to polyamidoamine dendrimer (PAMAM) dendrimers, has been suggested to be an effective carrier for gene delivery. In the present study, glutamic acid-modified hPAMAM was developed as a novel non-viral gene carrier for the first time. The hPAMAM was synthesized by using a modified one-pot method. DNA was found to be bound to hPAMAM at different weight ratios (WhPAMAM/WDNA). The resulting HPAMAM-Glu20 was able to efficiently protect the encapsulated-DNA against degradation for over 2 h. In addition to low cytotoxicity, the transfection efficiency of hPAMAM-Glu20 represented much higher (p < 0.05) than that of Lipofectamine 2000 in both MCF7 and MDA-MB231 cells. Cellular uptake of the hPAMAM-Glu20 in MDA-MB231 cells, 173.56 ± 1.37%, was significantly higher than that of MCF7 cells, 65.00 ± 1.73% (p < 0.05). The results indicated that hPAMAM-Glu20-mediated gene delivery to breast cancer cells is a feasible and effective strategy that may provide a new therapeutic avenue as a non-viral gene delivery carrier. In addition, it was found that hPAMAM-glutamic amino acid (Glu)-based gene delivery is an economical, effective and biocompatible method.

  2. Escherichia coli unsaturated fatty acid synthesis: complex transcription of the fabA gene and in vivo identification of the essential reaction catalyzed by FabB.

    PubMed

    Feng, Youjun; Cronan, John E

    2009-10-23

    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA.

  3. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  4. Conjugated linoleic acid-induced milk fat depression in lactating ewes is accompanied by reduced expression of mammary genes involved in lipid synthesis.

    PubMed

    Hussein, M; Harvatine, K H; Weerasinghe, W M P B; Sinclair, L A; Bauman, D E

    2013-06-01

    Conjugated linoleic acids (CLA) are produced during rumen biohydrogenation and exert a range of biological effects. The trans-10,cis-12 CLA isomer is a potent inhibitor of milk fat synthesis in lactating dairy cows and some aspects of the mechanism have been established. Conjugated linoleic acid-induced milk fat depression has also been observed in small ruminants and our objective was to examine the molecular mechanism in lactating ewes. Multiparous lactating ewes were fed a basal ration (0.55:0.45 concentrate-to-forage ratio; dry matter basis) and randomly allocated to 2 dietary CLA levels (n=8 ewes/treatment). Treatments were zero CLA (control) or 15 g/d of lipid-encapsulated CLA supplement containing cis-9,trans-11 and trans-10,cis-12 CLA isomers in equal proportions. Treatments were fed for 10 wk and the CLA supplement provided 1.5 g of trans-10,cis-12/d. No treatment effects were observed on milk yield or milk composition for protein or lactose at wk 10 of the study. In contrast, CLA treatment significantly decreased both milk fat percentage and milk fat yield (g/d) by about 23%. The de novo synthesized fatty acids (FA; C16) was increased (10%) for the CLA treatment. In agreement with the reduced de novo FA synthesis, mRNA abundance of acetyl-coenzyme A carboxylase α, FA synthase, stearoyl-CoA desaturase 1, and glycerol-3-phosphate acyltransferase 6 decreased by 25 to 40% in the CLA-treated group. Conjugated linoleic acid treatment did not significantly reduce the mRNA abundance of enzymes involved in NADPH production, but the mRNA abundance for sterol regulatory element-binding factor 1 and insulin-induced gene 1, genes involved in regulation of transcription of lipogenic enzymes, was decreased by almost 30 and 55%, respectively, with CLA treatment. Furthermore, mRNA abundance of lipoprotein lipase decreased by almost 40% due to CLA treatment

  5. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  6. Coexisting role of fasting or feeding and dietary lipids in the control of gene expression of enzymes involved in the synthesis of saturated, monounsaturated and polyunsaturated fatty acids.

    PubMed

    Rodríguez-Cruz, Maricela; Sánchez González, Raúl; Sánchez García, Apolos M; Lòpez-Alarcòn, Mardia

    2012-03-15

    In the liver, maintaining lipid homeostasis is regulated by physiological and exogenous factors. These lipids are synthesized by Fasn, elongases and desaturases. Interactions in an organism among these factors are quite complex and, to date, relatively little is known about them. The aim of this study was to evaluate the coexisting role of physiological (insulin, fasting and feeding) and exogenous (dietary lipids) factors in the control of gene expression of Fasn, elongases and desaturases via Srebf-1c in liver from rats. Gene expression of encoding enzymes for fatty acid synthesis and fatty acid composition was evaluated in liver from rats in fasting and feeding (at 30, 60, 90 and 120 min after feeding) when food intake (adequate or high-lipid diet) was synchronized to a restricted period of 7h. Fasn, Scd and Fads2 were induced during 120 min after initial feeding in both dietary groups. This induction may be activated in part by insulin via Srebf-1c. Also, we showed for the first time that Elovl7 may be regulated by insulin and dietary lipids. The failure to synthesize saturated and monounsaturated fatty acids is consistent with a downregulation of Fasn and Scd, respectively, by dietary lipids. A higher content of LC-PUFAs was observed due to a high expression of Elovl2 and Elovl5, although Fads2 was suppressed by dietary lipids. Therefore, elongases may have a mechanism that is Srebf-1c-independent. This study suggests that a high-lipid diet triggers, during 120 min after initial feeding, a tight coordination among de novo lipogenesis, elongation, and desaturation and may not always be regulated by Srebf-1c. Finally, upregulation by feeding (insulin) of Fasn, Scd, Fads2 and Srebf-1c is insufficient to compensate for the inhibitory effect of dietary lipids.

  7. Selenium promotes adipogenic determination and differentiation of chicken embryonic fibroblasts with regulation of genes involved in fatty acid uptake, triacylglycerol synthesis and lipolysis.

    PubMed

    Hassan, Aishlin; Ahn, Jinsoo; Suh, Yeunsu; Choi, Young Min; Chen, Paula; Lee, Kichoon

    2014-08-01

    Selenium (Se) has been utilized in the differentiation of primary pig and rat preadipocytes, indicating that it may have proadipogenic potential; however, some studies have also demonstrated that Se has antiadipogenic activity. In this study, chicken embryonic fibroblasts (CEFs) were used to investigate the role of Se in adipogenesis in vitro and in ovo. Se supplementation increased lipid droplet accumulation and inhibited proliferation of cultured CEFs isolated from 6-day-old embryos dose-dependently. This suggests that Se may play a role in cell cycle inhibition, thereby promoting the differentiation of fibroblasts to adipocytes. Se did not stimulate adipogenic differentiation of CEFs isolated from 9- to 12-day-old embryos, implying a permissive stage of adipogenic determination by Se at earlier embryonic ages. Microarray analysis comparing control and Se treatments on CEFs from 6-day-old embryos and confirmatory analysis by quantitative real-time polymerase chain reaction revealed that genes involved in adipocyte determination and differentiation, fatty acid uptake and triacylglycerol synthesis were up-regulated. In addition, up-regulation of an anti-lipolytic G0/G1 switch gene 2 and down-regulation of a prolipolytic monoglyceride lipase may lead to inhibition of lipolysis by Se. Both osteogenic and myogenic genes were down-regulated, and several genes related to oxidative stress response during adipogenesis were up-regulated. In ovo injection of Se at embryonic day 8 increased adipose tissue mass by 30% and caused adipocyte hypertrophy in 17-day-old chicken embryos, further supporting the proadipogenic role of Se during the embryonic development of chickens. These results suggest that Se plays a significant role in several mechanisms related to adipogenesis.

  8. Effects of salvianolic acid-A on NIH/3T3 fibroblast proliferation, collagen synthesis and gene expression

    PubMed Central

    Liu, Cheng-Hai; Hu, Yi-Yang; Wang, Xiao-Ling; Xu, Lie-Ming; Liu, Ping

    2000-01-01

    AIM: To investigate the mechanisms of salvianolic acid A (SA-A) against liver fibrosis in vitro. METHODS: NIH/3T3 fibroblasts were cultured routinely, and incubated with 10-4 mol/L-10-7 mol/L SA-A for 22 h. The cell viability was assayed by [3H]proline incorporation, cell proliferation by [3H]TdR incorporation, cell collagen synthetic rate was measured with [3H]proline impulse and collagenase digestion method. The total RNA was prepared from the control cells and the drug treated cells respectively, and α (1) I pro-collagen mRNA expression was semi-quantitatively analyzed with RT-PCR. RESULTS: 10-4 mol/L SA-A decreased cell viability and exerted some cytotoxiciy, while 10-5 mol/L-10-7 mol/L SA-A did not affect cell viability, but inhibited cell proliferation significantly, and 10-6 mol/L SA-A had the best effect on cell viability among these concentrations of drugs. 10-5 mol/L-10-6 mol/L SA-A inhibited intracellular collagen synthetic rate, but no significant influence on extracellular collagen secretion. Both 10-5 mol/L and 10-6 mol/L SA-A could decrease α (1) I pro-collagen mRNA expression remarkably. CONCLUSION: SA-A had potent action against liver fibrosis. It inhibited NIH/3T3 fibroblast proliferation, intracellular collagen synthetic rate and type I pro-collagen gene expression, which may be one of the main mechanisms of the drug. PMID:11819598

  9. Involvement of de Novo Protein Synthesis, Protein Kinase, Extracellular Ca2+, and Lipoxygenase in Arachidonic Acid Induction of 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Genes and Isoprenoid Accumulation in Potato (Solanum tuberosum L.).

    PubMed Central

    Choi, D.; Bostock, R. M.

    1994-01-01

    A series of inhibitors were tested to determine the participation of de novo protein synthesis, protein kinase activity, extracellular Ca2+, and lipoxygenase activity in arachidonic acid elicitation of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene expression and sesquiterpene phytoalexin biosynthesis in potato (Solanum tuberosum L. cv Kennebec). Gene-specific probes were used to discriminate effects on the expression of two HMGR genes (hmg1 and hmg2) that respond differentially in tuber tissue following wounding or elicitor treatment. Inhibition of protein synthesis with cycloheximide completely blocked arachidonate-induced hypersensitive necrosis and browning, including HMGR gene induction and phytoalexin accumulation. This suggests that proteins necessary for coupling arachidonic acid reception to HMGR mRNA accumulation are either rapidly turned over or not present constitutively and are induced following elicitor treatment. Staurosporin, a potent inhibitor of protein kinases, and ethyleneglycol-bis([beta]-aminoethyl ether)-N,N[prime]-tetraacetic acid, a Ca2+ chelator, inhibited arachidonate-induction of hmg2 gene expression and phytoalexin accumulation but did not inhibit the wound-induced expression of hmg1. However, staurosporin inhibited arachidonate's suppression of hmg1 gene expression. Eicosatetraynoic acid, a lipoxygenase inhibitor that suppresses elicitor-induced phytoalexin accumulation, also inhibited arachidonate's suppression of hmg1 and induction of hmg2. The results indicate that arachidonate's suppression of hmg1 and activation of hmg2 depend on a common intermediate or set of intermediates whose generation is sensitive to the inhibitors tested. PMID:12232162

  10. Escherichia coli Unsaturated Fatty Acid Synthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.

    2009-01-01

    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA. PMID:19679654

  11. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  12. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  13. Double transgenesis of humanized fat1 and fat2 genes promotes omega-3 polyunsaturated fatty acids synthesis in a zebrafish model.

    PubMed

    Pang, Shao-Chen; Wang, Hou-Peng; Li, Kuo-Yu; Zhu, Zuo-Yan; Kang, Jing X; Sun, Yong-Hua

    2014-10-01

    Omega-3 long-chain polyunsaturated fatty acid (n-3 LC-PUFA), especially eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), are essential nutrients for human health. However, vertebrates, including humans, have lost the abilities to synthesize EPA and DHA de novo, majorly due to the genetic absence of delta-12 desaturase and omega-3 desaturase genes. Fishes, especially those naturally growing marine fish, are major dietary source of EPA and DHA. Because of the severe decline of marine fishery and the decrease in n-3 LC-PUFA content of farmed fishes, it is highly necessary to develop alternative sources of n-3 LC-PUFA. In the present study, we utilized transgenic technology to generate n-3 LC-PUFA-rich fish by using zebrafish as an animal model. Firstly, fat1 was proved to function efficiently in fish culture cells, which showed an effective conversion of n-6 PUFA to n-3 PUFA with the n-6/n-3 ratio that decreased from 7.7 to 1.1. Secondly, expression of fat1 in transgenic zebrafish increased the 20:5n-3 and 22:6n-3 contents to 1.8- and 2.4-fold, respectively. Third, co-expression of fat2, a fish codon-optimized delta-12 desaturase gene, and fat1 in fish culture cell significantly promoted n-3 PUFA synthesis with the decreased n-6/n-3 ratio from 7.7 to 0.7. Finally, co-expression of fat1 and fat2 in double transgenic zebrafish increased the 20:5n-3 and 22:6n-3 contents to 1.7- and 2.8-fold, respectively. Overall, we generated two types of transgenic zebrafish rich in endogenous n-3 LC-PUFA, fat1 transgenic zebrafish and fat1/fat2 double transgenic zebrafish. Our results demonstrate that application of transgenic technology of humanized fat1 and fat2 in farmed fishes can largely improve the n-3 LC-PUFA production.

  14. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  15. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  16. Dynamic regions within and horizontal transfer of an otherwise stable gene cluster responsible for synthesis of the Fusarium mycotoxin fusaric acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Fusarium mycotoxin fusaric acid is toxic to plants as well as animals, but its function in the biology of the fungus is not known. Here, we used genome sequencing to survey multiple species in 18 lineages (species complexes) of Fusarium for the presence of the fusaric acid biosynthetic gene (FUB...

  17. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  18. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  19. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  20. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  1. Endosymbiosis in trypanosomatids: the genomic cooperation between bacterium and host in the synthesis of essential amino acids is heavily influenced by multiple horizontal gene transfers

    PubMed Central

    2013-01-01

    Background Trypanosomatids of the genera Angomonas and Strigomonas live in a mutualistic association characterized by extensive metabolic cooperation with obligate endosymbiotic Betaproteobacteria. However, the role played by the symbiont has been more guessed by indirect means than evidenced. Symbiont-harboring trypanosomatids, in contrast to their counterparts lacking symbionts, exhibit lower nutritional requirements and are autotrophic for essential amino acids. To evidence the symbiont’s contributions to this autotrophy, entire genomes of symbionts and trypanosomatids with and without symbionts were sequenced here. Results Analyses of the essential amino acid pathways revealed that most biosynthetic routes are in the symbiont genome. By contrast, the host trypanosomatid genome contains fewer genes, about half of which originated from different bacterial groups, perhaps only one of which (ornithine cyclodeaminase, EC:4.3.1.12) derived from the symbiont. Nutritional, enzymatic, and genomic data were jointly analyzed to construct an integrated view of essential amino acid metabolism in symbiont-harboring trypanosomatids. This comprehensive analysis showed perfect concordance among all these data, and revealed that the symbiont contains genes for enzymes that complete essential biosynthetic routes for the host amino acid production, thus explaining the low requirement for these elements in symbiont-harboring trypanosomatids. Phylogenetic analyses show that the cooperation between symbionts and their hosts is complemented by multiple horizontal gene transfers, from bacterial lineages to trypanosomatids, that occurred several times in the course of their evolution. Transfers occur preferentially in parts of the pathways that are missing from other eukaryotes. Conclusion We have herein uncovered the genetic and evolutionary bases of essential amino acid biosynthesis in several trypanosomatids with and without endosymbionts, explaining and complementing decades of

  2. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  3. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  4. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  5. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  6. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  7. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  8. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  9. Race-Specific Elicitors of Cladosporium fulvum Induce Changes in Cell Morphology and the Synthesis of Ethylene and Salicylic Acid in Tomato Plants Carrying the Corresponding Cf Disease Resistance Gene.

    PubMed Central

    Hammond-Kosack, K. E.; Silverman, P.; Raskin, I.; Jones, JDG.

    1996-01-01

    Defense responses mediated by the genetically unlinked Cf-9 and Cf-2 genes were compared with those involving no Cf gene (Cf0). Compatible tomato (Lycopersicon esculentum)-Cladosporium fulvum intercellular washing fluids were injected into tomato cotyledons, and the kinetics of responses was monitored under conditions of 70 and 98% relative humidity. The latter conditions suppressed the normal macroscopic responses. For the Cf-9-Avr9 interaction, stomatal opening was induced within 3 to 4 h and after 9 h mesophyll cell death commenced. A burst of ethylene production occurred between 9 and 12.5 h and remained elevated. Free salicylic acid levels increased after 12 h, peaked at 24 h, and thereafter declined. For the Cf-2-Avr2 interaction, stomata became plugged after 8 h, and salicylic acid and ethylene levels increased by 12 and 18 h, respectively, and thereafter declined. Host cell death commenced around vascular tissue by 24 h. Cell death in both incompatible interactions was frequently preceded by cell enlargement. For Cf0-injected plants, no significant responses were detected. High humidity delayed and reduced the Cf-Avr-gene-dependent cell death and ethylene synthesis, whereas induced salicylic acid levels were unaffected for Cf-2-Avr2 and reduced in magnitude only for Cf-9-Avr9. PMID:12226268

  10. Association Between Seed Dormancy and Pericarp Color Is Controlled by a Pleiotropic Gene That Regulates Abscisic Acid and Flavonoid Synthesis in Weedy Red Rice

    PubMed Central

    Gu, Xing-You; Foley, Michael E.; Horvath, David P.; Anderson, James V.; Feng, Jiuhuan; Zhang, Lihua; Mowry, Chase R.; Ye, Heng; Suttle, Jeffrey C.; Kadowaki, Koh-ichi; Chen, Zongxiang

    2011-01-01

    Seed dormancy has been associated with red grain color in cereal crops for a century. The association was linked to qSD7-1/qPC7, a cluster of quantitative trait loci for seed dormancy/pericarp color in weedy red rice. This research delimited qSD7-1/qPC7 to the Os07g11020 or Rc locus encoding a basic helix-loop-helix family transcription factor by intragenic recombinants and provided unambiguous evidence that the association arises from pleiotropy. The pleiotropic gene expressed in early developing seeds promoted expression of key genes for biosynthesis of abscisic acid (ABA), resulting in an increase in accumulation of the dormancy-inducing hormone; activated a conserved network of eight genes for flavonoid biosynthesis to produce the pigments in the lower epidermal cells of the pericarp tissue; and enhanced seed weight. Thus, the pleiotropic locus most likely controls the dormancy and pigment traits by regulating ABA and flavonoid biosynthetic pathways, respectively. The dormancy effect could be eliminated by a heat treatment, but could not be completely overcome by gibberellic acid or physical removal of the seed maternal tissues. The dormancy-enhancing alleles differentiated into two groups basically associated with tropical and temperate ecotypes of weedy rice. Of the pleiotropic effects, seed dormancy could contribute most to the weed adaptation. Pleiotropy prevents the use of the dormancy gene to improve resistance of white pericarp cultivars against pre-harvest sprouting through conventional breeding approaches. PMID:21954164

  11. Mapping of glutamic acid decarboxylase (GAD) genes

    SciTech Connect

    Edelhoff, S.; Adler, D.A.; Disteche, C.M.; Grubin, C.E.; Karlsen, A.E.; Lernmark, A.; Foster, D. )

    1993-07-01

    Glutamic acid decarboxylase (GAD) catalyzes the synthesis of [gamma]-aminobutyric acid (GABA), which is known as a major inhibitory neurotransmitter in the central nervous system (CNS), but is also present outside the CNS. Recent studies showed that GAD is the major target of autoantibodies associated with the development of insulin-dependent diabetes mellitus and of the rare stiff man syndrome. Studies of GAD expression have demonstrated multiple transcripts, suggesting several isoforms of GAD. In this study, three different genes were mapped by in situ hybridization to both human and mouse chromosomes. The GAD1 gene was mapped to human chromosome 2q31 and to mouse chromosome 2D in a known region of conservation between human and mouse. GAD2, previously mapped to human chromosome 10p11.2-p12, was mapped to mouse chromosome 2A2-B, which identifies a new region of conservation between human and mouse chromosomes. A potential GAD3 transcript was mapped to human chromosome 22q13 and to mouse chromosome 15E in a known region of conservation between human and mouse. It is concluded that the GAD genes may form a family with as many as three related members. 30 refs., 5 figs.

  12. Effects of different model diets on milk composition and expression of genes related to fatty acid synthesis in the mammary gland of lactating dairy goats.

    PubMed

    Zhang, H; Ao, C J; Khas-Erdene; Song, L W; Zhang, X F

    2015-07-01

    This study examined the effects of different roughage diets on milk composition and the expression of key genes associated with fatty acid (FA) synthesis in the mammary gland of lactating dairy goats. Eight multiparous lactating goats (body weight=43.6±2.5kg, 90±12 d in milk) fitted with external pudic artery and subcutaneous abdominal vein catheters were assigned to 2 treatments in a crossover design. The goats were fed different roughage diets with a similar concentrate-to-roughage ratio. The diets were (1) a high-quality roughage treatment (HQR) containing 28.5% Chinese wildrye hay, 19% corn silage, 9.5% alfalfa, and 43% concentrate or (2) a low-quality roughage treatment (LQR) containing 28% Chinese wildrye hay, 28% corn stover, and 44% concentrate, on a dry matter basis. Each feeding period lasted 21 d. The first 18 d served as an adaptation period, and the last 3 d served as a sample collection period. Dry matter intake, milk yield, and milk composition were measured. Milk and blood samples were collected for FA analysis. Mammary gland biopsies were performed after milking on the last day of each period and the tissues were analyzed for the mRNA expression of acetyl-coenzyme A carboxylase-α (ACACA), FA synthase (FASN), stearoyl CoA desaturase (SCD), and lipoprotein lipase (LPL). Dry matter intake and milk yield were not affected by the treatments. Milk fat (3.16 vs. 2.96%) and protein (2.99 vs. 2.89%) contents were higher in HQR goats than in LQR goats, and milk fat yield tended to be higher in HQR goats (16.7 vs. 15.1g/d). Milk FA composition was not different between treatments, except for C18:3n-3 (0.27 vs. 0.15g/100g). Compared with LQR goats, HQR goats had a higher vein concentration of total FA (0.62 vs. 0.44mg/mL). In HQR goats, the mammary balance of total FA increased (9.17 vs. 5.51g/d), whereas the clearance rate of total FA decreased (103.03 vs. 138.25 L/d). No differences were found in mammary blood flow, artery concentration, and mammary

  13. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  14. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  15. Mutations in the Arabidopsis Lst8 and Raptor genes encoding partners of the TOR complex, or inhibition of TOR activity decrease abscisic acid (ABA) synthesis.

    PubMed

    Kravchenko, Alena; Citerne, Sylvie; Jéhanno, Isabelle; Bersimbaev, Rakhmetkazhi I; Veit, Bruce; Meyer, Christian; Leprince, Anne-Sophie

    2015-11-27

    The Target of Rapamycin (TOR) kinase regulates essential processes in plant growth and development by modulation of metabolism and translation in response to environmental signals. In this study, we show that abscisic acid (ABA) metabolism is also regulated by the TOR kinase. Indeed ABA hormone level strongly decreases in Lst8-1 and Raptor3g mutant lines as well as in wild-type (WT) Arabidopsis plants treated with AZD-8055, a TOR inhibitor. However the growth and germination of these lines are more sensitive to exogenous ABA. The diminished ABA hormone accumulation is correlated with lower transcript levels of ZEP, NCED3 and AAO3 biosynthetic enzymes, and higher transcript amount of the CYP707A2 gene encoding a key-enzyme in abscisic acid catabolism. These results suggest that the TOR signaling pathway is implicated in the regulation of ABA accumulation in Arabidopsis.

  16. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  17. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  18. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  19. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  20. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  1. Internode length in Pisum. Gene na may block gibberellin synthesis between ent-7. cap alpha. -hydroxykaurenoic acid and biggerellin A/sub 12/-aldehyde. [Pisum sativum

    SciTech Connect

    Ingram, T.J.; Reid, J.B.

    1987-04-01

    The elongation response of the gibberellin (GA) deficient genotypes na, ls, and lh of peas (Pisum sativum L.) to a range of GA-precursors was examined. Plants possessing gene na did not respond to precursors in the GA biosynthetic pathway prior to GA/sub 12/-aldehyde. In contrast, plants possessing lh and ls responded as well as wild-type plants (dwarfed with AMO-1618) to these compounds. The results suggest that GA biosynthesis is blocked prior to ent-kaurene in the lh and ls mutants and between ent-7..cap alpha..-hydroxykaurenoic acid and GA/sub 12/-aldehyde in the na mutant. Feeds of ent(/sup 3/H)kaurenoic acid and (/sup 2/H)GA/sub 12/-aldehyde to a range of genotypes supported the above conclusions. The na line WL1766 was shown by gas chromatography-mass spectrometry (GC-MS) to metabolize(/sup 2/H)GA/sub 12/-aldehyde to a number of (/sup 2/H)C/sub 19/-GAs including GA/sub 1/. However, there was no indication in na genotypes for the metabolism of ent-(/sup 3/H)kaurenoic acid to these GAs. In contrast, the expanding shoot tissue of all Na genotypes examined metabolized ent-(/sup 3/H)kaurenoic acid to radioactive compounds that co-chromatographed with GA/sub 1/, GA/sub 8/, GA/sub 20/, and GA/sub 29/. However, insufficient material was present for unequivocal identification of the metabolites. The radioactive profiles from HPLC of extracts of the node treated with ent-(/sup 3/H)kaurenoic acid were similar for both Na and na plants and contained ent-16..cap alpha..,17-dihydroxykaurenoic acid and ent-6..cap alpha..,7..cap alpha..,16..beta..,17-tetrahydroxykaurenoic acid (both characterized by GC-MS), suggesting that the metabolites arose from side branches of the main GA-biosynthetic pathway. Thus, both Na and na plants appear capable of ent-7..cap alpha..-hydroxylation.

  2. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  3. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  4. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  5. Docosahexaenoic acid prevents trans-10, cis-12 conjugated linoleic acid-induced non-alcoholic fatty liver disease in mice by altering expression of hepatic genes regulating fatty acid synthesis and oxidation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Concomitant supplementation with docosahexaenoic acid (22:6 n-3; DHA) prevented t10, c12- conjugated linoleic acid (CLA)-induced non-alcoholic fatty liver disease (NAFLD) and insulin resistance. Effective dose of DHA and mechanisms involved are poorly understood. Methods: We examined abi...

  6. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  7. Characterization of the β-Carotene Hydroxylase Gene DSM2 Conferring Drought and Oxidative Stress Resistance by Increasing Xanthophylls and Abscisic Acid Synthesis in Rice1[C][W][OA

    PubMed Central

    Du, Hao; Wang, Nili; Cui, Fei; Li, Xianghua; Xiao, Jinghua; Xiong, Lizhong

    2010-01-01

    Drought is a major limiting factor for crop production. To identify critical genes for drought resistance in rice (Oryza sativa), we screened T-DNA mutants and identified a drought-hypersensitive mutant, dsm2. The mutant phenotype was caused by a T-DNA insertion in a gene encoding a putative β-carotene hydroxylase (BCH). BCH is predicted for the biosynthesis of zeaxanthin, a carotenoid precursor of abscisic acid (ABA). The amounts of zeaxanthin and ABA were significantly reduced in two allelic dsm2 mutants after drought stress compared with the wild type. Under drought stress conditions, the mutant leaves lost water faster than the wild type and the photosynthesis rate, biomass, and grain yield were significantly reduced, whereas malondialdehyde level and stomata aperture were increased in the mutant. The mutant is also hypersensitive to oxidative stresses. The mutant had significantly lower maximal efficiency of photosystem II photochemistry and nonphotochemical quenching capacity than the wild type, indicating photoinhibition in photosystem II and decreased capacity for eliminating excess energy by thermal dissipation. Overexpression of DSM2 in rice resulted in significantly increased resistance to drought and oxidative stresses and increases of the xanthophylls and nonphotochemical quenching. Some stress-related ABA-responsive genes were up-regulated in the overexpression line. DSM2 is a chloroplast protein, and the response of DSM2 to environmental stimuli is distinctive from the other two BCH members in rice. We conclude that the DSM2 gene significantly contributes to control of the xanthophyll cycle and ABA synthesis, both of which play critical roles in the establishment of drought resistance in rice. PMID:20852032

  8. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  9. Amino acid regulation of gene expression.

    PubMed Central

    Fafournoux, P; Bruhat, A; Jousse, C

    2000-01-01

    The impact of nutrients on gene expression in mammals has become an important area of research. Nevertheless, the current understanding of the amino acid-dependent control of gene expression is limited. Because amino acids have multiple and important functions, their homoeostasis has to be finely maintained. However, amino-acidaemia can be affected by certain nutritional conditions or various forms of stress. It follows that mammals have to adjust several of their physiological functions involved in the adaptation to amino acid availability by regulating the expression of numerous genes. The aim of the present review is to examine the role of amino acids in regulating mammalian gene expression and protein turnover. It has been reported that some genes involved in the control of growth or amino acid metabolism are regulated by amino acid availability. For instance, limitation of several amino acids greatly increases the expression of the genes encoding insulin-like growth factor binding protein-1, CHOP (C/EBP homologous protein, where C/EBP is CCAAT/enhancer binding protein) and asparagine synthetase. Elevated mRNA levels result from both an increase in the rate of transcription and an increase in mRNA stability. Several observations suggest that the amino acid regulation of gene expression observed in mammalian cells and the general control process described in yeast share common features. Moreover, amino acid response elements have been characterized in the promoters of the CHOP and asparagine synthetase genes. Taken together, the results discussed in the present review demonstrate that amino acids, by themselves, can, in concert with hormones, play an important role in the control of gene expression. PMID:10998343

  10. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  11. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  12. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  13. Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins

    NASA Astrophysics Data System (ADS)

    Tang, Nicholas C.; Chilkoti, Ashutosh

    2016-04-01

    Most genes are synthesized using seamless assembly methods that rely on the polymerase chain reaction (PCR). However, PCR of genes encoding repetitive proteins either fails or generates nonspecific products. Motivated by the need to efficiently generate new protein polymers through high-throughput gene synthesis, here we report a codon-scrambling algorithm that enables the PCR-based gene synthesis of repetitive proteins by exploiting the codon redundancy of amino acids and finding the least-repetitive synonymous gene sequence. We also show that the codon-scrambling problem is analogous to the well-known travelling salesman problem, and obtain an exact solution to it by using De Bruijn graphs and a modern mixed integer linear programme solver. As experimental proof of the utility of this approach, we use it to optimize the synthetic genes for 19 repetitive proteins, and show that the gene fragments are amenable to PCR-based gene assembly and recombinant expression.

  14. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  15. Regulation of resin acid synthesis in Pinus densiflora by differential transcription of genes encoding multiple 1-deoxy-D-xylulose 5-phosphate synthase and 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase genes.

    PubMed

    Kim, Yeon-Bok; Kim, Sang-Min; Kang, Min-Kyoung; Kuzuyama, Tomohisa; Lee, Jong Kyu; Park, Seung-Chan; Shin, Sang-Chul; Kim, Soo-Un

    2009-05-01

    Pinus densiflora Siebold et Zucc. is the major green canopy species in the mountainous area of Korea. To assess the response of resin acid biosynthetic genes to mechanical and chemical stimuli, we cloned cDNAs of genes encoding enzymes involved in the 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway (1-deoxy-d-xylulose 5-phosphate synthase (PdDXS), 1-deoxy-d-xylulose 5-phosphate reductoisomerase (PdDXR) and 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase (PdHDR)) by the rapid amplification of cDNA ends (RACE) technique. In addition, we cloned the gene encoding abietadiene synthase (PdABS) as a marker for the site of pine resin biosynthesis. PdHDR and PdDXS occurred as two gene families. In the phylogenetic trees, PdDXSs, PdDXR and PdHDRs each formed a separate clade from their respective angiosperm homologs. PdDXS2, PdHDR2 and PdDXR were most actively transcribed in stem wood, whereas PdABS was specifically transcribed. The abundance of PdDXS2 transcripts in wood in the resting state was generally 50-fold higher than the abundance of PdDXS1 transcripts, and PdHDR2 transcripts were more abundant by an order of magnitude in wood than in other tissues, with the ratio of PdHDR2 to PdHDR1 transcripts in wood being about 1. Application of 1 mM methyl jasmonate (MeJA) selectively enhanced the transcript levels of PdDXS2 and PdHDR2 in wood. The ratios of PdDXS2 to PdDXS1 and PdHDR2 to PdHDR1 reached 900 and 20, respectively, on the second day after MeJA treatment, whereas the transcript level of PdABS increased twofold by 3 days after MeJA treatment. Wounding of the stem differentially enhanced the transcript ratios of PdDXS2 to PdDXS1 and PdHDR2 to PdHDR1 to 300 and 70, respectively. The increase in the transcript levels of the MEP pathway genes in response to wounding was accompanied by two orders of magnitude increase in PdABS transcripts. These observations indicated that resin acid biosynthesis activity, represented by PdABS transcription, was correlated

  16. Molecular Cloning of the Human Genes(s) Directing the Synthesis of Nervous System Cholinesterases.

    DTIC Science & Technology

    1985-12-01

    AD-8163 229 MOLECULAR CLONING OF THE HUMAN GENES (S) DIRECTING THE 1/1 SYNTHESIS OF NERYOU.. (U) NEIZMANN INST OF SCIENCE REHOVOT (ISRAEL) DEPT OF...whether these forms are produced from discrete genes or by post-transcrip- tional and post-translational processing. In addition, the amino acid...brain cholinseee (aRE.) is =*rxm yet, Which leaves open several questions Of cosdeal 1. Are the various Ch foru produiced from discrete genes , or is

  17. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  18. Oligogalacturonide-mediated induction of a gene involved in jasmonic acid synthesis in response to the cell-wall-degrading enzymes of the plant pathogen Erwinia carotovora.

    PubMed

    Norman, C; Vidal, S; Palva, E T

    1999-07-01

    Identification of Arabidopsis thaliana genes responsive to plant cell-wall-degrading enzymes of Erwinia carotovora subsp. carotovora led to the isolation of a cDNA clone with high sequence homology to the gene for allene oxide synthase, an enzyme involved in the biosynthesis of jasmonates. Expression of the corresponding gene was induced by the extracellular enzymes from this pathogen as well as by treatment with methyl jasmonate and short oligogalacturonides (OGAs). This suggests that OGAs are involved in the induction of the jasmonate pathway during plant defense response to E. carotovora subsp. carotovora attack.

  19. Development of a specific real-time PCR assay targeting the poly-γ-glutamic acid synthesis gene, pgsB, for the quantification of Bacillus amyloliquefaciens in solid-state fermentation.

    PubMed

    Yong, Xiaoyu; Zhang, Ruifu; Zhang, Nan; Chen, Yilu; Huang, Xinqi; Zhao, Jun; Shen, Qirong

    2013-02-01

    A TaqMan real-time PCR procedure was developed for specific detection and quantification of strains belonging to Bacillus amyloliquefaciens group. The primer pair pgsB726-f/pgsB791-r and the pgsB-probe were designed from one of the poly-γ-glutamic acid synthesis gene (pgsB) of B. amyloliquefaciens. The detection limit was approximately between 10(2)-10(3) cells/mL. A linear correlation between the log10 input pMD-pgsB plasmid DNA copies and the threshold cycle values were observed with a magnitude of linearity in the range of 9.415×10(3)-10(7) copies/mL for the standard curve, which exhibited a slope of -3.35 and an R2 value of 99.8%. Results of validation of this method with artificially contaminated and natural solid-state fermentation samples showed that it was suitable for specific and sensitive detection and quantification for the target strains in solid-state fermentation samples. This could be more useful to understand the fermentation starting strain and the final microbiological properties of fermentation products.

  20. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  1. Gene and library synthesis without amplification: polymerase step reaction (PSR).

    PubMed

    Lee, Zhuo-Bin; Firnhaber, Christopher; Clarke, Jesse; DeDecker, Brian S

    2015-09-01

    Current gene synthesis methods often incorporate a PCR amplification step in order to yield final material sufficient for resolution from multiple off-products. These amplification steps can cause stochastic sampling effects that propagate errors in gene synthesis or decrease variability when applied to the construction of randomized libraries. We have developed a simple DNA polymerase-based gene synthesis reaction, polymerase step reaction (PSR), that assembles DNA oligonucleotides in a unidirectional fashion without the need for amplification. We demonstrate that PSR is efficient, with little off-product production, no detectable error propagation, and maximized variability in the synthesis of a phage display library.

  2. Cationic liposome–nucleic acid complexes for gene delivery and gene silencing

    PubMed Central

    Ewert, Kai K.; Majzoub, Ramsey N.; Leal, Cecília

    2014-01-01

    Cationic liposomes (CLs) are studied worldwide as carriers of DNA and short interfering RNA (siRNA) for gene delivery and gene silencing, and related clinical trials are ongoing. Optimization of transfection efficiency and silencing efficiency by cationic liposome carriers requires a comprehensive understanding of the structures of CL–nucleic acid complexes and the nature of their interactions with cell membranes as well as events leading to release of active nucleic acids within the cytoplasm. Synchrotron x-ray scattering has revealed that CL–nucleic acid complexes spontaneously assemble into distinct liquid crystalline phases including the lamellar, inverse hexagonal, hexagonal, and gyroid cubic phases, and fluorescence microscopy has revealed CL–DNA pathways and interactions with cells. The combining of custom synthesis with characterization techniques and gene expression and silencing assays has begun to unveil structure–function relations in vitro. As a recent example, this review will briefly describe experiments with surface-functionalized PEGylated CL–DNA nanoparticles. The functionalization, which is achieved through custom synthesis, is intended to address and overcome cell targeting and endosomal escape barriers to nucleic acid delivery faced by PEGylated nanoparticles designed for in vivo applications. PMID:25587216

  3. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  4. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  5. Effect of rate of weight gain of steers during the stocker phase. IV. Rumen fermentation characteristics and expression of genes involved in substrate utilization for fatty acid synthesis in adipose tissues of growing-finishing beef cattle.

    PubMed

    Lancaster, P A; Sharman, E D; Horn, G W; Krehbiel, C R; Dillwith, J W; Starkey, J D

    2015-06-01

    The objective of this study was to determine the impact of stocker production systems differing in growth rate on rumen fermentation characteristics and utilization of substrates for fatty acid synthesis in intramuscular (IM), subcutaneous (SC), and perirenal (PR) adipose tissues. Angus steers were assigned to 4 stocker cattle production systems in 2 consecutive years: 1) 1.0 kg/d of 40% CP cottonseed meal–based supplement while grazing dormant native range (CON), 2) ground corn/soybean meal–based supplement while grazing dormant native range fed at 1% of BW (CORN), 3) grazing wheat pasture at a high stocking rate to achieve a low rate of BW gain (LGWP), and 4) grazing wheat pasture at a low stocking rate for a high rate of BW gain (HGWP). Eight ruminally cannulated steers were used to determine rumen fermentation characteristics. Steers were harvested during the stocker phase at similar age (different carcass weight) in Exp. 1 (3 steers/treatment) or at similar carcass weight in Exp. 2 (4 steers/treatment). Adipose tissues were analyzed for mRNA expression of genes involved in glucose (solute carrier family 2, member 4 [GLUT4], glucose-6-phosphate dehydrogenase [G6PDH], phosphofructokinase, muscle [PFKM], and pyruvate kinase 2, muscle [PK2]), lactate (lactate dehydrogenase B [LDHB]), and acetate (acetyl-CoA synthetase, cytosol [ACSS2]) utilization for fatty acid synthesis. The acetate:propionate ratio was least (P < 0.05) for HGWP steers, intermediate for CORN and LGWP steers, and greatest for CON steers. At similar age, LGWP and HGWP steers tended (F-test; P < 0.15) to have greater (P < 0.10) G6PDH and ACSS2 mRNA expression than CON and CORN steers in SC and PR but not IM adipose tissue. Expression of PFKM and PK2 mRNA tended (F-test; P < 0.15) to be greater (P < 0.10) in HGWP than CON and LGWP steers in IM but not SC or PR adipose tissue. At similar HCW, expression of GLUT4 and G6PDH mRNA were greater (P < 0.10) in SC adipose tissue of LGWP and HGWP steers

  6. Comparative Approach of the de novo Fatty Acid Synthesis (Lipogenesis) between Ruminant and Non Ruminant Mammalian Species: From Biochemical Level to the Main Regulatory Lipogenic Genes

    PubMed Central

    Laliotis, G.P.; Bizelis, I.; Rogdakis, E.

    2010-01-01

    Over the second half of 20th century much research on lipogenesis has been conducted, especially focused on increasing the production efficiency and improving the quality of animal derived products. However, many diferences are observed in the physiology of lipogenesis between species. Recently, many studies have also elucidated the involvement of numerous genes in this procedure, highlighting diferences not only at physiology but also at the molecular level. The main scope of this review is to point out the major differences between ruminant and non ruminant species, that are observed in key regulatory genes involved in lipogenesis. Human is used as a central reference and according to the findinggs, main differences are analysed. These findings could serve not only as basis for understanding the main physiology of lipogenesis and further basic research, but also as a basis for any animal scientist to develop new concepts and methods for use in improving animal production and modern genetic improvement. PMID:21037855

  7. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  8. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  9. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  10. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  11. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  12. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  13. A Novel Gene Required for Rhamnose-Glucose Polysaccharide Synthesis in Streptococcus mutans

    PubMed Central

    Yamashita, Yoshihisa; Shibata, Yukie; Nakano, Yoshio; Tsuda, Hiromasa; Kido, Nobuo; Ohta, Michio; Koga, Toshihiko

    1999-01-01

    Gene rgpG is required for biosynthesis of rhamnose-glucose polysaccharide (RGP) in Streptococcus mutans. Its deduced amino acid sequence had similarity to WecA, which initiates syntheses of enterobacterial common antigen and some O antigens in Escherichia coli. Gene rgpG complemented a wecA mutation of E. coli, suggesting that rgpG may function similarly in RGP synthesis. PMID:10515952

  14. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  15. Transcriptome analysis and identification of genes associated with omega-3 fatty acid biosynthesis in Perilla frutescens (L.) var. frutescens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Perilla (Perilla frutescens (L.) var frutescens) produces high levels of a-linolenic acid (ALA), an omega-3 fatty acid important to health and development. To uncover key genes involved in fatty acid (FA) and triacylglycerol (TAG) synthesis in perilla, we conducted deep sequencing of cD...

  16. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  17. Tolerance to acetic acid is improved by mutations of the TATA-binding protein gene.

    PubMed

    An, Jieun; Kwon, Hyeji; Kim, Eunjung; Lee, Young Mi; Ko, Hyeok Jin; Park, Hongjae; Choi, In-Geol; Kim, Sooah; Kim, Kyoung Heon; Kim, Wankee; Choi, Wonja

    2015-03-01

    Screening a library of overexpressing mutant alleles of the TATA-binding gene SPT15 yielded two Saccharomyces cerevisiae strains (MRRC 3252 and 3253) with enhanced tolerance to acetic acid. They were also tolerant to propionic acid and hydrogen peroxide. Transcriptome profile analysis identified 58 upregulated genes and 106 downregulated genes in MRRC 3252. Stress- and protein synthesis-related transcription factors were predominantly enriched in the upregulated and downregulated genes respectively. Eight deletion mutants for some of the highly downregulated genes were acetic acid-tolerant. The level of intracellular reactive oxygen species was considerably lessened in MRRC 3252 and 3253 upon exposure to acetic acid. Metabolome profile analysis revealed that intracellular concentrations of 5 and 102 metabolites were increased and decreased, respectively, in MRRC 3252, featuring a large increase of urea and a significant decrease of amino acids. The dur1/2Δmutant, in which the urea degradation gene DUR1/2 is deleted, displayed enhanced tolerance to acetic acid. Enhanced tolerance to acetic acid was also observed on the medium containing a low concentration of amino acids. Taken together, this study identified two SPT15 alleles, nine gene deletions and low concentration of amino acids in the medium that confer enhanced tolerance to acetic acid.

  18. Properties of bacteriophage T4 mutants defective in gene 30 (deoxyribonucleic acid ligase) and the rII gene.

    PubMed

    Karam, J D; Barker, B

    1971-02-01

    In Escherichia coli K-12 strains infected with phage T4 which is defective in gene 30 [deoxyribonucleic acid (DNA) ligase] and in the rII gene (product unknown), near normal levels of DNA and viable phage were produced. Growth of such T4 ligase-rII double mutants was less efficient in E. coli B strains which show the "rapidlysis" phenotype of rII mutations. In pulse-chase experiments coupled with temperature shifts and with inhibition of DNA synthesis, it was observed that DNA synthesized by gene 30-defective phage is more susceptible to breakdown in vivo when the phage is carrying a wild-type rII gene. Breakdown was delayed or inhibited by continued DNA synthesis. Mutations of the rII gene decreased but did not completely abolish the breakdown. T4 ligase-rII double mutants had normal sensitivity to ultraviolet irradiation.

  19. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  20. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  1. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  2. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  3. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  4. Polymerase chain reaction-mediated gene synthesis: synthesis of a gene coding for isozyme c of horseradish peroxidase.

    PubMed Central

    Jayaraman, K; Fingar, S A; Shah, J; Fyles, J

    1991-01-01

    The synthesis of a gene coding for horseradish peroxidase (HRP, isozyme c; EC 1.11.1.7) is described using a polymerase chain reaction (PCR)-mediated gene synthesis approach developed in our laboratory. In this approach, all the oligonucleotides making up the gene are ligated in a single step by using the two outer oligonucleotides as PCR primers and the crude ligation mixture as the target. The PCR facilitates synthesis and purification of the gene simultaneously. The gene for HRP was synthesized by ligating all 40 oligonucleotides in a single step followed by PCR amplification. The gene was also synthesized from its fragments by using an overlap extension method similar to the procedure as described [Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. (1989) Gene 77, 61-68]. A method for combining different DNA fragments, in-frame, by using the PCR was also developed and used to synthesize the HRP gene from its gene fragments. This method is applicable to the synthesis of even larger genes and to combine any DNA fragments in-frame. After the synthesis, preliminary characterization of the HRP gene was also carried out by the PCR to confirm the arrangement of oligonucleotides in the gene. This was done by carrying out the PCR with several sets of primers along the gene and comparing the product sizes with the expected sizes. The gene and the fragments generated by PCR were cloned in Escherichia coli and the sequence was confirmed by manual and automated DNA sequencing. Images PMID:1851991

  5. Polymerase chain reaction-mediated gene synthesis: synthesis of a gene coding for isozyme c of horseradish peroxidase.

    PubMed

    Jayaraman, K; Fingar, S A; Shah, J; Fyles, J

    1991-05-15

    The synthesis of a gene coding for horseradish peroxidase (HRP, isozyme c; EC 1.11.1.7) is described using a polymerase chain reaction (PCR)-mediated gene synthesis approach developed in our laboratory. In this approach, all the oligonucleotides making up the gene are ligated in a single step by using the two outer oligonucleotides as PCR primers and the crude ligation mixture as the target. The PCR facilitates synthesis and purification of the gene simultaneously. The gene for HRP was synthesized by ligating all 40 oligonucleotides in a single step followed by PCR amplification. The gene was also synthesized from its fragments by using an overlap extension method similar to the procedure as described [Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. (1989) Gene 77, 61-68]. A method for combining different DNA fragments, in-frame, by using the PCR was also developed and used to synthesize the HRP gene from its gene fragments. This method is applicable to the synthesis of even larger genes and to combine any DNA fragments in-frame. After the synthesis, preliminary characterization of the HRP gene was also carried out by the PCR to confirm the arrangement of oligonucleotides in the gene. This was done by carrying out the PCR with several sets of primers along the gene and comparing the product sizes with the expected sizes. The gene and the fragments generated by PCR were cloned in Escherichia coli and the sequence was confirmed by manual and automated DNA sequencing.

  6. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  7. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  8. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  9. Oleic acid attenuates trans-10,cis-12 conjugated linoleic acid-mediated inflammatory gene expression in human adipocytes.

    PubMed

    Reardon, Meaghan; Gobern, Semone; Martinez, Kristina; Shen, Wan; Reid, Tanya; McIntosh, Michael

    2012-11-01

    The weight loss supplement conjugated linoleic acid (CLA) consists of an equal mixture of trans-10,cis-12 (10,12) and cis-9,trans-11 (9,11) isomers. However, high levels of mixed CLA isomers, or the 10,12 isomer, causes chronic inflammation, lipodystrophy, or insulin resistance. We previously demonstrated that 10,12 CLA decreases de novo lipid synthesis along with the abundance and activity of stearoyl-CoA desaturase (SCD)-1, a δ-9 desaturase essential for the synthesis of monounsaturated fatty acids (MUFA). Thus, we hypothesized that the 10,12 CLA-mediated decrease in SCD-1, with the subsequent decrease in MUFA, was responsible for the observed effects. To test this hypothesis, 10,12 CLA-treated human adipocytes were supplemented with oleic acid for 12 h to 7 days, and inflammatory gene expression, insulin-stimulated glucose uptake, and lipid content were measured. Oleic acid reduced inflammatory gene expression in a dose-dependent manner, and restored the lipid content of 10,12 CLA-treated adipocytes without improving insulin-stimulated glucose uptake. In contrast, supplementation with stearic acid, a substrate for SCD-1, or 9,11 CLA did not prevent inflammatory gene expression by 10,12 CLA. Notably, 10,12 CLA impacted the expression of several G-protein coupled receptors that was attenuated by oleic acid. Collectively, these data show that oleic acid attenuates 10,12 CLA-induced inflammatory gene expression and lipid content, possibly by alleviating cell stress caused by the inhibition of MUFA needed for phospholipid and neutral lipid synthesis.

  10. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  11. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  12. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  13. Selective synthesis and labeling of the polysialic acid capsule in Escherichia coli K1 strains with mutations in nanA and neuB.

    PubMed Central

    Vimr, E R

    1992-01-01

    The enzymes required for polysialic acid capsule synthesis in Escherichia coli K1 are encoded by region 2 neu genes of the multigenic kps cluster. To facilitate analysis of capsule synthesis and translocation, an E. coli K1 strain with mutations in nanA and neuB, affecting sialic acid degradation and synthesis, respectively, was constructed by transduction. The acapsular phenotype of the mutant was corrected in vivo by exogenous addition of sialic acid. By blocking sialic acid degradation, the nanA mutation allows intracellular metabolite accumulation, while the neuB mutation prevents dilution by the endogenous sialic acid pool and allows capsule synthesis to be controlled experimentally by the exogenous addition of sialic acid to the growth medium. Complementation was detected by bacteriophage K1F adsorption or infectivity assays. Polysialic acid translocation was observed within 2 min after addition of sialic acid to the growth medium, demonstrating the rapidity in vivo of sialic acid transport, activation, and polymerization and translocation of polysaccharide to the cell surface. Phage adsorption was not inhibited by chloramphenicol, demonstrating that de novo protein synthesis was not required for polysialic acid synthesis or translocation at 37 degrees C. Exogenous radiolabeled sialic acid was incorporated exclusively into capsular polysaccharide. The polymeric nature of the labeled capsular material was confirmed by gel permeation chromatography and susceptibility of sialyl polymers to K1F endo-N-acylneuraminidase. The ability to experimentally manipulate capsule expression provides new approaches for investigating polysialic acid synthesis and membrane translocation mechanisms. PMID:1400168

  14. Responsibility of regulatory gene expression and repressed protein synthesis for triacylglycerol accumulation on sulfur-starvation in Chlamydomonas reinhardtii.

    PubMed

    Sato, Atsushi; Matsumura, Rie; Hoshino, Naomi; Tsuzuki, Mikio; Sato, Norihiro

    2014-01-01

    Triacylglycerol (TG) synthesis is induced for energy and carbon storage in algal cells under nitrogen(N)-starved conditions, and helps prevent reactive oxygen species (ROS) production through fatty acid synthesis that consumes excessive reducing power. Here, the regulatory mechanism for the TG content in sulfur(S)-starved cells of Chlamydomonas reinhardtii was examined, in comparison to that in N- or phosphorus(P)-starved cells. S- and N- starved cells exhibited markedly increased TG contents with up-regulation of mRNA levels of diacylglycerol acyltransferase (DGAT) genes. S-Starvation also induced expression of the genes for phosphatidate synthesis. In contrast, P-starved cells exhibited little alteration of the TG content with almost no induction of these genes. The results implied deficient nutrient-specific regulation of the TG content. An arg9 disruptant defective in arginine synthesis, even without nutritional deficiencies, exhibited an increased TG content upon removal of supplemented arginine, which repressed protein synthesis. Repression of protein synthesis thus seemed crucial for TG accumulation in S- or N- starved cells. Meanwhile, the results of inhibitor experiments involving cells inferred that TG accumulation during S-starvation is supported by photosynthesis and de novo fatty acid synthesis. During S-starvation, sac1 and snrk2.2 disruptants, which are defective in the response to the ambient S-status, accumulated TG at lower and higher levels, respectively, than the wild type. The sac1 and snrk2.2 disruptants showed no or much greater up-regulation of DGAT genes, respectively. In conclusion, TG synthesis would be activated in S-starved cells, through the diversion of metabolic carbon-flow from protein to TG synthesis, and simultaneously through up-regulation of the expression of a particular set of genes for TG synthesis at proper levels through the actions of SAC1 and SNRK2.2.

  15. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  16. Progressive familial intrahepatic cholestasis and inborn errors of bile acid synthesis.

    PubMed

    Jankowska, Irena; Socha, Piotr

    2012-06-01

    Progressive familial intrahepatic cholestasis (PFIC), types 1, 2 and 3, are due to defects in genes involved in bile secretion (FIC1, BSEP, MDR3). PFIC and inborn errors of bile acid synthesis (IEBAS) often present in infancy with cholestasis. The distinctive feature of PFIC 1 and 2 and IEBAS is a normal level of GGT, while IEBAS are suspected in patients with low plasma bile acids concentration. Molecular testing, urinary bile acid analysis (IEBAS), liver biopsy and immuno-staining are used for the diagnosis. Some patients with PFIC can be successfully treated with ursodeoxycholic acid or partial external biliary diversion. IEBAS is treated with cholic acid. Liver transplantation is required for cirrhosis with liver failure. Hepatocarcinoma has been reported in PFIC2.

  17. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  18. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  19. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  20. Downregulation of de Novo Fatty Acid Synthesis in Subcutaneous Adipose Tissue of Moderately Obese Women.

    PubMed

    Guiu-Jurado, Esther; Auguet, Teresa; Berlanga, Alba; Aragonès, Gemma; Aguilar, Carmen; Sabench, Fàtima; Armengol, Sandra; Porras, José Antonio; Martí, Andreu; Jorba, Rosa; Hernández, Mercè; del Castillo, Daniel; Richart, Cristóbal

    2015-12-16

    The purpose of this work was to evaluate the expression of fatty acid metabolism-related genes in human adipose tissue from moderately obese women. We used qRT-PCR and Western Blot to analyze visceral (VAT) and subcutaneous (SAT) adipose tissue mRNA expression involved in de novo fatty acid synthesis (ACC1, FAS), fatty acid oxidation (PPARα, PPARδ) and inflammation (IL6, TNFα), in normal weight control women (BMI < 25 kg/m², n = 35) and moderately obese women (BMI 30-38 kg/m², n = 55). In SAT, ACC1, FAS and PPARα mRNA expression were significantly decreased in moderately obese women compared to controls. The downregulation reported in SAT was more pronounced when BMI increased. In VAT, lipogenic-related genes and PPARα were similar in both groups. Only PPARδ gene expression was significantly increased in moderately obese women. As far as inflammation is concerned, TNFα and IL6 were significantly increased in moderate obesity in both tissues. Our results indicate that there is a progressive downregulation in lipogenesis in SAT as BMI increases, which suggests that SAT decreases the synthesis of fatty acid de novo during the development of obesity, whereas in VAT lipogenesis remains active regardless of the degree of obesity.

  1. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  2. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  3. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  4. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  5. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  6. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  7. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  8. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  9. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  10. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  11. Synthesis of repressible acid phosphatase in Saccharomyces cerevisiae under conditions of enzyme instability.

    PubMed Central

    Bostian, K A; Lemire, J M; Halvorson, H O

    1982-01-01

    The synthesis of repressible acid phosphatase in Saccharomyces cerevisiae was examined under conditions of blocked derepression as described by Toh-e et al. (Mol. Gen. Genet. 162:139-149, 1978). Based on a genetic and biochemical analysis of the phenomenon these authors proposed a new regulatory model for acid phosphatase expression involving a simultaneous interaction of regulatory factors in the control of structural gene transcription. We demonstrate here that under growth conditions that fail to produce acid phosphatase the enzyme is readily inactivated. Furthermore, we demonstrate under these conditions the production of acid phosphatase mRNA which is active both in vitro and in vivo in the synthesis of enzyme. This eliminates any step prior to translation of acid phosphatase polypeptide as an explanation for the phenomenon. We interpret our results for the block in appearance of acid phosphatase as a result of both deaccelerated growth and cellular biosynthesis during derepression, accompanied by an enhanced instability of the enzyme. Images PMID:7050664

  12. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  13. Developmental aspects and factors influencing the synthesis and status of ascorbic Acid in the pig.

    PubMed

    Mahan, D C; Ching, S; Dabrowski, K

    2004-01-01

    Ascorbic acid synthesis in the pig occurs at mid-pregnancy, but activity of the enzyme l-gulono-gamma-lactone oxidase (GLO) declines thereafter during gestation and remains low when the pig nurses the sow. During late gestation the ascorbic acid concentration in the fetus increases, but serum and liver ascorbic acid concentration in the sow declines without affecting the dam's liver GLO activity. It is presumed that as gestation progresses an increased amount of maternal ascorbic acid is transferred to the fetus and to the mammary gland. Colostrum and milk are rich sources of the vitamin and supply the nursing pig with ascorbic acid. The available data suggest that high amounts of ascorbic acid appear to suppress liver GLO activity in the pig. Upon weaning, when exogenous vitamin C is generally not provided, liver GLO activity and serum ascorbic acid increases. During the initial periods postweaning, some reports have indicated growth benefits of supplemental vitamin C. Body tissues differ in their concentrations of ascorbic acid, but tissues of high metabolic need generally have greater concentrations. The corpus luteum in the female, the testis in the male, and the adrenal glands in all pigs contain greater concentrations of the vitamin. Knockout genes preventing ascorbic acid synthesis in pigs have demonstrated poor skeletal and collagen formation and poor antioxidant protection. Under periods of stress ascorbic acid declines in the adrenal, but the pig rapidly recovers to its resting state once the stressor agent is removed. Although there are periods when supplemental vitamin C has been shown to promote pig performance (e.g., during high environmental stress and early postweaning), supplemental vitamin C has not been shown to routinely enhance pig performance.

  14. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  15. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  16. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  17. Transcriptome analysis of acetic-acid-treated yeast cells identifies a large set of genes whose overexpression or deletion enhances acetic acid tolerance.

    PubMed

    Lee, Yeji; Nasution, Olviyani; Choi, Eunyong; Choi, In-Geol; Kim, Wankee; Choi, Wonja

    2015-08-01

    Acetic acid inhibits the metabolic activities of Saccharomyces cerevisiae. Therefore, a better understanding of how S. cerevisiae cells acquire the tolerance to acetic acid is of importance to develop robust yeast strains to be used in industry. To do this, we examined the transcriptional changes that occur at 12 h post-exposure to acetic acid, revealing that 56 and 58 genes were upregulated and downregulated, respectively. Functional categorization of them revealed that 22 protein synthesis genes and 14 stress response genes constituted the largest portion of the upregulated and downregulated genes, respectively. To evaluate the association of the regulated genes with acetic acid tolerance, 3 upregulated genes (DBP2, ASC1, and GND1) were selected among 34 non-protein synthesis genes, and 54 viable mutants individually deleted for the downregulated genes were retrieved from the non-essential haploid deletion library. Strains overexpressing ASC1 and GND1 displayed enhanced tolerance to acetic acid, whereas a strain overexpressing DBP2 was sensitive. Fifty of 54 deletion mutants displayed enhanced acetic acid tolerance. Three chosen deletion mutants (hsps82Δ, ato2Δ, and ssa3Δ) were also tolerant to benzoic acid but not propionic and sorbic acids. Moreover, all those five (two overexpressing and three deleted) strains were more efficient in proton efflux and lower in membrane permeability and internal hydrogen peroxide content than controls. Individually or in combination, those physiological changes are likely to contribute at least in part to enhanced acetic acid tolerance. Overall, information of our transcriptional profile was very useful to identify molecular factors associated with acetic acid tolerance.

  18. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  19. Mouse Vk gene classification by nucleic acid sequence similarity.

    PubMed

    Strohal, R; Helmberg, A; Kroemer, G; Kofler, R

    1989-01-01

    Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.

  20. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  1. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  2. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  3. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  4. De novo gene synthesis design using TmPrime software.

    PubMed

    Li, Mo-Huang; Bode, Marcus; Huang, Mo Chao; Cheong, Wai Chye; Lim, Li Shi

    2012-01-01

    This chapter presents TmPrime, a computer program to design oligonucleotide for both ligase chain reaction (LCR)- and polymerase chain reaction (PCR)-based de novo gene synthesis. The program divides a long input DNA sequence based on user-specified melting temperatures and assembly conditions, and dynamically optimizes the length of oligonucleotides to achieve homologous melting temperatures. The output reports the melting temperatures, oligonucleotide sequences, and potential formation of secondary structures in a PDF file, which will be sent to the user via e-mail. The program also provides functions on sequence pooling to separate long genes into smaller pieces for multipool assembly and codon optimization for expression based on the highest organism-specific codon frequency. This software has been successfully used in the design and synthesis of various genes with total length >20 kbp. This program is freely available at http://prime.ibn.a-star.edu.sg.

  5. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  6. Molecular genetic and molecular evolutionary studies on the bacteriochlorophyll synthesis genes of Rhodobacter capsulatus

    SciTech Connect

    Burke-Agueero, Donald H.

    1992-08-01

    Rhodobacter capsulatus, purple bacterium capable of either aerobic or photosynthetic growth, has proven to be very useful in genetic studies of photosynthesis. Forty-four genes clustered together within a 46 kilobase region are required to establish photosynthetic ability in R. capsulatus. Approximately twenty of these genes are involved in bacteriochlorophyll synthesis of which eight ``bch`` genes are the subject of this thesis. Six of these genes were found to code for the two ring reductases. The first converts protochlorophyllide (PChlide) into a chlorin, the immediate precursor to chlorophyll a, and then into a bacteriochlorin. Each reductase is shown to be made up of three subunits. PChlide reductase is coded by the genes bchN, bchB, and bchL. Proteins with amino acid sequences markedly similar to those of bchN and bchL have been shown in other organisms to be required for chlorophyll synthesis; hence, their designation as chlN and chlB. A third chloroplast-encoded gene of heretofore unknown function shares amino acid identities with bchB and is probably the third subunit of the plant PChlide reductase. The bchA locus, which encodes the chlorin reductase, is found to be made up of three separate, translationally coupled genes, referred to as bchX, bchY, and bchZ. Amino acid similarities between bchX, bchL, and the nitrogenase reductase protein nifH suggest that all three classes of proteins share certain three-dimensional structural features, including elements that are central to the enzymatic mechanism of nifH. PChlide reductase and chlorin reductase are clearly derived from a common ancestor. Several lines of analysis suggests the ancestor of both enzyme systems reduced PChlide twice to produce bacteriochlorophyll supporting the concept bacteriochlorophyll as the ancestral reaction center pigment.

  7. Molecular genetic and molecular evolutionary studies on the bacteriochlorophyll synthesis genes of Rhodobacter capsulatus

    SciTech Connect

    Burke-Agueero, D.H.

    1992-08-01

    Rhodobacter capsulatus, purple bacterium capable of either aerobic or photosynthetic growth, has proven to be very useful in genetic studies of photosynthesis. Forty-four genes clustered together within a 46 kilobase region are required to establish photosynthetic ability in R. capsulatus. Approximately twenty of these genes are involved in bacteriochlorophyll synthesis of which eight bch'' genes are the subject of this thesis. Six of these genes were found to code for the two ring reductases. The first converts protochlorophyllide (PChlide) into a chlorin, the immediate precursor to chlorophyll a, and then into a bacteriochlorin. Each reductase is shown to be made up of three subunits. PChlide reductase is coded by the genes bchN, bchB, and bchL. Proteins with amino acid sequences markedly similar to those of bchN and bchL have been shown in other organisms to be required for chlorophyll synthesis; hence, their designation as chlN and chlB. A third chloroplast-encoded gene of heretofore unknown function shares amino acid identities with bchB and is probably the third subunit of the plant PChlide reductase. The bchA locus, which encodes the chlorin reductase, is found to be made up of three separate, translationally coupled genes, referred to as bchX, bchY, and bchZ. Amino acid similarities between bchX, bchL, and the nitrogenase reductase protein nifH suggest that all three classes of proteins share certain three-dimensional structural features, including elements that are central to the enzymatic mechanism of nifH. PChlide reductase and chlorin reductase are clearly derived from a common ancestor. Several lines of analysis suggests the ancestor of both enzyme systems reduced PChlide twice to produce bacteriochlorophyll supporting the concept bacteriochlorophyll as the ancestral reaction center pigment.

  8. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  9. Functional Diversity in Fungal Fatty Acid Synthesis

    PubMed Central

    Blacklock, Brenda J.; Scheffler, Brian E.; Shepard, Michael R.; Jayasuriya, Naomi; Minto, Robert E.

    2010-01-01

    Acetylenic specialized metabolites containing one or more carbon-carbon triple bonds are widespread, being found in fungi, vascular and lower plants, marine sponges and algae, and insects. Plants, moss, and most recently, insects, have been shown to employ an energetically difficult, sequential dehydrogenation mechanism for acetylenic bond formation. Here, we describe the cloning and heterologous expression in yeast of a linoleoyl 12-desaturase (acetylenase) and a bifunctional desaturase with Δ12-/Δ14-regiospecificity from the Pacific golden chanterelle. The acetylenase gene, which is the first identified from a fungus, is phylogenetically distinct from known plant and fungal desaturases. Together, the bifunctional desaturase and the acetylenase provide the enzymatic activities required to drive oleate through linoleate to crepenynate and the conjugated enyne (14Z)-dehydrocrepenynate, the branchpoint precursors to a major class of acetylenic natural products. PMID:20606235

  10. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  11. A carotenogenic gene cluster from Brevibacterium linens with novel lycopene cyclase genes involved in the synthesis of aromatic carotenoids.

    PubMed

    Krubasik, P; Sandmann, G

    2000-04-01

    The carotenogenic (crt) gene cluster from Brevibacterium linens, a member of the commercially important group of coryneform bacteria, was cloned and identified. An expression library of B. linens genes was constructed and a fragment of the crt cluster was obtained by functional complementation of a colourless B. flavum mutant, screening transformed cells for production of a yellow pigment. Subsequent screening of a cosmid library resulted in the cloning of the whole crt cluster from B. linens. All genes necessary for the synthesis of the aromatic carotenoid isorenieratene were identified on the basis of sequence homologies. In addition a novel type of lycopene cyclase was identified by complementation of a lycopene-accumulating B. flavum mutant. Two genes, named crt Yc and crt Yd, which code for polypeptides of 125 and 107 amino acids, respectively, are necessary to convert lycopene to beta-carotene. The amino acid sequences of these polypeptides show no similarity to any of the known lycopene cyclases. This is the first example of a carotenoid biosynthetic conversion in which two different gene products are involved, probably forming a heterodimer.

  12. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.

    PubMed Central

    Brandl, M T; Lindow, S E

    1996-01-01

    Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cultures supplemented with L-tryptophan. The deduced amino acid sequence of the gene product has high similarity to that of the indolepyruvate decarboxylase of Enterobacter cloacae. Regions within pyruvate decarboxylases of various fungal and plant species also exhibited considerable homology to portions of this gene. This gene therefore presumably encodes an indolepyruvate decarboxylase (IpdC) which catalyzes the conversion of indole-3-pyruvic acid to indole-3-acetaldehyde. Insertions of Tn3-spice within ipdC abolished the ability of strain 299R to synthesize indole-3-acetaldehyde and tryptophol and reduced its IAA production in tryptophan-supplemented minimal medium by approximately 10-fold, thus providing genetic evidence for the role of the indolepyruvate pathway in IAA synthesis in this strain. An ipdC probe hybridized strongly with the genomic DNA of all E. herbicola strains tested in Southern hybridization studies, suggesting that the indolepyruvate pathway is common in this species. Maximum parsimony analysis revealed that the ipdC gene is highly conserved within this group and that strains of diverse geographic origin were very similar with respect to ipdC. PMID:8900003

  13. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  14. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  15. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  16. Identification of genes and gene clusters involved in mycotoxin synthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Research methods to identify and characterize genes involved in mycotoxin biosynthetic pathways have evolved considerably over the years. Before whole genome sequences were available (e.g. pre-genomics), work focused primarily on chemistry, biosynthetic mutant strains and molecular analysis of sing...

  17. Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.

    PubMed

    Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen

    2017-04-01

    Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis.

  18. Suppressing Sorbitol Synthesis Substantially Alters the Global Expression Profile of Stress Response Genes in Apple (Malus domestica) Leaves.

    PubMed

    Wu, Ting; Wang, Yi; Zheng, Yi; Fei, Zhangjun; Dandekar, Abhaya M; Xu, Kenong; Han, Zhenhai; Cheng, Lailiang

    2015-09-01

    Sorbitol is a major product of photosynthesis in apple (Malus domestica) that is involved in carbohydrate metabolism and stress tolerance. However, little is known about how the global transcript levels in apple leaves respond to decreased sorbitol synthesis. In this study we used RNA sequencing (RNA-seq) profiling to characterize the transcriptome of leaves from transgenic lines of the apple cultivar 'Greensleeves' exhibiting suppressed expression of aldose-6-phosphate reductase (A6PR) to gain insights into sorbitol function and the consequences of decreased sorbitol synthesis on gene expression. We observed that, although the leaves of the low sorbitol transgenic lines accumulate higher levels of various primary metabolites, only very limited changes were found in the levels of transcripts associated with primary metabolism. We suggest that this is indicative of post-transcriptional and/or post-translational regulation of primary metabolite accumulation and central carbon metabolism. However, we identified significantly enriched gene ontology terms belonging to the 'stress related process' category in the antisense lines (P-value < 0.05). These include genes involved in the synthesis/degradation of abscisic acid, salicylic acid and jasmonic acid, nucleotide-binding site leucine-rich repeat (NBS-LRR) disease resistance genes and ATP-binding cassette (ABC) transporter genes. This suggests that sorbitol plays a role in the responses of apple trees to abiotic and biotic stresses.

  19. An Arabidopsis gene regulatory network for secondary cell wall synthesis

    SciTech Connect

    Taylor-Teeples, M.; Lin, L.; de Lucas, M.; Turco, G.; Toal, T. W.; Gaudinier, A.; Young, N. F.; Trabucco, G. M.; Veling, M. T.; Lamothe, R.; Handakumbura, P. P.; Xiong, G.; Wang, C.; Corwin, J.; Tsoukalas, A.; Zhang, L.; Ware, D.; Pauly, M.; Kliebenstein, D. J.; Dehesh, K.; Tagkopoulos, I.; Breton, G.; Pruneda-Paz, J. L.; Ahnert, S. E.; Kay, S. A.; Hazen, S. P.; Brady, S. M.

    2014-12-24

    The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. In this paper, we present a protein–DNA network between Arabidopsis thaliana transcription factors and secondary cell wall metabolic genes with gene expression regulated by a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. Finally, these interactions will serve as a foundation for understanding the regulation of a complex, integral plant component.

  20. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  1. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology

    2000-08-01

    Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer PRINCIPAL INVESTIGATOR: Francis P. Kuhajda, M.D. CONTRACTING ORGANIZATION...SUBTITLE 5. FUNDING NUMBERS Xenograft Studies of Fatty Acid Synthesis DAMD17-96-1-6235 Inhibition as Novel Therapy for Breast Cancer 6. AUTHOR(S...5012. 13. ABSTRACT (Maximum 200 Words) This grant proposed to study the effect of fatty acid synthesis inhibition in human breast cancer xenografts

  2. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  3. Regulation of lipid synthesis genes and milk fat production in human mammary epithelial cells during secretory activation.

    PubMed

    Mohammad, Mahmoud A; Haymond, Morey W

    2013-09-15

    Expression of genes for lipid biosynthetic enzymes during initiation of lactation in humans is unknown. Our goal was to study mRNA expression of lipid metabolic enzymes in human mammary epithelial cell (MEC) in conjunction with the measurement of milk fatty acid (FA) composition during secretory activation. Gene expression from mRNA isolated from milk fat globule (MFG) and milk FA composition were measured from 6 h to 42 days postpartum in seven normal women. Over the first 96 h postpartum, daily milk fat output increased severalfold and mirrored expression of genes for all aspects of lipid metabolism and milk FA production, including lipolysis at the MEC membrane, FA uptake from blood, intracellular FA transport, de novo FA synthesis, FA and glycerol activation, FA elongation, FA desaturation, triglyceride synthesis, cholesterol synthesis, and lipid droplet formation. Expression of the gene for a key lipid synthesis regulator, sterol regulatory element-binding transcription factor 1 (SREBF1), increased 2.0-fold by 36 h and remained elevated over the study duration. Expression of genes for estrogen receptor 1, thyroid hormone-responsive protein, and insulin-induced 2 increased progressively to plateau by 96 h. In contrast, mRNA of peroxisome proliferator-activated receptor-γ decreased severalfold. With onset of lactation, increased de novo synthesis of FA was the most prominent change in milk FA composition and mirrored the expression of FA synthesis genes. In conclusion, milk lipid synthesis and secretion in humans is a complex process requiring the orchestration of a wide variety of pathways of which SREBF1 may play a primary role.

  4. Exopolysaccharide (EPS) Synthesis by Oenococcus oeni: From Genes to Phenotypes

    PubMed Central

    Dimopoulou, Maria; Vuillemin, Marlène; Campbell-Sills, Hugo; Lucas, Patrick M.; Ballestra, Patricia; Miot-Sertier, Cécile; Favier, Marion; Coulon, Joana; Moine, Virginie; Doco, Thierry; Roques, Maryline; Williams, Pascale; Petrel, Melina; Gontier, Etienne; Moulis, Claire; Remaud-Simeon, Magali; Dols-Lafargue, Marguerite

    2014-01-01

    Oenococcus oeni is the bacterial species which drives malolactic fermentation in wine. The analysis of 50 genomic sequences of O. oeni (14 already available and 36 newly sequenced ones) provided an inventory of the genes potentially involved in exopolysaccharide (EPS) biosynthesis. The loci identified are: two gene clusters named eps1 and eps2, three isolated glycoside-hydrolase genes named dsrO, dsrV and levO, and three isolated glycosyltransferase genes named gtf, it3, it4. The isolated genes were present or absent depending on the strain and the eps gene clusters composition diverged from one strain to another. The soluble and capsular EPS production capacity of several strains was examined after growth in different culture media and the EPS structure was determined. Genotype to phenotype correlations showed that several EPS biosynthetic pathways were active and complementary in O. oeni. Can be distinguished: (i) a Wzy -dependent synthetic pathway, allowing the production of heteropolysaccharides made of glucose, galactose and rhamnose, mainly in a capsular form, (ii) a glucan synthase pathway (Gtf), involved in β-glucan synthesis in a free and a cell-associated form, giving a ropy phenotype to growth media and (iii) homopolysaccharide synthesis from sucrose (α-glucan or β-fructan) by glycoside-hydrolases of the GH70 and GH68 families. The eps gene distribution on the phylogenetic tree was examined. Fifty out of 50 studied genomes possessed several genes dedicated to EPS metabolism. This suggests that these polymers are important for the adaptation of O. oeni to its specific ecological niche, wine and possibly contribute to the technological performance of malolactic starters. PMID:24901216

  5. Inhibitory effect of p-coumaric acid by Rhodiola sachalinensis on melanin synthesis in B16F10 cells.

    PubMed

    Park, So-Hee; Kim, Dong-Seok; Park, Seo-Hyoung; Shin, Jung-Won; Youn, Sang-Woong; Park, Kyoung-Chan

    2008-04-01

    Rhodiola has been widely used in traditional Asian medicine. In this study, we tested the hypopigmentation effects of R. sachalinensis and its active compounds including catechin, chlorogenic acid, p-coumaric acid, and p-tyrosol. Results have shown that only p-coumaric acid inhibits melanin synthesis in B16F10 cells. However, p-coumaric acid did not inhibit tyrosinase activity when L-DOPA was used as a substrate. Instead, p-coumaric acid inhibited tyrosinase activity when L-tyrosine was used as a substrate. We further analyzed the changes of cAMP responsive element binding protein (CREB) phosphorylation and tyrosinase gene expression. The results indicate that p-coumaric acid does not affect CREB phosphorylation or tyrosinase protein production. In turn, these findings demonstrate that p-coumaric acid has no effect on the upstream regulation of tyrosinase gene expression, although p-coumaric acid showed a significant inhibitory effect on melanogenesis. Because p-coumaric acid showed different effects on tyrosinase activity according to different substrates, we tested whether tyrosinase can utilize p-coumaric acid as a substrate. Our findings revealed that competitive inhibition occurs between p-coumaric acid and tyrosine. Consequently, this finding could be a primary mechanism for the hypopigmenting action of p-coumaric acid.

  6. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  7. Escherichia coli tol and rcs genes participate in the complex network affecting curli synthesis.

    PubMed

    Vianney, Anne; Jubelin, Grégory; Renault, Sophie; Dorel, Corine; Lejeune, Philippe; Lazzaroni, Jean Claude

    2005-07-01

    Curli are necessary for the adherence of Escherichia coli to surfaces, and to each other, during biofilm formation, and the csgBA and csgDEFG operons are both required for their synthesis. A recent survey of gene expression in Pseudomonas aeruginosa biofilms has identified tolA as a gene activated in biofilms. The tol genes play a fundamental role in maintaining the outer-membrane integrity of Gram-negative bacteria. RcsC, the sensor of the RcsBCD phosphorelay, is involved, together with RcsA, in colanic acid capsule synthesis, and also modulates the expression of tolQRA and csgDEFG. In addition, the RcsBCD phosphorelay is activated in tol mutants or when Tol proteins are overexpressed. These results led the authors to investigate the role of the tol genes in biofilm formation in laboratory and clinical isolates of E. coli. It was shown that the adherence of cells was lowered in the tol mutants. This could be the result of a drastic decrease in the expression of the csgBA operon, even though the expression of csgDEFG was slightly increased under such conditions. It was also shown that the Rcs system negatively controls the expression of the two csg operons in an RcsA-dependent manner. In the tol mutants, activation of csgDEFG occurred via OmpR and was dominant upon repression by RcsB and RcsA, while these two regulatory proteins repressed csgBA through a dominant effect on the activator protein CsgD, thus affecting curli synthesis. The results demonstrate that the Rcs system, previously known to control the synthesis of the capsule and the flagella, is an additional component involved in the regulation of curli. Furthermore, it is shown that the defect in cell motility observed in the tol mutants depends on RcsB and RcsA.

  8. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  9. Gene Expressions for Signal Transduction under Acidic Conditions

    PubMed Central

    Fukamachi, Toshihiko; Ikeda, Syunsuke; Wang, Xin; Saito, Hiromi; Tagawa, Masatoshi; Kobayashi, Hiroshi

    2013-01-01

    Although it is now well known that some diseased areas, such as cancer nests, inflammation loci, and infarction areas, are acidified, little is known about cellular signal transduction, gene expression, and cellular functions under acidic conditions. Our group showed that different signal proteins were activated under acidic conditions compared with those observed in a typical medium of around pH 7.4 that has been used until now. Investigations of gene expression under acidic conditions may be crucial to our understanding of signal transduction in acidic diseased areas. In this study, we investigated gene expression in mesothelioma cells cultured at an acidic pH using a DNA microarray technique. After 24 h culture at pH 6.7, expressions of 379 genes were increased more than twofold compared with those in cells cultured at pH 7.5. Genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors numbered 35, 32, and 17 among the 379 genes, respectively. Since the functions of 78 genes are unknown, it can be argued that cells may have other genes for signaling under acidic conditions. The expressions of 37 of the 379 genes were observed to increase after as little as 2 h. After 24 h culture at pH 6.7, expressions of 412 genes were repressed more than twofold compared with those in cells cultured at pH 7.5, and the 412 genes contained 35, 76, and 7 genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors, respectively. These results suggest that the signal pathways in acidic diseased areas are different, at least in part, from those examined with cells cultured at a pH of around 7.4. PMID:24705103

  10. Linoleic acid isomerase gene FgLAI12 affects sensitivity to salicylic acid, mycelial growth and virulence of Fusarium graminearum

    PubMed Central

    Zhang, Ya-Zhou; Wei, Zhen-Zhen; Liu, Cai-Hong; Chen, Qing; Xu, Bin-Jie; Guo, Zhen-Ru; Cao, Yong-Li; Wang, Yan; Han, Ya-Nan; Chen, Chen; Feng, Xiang; Qiao, Yuan-Yuan; Zong, Lu-Juan; Zheng, Ting; Deng, Mei; Jiang, Qian-Tao; Li, Wei; Zheng, You-Liang; Wei, Yu-Ming; Qi, Peng-Fei

    2017-01-01

    Fusarium graminearum is the major causal agent of fusarium head blight in wheat, a serious disease worldwide. Linoleic acid isomerase (LAI) catalyses the transformation of linoleic acid (LA) to conjugated linoleic acid (CLA), which is beneficial for human health. We characterised a cis-12 LAI gene of F. graminearum (FGSG_02668; FgLAI12), which was downregulated by salicylic acid (SA), a plant defence hormone. Disruption of FgLAI12 in F. graminearum resulted in decreased accumulation of cis-9,trans-11 CLA, enhanced sensitivity to SA, and increased accumulation of LA and SA in wheat spikes during infection. In addition, mycelial growth, accumulation of deoxynivalenol, and pathogenicity in wheat spikes were reduced. Re-introduction of a functional FgLAI12 gene into ΔFgLAI12 recovered the wild-type phenotype. Fluorescent microscopic analysis showed that FgLAI12 protein was usually expressed in the septa zone of conidia and the vacuole of hyphae, but was expressed in the cell membrane of hyphae in response to exogenous LA, which may be an element of LA metabolism during infection by F. graminearum. The cis-12 LAI enzyme encoded by FgLAI12 is critical for fungal response to SA, mycelial growth and virulence in wheat. The gene FgLAI12 is potentially valuable for biotechnological synthesis of cis-9,trans-11 CLA. PMID:28387243

  11. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  12. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  13. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  14. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  15. Reassessment of the Genetic Regulation of Fatty Acid Synthesis in Escherichia coli: Global Positive Control by the Dual Functional Regulator FadR

    PubMed Central

    My, L.; Ghandour Achkar, N.; Viala, J. P.

    2015-01-01

    ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator

  16. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  17. Fatty acid regulates gene expression and growth of human prostate cancer PC-3 cells

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Chen, Y.; Tjandrawinata, R. R.

    2001-01-01

    It has been proposed that the omega-6 fatty acids increase the rate of tumor growth. Here we test that hypothesis in the PC-3 human prostate tumor. We found that the essential fatty acids, linoleic acid (LA) and arachidonic acid (AA), and the AA metabolite PGE(2) stimulate tumor growth while oleic acid (OA) and the omega-3 fatty acid, eicosapentaenoic acid (EPA) inhibited growth. In examining the role of AA in growth response, we extended our studies to analyze changes in early gene expression induced by AA. We demonstrate that c-fos expression is increased within minutes of addition in a dose-dependent manner. Moreover, the immediate early gene cox-2 is also increased in the presence of AA in a dose-dependent manner, while the constitutive cox-1 message was not increased. Three hours after exposure to AA, the synthesis of PGE(2) via COX-2 was also increased. Previous studies have demonstrated that AA was primarily delivered by low density lipoprotein (LDL) via its receptor (LDLr). Since it is known that hepatomas, acute myelogenous leukemia and colorectal tumors lack normal cholesterol feedback, we examined the role of the LDLr in growth regulation of the PC-3 prostate cancer cells. Analysis of ldlr mRNA expression and LDLr function demonstrated that human PC-3 prostate cancer cells lack normal feedback regulation. While exogenous LDL caused a significant stimulation of cell growth and PGE(2) synthesis, no change was seen in regulation of the LDLr by LDL. Taken together, these data show that normal cholesterol feedback of ldlr message and protein is lost in prostate cancer. These data suggest that unregulated over-expression of LDLr in tumor cells would permit increased availability of AA, which induces immediate early genes c-fos and cox-2 within minutes of uptake.

  18. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  19. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  20. Up-regulation of the expression of the gene for liver fatty acid-binding protein by long-chain fatty acids.

    PubMed Central

    Meunier-Durmort, C; Poirier, H; Niot, I; Forest, C; Besnard, P

    1996-01-01

    The role of fatty acids in the expression of the gene for liver fatty acid-binding protein (L-FABP) was investigated in the well-differentiated FAO rat hepatoma cell line. Cells were maintained in serum-free medium containing 40 microM BSA/320 microM oleate. Western blot analysis showed that oleate triggered an approx. 4-fold increase in the cytosolic L-FABP level in 16 h. Oleate specifically stimulated L-FABP mRNA in time-dependent and dose-dependent manners with a maximum 7-fold increase at 16 h in FAO cells. Preincubation of FAO cells with cycloheximide prevented the oleate-mediated induction of L-FABP mRNA, showing that protein synthesis was required for the action of fatty acids. Run-on transcription assays demonstrated that the control of L-FABP gene expression by oleate was, at least in part, transcriptional. Palmitic acid, oleic acid, linoleic acid, linolenic acid and arachidonic acid were similarly potent whereas octanoic acid was inefficient. This regulation was also found in normal hepatocytes. Therefore long-chain fatty acids are strong inducers of L-FABP gene expression. FAO cells constitute a useful tool for studying the underlying mechanism of fatty acid action. PMID:8912685

  1. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  2. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  3. Cloning and transcriptional regulation of genes responsible for synthesis of gangliosides.

    PubMed

    Zeng, Guichao; Yu, Robert K

    2008-04-01

    Ganglioside synthases are glycosyltransferases involved in the biosynthesis of glycoconjugates. A number of ganglioside synthase genes have been cloned and characterized. They are classified into different families of glycosyltransferases based on similarities of their amino acid sequences. Tissue-specific expression of these genes has been analyzed by hybridization using cDNA fragments. Enzymatic characterization with the expressed recombinant enzymes showed these enzymes differ in their donor and acceptor substrate specificities and other biochemical parameters. In vitro enzymatic analysis also showed that one linkage can be synthesized by multiple enzymes and one enzyme may be responsible for synthesis of multiple gangliosides. Following the cloning of the ganglioside synthase genes, the promoters of the key synthase genes in the ganglioside biosynthetic pathway have been cloned and analyzed. All of the promoters are TATA-less, lacking a CCAAT box but containing GC-rich boxes, characteristic of the house-keeping genes, although transcription of ganglioside synthase genes is subject to complex developmental and tissue-specific regulation. A set of cis-acting elements and transcription factors, including Sp1, AP2, and CREB, function in the proximal promoters. Negative-regulatory regions have also been defined in most of the promoters. We present here an overview of these genes and their transcriptional regulation.

  4. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  5. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  6. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  7. Influence of phenolic acids on indole acetic acid production and on the type III secretion system gene transcription in food-associated Pseudomonas fluorescens KM05.

    PubMed

    Myszka, Kamila; Schmidt, Marcin T; Olejnik-Schmidt, Agnieszka K; Leja, Katarzyna; Czaczyk, Katarzyna

    2014-12-01

    The purpose of these investigations was to evaluate the reduction capability of phenolic acids (ferulic, chlorogenic, gallic, and p-coumaric acids) on indole acetic acid synthesis by food-associated Pseudomonas fluorescens KM05. Specific genetic primer for the type III secretion system (TTSS) in P. fluorescens KM05 was designed and the influence of phenolic acids on its expression was investigated. In the work the ferulic and chlorogenic acids at the concentration of 0.02 and 0.04 μg/ml affected on bacterial growth pattern and the signal molecules production. The phenolic acids, that were appreciable effective against P. fluorescens KM05 indole acetic acid production, significantly suppressed TTSS gene.

  8. Fatty acid synthesis and pyruvate metabolism pathways remain active in dihydroartemisinin-induced dormant ring stages of Plasmodium falciparum.

    PubMed

    Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin

    2014-08-01

    Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment.

  9. Mutation of Host Δ9 Fatty Acid Desaturase Inhibits Brome Mosaic Virus RNA Replication between Template Recognition and RNA Synthesis

    PubMed Central

    Lee, Wai-Ming; Ishikawa, Masayuki; Ahlquist, Paul

    2001-01-01

    All positive-strand RNA viruses assemble their RNA replication complexes on intracellular membranes. Brome mosaic virus (BMV) replicates its RNA in endoplasmic reticulum (ER)-associated complexes in plant cells and the yeast Saccharomyces cerevisiae. BMV encodes RNA replication factors 1a, with domains implicated in RNA capping and helicase functions, and 2a, with a central polymerase-like domain. Factor 1a interacts independently with the ER membrane, viral RNA templates, and factor 2a to form RNA replication complexes on the perinuclear ER. We show that BMV RNA replication is severely inhibited by a mutation in OLE1, an essential yeast chromosomal gene encoding Δ9 fatty acid desaturase, an integral ER membrane protein and the first enzyme in unsaturated fatty acid synthesis. OLE1 deletion and medium supplementation show that BMV RNA replication requires unsaturated fatty acids, not the Ole1 protein, and that viral RNA replication is much more sensitive than yeast growth to reduced unsaturated fatty acid levels. In ole1 mutant yeast, 1a still becomes membrane associated, recruits 2a to the membrane, and recognizes and stabilizes viral RNA templates normally. However, RNA replication is blocked prior to initiation of negative-strand RNA synthesis. The results show that viral RNA synthesis is highly sensitive to lipid composition and suggest that proper membrane fluidity or plasticity is essential for an early step in RNA replication. The strong unsaturated fatty acid dependence also demonstrates that modulating fatty acid balance can be an effective antiviral strategy. PMID:11160714

  10. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  11. Gene quantification by the NanoGene assay is resistant to inhibition by humic acids.

    PubMed

    Kim, Gha-Young; Wang, Xiaofang; Ahn, Hosang; Son, Ahjeong

    2011-10-15

    NanoGene assay is a magnetic bead and quantum dot nanoparticles based gene quantification assay. It relies on a set of probe and signaling probe DNAs to capture the target DNA via hybridization. We have demonstrated the inhibition resistance of the NanoGene assay using humic acids laden genomic DNA (gDNA). At 1 μg of humic acid per mL, quantitiative PCR (qPCR) was inhibited to 0% of its quantification capability whereas NanoGene assay was able to maintain more than 60% of its quantification capability. To further increase the inhibition resistance of NanoGene assay at high concentration of humic acids, we have identified the specific mechanisms that are responsible for the inhibition. We examined five potential mechanisms with which the humic acids can partially inhibit our NanoGene assay. The mechanisms examined were (1) adsorption of humic acids on the particle surface; (2) particle aggregation induced by humic acids; (3) fluorescence quenching of quantum dots by humic acids during hybridization; (4) humic acids mimicking of target DNA; and (5) nonspecific binding between humic acids and target gDNA. The investigation showed that no adsorption of humic acids onto the particles' surface was observed for the humic acids' concentration. Particle aggregation and fluorescence quenching were also negligible. Humic acids also did not mimic the target gDNA except 1000 μg of humic acids per mL and hence should not contribute to the partial inhibition. Four of the above mechanisms were not related to the inhibition effect of humic acids particularly at the environmentally relevant concentrations (<100 μg/mL). However, a substantial amount of nonspecific binding was observed between the humic acids and target gDNA. This possibly results in lesser amount of target gDNA being captured by the probe and signaling DNA.

  12. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  13. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  14. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  15. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  16. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.

  17. Gene cloning, expression, and characterization of phenolic acid decarboxylase from Lactobacillus brevis RM84.

    PubMed

    Landete, José María; Rodríguez, Héctor; Curiel, José Antonio; de las Rivas, Blanca; Mancheño, José Miguel; Muñoz, Rosario

    2010-06-01

    Phenolic acid decarboxylase (PAD) catalyzes the synthesis of vinyl phenols from hydroxycinnamic acids. The gene encoding PAD from Lactobacillus brevis was cloned and expressed as a fusion protein in Escherichia coli. The recombinant PAD enzyme is a heat-labile enzyme that functions optimally at 22 degrees C and pH 6.0. The purified enzyme did not show thermostability at temperatures above 22 degrees C. L. brevis PAD is able to decarboxylate exclusively the hydroxycinnamic acids, such as p-coumaric, caffeic, and ferulic acids, with K (m) values of 0.98, 0.96, and 0.78 mM, respectively. The substrate specificity exhibited by L. brevis PAD is similar to the PAD isolated from Bacillus subtilis and B. pumilus, but different from that of L. plantarum and Pediococcus pentosaceus. As the C-terminal region may be involved in determining PAD substrate specificity and catalytic capacity, amino acid differences among these proteins could explain the differences observed. The substrate specificity shown by L. brevis PAD shows promise for the synthesis of high-added value products from plant wastes.

  18. Novel acid resistance genes from the metagenome of the Tinto River, an extremely acidic environment.

    PubMed

    Guazzaroni, María-Eugenia; Morgante, Verónica; Mirete, Salvador; González-Pastor, José E

    2013-04-01

    Microorganisms that thrive in acidic environments are endowed with specialized molecular mechanisms to survive under this extremely harsh condition. In this work, we performed functional screening of six metagenomic libraries from planktonic and rhizosphere microbial communities of the Tinto River, an extremely acidic environment, to identify genes involved in acid resistance. This approach has revealed 15 different genes conferring acid resistance to Escherichia coli, most of which encoding putative proteins of unknown function or previously described proteins not known to be related to acid resistance. Moreover, we were able to assign function to one unknown and three hypothetical proteins. Among the recovered genes were the ClpXP protease, the transcriptional repressor LexA and nucleic acid-binding proteins such as an RNA-binding protein, HU and Dps. Furthermore, nine of the retrieved genes were cloned and expressed in Pseudomonas putida and Bacillus subtilis and, remarkably, most of them were able to expand the capability of these bacteria to survive under severe acid stress. From this set of genes, four presented a broad-host range as they enhance the acid resistance of the three different organisms tested. These results expand our knowledge about the different strategies used by microorganisms to survive under extremely acid conditions.

  19. Transcriptional profiling of canola developing embryo and identification of the important roles of BnDof5.6 in embryo development and fatty acids synthesis.

    PubMed

    Deng, Wei; Yan, Fang; Zhang, Xiaolan; Tang, Yuwei; Yuan, Yujin

    2015-08-01

    Canola is an important vegetable oil crop globally, and the understanding of the molecular mechanism underlying fatty acids biosynthesis during seed embryo development is an important research goal. Here we report the transcriptional profiling analysis of developing canola embryos using RNA-sequencing (RNA-Seq) method. RNA-Seq analysis generated 58,579,451 sequence reads aligned with 32,243 genes. It was found that a total of 55 differential expression genes (DEGs) encoding 28 enzymes function in carbon flow to fatty acids of storage TAG. Most of the DEGs encoding above enzymes showed similar expression pattern, indicating the DEGs are cooperatively involved in carbon flow into fatty acids. In addition, 41 DEGs associated with signal transductions, transport and metabolic processing of auxin, gibberellin, abscisic acid, cytokinin and salicylic acids were found in the RNA-Seq database, which indicates the important roles of the phytohormones in controlling embryo development and fatty acids synthesis. 122 DEGs encoding transcriptional factor family members were found in developing canola embryos. Furthermore, BnDOF5.6, a zinc finger transcriptional factor gene, found in RNA-Seq database was down-regulated in developing canola embryos. The transgenic plants displayed reduced embryo sizes, decreased fatty acids contents and altered seed fatty acids composition in canola. Down-regulated of BnDof5.6 also changed the expression levels of genes involved in fatty acids synthesis and desaturation. Our results indicate that BnDof5.6 is required for embryo development and fatty acids synthesis in canola. Overall this study presents new information on the global expression patterns of genes during embryo development and will expand our understanding of the complex molecular mechanism of carbon flow into fatty acids and embryo development in canola.

  20. Extensive horizontal gene transfer, duplication, and loss of chlorophyll synthesis genes in the algae

    DOE PAGES

    Hunsperger, Heather M.; Randhawa, Tejinder; Cattolico, Rose Ann

    2015-02-10

    Two non-homologous, isofunctional enzymes catalyze the penultimate step of chlorophyll a synthesis in oxygenic photosynthetic organisms such as cyanobacteria, eukaryotic algae and land plants: the light independent (LIPOR) and light-dependent (POR) protochlorophyllide oxidoreductases. Whereas the distribution of these enzymes in cyanobacteria and land plants is well understood, the presence, loss, duplication, and replacement of these genes have not been surveyed in the polyphyletic and remarkably diverse eukaryotic algal lineages.

  1. Phylogenetic, Molecular, and Biochemical Characterization of Caffeic Acid o-Methyltransferase Gene Family in Brachypodium distachyon

    PubMed Central

    Wu, Xianting; Wu, Jiajie; Luo, Yangfan; Bragg, Jennifer; Anderson, Olin; Vogel, John; Gu, Yong Q.

    2013-01-01

    Caffeic acid o-methyltransferase (COMT) is one of the important enzymes controlling lignin monomer production in plant cell wall synthesis. Analysis of the genome sequence of the new grass model Brachypodium distachyon identified four COMT gene homologs, designated as BdCOMT1, BdCOMT2, BdCOMT3, and BdCOMT4. Phylogenetic analysis suggested that they belong to the COMT gene family, whereas syntenic analysis through comparisons with rice and sorghum revealed that BdCOMT4 on Chromosome 3 is the orthologous copy of the COMT genes well characterized in other grass species. The other three COMT genes are unique to Brachypodium since orthologous copies are not found in the collinear regions of rice and sorghum genomes. Expression studies indicated that all four Brachypodium COMT genes are transcribed but with distinct patterns of tissue specificity. Full-length cDNAs were cloned in frame into the pQE-T7 expression vector for the purification of recombinant Brachypodium COMT proteins. Biochemical characterization of enzyme activity and substrate specificity showed that BdCOMT4 has significant effect on a broad range of substrates with the highest preference for caffeic acid. The other three COMTs had low or no effect on these substrates, suggesting that a diversified evolution occurred on these duplicate genes that not only impacted their pattern of expression, but also altered their biochemical properties. PMID:23431288

  2. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.

    PubMed

    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus

    2014-10-13

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  3. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.

    PubMed

    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G

    1998-06-01

    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  4. Analysis of ldh genes in Lactobacillus casei BL23: role on lactic acid production.

    PubMed

    Rico, Juan; Yebra, María Jesús; Pérez-Martínez, Gaspar; Deutscher, Josef; Monedero, Vicente

    2008-06-01

    Lactobacillus casei is a lactic acid bacterium that produces L-lactate as the main product of sugar fermentation via L-lactate dehydrogenase (Ldh1) activity. In addition, small amounts of the D-lactate isomer are produced by the activity of a D-hydroxycaproate dehydrogenase (HicD). Ldh1 is the main L-lactate producing enzyme, but mutation of its gene does not eliminate L-lactate synthesis. A survey of the L. casei BL23 draft genome sequence revealed the presence of three additional genes encoding Ldh paralogs. In order to study the contribution of these genes to the global lactate production in this organism, individual, as well as double mutants (ldh1 ldh2, ldh1 ldh3, ldh1 ldh4 and ldh1 hicD) were constructed and lactic acid production was assessed in culture supernatants. ldh2, ldh3 and ldh4 genes play a minor role in lactate production, as their single mutation or a mutation in combination with an ldh1 deletion had a low impact on L-lactate synthesis. A Deltaldh1 mutant displayed an increased production of D-lactate, which was probably synthesized via the activity of HicD, as it was abolished in a Deltaldh1 hicD double mutant. Contrarily to HicD, no Ldh1, Ldh2, Ldh3 or Ldh4 activities could be detected by zymogram assays. In addition, these assays revealed the presence of extra bands exhibiting D-/L-lactate dehydrogenase activity, which could not be attributed to any of the described genes. These results suggest that L. casei BL23 possesses a complex enzymatic system able to reduce pyruvic to lactic acid.

  5. Gene Composer: database software for protein construct design, codon engineering, and gene synthesis

    PubMed Central

    Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance

    2009-01-01

    Background To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. Results An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. Conclusion We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis

  6. Consequences of PPARα Invalidation on Glutathione Synthesis: Interactions with Dietary Fatty Acids

    PubMed Central

    Guelzim, Najoua; Huneau, Jean-François; Mathé, Véronique; Quignard-Boulangé, Annie; Martin, Pascal G.; Tomé, Daniel; Hermier, Dominique

    2011-01-01

    Glutathione (GSH) derives from cysteine and plays a key role in redox status. GSH synthesis is determined mainly by cysteine availability and γ-glutamate cysteine ligase (γGCL) activity. Because PPARα activation is known to control the metabolism of certain amino acids, GSH synthesis from cysteine and related metabolisms were explored in wild-type (WT) and PPARα-null (KO) mice, fed diets containing either saturated (COCO diet) or 18 : 3 n-3, LIN diet. In mice fed the COCO diet, but not in those fed the LIN diet, PPARα deficiency enhanced hepatic GSH content and γGCL activity, superoxide dismutase 2 mRNA levels, and plasma uric acid concentration, suggesting an oxidative stress. In addition, in WT mice, the LIN diet increased the hepatic GSH pool, without effect on γGCL activity, or change in target gene expression, which rules out a direct effect of PPARα. This suggests that dietary 18 : 3 n-3 may regulate GSH metabolism and thus mitigate the deleterious effects of PPARα deficiency on redox status, without direct PPARα activation. PMID:21915176

  7. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis

    PubMed Central

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-01-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 − were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis. PMID:27162276

  8. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis.

    PubMed

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-04-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 (-) were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis.

  9. An Arabidopsis gene regulatory network for secondary cell wall synthesis

    DOE PAGES

    Taylor-Teeples, M.; Lin, L.; de Lucas, M.; ...

    2014-12-24

    The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. In this paper, we present a protein–DNA network between Arabidopsis thaliana transcription factors and secondary cell wall metabolic genes with gene expression regulated bymore » a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. Finally, these interactions will serve as a foundation for understanding the regulation of a complex, integral plant component.« less

  10. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  11. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  12. Overproduction of α-Lipoic Acid by Gene Manipulated Escherichia coli

    PubMed Central

    Sun, Yirong; Zhang, Wenbin; Ma, Jincheng; Pang, Hongshen; Wang, Haihong

    2017-01-01

    Alpha-lipoic acid (LA) is an important enzyme cofactor widely used by organisms and is also a natural antioxidant for the treatment of pathologies driven by low levels of endogenous antioxidants. In order to establish a safer and more efficient process for LA production, we developed a new biological method for LA synthesis based on the emerging knowledge of lipoic acid biosynthesis. We first cloned the lipD gene, which encodes the lipoyl domain of the E2 subunit of pyruvate dehydrogenase, allowing high levels of LipD production. Plasmids containing genes for the biosynthesis of LA were subsequently constructed utilizing various vectors and promotors to produce high levels of LA. These plasmids were transformed into the Escherichia coli strain BL21. Octanoic acid (OA) was used as the substrate for LA synthesis. One transformant, YS61, which carried lipD, lplA, and lipA, produced LA at levels over 200-fold greater than the wild-type strain, showing that LA could be produced efficiently in E. coli using genetic engineering methods. PMID:28068366

  13. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei

    2011-01-01

    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  14. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng

    2009-07-01

    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  15. Regulation of hepatic gene expression by saturated fatty acids.

    PubMed

    Vallim, T; Salter, A M

    2010-01-01

    Diets rich in saturated fatty acids have long been associated with increased plasma cholesterol concentrations and hence increased risk of cardiovascular disease. More recently, they have also been suggested to promote the development of non-alcoholic fatty liver disease. While there is now considerable evidence to suggest that polyunsaturated fatty acids exert many of their effects through regulating the activity of transcription factors, including peroxisome proliferator activated receptors, sterol regulatory binding proteins (SREBPs) and liver X receptor, our understanding of how saturated fatty acids act is still limited. Here we review the potential mechanisms whereby saturated fatty acids modulate hepatic lipid metabolism thereby impacting on the synthesis, storage and secretion of lipids. Evidence is presented that their effects are, at least partly, mediated through modulation of the activity of the SREBP family of transcription factors.

  16. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.

    1966-01-01

    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  17. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  18. Highly expressed amino acid biosynthesis genes revealed by global gene expression analysis of Salmonella enterica serovar Enteritidis during growth in whole egg are not essential for this growth.

    PubMed

    Jakočiūnė, Džiuginta; Herrero-Fresno, Ana; Jelsbak, Lotte; Olsen, John Elmerdahl

    2016-05-02

    Salmonella enterica serovar Enteritidis (S. Enteritidis) is the most common cause of egg borne salmonellosis in many parts of the world. This study analyzed gene expression of this bacterium during growth in whole egg, and whether highly expressed genes were essential for the growth. High quality RNA was extracted from S. Enteritidis using a modified RNA-extraction protocol. Global gene expression during growth in whole egg was compared to growth in LB-medium using DNA array method. Twenty-six genes were significantly upregulated during growth in egg; these belonged to amino acid biosynthesis, di/oligopeptide transport system, biotin synthesis, ferrous iron transport system, and type III secretion system. Significant downregulation of 15 genes related to formate hydrogenlyase (FHL) and trehalose metabolism was observed. The results suggested that S. Enteritidis is starved for amino-acids, biotin and iron when growing in egg. However, site specific mutation of amino acid biosynthesis genes asnA (17.3 fold upregulated), asnB (18.6 fold upregulated), asnA/asnB and, serA (12.0 fold upregulated) and gdhA (3.7 fold upregulated), did not result in growth attenuation, suggesting that biosynthesis using the enzymes encoded from these genes may represent the first choice for S. Enteritidis when growing in egg, but when absent, the bacterium could use alternative ways to obtain the amino acids.

  19. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  20. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  1. Production of γ-linolenic acid and stearidonic acid by Synechococcus sp. PCC7002 containing cyanobacterial fatty acid desaturase genes

    NASA Astrophysics Data System (ADS)

    Dong, Xuewei; He, Qingfang; Peng, Zhenying; Yu, Jinhui; Bian, Fei; Li, Youzhi; Bi, Yuping

    2016-07-01

    Genetic modification is useful for improving the nutritional qualities of cyanobacteria. To increase the total unsaturated fatty acid content, along with the ratio of ω-3/ω-6 fatty acids, genetic engineering can be used to modify fatty acid metabolism. Synechococcus sp. PCC7002, a fast-growing cyanobacterium, does not contain a Δ6 desaturase gene and is therefore unable to synthesize γ-linolenic acid (GLA) and stearidonic acid (SDA), which are important in human health. In this work, we constructed recombinant vectors Syd6D, Syd15D and Syd6Dd15D to express the Δ15 desaturase and Δ6 desaturase genes from Synechocystis PCC6803 in Synechococcus sp. PCC7002, with the aim of expressing polyunsaturated fatty acids. Overexpression of the Δ15 desaturase gene in Synechococcus resulted in 5.4 times greater accumulation of α-linolenic acid compared with the wild-type while Δ6 desaturase gene expression produced both GLA and SDA. Co-expression of the two genes resulted in low-level accumulation of GLA but much larger amounts of SDA, accounting for as much to 11.64% of the total fatty acid content.

  2. Retinoic acid-related orphan receptor α regulates diurnal rhythm and fasting induction of sterol 12α-hydroxylase in bile acid synthesis.

    PubMed

    Pathak, Preeti; Li, Tiangang; Chiang, John Y L

    2013-12-27

    Sterol 12α-hydroxylase (CYP8B1) is required for cholic acid synthesis and plays a critical role in intestinal cholesterol absorption and pathogenesis of cholesterol gallstone, dyslipidemia, and diabetes. In this study we investigated the underlying mechanism of fasting induction and circadian rhythm of CYP8B1 by a cholesterol-activated nuclear receptor and core clock gene retinoic acid-related orphan receptor α (RORα). Fasting stimulated, whereas restricted-feeding reduced expression of CYP8B1 mRNA and protein. However, fasting and feeding had little effect on the diurnal rhythm of RORα mRNA expression, but fasting increased RORα protein levels by cAMP-activated protein kinase A-mediated phosphorylation and stabilization of the protein. Adenovirus-mediated gene transduction of RORα to mice strongly induced CYP8B1 expression, and increased liver cholesterol and 12α-hydroxylated bile acids in the bile acid pool and serum. A reporter assay identified a functional RORα response element in the CYP8B1 promoter. RORα recruited cAMP response element-binding protein-binding protein (CBP) to stimulate histone acetylation on the CYP8B1 gene promoter. In conclusion, RORα is a key regulator of diurnal rhythm and fasting induction of CYP8B1, which regulates bile acid composition and serum and liver cholesterol levels. Antagonizing RORα activity may be a therapeutic strategy for treating inflammatory diseases such as non-alcoholic fatty liver disease and type 2 diabetes.

  3. MUTANT GENES REGULATING THE INDUCIBILITY OF KYNURENINE SYNTHESIS.

    PubMed

    RIZKI, T M

    1964-05-01

    Alterations in the cellular synthesis of kynurenine in the larval fatbody of Drosophila melanogaster may be obtained by feeding the precursor tryptophan or by changing the genotype. In the wild type Ore-R strain, autofluorescent kynurenine globules normally occur in the cells in the anterior regions of the fatbody designated as regions 1, 2, and 3. When tryptophan is included in the larval diet, kynurenine will develop throughout the entire fatbody, thus extending to the cells in regions 4, 5, and 6. In the fatbodies of both the sepia mutant strain and the mutant combinations of the suppressible vermilion alleles with the suppressor gene (su(2)-s, v(1) and su(2)-s, v(2)), kynurenine is found in the cells from region 1 through region 4. This involvement of additional cells in the synthesis of kynurenine occurs under the usual culture conditions for Drosophila. When sepia larvae are fed tryptophan, kynurenine appears in all of the cells of the fatbody. However, dietary tryptophan does not induce kynurenine production in cells in regions 5 and 6 in the mutant combination su(2)-s, v(1) or su(2)-s, v(2). In the latter strains, an increase in the quantity of kynurenine in the fatbody is detected, but this increase remains limited to the same cells in which kynurenine production is found under normal feeding conditions. When the v(36f) allele is combined with the su(2)-s allele, an extremely faint autofluorescence characteristic of kynurenine is found in some of the anteriormost fat cells of regions 1 and 2. This autofluorescence becomes intensified when tryptophan is fed to su(2)-s, v(36f) larvae. The genetic control of kynurenine synthesis in the cells of the fatbody of Drosophila melanogaster has been previously demonstrated. The present observations establish genetic regulation of the ability to induce kynurenine production within a cell through the administration of the inducer tryptophan. Kynurenine production has been considered as a unit function of the cell as a

  4. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.

    PubMed

    Suć, Josipa; Jerić, Ivanka

    2015-01-01

    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  5. A convenient synthesis of anthranilic acids by Pd-catalyzed direct intermolecular ortho-C-H amidation of benzoic acids.

    PubMed

    Ng, Ka-Ho; Ng, Fo-Ning; Yu, Wing-Yiu

    2012-12-11

    An efficient method for synthesis of anthranilic acids by Pd-catalyzed ortho-C-H amidation of benzoic acids is disclosed. The amidation is proposed to proceed by carboxylate-assisted ortho-C-H palladation to form an arylpalladium(II) complex, followed by nitrene insertion to the Pd-C bond.

  6. ORAL AND INTRAVENOUSLY ADMINISTERED AMINO ACIDS PRODUCE SIMILAR EFFECTS ON MUSCLE PROTEIN SYNTHESIS IN THE ELDERLY

    PubMed Central

    Rasmussen, B.B.; Wolfe, R.R.; Volpi, E.

    2011-01-01

    BACKGROUND Muscle protein synthesis is stimulated in the elderly when amino acid availability is increased. OBJECTIVE To determine which mode of delivery of amino acids (intravenous vs. oral ingestion) is more effective in stimulating the rate of muscle protein synthesis in elderly subjects. DESIGN Fourteen elderly subjects were assigned to one of two groups. Following insertion of femoral arterial and venous catheters, subjects were infused with a primed, continuous infusion of L-[ring-2H5] phenylalanine. Blood samples and muscle biopsies were obtained to measure muscle protein fractional synthesis rate (FSR) with the precursor-product model, phenylalanine kinetics across the leg with the three-pool model, and whole body phenylalanine kinetics. Protein metabolism parameters were measured in the basal period, and during the administration of oral amino acids (n=8) or a similar amount of intravenous amino acids (n=6). RESULTS Enteral and parenteral amino acid administration increased amino acid arterial concentrations and delivery to the leg to a similar extent in both groups. Muscle protein synthesis as measured by both FSR, and the three-pool model, increased during amino acid administration (P < 0.05 vs. basal) in both groups with no differences between groups. Whole body proteolysis did not change with the oral amino acids whereas it increased slightly during parenteral amino acid administration. CONCLUSIONS Increased amino acid availability stimulates the rate of muscle protein synthesis independent of the route of administration (enteral vs. parenteral). PMID:12459885

  7. Synthesis of methylphosphonic acid by marine microbes: a source for methane in the aerobic ocean.

    PubMed

    Metcalf, William W; Griffin, Benjamin M; Cicchillo, Robert M; Gao, Jiangtao; Janga, Sarath Chandra; Cooke, Heather A; Circello, Benjamin T; Evans, Bradley S; Martens-Habbena, Willm; Stahl, David A; van der Donk, Wilfred A

    2012-08-31

    Relative to the atmosphere, much of the aerobic ocean is supersaturated with methane; however, the source of this important greenhouse gas remains enigmatic. Catabolism of methylphosphonic acid by phosphorus-starved marine microbes, with concomitant release of methane, has been suggested to explain this phenomenon, yet methylphosphonate is not a known natural product, nor has it been detected in natural systems. Further, its synthesis from known natural products would require unknown biochemistry. Here we show that the marine archaeon Nitrosopumilus maritimus encodes a pathway for methylphosphonate biosynthesis and that it produces cell-associated methylphosphonate esters. The abundance of a key gene in this pathway in metagenomic data sets suggests that methylphosphonate biosynthesis is relatively common in marine microbes, providing a plausible explanation for the methane paradox.

  8. Structure and expression of the Drosophila ubiquitin-80-amino-acid fusion-protein gene.

    PubMed Central

    Barrio, R; del Arco, A; Cabrera, H L; Arribas, C

    1994-01-01

    In the fruitfly Drosophila, as in all eukaryotes examined so far, some ubiquitin-coding sequences appear fused to unrelated open reading frames. Two of these fusion genes have been previously described (the homologues of UBI1-UBI2 and UBI4 in yeast), and we report here the organization and expression of a third one, the DUb80 gene (the homologue of UBI3 in yeast). This gene encodes a ubiquitin monomer fused to an 80-amino-acid extension which is homologous with the ribosomal protein encoded by the UB13 gene. The 5' regulatory region of DUb80 shares common features with another ubiquitin fusion gene, DUb52, and with the ribosomal protein genes of Drosophila, Xenopus and mouse. We also find helix-loop-helix protein-binding sequences (E-boxes). The DUb80 gene is transcribed to a 0.9 kb mRNA which is particularly abundant under conditions of high protein synthesis, such as in ovaries and exponentially growing cells. Images Figure 3 Figure 4 PMID:8068011

  9. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  10. Energy, genes and evolution: introduction to an evolutionary synthesis

    PubMed Central

    Lane, Nick; Martin, William F.; Raven, John A.; Allen, John F.

    2013-01-01

    Life is the harnessing of chemical energy in such a way that the energy-harnessing device makes a copy of itself. No energy, no evolution. The ‘modern synthesis’ of the past century explained evolution in terms of genes, but this is only part of the story. While the mechanisms of natural selection are correct, and increasingly well understood, they do little to explain the actual trajectories taken by life on Earth. From a cosmic perspective—what is the probability of life elsewhere in the Universe, and what are its probable traits?—a gene-based view of evolution says almost nothing. Irresistible geological and environmental changes affected eukaryotes and prokaryotes in very different ways, ones that do not relate to specific genes or niches. Questions such as the early emergence of life, the morphological and genomic constraints on prokaryotes, the singular origin of eukaryotes, and the unique and perplexing traits shared by all eukaryotes but not found in any prokaryote, are instead illuminated by bioenergetics. If nothing in biology makes sense except in the light of evolution, nothing in evolution makes sense except in the light of energetics. This Special Issue of Philosophical Transactions examines the interplay between energy transduction and genome function in the major transitions of evolution, with implications ranging from planetary habitability to human health. We hope that these papers will contribute to a new evolutionary synthesis of energetics and genetics. PMID:23754807

  11. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

    PubMed

    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

    2017-03-01

    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins.

  12. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.

    PubMed

    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes

    2014-05-01

    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  13. Effects of oral eicosapentaenoic acid versus docosahexaenoic acid on human peripheral blood mononuclear cell gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objective: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have beneficial effects on inflammation and cardiovascular disease (CVD). Our aim was to assess the effect of a six-week supplementation with either olive oil, EPA, or DHA on gene expression in peripheral blood mononuclear cells (...

  14. Sugar-mediated semidian oscillation of gene expression in the cassava storage root regulates starch synthesis

    SciTech Connect

    Jansson, Christer; Baguma, Yona; Sun, Chuanxin; Boren, Mats; Olsson, Helena; Rosenqvist, Sara; Mutisya, Joel; Rubaihayo, Patrick R.; Jansson, Christer

    2008-01-15

    Starch branching enzyme (SBE) activity in the cassava storage root exhibited a diurnal fluctuation, dictated by a transcriptional oscillation of the corresponding SBE genes. The peak of SBE activity coincided with the onset of sucrose accumulation in the storage, and we conclude that the oscillatory mechanism keeps the starch synthetic apparatus in the storage root sink in tune with the flux of sucrose from the photosynthetic source. When storage roots were uncoupled from the source, SBE expression could be effectively induced by exogenous sucrose. Turanose, a sucrose isomer that cannot be metabolized by plants, mimicked the effect of sucrose, demonstrating that downstream metabolism of sucrose was not necessary for signal transmission. Also glucose and glucose-1-P induced SBE expression. Interestingly, induction by sucrose, turanose and glucose but not glucose-1-P sustained an overt semidian (12-h) oscillation in SBE expression and was sensitive to the hexokinase (HXK) inhibitor glucosamine. These results suggest a pivotal regulatory role for HXK during starch synthesis. Abscisic acid (ABA) was another potent inducer of SBE expression. Induction by ABA was similar to that of glucose-1-P in that it bypassed the semidian oscillator. Both the sugar and ABA signaling cascades were disrupted by okadaic acid, a protein phosphatase inhibitor. Based on these findings, we propose a model for sugar signaling in regulation of starch synthesis in the cassava storage root.

  15. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  16. Genomic organization of the human lysosomal acid lipase gene (LIPA)

    SciTech Connect

    Aslandis, C.; Klima, H.; Lackner, K.J.; Schmitz, G. )

    1994-03-15

    Defects in the human lysosomal acid lipase gene are responsible for cholesteryl ester storage disease (CESD) and Wolman disease. Exon skipping as the cause for CESD has been demonstrated. The authors present here a summary of the exon structure of the entire human lysosomal acid lipase gene consisting of 10 exons, together with the sizes of genomic EcoRI and SacI fragments hybridizing to each exon. In addition, the DNA sequence of the putative promoter region is presented. The EMBL accession numbers for adjacent intron sequences are given. 7 refs., 2 figs., 1 tab.

  17. Enhanced Acid Tolerance in Bifidobacterium longum by Adaptive Evolution: Comparison of the Genes between the Acid-Resistant Variant and Wild-Type Strain.

    PubMed

    Jiang, Yunyun; Ren, Fazheng; Liu, Songling; Zhao, Liang; Guo, Huiyuan; Hou, Caiyun

    2016-03-01

    Acid stress can affect the viability of probiotics, especially Bifidobacterium. This study aimed to improve the acid tolerance of Bifidobacterium longum BBMN68 using adaptive evolution. The stress response, and genomic differences of the parental strain and the variant strain were compared by acid stress. The highest acid-resistant mutant strain (BBMN68m) was isolated from more than 100 asexual lines, which were adaptive to the acid stress for 10(th), 20(th), 30(th), 40(th), and 50(th) repeats, respectively. The variant strain showed a significant increase in acid tolerance under conditions of pH 2.5 for 2 h (from 7.92 to 4.44 log CFU/ml) compared with the wildtype strain (WT, from 7.87 to 0 log CFU/ml). The surface of the variant strain was also smoother. Comparative whole-genome analysis showed that the galactosyl transferase D gene (cpsD, bbmn68_1012), a key gene involved in exopolysaccharide (EPS) synthesis, was altered by two nucleotides in the mutant, causing alteration in amino acids, pI (from 8.94 to 9.19), and predicted protein structure. Meanwhile, cpsD expression and EPS production were also reduced in the variant strain (p < 0.05) compared with WT, and the exogenous WT-EPS in the variant strain reduced its acid-resistant ability. These results suggested EPS was related to acid responses of BBMN68.

  18. Expressing yeast SAMdc gene confers broad changes in gene expression and alters fatty acid composition in tomato fruit.

    PubMed

    Kolotilin, Igor; Koltai, Hinanit; Bar-Or, Carmiya; Chen, Lea; Nahon, Sahadia; Shlomo, Haviva; Levin, Ilan; Reuveni, Moshe

    2011-07-01

    Tomato (Solanum lycopersicum) fruits expressing a yeast S-adenosyl methionine decarboxylase (ySAMdc) gene under control of a ripening-induced promoter show altered phytonutrient content and broad changes in gene expression. Genome-wide transcriptional alterations in pericarp tissues of the ySAMdc-expressing fruits are shown. Consistent with the ySAMdc expression pattern from the ripening-induced promoter, very minor transcriptional alterations were detected at the mature green developmental stage. At the breaker and red stages, altered levels of numerous transcripts were observed with a general tendency toward upregulation in the transgenic fruits. Ontological analysis of up- and downregulated transcript groups revealed various affected metabolic processes, mainly carbohydrate and amino acid metabolism, and protein synthesis, which appeared to be intensified in the ripening transgenic fruits. Other functional ontological categories of altered transcripts represented signal transduction, transcription regulation, RNA processing, molecular transport and stress response, as well as metabolism of lipids, glycans, xenobiotics, energy, cofactors and vitamins. In addition, transcript levels of genes encoding structural enzymes for several biosynthetic pathways showed strong correlations to levels of specific metabolites that displayed altered levels in transgenic fruits. Increased transcript levels of fatty acid biosynthesis enzymes were accompanied by a change in the fatty acid profile of transgenic fruits, most notably increasing ω-3 fatty acids at the expense of other lipids. Thus, SAMdc is a prime target in manipulating the nutritional value of tomato fruits. Combined with analyses of selected metabolites in the overripe fruits, a model of enhanced homeostasis of the pericarp tissue in the polyamine-accumulating tomatoes is proposed.

  19. Sinorhizobium meliloti Functionally Replaces 3-Oxoacyl-Acyl Carrier Protein Reductase (FabG) by Overexpressing NodG During Fatty Acid Synthesis.

    PubMed

    Mao, Ya-Hui; Li, Feng; Ma, Jin-Cheng; Hu, Zhe; Wang, Hai-Hong

    2016-06-01

    In Sinorhizobium meliloti, the nodG gene is located in the nodFEG operon of the symbiotic plasmid. Although strong sequence similarity (53% amino acid identities) between S. meliloti NodG and Escherichia coli FabG was reported in 1992, it has not been determined whether S. meliloti NodG plays a role in fatty acid synthesis. We report that expression of S. meliloti NodG restores the growth of the E. coli fabG temperature-sensitive mutant CL104 under nonpermissive conditions. Using in vitro assays, we demonstrated that NodG is able to catalyze the reduction of the 3-oxoacyl-ACP intermediates in E. coli fatty acid synthetic reaction. Moreover, although deletion of the S. meliloti nodG gene does not cause any growth defects, upon overexpression of nodG from a plasmid, the S. meliloti fabG gene encoding the canonical 3-oxoacyl-ACP reductase (OAR) can be disrupted without any effects on growth or fatty acid composition. This indicates that S. meliloti nodG encodes an OAR and can play a role in fatty acid synthesis when expressed at sufficiently high levels. Thus, a bacterium can simultaneously possess two or more OARs that can play a role in fatty acid synthesis. Our data also showed that, although SmnodG increases alfalfa nodulation efficiency, it is not essential for alfalfa nodulation.

  20. Synthesis and cytotoxic activity of new betulin and betulinic acid esters with conjugated linoleic acid (CLA).

    PubMed

    Tubek, Barbara; Mituła, Paweł; Niezgoda, Natalia; Kempińska, Katarzyna; Wietrzyk, Joanna; Wawrzeńczyk, Czesław

    2013-04-01

    The synthesis of new ester derivatives of betulin (3a-c) and betulinic acid (4) with conjugated linoleic acid isomers (CLA; in a mixture of 43.4% 9c, 11t; 49.5% 10t, 12c; 7.1% other isomers) is presented. Esterification was carried out with N,N'-dicyclohexylcarbodiimide (DCC) as the coupling agent in the presence of 4-dimethylamino-pyridine (DMAP) in dichloromethane (or pyridine). The in vitro cytotoxic effect of betulin (1), betulinic acid (2), a mixture of CLA isomers and their derivatives (3a-c, 4) was examined using the MTT assay against four cancer cell lines (P388, CEM/C2, CCRF/CEM and HL-60) and the SRB assay on the HT-29 cell line. Ester 4 was the most active among the esters synthesized against the CEM/C2 cell line with an ID50 value 16.9 +/- 6.5 microg/mL. Betulin (1), betulinic acid (2) and CLA were the most active agents against the cancer cell lines studied.

  1. Activation of the constitutive androstane receptor inhibits gluconeogenesis without affecting lipogenesis or fatty acid synthesis in human hepatocytes

    SciTech Connect

    Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

    2014-08-15

    Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches. • The role

  2. Cyclopiazonic acid biosynthesis gene cluster gene cpaM is required for speradine A biosynthesis.

    PubMed

    Tokuoka, Masafumi; Kikuchi, Tomoki; Shinohara, Yasutomo; Koyama, Akifumi; Iio, Shin-Ichiro; Kubota, Takaaki; Kobayashi, Jun'ichi; Koyama, Yasuji; Totsuka, Akira; Shindo, Hitoshi; Sato, Kazuo

    2015-01-01

    Speradine A is a derivative of cyclopiazonic acid (CPA) found in culture of an Aspergillus tamarii isolate. Heterologous expression of a predicted methyltransferase gene, cpaM, in the cpa biosynthesis gene cluster of A. tamarii resulted in the speradine A production in a 2-oxoCPA producing A. oryzae strain, indicating cpaM is involved in the speradine A biosynthesis.

  3. Control of mammalian gene expression by amino acids, especially glutamine.

    PubMed

    Brasse-Lagnel, Carole; Lavoinne, Alain; Husson, Annie

    2009-04-01

    Molecular data rapidly accumulating on the regulation of gene expression by amino acids in mammalian cells highlight the large variety of mechanisms that are involved. Transcription factors, such as the basic-leucine zipper factors, activating transcription factors and CCAAT/enhancer-binding protein, as well as specific regulatory sequences, such as amino acid response element and nutrient-sensing response element, have been shown to mediate the inhibitory effect of some amino acids. Moreover, amino acids exert a wide range of effects via the activation of different signalling pathways and various transcription factors, and a number of cis elements distinct from amino acid response element/nutrient-sensing response element sequences were shown to respond to changes in amino acid concentration. Particular attention has been paid to the effects of glutamine, the most abundant amino acid, which at appropriate concentrations enhances a great number of cell functions via the activation of various transcription factors. The glutamine-responsive genes and the transcription factors involved correspond tightly to the specific effects of the amino acid in the inflammatory response, cell proliferation, differentiation and survival, and metabolic functions. Indeed, in addition to the major role played by nuclear factor-kappaB in the anti-inflammatory action of glutamine, the stimulatory role of activating protein-1 and the inhibitory role of C/EBP homology binding protein in growth-promotion, and the role of c-myc in cell survival, many other transcription factors are also involved in the action of glutamine to regulate apoptosis and intermediary metabolism in different cell types and tissues. The signalling pathways leading to the activation of transcription factors suggest that several kinases are involved, particularly mitogen-activated protein kinases. In most cases, however, the precise pathways from the entrance of the amino acid into the cell to the activation of gene

  4. Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis.

    PubMed Central

    Okuley, J; Lightner, J; Feldmann, K; Yadav, N; Lark, E; Browse, J

    1994-01-01

    The polyunsaturated fatty acids linoleate and alpha-linolenate are important membrane components and are the essential fatty acids of human nutrition. The major enzyme responsible for the synthesis of these compounds is the plant oleate desaturase of the endoplasmic reticulum, and its activity is controlled in Arabidopsis by the fatty acid desaturation 2 (fad2) locus. A fad2 allele was identified in a population of Arabidopsis in which mutations had been created by T-DNA insertions. Genomic DNA flanking the T-DNA was cloned by plasmid rescue and used to isolate cDNA and genomic clones of FAD2. A cDNA containing the entire FAD2 coding sequence was expressed in fad2 mutant plants and shown to complement the mutant fatty acid phenotype. The deduced amino acid sequence from the cDNA showed homology to other plant desaturases, and this confirmed that FAD2 is the structural gene for the desaturase. Gel blot analyses of FAD2 mRNA levels showed that the gene is expressed throughout the plant and suggest that transcript levels are in excess of the amount needed to account for oleate desaturation. Sequence analysis identified histidine-rich motifs that could contribute to an iron binding site in the cytoplasmic domain of the protein. Such a position would facilitate interaction between the desaturase and cytochrome b5, which is the direct source of electrons for the desaturation reaction, but would limit interaction of the active site with the fatty acyl substrate. PMID:7907506

  5. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  6. Role of the rfe gene in the synthesis of the O8 antigen in Escherichia coli K-12.

    PubMed Central

    Rick, P D; Hubbard, G L; Barr, K

    1994-01-01

    The Escherichia coli O8 antigen is a mannan composed of the trisaccharide repeat unit -->3)-alpha-Man-(1-->2)-alpha-Man-(1-->2)-alpha-Man-(1--> (K. Reske and K. Jann, Eur. J. Biochem. 67:53-56, 1972), and synthesis of the O8 antigen is rfe dependent (G. Schmidt, H. Mayer, and P. H. Mäkelä, J. Bacteriol. 127:755-762, 1976). The rfe gene has recently been identified as encoding a tunicamycin-sensitive UDP-GlcNAc:undecaprenylphosphate GlcNAc-1-phosphate transferase (U. Meier-Dieter, K. Barr, R. Starman, L. Hatch, and P. D. Rick, J. Biol. Chem. 267:746-753, 1992). However, the role of rfe in O8 side chain synthesis is not understood. Thus, the role of the rfe gene in the synthesis of the O8 antigen was investigated in an rfbO8+ (rfb genes encoding O8 antigen) derivative of E. coli K-12 mutant possessing a defective phosphoglucose isomerase (pgi). The in vivo synthesis of O8 side chains was inhibited by the antibiotic tunicamycin. In addition, putative lipid carrier-linked O8 side chains accumulated in vivo when lipopolysaccharide outer core synthesis was precluded by growing cells in the absence of exogenously supplied glucose. The lipid carrier-linked O8 antigen was extracted from cells and treated with mild acid in order to release free O8 side chains. The water-soluble O8 side chains were then purified by affinity chromatography using Sepharose-bound concanavalin A. Characterization of the affinity-purified O8 side chains revealed the occurrence of glucosamine in the reducing terminal position of the polysaccharide chains. The data presented suggest that GlcNAc-pyrophosphorylundecaprenol functions as the acceptor of mannose residues for the in vivo synthesis of O8 side chains in E. coli K-12. Images PMID:7514591

  7. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  8. Identification and expression of a stearoyl-ACP desaturase gene responsible for oleic acid accumulation in Xanthoceras sorbifolia seeds.

    PubMed

    Zhao, Na; Zhang, Yuan; Li, Qiuqi; Li, Rufang; Xia, Xinli; Qin, Xiaowei; Guo, Huihong

    2015-02-01

    Xanthoceras sorbifolia Bunge is an oilseed tree that grows well on barren lands in dry climate. Its seeds contain a large amount of oil rich in oleic acid (18:1(Δ9)) and linoleic acid (18:2(Δ9, 12)). However, the molecular regulation of oil biosynthesis in X. sorbifolia seeds is poorly understood. Stearoyl-ACP desaturase (SAD, EC 1.14.99.6) is a plastid-localized soluble desaturase that catalyzes the conversion of stearic acid (18:0) to oleic acid, which plays a key role in determining the ratio of saturated to unsaturated fatty acids. In this study, a full-length cDNA of XsSAD was isolated from developing X. sorbifolia embryos. The XsSAD open reading frame had 1194-bp, encoding a polypeptide of 397 amino acids. XsSAD expression in Escherichia coli cells resulted in increased 18:1(Δ9) level, confirming the biological activity of the enzyme encoded by XsSAD. XsSAD expression in Arabidopsis ssi2 mutants partially restored the morphological phenotype and effectively increased the 18:1(Δ9) level. The levels of other unsaturated fatty acids synthesized with 18:1(Δ9) as the substrate also increased to some degree. XsSAD in X. sorbifolia had a much higher expression in embryos than in leaves and petals. XsSAD expression also correlated well with the oleic acid, unsaturated fatty acid, and total fatty acid levels in developing embryos. These data suggested that XsSAD determined the synthesis of oleic acid and contributed to the accumulation of unsaturated fatty acid and total oil in X. sorbifolia seeds. A preliminary tobacco rattle virus-based virus-induced gene silencing system established in X. sorbifolia can also be helpful for further analyzing the functions of XsSAD and other oil synthesis-related genes in woody plants.

  9. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  10. Identification of nitrogen-fixing genes and gene clusters from metagenomic library of acid mine drainage.

    PubMed

    Dai, Zhimin; Guo, Xue; Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community.

  11. Identification of Nitrogen-Fixing Genes and Gene Clusters from Metagenomic Library of Acid Mine Drainage

    PubMed Central

    Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community. PMID:24498417

  12. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  13. Cadmium Induces Retinoic Acid Signaling by Regulating Retinoic Acid Metabolic Gene Expression*

    PubMed Central

    Cui, Yuxia; Freedman, Jonathan H.

    2009-01-01

    The transition metal cadmium is an environmental teratogen. In addition, cadmium and retinoic acid can act synergistically to induce forelimb malformations. The molecular mechanism underlying the teratogenicity of cadmium and the synergistic effect with retinoic acid has not been addressed. An evolutionarily conserved gene, β,β-carotene 15,15′-monooxygenase (BCMO), which is involved in retinoic acid biosynthesis, was studied in both Caenorhabditis elegans and murine Hepa 1–6 cells. In C. elegans, bcmo-1 was expressed in the intestine and was cadmium inducible. Similarly, in Hepa 1–6 cells, Bcmo1 was induced by cadmium. Retinoic acid-mediated signaling increased after 24-h exposures to 5 and 10 μm cadmium in Hepa 1–6 cells. Examination of gene expression demonstrated that the induction of retinoic acid signaling by cadmium may be mediated by overexpression of Bcmo1. Furthermore, cadmium inhibited the expression of Cyp26a1 and Cyp26b1, which are involved in retinoic acid degradation. These results indicate that cadmium-induced teratogenicity may be due to the ability of the metal to increase the levels of retinoic acid by disrupting the expression of retinoic acid-metabolizing genes. PMID:19556237

  14. Next-Gen Gene Synthesis Enables Large-Scale Engineering in Biological Systems: Recent advances in synthetic biology are making this field more promising than ever.

    PubMed

    Leake, Devin

    2015-01-01

    As scientists make strides toward the goal of developing a form of biological engineering that's as predictive and reliable as chemical engineering is for chemistry, one technology component has become absolutely critical: gene synthesis. Gene synthesis is the process of building stretches of deoxyribonucleic acid (DNA) to order--some stretches based on DNA that exists already in nature, some based on novel designs intended to accomplish new functions. This process is the foundation of synthetic biology, which is rapidly becoming the engineering counterpart to biology.

  15. Synthesis of unnatural amino acids from serine derivatives by beta-fragmentation of primary alkoxyl radicals.

    PubMed

    Boto, Alicia; Gallardo, Juan A; Hernández, Dacil; Hernández, Rosendo

    2007-09-14

    The fragmentation of primary alkoxyl radicals has been scarcely used in synthesis since other competing processes (such as oxidation or hydrogen abstraction) usually predominate. However, when serine derivatives were used as substrates, the scission took place in excellent yields. Tandem scission-allylation, -alkylation, or -arylation reactions were subsequently developed. This one-pot methodology was applied to the synthesis of unnatural amino acids, which are useful synthetic blocks or amino acid surrogates in peptidomimetics.

  16. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

    PubMed

    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

    2012-05-18

    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  17. Suppression of brain cholesterol synthesis in male Mecp2-deficient mice is age dependent and not accompanied by a concurrent change in the rate of fatty acid synthesis.

    PubMed

    Lopez, Adam M; Chuang, Jen-Chieh; Posey, Kenneth S; Turley, Stephen D

    2017-01-01

    Mutations in the X-linked gene methyl-CpG-binding protein 2 (MECP2) are the principal cause of Rett syndrome, a progressive neurodevelopmental disorder afflicting 1 in 10,000 to 15,000 females. Studies using hemizygous Mecp2 mouse models have revealed disruptions to some aspects of their lipid metabolism including a partial suppression of cholesterol synthesis in the brains of mature Mecp2 mutants. The present studies investigated whether this suppression is evident from early neonatal life, or becomes manifest at a later stage of development. We measured the rate of cholesterol synthesis, in vivo, in the brains of male Mecp2(-)(/y) and their Mecp2(+/y) littermates at 7, 14, 21, 28, 42 and 56 days of age. Brain weight was consistently lower in the Mecp2(-/y) mice than in their Mecp2(+/y) controls except at 7 days of age. In the 7- and 14-day-old mice there was no genotypic difference in the rate of brain cholesterol synthesis but, from 21 days and later, it was always marginally lower in the Mecp2(-/y) mice than in age-matched Mecp2(+/y) littermates. At no age was a genotypic difference detected in either the rate of fatty acid synthesis or cholesterol concentration in the brain. Cholesterol synthesis rates in the liver and lungs of 56-day-old Mecp2(-/y) mice were normal. The onset of lower rates of brain cholesterol synthesis at about the time closure of the blood brain barrier purportedly occurs might signify a disruption to mechanism(s) that dictate intracellular levels of cholesterol metabolites including oxysterols known to exert a regulatory influence on the cholesterol biosynthetic pathway.

  18. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  19. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement.

  20. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  1. Evolution of abscisic acid synthesis and signaling mechanisms.

    PubMed

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I

    2011-05-10

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  2. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  3. Polymer production by Klebsiella pneumoniae 4-hydroxyphenylacetic acid hydroxylase genes cloned in Escherichia coli.

    PubMed Central

    Gibello, A; Ferrer, E; Sanz, J; Martin, M

    1995-01-01

    The expression of Klebsiella pneumoniae hpaA and hpaH genes, which code for 4-hydroxyphenylacetic acid hydroxylase in Escherichia coli K-12 derivative strains, is associated with the production of a dark brown pigment in the cultures. This pigment has been identified as a polymer which shows several of the characteristics reported for microbial melanins and results from the oxidative activity of 4-hydroxyphenylacetic acid hydroxylase on some dihydroxylated compounds to form o-quinones. A dibenzoquinone is formed from the oxidation of different mono- or dihydroxylated aromatic compounds by the enzyme prior to polymerization. We report a hydroxylase activity, other than tyrosinase, that is associated with the synthesis of a bacterial melanin. PMID:8534083

  4. Cooperative Brønsted Acid-Type Organocatalysis for the Stereoselective Synthesis of Deoxyglycosides

    PubMed Central

    2016-01-01

    A practical approach for the α-stereoselective synthesis of deoxyglycosides using cooperative Brønsted acid-type organocatalysis has been developed. The method is tolerant of a wide range of glycoside donors and acceptors, and its versatility is exemplified in the one-pot synthesis of a trisaccharide. Mechanistic studies suggest that thiourea-induced acid amplification of the chiral acid via H-bonding is key for the enhancement in reaction rate and yield, while stereocontrol is dependent on the chirality of the acid. PMID:28004941

  5. A Δ-9 Fatty Acid Desaturase Gene in the Microalga Myrmecia incisa Reisigl: Cloning and Functional Analysis.

    PubMed

    Xue, Wen-Bin; Liu, Fan; Sun, Zheng; Zhou, Zhi-Gang

    2016-07-16

    The green alga Myrmecia incisa is one of the richest natural sources of arachidonic acid (ArA). To better understand the regulation of ArA biosynthesis in M. incisa, a novel gene putatively encoding the Δ9 fatty acid desaturase (FAD) was cloned and characterized for the first time. Rapid-amplification of cDNA ends (RACE) was employed to yield a full length cDNA designated as MiΔ9FAD, which is 2442 bp long in sequence. Comparing cDNA open reading frame (ORF) sequence to genomic sequence indicated that there are 8 introns interrupting the coding region. The deduced MiΔ9FAD protein is composed of 432 amino acids. It is soluble and localized in the chloroplast, as evidenced by the absence of transmembrane domains as well as the presence of a 61-amino acid chloroplast transit peptide. Multiple sequence alignment of amino acids revealed two conserved histidine-rich motifs, typical for Δ9 acyl-acyl carrier protein (ACP) desaturases. To determine the function of MiΔ9FAD, the gene was heterologously expressed in a Saccharomyces cerevisiae mutant strain with impaired desaturase activity. Results of GC-MS analysis indicated that MiΔ9FAD was able to restore the synthesis of monounsaturated fatty acids, generating palmitoleic acid and oleic acid through the addition of a double bond in the Δ9 position of palmitic acid and stearic acid, respectively.

  6. A Δ-9 Fatty Acid Desaturase Gene in the Microalga Myrmecia incisa Reisigl: Cloning and Functional Analysis

    PubMed Central

    Xue, Wen-Bin; Liu, Fan; Sun, Zheng; Zhou, Zhi-Gang

    2016-01-01

    The green alga Myrmecia incisa is one of the richest natural sources of arachidonic acid (ArA). To better understand the regulation of ArA biosynthesis in M. incisa, a novel gene putatively encoding the Δ9 fatty acid desaturase (FAD) was cloned and characterized for the first time. Rapid-amplification of cDNA ends (RACE) was employed to yield a full length cDNA designated as MiΔ9FAD, which is 2442 bp long in sequence. Comparing cDNA open reading frame (ORF) sequence to genomic sequence indicated that there are 8 introns interrupting the coding region. The deduced MiΔ9FAD protein is composed of 432 amino acids. It is soluble and localized in the chloroplast, as evidenced by the absence of transmembrane domains as well as the presence of a 61-amino acid chloroplast transit peptide. Multiple sequence alignment of amino acids revealed two conserved histidine-rich motifs, typical for Δ9 acyl-acyl carrier protein (ACP) desaturases. To determine the function of MiΔ9FAD, the gene was heterologously expressed in a Saccharomyces cerevisiae mutant strain with impaired desaturase activity. Results of GC-MS analysis indicated that MiΔ9FAD was able to restore the synthesis of monounsaturated fatty acids, generating palmitoleic acid and oleic acid through the addition of a double bond in the Δ9 position of palmitic acid and stearic acid, respectively. PMID:27438826

  7. Enhanced dipicolinic acid production during the stationary phase in Bacillus subtilis by blocking acetoin synthesis.

    PubMed

    Toya, Yoshihiro; Hirasawa, Takashi; Ishikawa, Shu; Chumsakul, Onuma; Morimoto, Takuya; Liu, Shenghao; Masuda, Kenta; Kageyama, Yasushi; Ozaki, Katsuya; Ogasawara, Naotake; Shimizu, Hiroshi

    2015-01-01

    Bacterial bio-production during the stationary phase is expected to lead to a high target yield because the cells do not consume the substrate for growth. Bacillus subtilis is widely used for bio-production, but little is known about the metabolism during the stationary phase. In this study, we focused on the dipicolinic acid (DPA) production by B. subtilis and investigated the metabolism. We found that DPA production competes with acetoin synthesis and that acetoin synthesis genes (alsSD) deletion increases DPA productivity by 1.4-fold. The mutant showed interesting features where the glucose uptake was inhibited, whereas the cell density increased by approximately 50%, resulting in similar volumetric glucose consumption to that of the parental strain. The metabolic profiles revealed accumulation of pyruvate, acetyl-CoA, and the TCA cycle intermediates in the alsSD mutant. Our results indicate that alsSD-deleted B. subtilis has potential as an effective host for stationary-phase production of compounds synthesized from these intermediates.

  8. Exogenous amino acids stimulate net muscle protein synthesis in the elderly.

    PubMed Central

    Volpi, E; Ferrando, A A; Yeckel, C W; Tipton, K D; Wolfe, R R

    1998-01-01

    We have investigated the response of amino acid transport and protein synthesis in healthy elderly individuals (age 71+/-2 yr) to the stimulatory effect of increased amino acid availability. Muscle protein synthesis and breakdown, and amino acid transport were measured in the postabsorptive state and during the intravenous infusion of an amino acid mixture. Muscle-free amino acid kinetics were calculated by means of a three compartment model using data obtained by femoral arterio-venous catheterization and muscle biopsies from the vastus lateralis during the infusion of stable isotope tracers of amino acids. In addition, muscle protein fractional synthetic rate (FSR) was measured. Peripheral amino acid infusion significantly increased amino acid delivery to the leg, amino acid transport, and muscle protein synthesis when measured either with the three compartment model (P < 0.05) or with the traditional precursor-product approach (FSR increased from 0. 0474+/-0.0054 to 0.0940+/-0.0143%/h, P < 0.05). Because protein breakdown did not change during amino acid infusion, a positive net balance of amino acids across the muscle was achieved. We conclude that, although muscle mass is decreased in the elderly, muscle protein anabolism can nonetheless be stimulated by increased amino acid availability. We thus hypothesize that muscle mass could be better maintained with an increased intake of protein or amino acids. PMID:9576765

  9. Glycolysis, Glutaminolysis and Fatty Acid Synthesis are Required for Distinct Stages of KSHV Lytic Replication.

    PubMed

    Sanchez, Erica L; Pulliam, Thomas H; Dimaio, Terri A; Thalhofer, Angel B; Delgado, Tracie; Lagunoff, Michael

    2017-03-08

    Kaposi's Sarcoma-associated Herpesvirus (KSHV) is the etiologic agent of Kaposi's Sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including glycolysis, glutaminolysis and fatty acid synthesis (FAS) for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription while glutaminolysis is necessary for early gene translation, but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions, but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are non-infectious indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication providing novel therapeutic avenues for KS tumors.IMPORTANCE KSHV is the etiologic agent of Kaposi's Sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state where there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation. Our previous findings showed that

  10. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.

    PubMed

    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc

    2015-09-01

    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica.

  11. The inhibitory effect of glycolic acid and lactic acid on melanin synthesis in melanoma cells.

    PubMed

    Usuki, Akiko; Ohashi, Akiko; Sato, Hirofumi; Ochiai, Yasunobu; Ichihashi, Masamitsu; Funasaka, Yoko

    2003-01-01

    Alpha-hydroxy acids (AHAs) such as glycolic acid (GA) and lactic acid (LA) have been reported to be effective in treating pigmentary lesions such as melasma, solar lentigines, and postinflammatory hyperpigmentation. The mechanism of this effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion. However, the direct effect of AHAs on melanin synthesis has not yet been well studied. To elucidate such a direct effect of AHAs on melanogenesis, we performed melanin assays, growth curve determinations, Northern and Western blotting for melanogenic proteins [tyrosinase, tyrosinase related protein (TRP)-1 and TRP-2], and tyrosinase and, 4-dihydroxyphenylalaninechrome tautomerase enzyme activity assays using mouse B16 and human melanoma cells. GA or LA (at doses of 300 or 500 microg/ml) inhibited melanin formation in similar dose-dependent manner, without affecting cell growth. Although the mRNA and protein expression or molecular size of tyrosinase, TRP-1 and TRP-2 were not affected, tyrosinase activity was inhibited. To see whether GA and/or LA directly inhibit tyrosinase catalytic function, the effect of GA and LA on human tyrosinase purified from the melanosome-rich large granule fraction of human melanoma cells was performed. GA or LA were shown to inhibit tyrosinase enzyme activity directly, but this effect was not due to the acidity of GA or LA, because adjusting the pH to 5.6 (the pH of GA and LA at concentrations of 2500 microg/ml), did not affect tyrosinase activity. Taken together, these results show that GA and LA suppress melanin formation by directly inhibiting tyrosinase activity, an effect independent of their acidic nature. GA and LA might work on pigmentary lesions not only by accelerating the turnover of the epidermis but also by directly inhibiting melanin formation in melanocytes.

  12. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  13. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  14. Hepatic cannabinoid receptor type 1 mediates alcohol-induced regulation of bile acid enzyme genes expression via CREBH.

    PubMed

    Chanda, Dipanjan; Kim, Yong-Hoon; Li, Tiangang; Misra, Jagannath; Kim, Don-Kyu; Kim, Jung Ran; Kwon, Joseph; Jeong, Won-Il; Ahn, Sung-Hoon; Park, Tae-Sik; Koo, Seung-Hoi; Chiang, John Y L; Lee, Chul-Ho; Choi, Hueng-Sik

    2013-01-01

    Bile acids concentration in liver is tightly regulated to prevent cell damage. Previous studies have demonstrated that deregulation of bile acid homeostasis can lead to cholestatic liver disease. Recently, we have shown that ER-bound transcription factor Crebh is a downstream effector of hepatic Cb1r signaling pathway. In this study, we have investigated the effect of alcohol exposure on hepatic bile acid homeostasis and elucidated the mediatory roles of Cb1r and Crebh in this process. We found that alcohol exposure or Cb1r-agonist 2-AG treatment increases hepatic bile acid synthesis and serum ALT, AST levels in vivo alongwith significant increase in Crebh gene expression and activation. Alcohol exposure activated Cb1r, Crebh, and perturbed bile acid homeostasis. Overexpression of Crebh increased the expression of key bile acid synthesis enzyme genes via direct binding of Crebh to their promoters, whereas Cb1r knockout and Crebh-knockdown mice were protected against alcohol-induced perturbation of bile acid homeostasis. Interestingly, insulin treatment protected against Cb1r-mediated Crebh-induced disruption of bile acid homeostasis. Furthermore, Crebh expression and activation was found to be markedly increased in insulin resistance conditions and Crebh knockdown in diabetic mice model (db/db) significantly reversed alcohol-induced disruption of bile acid homeostasis. Overall, our study demonstrates a novel regulatory mechanism of hepatic bile acid metabolism by alcohol via Cb1r-mediated activation of Crebh, and suggests that targeting Crebh can be of therapeutic potential in ameliorating alcohol-induced perturbation of bile acid homeostasis.

  15. Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria1[OPEN

    PubMed Central

    Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.

    2016-01-01

    Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016

  16. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited.

    PubMed

    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy

    2014-01-01

    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding.

  17. Coordinated regulation of melatonin synthesis and degradation genes in rice leaves in response to cadmium treatment.

    PubMed

    Byeon, Yeong; Lee, Hyoung Yool; Hwang, Ok Jin; Lee, Hye-Jung; Lee, Kyungjin; Back, Kyoungwhan

    2015-05-01

    We investigated the expression patterns of genes involved in melatonin synthesis and degradation in rice leaves upon cadmium (Cd) treatment and the subcellular localization sites of melatonin 2-hydroxylase (M2H) proteins. The Cd-induced synthesis of melatonin coincided with the increased expression of melatonin biosynthetic genes including tryptophan decarboxylase (TDC), tryptamine 5-hydroxylase (T5H), and N-acetylserotonin methyltransferase (ASMT). However, the expression of serotonin N-acetyltransferase (SNAT), the penultimate gene in melatonin biosynthesis, was downregulated, suggesting that melatonin synthesis was counter-regulated by SNAT. Notably, the induction of melatonin biosynthetic gene expression was coupled with the induction of four M2H genes involved in melatonin degradation, which suggests that genes for melatonin synthesis and degradation are coordinately regulated. The induced M2H gene expression was correlated with enhanced M2H enzyme activity. Three of the M2H proteins were localized to the cytoplasm and one M2H protein was localized to chloroplasts, indicating that melatonin degradation occurs both in the cytoplasm and in chloroplasts. The biological activity of 2-hydroxymelatonin in the induction of the plant defense gene expression was 50% less than that of melatonin, which indicates that 2-hydroxymelatonin may be a metabolite of melatonin. Overall, our data demonstrate that melatonin synthesis occurs in parallel with melatonin degradation in both chloroplasts and cytoplasm, and the resulting melatonin metabolite 2-hydroxymelatonin also acts as a signaling molecule for defense gene induction.

  18. Eicosanoid synthesis in cardiomyocytes: influence of hypoxia, reoxygenation, and polyunsaturated fatty acids.

    PubMed

    Oudot, F; Grynberg, A; Sergiel, J P

    1995-01-01

    The synthesis of eicosanoids was investigated in cultured rat ventricular myocytes. Under normoxia, the cardiomyocytes released 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha) and prostaglandin (PG) E2 and smaller amounts of PGF2 alpha and thromboxane B2. Hypoxia enhanced the production of PGE2 and PGF2 alpha, whereas the synthesis of 6-keto-PGF1 alpha was not affected. Conversely, posthypoxic reoxygenation greatly increased the synthesis of 6-keto-PGF1 alpha, whereas the synthesis of PGF2 alpha, was not affected and that of PGE2 was reduced. The cardiomyocyte polyunsaturated fatty acid (PUFA) profile was altered by arachidonic acid or eicosapentaenoic acid and docosahexaenoic acid. Under normoxia, the eicosanoid production appeared to be roughly related to the cell phospholipid arachidonic acid content. Conversely, during posthypoxic reoxygenation, the production of eicosanoids was related to the cell phospholipid n-3 PUFA content, with the n-3-rich cells displaying a marked inhibition of the synthesis. This inhibition was mainly attributed to eicosapentaenoic acid and/or docosapentaenoic acid. Whether this inhibition occurs in vivo during postischemic reperfusion, it may contribute to the beneficial effect of n-3 PUFA on the heart.

  19. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis

    PubMed Central

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a “GRAS” (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  20. The control of ribonucleic acid synthesis in bacteria. The synthesis and stability of ribonucleic acids in relaxed and stringent amino acid auxotrophs of Escherichia coli.

    PubMed

    Gray, W J; Midgley, J E

    1972-08-01

    The biosynthesis and stability of various RNA fractions was studied in RC(str) and RC(rel) multiple amino acid auxotrophs of Escherichia coli. In conditions of amino acid deprivation, RC(str) mutants were labelled with exogenous nucleotide bases at less than 1% of the rate found in cultures growing normally in supplemented media. Studies by DNA-RNA hybridization and by other methods showed that, during a period of amino acid withdrawal, not more than 60-70% of the labelled RNA formed in RC(str) mutants had the characteristics of mRNA. Evidence was obtained for some degradation of newly formed 16S and 23S rRNA species to heterogeneous material of lower molecular weight. This led to overestimations of the mRNA content of rapidly labelled RNA from such methods as simple examination of sucrose-density-gradient profiles. In RC(rel) strains the absolute and relative rates of synthesis of the various RNA fractions were not greatly affected. However, the stability of about half of the mRNA fraction was increased in RC(rel) strains during amino acid starvation, giving kinetics of mRNA labelling and turnover that were identical with those found in either RC(str) or RC(rel) strains inhibited by high concentrations of chloramphenicol. Coincidence hybridization techniques showed that the mRNA content of amino acid-starved RC(str) auxotrophs was unchanged from that found in normally growing cells. In contrast, RC(rel) strains deprived of amino acids increased their mRNA content about threefold. In such cultures the mRNA content of accumulating newly formed RNA was a constant 16% by wt.

  1. Metabolite gene regulation of the L-arabinose operon in Escherichia coli with indoleacetic acid and other indole derivatives.

    PubMed

    Kline, E L; Brown, C S; Bankaitis, V; Montefiori, D C; Craig, K

    1980-04-01

    The ability of indole derivatives to facilitate RNA polymerase transcription of the L-arabinose operon in Escherichia coli was shown to require the catabolite activator protein (CAP) as well as the araC gene product. Adenosine 3',5'-monophosphate (cAMP) was not obligatory for araBAD transcription when the cells were grown in the presence of 1 mM indole-3-acetic acid or in the presence of indole-3-acetamide, indole-3-propionic acid, indole-3-butyric acid, or 5-hydroxyindole-3-acetic acid. However, these indole derivatives were unable to circumvent the cAMP requirement for the induction of the lactose and the maltose operons. Catabolic repression occurred when glucose was added to cells grown in the presence of L-arabinose and 1 mM indoleacetic acid or 1 mM cAMP. This effect was reversed at higher concentrations of indoleacetic acid or cAMP. The induction and the catabolite repression phenomena were quantitated by measuring the differential rate of synthesis of L-arabinose isomerase (the araA gene product). These results indicated that indole metabolites from various living systems may regulate gene expression and may be involved in "metabolite gene regulation."

  2. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  3. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-06-28

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise.

  4. Repeats in transforming acidic coiled-coil (TACC) genes.

    PubMed

    Trivedi, Seema

    2013-06-01

    Transforming acidic coiled-coil proteins (TACC1, 2, and 3) are essential proteins associated with the assembly of spindle microtubules and maintenance of bipolarity. Dysregulation of TACCs is associated with tumorigenesis, but studies of microsatellite instability in TACC genes have not been extensive. Microsatellite or simple sequence repeat instability is known to cause many types of cancer. The present in silico analysis of SSRs in human TACC gene sequences shows the presence of mono- to hexa-nucleotide repeats, with the highest densities found for mono- and di-nucleotide repeats. Density of repeats is higher in introns than in exons. Some of the repeats are present in regulatory regions and retained introns. Human TACC genes show conservation of many repeat classes. Microsatellites in TACC genes could be valuable markers for monitoring numerical chromosomal aberrations and or cancer.

  5. Identification of a conserved protein involved in anaerobic unsaturated fatty acid synthesis in Neiserria gonorrhoeae: implications for facultative and obligate anaerobes that lack FabA.

    PubMed

    Isabella, Vincent M; Clark, Virginia L

    2011-10-01

    Transcriptome analysis of the facultative anaerobe, Neisseria gonorrhoeae, revealed that many genes of unknown function were induced under anaerobic conditions. Mutation of one such gene, NGO1024, encoding a protein belonging to the 2-nitropropane dioxygenase-like superfamily of proteins, was found to result in an inability of gonococci to grow anaerobically. Anaerobic growth of an NG1024 mutant was restored upon supplementation with unsaturated fatty acids (UFA), but not with the saturated fatty acid palmitate. Gonococcal fatty acid profiles confirmed that NGO1024 was involved in UFA synthesis anaerobically, but not aerobically, demonstrating that gonococci contain two distinct pathways for the production of UFAs, with a yet unidentified aerobic mechanism, and an anaerobic mechanism involving NGO1024. Expression of genes involved in classical anaerobic UFA synthesis, fabA, fabM and fabB, was toxic in gonococci and unable to complement a NGO1024 mutation, suggesting that the chemistry involved in gonococcal anaerobic UFA synthesis is distinct from that of the classical pathway. NGO1024 homologues, which we suggest naming UfaA, form a distinct lineage within the 2-nitropropane dioxygenase-like superfamily, and are found in many facultative and obligate anaerobes that produce UFAs but lack fabA, suggesting that UfaA is part of a widespread pathway involved in UFA synthesis.

  6. Optimizing targeted gene delivery: chemical modification of viral vectors and synthesis of artificial virus vector systems.

    PubMed

    Boeckle, Sabine; Wagner, Ernst

    2006-01-01

    In comparison to classical medicines, gene therapy has the potential to mediate the highest possible level of therapeutic specificity. Every normal or diseased cell can switch on or off a gene expression cassette in a tissue-, disease-, and time-dependent fashion, by use of specific transcription factors that are active only in a given unique situation. In practice, we face the problem in realizing the concept: the delivery of nucleic acids into target cells is very ineffective and presents a formidable challenge. Key issues for future developments include improved targeting, enhanced intracellular uptake, and reduced toxicity of gene vectors. The currently used classes of vectors have complementary characteristics, such as high intracellular efficiency of viral vectors on the one hand and low immunogenicity and greater flexibility of nonviral vectors on the other hand. The merge of viral and nonviral vector technologies is highlighted as an encouraging strategy for the future; concepts include chemically modified viral vectors ("chemo-viruses") and synthesis of virus-like systems ("synthetic viruses"). Examples for the development of vectors toward artificial synthetic viruses are presented.

  7. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  8. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  9. Inactivation of the lys7 gene, encoding saccharopine reductase in Penicillium chrysogenum, leads to accumulation of the secondary metabolite precursors piperideine-6-carboxylic acid and pipecolic acid from alpha-aminoadipic acid.

    PubMed

    Naranjo, Leopoldo; Martín de Valmaseda, Eva; Casqueiro, Javier; Ullán, Ricardo V; Lamas-Maceiras, Mónica; Bañuelos, Oscar; Martín, Juan F

    2004-02-01

    Pipecolic acid serves as a precursor of the biosynthesis of the alkaloids slaframine and swainsonine (an antitumor agent) in some fungi. It is not known whether other fungi are able to synthesize pipecolic acid. Penicillium chrysogenum has a very active alpha-aminoadipic acid pathway that is used for the synthesis of this precursor of penicillin. The lys7 gene, encoding saccharopine reductase in P. chrysogenum, was target inactivated by the double-recombination method. Analysis of a disrupted strain (named P. chrysogenum SR1-) showed the presence of a mutant lys7 gene lacking about 1,000 bp in the 3'-end region. P. chrysogenum SR1- lacked saccharopine reductase activity, which was recovered after transformation of this mutant with the intact lys7 gene in an autonomously replicating plasmid. P. chrysogenum SR1- was a lysine auxotroph and accumulated piperideine-6-carboxylic acid. When mutant P. chrysogenum SR1- was grown with L-lysine as the sole nitrogen source and supplemented with DL-alpha-aminoadipic acid, a high level of pipecolic acid accumulated intracellularly. A comparison of strain SR1- with a lys2-defective mutant provided evidence showing that P. chrysogenum synthesizes pipecolic acid from alpha-aminoadipic acid and not from L-lysine catabolism.

  10. Defects in Mitochondrial Fatty Acid Synthesis Result in Failure of Multiple Aspects of Mitochondrial Biogenesis in Saccharomyces cerevisiae

    PubMed Central

    Kursu, V. A. Samuli; Pietikäinen, Laura P.; Fontanesi, Flavia; Aaltonen, Mari J.; Suomi, Fumi; Nair, Remya Raghavan; Schonauer, Melissa S.; Dieckmann, Carol L.; Barrientos, Antoni; Hiltunen, J. Kalervo; Kastaniotis, Alexander J.

    2014-01-01

    Summary Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild heme deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a coordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. PMID:24102902

  11. Alkaline stress and iron deficiency regulate iron uptake and riboflavin synthesis gene expression differently in root and leaf tissue: implications for iron deficiency chlorosis.

    PubMed

    Hsieh, En-Jung; Waters, Brian M

    2016-10-01

    Iron (Fe) is an essential mineral that has low solubility in alkaline soils, where its deficiency results in chlorosis. Whether low Fe supply and alkaline pH stress are equivalent is unclear, as they have not been treated as separate variables in molecular physiological studies. Additionally, molecular responses to these stresses have not been studied in leaf and root tissues simultaneously. We tested how plants with the Strategy I Fe uptake system respond to Fe deficiency at mildly acidic and alkaline pH by measuring root ferric chelate reductase (FCR) activity and expression of selected Fe uptake genes and riboflavin synthesis genes. Alkaline pH increased cucumber (Cucumis sativus L.) root FCR activity at full Fe supply, but alkaline stress abolished FCR response to low Fe supply. Alkaline pH or low Fe supply resulted in increased expression of Fe uptake genes, but riboflavin synthesis genes responded to Fe deficiency but not alkalinity. Iron deficiency increased expression of some common genes in roots and leaves, but alkaline stress blocked up-regulation of these genes in Fe-deficient leaves. In roots of the melon (Cucumis melo L.) fefe mutant, in which Fe uptake responses are blocked upstream of Fe uptake genes, alkaline stress or Fe deficiency up-regulation of certain Fe uptake and riboflavin synthesis genes was inhibited, indicating a central role for the FeFe protein. These results suggest a model implicating shoot-to-root signaling of Fe status to induce Fe uptake gene expression in roots.

  12. Structure and regulation of the omega-3 polyunsaturated fatty acid synthase genes from the deep-sea bacterium Photobacterium profundum strain SS9.

    PubMed

    Allen, Eric E; Bartlett, Douglas H

    2002-06-01

    Omega-3 polyunsaturated fatty acids (PUFAs) such as eicosapentaenoic acid (20:5n-3; EPA) and docosahexaenoic acid (22:6n-3; DHA) have been shown to be of major importance in the promotion of cardiovascular health, proper human development and the prevention of some cancers. A high proportion of bacterial isolates from low-temperature and high-pressure marine environments produce EPA or DHA. This paper presents the sequence of a 33 kbp locus from the deep-sea bacterium Photobacterium profundum strain SS9 which includes four of the five genes required for EPA biosynthesis. As with other bacterial pfa (polyunsaturated fatty acid) genes, the deduced amino acid sequences encoded by the SS9 genes reveal large multidomain proteins that are likely to catalyse EPA biosynthesis by a novel polyketide synthesis mechanism. RNase protection experiments separated the SS9 pfa genes into two transcriptional units, pfaA-C and pfaD. The pfaA transcriptional start site was identified. Cultivation at elevated hydrostatic pressure or reduced temperature did not increase pfa gene expression despite the resulting increase in percentage composition of EPA under these conditions. However, a regulatory mutant was characterized which showed both increased expression of pfaA-D and elevated EPA percentage composition. This result suggests that a regulatory factor exists which coordinates pfaA-D transcription. Additional consideration regarding the activities required for PUFA synthesis is provided together with comparative analyses of bacterial pfa genes and gene products.

  13. Screening and identification of differentially expressed genes in goose hepatocytes exposed to free fatty acid.

    PubMed

    Pan, Zhixiong; Wang, Jiwen; Kang, Bo; Lu, Lizhi; Han, Chunchun; Tang, Hui; Li, Liang; Xu, Feng; Zhou, Zehui; Lv, Jia

    2010-12-15

    The overaccumulation of triglycerides in hepatocytes induces hepatic steatosis; however, little is known about the mechanism of goose hepatic steatosis. The aim of this study was to define an experimental model of hepatocellular steatosis with TG overaccumulation and minimal cytotoxicity, using a mixture of various proportions of oleate and palmitate free fatty acids (FFAs) to induce fat-overloading, then using suppressive subtractive hybridization and a quantitative PCR approach to identify genes with higher or lower expression levels after the treatment of cells with FFA mixtures. Overall, 502 differentially expressed clones, representing 21 novel genes and 87 known genes, were detected by SSH. Based on functional clustering, up- and down-regulated genes were mostly related to carbohydrate and lipid metabolism, enzyme activity and signal transduction. The expression of 20 selected clones involved with carbohydrate and lipid metabolism pathways was further studied by quantitative PCR. The data indicated that six clones similar to the genes ChREBP, FoxO1, apoB, IHPK2, KIF1B, and FSP27, which participate in de novo synthesis of fatty acid and secretion of very low density lipoproteins, had significantly lower expression levels in the hepatocytes treated with FFA mixtures. Meanwhile, 13 clones similar to the genes DGAT-1, ACSL1, DHRS7, PPARα, L-FABP, DGAT-2, PCK, ACSL3, CPT-1, A-FABP, PPARβ, MAT, and ALDOB had significantly higher expression levels in the hepatocytes treated with FFA mixtures. These results suggest that several metabolic pathways are altered in goose hepatocytes, which may be useful for further research into the molecular mechanism of goose hepatic steatosis.

  14. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  15. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  16. Prolonged stimulation of protein synthesis by leucine is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leucine is unique among the amino acids in its ability to enhance protein synthesis by activating translation initiation (Kimball and Jefferson, 2005). Our laboratory has shown that raising leucine to postprandial levels, whilst keeping all other amino acids at the post absorptive, level acutely st...

  17. Pyrazinoic acid decreases the proton motive force, respiratory ATP synthesis activity, and cellular ATP levels.

    PubMed

    Lu, Ping; Haagsma, Anna C; Pham, Hoang; Maaskant, Janneke J; Mol, Selena; Lill, Holger; Bald, Dirk

    2011-11-01

    Pyrazinoic acid, the active form of the first-line antituberculosis drug pyrazinamide, decreased the proton motive force and respiratory ATP synthesis rates in subcellular mycobacterial membrane assays. Pyrazinoic acid also significantly lowered cellular ATP levels in Mycobacterium bovis BCG. These results indicate that the predominant mechanism of killing by this drug may operate by depletion of cellular ATP reserves.

  18. Facile synthesis of nucleic acid-polymer amphiphiles and their self-assembly.

    PubMed

    Jia, Fei; Lu, Xueguang; Tan, Xuyu; Zhang, Ke

    2015-05-07

    A solid-phase synthesis for nucleic acid-polymer amphiphiles is developed. Using this strategy, several DNA-b-polymer amphiphiles are synthesized, and their self-assembly in aqueous solution is investigated. This general method can in principle be extended to nearly all polymers synthesized by atom transfer radical polymerization to produce a variety of nucleic acid-polymer conjugates.

  19. Salicylic acid treatment of pea seeds induces its de novo synthesis.

    PubMed

    Szalai, Gabriella; Horgosi, Szabina; Soós, Vilmos; Majláth, Imre; Balázs, Ervin; Janda, Tibor

    2011-02-15

    Salicylic acid (SA), which is known as a signal molecule in the induction of defense mechanisms in plants, could be a promising compound for the reduction of stress sensitivity. The aim of the present work was to investigate the distribution of SA in young pea (Pisum sativum L.) seedlings grown from seeds soaked in (3)H-labeled SA solution before sowing, and to study the physiological changes induced by this seed treatment. The most pronounced changes in SA levels occurred in the epicotyl and the seeds. Radioactivity was detected only in the bound form of SA, the majority of which was localized in the seeds, and only a very low level of radioactivity was detected in the epicotyl. SA pre-treatment increased the expression of the chorismate synthase and isochorismate synthase genes in the epicotyl. Pre-soaking the seeds in SA increased the activities of some antioxidant enzymes, namely ascorbate peroxidase (EC 1.11.1.11) and guaiacol peroxidase (EC 1.11.1.7) and the level of ortho-hydroxycinnamic acid, but decreased the level of polyamines. These results suggest that the increased level of free and bound SA detected in plants growing from seeds soaked in SA solution before sowing is the product of de novo synthesis, rather than having been taken up and mobilized by the plants.

  20. Synthesis of Nucleic Acid and Protein in L Cells Infected with the Agent of Meningopneumonitis

    PubMed Central

    Schechter, Esther M.

    1966-01-01

    Schechter, Esther M. (The University of Chicago, Chicago, Ill.). Synthesis of nucleic acid and protein in L cells infected with the agent of meningopneumonitis. J. Bacteriol. 91:2069–2080. 1966.—Synthesis of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein in uninfected L cells and in L cells infected with the meningopneumonitis agent was compared by measuring rates of incorporation of H3-cytidine and C14-lysine into nuclear, cytoplasmic, and agent fractions in successive 5-hr periods during the meningopneumonitis growth cycle. Synthesis of meningopneumonitis DNA, RNA, and protein was first clearly evident in the labeling period 15 to 20 hr after infection, soon after initiation of agent multiplication. The rates of synthesis of agent DNA, RNA, and protein increased logarithmically for a brief period and then declined. However, rates of isotope incorporation into all three meningopneumonitis macromolecules were sustained at near maximal values throughout the remainder of the meningopneumonitis growth cycle. These data are most readily interpreted in terms of multiplication of the meningopneumonitis agent by binary fission. The L cell response to infection was a decreased rate of DNA and RNA synthesis and an accelerated rate of cell death. Host protein synthesis was unaffected. The inhibition of nucleic acid synthesis in infected L cells probably involved competition between host and parasite for nucleic acid precursors. Different sublines of L cells varied greatly in the degree to which their nucleic acid-synthesizing mechanisms were damaged by infection. The cytoplasm of infected L cells contained newly synthesized DNA and RNA that could not be accounted for as intact meningopneumonitis cells. This nucleic acid probably arose from disintegration of the fragile intracellular forms of the meningopneumonitis agent. Images PMID:5937251

  1. Role of maternal tissue in the synthesis of polyunsaturated fatty acids in response to a lipid-deficient diet during pregnancy and lactation in rats.

    PubMed

    González, Raúl Sánchez; Rodriguez-Cruz, Maricela; Maldonado, Jorge; Saavedra, Filiberto Jasso

    2014-10-01

    During pregnancy and lactation, metabolic adaptations involve changes in expression of desaturases and elongases (Elovl2 and Elovl5) in the mammary gland and liver for the synthesis of long-chain polyunsaturated fatty acids (LC-PUFAs) such as arachidonic acid (AA) required for fetal and postnatal growth. Adipose tissue is a pool of LC-PUFAs. The response of adipose tissue for the synthesis of these fatty acids in a lipid-deficient diet of dams is unknown. The aim of this study was to explore the role of maternal tissue in the synthesis of LC-PUFAs in rats fed a low-lipid diet during pregnancy and lactation. Fatty acid composition (indicative of enzymatic activity) and gene expression of encoding enzymes for fatty acid synthesis were measured in liver, mammary gland and adipose tissue in rats fed a low-lipid diet. Gene expression of desaturases, elongases, fatty acid synthase (Fasn) and their regulator Srebf-1c was increased in the mammary gland, liver and adipose tissue of rats fed a low-lipid diet compared with rats from the adequate-lipid diet group throughout pregnancy and lactation. Genes with the highest (P<0.05) expression in the mammary gland, liver and adipose tissue were Elovl5 (1333%), Fads2 (490%) and Fasn (6608%), respectively, in a low-lipid diet than in adequate-lipid diet. The percentage of AA in the mammary gland was similar between the low-lipid diet and adequate-lipid diet groups during the second stage of pregnancy and during lactation. The percentage of monounsaturated and saturated fatty acids was significantly (P<0.05) increased throughout pregnancy and lactation in all tissues in rats fed a low-lipid diet than in rats fed an adequate-lipid diet. Results suggest that maternal metabolic adaptations used to compensate for lipid-deficient diet during pregnancy and lactation include increased expression of genes involved in LC-PUFAs synthesis in a stage- and tissue-specific manner and elevated lipogenic activity (saturated and monounsaturated

  2. T7 Endonuclease I Mediates Error Correction in Artificial Gene Synthesis.

    PubMed

    Sequeira, Ana Filipa; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A

    2016-09-01

    Efficacy of de novo gene synthesis largely depends on the quality of overlapping oligonucleotides used as template for PCR assembly. The error rate associated with current gene synthesis protocols limits the efficient and accurate production of synthetic genes, both in the small and large scales. Here, we analysed the ability of different endonuclease enzymes, which specifically recognize and cleave DNA mismatches resulting from incorrect impairments between DNA strands, to remove mutations accumulated in synthetic genes. The gfp gene, which encodes the green fluorescent protein, was artificially synthesized using an integrated protocol including an enzymatic mismatch cleavage step (EMC) following gene assembly. Functional and sequence analysis of resulting artificial genes revealed that number of deletions, insertions and substitutions was strongly reduced when T7 endonuclease I was used for mutation removal. This method diminished mutation frequency by eightfold relative to gene synthesis not incorporating an error correction step. Overall, EMC using T7 endonuclease I improved the population of error-free synthetic genes, resulting in an error frequency of 0.43 errors per 1 kb. Taken together, data presented here reveal that incorporation of a mutation-removal step including T7 endonuclease I can effectively improve the fidelity of artificial gene synthesis.

  3. Colored petri nets to model gene mutation and amino acids classification.

    PubMed

    Yang, Jinliang; Gao, Rui; Meng, Max Q-H; Tarn, Tzyh-Jong

    2012-05-07

    The genetic code is the triplet code based on the three-letter codons, which determines the specific amino acid sequences in proteins synthesis. Choosing an appropriate model for processing these codons is a useful method to study genetic processes in Molecular Biology. As an effective modeling tool of discrete event dynamic systems (DEDS), colored petri net (CPN) has been used for modeling several biological systems, such as metabolic pathways and genetic regulatory networks. According to the genetic code table, CPN is employed to model the process of genetic information transmission. In this paper, we propose a CPN model of amino acids classification, and further present the improved CPN model. Based on the model mentioned above, we give another CPN model to classify the type of gene mutations via contrasting the bases of DNA strands and the codons of amino acids along the polypeptide chain. This model is helpful in determining whether a certain gene mutation will cause the changes of the structures and functions of protein molecules. The effectiveness and accuracy of the presented model are illustrated by the examples in this paper.

  4. Total synthesis of racemic and (R) and (S)-4-methoxyalkanoic acids and their antifungal activity.

    PubMed

    Das, Biswanath; Shinde, Digambar Balaji; Kanth, Boddu Shashi; Kamle, Avijeet; Kumar, C Ganesh

    2011-07-01

    The total synthesis of 4-methoxydecanoic acid and 4-methoxyundecanoic acid in racemic and stereoselective [(R) and (S)] forms has been accomplished. For stereoselective synthesis of the compounds (S) and (R)-BINOL complexes have been used to generate the required chiral centres. The antifungal activity of these compounds has been studied against different organisms and the results were found to be impressive. The activity of the compounds in racemic and in stereoselective forms was compared. (R)-4-Methoxydecanoic acid was found to be most potent (MIC: 0.019 mg/mL against Candida albicans MTCC 227, C. albicans MTCC 4748, Aspergillus brasiliensis (niger) MTCC 281 and Issatchenkia orientalis MTCC 3020).

  5. Final Step of Phosphatidic Acid Synthesis in Pea Chloroplasts Occurs in the Inner Envelope Membrane 1

    PubMed Central

    Andrews, Jaen; Ohlrogge, John B.; Keegstra, Kenneth

    1985-01-01

    The second enzyme of phosphatidic acid synthesis from glycerol-3-phosphate, 1-acylglycerophospate acyltransferase, was localized to the inner envelope membrane of pea chloroplasts. The activity of this enzyme was measured by both a coupled enzyme assay and a direct enzyme assay. Using the coupled enzyme assay, phosphatidic acid phosphatase was also localized to the inner envelope membrane, although this enzyme has very low activity in pea chloroplasts. The addition of UDP-galactose to unfractionated pea chloroplast envelope preparations did not result in significant conversion of newly synthesized diacylglycerol to monogalactosyldiacylglycerol. Thus, the envelope synthesized phosphatidic acid may not be involved in galactolipid synthesis in pea chloroplasts. PMID:16664266

  6. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  7. A Robust and Versatile Method of Combinatorial Chemical Synthesis of Gene Libraries via Hierarchical Assembly of Partially Randomized Modules.

    PubMed

    Popova, Blagovesta; Schubert, Steffen; Bulla, Ingo; Buchwald, Daniela; Kramer, Wilfried

    2015-01-01

    A major challenge in gene library generation is to guarantee a large functional size and diversity that significantly increases the chances of selecting different functional protein variants. The use of trinucleotides mixtures for controlled randomization results in superior library diversity and offers the ability to specify the type and distribution of the amino acids at each position. Here we describe the generation of a high diversity gene library using tHisF of the hyperthermophile Thermotoga maritima as a scaffold. Combining various rational criteria with contingency, we targeted 26 selected codons of the thisF gene sequence for randomization at a controlled level. We have developed a novel method of creating full-length gene libraries by combinatorial assembly of smaller sub-libraries. Full-length libraries of high diversity can easily be assembled on demand from smaller and much less diverse sub-libraries, which circumvent the notoriously troublesome long-term archivation and repeated proliferation of high diversity ensembles of phages or plasmids. We developed a generally applicable software tool for sequence analysis of mutated gene sequences that provides efficient assistance for analysis of library diversity. Finally, practical utility of the library was demonstrated in principle by assessment of the conformational stability of library members and isolating protein variants with HisF activity from it. Our approach integrates a number of features of nucleic acids synthetic chemistry, biochemistry and molecular genetics to a coherent, flexible and robust method of combinatorial gene synthesis.

  8. Formamide Synthesis through Borinic Acid Catalysed Transamidation under Mild Conditions.

    PubMed

    Dine, Tharwat Mohy El; Evans, David; Rouden, Jacques; Blanchet, Jérôme

    2016-04-18

    A highly efficient and mild transamidation of amides with amines co-catalysed by borinic acid and acetic acid has been reported. A wide range of functionalised formamides was synthesized in excellent yields, including important chiral α-amino acid derivatives, with minor racemisation being observed. Experiments suggested that the reaction rely on a cooperative catalysis involving an enhanced boron-derived Lewis acidity rather than an improved Brønsted acidity of acetic acid.

  9. Effects of bovine fatty acid synthase, stearoyl-coenzyme A desaturase, sterol regulatory element-binding protein 1, and growth hormone gene polymorphisms on fatty acid composition and carcass traits in Japanese Black cattle.

    PubMed

    Matsuhashi, T; Maruyama, S; Uemoto, Y; Kobayashi, N; Mannen, H; Abe, T; Sakaguchi, S; Kobayashi, E

    2011-01-01

    The quality of fat is an important factor in defining the quality of meat. Fat quality is determined by the composition of fatty acids. Among lipid metabolism-related genes, including fatty acid synthesis genes, several genetic variations have been reported in the bovine fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD), sterol regulatory element-binding protein 1 (SREBP1), and GH genes. In the present study, we evaluated the single and epistatic effects of 5 genetic variations (4 SNP and 1 insertion/deletion) in 4 genes (FASN, SCD, SREBP1, and GH) on the fatty acid composition of the longissimus thoracis muscle and carcass and meat quality traits in 480 commercial Japanese Black cattle. Significant single effects of FASN, SCD, and GH(L127V) polymorphisms on the fatty acid composition of the longissimus thoracis muscle were detected. The A293V polymorphism of SCD had the largest effect on myristic acid (C14:0, P < 0.001), myristoleic acid (C14:1, P < 0.001), stearic acid (C18:0, P < 0.001), oleic acid (C18:1, P < 0.001), and MUFA (P < 0.001). Polymorphisms in the FASN, SCD, and SREBP1 genes showed no effect on any meat yield trait. There were no significant epistatic effects on fatty acid composition among pairs of the 3 genes (FASN, SCD, and SREBP1) involved in fatty acid synthesis. No epistatic interactions (P > 0.1) were detected between FASN and SCD for any carcass trait. When the genotypes of 3 markers (FASN, SCD, and GH(L127V)) were substituted from the lesser effect allele to the greater effect allele, the proportion of C18:1 increased by 4.46%. More than 20% of the genetic variance in the C18:1 level could be accounted for by these 3 genetic markers. The present results revealed that polymorphisms in 2 fatty acid synthesis genes (FASN and SCD) independently influenced fatty acid composition in the longissimus thoracis muscle. These results suggest that SNP in the FASN and SCD genes are useful markers for the improvement of fatty acid composition in

  10. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  11. Yeast genes involved in response to lactic acid and acetic acid: acidic conditions caused by the organic acids in Saccharomyces cerevisiae cultures induce expression of intracellular metal metabolism genes regulated by Aft1p.

    PubMed

    Kawahata, Miho; Masaki, Kazuo; Fujii, Tsutomu; Iefuji, Haruyuki

    2006-09-01

    Using two types of genome-wide analysis to investigate yeast genes involved in response to lactic acid and acetic acid, we found that the acidic condition affects metal metabolism. The first type is an expression analysis using DNA microarrays to investigate 'acid shock response' as the first step to adapt to an acidic condition, and 'acid adaptation' by maintaining integrity in the acidic condition. The other is a functional screening using the nonessential genes deletion collection of Saccharomyces cerevisiae. The expression analysis showed that genes involved in stress response, such as YGP1, TPS1 and HSP150, were induced under the acid shock response. Genes such as FIT2, ARN1 and ARN2, involved in metal metabolism regulated by Aft1p, were induced under the acid adaptation. AFT1 was induced under acid shock response and under acid adaptation with lactic acid. Moreover, green fluorescent protein-fused Aft1p was localized to the nucleus in cells grown in media containing lactic acid, acetic acid, or hydrochloric acid. Both analyses suggested that the acidic condition affects cell wall architecture. The depletion of cell-wall components encoded by SED1, DSE2, CTS1, EGT2, SCW11, SUN4 and YNL300W and histone acetyltransferase complex proteins encoded by YID21, EAF3, EAF5, EAF6 and YAF9 increased resistance to lactic acid. Depletion of the cell-wall mannoprotein Sed1p provided resistance to lactic acid, although the expression of SED1 was induced by exposure to lactic acid. Depletion of vacuolar membrane H+-ATPase and high-osmolarity glycerol mitogen-activated protein kinase proteins caused acid sensitivity. Moreover, our quantitative PCR showed that expression of PDR12 increased under acid shock response with lactic acid and decreased under acid adaptation with hydrochloric acid.

  12. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  13. Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips.

    PubMed

    Kosuri, Sriram; Eroshenko, Nikolai; Leproust, Emily M; Super, Michael; Way, Jeffrey; Li, Jin Billy; Church, George M

    2010-12-01

    Development of cheap, high-throughput and reliable gene synthesis methods will broadly stimulate progress in biology and biotechnology. Currently, the reliance on column-synthesized oligonucleotides as a source of DNA limits further cost reductions in gene synthesis. Oligonucleotides from DNA microchips can reduce costs by at least an order of magnitude, yet efforts to scale their use have been largely unsuccessful owing to the high error rates and complexity of the oligonucleotide mixtures. Here we use high-fidelity DNA microchips, selective oligonucleotide pool amplification, optimized gene assembly protocols and enzymatic error correction to develop a method for highly parallel gene synthesis. We tested our approach by assembling 47 genes, including 42 challenging therapeutic antibody sequences, encoding a total of ∼35 kilobase pairs of DNA. These assemblies were performed from a complex background containing 13,000 oligonucleotides encoding ∼2.5 megabases of DNA, which is at least 50 times larger than in previously published attempts.

  14. β-Ketoacyl-acyl Carrier Protein Synthase I (KASI) Plays Crucial Roles in the Plant Growth and Fatty Acids Synthesis in Tobacco

    PubMed Central

    Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong

    2016-01-01

    Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494

  15. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  16. PHOSPHATIDIC ACID PHOSPHOHYDROLASE1 and 2 Regulate Phospholipid Synthesis at the Endoplasmic Reticulum in Arabidopsis[W

    PubMed Central

    Eastmond, Peter J.; Quettier, Anne-Laure; Kroon, Johan T.M.; Craddock, Christian; Adams, Nicolette; Slabas, Antoni R.

    2010-01-01

    Phospholipid biosynthesis is essential for the construction of most eukaryotic cell membranes, but how this process is regulated in plants remains poorly understood. Here, we show that in Arabidopsis thaliana, two Mg2+-dependent phosphatidic acid phosphohydrolases called PAH1 and PAH2 act redundantly to repress phospholipid biosynthesis at the endoplasmic reticulum (ER). Leaves from pah1 pah2 double mutants contain ~1.8-fold more phospholipid than the wild type and exhibit gross changes in ER morphology, which are consistent with massive membrane overexpansion. The net rate of incorporation of [methyl-14C]choline into phosphatidylcholine (PC) is ~1.8-fold greater in the double mutant, and the transcript abundance of several key genes that encode enzymes involved in phospholipid synthesis is increased. In particular, we show that PHOSPHORYLETHANOLAMINE N-METHYLTRANSFERASE1 (PEAMT1) is upregulated at the level of transcription in pah1 pah2 leaves. PEAMT catalyzes the first committed step of choline synthesis in Arabidopsis and defines a variant pathway for PC synthesis not found in yeasts or mammals. Our data suggest that PAH1/2 play a regulatory role in phospholipid synthesis that is analogous to that described in Saccharomyces cerevisiae. However, the target enzymes differ, and key components of the signal transduction pathway do not appear to be conserved. PMID:20699392

  17. Single amino acid polymorphism in aldehyde dehydrogenase gene superfamily.

    PubMed

    Priyadharshini Christy, J; George Priya Doss, C

    2015-01-01

    The aldehyde dehydrogenase gene superfamily comprises of 19 genes and 3 pseudogenes. These superfamily genes play a vital role in the formation of molecules that are involved in life processes, and detoxification of endogenous and exogenous aldehydes. ALDH superfamily genes associated mutations are implicated in various diseases, such as pyridoxine-dependent seizures, gamma-hydroxybutyric aciduria, type II Hyperprolinemia, Sjogren-Larsson syndrome including cancer and Alzheimer's disease. Accumulation of large DNA variations data especially Single Amino acid Polymorphisms (SAPs) in public databases related to ALDH superfamily genes insisted us to conduct a survey on the disease associated mutations and predict their function impact on protein structure and function. Overall this study provides an update and highlights the importance of pathogenic mutations in associated diseases. Using KD4v and Project HOPE a computational based platform, we summarized all the deleterious properties of SAPs in ALDH superfamily genes by the providing valuable insight into structural alteration rendered due to mutation. We hope this review might provide a way to define the deleteriousness of a SAP and helps to understand the molecular basis of the associated disease and also permits precise diagnosis and treatment in the near future.

  18. Riboflavin synthesis genes ribE, ribB, ribH, ribA reside in the lux operon of Photobacterium leiognathi.

    PubMed

    Lin, J W; Chao, Y F; Weng, S F

    2001-06-15

    Nucleotide sequence of the riboflavin synthesis genes ribE, ribB, ribH, ribA (GenBank Accession No. AF364106) resided in the lux operon of Photobacterium leiognathi PL741 has been determined, and the amino acid sequences of riboflavin synthetase (RibE), DHBP synthetase (RibB), lumazine synthetase (RibH), GTP cyclohydrolase II (RibA) encoded by the riboflavin synthesis genes are deduced. Nucleotide sequence reveals that the ribE gene encodes the riboflavin synthetase responsible for converting lumazine to riboflavin, the ribB gene encodes the DHBP synthetase responsible for 3,4-dihydroxyl-2-butanone 4-phosphate synthesis, the ribH gene encodes the lumazine synthetase responsible for lumazine synthesis, and the ribA gene encodes the GTP cyclohydrolase II responsible for lumazine synthesis. Functional analysis illustrates that the specific segments lay behind the ribH and ribA genes might form potential loops Omega(oT) and Omega(TI)--Omega(TII); Omega(oT) is functioned as mRNA stability loop or/and for subregulation by alternative modulation, and Omega(TI)--Omega(TII) could be the transcriptional terminator of the lux operon. The gene order of the ribE, ribB, ribH, ribA genes resided in the lux operon and linked to the lum operon is <--ter*-lumQ-lumP-R&R-luxC-luxD-luxA-luxB-luxN-luxE-luxG-ribE-ribB-ribH-ribA-ter--> (R&R: regulatory region; ter: transcriptional terminator), whereas the R&R is the regulatory region for the lum and the lux operons, and ter and ter* are the transcriptional terminators for the lux and lum operons.

  19. Indole-3-acetic acid (IAA) induced changes in oil content, fatty acid profiles and expression of four fatty acid biosynthetic genes in Chlorella vulgaris at early stationary growth phase.

    PubMed

    Jusoh, Malinna; Loh, Saw Hong; Chuah, Tse Seng; Aziz, Ahmad; Cha, Thye San

    2015-03-01

    Microalgae lipids and oils are potential candidates for renewable biodiesel. Many microalgae species accumulate a substantial amount of lipids and oils under environmental stresses. However, low growth rate under these adverse conditions account for the decrease in overall biomass productivity which directly influence the oil yield. This study was undertaken to investigate the effect of exogenously added auxin (indole-3-acetic acid; IAA) on the oil content, fatty acid compositions, and the expression of fatty acid biosynthetic genes in Chlorella vulgaris (UMT-M1). Auxin has been shown to regulate growth and metabolite production of several microalgae. Results showed that oil accumulation was highest on days after treatment (DAT)-2 with enriched levels of palmitic (C16:0) and stearic (C18:0) acids, while the linoleic (C18:2) and α-linolenic (C18:3n3) acids levels were markedly reduced by IAA. The elevated levels of saturated fatty acids (C16:0 and C18:0) were consistent with high expression of the β-ketoacyl ACP synthase I (KAS I) gene, while low expression of omega-6 fatty acid desaturase (ω-6 FAD) gene was consistent with low production of C18:2. However, the increment of stearoyl-ACP desaturase (SAD) gene expression upon IAA induction did not coincide with oleic acid (C18:1) production. The expression of omega-3 fatty acid desaturase (ω-3 FAD) gene showed a positive correlation with the synthesis of PUFA and C18:3n3.

  20. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-03-16

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  1. Identification of genes regulated by UV/salicylic acid.

    SciTech Connect

    Paunesku, T.; Chang-Liu, C.-M.; Shearin-Jones, P.; Watson, C.; Milton, J.; Oryhon, J.; Salbego, D.; Milosavljevic, A.; Woloschak, G. E.; CuraGen Corp.

    2000-02-01

    Purpose : Previous work from the authors' group and others has demonstrated that some of the effects of UV irradiation on gene expression are modulated in response to the addition of salicylic acid to irradiated cells. The presumed effector molecule responsible for this modulation is NF-kappaB. In the experiments described here, differential-display RT-PCR was used to identify those cDNAs that are differentially modulated by UV radiation with and without the addition of salicylic acid. Materials and methods : Differential-display RT-PCR was used to identify differentially expressed genes. Results : Eight such cDNAs are presented: lactate dehydrogenase (LDH-beta), nuclear encoded mitochondrial NADH ubiquinone reductase 24kDa (NDUFV2), elongation initiation factor 4B (eIF4B), nuclear dots protein SP100, nuclear encoded mitochondrial ATPase inhibitor (IF1), a cDNA similar to a subunit of yeast CCAAT transcription factor HAP5, and two expressed sequence tags (AA187906 and AA513156). Conclusions : Sequences of four of these genes contained NF-kappaB DNA binding sites of the type that may attract transrepressor p55/p55 NF-kappaB homodimers. Down-regulation of these genes upon UV irradiation may contribute to increased cell survival via suppression of p53 independent apoptosis.

  2. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  3. Synthesis of bile acid monosulphates by the isolated perfused rat kidney.

    PubMed Central

    Summerfield, J A; Gollan, J L; Billing, B H

    1976-01-01

    Perfusion of an isolated rat kidney with labelled bile acids, in a protein-free medium, resulted in the urinary excretion of the labelled bile acid, 3% being converted into polar metabolities in 1h. These metabolities were neither glycine nor taurine conjugates, nor bile acid glucuronides, and on solovolysis yielded the free bile acid. On t.l.c. the metabolite of [24-14C]lithocholic acid had the mobility of lithocholate 3-sulphate. The principal metabolite of [24-14C]chenodeoxycholic acid had the mobility of chenodeoxycholate 7-sulphate; trace amounts appeared as chenodeoxycholate 3-sulphate. [35S]sulphate was incorporated in chenodeoxycholic acid by the kidney, resulting in a similar pattern of sulphation. No disulphate salt of chenodeoxycholic acid was detected. These findings lend support to the hypothesis that renal synthesis may account for some of the bile acid sulphates present in urine in the cholestatic syndrome in man. PMID:942413

  4. Lewis Acid Promoted Oxonium Ion Driven Carboamination of Alkynes for the Synthesis of 4-Alkoxy Quinolines.

    PubMed

    Gharpure, Santosh J; Nanda, Santosh K; Adate, Priyanka A; Shelke, Yogesh G

    2017-02-17

    Lewis acid mediated multisegment coupling cascade is designed for the synthesis of densely substituted 4-alkoxy quinolines via an oxonium ion triggered alkyne carboamination sequence involving C-C and C-N bond formations. Cyclic ether fused-quinolines could also be accessed using this fast, operationally simple, high yielding, chemoselective and functional group tolerant method. Versatility and utility of this methodology is demonstrated by postfunctionalization of products obtained and its use in synthesis of potent drug molecules.

  5. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  6. On the origin of protein synthesis factors: a gene duplication/fusion model.

    PubMed

    Cousineau, B; Leclerc, F; Cedergren, R

    1997-12-01

    Sequence similarity has given rise to the proposal that IF-2, EF-G, and EF-Tu are related through a common ancestor. We evaluate this proposition and whether the relationship can be extended to other factors of protein synthesis. Analysis of amino acid sequence similarity gives statistical support for an evolutionary affiliation among IF-1, IF-2, IF-3, EF-Tu, EF-Ts, and EF-G and suggests further that this association is a result of gene duplication/fusion events. In support of this mechanism, the three-dimensional structures of IF-3, EF-Tu, and EF-G display a predictable domain structure and overall conformational similarity. The model that we propose consists of three consecutives duplication/fusion events which would have taken place before the divergence of the three superkingdoms: eubacteria, archaea, and eukaryotes. The root of this protein superfamily tree would be an ancestor of the modern IF-1 gene sequence. The repeated fundamental motif of this protein superfamily is a small RNA binding domain composed of two alpha-helices packed along side of an antiparallel beta-sheet.

  7. Synthesis of multi-functional large pore mesoporous silica nanoparticles as gene carriers

    NASA Astrophysics Data System (ADS)

    Hartono, Sandy B.; Yu, Meihua; Gu, Wenyi; Yang, Jie; Strounina, Ekaterina; Wang, Xiaolin; Qiao, Shizhang; Yu, Chengzhong

    2014-02-01

    The development of functional nanocarriers that can enhance the cellular delivery of a variety of nucleic acid agents is important in many biomedical applications such as siRNA therapy. We report the synthesis of large pore mesoporous silica nanoparticles (LPMSN) loaded with iron oxide and covalently modified by polyethyleneimine (denoted PEI-Fe-LPMSN) as carriers for gene delivery. The LPMSN have a particle size of ˜200 nm and a large pore size of 11 nm. The large pore size is essential for the formation of large iron oxide nanoparticles to increase the magnetic properties and the adsorption capacity of siRNA molecules. The magnetic property facilitates the cellular uptake of nanocarriers under an external magnetic field. PEI is covalently grafted on the silica surface to enhance the nanocarriers’ affinity against siRNA molecules and to improve gene silencing performance. The PEI-Fe-LPMSN delivered siRNA-PLK1 effectively into osteosarcoma cancer cells, leading to cell viability inhibition of 80%, higher compared to the 50% reduction when the same dose of siRNA was delivered by a commercial product, oligofectamine.

  8. Cloning, sequencing and overexpression of the gene for prokaryotic factor EF-P involved in peptide bond synthesis.

    PubMed Central

    Aoki, H; Adams, S L; Chung, D G; Yaguchi, M; Chuang, S E; Ganoza, M C

    1991-01-01

    A soluble protein EF-P (elongation factor P) from Escherichia coli has been purified and shown to stimulate efficient translation and peptide-bond synthesis on native or reconstituted 70S ribosomes in vitro. Based on the partial amino acid sequence of EF-P, 18- and 24-nucleotide DNA probes were synthesized and used to screen lambda phage clones from the Kohara Gene Bank. The entire EF-P gene was detected on lambda clone #650 which contains sequences from the 94 minute region of the E.coli genome. Two DNA fragments, 3.0 and 0.78 kilobases in length encompassing the gene, were isolated and cloned into pUC18 and pUC19. Partially purified extracts from cells transformed with these plasmids overrepresented a protein which co-migrates with EF-P upon SDS polyacrylamide gel electrophoresis, and also exhibited increased EF-P mediated peptide-bond synthetic activity. Based on DNA sequence analysis of this gene, the EF-P protein consists of 187 amino acids with a calculated molecular weight of 20,447. The sequence and chromosomal location of EF-P establishes it as a unique gene product. Images PMID:1956781

  9. Whole body synthesis rates of DHA from α-linolenic acid are greater than brain DHA accretion and uptake rates in adult rats[S

    PubMed Central

    Domenichiello, Anthony F.; Chen, Chuck T.; Trepanier, Marc-Olivier; Stavro, P. Mark; Bazinet, Richard P.

    2014-01-01

    Docosahexaenoic acid (DHA) is important for brain function, however, the exact amount required for the brain is not agreed upon. While it is believed that the synthesis rate of DHA from α-linolenic acid (ALA) is low, how this synthesis rate compares with the amount of DHA required to maintain brain DHA levels is unknown. The objective of this work was to assess whether DHA synthesis from ALA is sufficient for the brain. To test this, rats consumed a diet low in n-3 PUFAs, or a diet containing ALA or DHA for 15 weeks. Over the 15 weeks, whole body and brain DHA accretion was measured, while at the end of the study, whole body DHA synthesis rates, brain gene expression, and DHA uptake rates were measured. Despite large differences in body DHA accretion, there was no difference in brain DHA accretion between rats fed ALA and DHA. In rats fed ALA, DHA synthesis and accretion was 100-fold higher than brain DHA accretion of rats fed DHA. Also, ALA-fed rats synthesized approximately 3-fold more DHA than the DHA uptake rate into the brain. This work indicates that DHA synthesis from ALA may be sufficient to supply the brain. PMID:24212299

  10. Salicylic acid differently impacts ethylene and polyamine synthesis in the glycophyte Solanum lycopersicum and the wild-related halophyte Solanum chilense exposed to mild salt stress.

    PubMed

    Gharbi, Emna; Martínez, Juan-Pablo; Benahmed, Hela; Fauconnier, Marie-Laure; Lutts, Stanley; Quinet, Muriel

    2016-10-01

    This study aimed to determine the effects of exogenous application of salicylic acid (SA) on the toxic effects of salt in relation to ethylene and polyamine synthesis, and to correlate these traits with the expression of genes involved in ethylene and polyamine metabolism in two tomato species differing in their sensitivity to salt stress, Solanum lycopersicum cv Ailsa Craig and its wild salt-resistant relative Solanum chilense. In S. chilense, treatment with 125 mM NaCl improved plant growth, increased production of ethylene, endogenous salicylic acid and spermine. The production was related to a modification of expression of genes involved in ethylene and polyamine metabolism. In contrast, salinity decreased plant growth in S. lycopersicum without affecting endogenous ethylene, salicylic or polyamine concentrations. Exogenous application of salicylic acid at 0.01 mM enhanced shoot growth in both species and affected ethylene and polyamine production in S. chilense. Concomitant application of NaCl and salicylic acid improved osmotic adjustment, thus suggesting that salt and SA may act in synergy on osmolyte synthesis. However, the beneficial impact of exogenous application of salicylic acid was mitigated by salt stress since NaCl impaired endogenous SA accumulation in the shoot and salicylic acid did not improve plant growth in salt-treated plants. Our results thus revealed that both species respond differently to salinity and that salicylic acid, ethylene and polyamine metabolisms are involved in salt resistance in S. chilense.

  11. Nucleic acid modifications in regulation of gene expression

    PubMed Central

    Chen, Kai; Zhao, Boxuan Simen; He, Chuan

    2016-01-01

    Nucleic acids carry a wide range of different chemical modifications. In contrast to previous views that these modifications are static and only play fine-tuning functions, recent research advances paint a much more dynamic picture. Nucleic acids carry diverse modifications and employ these chemical marks to exert essential or critical influences in a variety of cellular processes in eukaryotic organisms. This review covers several nucleic acid modifications that play important regulatory roles in biological systems, especially in regulation of gene expression: 5-methylcytosine (5mC) and its oxidative derivatives, and N6 -methyladenine (6mA) in DNA; N6 -methyladenosine (m6A), pseudouridine (), and 5-methylcytosine (m5C) in messenger RNA and long non-coding RNA. Modifications in other non-coding RNAs, such as tRNA, miRNA, and snRNA, are also briefly summarized. We provide brief historical perspective of the field, and highlight recent progress in identifying diverse nucleic acid modifications and exploring their functions in different organisms. Overall, we believe that work in this field will yield additional layers of both chemical and biological complexity as we continue to uncover functional consequences of known nucleic acid modifications and discover new ones. PMID:26933737

  12. Gene cloning and molecular characterization of the Talaromyces thermophilus lipase catalyzed efficient hydrolysis and synthesis of esters.

    PubMed

    Romdhane, Ines Belhaj-Ben; Frikha, Fakher; Maalej-Achouri, Inès; Gargouri, Ali; Belghith, Hafedh

    2012-02-15

    A genomic bank from Talaromyces thermophilus fungus was constructed and screened using a previously isolated fragment lipase gene as probe. From several clones isolated, the nucleotide sequence of the lipase gene (TTL gene) was completed and sequenced. The TTL coding gene consists of an open reading frame (ORF) of 1083bp encoding a protein of 269 Aa with an estimated molecular mass of 30kDa. The TTL belongs to the same gene family as Thermomyces lanuginosus lipase (TLL, Lipolase®), a well known lipase with multiple applications. The promoter sequence of the TTL gene showed the conservation of known consensus sequences PacC, CreA, Hap2-3-4 and the existence of a particular sequence like the binding sites of Oleate Response Element (ORE) and Fatty acids Responsis Element (FARE) which are similar to that already found to be specific of lipolytic genes in Candida and Fusarium, respectively. Northern blot analysis showed that the TTL expression was much higher on wheat bran than on olive oil as sole carbon source. Compared to the Lipolase®, this enzyme was found to be more efficient for the hydrolysis and the synthesis of esters; and its synthetic efficiency even reached 91.6% from Waste Cooking Oil triglycerides.

  13. In Vivo Evidence that S-Adenosylmethionine and Fatty Acid Synthesis Intermediates Are the Substrates for the LuxI Family of Autoinducer Synthases

    PubMed Central

    Val, Dale L.; Cronan, John E.

    1998-01-01

    Many gram-negative bacteria synthesize N-acyl homoserine lactone autoinducer molecules as quorum-sensing signals which act as cell density-dependent regulators of gene expression. We have investigated the in vivo source of the acyl chain and homoserine lactone components of the autoinducer synthesized by the LuxI homolog, TraI. In Escherichia coli, synthesis of N-(3-oxooctanoyl)homoserine lactone by TraI was unaffected in a fadD mutant blocked in β-oxidative fatty acid degradation. Also, conditions known to induce the fad regulon did not increase autoinducer synthesis. In contrast, cerulenin and diazoborine, specific inhibitors of fatty acid synthesis, both blocked autoinducer synthesis even in a strain dependent on β-oxidative fatty acid degradation for growth. These data provide the first in vivo evidence that the acyl chains in autoinducers synthesized by LuxI-family synthases are derived from acyl-acyl carrier protein substrates rather than acyl coenzyme A substrates. Also, we show that decreased levels of intracellular S-adenosylmethionine caused by expression of bacteriophage T3 S-adenosylmethionine hydrolase result in a marked reduction in autoinducer synthesis, thus providing direct in vivo evidence that the homoserine lactone ring of LuxI-family autoinducers is derived from S-adenosylmethionine. PMID:9573148

  14. Identification of Cell Wall Synthesis Regulatory Genes Controlling Biomass Characteristics and Yield in Rice (Oryza Sativa)

    SciTech Connect

    Peng, Zhaohua PEng; Ronald, Palmela; Wang, Guo-Liang

    2013-04-26

    This project aims to identify the regulatory genes of rice cell wall synthesis pathways using a cell wall removal and regeneration system. We completed the gene expression profiling studies following the time course from cell wall removal to cell wall regeneration in rice suspension cells. We also completed, total proteome, nuclear subproteome and histone modification studies following the course from cell wall removal and cell wall regeneration process. A large number of differentially expressed regulatory genes and proteins were identified. Meanwhile, we generated RNAi and over-expression transgenic rice for 45 genes with at least 10 independent transgenic lines for each gene. In addition, we ordered T-DNA and transposon insertion mutants for 60 genes from Korea, Japan, and France and characterized the mutants. Overall, we have mutants and transgenic lines for over 90 genes, exceeded our proposed goal of generating mutants for 50 genes. Interesting Discoveries a) Cell wall re-synthesis in protoplasts may involve a novel cell wall synthesis mechanism. The synthesis of the primary cell wall is initiated in late cytokinesis with further modification during cell expansion. Phragmoplast plays an essential role in cell wall synthesis. It services as a scaffold for building the cell plate and formation of a new cell wall. Only one phragmoplast and one new cell wall is produced for each dividing cell. When the cell wall was removed enzymatically, we found that cell wall re-synthesis started from multiple locations simultaneously, suggesting that a novel mechanism is involved in cell wall re-synthesis. This observation raised many interesting questions, such as how the starting sites of cell wall synthesis are determined, whether phragmoplast and cell plate like structures are involved in cell wall re-synthesis, and more importantly whether the same set of enzymes and apparatus are used in cell wall re-synthesis as during cytokinesis. Given that many known cell wall

  15. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-04

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  16. Orthogonally Protected Furanoid Sugar Diamino Acids for Solid-Phase Synthesis of Oligosaccharide Mimetics.

    PubMed

    John, Franklin; Wittmann, Valentin

    2015-08-07

    Sugar diamino acids (SDAs), which differ from the widely used sugar amino acids in the presence of a second amino group connected to the carbohydrate core, share structural features of both amino acids and carbohydrates. They can be used for the preparation of linear and branched amide-linked oligosaccharide mimetics. Such oligomers carry free amino groups, which are positively charged at neutral pH, in a spatially defined way and, thus, represent a potential class of aminoglycoside mimetics. We report here the first examples of orthogonally protected furanoid SDAs and their use in solid-phase synthesis. Starting from d-glucose, we developed a divergent synthetic route to three derivatives of 3,5-diamino-3,5-dideoxy-d-ribofuranose. These building blocks are compatible with solid-phase peptide synthesis following the 9-fluorenylmethoxycarbonyl (Fmoc) strategy, which we demonstrate by the synthesis of an SDA tetramer.

  17. New hydroxamic acid derivatives of fluoroquinolones: synthesis and evaluation of antibacterial and anticancer properties.

    PubMed

    Rajulu, Gavara Govinda; Bhojya Naik, Halehatty Seephya; Viswanadhan, Abhilash; Thiruvengadam, Jayaraman; Rajesh, Kondodiyil; Ganesh, Sambasivam; Jagadheshan, Hiriyan; Kesavan, Poonimangadu Koppolu

    2014-01-01

    A series of new hydroxamic acid derivatives (6a-f) at C-3 position of fluoroquinolones were designed and synthesized through multistep synthesis. The design concept involved replacement of the 3-carboxylic acid in fluoquinolones with hydroxamic acid as an acid mimicking group. The synthetic work employed in this work provides a good example for the synthesis of pure hydroxamic acid based fluoroquinolones. The synthesized compounds were characterized by (1)H-NMR, electrospray ionization (ESI)-MS and IR. The new compounds were tested for their in vitro antimicrobial and anti-proliferative activity. Out of the six derivatives, compound 6e exhibited moderate antibacterial activity by inhibiting the growth of Escherichia coli and Klebsiella pneumoniae (MIC: 4.00-8.00 µg/mL). Compounds 6b and 6f displayed good growth inhibition against A549 Lung adenocarcinoma and HCT-116 Colon carcinoma cell lines.

  18. Synthesis of 5,9-hexacosadienoic acid phospholipids. 11. Phospholipid studies of marine organisms.

    PubMed

    Mena, P L; Djerassi, C

    1985-01-01

    The synthesis of phosphatidylcholines (PC), phosphatidylethanolamines (PE) and phosphatidylserines (PS) containing two acyl chains of the naturally occurring sponge fatty acid (5Z,9Z)-5,9-hexacosadienoic acid as well as its hitherto unknown geometrical isomers is described. The PCs were prepared by deacylation of natural lecithins, followed by reacylation with fatty acid anhydrides. The synthesis of mixed-acid PCs is also reported: a diacyl product was converted to the lyso-PC by treatment with phospholipase A2 and subsequent acylation of the secondary hydroxyl group to give the desired mixed-acid PCs. The PEs and the PSs were prepared from the corresponding PCs by enzymatic transphosphatidylation catalyzed by phospholipase D. Structural assignments of the compounds were confirmed by spectroscopy (1H-NMR and MS). Ammonia chemical ionization mass spectrometry provided molecular ion and significant fragment peaks for PCs and PEs.

  19. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  20. Stimulation of Ribonucleic Acid Synthesis by Chloramphenicol in a rel+ Aminoacyl-Transfer Ribonucleic Acid Synthetase Mutant of Escherichia coli

    PubMed Central

    Yegian, Charles D.; Vanderslice, Rebecca W.

    1971-01-01

    Escherichia coli strain 9D3 possesses a highly temperature-sensitive valyl-transfer ribonucleic acid (tRNA) synthetase (EC 6.1.1.9). Since 9D3 is a rel+ strain, it cannot carry out net RNA synthesis at high temperature. A 100-μg amount of chloramphenicol (CAP) per ml added in the absence of valine cannot stimulate RNA synthesis. Either 300 μg of CAP or 100 μg of CAP plus 50 μg of valine per ml, however, promotes nearly maximal RNA synthesis. These results can be understood as follows. (i) Valyl-tRNA is required for net RNA synthesis, (ii) the synthetase lesion is incomplete, (iii) the rate of mutant acylation of tRNAval at high temperature is valine-dependent, and (iv) the CAP concentration determines the rate of residual protein synthesis. Data are also presented which demonstrate that the rate of net RNA synthesis can greatly increase long after the addition of CAP, if the amount of valyl-tRNA increases. PMID:4942766

  1. Genome wide association study identifies 20 novel promising genes associated with milk fatty acid traits in Chinese Holstein.

    PubMed

    Li, Cong; Sun, Dongxiao; Zhang, Shengli; Wang, Sheng; Wu, Xiaoping; Zhang, Qin; Liu, Lin; Li, Yanhua; Qiao, Lv

    2014-01-01

    Detecting genes associated with milk fat composition could provide valuable insights into the complex genetic networks of genes underling variation in fatty acids synthesis and point towards opportunities for changing milk fat composition via selective breeding. In this study, we conducted a genome-wide association study (GWAS) for 22 milk fatty acids in 784 Chinese Holstein cows with the PLINK software. Genotypes were obtained with the Illumina BovineSNP50 Bead chip and a total of 40,604 informative, high-quality single nucleotide polymorphisms (SNPs) were used. Totally, 83 genome-wide significant SNPs and 314 suggestive significant SNPs associated with 18 milk fatty acid traits were detected. Chromosome regions that affect milk fatty acid traits were mainly observed on BTA1, 2, 5, 6, 7, 9, 13, 14, 18, 19, 20, 21, 23, 26 and 27. Of these, 146 SNPs were associated with more than one milk fatty acid trait; most of studied fatty acid traits were significant associated with multiple SNPs, especially C18:0 (105 SNPs), C18 index (93 SNPs), and C14 index (84 SNPs); Several SNPs are close to or within the DGAT1, SCD1 and FASN genes which are well-known to affect milk composition traits of dairy cattle. Combined with the previously reported QTL regions and the biological functions of the genes, 20 novel promising candidates for C10:0, C12:0, C14:0, C14:1, C14 index, C18:0, C18:1n9c, C18 index, SFA, UFA and SFA/UFA were found, which composed of HTR1B, CPM, PRKG1, MINPP1, LIPJ, LIPK, EHHADH, MOGAT1, ECHS1, STAT1, SORBS1, NFKB2, AGPAT3, CHUK, OSBPL8, PRLR, IGF1R, ACSL3, GHR and OXCT1. Our findings provide a groundwork for unraveling the key genes and causal mutations affecting milk fatty acid traits in dairy cattle.

  2. Aromatic amino acids are utilized and protein synthesis is stimulated during amino acid infusion in the ovine fetus.

    PubMed

    Liechty, E A; Boyle, D W; Moorehead, H; Auble, L; Denne, S C

    1999-06-01

    The purpose of this study was to determine whether the ovine fetus is capable of increased disposal of an amino acid load; if so, would it respond by increased protein synthesis, amino acid catabolism or both? A further purpose of the study was to determine whether the pathways of aromatic amino acid catabolism are functional in the fetus. Late gestation ovine fetuses of well-nourished ewes received an infusion of Aminosyn PF alone (APF), and Aminosyn PF + glycyl-L-tyrosine (APF+GT) at rates estimated to double the intake of these amino acids. The initial study, using APF, was performed at 126 +/- 1.4 d; the APF+GT study was performed at 132 +/- 1.7 d (term = 150 d). Phenylalanine and tyrosine kinetics were determined using both stable and radioactive isotopes. Plasma concentrations of most amino acids, but not tyrosine, increased during both studies; tyrosine concentration increased only during the APF+GT study. Phenylalanine rate of appearance and phenylalanine hydroxylation increased during both studies. Tyrosine rate of appearance increased only during the APF+GT study; tyrosine oxidation did not increase during either study. Fetal protein synthesis increased significantly during both studies, producing a significant increase in fetal protein accretion. Fetal proteolysis was unchanged in response to either amino acid infusion. These results indicate that the fetus responds to an acute increase in amino acid supply primarily by increasing protein synthesis and accretion, with a smaller but significant increase in amino acid catabolism also. Both phenylalanine hydroxylation and tyrosine oxidation are active in the fetus, and the fetus is able to increase phenylalanine hydroxylation rapidly in response to increased supply.

  3. Nucleotide sequences of the Pseudomonas savastanoi indoleacetic acid genes show homology with Agrobacterium tumefaciens T-DNA

    PubMed Central

    Yamada, Tetsuji; Palm, Curtis J.; Brooks, Bob; Kosuge, Tsune

    1985-01-01

    We report the nucleotide sequences of iaaM and iaaH, the genetic determinants for, respectively, tryptophan 2-monooxygenase and indoleacetamide hydrolase, the enzymes that catalyze the conversion of L-tryptophan to indoleacetic acid in the tumor-forming bacterium Pseudomonas syringae pv. savastanoi. The sequence analysis indicates that the iaaM locus contains an open reading frame encoding 557 amino acids that would comprise a protein with a molecular weight of 61,783; the iaaH locus contains an open reading frame of 455 amino acids that would comprise a protein with a molecular weight of 48,515. Significant amino acid sequence homology was found between the predicted sequence of the tryptophan monooxygenase of P. savastanoi and the deduced product of the T-DNA tms-1 gene of the octopine-type plasmid pTiA6NC from Agrobacterium tumefaciens. Strong homology was found in the 25 amino acid sequence in the putative FAD-binding region of tryptophan monooxygenase. Homology was also found in the amino acid sequences representing the central regions of the putative products of iaaH and tms-2 T-DNA. The results suggest a strong similarity in the pathways for indoleacetic acid synthesis encoded by genes in P. savastanoi and in A. tumefaciens T-DNA. Images PMID:16593610

  4. Artemisinic acid inhibits melanogenesis through downregulation of C/EBP α-dependent expression of HMG-CoA reductase gene.

    PubMed

    Lee, Jongsung; Lee, Jienny; Jung, Eunsun; Cho, Jae Youl; Park, Deokhoon

    2013-01-01

    Cholesterol is associated with the regulation of melanogenesis which is the major physiological defense against solar irradiation. The present study was designed to determine the effects of artemisinic acid on melanogenesis and its mechanisms of action in human epidermal melanocytes. In this study, we found that artemisinic acid inhibited melanin content. The mRNA levels of microphthalmia-associated transcription factor (MITF) and its downstream genes tyrosinase, tyrosinase-related protein (TRP)-1, and TRP-2 were reduced by artemisinic acid treatment. Additionally, the mRNA levels of melanogenesis-related genes (c-KIT, stem cell factor (SCF), and macrophage migration inhibitory factor (MIF)) were down-regulated by artemisinic acid. Furthermore, cAMP production and protein kinase A (PKA) activity were suppressed by artemisinic acid. Moreover, attempts to elucidate a possible mechanism underlying the artemisinic acid-mediated effects revealed that artemisinic acid regulated melanogenesis by inhibiting cholesterol synthesis through downregulation of the hydroxymethylglutaryl CoA (HMG CoA) reductase gene, which was mediated through reduced expression of the CCAAT/enhancer-binding protein (C/EBP) α gene. Taken together, these findings indicate that the inhibition of melanogenesis by artemisinic acid occurs through reduced expression of the HMG CoA reductase gene, which is mediated by C/EBP α inhibition and suggest that artemisinic acid may be useful as a hyperpigmentation inhibitor.

  5. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-08

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  6. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  7. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  8. Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer

    PubMed Central

    Getino, María; Sanabria-Ríos, David J.; Fernández-López, Raúl; Campos-Gómez, Javier; Sánchez-López, José M.; Fernández, Antonio; Carballeira, Néstor M.

    2015-01-01

    ABSTRACT Bacterial conjugation constitutes a major horizontal gene transfer mechanism for the dissemination of antibiotic resistance genes among human pathogens. Antibiotic resistance spread could be halted or diminished by molecules that interfere with the conjugation process. In this work, synthetic 2-alkynoic fatty acids were identified as a novel class of conjugation inhibitors. Their chemical properties were investigated by using the prototype 2-hexadecynoic acid and its derivatives. Essential features of effective inhibitors were the carboxylic group, an optimal long aliphatic chain of 16 carbon atoms, and one unsaturation. Chemical modification of these groups led to inactive or less-active derivatives. Conjugation inhibitors were found to act on the donor cell, affecting a wide number of pathogenic bacterial hosts, including Escherichia, Salmonella, Pseudomonas, and Acinetobacter spp. Conjugation inhibitors were active in inhibiting transfer of IncF, IncW, and IncH plasmids, moderately active against IncI, IncL/M, and IncX plasmids, and inactive against IncP and IncN plasmids. Importantly, the use of 2-hexadecynoic acid avoided the spread of a derepressed IncF plasmid into a recipient population, demonstrating the feasibility of abolishing the dissemination of antimicrobial resistances by blocking bacterial conjugation. PMID:26330514

  9. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  10. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  11. Only One of the Five Ralstonia solanacearum Long-Chain 3-Ketoacyl-Acyl Carrier Protein Synthase Homologues Functions in Fatty Acid Synthesis

    PubMed Central

    Cheng, Juanli; Ma, Jincheng; Lin, Jinshui; Fan, Zhen-Chuan; Cronan, John E.

    2012-01-01

    Ralstonia solanacearum, a major phytopathogenic bacterium, causes a bacterial wilt disease in diverse plants. Although fatty acid analyses of total membranes of R. solanacearum showed that they contain primarily palmitic (C16:0), palmitoleic (C16:1) and cis-vaccenic (C18:1) acids, little is known regarding R. solanacearum fatty acid synthesis. The R. solanacearum GMI1000 genome is unusual in that it contains four genes (fabF1, fabF2, fabF3, and fabF4) annotated as encoding 3-ketoacyl-acyl carrier protein synthase II homologues and one gene (fabB) annotated as encoding 3-ketoacyl-acyl carrier protein synthase I. We have analyzed this puzzling apparent redundancy and found that only one of these genes, fabF1, encoded a long-chain 3-ketoacyl-acyl carrier protein synthase, whereas the other homologues did not play roles in R. solanacearum fatty acid synthesis. Mutant strains lacking fabF1 are nonviable, and thus, FabF1 is essential for R. solanacearum fatty acid biosynthesis. Moreover, R. solanacearum FabF1 has the activities of both 3-ketoacyl-acyl carrier protein synthase II and 3-ketoacyl-acyl carrier protein synthase I. PMID:22194290

  12. Only one of the five Ralstonia solanacearum long-chain 3-ketoacyl-acyl carrier protein synthase homologues functions in fatty acid synthesis.

    PubMed

    Cheng, Juanli; Ma, Jincheng; Lin, Jinshui; Fan, Zhen-Chuan; Cronan, John E; Wang, Haihong

    2012-03-01

    Ralstonia solanacearum, a major phytopathogenic bacterium, causes a bacterial wilt disease in diverse plants. Although fatty acid analyses of total membranes of R. solanacearum showed that they contain primarily palmitic (C(16:0)), palmitoleic (C(16:1)) and cis-vaccenic (C(18:1)) acids, little is known regarding R. solanacearum fatty acid synthesis. The R. solanacearum GMI1000 genome is unusual in that it contains four genes (fabF1, fabF2, fabF3, and fabF4) annotated as encoding 3-ketoacyl-acyl carrier protein synthase II homologues and one gene (fabB) annotated as encoding 3-ketoacyl-acyl carrier protein synthase I. We have analyzed this puzzling apparent redundancy and found that only one of these genes, fabF1, encoded a long-chain 3-ketoacyl-acyl carrier protein synthase, whereas the other homologues did not play roles in R. solanacearum fatty acid synthesis. Mutant strains lacking fabF1 are nonviable, and thus, FabF1 is essential for R. solanacearum fatty acid biosynthesis. Moreover, R. solanacearum FabF1 has the activities of both 3-ketoacyl-acyl carrier protein synthase II and 3-ketoacyl-acyl carrier protein synthase I.

  13. Ethacrynic and alpha-lipoic acids inhibit vaccinia virus late gene expression.

    PubMed

    Spisakova, Martina; Cizek, Zdenek; Melkova, Zora

    2009-02-01

    Smallpox was declared eradicated in 1980. However recently, the need of agents effective against poxvirus infection has emerged again. In this paper, we report an original finding that two redox-modulating agents, the ethacrynic and alpha-lipoic acids (EA, LA), inhibit growth of vaccinia virus (VACV) in vitro. The effect of EA and LA was compared with those of beta-mercaptoethanol, DTT and ascorbic acid, but these agents increased VACV growth in HeLa G cells. The inhibitory effects of EA and LA on the growth of VACV were further confirmed in several cell lines of different embryonic origin, in epithelial cells, fibroblasts, macrophages and T-lymphocytes. Finally, we have analyzed the mechanism of action of the two agents. They both decreased expression of VACV late genes, as demonstrated by western blot analysis and activity of luciferase expressed under control of different VACV promoters. In contrast, they did not inhibit virus entry into the cell, expression of VACV early genes or VACV DNA synthesis. The results suggest new directions in development of drugs effective against poxvirus infection.

  14. The expression of genes involved in jejunal lipogenesis and lipoprotein synthesis is altered in morbidly obese subjects with insulin resistance.

    PubMed

    Gutierrez-Repiso, Carolina; Rodriguez-Pacheco, Francisca; Garcia-Arnes, Juan; Valdes, Sergio; Gonzalo, Montserrat; Soriguer, Federico; Moreno-Ruiz, Francisco J; Rodriguez-Cañete, Alberto; Gallego-Perales, Jose L; Alcain-Martinez, Guillermo; Vazquez-Pedreño, Luis; Lopez-Enriquez, Soledad; Garcia-Serrano, Sara; Garrido-Sanchez, Lourdes; Garcia-Fuentes, Eduardo

    2015-12-01

    The dyslipidemia associated with type 2 diabetes mellitus (T2DM) is an important risk factor for atherosclerotic cardiovascular disease. However, until now little attention has been paid to the role that the intestine might have. The aim of this research was to determine the relation between insulin resistance and intestinal de novo lipogenesis/lipoprotein synthesis in morbidly obese subjects and to study the effect of insulin on these processes. Jejunal mRNA expression of the different genes involved in the intestinal de novo lipogenesis/lipoprotein synthesis was analyzed in three groups of morbidly obese subjects: Group 1 with low insulin resistance (MO-low-IR), group 2 with high insulin resistance (MO-high-IR), and group 3 with T2DM and treatment with metformin (MO-metf-T2DM). In addition, intestinal epithelial cells (IECs) from MO-low-IR were incubated with different doses of insulin/glucose. In Group 2 (MO-high-IR), the jejunal mRNA expression levels of apo A-IV, ATP-citrate lyase (ACLY), pyruvate dehydrogenase (lipoamide) beta (PDHB), and sterol regulatory element-binding protein-1c (SREBP-1c) were significantly higher and acetyl-CoA carboxylase alpha (ACC1) and fatty-acid synthase lower than in Group 1 (MO-low-IR). In Group 3 (MO-metf-T2DM), only the ACLY and PDHB mRNA expressions were significantly higher than in Group 1 (MO-low-IR). The mRNA expression of most of the genes studied was significantly linked to insulin and glucose levels. The incubation of IEC with different doses of insulin and glucose produced a higher expression of diacylglycerol acyltransferase 2, microsomal triglyceride transfer protein, apo A-IV, SREBP-1c, and ACC1 when both, glucose and insulin, were at a high concentration. However, with only high insulin levels, there were higher apo A-IV, PDHB and SREBP-1c expressions, and a lower ACLY expression. In conclusion, the jejunum of MO-high-IR has a decreased mRNA expression of genes involved in de novo fatty-acid synthesis and an

  15. Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon activator.

    PubMed Central

    James, D W; Lim, E; Keller, J; Plooy, I; Ralston, E; Dooner, H K

    1995-01-01

    The FATTY ACID ELONGATION1 (FAE1) gene of Arabidopsis is required for the synthesis of very long chain fatty acids in the seed. The product of the FAE1 gene is presumed to be a condensing enzyme that extends the chain length of fatty acids from C18 to C20 and C22. We report here the cloning of FAE1 by directed transposon tagging with the maize element Activator (Ac). An unstable fae1 mutant was isolated in a line carrying Ac linked to the FAE1 locus on chromosome 4. Cosegregation and reversion analyses established that the new mutant was tagged by Ac. A DNA fragment flanking Ac was cloned by inverse polymerase chain reaction and used to isolate FAE1 genomic clones and a cDNA clone from a library made from immature siliques. The predicted amino acid sequence of the FAE1 protein shares homology with those of other condensing enzymes (chalcone synthase, stilbene synthases, and beta-ketoacyl-acyl carrier protein synthase III), supporting the notion that FAE1 is the structural gene for a synthase or condensing enzyme. FAE1 is expressed in developing seed, but not in leaves, as expected from the effect of the fae1 mutation on the fatty acid compositions of those tissues. PMID:7734965

  16. Genetic diversity analysis of buffalo fatty acid synthase (FASN) gene and its differential expression among bovines.

    PubMed

    Niranjan, S K; Goyal, S; Dubey, P K; Kumari, N; Mishra, S K; Mukesh, M; Kataria, R S

    2016-01-10

    Fatty Acid Synthase (FASN) gene seems to be structurally and functionally different in bovines in view of their distinctive fatty acid synthesis process. Structural variation and differential expression of FASN gene is reported in buffalo (Bubalus bubalis), a bovine species close to cattle, in this study. Amino acid sequence and phylogenetic analysis of functionally important thioesterase (TE) domain of FASN revealed its conserved nature across mammals. Amino acid residues at TE domain, responsible for substrate binding and processing, were found to be invariant in all the mammalian species. A total of seven polymorphic nucleotide sites, including two in coding region of TE domain were identified across the 10 buffalo populations of riverine and swamp types. G and C alleles were found almost fixed at g18996 and g19056 loci, respectively in riverine buffaloes. Principal component analysis of three SNPs (g18433, g18996 and g19056) revealed distinct classification of riverine and swamp buffalo populations. Reverse Transcription-PCR amplification of mRNA corresponding to exon 8-10 region of buffalo FASN helped in identification of two transcript variants; one transcript of 565 nucleotides and another alternate transcript of 207 nucleotides, seems to have arisen through alternative splicing. Both the transcripts were found to be expressed in most of the vital tissues of buffalo with the highest expression in mammary gland. Semi-quantitative and real-time expression analysis across 13 different buffalo tissues revealed its highest expression in lactating mammary gland. When compared, expression of FASN was also found to be higher in liver, adipose and skeletal muscle of buffalo tissues, than cattle. However, the FASN expression was highest in adipose among the three tissues in both the species. Results indicate structural and functional distinctiveness of bovine FASN. Presence of alternate splicing in buffalo FASN also seems to be a unique phenomenon to the bovines

  17. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase

    PubMed Central

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  18. Modulation of medium-chain fatty acid synthesis in Synechococcus sp. PCC 7002 by replacing FabH with a Chaetoceros Ketoacyl-ACP synthase

    DOE PAGES

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; ...

    2016-05-26

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less

  19. Higher transcription levels in ascorbic acid biosynthetic and recycling genes were associated with higher ascorbic acid accumulation in blueberry.

    PubMed

    Liu, Fenghong; Wang, Lei; Gu, Liang; Zhao, Wei; Su, Hongyan; Cheng, Xianhao

    2015-12-01

    In our preliminary study, the ripe fruits of two highbush blueberry (Vaccinium corymbosum L.) cultivars, cv 'Berkeley' and cv 'Bluecrop', were found to contain different levels of ascorbic acid. However, factors responsible for these differences are still unknown. In the present study, ascorbic acid content in fruits was compared with expression profiles of ascorbic acid biosynthetic and recycling genes between 'Bluecrop' and 'Berkeley' cultivars. The results indicated that the l-galactose pathway was the predominant route of ascorbic acid biosynthesis in blueberry fruits. Moreover, higher expression levels of the ascorbic acid biosynthetic genes GME, GGP, and GLDH, as well as the recycling genes MDHAR and DHAR, were associated with higher ascorbic acid content in 'Bluecrop' compared with 'Berkeley', which indicated that a higher efficiency ascorbic acid biosynthesis and regeneration was likely to be responsible for the higher ascorbic acid accumulation in 'Bluecrop'.

  20. Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

  1. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

  2. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  3. Vitamin B(12) synthesis and salvage pathways were acquired by horizontal gene transfer to the Thermotogales.

    PubMed

    Swithers, Kristen S; Petrus, Amanda K; Secinaro, Michael A; Nesbø, Camilla L; Gogarten, J Peter; Noll, Kenneth M; Butzin, Nicholas C

    2012-01-01

    The availability of genome sequences of Thermotogales species from across the order allows an examination of the evolutionary origins of phenotypic characteristics in this lineage. Several studies have shown that the Thermotogales have acquired large numbers of genes from distantly related lineages, particularly Firmicutes and Archaea. Here, we report the finding that some Thermotogales acquired the ability to synthesize vitamin B(12) by acquiring the requisite genes from these distant lineages. Thermosipho species, uniquely among the Thermotogales, contain genes that encode the means to synthesize vitamin B(12) de novo from glutamate. These genes are split into two gene clusters: the corrinoid synthesis gene cluster, that is unique to the Thermosipho and the cobinamide salvage gene cluster. The corrinoid synthesis cluster was acquired from the Firmicutes lineage, whereas the salvage pathway is an amalgam of bacteria- and archaea-derived proteins. The cobinamide salvage gene cluster has a patchy distribution among Thermotogales species, and ancestral state reconstruction suggests that this pathway was present in the common Thermotogales ancestor. We show that Thermosipho africanus can grow in the absence of vitamin B(12), so its de novo pathway is functional. We detected vitamin B(12) in the extracts of T. africanus cells to verify the synthetic pathway. Genes in T. africanus with apparent B(12) riboswitches were found to be down-regulated in the presence of vitamin B(12) consistent with their roles in B(12) synthesis and cobinamide salvage.

  4. Vitamin B12 Synthesis and Salvage Pathways Were Acquired by Horizontal Gene Transfer to the Thermotogales

    PubMed Central

    Swithers, Kristen S.; Petrus, Amanda K.; Secinaro, Michael A.; Nesbø, Camilla L.; Gogarten, J. Peter; Noll, Kenneth M.; Butzin, Nicholas C.

    2012-01-01

    The availability of genome sequences of Thermotogales species from across the order allows an examination of the evolutionary origins of phenotypic characteristics in this lineage. Several studies have shown that the Thermotogales have acquired large numbers of genes from distantly related lineages, particularly Firmicutes and Archaea. Here, we report the finding that some Thermotogales acquired the ability to synthesize vitamin B12 by acquiring the requisite genes from these distant lineages. Thermosipho species, uniquely among the Thermotogales, contain genes that encode the means to synthesize vitamin B12 de novo from glutamate. These genes are split into two gene clusters: the corrinoid synthesis gene cluster, that is unique to the Thermosipho and the cobinamide salvage gene cluster. The corrinoid synthesis cluster was acquired from the Firmicutes lineage, whereas the salvage pathway is an amalgam of bacteria- and archaea-derived proteins. The cobinamide salvage gene cluster has a patchy distribution among Thermotogales species, and ancestral state reconstruction suggests that this pathway was present in the common Thermotogales ancestor. We show that Thermosipho africanus can grow in the absence of vitamin B12, so its de novo pathway is functional. We detected vitamin B12 in the extracts of T. africanus cells to verify the synthetic pathway. Genes in T. africanus with apparent B12 riboswitches were found to be down-regulated in the presence of vitamin B12 consistent with their roles in B12 synthesis and cobinamide salvage. PMID:22798452

  5. Amino Acid Starvation Has Opposite Effects on Mitochondrial and Cytosolic Protein Synthesis

    PubMed Central

    Pearce, Sarah F.; Rorbach, Joanna; He, Jiuya; Brea-Calvo, Gloria; Minczuk, Michal; Reyes, Aurelio; Holt, Ian J.; Spinazzola, Antonella

    2014-01-01

    Amino acids are essential for cell growth and proliferation for they can serve as precursors of protein synthesis, be remodelled for nucleotide and fat biosynthesis, or be burnt as fuel. Mitochondria are energy producing organelles that additionally play a central role in amino acid homeostasis. One might expect mitochondrial metabolism to be geared towards the production and preservation of amino acids when cells are deprived of an exogenous supply. On the contrary, we find that human cells respond to amino acid starvation by upregulating the amino acid-consuming processes of respiration, protein synthesis, and amino acid catabolism in the mitochondria. The increased utilization of these nutrients in the organelle is not driven primarily by energy demand, as it occurs when glucose is plentiful. Instead it is proposed that the changes in the mitochondrial metabolism complement the repression of cytosolic protein synthesis to restrict cell growth and proliferation when amino acids are limiting. Therefore, stimulating mitochondrial function might offer a means of inhibiting nutrient-demanding anabolism that drives cellular proliferation. PMID:24718614

  6. A gene network engineering platform for lactic acid bacteria.

    PubMed

    Kong, Wentao; Kapuganti, Venkata S; Lu, Ting

    2016-02-29

    Recent developments in synthetic biology have positioned lactic acid bacteria (LAB) as a major class of cellular chassis for applications. To achieve the full potential of LAB, one fundamental prerequisite is the capacity for rapid engineering of complex gene networks, such as natural biosynthetic pathways and multicomponent synthetic circuits, into which cellular functions are encoded. Here, we present a synthetic biology platform for rapid construction and optimization of large-scale gene networks in LAB. The platform involves a copy-controlled shuttle for hosting target networks and two associated strategies that enable efficient genetic editing and phenotypic validation. By using a nisin biosynthesis pathway and its variants as examples, we demonstrated multiplex, continuous editing of small DNA parts, such as ribosome-binding sites, as well as efficient manipulation of large building blocks such as genes and operons. To showcase the platform, we applied it to expand the phenotypic diversity of the nisin pathway by quickly generating a library of 63 pathway variants. We further demonstrated its utility by altering the regulatory topology of the nisin pathway for constitutive bacteriocin biosynthesis. This work demonstrates the feasibility of rapid and advanced engineering of gene networks in LAB, fostering their applications in biomedicine and other areas.

  7. Synthesis and characterization of bis-thiourea having amino acid derivatives

    NASA Astrophysics Data System (ADS)

    Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah

    2016-11-01

    In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.

  8. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  9. Associations between variants of FADS genes and omega-3 and omega-6 milk fatty acids of Canadian Holstein cows

    PubMed Central

    2014-01-01

    Background Fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes code respectively for the enzymes delta-5 and delta-6 desaturases which are rate limiting enzymes in the synthesis of polyunsaturated omega-3 and omega-6 fatty acids (FAs). Omega-3 and-6 FAs as well as conjugated linoleic acid (CLA) are present in bovine milk and have demonstrated positive health effects in humans. Studies in humans have shown significant relationships between genetic variants in FADS1 and 2 genes with plasma and tissue concentrations of omega-3 and-6 FAs. The aim of this study was to evaluate the extent of sequence variations within these two genes in Canadian Holstein cows as well as the association between sequence variants and health promoting FAs in milk. Results Thirty three SNPs were detected within the studied regions of genes including a synonymous mutation (FADS1-07, rs42187261, 306Tyr > Tyr) in exon 8 of FADS1, a non-synonymous mutation (FADS2-14, rs211580559, 294Ala > Val) within FADS2 exon 7, a splice site SNP (FADS2-05, rs211263660), a 3′UTR SNP (FADS2-23, rs109772589), and another 3′UTR SNP with an effect on a microRNA binding site within FADS2 gene (FADS2-19, rs210169303). Association analyses showed significant relations between three out of seven tested SNPs and several FAs. Significant associations (FDR P < 0.05) were recorded between FADS2-23 (rs109772589) and two omega-6 FAs (dihomogamma linolenic acid [C20:3n6] and arachidonic acid [C20:4n6]), FADS1-07 (rs42187261) and one omega-3 FA (eicosapentaenoic acid, C20:5n3) and tricosanoic acid (C23:0), and one intronic SNP, FADS1-01 (rs136261927) and C20:3n6. Conclusion Our study has demonstrated positive associations between three SNPs within FADS1 and FADS2 genes (a SNP within the 3’UTR, a synonymous SNP and an intronic SNP), with three milk PUFAs of Canadian Holstein cows thus suggesting possible involvement of synonymous and non-coding region variants in FA synthesis. These SNPs may serve as

  10. Genes associated with long-chain omega-3 fatty acids in bovine skeletal muscle.

    PubMed

    Perez, R; Cañón, J; Dunner, S

    2010-01-01

    Long-chain omega-3 fatty acids (n-3 FAs) influence meat tenderness, juiciness, and flavor, and are beneficial to human health. The percentage of long-chain n-3 FAs in total FAs is termed the omega-3 index (O3I). It is thus of great interest to favor rising this index in bovine skeletal muscle, to obtain healthier, tastier, and more nutritive meat. This study was aimed to detect transcriptomic variations related to O3I in muscles in 15-month-old males of 4 Spanish cattle breeds raised under the same conditions. Through the analysis of extreme O3I phenotypes, 3 genes of interest (AANAT, UCP2 and AHA1) were identified. AANAT and UCP2 were strongly up-regulated, while AHA1 was repressed in animals with a high O3I. Moreover, gene expression differed between GDF8-null animal muscles (tested for nt821del11 and Q204X mutations) and the wild-type muscles for genes GDH1, IGF2R, FADS1, ASPH, and AIM1, all showing down-regulation in Asturiana de los Valles calves with muscle hypertrophy (GDF8-null). This shows that in GDF8-null animals other pathways are used for FA synthesis.

  11. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  12. The use of ascorbate as an oxidation inhibitor in prebiotic amino acid synthesis: a cautionary note.

    PubMed

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO(2)-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO(2) was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO(2)-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO(2)-rich atmosphere under the conditions studied.

  13. CHS5, a gene involved in chitin synthesis and mating in Saccharomyces cerevisiae.

    PubMed Central

    Santos, B; Duran, A; Valdivieso, M H

    1997-01-01

    The CHS5 locus of Saccharomyces cerevisiae is important for wild-type levels of chitin synthase III activity. chs5 cells have reduced levels of this activity. To further understand the role of CHS5 in yeast, the CHS5 gene was cloned by complementation of the Calcofluor resistance phenotype of a chs5 mutant. Transformation of the mutant with a plasmid carrying CHS5 restored Calcofluor sensitivity, wild-type cell wall chitin levels, and chitin synthase III activity levels. DNA sequence analysis reveals that CHS5 encodes a unique polypeptide of 671 amino acids with a molecular mass of 73,642 Da. The predicted sequence shows a heptapeptide repeated 10 times, a carboxy-terminal lysine-rich tail, and some similarity to neurofilament proteins. The effects of deletion of CHS5 indicate that it is not essential for yeast cell growth; however, it is important for mating. Deletion of CHS3, the presumptive structural gene for chitin synthase III activity, results in a modest decrease in mating efficiency, whereas chs5delta cells exhibit a much stronger mating defect. However, chs5 cells produce more chitin than chs3 mutants, indicating that CHS5 plays a role in other processes besides chitin synthesis. Analysis of mating mixtures of chs5 cells reveals that cells agglutinate and make contact but fail to undergo cell fusion. The chs5 mating defect can be partially rescued by FUS1 and/or FUS2, two genes which have been implicated previously in cell fusion, but not by FUS3. In addition, mating efficiency is much lower in fus1 fus2 x chs5 than in fus1 fus2 x wild type crosses. Our results indicate that Chs5p plays an important role in the cell fusion step of mating. PMID:9111317

  14. Acyl Meldrum's acid derivatives: application in organic synthesis

    NASA Astrophysics Data System (ADS)

    Janikowska, K.; Rachoń, J.; Makowiec, S.

    2014-07-01

    This review is focused on an important class of Meldrum's acid derivatives commonly known as acyl Meldrum's acids. The preparation methods of these compounds are considered including the recently proposed and rather rarely used ones. The chemical properties of acyl Meldrum's acids are described in detail, including thermal stability and reactions with various nucleophiles. The possible mechanisms of these transformations are analyzed. The bibliography includes 134 references.

  15. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials.

  16. Synthesis and biological activity of glutamic acid derivatives.

    PubMed

    Receveur, J M; Guiramand, J; Récasens, M; Roumestant, M L; Viallefont, P; Martinez, J

    1998-01-20

    In order to develop new specific glutamate analogues at metabotropic glutamate receptors, Diels-Alder, 1-4 ionic and radical reactions were performed starting from (2S)-4-methyleneglutamic acid. Preliminary pharmacological evaluation by measuring IP accumulation using rat forebrain synaptoneurosomes has shown that (2S)-4-(2-phthalimidoethyl)glutamic acid (3a), (2S)-4-(4-phthalimidobutyl)glutamic acid (3b) and 1-[(S)-2-amino-2-carboxyethyl]-3,4-dimethylcyclohex-3-ene-1-carbox ylic acid (8) presented moderate antagonist activities.

  17. Interrelated effects of dihomo-γ-linolenic and arachidonic acids, and sesamin on hepatic fatty acid synthesis and oxidation in rats.

    PubMed

    Ide, Takashi; Ono, Yoshiko; Kawashima, Hiroshi; Kiso, Yoshinobu

    2012-12-14

    Interrelated effects of dihomo-γ-linolenic acid (DGLA) and arachidonic acid (ARA), and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined in rats. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin), containing 100 g/kg of maize oil or fungal oil rich in DGLA or ARA for 16 d. Among the groups fed sesamin-free diets, oils rich in DGLA or ARA, especially the latter, compared with maize oil strongly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin, irrespective of the type of fat, reduced the parameters of lipogenic enzymes except for malic enzyme. The type of dietary fat was rather irrelevant in affecting hepatic fatty acid oxidation among rats fed the sesamin-free diets. Sesamin increased the activities of enzymes involved in fatty acid oxidation in all groups of rats given different fats. The extent of the increase depended on the dietary fat type, and the values became much higher with a diet containing sesamin and oil rich in ARA in combination than with a diet containing lignan and maize oil. Analyses of mRNA levels revealed that the combination of sesamin and oil rich in ARA compared with the combination of lignan and maize oil markedly increased the gene expression of various peroxisomal fatty acid oxidation enzymes but not mitochondrial enzymes. The enhancement of sesamin action on hepatic fatty acid oxidation was also confirmed with oil rich in DGLA but to a lesser extent.

  18. Mutations in a delta9-Stearoyl-ACP-Desaturase Gene Are Associated with Enhanced Stearic Acid Levels in Soybean Seeds

    SciTech Connect

    Zhang, P.; Shanklin, J.; Burton, J. W.; Upchurch, R. G.; Whittle, E.; Dewey, R. E.

    2008-11-01

    Stearic acid (18:0) is typically a minor component of soybean [Glycine max (L.) Merr.] oil, accounting for only 2 to 4% of the total fatty acid content. Increasing stearic acid levels of soybean oil would lead to enhanced oxidative stability, potentially reducing the need for hydrogenation, a process leading to the formation of undesirable trans fatty acids. Although mutagenesis strategies have been successful in developing soybean germplasm with elevated 18:0 levels in the seed oil, the specific gene mutations responsible for this phenotype were not known. We report a newly identified soybean gene, designated SACPD-C, that encodes a unique isoform of {Delta}{sup 9}-stearoyl-ACP-desaturase, the enzyme responsible for converting stearic acid to oleic acid (18:1). High levels of SACPD-C transcript were only detected in developing seed tissue, suggesting that the encoded desaturase functions to enhance oleic acid biosynthetic capacity as the immature seed is actively engaged in triacylglycerol production and storage. The participation of SACPD-C in storage triacylglycerol synthesis is further supported by the observation of mutations in this gene in two independent sources of elevated 18:0 soybean germplasm, A6 (30% 18:0) and FAM94-41 (9% 18:0). A molecular marker diagnostic for the FAM94-41 SACPD-C gene mutation strictly associates with the elevated 18:0 phenotype in a segregating population, and could thus serve as a useful tool in the development of cultivars with oils possessing enhanced oxidative stability.

  19. Indole-3-acetic Acid Synthesis in Tumorous and Nontumorous Species of Nicotiana 1

    PubMed Central

    Liu, Shih-Tung; Katz, Charles D.; Knight, C. Arthur

    1978-01-01

    The synthesis of indole-3-acetic acid (IAA) in the enzyme extracts of Nicotiana glauca, Nicotiana langsdorffii, their F1 hybrid, their amphidiploid hybrid, and the nontumorous mutant of the hybrid was investigated. Tryptamine, a possible precursor of IAA biosynthesis in Nicotiana tabacum, was not found in the callus tissue of N. glauca, N. langsdorffii, and their F1 hybrid. In petiole slices, the synthesis of IAA progressively increased during 5 hours of incubation in [14C]tryptophan. The rate of synthesis was about equal in the hybrid and N. langsdorffii but lower in N. glauca on either a cell or fresh weight basis. It was also found that tryptophan was about 25 times more efficient than tryptamine in promoting synthesis of IAA in petiole slices. It was found that indoleacetaldehyde oxidase, indoleacetaldehyde reductase, and tryptophan aminotransferase activities were present in all of the species examined; however, tryptophan decarboxylase activity was not found. The tryptophan aminotransferase activity in N. glauca, N. langsdorffii, and the nontumorous mutant required α-ketoglutaric acid and pyridoxal 5-phosphate whereas the addition of pyridoxal 5-phosphate seemed not to increase the enzyme activity in tumor plants. The tryptophan aminotransferase in the amphidiploid hybrid was partially purified by acetone precipitation. The enzyme activity had a temperature optimum at 49 C and a pH optimum at 8.9. It is suggested that there is an indolepyruvic acid pathway in the synthesis of IAA in the Nicotiana species examined. PMID:16660376

  20. Clustered Genes Involved in Cyclopiazonic Acid Production are Next to the Aflatoxin Biosynthesis Gene Cluster in Aspergillus flavus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cyclopiazonic acid (CPA), an indole-tetramic acid toxin, is produced by many species of Aspergillus and Penicillium. In addition to CPA Aspergillus flavus produces polyketide-derived carcinogenic aflatoxins (AFs). AF biosynthesis genes form a gene cluster in a subtelomeric region. Isolates of A. fla...

  1. Synthesis of phosphonic analogues of carnitine and gamma-amino-beta-hydroxybutyric acid.

    PubMed

    Tadeusiak, Elzbieta J

    2004-12-01

    The involvement of carnitine and gamma-amino-beta-hydroxybutyric acid in the biology of mammalian cells, the physiology of the human body, and some important aspects of medicinal treatment has induced many research groups to develop their pharmacologically potent analogues. Among them are the very important phosphonic analogues: phosphocarnitine and gamma-amino-beta-hydroxypropylphosphonic acid. This mini-review describes the various methodologies used for the synthesis of these compounds.

  2. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  3. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  4. [Genetic code: codon bases--the symbols of amino acid synthesis and catabolism pathways].

    PubMed

    Konyshev, V A

    1983-01-01

    The correlations between genetic codes of amino acids and pathways of synthesis and catabolism of carbon backbone of amino acids are considered. Codes of amino acids which are synthesized from oxoacids of glycolysis, the Krebs cycle and glyoxalic cycle via transamination without any additional chemical reactions, are initiated with guanine (alanine, glutamic and aspartic acids, glycine). Codons of amino acids which are formed on the branches of glycolysis at the level of compounds with three carbon atoms, begin with uracil (phenylalanine, serine, leucine, tyrosine, cysteine, tryptophan). Codes of amino acids formed from aspartate begin with adenine (methionine, isoleucine, threonine, asparagine, lysine, serine), while those of the amino acids formed from the compounds with five carbon atoms (glutamic acid and phosphoribosyl pyrophosphate) begin with cytosine (arginine, proline, glutamine, histidine). The second letter of codons is linked to catabolic pathways of amino acids: most of amino acids entering glycolysis and the Krebs cycle through even-numbered carbon compounds, have adenine and uracil at the second position of codes (A-U type); most of amino acids entering the glycolysis and the Krebs cycle via odd-numbered carbon compounds, have codons with guanine and cytidine at the second position (G-C type). The usage of purine and pyrimidine as the third letter of weak codones in most of amino acids is linked to the enthropy of amino acid formation. A hypothesis claiming that the linear genetic code was assembled from the purine and pyrimidine derivatives which have acted as participants of primitive control of amino acid synthesis and catabolism, is suggested.

  5. Resistance of lung fatty acid synthesis to inhibition by dietary fat in the meal-fed rat.

    PubMed

    Clarke, S D; Wilson, M D; Ibnoughazala, T

    1984-03-01

    One-half of the palmitate utilized by the lung for production of the surfactant phospholipid, dipalmitoyl phosphatidylcholine, originates from de novo palmitate synthesis in the lung. In this report the lung was examined for the influence of dietary fat on the lung de novo fatty acid synthesis pathway. Lung lipogenesis was reduced by fasting and accelerated by carbohydrate refeeding or insulin injection. However, in general lung fatty acid synthesis was unaffected by dietary fat. Supplementing one meal (high glucose diet) with as much as 36% additional fat kilocalories did not suppress lung fatty acid synthesis. An inhibition of fatty acid synthesis resulted from a fat supplement of +60 and +120% of meal kilocalories, but this inhibition was likely due to an attenuated rate of glucose absorption. Ingestion of a high carbohydrate diet supplemented with 10, 17, or 30% added kilocalories as safflower oil or palmitate had no effect on lipogenesis after 10 days. On the other hand, liver fatty acid synthesis and acetyl-CoA carboxylase were selectively suppressed by safflower oil, whereas dietary palmitate was ineffective as an inhibitor of lipogenesis. These data clearly demonstrate that the well-characterized preferential suppression of liver lipogenesis by dietary polyunsaturated fats does not extend to lung tissue, and, more importantly, the inhibition of liver lipogenesis is not secondary to an essential fatty acid deficiency. The marked resistance of lung fatty acid synthesis to inhibition by dietary fat might be a biological protective mechanism to ensure adequate palmitate for dipalmitoyl phosphatidylcholine synthesis.

  6. Amino acid regulation of mammalian gene expression in the intestine.

    PubMed

    Brasse-Lagnel, Carole G; Lavoinne, Alain M; Husson, Annie S

    2010-07-01

    Some amino acids exert a wide range of regulatory effects on gene expression via the activation of different signalling pathways and transcription factors, and a number of cis elements were shown to respond to changes in amino acid concentration. Particular attention has been paid to the effects of glutamine and arginine, which modulate a number of cell functions through the activation of various pathways in different tissues. In the intestine, appropriate concentrations of both arginine and/or glutamine contribute to facilitate cell proliferation, to limit the inflammatory response and apoptosis, and to modulate intermediary metabolism through specific transcription factors. Particularly, besides its role as a major fuel for enterocytes, the regulatory effects of glutamine have been extensively studied and the molecular mechanisms involved appear diversified and complex. Indeed, in addition to a major role of NF-kappaB in its anti-inflammatory action and a stimulatory role of AP-1 in its growth-promoting action and cell survival, the involvement of some other transcription factors, such as PPAR-gamma or HSF-1, was shown to maintain intestinal cell integrity. The signalling pathways leading to the activation of transcription factors imply several kinases, particularly MAP kinases in the effect of glutamine and p70 S6 kinase for those of arginine, but in most cases the precise pathways from the entrance of the aminoacid into the cell to the activation of gene transcription has remained elusive.

  7. Synthesis and characterization of L-lactide and polylactic acid (PLA) from L-lactic acid for biomedical applications

    NASA Astrophysics Data System (ADS)

    Rahmayetty, Sukirno, Prasetya, Bambang; Gozan, Misri

    2017-02-01

    Lactide is the monomer for the polymer polylactic acid (PLA) from lactic acid through polycondensation and depolymerization process. The properties of PLA strongly depend on the quality of the lactide monomer from which it is synthesized. Optical purity of lactide produced in depolymerization process confirmed to be L-lactide. The highest yield of crude lactide was 38.5% at temperature 210 °C with average molecular weight (Mn) of oligomer was 2389. Ring opening polymerization of lactide using Candida rugosa lipase as biocatalyst to PLLA synthesis has been achieved to generate useful biomedical materials free from heavy metal.

  8. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  9. Nuclear factor erythroid 2-related factor 2 facilitates neuronal glutathione synthesis by upregulating neuronal excitatory amino acid transporter 3 expression.

    PubMed

    Escartin, Carole; Won, Seok Joon; Malgorn, Carole; Auregan, Gwennaelle; Berman, Ari E; Chen, Pei-Chun; Déglon, Nicole; Johnson, Jeffrey A; Suh, Sang Won; Swanson, Raymond A

    2011-05-18

    Astrocytes support neuronal antioxidant capacity by releasing glutathione, which is cleaved to cysteine in brain extracellular space. Free cysteine is then taken up by neurons through excitatory amino acid transporter 3 [EAAT3; also termed Slc1a1 (solute carrier family 1 member 1)] to support de novo glutathione synthesis. Activation of the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant responsive element (ARE) pathway by oxidative stress promotes astrocyte release of glutathione, but it remains unknown how this release is coupled to neuronal glutathione synthesis. Here we evaluated transcriptional regulation of the neuronal cysteine transporter EAAT3 by the Nrf2-ARE pathway. Nrf2 activators and Nrf2 overexpression both produced EAAT3 transcriptional activation in C6 cells. A conserved ARE-related sequence was found in the EAAT3 promoter of several mammalian species. This ARE-related sequence was bound by Nrf2 in mouse neurons in vivo as observed by chromatin immunoprecipitation. Chemical activation of the Nrf2-ARE pathway in mouse brain increased both neuronal EAAT3 levels and neuronal glutathione content, and these effects were abrogated in mice genetically deficient in either Nrf2 or EAAT3. Selective overexpression of Nrf2 in brain neurons by lentiviral gene transfer was sufficient to upregulate both neuronal EAAT3 protein and glutathione content. These findings identify a mechanism whereby Nrf2 activation can coordinate astrocyte glutathione release with neuronal glutathione synthesis through transcriptional upregulation of neuronal EAAT3 expression.

  10. Evolution of pigment synthesis pathways by gene and genome duplication in fish

    PubMed Central

    Braasch, Ingo; Schartl, Manfred; Volff, Jean-Nicolas

    2007-01-01

    Background Coloration and color patterning belong to the most diverse phenotypic traits in animals. Particularly, teleost fishes possess more pigment cell types than any other group of vertebrates. As the result of an ancient fish-specific genome duplication (FSGD), teleost genomes might contain more copies of genes involved in pigment cell development than tetrapods. No systematic genomic inventory allowing to test this hypothesis has been drawn up so far for pigmentation genes in fish, and almost nothing is known about the evolution of these genes in different fish lineages. Results Using a comparative genomic approach including phylogenetic reconstructions and synteny analyses, we have studied two major pigment synthesis pathways in teleost fish, the melanin and the pteridine pathways, with respect to different types of gene duplication. Genes encoding three of the four enzymes involved in the synthesis of melanin from tyrosine have been retained as duplicates after the FSGD. In the pteridine pathway, two cases of duplicated genes originating from the FSGD as well as several lineage-specific gene duplications were observed. In both pathways, genes encoding the rate-limiting enzymes, tyrosinase and GTP-cyclohydrolase I (GchI), have additional paralogs in teleosts compared to tetrapods, which have been generated by different modes of duplication. We have also observed a previously unrecognized diversity of gchI genes in vertebrates. In addition, we have found evidence for divergent resolution of duplicated pigmentation genes, i.e., differential gene loss in divergent teleost lineages, particularly in the tyrosinase gene family. Conclusion Mainly due to the FSGD, teleost fishes apparently have a greater repertoire of pigment synthesis genes than any other vertebrate group. Our results support an important role of the FSGD and other types of duplication in the evolution of pigmentation in fish. PMID:17498288

  11. Synthesis and characterization of hydrogen-bond acidic functionalized graphene

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Han, Qiang; Pan, Yong; Cao, Shuya; Ding, Mingyu

    2014-05-01

    Hexafluoroisopropanol phenyl group functionalized materials have great potential in the application of gas-sensitive materials for nerve agent detection, due to the formation of strong hydrogen-bonding interactions between the group and the analytes. In this paper, take full advantage of ultra-large specific surface area and plenty of carbon-carbon double bonds and hexafluoroisopropanol phenyl functionalized graphene was synthesized through in situ diazonium reaction between -C=C- and p-hexafluoroisopropanol aniline. The identity of the as-synthesis material was confirmed by transmission electron microscopy, Raman spectroscopy, ultraviolet visible spectroscopy, X-ray photoelectron spectroscopy and thermo gravimetric analysis. The synthesis method is simply which retained the excellent physical properties of original graphene. In addition, the novel material can be assigned as an potential candidate for gas sensitive materials towards organophosphorus nerve agent detection.

  12. Asymmetric synthesis of aromatic β-amino acids using ω-transaminase: Optimizing the lipase concentration to obtain thermodynamically unstable β-keto acids.

    PubMed

    Mathew, Sam; Jeong, Seong-Su; Chung, Taeowan; Lee, Sang-Hyeup; Yun, Hyungdon

    2016-01-01

    Synthesized aromatic β-amino acids have recently attracted considerable attention for their application as precursors in many pharmacologically relevant compounds. Previous studies on asymmetric synthesis of aromatic β-amino acids using ω-transaminases could not be done efficiently due to the instability of β-keto acids. In this study, a strategy to circumvent the instability problem of β-keto acids was utilized to generate β-amino acids efficiently via asymmetric synthesis. In this work, thermodynamically stable β-ketoesters were initially converted to β-keto acids using lipase, and the β-keto acids were subsequently aminated using ω-transaminase. By optimizing the lipase concentration, we successfully overcame the instability problem of β-keto acids and enhanced the production of β-amino acids. This strategy can be used as a general approach to efficiently generate β-amino acids from β-ketoesters.

  13. RutR is the uracil/thymine-sensing master regulator of a set of genes for synthesis and degradation of pyrimidines.

    PubMed

    Shimada, Tomohiro; Hirao, Kiyo; Kori, Ayako; Yamamoto, Kaneyoshi; Ishihama, Akira

    2007-11-01

    Using the genomic SELEX, a total of six Escherichia coli DNA fragments have been identified, which formed complexes with transcription factor RutR. The RutR regulon was found to include a large number of genes encoding components for not only degradation of pyrimidines but also transport of glutamate, synthesis of glutamine, synthesis of pyrimidine nucleotides and arginine, and degradation of purines. DNase I footprinting indicated that RutR recognizes a palindromic sequence of TTGACCAnnTGGTCAA. The RutR box in P1 promoter of carAB encoding carbamoyl phosphate synthetase, a key enzyme of pyrimidine synthesis, overlaps with the PepA (CarP) repressor binding site, implying competition between RutR and PepA. Adding either uracil or thymine abolished RutR binding in vitro to the carAB P1 promoter. Accordingly, in the rutR-deletion mutant or in the presence of uracil, the activation in vivo of carAB P1 promoter was markedly reduced. Northern blot analysis of the RutR target genes indicated that RutR represses the Gad system genes involved in glutamate-dependent acid resistance and allantoin degradation. Altogether we propose that RutR is the pyrimidine sensor and the master regulator for a large set of the genes involved in the synthesis and degradation of pyrimidines.

  14. Total synthesis of (±)-epithuriferic acid methyl ester via Diels-Alder reaction.

    PubMed

    Koprowski, Marek; Bałczewski, Piotr; Owsianik, Krzysztof; Różycka-Sokołowska, Ewa; Marciniak, Bernard

    2016-02-07

    In this paper, we have described the first total synthesis of (±)-epithuriferic acid methyl ester from non-natural sources, in four steps (20% overall yield). The key step involves the Diels-Alder reaction of isobenzofuran with methyl 3-(dimethoxyphosphoryl)acrylate which is controlled by "ortho" regio- and endo stereoselectivities due to the COOMe group.

  15. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  16. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  17. Total synthesis of (−)-dihydroprotolichesterenic acid via diastereoselective conjugate addition to chiral fumarates

    PubMed Central

    Hethcox, J. Caleb; Shanahan, Charles S.; Martin, Stephen F.

    2013-01-01

    A diastereoselective conjugate addition of a variety of monoorganocuprates, Li[RCuI], to chiral fumarates to provide funtionalized succinates has been developed. The utility of this reaction is demonstrated in a concise total synthesis of (−)-dihydroprotolichesterenic acid that required only four steps and proceeded in an overall 31% yield. PMID:23539490

  18. Diastereoselective addition of monoorganocuprates to a chiral fumarate: reaction development and synthesis of (-)-dihydroprotolichesterinic acid.

    PubMed

    Hethcox, J Caleb; Shanahan, Charles S; Martin, Stephen F

    2015-09-16

    Recent studies of diastereoselective conjugate additions of monoorganocuprates, Li[RCuI], to chiral γ-alkoxycrotonates and fumarates are disclosed. This methodology was applied to the shortest total synthesis of (-)-dihydroprotolichesterinic acid to date, but several attempts to prepare other succinate-derived natural products, such as pilocarpine and antrodin E, were unsuccessful.

  19. Stimulation of muscle protein synthesis by leucine is dependent on plasma amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that a physiological increase in plasma leucine increased translation initiation factor activity during 60- and 120-min leucine infusion. Muscle protein synthesis was stimulated at 60 min but not at 120 min, perhaps due to the decrease (-50%) in plasma essential amino acids (AA). ...

  20. An Overview of Stereoselective Synthesis of α-Aminophosphonic Acids and Derivatives

    PubMed Central

    Ordóñez, Mario; Rojas-Cabrera, Haydée; Cativiela, Carlos

    2009-01-01

    An overview of all methodologies published during the last few years focused to the stereoselective (diastereoselective or enantioselective) synthesis of α-aminophosphonic acids and derivatives is reported. The procedures have been classified according a retrosynthetic strategy and taking into account the formation of each one of the bonds connected to the chiral centre. PMID:20871799

  1. Methods for the synthesis of tritium-labelled fatty acids and their derivatives, oxylipins and steroids

    NASA Astrophysics Data System (ADS)

    Shevchenko, Valerii P.; Nagaev, Igor Yu; Myasoedov, Nikolai F.

    1999-10-01

    The achievements in the field of synthesis and application of tritium-labelled oxylipins, steroids, fatty acids, phospho-, sphingo- and other lipids are reviewed. The importance of these studies for the solution of current problems of biochemistry, biology and pharmacology is exemplified in the application of labelled compounds. The bibliography includes 148 references.

  2. [Gene cloning and bioinformatics analysis of new gene for chlorogenic acid biosynthesis of Lonicera hypoglauca].

    PubMed

    Yu, Shu-lin; Huang, Lu-qi; Yuan, Yuan; Qi, Lin-jie; Liu, Da-hui

    2015-03-01

    To obtain the key genes for chlorogenic acid biosynthesis of Lonicera hypoglauca, four new genes ware obtained from the our dataset of L. hypoglauca. And we also predicted the structure and function of LHPAL4, LHHCT1 , LHHCT2 and LHHCT3 proteins. The phylogenetic tree showed that LHPAL4 was closely related with LHPAL1, LHHCT1 was closely related with LHHCT3, LHHCT2 clustered into a single group. By Real-time PCR to detect the gene expressed level in different organs of L. hypoglauca, we found that the transcripted level of LHPAL4, LHHCT1 and LHHCT3 was the highest in defeat flowers, and the transcripted level of LHHCT2 was the highest in leaves. These result provided a basis to further analysis the mechanism of active ingredients in different organs, as well as the element for in vitro biosynthesis of active ingredients.

  3. Processing and amino acid sequence analysis of the mouse mammary tumor virus env gene product.

    PubMed Central

    Arthur, L O; Copeland, T D; Oroszlan, S; Schochetman, G

    1982-01-01

    The envelope proteins of mouse mammary tumor virus (MMTV) are synthesized from a subgenomic 24S mRNA as a 75,000-dalton glycosylated precursor polyprotein which is eventually processed to the mature glycoproteins gp52 and gp36. In vivo synthesis of this env precursor in the presence of the core glycosylation inhibitor tunicamycin yielded a precursor of approximately 61,000 daltons (P61env). However, a 67,000-dalton protein (P67env) was obtained from cell-free translation with the MMTV 24S mRNA as the template. To determine whether the portion of the protein cleaved from P67env to give P61env was removed from the NH2-terminal end of P67env and as such would represent a leader sequence, the NH2-terminal amino acid sequence of the terminal peptide gp52 was determined. Glutamic acid, and not methionine, was found to be the amino-terminal residue of gp52, indicating that the cleaved portion was derived from the NH2-terminal end of P67env. The NH2-terminal amino acid sequences of gp52's from endogenous and exogenous C3H MMTVs were determined though 46 residues and found to be identical. However, amino acid composition and type-specific gp52 radioimmunoassays from MMTVs grown in heterologous cells indicated primary structure differences between gp52's of the two viruses. The nucleic acid sequence of cloned MMTV DNA fragments (J. Majors and H. E. Varmus, personal communication) in conjunction with the NH2-terminal sequence of gp52 allowed localization of the env gene in the MMTV genome. Nucleotides coding for the NH2 terminus of gp52 begin approximately 0.8 kilobase to the 3' side of the single EcoRI cleavage site. Localization of the env gene at that point agrees with the proposed gene order -gag-pol-env- and also allows sufficient coding potential for the glycoprotein precursor without extending into the long terminal repeat. Images PMID:6281457

  4. Synthesis of mixed acid anhydrides from methane and carbon dioxide in acid solvents.

    PubMed

    Zerella, Mark; Mukhopadhyay, Sudip; Bell, Alexis T

    2003-09-04

    [reaction: see text] The reaction of CH(4) with CO(2) has been performed in anhydrous acids using VO(acac)(2) and K(2)S(2)O(8) as promoters. NMR analysis establishes that the primary product is a mixed anhydride of acetic acid and the acid solvent. In sulfuric acid, the overall reaction is CH(4) + CO(2) + SO(3) --> CH(3)C(O)-O-SO(3)H. Hydrolysis of the mixed anhydride produces acetic acid and the solvent acid. When trifluoroacetic acid is the solvent, acetic acid is primarily formed via the reaction CH(4) + CF(3)COOH --> CH(3)COOH + CHF(3).

  5. Synthesis of polyacrylic-acid-based thermochromic polymers

    NASA Astrophysics Data System (ADS)

    Srivastava, Jyoti; Alam, Sarfaraz; Mathur, G. N.

    2003-10-01

    Smart materials respond to environmental stimuli with particular changes in some variables (for example temperature, pressure and electric field etc), for that reason they are often called responsive materials. In the present work, we have synthesized thermochromic polymer based on poly acrylic acid cobalt chloride (CoCl2) and phosphoric acid (H3PO4) that visually and reversibly changes color in the temperature range (70 - 130°C). These thermochromic materials can be used as visual sensors of temperature. Thermochromic polymers are based on polyacrylic acid and CoCl2 complex.

  6. Dietary conjugated linoleic acid modify gene expression in liver, muscles, and fat tissues of finishing pigs.

    PubMed

    Tous, N; Theil, P K; Lauridsen, C; Lizardo, R; Vilà, B; Esteve-Garcia, E

    2012-12-01

    The aim of this study was to investigate underlying mechanisms of dietary conjugated linoleic acid (CLA) on lipid metabolism in various tissues of pigs. Sixteen gilts (73 ± 3 kg) were fed a control (containing sunflower oil) or an experimental diet in which 4% of sunflower oil was replaced by CLA, and slaughtered at an average BW of 117 ± 4.9 kg. Transcription of peroxisome proliferator-activated receptor alpha (PPARα), peroxisome proliferator-activated receptor gamma (PPARγ), fatty acid synthase (FAS), sterol regulatory element binding protein (SREBP1), acetyl-CoA carboxylase (ACC), lipoprotein lipase (LPL), delta-6-desaturase (D6D), and stearoyl CoA desaturase (SCD) were determined by real-time PCR in longissimus thoracis (LT) and semimembranosus (SM) muscles, LT subcutaneous and SM intermuscular fat, and in the liver. Fatty acid (FA) composition was analyzed using gas chromatography in these tissues, except for SM intermuscular fat. Dietary CLA increased PPARγ in LT muscle (P < 0.05), whereas CLA reduced PPARα transcription in all tissues studied (P < 0.05) with the exception of intermuscular fat. Transcription of genes related to FA synthesis was reduced by CLA in SM muscle and liver (SREBP1, both P < 0.1; ACC, P < 0.01 in SM; and FAS, P < 0.01 in liver), whereas CLA reduced (P < 0.05) LPL and D6D transcriptions in SM muscle and reduced (P < 0.05) SCD in liver but increased (P < 0.05) SCD in LT muscle and intermuscular fat. Saturated FA were increased in all studied tissues (P < 0.01), while monosaturated and polyunsaturated FA were reduced in a tissue-specific way by CLA. It was concluded that dietary CLA affected transcription of genes and fat metabolism in a tissue-specific manner.

  7. Microbiologically produced carboxylic acids used as building blocks in organic synthesis.

    PubMed

    Aurich, Andreas; Specht, Robert; Müller, Roland A; Stottmeister, Ulrich; Yovkova, Venelina; Otto, Christina; Holz, Martina; Barth, Gerold; Heretsch, Philipp; Thomas, Franziska A; Sicker, Dieter; Giannis, Athanassios

    2012-01-01

    Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building blocks. Thereby, our biotechnological goal was the development of process fundamentals regarding the variable use of renewable raw materials, the development of a multi purpose bioreactor and application of a pilot plant with standard equipment for organic acid production to minimize the technological effort. Furthermore the development of new product isolation procedures, with the aim of direct product recovery, capture of products or single step operation, was necessary. The application of robust and approved microorganisms, also genetically modified, capable of using a wide range of substrates as well as producing a large spectrum of products, was of special importance. Microbiologically produced acids, like 2-oxo-glutaric acid and 2-oxo-D-gluconic acid, are useful educts for the chemical synthesis of hydrophilic triazines, spiro-connected heterocycles, benzotriazines, and pyranoic amino acids. The chiral intermediate of the tricarboxylic acid cycle, (2R,3S)-isocitric acid, is another promising compound. For the first time our process provides large quantities of enantiopure trimethyl (2R,3S)-isocitrate which was used in subsequent chemical transformations to provide new chiral entities for further usage in total synthesis and pharmaceutical research.Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building

  8. Synthesis of deuterated [D32 ]oleic acid and its phospholipid derivative [D64 ]dioleoyl-sn-glycero-3-phosphocholine.

    PubMed

    Darwish, Tamim A; Luks, Emily; Moraes, Greta; Yepuri, Nageshwar R; Holden, Peter J; James, Michael

    2013-01-01

    Oleic acid and its phospholipid derivatives are fundamental to the structure and function of cellular membranes. As a result, there has been increasing interest in the availability of their deuterated forms for many nuclear magnetic resonance, infrared, mass spectroscopy and neutron scattering studies. Here, we present for the first time a straightforward, large-scale (gram quantities) synthesis of highly deuterated [D32 ]oleic acid by using multiple, yet simple and high yielding reactions. The precursors for the synthesis of [D32 ]oleic acid are [D14 ]azelaic acid and [D17 ]nonanoic acid, which were obtained by complete deuteration (>98% D) of their (1) H forms by using metal catalysed hydrothermal H/D exchange reactions. The oleic acid was produced with ca. 94% D isotopic purity and with no contamination by the trans-isomer (elaidic acid). The subsequent synthesis of [D64 ]dioleoyl-sn-glycero-3-phosphocholine from [D32 ]oleic acid is also described.

  9. Phylogenetic distribution of compatible solute synthesis genes support a freshwater origin for cyanobacteria.

    PubMed

    Blank, Carrine E

    2013-10-01

    Previous work using ancestral state reconstruction of habitat salinity preference proposed that the early cyanobacteria likely lived in a freshwater environment. The aim of this study was to test that hypothesis by performing phylogenetic analyses of the genes underlying salinity preferences in the cyanobacteria. Phylogenetic analysis of compatible solute genes shows that sucrose synthesis genes were likely ancestral in the cyanobacteria, and were also likely inherited during the cyanobacterial endosymbiosis and into the photosynthetic algae and land plants. In addition, the genes for the synthesis of compatible solutes that are necessary for survival in marine and hypersaline environments (such as glucosylglycerol, glucosylglycerate, and glycine betaine) were likely acquired independently high up (i.e., more recently) in the cyanobacterial tree. Because sucrose synthesis is strongly associated with growth in a low salinity environment, this independently supports a freshwater origin for the cyanobacteria. It is also consistent with geologic evidence showing that the early oceans were much warmer and saltier than modern oceans-sucrose synthesis alone would have been insufficient for early cyanobacteria to have colonized early Precambrian oceans that had a higher ionic strength. Indeed, the acquisition of an expanded set of new compatible solute genes may have enabled the historical colonization of marine and hypersaline environments by cyanobacteria, midway through their evolutionary history.

  10. A Synthesis Method of Gene Networks Having Cyclic Expression Pattern Sequences by Network Learning

    NASA Astrophysics Data System (ADS)

    Mori, Yoshihiro; Kuroe, Yasuaki

    Recently, synthesis of gene networks having desired functions has become of interest to many researchers because it is a complementary approach to understanding gene networks, and it could be the first step in controlling living cells. There exist several periodic phenomena in cells, e.g. circadian rhythm. These phenomena are considered to be generated by gene networks. We have already proposed synthesis method of gene networks based on gene expression. The method is applicable to synthesizing gene networks possessing the desired cyclic expression pattern sequences. It ensures that realized expression pattern sequences are periodic, however, it does not ensure that their corresponding solution trajectories are periodic, which might bring that their oscillations are not persistent. In this paper, in order to resolve the problem we propose a synthesis method of gene networks possessing the desired cyclic expression pattern sequences together with their corresponding solution trajectories being periodic. In the proposed method the persistent oscillations of the solution trajectories are realized by specifying passing points of them.

  11. Synthesis of Site-Specifically (13)C Labeled Linoleic Acids.

    PubMed

    Offenbacher, Adam R; Zhu, Hui; Klinman, Judith P

    2016-10-12

    Soybean lipoxygenase-1 (SLO-1) catalyzes the C-H abstraction from the reactive carbon (C-11) in linoleic acid as the first and rate-determining step in the formation of alkylhydroperoxides. While previous labeling strategies have focused on deuterium labeling to ascertain the primary and secondary kinetic isotope effects for this reaction, there is an emerging interest and need for selectively enriched (13)C isotopologues. In this report, we present synthetic strategies for site-specific (13)C labeled linoleic acid substrates. We take advantage of a Corey-Fuchs formyl to terminal (13)C-labeled alkyne conversion, using (13)CBr4 as the labeling source, to reduce the number of steps from a previous fatty acid (13)C synthetic labeling approach. The labeled linoleic acid substrates are useful as nuclear tunneling markers and for extracting active site geometries of the enzyme-substrate complex in lipoxygenase.

  12. [Clarification on publications concerning the synthesis of acetylsalicylic acid].

    PubMed

    Lafont, O

    1996-01-01

    Charles Frédéric Gerhardt (1816-1856) mentioned in his Traité de chimie Organique (1854) a publication, in French (realized in 1852 but published in 1853) entitled "Researches on anhydrous organic acids" in which, was reported the reaction of sodium salicylate with acetyl chloride. He thought that the reaction product was an acid anhydride, but obtained really crude acetylsalicylic acid. Later on, but also in 1853, a publication in german, by the same author related the same experiments. Surprisingly only the second publication has been mentioned in most of the historical studies on the subject. Acetyl salicylic acid was identified and synthesised in 1859 by von Gilm by another method and the product obtained by Gerhardt was identified to it in 1869.

  13. Nalidixic Acid and Macromolecular Metabolism in Tetrahymena pyriformis: Effects on Protein Synthesis

    PubMed Central

    de Castro, J. F.; Carvalho, J. F. O.; Moussatché, N.; de Castro, F. T.

    1975-01-01

    A study on the effect of nalidixic acid on macromolecular metabolism, particularly of protein, in Tetrahymena pyriformis was performed. It was shown that the compound is a potent inhibitor of deoxyribonucleic acid, ribonucleic acid, and protein synthesis for this organism. A conspicuous breakdown of polysomes, accompanied by the accumulation of 80S ribosomes, occurred in cells incubated for 10 min with the drug; polysome formation was prevented. The accumulating 80S particles were shown to be run-off ribosomal units. The incorporation of amino acids by a cell-free system is not affected by nalidixic acid. In nonproliferating cells the incorporation was also not prevented, unless the cells were previously incubated with the drug. These results are discussed in terms of the possible mechanism of action of nalidixic acid in T. pyriformis. PMID:807153

  14. Synthesis of an indole analog of folic acid

    SciTech Connect

    Shengeliya, M.S.; Avramenko, V.G.; Kuleshova, L.N.; Ershova, Yu.A.; Chernov, V.A.; Surorov, N.N.

    1987-06-01

    The authors study the replacement of the p-aminobenzoic acid (PABA) moiety. The authors synthesized an indole analog of folic acid, namely dimethyl N-(5-(2'-amino-4'-oxo-6'-pteridinyl)methylaminoindol-2-yl)glutamate. The physicochemical properties and the chemical shifts in the PMR spectra of the compounds obtained are shown. The examination of the compound for antitumor activity was carried out using rats and mice.

  15. Concurrent synthesis and release of nod-gene-inducing flavonoids from alfalfa roots. [Medicago sativa L. ; Rhizobium meliloti

    SciTech Connect

    Maxwell, C.A.; Phillips, D.A. )

    1990-08-01

    Flavonoid signals from alfalfa (Medicago sativa L.) induce transcription of nodulation (nod) genes in Rhizobium meliloti. Alfalfa roots release three major nod-gene inducers: 4{prime},7-dihydroxyflavanone, 4{prime},7-dihydroxyflavone, and 4,4{prime}-dihydroxy-2{prime}-methoxychalcone. The objective of the present study was to define temporal relationships between synthesis and exudation for those flavonoids. Requirements for concurrent flavonoid biosynthesis were assessed by treating roots of intact alfalfa seedlings with (U-{sup 14}C)-L-phenylalanine in the presence or absence of the phenylalanine ammonia-lyase inhibitor L-2-aminoxy-3-phenylpropionic acid (AOPP). In the absence of AOPP, each of the three flavonoids in exudates contained {sup 14}C. In the presence of AOPP, {sup 14}C labeling and release of all the exuded nod-gene inducers were reduced significantly. AOPP inhibited labeling and release of the strongest nod-gene inducer, methoxychalcone, by more than 90%. The release process responsible for exudation of nod-gene inducers appears to be specific rather than a general phenomenon such as a sloughing off of cells during root growth.

  16. Synthesis and biological activity of alkynoic acids derivatives against mycobacteria

    PubMed Central

    Vilchèze, Catherine; Leung, Lawrence W.; Bittman, Robert; Jacobs, William R.

    2015-01-01

    2-alkynoic acids have bactericidal activity against Mycobacterium smegmatis but their activity fall sharply as the length of the carbon chain increased. In this study, derivatives of 2- alkynoic acids were synthesized and tested against fast- and slow-growing mycobacteria. Their activity was first evaluated in M. smegmatis against their parental 2-alkynoic acids, as well as isoniazid, a first-line antituberculosis drug. The introduction of additional unsaturation or heteroatoms into the carbon chain enhanced the antimycobacterial activity of longer chain alkynoic acids (more than 19 carbons long). In contrast, although the modification of the carboxylic group did not improve the antimycobacterial activity, it significantly reduced the toxicity of the compounds against eukaryotic cells. Importantly, 4-(alkylthio)but-2-ynoic acids, had better bactericidal activity than the parental 2-alkynoic acids and on a par with isoniazid against the slow-grower Mycobacterium bovis BCG. These compounds had also low toxicity against eukaryotic cells, suggesting that they could be potential therapeutic agents against other types of topical mycobacterial infections causing skin diseases including Mycobacterium abscessus, Mycobacterium ulcerans, and Mycobacterium leprae. Moreover, they provide a possible scaffold for future drug development. PMID:26256431

  17. Oxalic acid production by citric acid-producing Aspergillus niger overexpressing the oxaloacetate hydrolase gene oahA.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2014-05-01

    The filamentous fungus Aspergillus niger is used worldwide in the industrial production of citric acid. However, under specific cultivation conditions, citric acid-producing strains of A. niger accumulate oxalic acid as a by-product. Oxalic acid is used as a chelator, detergent, or tanning agent. Here, we sought to develop oxalic acid hyperproducers using A. niger as a host. To generate oxalic acid hyperproducers by metabolic engineering, transformants overexpressing the oahA gene, encoding oxaloacetate hydrolase (OAH; EC 3.7.1.1), were constructed in citric acid-producing A. niger WU-2223L as a host. The oxalic acid production capacity of this strain was examined by cultivation of EOAH-1 under conditions appropriate for oxalic acid production with 30 g/l glucose as a carbon source. Under all the cultivation conditions tested, the amount of oxalic acid produced by EOAH-1, a representative oahA-overexpressing transformant, exceeded that produced by A. niger WU-2223L. A. niger WU-2223L and EOAH-1 produced 15.6 and 28.9 g/l oxalic acid, respectively, during the 12-day cultivation period. The yield of oxalic acid for EOAH-1 was 64.2 % of the maximum theoretical yield. Our method for oxalic acid production gave the highest yield of any study reported to date. Therefore, we succeeded in generating oxalic acid hyperproducers by overexpressing a single gene, i.e., oahA, in citric acid-producing A. niger as a host.

  18. bchFNBH bacteriochlorophyll synthesis genes of Rhodobacter capsulatus and identification of the third subunit of light-independent protochlorophyllide reductase in bacteria and plants.

    PubMed

    Burke, D H; Alberti, M; Hearst, J E

    1993-04-01

    We present the nucleotide and deduced amino acid sequences of four contiguous bacteriochlorophyll synthesis genes from Rhodobacter capsulatus. Three of these genes code for enzymes which catalyze reactions common to the chlorophyll synthesis pathway and therefore are likely to be found in plants and cyanobacteria as well. The pigments accumulated in strains with physically mapped transposon insertion mutations are analyzed by absorbance and fluorescence spectroscopy, allowing us to assign the genes as bchF, bchN, bchB, and bchH, in that order. bchF encodes a bacteriochlorophyll alpha-specific enzyme that adds water across the 2-vinyl group. The other three genes are required for portions of the pathway that are shared with chlorophyll synthesis, and they were expected to be common to both pathways. bchN and bchB are required for protochlorophyllide reduction in the dark (along with bchL), a reaction that has been observed in all major groups of photosynthetic organisms except angiosperms, where only the light-dependent reaction has been clearly established. The purple bacterial and plant enzymes show 35% identity between the amino acids coded by bchN and chlN (gidA) and 49% identity between the amino acids coded by bchL and chlL (frxC). Furthermore, bchB is 33% identical to ORF513 from the Marchantia polymorpha chloroplast. We present arguments in favor of the probable role of ORF513 (chlB) in protochlorophyllide reduction in the dark. The further similarities of all three subunits of protochlorophyllide reductase and the three subunits of chlorin reductase in bacteriochlorophyll synthesis suggest that the two reductase systems are derived from a common ancestor.

  19. Metabolic analyses elucidate non-trivial gene targets for amplifying dihydroartemisinic acid production in yeast

    PubMed Central

    Misra, Ashish; Conway, Matthew F.; Johnnie, Joseph; Qureshi, Tabish M.; Lige, Bao; Derrick, Anne M.; Agbo, Eddy C.; Sriram, Ganesh

    2013-01-01

    Synthetic biology enables metabolic engineering of industrial microbes to synthesize value-added molecules. In this, a major challenge is the efficient redirection of carbon to the desired metabolic pathways. Pinpointing strategies toward this goal requires an in-depth investigation of the metabolic landscape of the organism, particularly primary metabolism, to identify precursor and cofactor availability for the target compound. The potent antimalarial therapeutic artemisinin and its precursors are promising candidate molecules for production in microbial hosts. Recent advances have demonstrated the production of artemisinin precursors in engineered yeast strains as an alternative to extraction from plants. We report the application of in silico and in vivo metabolic pathway analyses to identify metabolic engineering targets to improve the yield of the direct artemisinin precursor dihydroartemisinic acid (DHA) in yeast. First, in silico extreme pathway (ExPa) analysis identified NADPH-malic enzyme and the oxidative pentose phosphate pathway (PPP) as mechanisms to meet NADPH demand for DHA synthesis. Next, we compared key DHA-synthesizing ExPas to the metabolic flux distributions obtained from in vivo 13C metabolic flux analysis of a DHA-synthesizing strain. This comparison revealed that knocking out ethanol synthesis and overexpressing glucose-6-phosphate dehydrogenase in the oxidative PPP (gene YNL241C) or the NADPH-malic enzyme ME2 (YKL029C) are vital steps toward overproducing DHA. Finally, we employed in silico flux balance analysis and minimization of metabolic adjustment on a yeast genome-scale model to identify gene knockouts for improving DHA yields. The best strategy involved knockout of an oxaloacetate transporter (YKL120W) and an aspartate aminotransferase (YKL106W), and was predicted to improve DHA yields by 70-fold. Collectively, our work elucidates multiple non-trivial metabolic engineering strategies for improving DHA yield in yeast. PMID:23898325

  20. Bioengineering of bacterial polymer inclusions catalyzing the synthesis of N-acetylneuraminic acid.

    PubMed

    Hooks, David O; Blatchford, Paul A; Rehm, Bernd H A

    2013-05-01

    N-Acetylneuraminic acid is produced by alkaline epimerization of N-acetylglucosamine to N-acetylmannosamine and then subsequent condensation with pyruvate catalyzed by free N-acetylneuraminic acid aldolase. The high-alkaline conditions of this process result in the degradation of reactants and products, while the purification of free enzymes to be used for the synthesis reaction is a costly process. The use of N-acetylglucosamine 2-epimerase has been seen as an alternative to the alkaline epimerization process. In this study, these two enzymes involved in N-acetylneuraminic acid production were immobilized to biopolyester beads in vivo in a one-step, cost-efficient process of production and isolation. Beads with epimerase-only, aldolase-only, and combined epimerase/aldolase activity were recombinantly produced in Escherichia coli. The enzymatic activities were 32 U, 590 U, and 2.2 U/420 U per gram dry bead weight, respectively. Individual beads could convert 18% and 77% of initial GlcNAc and ManNAc, respectively, at high substrate concentrations and near-neutral pH, demonstrating the application of this biobead technology to fine-chemical synthesis. Beads establishing the entire N-acetylneuraminic acid synthesis pathway were able to convert up to 22% of the initial N-acetylglucosamine after a 50-h reaction time into N-acetylneuraminic acid.

  1. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases.

  2. Synthesis and Bioactivity of (R)-Ricinoleic Acid Derivatives: A Review.

    PubMed

    Pabiś, Sylwia; Kula, Józef

    2016-01-01

    (R)-Ricinoleic acid (RA) [(12R,9Z)-hydroxyoctadecenoic acid], the main compound of castor seed oil, because of its unusual structure readily undergoes multi-directional chemical and biochemical transformations to produce derivatives with the retained carbon skeleton or with its degradation. Many of these are of high biological activity, as documented by an in vitro study, and possess therapeutic potential. This review article provides an overview of the recent developments in the area of synthesis of RA based compounds with anticancer and antimicrobial activities. Moreover, the antiinflammatory and analgesic properties of some ricinoleic acid derivatives are also highlighted.

  3. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  4. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  5. Double-helical nucleic acids with cross-linked strands: synthesis and applications in molecular biology

    NASA Astrophysics Data System (ADS)

    Antsypovitch, Sergei I.; Oretskaya, Tat'yana S.

    1998-03-01

    Data on the methods employed for cross-linking of DNA strands and for the synthesis of oligonucleotide duplexes with cross-links between strands are summarised. Existing methods are systematised; their advantages and drawbacks are discussed. The examples of applications of DNA duplexes with covalently cross-linked chains for the study of protein-nucleic acid recognition and mechanisms of action of nucleic acid-binding proteins for gaining information about the spatial structure of nucleic acids, and for the solution of other problems of molecular biology are given. The bibliography includes 131 references.

  6. Recent advances in the synthesis and application of fluorescent α-amino acids.

    PubMed

    Harkiss, Alexander H; Sutherland, Andrew

    2016-09-26

    Fluorescence spectroscopy has become a powerful technique for probing a range of complex biological processes including enzyme mechanisms and protein-protein interactions. While the application of this technique uses a number of strategies, many of these rely on the use of fluorescent α-amino acids. This review highlights the recent synthetic methods developed for the incorporation of highly conjugated chromophores into the side-chain of α-amino acids and the application of these compounds as probes for imaging in medicine and biology. In particular, the design and synthesis of α-amino acids bearing coumarin, flavone and polyaromatic derived chromophores is described.

  7. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  8. Enhanced production of shikimic acid using a multi-gene co-expression system in Escherichia coli.

    PubMed

    Liu, Xiang-Lei; Lin, Jun; Hu, Hai-Feng; Zhou, Bin; Zhu, Bao-Quan

    2016-04-01

    Shikimic acid (SA) is the key synthetic material for the chemical synthesis of Oseltamivir, which is prescribed as the front-line treatment for serious cases of influenza. Multi-gene expression vector can be used for expressing the plurality of the genes in one plasmid, so it is widely applied to increase the yield of metabolites. In the present study, on the basis of a shikimate kinase genetic defect strain Escherichia coli BL21 (ΔaroL/aroK, DE3), the key enzyme genes aroG, aroB, tktA and aroE of SA pathway were co-expressed and compared systematically by constructing a series of multi-gene expression vectors. The results showed that different gene co-expression combinations (two, three or four genes) or gene orders had different effects on the production of SA. SA production of the recombinant BL21-GBAE reached to 886.38 mg·L(-1), which was 17-fold (P < 0.05) of the parent strain BL21 (ΔaroL/aroK, DE3).

  9. Enantiomeric deoxycholic acid: total synthesis, characterization, and preliminary toxicity toward colon cancer cell lines.

    PubMed

    Katona, Bryson W; Rath, Nigam P; Anant, Shrikant; Stenson, William F; Covey, Douglas F

    2007-11-23

    Deoxycholic acid (DCA) is an endogenous secondary bile acid implicated in numerous pathological conditions including colon cancer formation and progression and cholestatic liver disease. DCA involvement in these disease processes results partly from its ability to modulate signaling cascades within the cell, presumably through both direct receptor activation and general detergent mediated membrane changes. To further explore DCA induced changes in cell signaling, we completed a total synthesis of enantiomeric deoxycholic acid (ent-DCA) from achiral 2-methyl-1,3-cyclopentanedione. Using a modified method of the synthesis of ent-testosterone that proceeds through the (R)-(-)-Hajos-Parrish ketone, we have completed the successful synthesis of ent-DCA in 25 steps with a yield of 0.3% with all stereochemical assignments of the product confirmed by X-ray crystallography. Our studies toward this synthesis also uncovered the methodology for the development of a novel A,B-cis steroidal skeleton system containing a C3-C9 single bond as well as conditions to selectively ketalize the typically less reactive 12-carbonyl in poly-keto A,B-cis androgens. The critical micelle concentration (cmc) of ent-DCA, determined by a dye solubilization method, was identical to the cmc of natural DCA. Toxicity studies toward HT-29 and HCT-116 human colon cancer cell lines demonstrated that ent-DCA had similar effects on proliferation, yet showed a markedly decreased ability to induce apoptosis as compared to natural DCA.

  10. The promoting effects of geniposidic acid and aucubin in Eucommia ulmoides Oliver leaves on collagen synthesis.

    PubMed

    Li, Y; Sato, T; Metori, K; Koike, K; Che, Q M; Takahashi, S

    1998-12-01

    We have reported that collagen synthesis was stimulated by the administration of a hot water extract from the leaves of Eucommia ulmoides OLIVER, Eucommiaceae (Du-Zhong leaves) in false aged model rats. In this paper, we set out to examine the compounds in Du-Zhong leaves that stimulated collagen synthesis in false aged model rats. In experiment 1, a methanol extract of Du-Zhong leaves also stimulated collagen synthesis in aged model rats. An acetone fraction was derived from the methanol extract by silica gel chromatography in experiment 2. The acetone fraction mainly contained iridoides mono-glycosides such as geniposidic acid and aucubin. The administration of geniposidic acid or aucubin stimulated collagen synthesis in aged model rats in experiments 3 and 4 (significance (p<0.05)). The reported pharmacological effects of Du-Zhong leaves, including healing organs and strengthening bone and muscle, are closely related to collagen metabolism. It appears that geniposidic acid and aucubin are the actual compounds in Du-Zhong which caused the effect in our experiments.

  11. Nitrogen metabolism and gas exchange parameters associated with zinc stress in tobacco expressing an ipt gene for cytokinin synthesis.

    PubMed

    Pavlíková, Daniela; Pavlík, Milan; Procházková, Dagmar; Zemanová, Veronika; Hnilička, František; Wilhelmová, Naďa

    2014-04-15

    Increased endogenous plant cytokinin (CK) content through transformation with an isopentyl transferase (ipt) gene has been associated with improved plant stress tolerance. The impact of zinc (tested levels Zn1=250, Zn2=500, Zn3=750mgkg(-1)soil) on gas exchange parameters (net photosynthetic rate, transpiration rate, stomatal conductance, intercellular CO2 concentration) and nitrogen utilization by plants resulted in changes of free amino acid concentrations (glutamic acid, glutamine, asparagine, aspartate, glycine, serine, cystein) and differed for transformed and non-transformed tobacco plants. For pot experiments, tobacco plants (Nicotiana tabacum L., cv. Wisconsin 38) transformed with a construct consisting of SAG12 promoter fused with the ipt gene for cytokinin synthesis (SAG plants) and its wild type (WT plants as a control) were used. Physiological analyses confirmed that SAG plants had improved zinc tolerance compared with the WT plants. The enhanced Zn tolerance of SAG plants was associated with the maintenance of accumulation of amino acids and with lower declines of photosynthetic and transpiration rates. In comparison to WT plants, SAG plants exposed to the highest Zn concentration accumulated lower concentrations of asparagine, which is a major metabolic product during senescence.

  12. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  13. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  14. Novel chemical synthesis of ginkgolic acid (13:0) and evaluation of its tyrosinase inhibitory activity.

    PubMed

    Fu, Yuanqing; Hong, Shan; Li, Duo; Liu, Songbai

    2013-06-05

    A novel efficient synthesis of ginkgolic acid (13:0) from abundant 2,6-dihydroxybenzoic acid was successfully developed through a state-of-the-art palladium-catalyzed cross-coupling reaction and catalytic hydrogenation with an overall yield of 34% in five steps. The identity of the synthesized ginkgolic acid (13:0) was confirmed by nuclear magnetic resonance, mass spectrometry, infrared, and high-performance liquid chromatography. The reaction sequence of this method can be readily extended to the synthesis of other ginkgolic acids. The synthesized ginkgolic acid (13:0) exhibited promising anti-tyrosinase activity (IC₅₀ = 2.8 mg/mL) that was not correlated to antioxidant activity as probed by 1,1-diphenyl-2-picrylhydrazyl, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), ferric reducing ability of plasma, and oxygen radical absorbance capacity assays. The synthetic strategy developed in this work will significantly facilitate biological studies of ginkgolic acids that have great potential applications in food and pharmaceuticals.

  15. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  16. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  17. The use of supported acidic ionic liquids in organic synthesis.

    PubMed

    Skoda-Földes, Rita

    2014-06-26

    Catalysts obtained by the immobilisation of acidic ionic liquids (ILs) on solid supports offer several advantages compared to the use of catalytically active ILs themselves. Immobilisation may result in an increase in the number of accessible active sites of the catalyst and a reduction of the amount of the IL required. The ionic liquid films on the carrier surfaces provide a homogeneous environment for catalytic reactions but the catalyst appears macroscopically as a dry solid, so it can simply be separated from the reaction mixture. As another advantage, it can easily be applied in a continuous fixed bed reactor. In the present review the main synthetic strategies towards the preparation of supported Lewis acidic and Brønsted acidic ILs are summarised. The most important characterisation methods and structural features of the supported ionic liquids are presented. Their efficiency in catalytic reactions is discussed with special emphasis on their recyclability.

  18. Retinoic acid increases zif268 early gene expression in rat preosteoblastic cells.

    PubMed Central

    Suva, L J; Ernst, M; Rodan, G A

    1991-01-01

    In this study we demonstrate that retinoic acid (RA) increases the expression of transcription factor zif268 mRNA in primary cultures of fetal rat calvarial cells and in simian virus 40-immortalized clonal rat calvarial preosteoblastic cells (RCT-1), which differentiate in response to RA, but not in the more differentiated RCT-3 and ROS 17/2.8 cells. The increased expression of zif268 mRNA is rapid (maximal within 1 h), transient (returns to basal levels by 3 h), detectable at RA doses of 10(-12)M, and independent of protein synthesis. The relative stimulation of zif268 mRNA by RA was much larger than that of other early genes, including c-fos, c-jun, and junB. The rate of transcription of RA-stimulated RCT-1 cells, estimated by nuclear run-on assays, was elevated, suggesting that RA regulation of zif268 gene transcription was at least in part transcriptional. Moreover, RA stimulated the transcriptional activity of a Zif268CAT (chloramphenicol acetyltransferase) plasmid containing 632 bp of zif268 5' regulatory sequences in RCT-1 cells but not in the more differentiated RCT-3 cells. These in vitro data support the in vivo observations which localize zif268 and RA receptor-gamma transcripts to bone and cartilage during development, suggesting that both RA and zif268 may play a role in osteoblast differentiation. Images PMID:1708092

  19. Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in s...

  20. Survival, Deoxyribonucleic Acid Breakdown, and Synthesis in Salmonella typhimurium as Compared with Escherichia coli B Strains

    PubMed Central

    Hudnik-Plevnik, Tamara A.; Djordjević, Nadežda

    1970-01-01

    Salmonella typhimurium LT-2 was compared with radioresistant (B/r) and radiosensitive (Bs−2) strains of Escherichia coli in respect to the survival, deoxyribonucleic acid (DNA) breakdown, and DNA synthesis after X irradiation. It is shown that S. typhimurium LT-2 is about four times more sensitive than E. coli B/r but less sensitive than Bs−2. The DNA breakdown is in S. typhimurium LT-2 lower than the postirradiation breakdown of DNA in both E. coli strains and DNA synthesis proceeds in this bacterium in spite of a much lower survival, as in the radioresistant E. coli B/r. PMID:4916313

  1. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    PubMed Central

    Feagin, Trevor A.; Shah, Nirmal I.; Heemstra, Jennifer M.

    2012-01-01

    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  2. Fatty acid transport and activation and the expression patterns of genes involved in fatty acid trafficking.

    PubMed

    Sandoval, Angel; Fraisl, Peter; Arias-Barrau, Elsa; Dirusso, Concetta C; Singer, Diane; Sealls, Whitney; Black, Paul N

    2008-09-15

    These studies defined the expression patterns of genes involved in fatty acid transport, activation and trafficking using quantitative PCR (qPCR) and established the kinetic constants of fatty acid transport in an effort to define whether vectorial acylation represents a common mechanism in different cell types (3T3-L1 fibroblasts and adipocytes, Caco-2 and HepG2 cells and three endothelial cell lines (b-END3, HAEC, and HMEC)). As expected, fatty acid transport protein (FATP)1 and long-chain acyl CoA synthetase (Acsl)1 were the predominant isoforms expressed in adipocytes consistent with their roles in the transport and activation of exogenous fatty acids destined for storage in the form of triglycerides. In cells involved in fatty acid processing including Caco-2 (intestinal-like) and HepG2 (liver-like), FATP2 was the predominant isoform. The patterns of Acsl expression were distinct between these two cell types with Acsl3 and Acsl5 being predominant in Caco-2 cells and Acsl4 in HepG2 cells. In the endothelial lines, FATP1 and FATP4 were the most highly expressed isoforms; the expression patterns for the different Acsl isoforms were highly variable between the different endothelial cell lines. The transport of the fluorescent long-chain fatty acid C(1)-BODIPY-C(12) in 3T3-L1 fibroblasts and 3T3-L1 adipocytes followed typical Michaelis-Menten kinetics; the apparent efficiency (k(cat)/K(T)) of this process increases over 2-fold (2.1 x 10(6)-4.5 x 10(6)s(-1)M(-1)) upon adipocyte differentiation. The V(max) values for fatty acid transport in Caco-2 and HepG2 cells were essentially the same, yet the efficiency was 55% higher in Caco-2 cells (2.3 x 10(6)s(-1)M(-1) versus 1.5 x 10(6)s(-1)M(-1)). The kinetic parameters for fatty acid transport in three endothelial cell types demonstrated they were the least efficient cell types for this process giving V(max) values that were nearly 4-fold lower than those defined form 3T3-L1 adipocytes, Caco-2 cells and HepG2 cells. The

  3. Hydrothermal synthesis of hollow silica spheres under acidic conditions.

    PubMed

    Yu, Qiyu; Wang, Pengpeng; Hu, Shi; Hui, Junfeng; Zhuang, Jing; Wang, Xun

    2011-06-07

    It is well-known that silica can be etched in alkaline media or in a unique hydrofluoric acid (HF) solution, which is widely used to prepare various kinds of hollow nanostructures (including silica hollow structures) via silica-templating methods. In our experiments, we found that stöber silica spheres could be etched in generic acidic media in a well-controlled way under hydrothermal conditions, forming well-defined hollow/rattle-type silica spheres. Furthermore, some salts such as NaCl and Na(2)SO(4) were found to be favorable for the formation of hollow/rattle-type silica spheres.

  4. Influence of virgin coconut oil-enriched diet on the transcriptional regulation of fatty acid synthesis and oxidation in rats - a comparative study.

    PubMed

    Arunima, Sakunthala; Rajamohan, Thankappan

    2014-05-28

    The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.

  5. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    PubMed

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  6. The Synthesis and Evaluation of Arctigenin Amino Acid Ester Derivatives.

    PubMed

    Cai, En-Bo; Yang, Li-Min; Jia, Cai-Xia; Zhang, Wei-Yuan; Zhao, Yan; Li, Wei; Song, Xing-Zhuo; Zheng, Man-Ling

    2016-10-01

    The use of arctigenin (ARG), a traditional medicine with many pharmacological activities, has been restricted due to its poor solubility in water. Five amino acid derivatives of ARG have been synthesized using glycine, o-alanine, valine, leucine, and isoleucine, which have t-butyloxy carbonyl (BOC) as a protective group. In this study, we examined the effects of removing these protective groups. The results showed that the amino acid derivatives have better solubility and nitrite-clearing ability than ARG. Among the compounds tested, the amino acid derivatives without protective group were the best. Based on these results, ARG and its two amino acid derivatives without protective group (ARG8, ARG10) were selected to evaluate their anti-tumor activity in vivo at a dosage of 40 mg/kg. The results indicated that ARG8 and ARG10 both exhibit more anti-tumor activity than ARG in H22 tumor-bearing mice. The tumor inhibition rates of ARG8 and ARG10 were 69.27 and 43.58%, which was much higher than ARG. Furthermore, the mice treated with these compounds exhibited less damage to the liver, kidney and immune organs compared with the positive group. Furthermore, ARG8 and ARG10 improved the serum cytokine levels significantly compared to ARG. In brief, this study provides a method to improve the water solubility of drugs, and we also provide a reference basis for new drug development.

  7. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  8. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  9. Synthesis of copper sulphide nanoparticles in carboxylic acids as solvent.

    PubMed

    Armelao, Lidia; Camozzo, Daniele; Gross, Silvia; Tondello, Eugenio

    2006-02-01

    A novel method for the preparation of CuS nanoparticles based on the fast nucleation of the sulphide has been developed. The particles have been synthesized by reaction of thioacetic acid with water and copper carboxylates (acetate, propionate) in the corresponding carboxylic acid (acetic, propionic) as a solvent. The use of carboxylic acids presents several advantages: (i) the hydrolysis of the C-S bond is favoured thus producing a fast CuS supersaturation and a high nucleation rate; (ii) the mobility of the precursor molecules is limited so that nucleation events are favoured with respect to particle growth; (iii) the low dielectric constant of the medium stabilises the nanoparticles dispersion by reducing the critical coagulation concentration. The prepared nanoparticles were investigated by UV-Vis spectroscopy, X-ray photoelectron spectroscopy, atomic force microscopy and dynamic light scattering. The nanoparticle suspensions are clear and characterized by a blue-shifted adsorption edge with respect to bulk CuS. Light scattering measurements performed on acetic acid suspensions evidence the formation of monodispersed nanoparticles with an average diameter of about 5 nm.

  10. First Synthesis of 1,4-Dimethoxy-2-Naphthoxyacetic acid.

    PubMed

    Chinea, Kimberly; Banerjee, Ajoy K

    2015-07-01

    2-Acetyl-1-hydroxynaphthalene was converted into 1,4-dimethoxy-2-naphthoxyacetic acid in seven steps (methylation, Bayer-Villiger oxidation, hydrolysis, bromination, methylation, alkylation and hydrolysis). 2-Hydroxy-1,4-naphthoquinone on acetylation, aromatization, methylation and hydrolysis, respectively, also yielded the title compound.

  11. An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

    PubMed

    Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

    2014-05-20

    Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies.

  12. The genes required for heme synthesis in Salmonella typhimurium include those encoding alternative functions for aerobic and anaerobic coproporphyrinogen oxidation.

    PubMed Central

    Xu, K; Delling, J; Elliott, T

    1992-01-01

    Insertion mutagenesis has been used to isolate Salmonella typhimurium strains that are blocked in the conversion of 5-aminolevulinic acid (ALA) to heme. These mutants define the steps of the heme biosynthetic pathway after ALA. Insertions were recovered at five unlinked loci: hemB, hemCD, and hemE, which have been mapped previously in S. typhimurium, and hemG and hemH, which have been described only for Escherichia coli. No other simple hem mutants were found. However, double mutants are described that are auxotrophic for heme during aerobic growth and fail to convert coproporphyrinogen III to protoporphyrinogen IX. These mutant strains are defective in two genes, hemN and hemF. Single mutants defective only in hemN require heme for anaerobic growth on glycerol plus nitrate but not for aerobic growth on glycerol. Mutants defective only in hemF have no apparent growth defect. We suggest that these two genes encode alternative forms of coproporphyrinogen oxidase. Anaerobic heme synthesis requires hemN function, while either hemN or hemF is sufficient for aerobic heme synthesis. These phenotypes are consistent with the requirement of a well-characterized class of coproporphyrinogen oxidase for molecular oxygen. PMID:1317844

  13. Alkaline stress and iron deficiency regulate iron uptake and riboflavin synthesis gene expression differently in root and leaf tissue: implications for iron deficiency chlorosis

    PubMed Central

    Hsieh, En-Jung; Waters, Brian M.

    2016-01-01

    Iron (Fe) is an essential mineral that has low solubility in alkaline soils, where its deficiency results in chlorosis. Whether low Fe supply and alkaline pH stress are equivalent is unclear, as they have not been treated as separate variables in molecular physiological studies. Additionally, molecular responses to these stresses have not been studied in leaf and root tissues simultaneously. We tested how plants with the Strategy I Fe uptake system respond to Fe deficiency at mildly acidic and alkaline pH by measuring root ferric chelate reductase (FCR) activity and expression of selected Fe uptake genes and riboflavin synthesis genes. Alkaline pH increased cucumber (Cucumis sativus L.) root FCR activity at full Fe supply, but alkaline stress abolished FCR response to low Fe supply. Alkaline pH or low Fe supply resulted in increased expression of Fe uptake genes, but riboflavin synthesis genes responded to Fe deficiency but not alkalinity. Iron deficiency increased expression of some common genes in roots and leaves, but alkaline stress blocked up-regulation of these genes in Fe-deficient leaves. In roots of the melon (Cucumis melo L.) fefe mutant, in which Fe uptake responses are blocked upstream of Fe uptake genes, alkaline stress or Fe deficiency up-regulation of certain Fe uptake and riboflavin synthesis genes was inhibited, indicating a central role for the FeFe protein. These results suggest a model implicating shoot-to-root signaling of Fe status to induce Fe uptake gene expression in roots. PMID:27605716

  14. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  15. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  16. Synthesis of medronic acid monoesters and their purification by high-performance countercurrent chromatography or by hydroxyapatite

    PubMed Central

    Vepsäläinen, Jouko; Turhanen, Petri A

    2016-01-01

    Summary We achieved the synthesis of important medronic acid monoalkyl esters via the dealkylation of mixed trimethyl monoalkyl esters of medronic acid. Two methods were developed for the purification of medronic acid monoesters: 1) small scale (10–20 mg) purification by using hydroxyapatite and 2) large scale (tested up to 140 mg) purification by high-performance countercurrent chromatography (HPCCC). PMID:27829921

  17. Assessing the Role of ETHYLENE RESPONSE FACTOR Transcriptional Repressors in Salicylic Acid-Mediated Suppression of Jasmonic Acid-Responsive Genes.

    PubMed

    Caarls, Lotte; Van der Does, Dieuwertje; Hickman, Richard; Jansen, Wouter; Verk, Marcel C Van; Proietti, Silvia; Lorenzo, Oscar; Solano, Roberto; Pieterse, Corné M J; Van Wees, Saskia C M

    2016-11-10

    Salicylic acid (SA) and jasmonic acid (JA) cross-communicate in the plant immune signaling network to finely regulate induced defenses. In Arabidopsis, SA antagonizes many JA-responsive genes, partly by targeting the ETHYLENE RESPONSE FACTOR (ERF)-type transcriptional activator ORA59. Members of the ERF transcription factor family typically bind to GCC-box motifs in the promoters of JA- and ethylene-responsive genes, thereby positively or negatively regulating their expression. The GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Here, we investigated whether SA-induced ERF-type transcriptional repressors, which may compete with JA-induced ERF-type activators for binding at the GCC-box, play a role in SA/JA antagonism. We selected ERFs that are transcriptionally induced by SA and/or possess an EAR transcriptional repressor motif. Several of the 16 ERFs tested suppressed JA-dependent gene expression, as revealed by enhanced JA-induced PDF1.2 or VSP2 expression levels in the corresponding erf mutants, while others were involved in activation of these genes. However, SA could antagonize JA-induced PDF1.2 or VSP2 in all erf mutants, suggesting that the tested ERF transcriptional repressors are not required for SA/JA cross-talk. Moreover, a mutant in the co-repressor TOPLESS, that showed reduction in repression of JA signaling, still displayed SA-mediated antagonism of PDF1.2 and VSP2. Collectively, these results suggest that SA-regulated ERF transcriptional repressors are not essential for antagonism of JA-responsive gene expression by SA. We further show that de novo SA-induced protein synthesis is required for suppression of JA-induced PDF1.2, pointing to SA-stimulated production of an as yet unknown protein that suppresses JA-induced transcription.

  18. Fmoc/Trt-amino acids: comparison to Fmoc/tBu-amino acids in peptide synthesis.

    PubMed

    Barlos, K; Gatos, D; Koutsogianni, S

    1998-03-01

    Model peptides containing the nucleophilic amino acids Trp and Met have been synthesized with the application of Fmoc/Trt- and Fmoc/tBu-amino acids, for comparison. The deprotection of the peptides synthesized using Fmoc/Trt-amino acids in all cases leads to crude peptides of higher purity than that of the same peptides synthesized using Fmoc/tBu-amino acids.

  19. Structural gene and complete amino acid sequence of Vibrio alginolyticus collagenase.

    PubMed Central

    Takeuchi, H; Shibano, Y; Morihara, K; Fukushima, J; Inami, S; Keil, B; Gilles, A M; Kawamoto, S; Okuda, K

    1992-01-01

    The DNA encoding the collagenase of Vibrio alginolyticus was cloned, and its complete nucleotide sequence was determined. When the cloned gene was ligated to pUC18, the Escherichia coli expression vector, bacteria carrying the gene exhibited both collagenase antigen and collagenase activity. The open reading frame from the ATG initiation codon was 2442 bp in length for the collagenase structural gene. The amino acid sequence, deduced from the nucleotide sequence, revealed that the mature collagenase consists of 739 amino acids with an Mr of 81875. The amino acid sequences of 20 polypeptide fragments were completely identical with the deduced amino acid sequences of the collagenase gene. The amino acid composition predicted from the DNA sequence was similar to the chemically determined composition of purified collagenase reported previously. The analyses of both the DNA and amino acid sequences of the collagenase gene were rigorously performed, but we could not detect any significant sequence similarity to other collagenases. Images Fig. 2. PMID:1311172

  20. Fatty Acid Synthesis Intermediates Represent Novel Noninvasive Biomarkers of Prostate Cancer Chemoprevention by Phenethyl Isothiocyanate.

    PubMed

    Singh, Krishna B; Singh, Shivendra V

    2017-03-14

    Increased de novo synthesis of fatty acids is a distinctive feature of prostate cancer, which continues to be a leading cause of cancer-related deaths among American men. Therefore, inhibition of de novo fatty acid synthesis represents an attractive strategy for chemoprevention of prostate cancer. We have shown previously that dietary feeding of phenethyl isothiocyanate (PEITC), a phytochemical derived from edible cruciferous vegetables such as watercress, inhibits incidence and burden of poorly-differentiated prostate cancer in Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model. The present study was designed to test the hypothesis of whether fatty acid intermediate(s) can serve as noninvasive biomarker(s) of prostate cancer chemoprevention by PEITC using archived plasma and tumor specimens from the TRAMP study as well as cellular models of prostate cancer. Exposure of prostate cancer cells (LNCaP and 22Rv1) to pharmacological concentrations of PEITC resulted in downregulation of key fatty acid metabolism proteins, including acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FASN), and carnitine palmitoyltransferase 1A (CPT1A). The mRNA expression of FASN and CPT1A as well as acetyl-CoA levels were decreased by PEITC treatment in both cell lines. PEITC administration to TRAMP mice also resulted in a significant decrease in tumor expression of FASN protein. Consistent with these findings, the levels of total free fatty acids, total phospholipids, triglyceride, and ATP were significantly lower in the plasma and/or prostate tumors of PEITC-treated TRAMP mice compared with controls. The present study is the first to implicate inhibition of fatty acid synthesis in prostate cancer chemoprevention by PEITC.

  1. Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.

    PubMed

    Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M

    2012-03-27

    In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages.

  2. Akt Phosphorylation and Regulation of Transketolase Is a Nodal Point for Amino Acid Control of Purine Synthesis

    PubMed Central

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T.; Phan, Tony; Pilz, Renate B.; Boss, Gerry R.

    2014-01-01

    SUMMARY The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mTORC2 and IκB kinase regulate Akt activity, and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the non-oxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the non-oxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for two days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a new mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  3. Inhibition of retinoic acid synthesis disrupts spermatogenesis and fecundity in zebrafish.

    PubMed

    Pradhan, Ajay; Olsson, Per-Erik

    2015-01-01

    Timing of germ cell entry into meiosis is sexually dimorphic in mammals. However it was recently shown that germ cells initiate meiosis at the same time in male and female zebrafish. Retinoic acid (RA) has been shown to be critical for mammalian spermatogenesis. Inhibition of RA synthesis by WIN 18,446 has been reported to inhibit spermatogenesis in a wide variety of animals including humans and was once used as a contraceptive in humans. In this study we explored the role of RA in zebrafish spermatogenesis. In silico analysis with Internal coordinate mechanics docking software showed that WIN 18,446 can bind to the rat, human and zebrafish Aldh1a2 catalytic domain with equivalent potency. RA exposure resulted in up-regulation of the RA metabolizing enzyme genes cyp26a1, cyp26b1 and cyp26c1 in vitro and in vivo. Exposure to WIN 18,446 resulted in down-regulation of Aldh1a2, cyp26a1 and cyp26b1 in vivo. WIN 18,446 was effective in disrupting spermatogenesis and fecundity in zebrafish but the reduction in sperm count and fecundity was only observed when zebrafish were maintained on a strict Artemia nauplii diet which is known to contain low levels of vitamin A. This study shows that RA is involved in spermatogenesis as well as oocyte development in zebrafish. As the zebrafish Aldh1a2 structure and function is similar to the mammalian counterpart, Aldh1a2 inhibitor screening using zebrafish as a model system may be beneficial in the discovery and development of new and safe contraceptives for humans.

  4. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    PubMed

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  5. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  6. Protein and Ribonucleic Acid Synthesis During the Diploid Life Cycle of Allomyces arbuscula

    PubMed Central

    Burke, Daniel J.; Seale, Thomas W.; McCarthy, Brian J.

    1972-01-01

    The diploid life cycle of Allomyces arbuscula may be divided into four parts: spore induction, germination, vegetative growth, and mitosporangium formation. Spore induction, germination, and mitosporangium formation are insensitive to inhibition of actinomycin D, probably indicating that stable, pre-existing messenger ribonucleic acid (RNA) is responsible for these developmental events. Protein synthesis is necessary during the entire life cycle except for cyst formation. A system for obtaining synchronous germination of mitospores is described. During germination there is a characteristic increase in the rate of synthesis of RNA and protein although none of the other morphogenetic changes occurring during the life cycle are necessarily accompanied by an appreciable change in the rate of macromolecular synthesis. PMID:4113121

  7. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-01-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  8. Isolation and characterization of a new mutant of Saccharomyces cerevisiae with altered synthesis of 5-aminolevulinic acid.

    PubMed Central

    Carvajal, E; Panek, A D; Mattoon, J R

    1990-01-01

    A new gene, RHM1, required for normal production of 5-aminolevulinic acid by Saccharomyces cerevisiae, was identified by a novel screening method. Ethyl methanesulfonate treatment of a fluorescent porphyric strain bearing the pop3-1 mutation produced nonfluorescent or weakly fluorescent mutants with defects in early stages of tetrapyrrole biosynthesis. Class I mutants defective in synthesis of 5-aminolevulinate regained fluorescence when grown on medium supplemented with 5-aminolevulinate, whereas class II mutants altered in later biosynthetic steps did not. Among six recessive class I mutants, at least three complementation groups were found. One mutant contained an allele of HEM1, the structural gene for 5-aminolevulinate synthase, and two mutants contained alleles of the regulatory gene CYC4. The remaining mutants contained genes complementary to both hem1 and cyc4. Mutant strain DA3-RS3/68 contained mutant gene rhm1, which segregated independently of hem1 and cyc4 during meiosis. 5-Aminolevulinate synthase activity of the rhm1 mutant was 35 to 40% of that of the parental pop3-1 strain, whereas intracellular 5-aminolevulinate concentration was only 3 to 4% of the parental value. Transformation of an rhm1 strain with a multicopy plasmid containing the cloned HEM1 gene restored normal levels of 5-aminolevulinate synthase activity, but intracellular 5-aminolevulinate was increased to only 9 to 10% of normal. We concluded that RHM1 could control either targeting of 5-aminolevulinate synthase to the mitochondrial matrix or the activity of the enzyme in vivo. PMID:2188943

  9. Expression Analysis of Phenylalanine Ammonia Lyase Gene and Rosmarinic Acid Production in Salvia officinalis and Salvia virgata Shoots Under Salicylic Acid Elicitation.

    PubMed

    Ejtahed, Roghayeh Sadat; Radjabian, Tayebeh; Hoseini Tafreshi, Sayed Ali

    2015-08-01

    Partial fragments of phenylalanine ammonia lyase (PAL) genes were cloned and characterized from Salvia officinalis (SoPAL) and Salvia virgata (SvPAL). Different concentrations (250 and 500 μM) of exogenous salicylic acid (SA) were used when correlation between PAL expression and rosmarinic acid (RA) accumulation was compared. The results showed that the deduced cDNA sequences of the partial genes had high similarities with those of known PAL gene from other plant species. Semi-quantitative reverse transcription PCR (RT-PCR) analysis revealed that exogenous application of SA led to up-regulating of the PAL expression. Further analysis showed that in S. virgata, at higher concentration of SA, higher accumulation of RA was achieved, while in S. officinalis, the higher RA accumulation was observed at lower concentration of SA. It was concluded that there was no positive correlation between the intensity of PAL transcription and the RA accumulation in the studied species. Therefore, despite of the increase in transcription rate of the PAL at the higher concentration of SA, the lower amounts of RA were accumulated in the case of S. officinalis. Consequently, the hypothesis that PAL is the rate-determining step in RA biosynthesis is not always valid and probably some other unknown factors participate in the synthesis of phenolics.

  10. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  11. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  12. Synthesis and verification of biobased terephthalic acid from furfural.

    PubMed

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-02-04

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  13. Synthesis and antifungal activity of bile acid-derived oxazoles.

    PubMed

    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela

    2016-04-01

    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives.

  14. Enzymatic synthesis of palm olein-based fatty thiohydroxamic acids.

    PubMed

    Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor Azowa Bt; Rahman, Mohd Zaki Ab

    2010-01-01

    Fatty thiohydroxamic acids (FTAs) have been successfully synthesized from palm olein and thiohydroxamic acid by a one-step lipase catalyzed reaction. The use of immobilized lipase (Lipozyme RMIM) as the catalyst for the preparation reaction provides an easy isolation of the enzyme from the products and other components in the reaction mixture. The FTAs were characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The highest conversion percentage (95 %) was obtained when the process was carried out for 30 hours using urea to palm oil ratio of 6.0: 1.0 at 40 °C. The method employed offers several advantages such as renewable and abundant of the raw material, simple reaction procedure, environmentally friendly process and high yield of the product.

  15. Cloning of the RHO1 gene from Candida albicans and its regulation of beta-1,3-glucan synthesis.

    PubMed Central

    Kondoh, O; Tachibana, Y; Ohya, Y; Arisawa, M; Watanabe, T

    1997-01-01

    The Saccharomyces cerevisiae RHO1 gene encodes a low-molecular-weight GTPase. One of its recently identified functions is the regulation of beta-1,3-glucan synthase, which synthesizes the main component of the fungal cell wall (J. Drgonova et al., Science 272:277-279, 1996; T. Mazur and W. Baginsky, J. Biol. Chem. 271:14604-14609, 1996; and H. Qadota et al., Science 272:279-281, 1996). From the opportunistic pathogenic fungus Candida albicans, we cloned the RHO1 gene by the PCR and cross-hybridization methods. Sequence analysis revealed that the Candida RHO1 gene has a 597-nucleotide region which encodes a putative 22.0-kDa peptide. The deduced amino acid sequence predicts that Candida albicans Rho1p is 82.9% identical to Saccharomyces Rho1p and contains all the domains conserved among Rho-type GTPases from other organisms. The Candida albicans RHO1 gene could rescue a S. cerevisiae strain containing a rho1 deletion. Furthermore, recombinant Candida albicans Rho1p could reactivate the beta-1,3-glucan synthesis activities of both C. albicans and S. cerevisiae membranes in which endogenous Rho1p had been depleted by Tergitol NP-40-NaCl treatment. Candida albicans Rho1p was copurified with the beta-1,3-glucan synthase putative catalytic subunit, Candida albicans Gsc1p, by product entrapment. Candida albicans Rho1p was shown to interact directly with Candida albicans Gsc1p in a ligand overlay assay and a cross-linking study. These results indicate that Candida albicans Rho1p acts in the same manner as Saccharomyces cerevisiae Rho1p to regulate beta-1,3-glucan synthesis. PMID:9401032

  16. The PH gene determines fruit acidity and contributes to the evolution of sweet melons.

    PubMed

    Cohen, Shahar; Itkin, Maxim; Yeselson, Yelena; Tzuri, Galil; Portnoy, Vitaly; Harel-Baja, Rotem; Lev, Shery; Sa'ar, Uzi; Davidovitz-Rikanati, Rachel; Baranes, Nadine; Bar, Einat; Wolf, Dalia; Petreikov, Marina; Shen, Shmuel; Ben-Dor, Shifra; Rogachev, Ilana; Aharoni, Asaph; Ast, Tslil; Schuldiner, Maya; Belausov, Eduard; Eshed, Ravit; Ophir, Ron; Sherman, Amir; Frei, Benedikt; Neuhaus, H Ekkehard; Xu, Yimin; Fei, Zhangjun; Giovannoni, Jim; Lewinsohn, Efraim; Tadmor, Yaakov; Paris, Harry S; Katzir, Nurit; Burger, Yosef; Schaffer, Arthur A

    2014-06-05

    Taste has been the subject of human selection in the evolution of agricultural crops, and acidity is one of the three major components of fleshy fruit taste, together with sugars and volatile flavour compounds. We identify a family of plant-specific genes with a major effect on fruit acidity by map-based cloning of C. melo PH gene (CmPH) from melon, Cucumis melo taking advantage of the novel natural genetic variation for both high and low fruit acidity in this species. Functional silencing of orthologous PH genes in two distantly related plant families, cucumber and tomato, produced low-acid, bland tasting fruit, showing that PH genes control fruit acidity across plant families. A four amino-acid duplication in CmPH distinguishes between primitive acidic varieties and modern dessert melons. This fortuitous mutation served as a preadaptive antecedent to the development of sweet melon cultigens in Central Asia over 1,000 years ago.

  17. First synthesis of thia steroids from cholic acid.

    PubMed

    Ibrahim-Ouali, Malika; Rocheblave, Luc

    2010-10-01

    Heterosteroids remain interesting due to their potential biological activities. This prompted us to synthesize novel thia steroids possessing the heteroatom in the A-ring. We set out to describe a new and versatile method for preparing 3-thia steroids from cholic acid via a selective oxidation of one hydroxyl group, a Baeyer-Villiger oxidation and a photolysis as the key steps. The characteristic (1)H and (13)C NMR spectroscopic features of the synthesized compounds are reported.

  18. An approach for the synthesis of nakamuric acid

    PubMed Central

    Wang, Xiaolei; Chen, Chuo

    2014-01-01

    The biosynthesis of dimeric pyrrole–imidazole alkaloids is likely mediated by enzyme-catalyzed reversible single-electron transfer (SET) cycloaddition. We now show that Ir(ppy)3 can promote SET-mediated formal [2+2] and [4+2] cycloaddition reactions of pyrrole–imidazole alkaloids-related substrates under photolytic conditions. This biomimetic approach is useful for the construction of the core skeleton of nakamuric acid and sceptrin. PMID:25983349

  19. Synthesis and characterization of fatty hydroxamic acids from triacylglycerides.

    PubMed

    Hoidy, Wisam H; Ahmad, Mansor B; Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor azowa Bt

    2010-01-01

    In this study, fatty haydroxamic acids (FHAs), which have biological activities as antibiotics and antifungal, have been synthesized via refluxing of triacylglycrides, palm olein, palm stearin or corn oil with hydroxylamine hydrochloride. The products were characterized using the complex formation test of hydroxamic acid group with zinc(I), copper(II) and iron(III), various technique methods including nuclear magnetic resonance ((1)H NMR) spectroscopy, Fourier transform infrared (FTIR) spectroscopy and elemental analysis. Parameters that may affect the conversion of oils to FHAs including the effect of reaction time, effect of organic solvent and effect of hydro/oil molar issue were also investigated in this study. Results of characterization indicate that FHAs were successfully produced from triacylglycrides. The conversion percentages of palm stearin, palm olein and corn oil into their fatty hydroxamic acids are 82, 81 and 78, respectively. Results also showed that hexane is the best organic solvent to produce the FHAs from the three oils used in this study. The optimum reaction time to achieve the maximum conversion percentage of the oils to FHAs was found to be 10 hours for all the three oils, while the optimum molar ration of hydro/to oil was found to be 7:1 for all the different three oils.

  20. Synthesis, crystal structure and computational studies of 4-nitrobenzylphosphonic acid

    NASA Astrophysics Data System (ADS)

    Wilk, Magdalena; Jarzembska, Katarzyna N.; Janczak, Jan; Hoffmann, Józef; Videnova-Adrabinska, Veneta

    2