Science.gov

Sample records for acid synthesis genes

  1. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  2. Retinoic acid response element in the human alcohol dehydrogenase gene ADH3: implications for regulation of retinoic acid synthesis.

    PubMed Central

    Duester, G; Shean, M L; McBride, M S; Stewart, M J

    1991-01-01

    Retinoic acid regulation of one member of the human class I alcohol dehydrogenase (ADH) gene family was demonstrated, suggesting that the retinol dehydrogenase function of ADH may play a regulatory role in the biosynthetic pathway for retinoic acid. Promoter activity of human ADH3, but not ADH1 or ADH2, was shown to be activated by retinoic acid in transient transfection assays of Hep3B human hepatoma cells. Deletion mapping experiments identified a region in the ADH3 promoter located between -328 and -272 bp which confers retinoic acid activation. This region was also demonstrated to confer retinoic acid responsiveness on the ADH1 and ADH2 genes in heterologous promoter fusions. Within a 34-bp stretch, the ADH3 retinoic acid response element (RARE) contains two TGACC motifs and one TGAAC motif, both of which exist in RAREs controlling other genes. A block mutation of the TGACC sequence located at -289 to -285 bp eliminated the retinoic acid response. As assayed by gel shift DNA binding studies, the RARE region (-328 to -272 bp) of ADH3 bound the human retinoic acid receptor beta (RAR beta) and was competed for by DNA containing a RARE present in the gene encoding RAR beta. Since ADH catalyzes the conversion of retinol to retinal, which can be further converted to retinoic acid by aldehyde dehydrogenase, these results suggest that retinoic acid activation of ADH3 constitutes a positive feedback loop regulating retinoic acid synthesis. Images PMID:1996113

  3. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  4. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective.

  5. Agrobacterium tumefaciens exoR controls acid response genes and impacts exopolysaccharide synthesis, horizontal gene transfer, and virulence gene expression.

    PubMed

    Heckel, Brynn C; Tomlinson, Amelia D; Morton, Elise R; Choi, Jeong-Hyeon; Fuqua, Clay

    2014-09-01

    Agrobacterium tumefaciens is a facultative plant pathogen and the causative agent of crown gall disease. The initial stage of infection involves attachment to plant tissues, and subsequently, biofilms may form at these sites. This study focuses on the periplasmic ExoR regulator, which was identified based on the severe biofilm deficiency of A. tumefaciens exoR mutants. Genome-wide expression analysis was performed to elucidate the complete ExoR regulon. Overproduction of the exopolysaccharide succinoglycan is a dramatic phenotype of exoR mutants. Comparative expression analyses revealed that the core ExoR regulon is unaffected by succinoglycan synthesis. Several findings are consistent with previous observations: genes involved in succinoglycan biosynthesis, motility, and type VI secretion are differentially expressed in the ΔexoR mutant. In addition, these studies revealed new functional categories regulated by ExoR, including genes related to virulence, conjugation of the pAtC58 megaplasmid, ABC transporters, and cell envelope architecture. To address how ExoR exerts a broad impact on gene expression from its periplasmic location, a genetic screen was performed to isolate suppressor mutants that mitigate the exoR motility phenotype and identify downstream components of the ExoR regulatory pathway. This suppression analysis identified the acid-sensing two-component system ChvG-ChvI, and the suppressor mutant phenotypes suggest that all or most of the characteristic exoR properties are mediated through ChvG-ChvI. Subsequent analysis indicates that exoR mutants are simulating a response to acidic conditions, even in neutral media. This work expands the model for ExoR regulation in A. tumefaciens and underscores the global role that this regulator plays on gene expression. PMID:24982308

  6. Response of Fatty Acid Synthesis Genes to the Binding of Human Salivary Amylase by Streptococcus gordonii

    PubMed Central

    Nikitkova, Anna E.; Haase, Elaine M.; Vickerman, M. Margaret; Gill, Steven R.

    2012-01-01

    Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were differentially expressed in response to the binding of purified human salivary amylase versus exposure to purified heat-denatured amylase. Selected genes found to be differentially expressed were validated by quantitative reverse transcription-PCR (qRT-PCR). Five genes from the fatty acid synthesis (FAS) cluster were highly (10- to 35-fold) upregulated in S. gordonii CH1 cells treated with native amylase relative to those treated with denatured amylase. An abpA-deficient strain of S. gordonii exposed to amylase failed to show a response in FAS gene expression similar to that observed in the parental strain. Predicted phenotypic effects of amylase binding to S. gordonii strain CH1 (associated with increased expression of FAS genes, leading to changes in fatty acid synthesis) were noted; these included increased bacterial growth, survival at low pH, and resistance to triclosan. These changes were not observed in the amylase-exposed abpA-deficient strain, suggesting a role for AbpA in the amylase-induced phenotype. These results provide evidence that the binding of salivary amylase elicits a differential gene response in S. gordonii, resulting in a phenotypic adjustment that is potentially advantageous for bacterial survival in the oral environment. PMID:22247133

  7. Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

    PubMed Central

    2010-01-01

    Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD) 2 and fatty acid elongase (FAE) 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general development of C. sativa should

  8. Promoter strength of folic acid synthesis genes affects sulfa drug resistance in Saccharomyces cerevisiae.

    PubMed

    Iliades, Peter; Berglez, Janette; Meshnick, Steven; Macreadie, Ian

    2003-01-01

    The enzyme dihydropteroate synthase (DHPS) is an important target for sulfa drugs in both prokaryotic and eukaryotic microbes. However, the understanding of DHPS function and the action of antifolates in eukaryotes has been limited due to technical difficulties and the complexity of DHPS being a part of a bifunctional or trifunctional protein that comprises the upstream enzymes involved in folic acid synthesis (FAS). Here, yeast strains have been constructed to study the effects of FOL1 expression on growth and sulfa drug resistance. A DHPS knockout yeast strain was complemented by yeast vectors expressing the FOL1 gene under the control of promoters of different strengths. An inverse relationship was observed between the growth rate of the strains and FOL1 expression levels. The use of stronger promoters to drive FOL1 expression led to increased sulfamethoxazole resistance when para-aminobenzoic acid (pABA) levels were elevated. However, high FOL1 expression levels resulted in increased susceptibility to sulfamethoxazole in pABA free media. These data suggest that up-regulation of FOL1 expression can lead to sulfa drug resistance in Saccharomyces cerevisiae.

  9. Effect of Diet Supplementation on the Expression of Bovine Genes Associated with Fatty Acid Synthesis and Metabolism

    PubMed Central

    Joseph, Sandeep J.; Robbins, Kelly R.; Pavan, Enrique; Pratt, Scott L.; Duckett, Susan K.; Rekaya, Romdhane

    2010-01-01

    Conjugated linoleic acids (CLA) are of important nutritional and health benefit to human. Food products of animal origin are their major dietary source and their concentration increases with high concentrate diets fed to animals. To examine the effects of diet supplementation on the expression of genes related to lipid metabolism, 28 Angus steers were fed either pasture only, pasture with soybean hulls and corn oil, pasture with corn grain, or high concentrate diet. At slaughter, samples of subcutaneous adipose tissue were collected, from which RNA was extracted. Relative abundance of gene expression was measured using Affymetrix GeneChip Bovine Genome array. An ANOVA model nested within gene was used to analyze the background adjusted, normalized average difference of probe-level intensities. To control experiment wise error, a false discovery rate of 0.01 was imposed on all contrasts. Expression of several genes involved in the synthesis of enzymes related to fatty acid metabolism and lipogenesis such as stearoyl-CoA desaturase (SCD), fatty acid synthetase (FASN), lipoprotein lipase (LPL), fatty-acyl elongase (LCE) along with several trancription factors and co-activators involved in lipogenesis were found to be differentially expressed. Confirmatory RT-qPCR was done to validate the microarray results, which showed satisfactory correspondence between the two platforms. Results show that changes in diet by increasing dietary energy intake by supplementing high concentrate diet have effects on the transcription of genes encoding enzymes involved in fat metabolism which in turn has effects on fatty acid content in the carcass tissue as well as carcass quality. Corn supplementation either as oil or grain appeared to significantly alter the expression of genes directly associated with fatty acid synthesis. PMID:20448844

  10. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  11. Inhibitors of Fatty Acid Synthesis Induce PPAR α -Regulated Fatty Acid β -Oxidative Genes: Synergistic Roles of L-FABP and Glucose.

    PubMed

    Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm

    2013-01-01

    While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.

  12. Functional differentiation and selective inactivation of multiple Saccharomyces cerevisiae genes involved in very-long-chain fatty acid synthesis.

    PubMed

    Rössler, H; Rieck, C; Delong, T; Hoja, U; Schweizer, E

    2003-05-01

    While de novo fatty acid synthesis uses acetyl-CoA, fatty acid elongation uses longer-chain acyl-CoAs as primers. Several mutations that interfere with fatty acid elongation in yeast have already been described, suggesting that there may be different elongases for medium- and long-chain acyl-CoA primers. In the present study, an experimental approach is described that allows differential characterization of the various yeast elongases in vitro. Based on their characteristic primer specificities and product patterns, at least three different yeast elongases are defined. Elongase I extends C12-C16 fatty acyl-CoAs to C16-C18 fatty acids. Elongase II elongates palmitoyl-CoA and stearoyl-CoA up to C22 fatty acids, and elongase III synthesizes 20-26-carbon fatty acids from C18-CoA primers. Elongases I, II and III are specifically inactivated in, respectively, elo1, elo2 and elo3 mutants. Elongases II and III share the same 3-ketoacyl reductase, which is encoded by the YBR159w gene. Inactivation of YBR159w inhibits in vitro fatty acid elongation after the first condensation reaction. Although in vitro elongase activity is absent, the mutant nevertheless contains 10-30% of normal VLCFA levels. On the basis of this finding, an additional elongating activity is inferred to be present in vivo. ybr159Delta cells show synthetic lethality in the presence of cerulenin, which inactivates fatty acid synthase. An involvement of FAS in VLCFA synthesis may account for these findings, but remains to be demonstrated directly. Alternatively, a vital role for C18 and C20 hydroxyacids, which are dramatically overproduced in ybr159Delta cells, may be postulated. PMID:12684876

  13. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  14. Lipoprotein Lipase, Tissue Expression and Effects on Genes Related to Fatty Acid Synthesis in Goat Mammary Epithelial Cells

    PubMed Central

    Zhao, Wang-Sheng; Hu, Shi-Liang; Yu, Kang; Wang, Hui; Wang, Wei; Loor, Juan; Luo, Jun

    2014-01-01

    Lipoprotein lipase (LPL) serves as a central factor in hydrolysis of triacylglycerol and uptake of free fatty acids from the plasma. However, there are limited data concerning the action of LPL on the regulation of milk fat synthesis in goat mammary gland. In this investigation, we describe the cloning and sequencing of the LPL gene from Xinong Saanen dairy goat mammary gland, along with a study of its phylogenetic relationships. Sequence analysis showed that goat LPL shares similarities with other species including sheep, bovine, human and mouse. LPL mRNA expression in various tissues determined by RT-qPCR revealed the highest expression in white adipose tissue, with lower expression in heart, lung, spleen, rumen, small intestine, mammary gland, and kidney. Expression was almost undetectable in liver and muscle. The expression profiles of LPL gene in mammary gland at early, peak, mid, late lactation, and the dry period were also measured. Compared with the dry period, LPL mRNA expression was markedly greater at early lactation. However, compared with early lactation, the expression was lower at peak lactation and mid lactation. Despite those differences, LPL mRNA expression was still greater at peak, mid, and late lactation compared with the dry period. Using goat mammary epithelial cells (GMEC), the in vitro knockdown of LPL via shRNA or with Orlistat resulted in a similar degree of down-regulation of LPL (respectively). Furthermore, knockdown of LPL was associated with reduced mRNA expression of SREBF1, FASN, LIPE and PPARG but greater expression of FFAR3. There was no effect on ACACA expression. Orlistat decreased expression of LIPE, FASN, ACACA, and PPARG, and increased FFAR3 and SREBF1 expression. The pattern of LPL expression was similar to the changes in milk fat percentage in lactating goats. Taken together, results suggest that LPL may play a crucial role in fatty acid synthesis. PMID:25501331

  15. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  16. Industrial scale gene synthesis.

    PubMed

    Notka, Frank; Liss, Michael; Wagner, Ralf

    2011-01-01

    The most recent developments in the area of deep DNA sequencing and downstream quantitative and functional analysis are rapidly adding a new dimension to understanding biochemical pathways and metabolic interdependencies. These increasing insights pave the way to designing new strategies that address public needs, including environmental applications and therapeutic inventions, or novel cell factories for sustainable and reconcilable energy or chemicals sources. Adding yet another level is building upon nonnaturally occurring networks and pathways. Recent developments in synthetic biology have created economic and reliable options for designing and synthesizing genes, operons, and eventually complete genomes. Meanwhile, high-throughput design and synthesis of extremely comprehensive DNA sequences have evolved into an enabling technology already indispensable in various life science sectors today. Here, we describe the industrial perspective of modern gene synthesis and its relationship with synthetic biology. Gene synthesis contributed significantly to the emergence of synthetic biology by not only providing the genetic material in high quality and quantity but also enabling its assembly, according to engineering design principles, in a standardized format. Synthetic biology on the other hand, added the need for assembling complex circuits and large complexes, thus fostering the development of appropriate methods and expanding the scope of applications. Synthetic biology has also stimulated interdisciplinary collaboration as well as integration of the broader public by addressing socioeconomic, philosophical, ethical, political, and legal opportunities and concerns. The demand-driven technological achievements of gene synthesis and the implemented processes are exemplified by an industrial setting of large-scale gene synthesis, describing production from order to delivery.

  17. Inhibition of Mammalian Target of Rapamycin Complex 1 (mTORC1) Downregulates ELOVL1 Gene Expression and Fatty Acid Synthesis in Goat Fetal Fibroblasts

    PubMed Central

    Wang, Weipeng; He, Qiburi; Guo, Zhixin; Yang, Limin; Bao, Lili; Bao, Wenlei; Zheng, Xu; Wang, Yanfeng; Wang, Zhigang

    2015-01-01

    Elongation of very-long-chain fatty acids 1 (ELOVL1) is a ubiquitously expressed gene that belongs to the ELOVL family and regulates the synthesis of very-long-chain fatty acids (VLCFAs) and sphingolipids, from yeast to mammals. Mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of cell metabolism and is associated with fatty acids synthesis. In this study, we cloned the cDNA that encodes Cashmere goat (Capra hircus) ELOVL1 (GenBank Accession number KF549985) and investigated its expression in 10 tissues. ELOVL1 cDNA was 840 bp, encoding a deduced protein of 279 amino acids, and ELOVL1 mRNA was expressed in a wide range of tissues. Inhibition of mTORC1 by rapamycin decreased ELOVL1 expression and fatty acids synthesis in Cashmere goat fetal fibroblasts. These data show that ELOVL1 expression is regulated by mTORC1 and that mTORC1 has significant function in fatty acids synthesis in Cashmere goat. PMID:26204830

  18. The effect of gestational age on expression of genes involved in uptake, trafficking and synthesis of fatty acids in the rat placenta.

    PubMed

    Rodríguez-Cruz, Maricela; González, Raúl Sánchez; Maldonado, Jorge; López-Alarcón, Mardia; Bernabe-García, Mariela

    2016-10-15

    Gestation triggers a tight coordination among maternal tissues to provide fatty acids (FA) to the fetus through placental transport; however, there is insufficient evidence regarding regulation of proteins involved in placental transport of FA according to gestational age. The aim of this study was to determine the role of gestational age on the expression of genes involved in FA uptake, trafficking and synthesis in the rat placenta to support fetal demands. Gene expression of encoding proteins for placental transport and synthesis of FA was measured in placenta. Also, FA composition was measured in placenta, fetuses and newborns. mRNA expression of lipoprotein lipase (lpl) and fatp-1 (for uptake) was 4.4- and 1.43-fold higher, respectively, during late gestation than at P14, but expression of p-fabp-pm decreased 0.37-fold at late pregnancy in comparison with P14. Only mRNA fabp-4 member for trafficking of FA was 2.95-fold higher at late gestation than at P14. mRNA of fasn and elovl-6 participating in saturated FA and enzymes for the polyunsaturated FA synthesis were downregulated during late gestation and their regulator srebf-1c increased at P16. This study suggests that gestational age has an effect on expression of some genes involved in uptake, trafficking and synthesis of FA in the rat placenta; mRNA expression of lpl and, fatp-1 for uptake and fabp-4 implicated in trafficking was expressed at high levels at late gestation. In addition, placenta expresses the mRNAs involved in FA synthesis; these genes were expressed at low levels at late gestation. Additionally, mRNAs of Srebf-1c transcriptional regulator of desaturases and elongases was highly expressed during late gestation. Finally, these changes in the rat placenta allowed the placenta to partially supply saturated and monounsaturated FA to the fetus.

  19. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  20. MicroRNA-24 can control triacylglycerol synthesis in goat mammary epithelial cells by targeting the fatty acid synthase gene.

    PubMed

    Wang, H; Luo, J; Chen, Z; Cao, W T; Xu, H F; Gou, D M; Zhu, J J

    2015-12-01

    In nonruminants it has been demonstrated that microRNA-24 (miR-24) is involved in preadipocyte differentiation, hepatic lipid, and plasma triacylglycerol synthesis. However, its role in ruminant mammary gland remains unclear. In this study we measured miR-24 expression in goat mammary gland tissue at 4 different stages of lactation and observed that it had highest expression at peak lactation when compared with the dry period. Overexpression or downregulation of miR-24 in goat mammary epithelial cells (GMEC) strongly affected fatty acid profiles; in particular, miR-24 enhanced unsaturated fatty acid concentration. Additional effects of miR-24 included changes in triacylglycerol content and the expression of fatty acid synthase, sterol regulatory element binding transcription protein 1, stearoyl-CoA desaturase, glycerol-3-phosphate acyltransferase mitochondrial, and acetyl-CoA carboxylase. Luciferase reporter assay confirmed that fatty acid synthase is a target of miR-24. Taken together, these results not only highlight the physiological importance of miR-24 in fatty acid metabolism in GMEC, but also laid the foundation for further research on regulatory mechanisms among miR-24 and other microRNA expressed in GMEC. PMID:26476938

  1. Transgenesis of humanized fat1 promotes n-3 polyunsaturated fatty acid synthesis and expression of genes involved in lipid metabolism in goat cells.

    PubMed

    Fan, Yixuan; Ren, Caifang; Wang, Zhibo; Jia, Ruoxin; Wang, Dan; Zhang, Yanli; Zhang, Guomin; Wan, Yongjie; Huang, Mingrui; Wang, Feng

    2016-01-15

    The n-3 fatty acid desaturase gene fat1 codes for the n-3 desaturase enzyme, which can convert n-6 polyunsaturated fatty acids (PUFAs) to n-3 PUFAs. The n-3 PUFAs are essential components required for normal cellular function and have preventive and therapeutic effects on many diseases. Goat is an important domestic animal for human consumption of meat and milk. To elevate the concentrations of n-3 PUFAs and examine the regulatory mechanism of fat1 in PUFA metabolism in goat cells, we successfully constructed a humanized fat1 expression vector and confirmed the efficient expression of fat1 in goat ear skin-derived fibroblast cells (GEFCs) by qRT-PCR and Western blot analysis. Fatty acid analysis showed that fat1 overexpression significantly increased the levels of total n-3 PUFAs and decreased the levels of total n-6 PUFAs in GEFCs. In addition, qRT-PCR results indicate that the FADS1 and FADS2 desaturase genes, ELOV2 and ELOV5 elongase genes, ACO and CPT1 oxidation genes, and PPARa and PPARγ transcription factors are up-regulated, and transcription factors of SREBP-1c gene are down-regulated in the fat1 transgenic goat cells. Overall, fat1-overexpression resulted in an increase in the n-3 fatty acids and altered expression of PUFA synthesis related genes in GEFCs. This work lays a foundation for both the production of fat1 transgenic goats and further study of the mechanism of fat1 function in the PUFAs metabolism. PMID:26474750

  2. Transgenesis of humanized fat1 promotes n-3 polyunsaturated fatty acid synthesis and expression of genes involved in lipid metabolism in goat cells.

    PubMed

    Fan, Yixuan; Ren, Caifang; Wang, Zhibo; Jia, Ruoxin; Wang, Dan; Zhang, Yanli; Zhang, Guomin; Wan, Yongjie; Huang, Mingrui; Wang, Feng

    2016-01-15

    The n-3 fatty acid desaturase gene fat1 codes for the n-3 desaturase enzyme, which can convert n-6 polyunsaturated fatty acids (PUFAs) to n-3 PUFAs. The n-3 PUFAs are essential components required for normal cellular function and have preventive and therapeutic effects on many diseases. Goat is an important domestic animal for human consumption of meat and milk. To elevate the concentrations of n-3 PUFAs and examine the regulatory mechanism of fat1 in PUFA metabolism in goat cells, we successfully constructed a humanized fat1 expression vector and confirmed the efficient expression of fat1 in goat ear skin-derived fibroblast cells (GEFCs) by qRT-PCR and Western blot analysis. Fatty acid analysis showed that fat1 overexpression significantly increased the levels of total n-3 PUFAs and decreased the levels of total n-6 PUFAs in GEFCs. In addition, qRT-PCR results indicate that the FADS1 and FADS2 desaturase genes, ELOV2 and ELOV5 elongase genes, ACO and CPT1 oxidation genes, and PPARa and PPARγ transcription factors are up-regulated, and transcription factors of SREBP-1c gene are down-regulated in the fat1 transgenic goat cells. Overall, fat1-overexpression resulted in an increase in the n-3 fatty acids and altered expression of PUFA synthesis related genes in GEFCs. This work lays a foundation for both the production of fat1 transgenic goats and further study of the mechanism of fat1 function in the PUFAs metabolism.

  3. Elevated dairy fat intake in lactating women alters milk lipid and fatty acids without detectible changes in expression of genes related to lipid uptake or synthesis.

    PubMed

    Yahvah, Katherine M; Brooker, Sarah L; Williams, Janet E; Settles, Matthew; McGuire, Mark A; McGuire, Michelle K

    2015-03-01

    Previous work has demonstrated that elevated maternal lipid intake (particularly from dairy products) is associated with increased lipids and altered fatty acid profile in milk produced by healthy lactating women. To investigate our primary hypothesis that a maternal diet rich in full-fat dairy products would simultaneously increase milk lipid percent and expression of genes related to the uptake and/or de novo biosynthesis of milk lipids, we provided 15 lactating women with diets enriched in full-fat or nonfat dairy products for 14 days each in a randomized, crossover study with a 2-week washout period. Milk fat (%) was lower when women consumed the low-fat compared with the full-fat dairy diet (2.41% ± 0.31% vs 3.35% ± 0.28%, respectively; P < .05); concentrations of more than 20 fatty acids also differed. However, neither conservatively evaluated microarray data nor quantitative real-time polymerase chain reaction analysis uncovered any treatment effects on expression of genes related to lipid synthesis or uptake. These data suggest that alteration in gene expression in the lactating human mammary gland is likely not the primary mechanism by which consumption of a high-fat diet affects milk fat percent in healthy, lactating women.

  4. Improved ethyl caproate production of Chinese liquor yeast by overexpressing fatty acid synthesis genes with OPI1 deletion.

    PubMed

    Chen, Yefu; Luo, Weiwei; Gong, Rui; Xue, Xingxiang; Guan, Xiangyu; Song, Lulu; Guo, Xuewu; Xiao, Dongguang

    2016-09-01

    During yeast fermentation, ethyl esters play a key role in the development of the flavor profiles of Chinese liquor. Ethyl caproate, an ethyl ester eliciting apple-like flavor, is the characteristic flavor of strong aromatic liquor, which is the best selling liquor in China. In the traditional fermentation process, ethyl caproate is mainly produced at the later fermentation stage by aroma-producing yeast, bacteria, and mold in a mud pit instead of Saccharomyces cerevisiae at the expense of grains and fermentation time. To improve the production of ethyl caproate by Chinese liquor yeast (S. cerevisiae) with less food consumption and shorter fermentation time, we constructed three recombinant strains, namely, α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 by overexpressing acetyl-CoA carboxylase (ACC1), fatty acid synthase 1 (FAS1), and fatty acid synthase 2 (FAS2) with OPI1 (an inositol/choline-mediated negative regulatory gene) deletion, respectively. In the liquid fermentation of corn hydrolysate, the contents of ethyl caproate produced by α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 increased by 0.40-, 1.75-, and 0.31-fold, correspondingly, compared with the initial strain α5. The contents of other fatty acid ethyl esters (FAEEs) (C8:0, C10:0, C12:0) also increased. In comparison, the content of FAEEs produced by α5-FAS1ΔOPI1 significantly improved. Meanwhile, the contents of acetyl-CoA and ethyl acetate were enhanced by α5-FAS1ΔOPI1. Overall, this study offers a promising platform for the development of pure yeast culture fermentation of Chinese strong aromatic liquor without the use of a mud pit. PMID:27344573

  5. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  6. Double transgenesis of humanized fat1 and fat2 genes promotes omega-3 polyunsaturated fatty acids synthesis in a zebrafish model.

    PubMed

    Pang, Shao-Chen; Wang, Hou-Peng; Li, Kuo-Yu; Zhu, Zuo-Yan; Kang, Jing X; Sun, Yong-Hua

    2014-10-01

    Omega-3 long-chain polyunsaturated fatty acid (n-3 LC-PUFA), especially eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), are essential nutrients for human health. However, vertebrates, including humans, have lost the abilities to synthesize EPA and DHA de novo, majorly due to the genetic absence of delta-12 desaturase and omega-3 desaturase genes. Fishes, especially those naturally growing marine fish, are major dietary source of EPA and DHA. Because of the severe decline of marine fishery and the decrease in n-3 LC-PUFA content of farmed fishes, it is highly necessary to develop alternative sources of n-3 LC-PUFA. In the present study, we utilized transgenic technology to generate n-3 LC-PUFA-rich fish by using zebrafish as an animal model. Firstly, fat1 was proved to function efficiently in fish culture cells, which showed an effective conversion of n-6 PUFA to n-3 PUFA with the n-6/n-3 ratio that decreased from 7.7 to 1.1. Secondly, expression of fat1 in transgenic zebrafish increased the 20:5n-3 and 22:6n-3 contents to 1.8- and 2.4-fold, respectively. Third, co-expression of fat2, a fish codon-optimized delta-12 desaturase gene, and fat1 in fish culture cell significantly promoted n-3 PUFA synthesis with the decreased n-6/n-3 ratio from 7.7 to 0.7. Finally, co-expression of fat1 and fat2 in double transgenic zebrafish increased the 20:5n-3 and 22:6n-3 contents to 1.7- and 2.8-fold, respectively. Overall, we generated two types of transgenic zebrafish rich in endogenous n-3 LC-PUFA, fat1 transgenic zebrafish and fat1/fat2 double transgenic zebrafish. Our results demonstrate that application of transgenic technology of humanized fat1 and fat2 in farmed fishes can largely improve the n-3 LC-PUFA production.

  7. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  8. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  9. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  10. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  11. Synthesis of Lipoteichoic Acids in Bacillus anthracis

    PubMed Central

    Garufi, Gabriella; Hendrickx, Antoni P.; Beeri, Karen; Kern, Justin W.; Sharma, Anshika; Richter, Stefan G.; Schneewind, Olaf

    2012-01-01

    Lipoteichoic acid (LTA), a glycerol phosphate polymer, is a component of the envelope of Gram-positive bacteria that has hitherto not been identified in Bacillus anthracis, the causative agent of anthrax. LTA synthesis in Staphylococcus aureus and other microbes is catalyzed by the product of the ltaS gene, a membrane protein that polymerizes polyglycerol phosphate from phosphatidyl glycerol. Here we identified four ltaS homologues, designated ltaS1 to -4, in the genome of Bacillus anthracis. Polyglycerol phosphate-specific monoclonal antibodies were used to detect LTA in the envelope of B. anthracis strain Sterne (pXO1+ pXO2−) vegetative forms. B. anthracis mutants lacking ltaS1, ltaS2, ltaS3, or ltaS4 did not display defects in growth or LTA synthesis. In contrast, B. anthracis strains lacking both ltaS1 and ltaS2 were unable to synthesize LTA and exhibited reduced viability, altered envelope morphology, aberrant separation of vegetative forms, and decreased sporulation efficiency. Expression of ltaS1 or ltaS2 alone in B. anthracis as well as in other microbes was sufficient for polyglycerol phosphate synthesis. Thus, similar to S. aureus, B. anthracis employs LtaS enzymes to synthesize LTA, an envelope component that promotes bacterial growth and cell division. PMID:22685279

  12. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly.

    PubMed

    Bates, Philip D; Johnson, Sean R; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G; Ohlrogge, John B; Browse, John

    2014-01-21

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [(14)C]acetate and [(3)H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [(14)C]acetate and [(14)C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl-CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl-CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid.

  13. Synthesis and Isolation of Chelidonic Acid

    ERIC Educational Resources Information Center

    Gagan, J. M. F.; Herbert, R. B.

    1976-01-01

    Described is an undergraduate laboratory experiment involving synthesis of chelidonic acid and its identification in plants. The experiment is offered as an ancillary topic for biology or chemistry classes. (SL)

  14. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  15. Endosymbiosis in trypanosomatids: the genomic cooperation between bacterium and host in the synthesis of essential amino acids is heavily influenced by multiple horizontal gene transfers

    PubMed Central

    2013-01-01

    Background Trypanosomatids of the genera Angomonas and Strigomonas live in a mutualistic association characterized by extensive metabolic cooperation with obligate endosymbiotic Betaproteobacteria. However, the role played by the symbiont has been more guessed by indirect means than evidenced. Symbiont-harboring trypanosomatids, in contrast to their counterparts lacking symbionts, exhibit lower nutritional requirements and are autotrophic for essential amino acids. To evidence the symbiont’s contributions to this autotrophy, entire genomes of symbionts and trypanosomatids with and without symbionts were sequenced here. Results Analyses of the essential amino acid pathways revealed that most biosynthetic routes are in the symbiont genome. By contrast, the host trypanosomatid genome contains fewer genes, about half of which originated from different bacterial groups, perhaps only one of which (ornithine cyclodeaminase, EC:4.3.1.12) derived from the symbiont. Nutritional, enzymatic, and genomic data were jointly analyzed to construct an integrated view of essential amino acid metabolism in symbiont-harboring trypanosomatids. This comprehensive analysis showed perfect concordance among all these data, and revealed that the symbiont contains genes for enzymes that complete essential biosynthetic routes for the host amino acid production, thus explaining the low requirement for these elements in symbiont-harboring trypanosomatids. Phylogenetic analyses show that the cooperation between symbionts and their hosts is complemented by multiple horizontal gene transfers, from bacterial lineages to trypanosomatids, that occurred several times in the course of their evolution. Transfers occur preferentially in parts of the pathways that are missing from other eukaryotes. Conclusion We have herein uncovered the genetic and evolutionary bases of essential amino acid biosynthesis in several trypanosomatids with and without endosymbionts, explaining and complementing decades of

  16. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  17. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  18. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  19. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  20. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  1. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  2. Hyperosmotic stress induces aquaporin-dependent cell shrinkage, polyphosphate synthesis, amino acid accumulation, and global gene expression changes in Trypanosoma cruzi.

    PubMed

    Li, Zhu-Hong; Alvarez, Vanina E; De Gaudenzi, Javier G; Sant'Anna, Celso; Frasch, Alberto C C; Cazzulo, Juan J; Docampo, Roberto

    2011-12-23

    The protist parasite Trypanosoma cruzi has evolved the ability to transit between completely different hosts and to replicate in adverse environments. In particular, the epimastigote form, the replicative stage inside the vector, is subjected to nutritional and osmotic stresses during its development. In this work, we describe the biochemical and global gene expression changes of epimastigotes under hyperosmotic conditions. Hyperosmotic stress resulted in cell shrinking within a few minutes. Depending on the medium osmolarity, this was followed by lack of volume recovery for at least 2 h or by slow recovery. Experiments with inhibitors, or with cells in which an aquaporin gene (TcAQP1) was knocked down or overexpressed, revealed its importance for the cellular response to hyperosmotic stress. Furthermore, the adaptation to this new environment was shown to involve the regulation of the polyphosphate polymerization state as well as changes in amino acid catabolism to generate compatible osmolytes. A genome-wide transcriptional analysis of stressed parasites revealed down-regulation of genes belonging to diverse functional categories and up-regulation of genes encoding trans-sialidase-like and ribosomal proteins. Several of these changes were confirmed by Northern blot analyses. Sequence analysis of the 3'UTRs of up- and down-regulated genes allowed the identification of conserved structural RNA motifs enriched in each group, suggesting that specific ribonucleoprotein complexes could be of great importance in the adaptation of this parasite to different environments through regulation of transcript abundance. PMID:22039054

  3. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  4. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  5. Fatty acid synthesis: from CO2 to functional genomics.

    PubMed

    Ohlrogge, J; Pollard, M; Bao, X; Focke, M; Girke, T; Ruuska, S; Mekhedov, S; Benning, C

    2000-12-01

    For over 25 years there has been uncertainty over the pathway from CO(2) to acetyl-CoA in chloroplasts. On the one hand, free acetate is the most effective substrate for fatty acid synthesis by isolated chloroplasts, and free acetate concentrations reported in leaf tissue (0.1-1 mM) appear adequate to saturate fatty acid synthase. On the other hand, a clear mechanism to generate sufficient free acetate for fatty acid synthesis is not established and direct production of acetyl-CoA from pyruvate by a plastid pyruvate dehydrogenase seems a more simple and direct path. We have re-examined this question and attempted to distinguish between the alternatives. The kinetics of (13)CO(2) and (14)CO(2) movement into fatty acids and the absolute rate of fatty acid synthesis in leaves was determined in light and dark. Because administered (14)C appears in fatty acids within < 2-3 min our results are inconsistent with a large pool of free acetate as an intermediate in leaf fatty acid synthesis. In addition, these studies provide an estimate of the turnover rate of fatty acid in leaves. Studies similar to the above are more complex in seeds, and some questions about the regulation of plant lipid metabolism seem difficult to solve using conventional biochemical or molecular approaches. For example, we have little understanding of why or how some seeds produce >50% oil whereas other seeds store largely carbohydrate or protein. Major control over complex plant biochemical pathways may only become possible by understanding regulatory networks which provide 'global' control over these pathways. To begin to discover such networks and provide a broad analysis of gene expression in developing oilseeds, we have produced microarrays that display approx. 5000 seed-expressed Arabidopsis genes. Sensitivity of the arrays was 1-2 copies of mRNA/cell. The arrays have been hybridized with probes derived from seeds, leaves and roots, and analysis of expression ratios between the different tissues

  6. Mutations in the Arabidopsis Lst8 and Raptor genes encoding partners of the TOR complex, or inhibition of TOR activity decrease abscisic acid (ABA) synthesis.

    PubMed

    Kravchenko, Alena; Citerne, Sylvie; Jéhanno, Isabelle; Bersimbaev, Rakhmetkazhi I; Veit, Bruce; Meyer, Christian; Leprince, Anne-Sophie

    2015-11-27

    The Target of Rapamycin (TOR) kinase regulates essential processes in plant growth and development by modulation of metabolism and translation in response to environmental signals. In this study, we show that abscisic acid (ABA) metabolism is also regulated by the TOR kinase. Indeed ABA hormone level strongly decreases in Lst8-1 and Raptor3g mutant lines as well as in wild-type (WT) Arabidopsis plants treated with AZD-8055, a TOR inhibitor. However the growth and germination of these lines are more sensitive to exogenous ABA. The diminished ABA hormone accumulation is correlated with lower transcript levels of ZEP, NCED3 and AAO3 biosynthetic enzymes, and higher transcript amount of the CYP707A2 gene encoding a key-enzyme in abscisic acid catabolism. These results suggest that the TOR signaling pathway is implicated in the regulation of ABA accumulation in Arabidopsis.

  7. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  8. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  9. Inhibition of de novo Palmitate Synthesis by Fatty Acid Synthase Induces Apoptosis in Tumor Cells by Remodeling Cell Membranes, Inhibiting Signaling Pathways, and Reprogramming Gene Expression

    PubMed Central

    Ventura, Richard; Mordec, Kasia; Waszczuk, Joanna; Wang, Zhaoti; Lai, Julie; Fridlib, Marina; Buckley, Douglas; Kemble, George; Heuer, Timothy S.

    2015-01-01

    Inhibition of de novo palmitate synthesis via fatty acid synthase (FASN) inhibition provides an unproven approach to cancer therapy with a strong biological rationale. FASN expression increases with tumor progression and associates with chemoresistance, tumor metastasis, and diminished patient survival in numerous tumor types. TVB-3166, an orally-available, reversible, potent, and selective FASN inhibitor induces apoptosis, inhibits anchorage-independent cell growth under lipid-rich conditions, and inhibits in-vivo xenograft tumor growth. Dose-dependent effects are observed between 20–200 nM TVB-3166, which agrees with the IC50 in biochemical FASN and cellular palmitate synthesis assays. Mechanistic studies show that FASN inhibition disrupts lipid raft architecture, inhibits biological pathways such as lipid biosynthesis, PI3K–AKT–mTOR and β-catenin signal transduction, and inhibits expression of oncogenic effectors such as c-Myc; effects that are tumor-cell specific. Our results demonstrate that FASN inhibition has anti-tumor activities in biologically diverse preclinical tumor models and provide mechanistic and pharmacologic evidence that FASN inhibition presents a promising therapeutic strategy for treating a variety of cancers, including those expressing mutant K-Ras, ErbB2, c-Met, and PTEN. The reported findings inform ongoing studies to link mechanisms of action with defined tumor types and advance the discovery of biomarkers supporting development of FASN inhibitors as cancer therapeutics. Research in context Fatty acid synthase (FASN) is a vital enzyme in tumor cell biology; the over-expression of FASN is associated with diminished patient prognosis and resistance to many cancer therapies. Our data demonstrate that selective and potent FASN inhibition with TVB-3166 leads to selective death of tumor cells, without significant effect on normal cells, and inhibits in vivo xenograft tumor growth at well-tolerated doses. Candidate biomarkers for

  10. Internode length in Pisum. Gene na may block gibberellin synthesis between ent-7. cap alpha. -hydroxykaurenoic acid and biggerellin A/sub 12/-aldehyde. [Pisum sativum

    SciTech Connect

    Ingram, T.J.; Reid, J.B.

    1987-04-01

    The elongation response of the gibberellin (GA) deficient genotypes na, ls, and lh of peas (Pisum sativum L.) to a range of GA-precursors was examined. Plants possessing gene na did not respond to precursors in the GA biosynthetic pathway prior to GA/sub 12/-aldehyde. In contrast, plants possessing lh and ls responded as well as wild-type plants (dwarfed with AMO-1618) to these compounds. The results suggest that GA biosynthesis is blocked prior to ent-kaurene in the lh and ls mutants and between ent-7..cap alpha..-hydroxykaurenoic acid and GA/sub 12/-aldehyde in the na mutant. Feeds of ent(/sup 3/H)kaurenoic acid and (/sup 2/H)GA/sub 12/-aldehyde to a range of genotypes supported the above conclusions. The na line WL1766 was shown by gas chromatography-mass spectrometry (GC-MS) to metabolize(/sup 2/H)GA/sub 12/-aldehyde to a number of (/sup 2/H)C/sub 19/-GAs including GA/sub 1/. However, there was no indication in na genotypes for the metabolism of ent-(/sup 3/H)kaurenoic acid to these GAs. In contrast, the expanding shoot tissue of all Na genotypes examined metabolized ent-(/sup 3/H)kaurenoic acid to radioactive compounds that co-chromatographed with GA/sub 1/, GA/sub 8/, GA/sub 20/, and GA/sub 29/. However, insufficient material was present for unequivocal identification of the metabolites. The radioactive profiles from HPLC of extracts of the node treated with ent-(/sup 3/H)kaurenoic acid were similar for both Na and na plants and contained ent-16..cap alpha..,17-dihydroxykaurenoic acid and ent-6..cap alpha..,7..cap alpha..,16..beta..,17-tetrahydroxykaurenoic acid (both characterized by GC-MS), suggesting that the metabolites arose from side branches of the main GA-biosynthetic pathway. Thus, both Na and na plants appear capable of ent-7..cap alpha..-hydroxylation.

  11. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  12. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  13. Crown gall oncogenesis: evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes synthesis of indoleacetic acid.

    PubMed Central

    Thomashow, L S; Reeves, S; Thomashow, M F

    1984-01-01

    Stable incorporation of tumor-inducing (Ti) plasmid sequences, the T-DNA, into the genomes of dicotyledonous plants results in the formation of crown gall tumors. Previous genetic studies have suggested that the products of the genes encoding transcripts 1 and 2, which are encoded by the TL-DNA region of pTiA6, are responsible for inducing the auxin-independent phenotype of crown gall tissues. Here we report the construction of a plasmid, pMTlacT2, which directs the synthesis of the Mr 49,800 polypeptide encoded by the transcript 2 gene. Cell-free extracts prepared from Escherichia coli harboring this plasmid converted indoleacetamide to indoleacetic acid, the natural auxin of plants; extracts prepared from plasmidless strains of E. coli or strains harboring the cloning vehicle pBR322 did not carry out this reaction. We conclude that the transcript 2 gene of pTiA6 codes for an enzyme that participates in auxin biosynthesis, probably an indoleacetamide hydrolase. Images PMID:6089175

  14. Gene Deletion by Synthesis in Yeast.

    PubMed

    Kim, Jinsil; Kim, Dong-Uk; Hoe, Kwang-Lae

    2017-01-01

    Targeted gene deletion is a useful tool for understanding the function of a gene and its protein product. We have developed an efficient and robust gene deletion approach in yeast that employs oligonucleotide-based gene synthesis. This approach requires a deletion cassette composed of three modules: a central 1397-bp KanMX4 selection marker module and two 366-bp gene-specific flanking modules. The invariable KanMX4 module can be used in combination with different pairs of flanking modules targeting different genes. The two flanking modules consist of both sequences unique to each cassette (chromosomal homologous regions and barcodes) and those common to all deletion constructs (artificial linkers and restriction enzyme sites). Oligonucleotides for each module and junction regions are designed using the BatchBlock2Oligo program and are synthesized on a 96-well basis. The oligonucleotides are ligated into a single deletion cassette by ligase chain reaction, which is then amplified through two rounds of nested PCR to obtain sufficient quantities for yeast transformation. After removal of the artificial linkers, the deletion cassettes are transformed into wild-type diploid fission yeast SP286 cells. Verification of correct clone and gene deletion is achieved by performing check PCR and tetrad analysis. This method with proven effectiveness, as evidenced by a high success rate of gene deletion, can be potentially applicable to create systematic gene deletion libraries in a variety of yeast species. PMID:27671940

  15. A simple, universal, efficient PCR-based gene synthesis method: sequential OE-PCR gene synthesis.

    PubMed

    Zhang, Pingping; Ding, Yingying; Liao, Wenting; Chen, Qiuli; Zhang, Huaqun; Qi, Peipei; He, Ting; Wang, Jinhong; Deng, Songhua; Pan, Tianyue; Ren, Hao; Pan, Wei

    2013-07-25

    Herein we present a simple, universal, efficient gene synthesis method based on sequential overlap extension polymerase chain reactions (OE-PCRs). This method involves four key steps: (i) the design of paired complementary 54-mer oligonucleotides with 18 bp overlaps, (ii) the utilisation of sequential OE-PCR to synthesise full-length genes, (iii) the cloning and sequencing of four positive T-clones of the synthesised genes and (iv) the resynthesis of target genes by OE-PCR with correct templates. Mispriming and secondary structure were found to be the principal obstacles preventing successful gene synthesis and were easily identified and solved in this method. Compensating for the disadvantages of being laborious and time-consuming, this method has many attractive advantages, such as the ability to guarantee successful gene synthesis in most cases and good allowance for Taq polymerase, oligonucleotides, PCR conditions and a high error rate. Thus, this method provides an alternative tool for individual gene synthesis without strict needs of the high-specialised experience. PMID:23597923

  16. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  17. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  18. MAFG is a transcriptional repressor of bile acid synthesis and metabolism.

    PubMed

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Ahn, Hannah; Hagey, Lee R; Romanoski, Casey E; Lee, Richard G; Graham, Mark J; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A

    2015-02-01

    Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis, and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG(+/-) mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR.

  19. MAFG Is a Transcriptional Repressor of Bile Acid Synthesis and Metabolism

    PubMed Central

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Ahn, Hannah; Hagey, Lee R.; Romanoski, Casey E.; Lee, Richard G.; Graham, Mark J.; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A.

    2015-01-01

    Summary Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway, and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG+/− mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-Seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR. PMID:25651182

  20. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  1. Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins

    NASA Astrophysics Data System (ADS)

    Tang, Nicholas C.; Chilkoti, Ashutosh

    2016-04-01

    Most genes are synthesized using seamless assembly methods that rely on the polymerase chain reaction (PCR). However, PCR of genes encoding repetitive proteins either fails or generates nonspecific products. Motivated by the need to efficiently generate new protein polymers through high-throughput gene synthesis, here we report a codon-scrambling algorithm that enables the PCR-based gene synthesis of repetitive proteins by exploiting the codon redundancy of amino acids and finding the least-repetitive synonymous gene sequence. We also show that the codon-scrambling problem is analogous to the well-known travelling salesman problem, and obtain an exact solution to it by using De Bruijn graphs and a modern mixed integer linear programme solver. As experimental proof of the utility of this approach, we use it to optimize the synthetic genes for 19 repetitive proteins, and show that the gene fragments are amenable to PCR-based gene assembly and recombinant expression.

  2. Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins.

    PubMed

    Tang, Nicholas C; Chilkoti, Ashutosh

    2016-04-01

    Most genes are synthesized using seamless assembly methods that rely on the polymerase chain reaction (PCR). However, PCR of genes encoding repetitive proteins either fails or generates nonspecific products. Motivated by the need to efficiently generate new protein polymers through high-throughput gene synthesis, here we report a codon-scrambling algorithm that enables the PCR-based gene synthesis of repetitive proteins by exploiting the codon redundancy of amino acids and finding the least-repetitive synonymous gene sequence. We also show that the codon-scrambling problem is analogous to the well-known travelling salesman problem, and obtain an exact solution to it by using De Bruijn graphs and a modern mixed integer linear programme solver. As experimental proof of the utility of this approach, we use it to optimize the synthetic genes for 19 repetitive proteins, and show that the gene fragments are amenable to PCR-based gene assembly and recombinant expression.

  3. Dietary polyunsaturated fatty acid regulation of gene transcription.

    PubMed

    Clarke, S D; Jump, D B

    1994-01-01

    We have known for nearly 30 years that dietary polyenoic (n-6) and (n-3) fatty acids potentially inhibit hepatic fatty acid biosynthesis. The teleological explanation for this unique action of PUFAs resides in their ability to suppress the synthesis of (n-9) fatty acids. By inhibiting fatty acid biosynthesis, dietary PUFAs reduce the availability of substrate for delta 9 desaturase (7, 22, 34, 36) and in turn reduce the availability of (n-9) fatty acids for incorporation into plasma membranes. In this way, essential biological processes dependent on essential fatty acids (e.g. reproduction and trans-dermal water loss) continue to operate normally. Therefore, if essential fatty acid intake did not regulate (n-9) fatty acid synthesis, the survival of the organism would be threatened. During the past 20 years, we have gradually elucidated the cellular and molecular mechanisms by which dietary PUFAs modulate fatty acid biosynthesis and (n-9) fatty acid availability. Central to this mechanism has been our ability to determine that dietary PUFAs regulate the transcription of genes coding for lipogenic enzymes (12, 40). The potential mechanisms by which PUFAs govern gene transcription are numerous, and it is unlikely that any one mechanism can fully elucidate the nuclear actions of PUFA. The difficulty in providing a unifying hypothesis at this time stems from: (a) the many metabolic routes taken by PUFAs upon entering the hepatocyte (Figure 1); and (b) the lack of identity of a specific PUFA-regulated trans-acting factor. However, the studies described above indicate that macronutrients, like PUFA, are not only utilized as fuel and structural components of cells, but also serve as important mediators of gene expression (12, 14, 40). As regulators of gene expression, PUFAs (or metabolites) are thought to affect the activity of transcription factors, which in turn target key cis-linked elements associated with specific genes. Whether this targeting involves DNA

  4. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition.

  5. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  6. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  7. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  8. Cationic liposome–nucleic acid complexes for gene delivery and gene silencing

    PubMed Central

    Ewert, Kai K.; Majzoub, Ramsey N.; Leal, Cecília

    2014-01-01

    Cationic liposomes (CLs) are studied worldwide as carriers of DNA and short interfering RNA (siRNA) for gene delivery and gene silencing, and related clinical trials are ongoing. Optimization of transfection efficiency and silencing efficiency by cationic liposome carriers requires a comprehensive understanding of the structures of CL–nucleic acid complexes and the nature of their interactions with cell membranes as well as events leading to release of active nucleic acids within the cytoplasm. Synchrotron x-ray scattering has revealed that CL–nucleic acid complexes spontaneously assemble into distinct liquid crystalline phases including the lamellar, inverse hexagonal, hexagonal, and gyroid cubic phases, and fluorescence microscopy has revealed CL–DNA pathways and interactions with cells. The combining of custom synthesis with characterization techniques and gene expression and silencing assays has begun to unveil structure–function relations in vitro. As a recent example, this review will briefly describe experiments with surface-functionalized PEGylated CL–DNA nanoparticles. The functionalization, which is achieved through custom synthesis, is intended to address and overcome cell targeting and endosomal escape barriers to nucleic acid delivery faced by PEGylated nanoparticles designed for in vivo applications. PMID:25587216

  9. Effect of rate of weight gain of steers during the stocker phase. IV. Rumen fermentation characteristics and expression of genes involved in substrate utilization for fatty acid synthesis in adipose tissues of growing-finishing beef cattle.

    PubMed

    Lancaster, P A; Sharman, E D; Horn, G W; Krehbiel, C R; Dillwith, J W; Starkey, J D

    2015-06-01

    The objective of this study was to determine the impact of stocker production systems differing in growth rate on rumen fermentation characteristics and utilization of substrates for fatty acid synthesis in intramuscular (IM), subcutaneous (SC), and perirenal (PR) adipose tissues. Angus steers were assigned to 4 stocker cattle production systems in 2 consecutive years: 1) 1.0 kg/d of 40% CP cottonseed meal–based supplement while grazing dormant native range (CON), 2) ground corn/soybean meal–based supplement while grazing dormant native range fed at 1% of BW (CORN), 3) grazing wheat pasture at a high stocking rate to achieve a low rate of BW gain (LGWP), and 4) grazing wheat pasture at a low stocking rate for a high rate of BW gain (HGWP). Eight ruminally cannulated steers were used to determine rumen fermentation characteristics. Steers were harvested during the stocker phase at similar age (different carcass weight) in Exp. 1 (3 steers/treatment) or at similar carcass weight in Exp. 2 (4 steers/treatment). Adipose tissues were analyzed for mRNA expression of genes involved in glucose (solute carrier family 2, member 4 [GLUT4], glucose-6-phosphate dehydrogenase [G6PDH], phosphofructokinase, muscle [PFKM], and pyruvate kinase 2, muscle [PK2]), lactate (lactate dehydrogenase B [LDHB]), and acetate (acetyl-CoA synthetase, cytosol [ACSS2]) utilization for fatty acid synthesis. The acetate:propionate ratio was least (P < 0.05) for HGWP steers, intermediate for CORN and LGWP steers, and greatest for CON steers. At similar age, LGWP and HGWP steers tended (F-test; P < 0.15) to have greater (P < 0.10) G6PDH and ACSS2 mRNA expression than CON and CORN steers in SC and PR but not IM adipose tissue. Expression of PFKM and PK2 mRNA tended (F-test; P < 0.15) to be greater (P < 0.10) in HGWP than CON and LGWP steers in IM but not SC or PR adipose tissue. At similar HCW, expression of GLUT4 and G6PDH mRNA were greater (P < 0.10) in SC adipose tissue of LGWP and HGWP steers

  10. Effect of rate of weight gain of steers during the stocker phase. IV. Rumen fermentation characteristics and expression of genes involved in substrate utilization for fatty acid synthesis in adipose tissues of growing-finishing beef cattle.

    PubMed

    Lancaster, P A; Sharman, E D; Horn, G W; Krehbiel, C R; Dillwith, J W; Starkey, J D

    2015-06-01

    The objective of this study was to determine the impact of stocker production systems differing in growth rate on rumen fermentation characteristics and utilization of substrates for fatty acid synthesis in intramuscular (IM), subcutaneous (SC), and perirenal (PR) adipose tissues. Angus steers were assigned to 4 stocker cattle production systems in 2 consecutive years: 1) 1.0 kg/d of 40% CP cottonseed meal–based supplement while grazing dormant native range (CON), 2) ground corn/soybean meal–based supplement while grazing dormant native range fed at 1% of BW (CORN), 3) grazing wheat pasture at a high stocking rate to achieve a low rate of BW gain (LGWP), and 4) grazing wheat pasture at a low stocking rate for a high rate of BW gain (HGWP). Eight ruminally cannulated steers were used to determine rumen fermentation characteristics. Steers were harvested during the stocker phase at similar age (different carcass weight) in Exp. 1 (3 steers/treatment) or at similar carcass weight in Exp. 2 (4 steers/treatment). Adipose tissues were analyzed for mRNA expression of genes involved in glucose (solute carrier family 2, member 4 [GLUT4], glucose-6-phosphate dehydrogenase [G6PDH], phosphofructokinase, muscle [PFKM], and pyruvate kinase 2, muscle [PK2]), lactate (lactate dehydrogenase B [LDHB]), and acetate (acetyl-CoA synthetase, cytosol [ACSS2]) utilization for fatty acid synthesis. The acetate:propionate ratio was least (P < 0.05) for HGWP steers, intermediate for CORN and LGWP steers, and greatest for CON steers. At similar age, LGWP and HGWP steers tended (F-test; P < 0.15) to have greater (P < 0.10) G6PDH and ACSS2 mRNA expression than CON and CORN steers in SC and PR but not IM adipose tissue. Expression of PFKM and PK2 mRNA tended (F-test; P < 0.15) to be greater (P < 0.10) in HGWP than CON and LGWP steers in IM but not SC or PR adipose tissue. At similar HCW, expression of GLUT4 and G6PDH mRNA were greater (P < 0.10) in SC adipose tissue of LGWP and HGWP steers

  11. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  12. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  13. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  14. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  15. Docosahexaenoic Acid (DHA) and Hepatic Gene Transcription1,3

    PubMed Central

    Jump, Donald B.; Botolin, Daniela; Wang, Yun; Xu, Jinghua; Demeure, Olivier; Christian, Barbara

    2008-01-01

    The type and quantity of dietary fat ingested contributes to the onset and progression of chronic diseases, like diabetes and atherosclerosis. The liver plays a central role in whole body lipid metabolism and responds rapidly to changes in dietary fat composition. Polyunsaturated fatty acids (PUFA) play a key role in membrane composition and function, metabolism and the control of gene expression. Certain PUFA, like the n-3 PUFA, enhance hepatic fatty acid oxidation and inhibit fatty acid synthesis and VLDL secretion, in part, by regulating gene expression. Our studies have established that key transcription factors, like PPARα, SREBP-1, ChREBP and MLX, are regulated by n-3 PUFA, which in turn control levels of proteins involved in lipid and carbohydrate metabolism. Of the n-3 PUFA, 22:6,n-3 has recently been established as a key controller of hepatic lipid synthesis. 22:6,n-3 controls the 26S proteasomal degradation of the nuclear form of SREBP-1. SREBP-1 is a major transcription factor that controls the expression of multiple genes involved fatty acid synthesis and desaturation. 22:6,n-3 suppresses nuclear SREBP-1 which, in turn suppresses lipogenesis. This mechanism is achieved, in part, through control of the phosphorylation status of protein kinases. This review will examine both the general features of PUFA-regulated hepatic gene transcription and highlight the unique mechanisms by which 22:6,n-3 impacts gene expression. The outcome of this analysis will reveal that changes in hepatic 22:6,n-3 content has a major impact on hepatic lipid and carbohydrate metabolism. Moreover, the mechanisms involve 22:6,n-3 control of several well-known signaling pathways, such as Akt, Erk1/2, Gsk3β and PKC (novel or atypical). 22:6,n-3 control of these same signaling pathways in non-hepatic tissues may help explain the diverse actions of n-3 PUFA on such complex physiological processes as visual acuity and learning. PMID:18343222

  16. Retinoic acid-mediated gene expression in transgenic reporter zebrafish.

    PubMed

    Perz-Edwards, A; Hardison, N L; Linney, E

    2001-01-01

    Retinoic acid-mediated gene activation is important for normal vertebrate development. The size and nature of retinoic acid make it difficult to identify the precise cellular location of this signaling molecule throughout an embryo. Additionally, retinoic acid (RA) signaling is regulated by a complex combination of receptors, coactivators, and antagonizing proteins. Thus, in order to integrate these signals and identify regions within a whole developing embryo where cells can respond transcriptionally to retinoic acid, we have used a reporter transgenic approach. We have generated several stable lines of transgenic zebrafish which use retinoic acid response elements to drive fluorescent protein expression. In these zebrafish lines, transgene expression is localized to regions of the neural tube, retina, notochord, somites, heart, pronephric ducts, branchial arches, and jaw muscles in embryos and larvae. Transgene expression can be induced in additional regions of the neural tube and retina as well as the immature notochord, hatching gland, enveloping cell layer, and fin by exposing embryos to retinoic acid. Treatment with retinoic acid synthase inhibitors, citral and diethylaminobenzaldehyde (DEAB), during neurulation, greatly reduces transgene expression. DEAB treatment of embryos at gastrulation phenocopies the embryonic effects of vitamin A deprivation or targeted disruption of the RA synthase retinaldehyde dehydrogenase-2 in other vertebrates. Together these data suggest that the reporter expression we see in zebrafish is dependent upon conserved vertebrate pathways of RA synthesis.

  17. Inhibition of plant fatty acid synthesis by nitroimidazoles.

    PubMed Central

    Jones, A V; Harwood, J L; Stratford, M R; Stumpf, P K

    1981-01-01

    1. The effect of the addition of a number of nitroimidazoles was tested on fatty acid synthesis by germinating pea seeds, isolated lettuce chloroplasts and a soluble fraction from pea seeds. 2. All the compounds tested had a marked inhibition on stearate desaturation by lettuce chloroplasts and on the synthesis of very-long-chain fatty acids by pea seeds. 3. In contrast, the effect of the drugs on total fatty acid synthesis from [14C]acetate in chloroplasts was related to the compound's electron reduction potentials. 4. Of the compounds used, only metronidazole had a marked inhibition on palmitate elongation in the systems tested. 5. The mechanism of inhibition of plant fatty acid synthesis by nitroimidazoles is discussed and the possible relevance of these findings to their neurotoxicity is suggested. PMID:7325993

  18. Gene networks driving bovine milk fat synthesis during the lactation cycle

    PubMed Central

    Bionaz, Massimo; Loor, Juan J

    2008-01-01

    Background The molecular events associated with regulation of milk fat synthesis in the bovine mammary gland remain largely unknown. Our objective was to study mammary tissue mRNA expression via quantitative PCR of 45 genes associated with lipid synthesis (triacylglycerol and phospholipids) and secretion from the late pre-partum/non-lactating period through the end of subsequent lactation. mRNA expression was coupled with milk fatty acid (FA) composition and calculated indexes of FA desaturation and de novo synthesis by the mammary gland. Results Marked up-regulation and/or % relative mRNA abundance during lactation were observed for genes associated with mammary FA uptake from blood (LPL, CD36), intracellular FA trafficking (FABP3), long-chain (ACSL1) and short-chain (ACSS2) intracellular FA activation, de novo FA synthesis (ACACA, FASN), desaturation (SCD, FADS1), triacylglycerol synthesis (AGPAT6, GPAM, LPIN1), lipid droplet formation (BTN1A1, XDH), ketone body utilization (BDH1), and transcription regulation (INSIG1, PPARG, PPARGC1A). Change in SREBF1 mRNA expression during lactation, thought to be central for milk fat synthesis regulation, was ≤2-fold in magnitude, while expression of INSIG1, which negatively regulates SREBP activation, was >12-fold and had a parallel pattern of expression to PPARGC1A. Genes involved in phospholipid synthesis had moderate up-regulation in expression and % relative mRNA abundance. The mRNA abundance and up-regulation in expression of ABCG2 during lactation was markedly high, suggesting a biological role of this gene in milk synthesis/secretion. Weak correlations were observed between both milk FA composition and desaturase indexes (i.e., apparent SCD activity) with mRNA expression pattern of genes measured. Conclusion A network of genes participates in coordinating milk fat synthesis and secretion. Results challenge the proposal that SREBF1 is central for milk fat synthesis regulation and highlight a pivotal role for a

  19. Mitochondrial acyl carrier protein is involved in lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Brody, S; Oh, C; Hoja, U; Schweizer, E

    1997-05-19

    The yeast gene, ACP1, encoding the mitochondrial acyl carrier protein, was deleted by gene replacement. The resulting acp1-deficient mutants had only 5-10% of the wild-type lipoic acid content remaining, and exhibited a respiratory-deficient phenotype. Upon meiosis, the lipoate deficiency co-segregated with the acp1 deletion. The role of ACP1 in long-chain fatty acid synthesis was studied in fast and fas2 null mutants completely lacking cytoplasmic fatty acid synthase. When grown on odd-chain (13:0 and 15:0) fatty acids, these cells showed less than 1% of C-16 and C-18 acids in their total lipids. Mitochondrial ACP is therefore suggested to be involved with the biosynthesis of octanoate, a precursor to lipoic acid. PMID:9187370

  20. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  1. Transcriptome analysis and identification of genes associated with omega-3 fatty acid biosynthesis in Perilla frutescens (L.) var. frutescens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Perilla (Perilla frutescens (L.) var frutescens) produces high levels of a-linolenic acid (ALA), an omega-3 fatty acid important to health and development. To uncover key genes involved in fatty acid (FA) and triacylglycerol (TAG) synthesis in perilla, we conducted deep sequencing of cD...

  2. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  3. Tolerance to acetic acid is improved by mutations of the TATA-binding protein gene.

    PubMed

    An, Jieun; Kwon, Hyeji; Kim, Eunjung; Lee, Young Mi; Ko, Hyeok Jin; Park, Hongjae; Choi, In-Geol; Kim, Sooah; Kim, Kyoung Heon; Kim, Wankee; Choi, Wonja

    2015-03-01

    Screening a library of overexpressing mutant alleles of the TATA-binding gene SPT15 yielded two Saccharomyces cerevisiae strains (MRRC 3252 and 3253) with enhanced tolerance to acetic acid. They were also tolerant to propionic acid and hydrogen peroxide. Transcriptome profile analysis identified 58 upregulated genes and 106 downregulated genes in MRRC 3252. Stress- and protein synthesis-related transcription factors were predominantly enriched in the upregulated and downregulated genes respectively. Eight deletion mutants for some of the highly downregulated genes were acetic acid-tolerant. The level of intracellular reactive oxygen species was considerably lessened in MRRC 3252 and 3253 upon exposure to acetic acid. Metabolome profile analysis revealed that intracellular concentrations of 5 and 102 metabolites were increased and decreased, respectively, in MRRC 3252, featuring a large increase of urea and a significant decrease of amino acids. The dur1/2Δmutant, in which the urea degradation gene DUR1/2 is deleted, displayed enhanced tolerance to acetic acid. Enhanced tolerance to acetic acid was also observed on the medium containing a low concentration of amino acids. Taken together, this study identified two SPT15 alleles, nine gene deletions and low concentration of amino acids in the medium that confer enhanced tolerance to acetic acid.

  4. Accurate multiplex gene synthesis from programmable DNA microchips

    NASA Astrophysics Data System (ADS)

    Tian, Jingdong; Gong, Hui; Sheng, Nijing; Zhou, Xiaochuan; Gulari, Erdogan; Gao, Xiaolian; Church, George

    2004-12-01

    Testing the many hypotheses from genomics and systems biology experiments demands accurate and cost-effective gene and genome synthesis. Here we describe a microchip-based technology for multiplex gene synthesis. Pools of thousands of `construction' oligonucleotides and tagged complementary `selection' oligonucleotides are synthesized on photo-programmable microfluidic chips, released, amplified and selected by hybridization to reduce synthesis errors ninefold. A one-step polymerase assembly multiplexing reaction assembles these into multiple genes. This technology enabled us to synthesize all 21 genes that encode the proteins of the Escherichia coli 30S ribosomal subunit, and to optimize their translation efficiency in vitro through alteration of codon bias. This is a significant step towards the synthesis of ribosomes in vitro and should have utility for synthetic biology in general.

  5. Bacterial synthesis of polysialic acid lactosides in recombinant Escherichia coli K-12.

    PubMed

    Richard, Emeline; Buon, Laurine; Drouillard, Sophie; Fort, Sébastien; Priem, Bernard

    2016-07-01

    Bacterial polysialyltransferases (PSTs) are processive enzymes involved in the synthesis of polysialic capsular polysaccharides. They can also synthesize polysialic acid in vitro from disialylated and trisialylated lactoside acceptors, which are the carbohydrate moieties of GD3 and GT3 gangliosides, respectively. Here, we engineered a non-pathogenic Escherichia coli strain that overexpresses recombinant sialyltransferases and sialic acid synthesis genes and can convert an exogenous lactoside into polysialyl lactosides. Several PSTs were assayed for their ability to synthesize polysialyl lactosides in the recombinant strains. Fed-batch cultures produced α-2,8 polysialic acid or alternate α-2,8-2,9 polysialic acid in quantities reaching several grams per liter. Bacterial culture in the presence of propargyl-β-lactoside as the exogenous acceptor led to the production of conjugatable polysaccharides by means of copper-assisted click chemistry. PMID:26927318

  6. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  7. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  8. A gene cluster for amylovoran synthesis in Erwinia amylovora: characterization and relationship to cps genes in Erwinia stewartii.

    PubMed

    Bernhard, F; Coplin, D L; Geider, K

    1993-05-01

    A large ams gene cluster required for production of the acidic extracellular polysaccharide (EPS) amylovoran by the fire blight pathogen Erwinia amylovora was cloned. Tn5 mutagenesis and gene replacement were used to construct chromosomal ams mutants. Five complementation groups, essential for amylovoran synthesis and virulence in E. amylovora, were identified and designated ams A-E. The ams gene cluster is about 7 kb in size and functionally equivalent to the cps gene cluster involved in EPS synthesis by the related pathogen Erwinia stewartii. Mucoidy and virulence were restored to E. stewartii mutants in four cps complementation groups by the cloned E. amylovora ams genes. Conversely, the E. stewartii cps gene cluster was able to complement mutations in E. amylovora ams genes. Correspondence was found between the amsA-E complementation groups and the cpsB-D region, but the arrangement of the genes appears to be different. EPS production and virulence were also restored to E. amylovora amsE and E. stewartii cpsD mutants by clones containing the Rhizobium meliloti exo A gene.

  9. Polymerase chain reaction-mediated gene synthesis: synthesis of a gene coding for isozyme c of horseradish peroxidase.

    PubMed Central

    Jayaraman, K; Fingar, S A; Shah, J; Fyles, J

    1991-01-01

    The synthesis of a gene coding for horseradish peroxidase (HRP, isozyme c; EC 1.11.1.7) is described using a polymerase chain reaction (PCR)-mediated gene synthesis approach developed in our laboratory. In this approach, all the oligonucleotides making up the gene are ligated in a single step by using the two outer oligonucleotides as PCR primers and the crude ligation mixture as the target. The PCR facilitates synthesis and purification of the gene simultaneously. The gene for HRP was synthesized by ligating all 40 oligonucleotides in a single step followed by PCR amplification. The gene was also synthesized from its fragments by using an overlap extension method similar to the procedure as described [Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. (1989) Gene 77, 61-68]. A method for combining different DNA fragments, in-frame, by using the PCR was also developed and used to synthesize the HRP gene from its gene fragments. This method is applicable to the synthesis of even larger genes and to combine any DNA fragments in-frame. After the synthesis, preliminary characterization of the HRP gene was also carried out by the PCR to confirm the arrangement of oligonucleotides in the gene. This was done by carrying out the PCR with several sets of primers along the gene and comparing the product sizes with the expected sizes. The gene and the fragments generated by PCR were cloned in Escherichia coli and the sequence was confirmed by manual and automated DNA sequencing. Images PMID:1851991

  10. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  11. Implementing bacterial acid resistance into cell-free protein synthesis for buffer-free expression and screening of enzymes.

    PubMed

    Kim, Ho-Cheol; Kim, Kwang-Soo; Kang, Taek-Jin; Choi, Jong Hyun; Song, Jae Jun; Choi, Yun Hee; Kim, Byung-Gee; Kim, Dong-Myung

    2015-12-01

    Cell-free protein synthesis utilizes translational machinery isolated from the cells for in vitro expression of template genes. Because it produces proteins without gene cloning and cell cultivation steps, cell-free protein synthesis can be used as a versatile platform for high-throughput expression of enzyme libraries. Furthermore, the open nature of cell-free protein synthesis allows direct integration of enzyme synthesis with subsequent screening steps. However, the presence of high concentration of chemical buffers in the conventional reaction mixture makes it difficult to streamline cell-free protein synthesis with pH-based assay of the synthesized enzymes. In this study, we have implemented an enzyme-assisted bacterial acid resistance mechanism into an Escherichia coli (E.coli) extract-based cell-free protein synthesis system in place of chemical buffers. When deployed in the reaction mixture for cell-free synthesis of enzymes, through proton-consuming conversion of glutamate into γ-aminobutyric acid (GABA), an engineered glutamate decarboxylase (GADβ) was able to maintain the pH of reaction mixture during enzyme synthesis. Because the reaction mixture becomes free of buffering capacity upon the depletion of glutamate, synthesized enzyme could be directly assayed without purification steps. The designed method was successfully applied to the screening of mutant library of sialyltransferase genes to identify mutants with improved enzymatic activity.

  12. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  13. Induction of cellular deoxyribonucleic acid synthesis in butyrate-treated cells by simian virus 40 deoxyribonucleic acid

    SciTech Connect

    Kawasaki, S.; Diamond, L.; Baserga, R.

    1981-11-01

    Sodium butyrate (3mM) inhibited the entry into the S phase of quiescent 3T3 cells stimulated by serum, but had no effect on the accumulation of cellular ribonucleic acid. Simian virus 40 infection or manual microinjection of cloned fragments from the simian virus 40 A gene caused quiescent 3T3 cells to enter the S phase even in the presence of butyrate. NGI cells, a line of 3T3 cells transformed by simian virus 40, grew vigorously in 3 mM butyrate. Homokaryons were formed between G/sub 1/ and S-phase 3T3 cells. Butyrate inhibited the induction of deoxyribonucleic acid synthesis that usually occurs in G/sub 1/ nuclei when G/sub 1/ cells are fused with S-phase cells. However, when G/sub 1/ 3T3 cells were fused with exponentially growing NGI cells, the 3T3 nuclei were induced to enter deoxyribonucleic acid synthesis. In tsAF8 cells, a ribonucleic acid polymerase II mutant that stops in the G/sub 1/ phase of the cell cycle, no temporal sequence was demonstrated between the butyrate block and the temperature-sensitive block. These results confirm previous reports that certain virally coded proteins can induce cell deoxyribonucleic acid synthesis in the absence of cellular functions that are required by serum-stimulated cells. The author's interpretation of these data is that butyrate inhibited cell growth by inhibiting the expression of genes required for the G/sub o/ ..-->.. G/sub 1/ ..-->.. S transition and that the product of the simian virus 40 A gene overrode this inhibition by providing all of the necessary functions for the entry into the S phase.

  14. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  15. Phytochrome activation of two nuclear genes requires cytoplasmic protein synthesis.

    PubMed Central

    Lam, E; Green, P J; Wong, M; Chua, N H

    1989-01-01

    We have investigated the effects of protein synthesis inhibitors on light-induced expression of two plant nuclear genes, Cab and rbcS, in wheat, pea and transgenic tobacco. Light activation of these two genes is very sensitive to cycloheximide, an inhibitor of cytoplasmic protein synthesis but not to chloramphenicol, an inhibitor of organellar protein synthesis. Studies with chimeric gene constructs in transgenic tobacco seedlings show that cycloheximide exerts its effect at the transcriptional level. As a control, we show that the expression of the cauliflower mosaic virus (CaMV) 35S promoter is enhanced by cycloheximide treatment, irrespective of the coding sequence used. Escape-time analyses with green wheat seedlings show that the cycloheximide block for Cab gene expression is after the primary signal transduction step linked to phytochrome photoconversion. Our results suggest that phytochrome activation of Cab and rbcS is mediated by a labile protein factor(s) synthesized on cytoplasmic ribosomes. Images PMID:2583082

  16. Kinetic investigation of erucamide synthesis using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Upadhayay, Santosh K; Singh, R P

    2008-01-01

    Fatty acid amides like erucamide are mainly used for lubrication and as slip agent to decrease friction in polymer and plastic industry. Erucamide is normally synthesized by ammonolysis of triglycerides or fatty acids at 200 degrees C and at high pressure (345-690 kPa.). However using urea in place of ammonia the economic synthesis of erucamide is possible at atmospheric pressure at approx 190 degrees C. In present investigation, the kinetics of synthesis of erucamide by ammonolysis of erucic acid has been investigated. The optimum conditions for the synthesis of erucamide have also been determined. 1:4 molar ratio of erucic acid to urea, 190 degrees C temperature and catalyst [P2O5 with (NH4)2H PO4, {(1:1) w/w }] concentration 3% (by wt. of erucic acid) were the optimum condition for synthesis of erucamide from erucic acid and can obtain a maximum yield of 92% of pure erucamide. Some other catalysts as titanium-iso -propoxide, phosphorus pent oxide were also tried but these catalysts were not economical. PMID:18685229

  17. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  18. Cationic liposome-nucleic acid nanoparticle assemblies with applications in gene delivery and gene silencing.

    PubMed

    Majzoub, Ramsey N; Ewert, Kai K; Safinya, Cyrus R

    2016-07-28

    Cationic liposomes (CLs) are synthetic carriers of nucleic acids in gene delivery and gene silencing therapeutics. The introduction will describe the structures of distinct liquid crystalline phases of CL-nucleic acid complexes, which were revealed in earlier synchrotron small-angle X-ray scattering experiments. When mixed with plasmid DNA, CLs containing lipids with distinct shapes spontaneously undergo topological transitions into self-assembled lamellar, inverse hexagonal, and hexagonal CL-DNA phases. CLs containing cubic phase lipids are observed to readily mix with short interfering RNA (siRNA) molecules creating double gyroid CL-siRNA phases for gene silencing. Custom synthesis of multivalent lipids and a range of novel polyethylene glycol (PEG)-lipids with attached targeting ligands and hydrolysable moieties have led to functionalized equilibrium nanoparticles (NPs) optimized for cell targeting, uptake or endosomal escape. Very recent experiments are described with surface-functionalized PEGylated CL-DNA NPs, including fluorescence microscopy colocalization with members of the Rab family of GTPases, which directly reveal interactions with cell membranes and NP pathways. In vitro optimization of CL-DNA and CL-siRNA NPs with relevant primary cancer cells is expected to impact nucleic acid therapeutics in vivo. This article is part of the themed issue 'Soft interfacial materials: from fundamentals to formulation'. PMID:27298431

  19. Regulation of collagen synthesis by ascorbic acid.

    PubMed Central

    Murad, S; Grove, D; Lindberg, K A; Reynolds, G; Sivarajah, A; Pinnell, S R

    1981-01-01

    After prolonged exposure to ascorbate, collagen synthesis in cultured human skin fibroblasts increased approximately 8-fold with no significant change in synthesis of noncollagen protein. This effect of ascorbate appears to be unrelated to its cofactor function in collagen hydroxylation. The collagenous protein secreted in the absence of added ascorbate was normal in hydroxylysine but was mildly deficient in hydroxyproline. In parallel experiments, lysine hydroxylase (peptidyllysine, 2-oxoglutarate:oxygen 5-oxidoreductase, EC 1.14.11.4) activity increased 3-fold in response to ascorbate administration whereas proline hydroxylase (prolyl-glycyl-peptide, 2-oxoglutarate:oxygen oxidoreductase, EC 1.14.11.2) activity decreased considerably. These results suggest that collage polypeptide synthesis, posttranslational hydroxylations, and activities of the two hydroxylases are independently regulated by ascorbate. PMID:6265920

  20. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  1. Simultaneous synthesis of human-, mouse- and chimeric epidermal growth factor genes via 'hybrid gene synthesis' approach.

    PubMed Central

    Sung, W L; Zahab, D M; Yao, F L; Wu, R; Narang, S A

    1986-01-01

    Simultaneous synthesis of two DNA duplexes encoding human and mouse epidermal growth factors (EGF) was accomplished in a single step. A 174 b.p. DNA heteroduplex, with 16 single and double base pair mismatches, was designed. One strand encoded the human EGF, and the opposite strand indirectly encoded the mouse EGF. The heteroduplex DNA was synthesized by ligation of seven overlapping oligodeoxyribonucleotides with a linearized plasmid. After transformation in E. coli HB101 (recA 13), the resulting heteroduplex plasmid served as the template in plasmid replication. Two different plasmid progenies bearing either the human or mouse EGF-coding sequence were identified by colony hybridization using the appropriate probes. However, in E. coli JM103, the same process yielded plasmid progenies encoding different chimeric EGF molecules, presumably due to crossover of human and mouse EGF gene sequences. Images PMID:3529034

  2. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  3. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  4. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains.

  5. Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

    PubMed

    Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

    2016-01-01

    Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

  6. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  7. Transcription of the Escherichia coli fatty acid synthesis operon fabHDG is directly activated by FadR and inhibited by ppGpp.

    PubMed

    My, Laetitia; Rekoske, Brian; Lemke, Justin J; Viala, Julie P; Gourse, Richard L; Bouveret, Emmanuelle

    2013-08-01

    In Escherichia coli, FadR and FabR are transcriptional regulators that control the expression of fatty acid degradation and unsaturated fatty acid synthesis genes, depending on the availability of fatty acids. In this report, we focus on the dual transcriptional regulator FadR. In the absence of fatty acids, FadR represses the transcription of fad genes required for fatty acid degradation. However, FadR is also an activator, stimulating transcription of the products of the fabA and fabB genes responsible for unsaturated fatty acid synthesis. In this study, we show that FadR directly activates another fatty acid synthesis promoter, PfabH, which transcribes the fabHDG operon, indicating that FadR is a global regulator of both fatty acid degradation and fatty acid synthesis. We also demonstrate that ppGpp and its cofactor DksA, known primarily for their role in regulation of the synthesis of the translational machinery, directly inhibit transcription from the fabH promoter. ppGpp also inhibits the fadR promoter, thereby reducing transcription activation of fabH by FadR indirectly. Our study shows that both ppGpp and FadR have direct roles in the control of fatty acid promoters, linking expression in response to both translation activity and fatty acid availability.

  8. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  9. Synthesis of sulfonate analogs of bile acids.

    PubMed

    Kihira, K; Mikami, T; Ikawa, S; Okamoto, A; Yoshii, M; Miki, S; Mosbach, E H; Hoshita, T

    1992-04-01

    Sulfonate analogs of C23 and C24 bile acids were synthesized from norcholic, norchenodeoxycholic, norursodeoxycholic, nordeoxycholic, norhyodeoxycholic, cholic, deoxycholic, hyodeoxycholic, and lithocholic acids. The principal reactions used were (1) reduction of the bile acids with NaBH4 to the corresponding bile alcohols, (2) selective tosylation of the terminal hydroxyl group, (3) iodination of the tosyl esters with NaI, and (4) treatment of the iodides with Na2SO3 to form the sulfonate analogs of the bile acids. The sulfonate analogs showed polarity similar to that of taurine-conjugated bile acids on thin-layer chromatography. The carbon 13 nuclear magnetic resonance spectral data for the sulfonate analogs were tabulated.

  10. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  11. Genetic analysis of chromosomal mutations in the polysialic acid gene cluster of Escherichia coli K1.

    PubMed Central

    Vimr, E R; Aaronson, W; Silver, R P

    1989-01-01

    The kps gene cluster of Escherichia coli K1 encodes functions for sialic acid synthesis, activation, polymerization, and possibly translocation of polymer to the cell surface. The size and complexity of this membrane polysaccharide biosynthetic cluster have hindered genetic mapping and functional descriptions of the kps genes. To begin a detailed investigation of the polysialic acid synthetic mechanism, acapsular mutants were characterized to determine their probable defects in polymer synthesis. The mutants were tested for complementation with kps fragments subcloned from two separately isolated, functionally intact kps gene clusters. Complementation was assayed by immunological and biochemical methods and by sensitivity to the K1-specific bacteriophage K1F. The kps cluster consisted of a central 5.8-kilobase region that contained at least two genes coding for sialic acid synthetic enzymes, a gene encoding the sialic acid-activating enzyme, and a gene encoding the sialic acid polymerase. This biosynthetic region is flanked on one side by an approximately 2.8-kilobase region that contains a potential regulatory locus and at least one structural gene for a polypeptide that appears to function in polysialic acid assembly. Flanking the biosynthetic region on the opposite side is a 6- to 8.4-kilobase region that codes for at least three proteins which may also function in polymer assembly and possibly in translocating polymer to the outer cell surface. Results of transduction crosses supported these conclusions and indicated that some of the kps genes flanking the central biosynthetic region may not function directly in transporting polymer to the cell surface. The results also demonstrate that the map position and probable function of most of the kps cluster genes have been identified. Images PMID:2644224

  12. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  13. Downregulation of de Novo Fatty Acid Synthesis in Subcutaneous Adipose Tissue of Moderately Obese Women

    PubMed Central

    Guiu-Jurado, Esther; Auguet, Teresa; Berlanga, Alba; Aragonès, Gemma; Aguilar, Carmen; Sabench, Fàtima; Armengol, Sandra; Porras, José Antonio; Martí, Andreu; Jorba, Rosa; Hernández, Mercè; del Castillo, Daniel; Richart, Cristóbal

    2015-01-01

    The purpose of this work was to evaluate the expression of fatty acid metabolism-related genes in human adipose tissue from moderately obese women. We used qRT-PCR and Western Blot to analyze visceral (VAT) and subcutaneous (SAT) adipose tissue mRNA expression involved in de novo fatty acid synthesis (ACC1, FAS), fatty acid oxidation (PPARα, PPARδ) and inflammation (IL6, TNFα), in normal weight control women (BMI < 25 kg/m2, n = 35) and moderately obese women (BMI 30–38 kg/m2, n = 55). In SAT, ACC1, FAS and PPARα mRNA expression were significantly decreased in moderately obese women compared to controls. The downregulation reported in SAT was more pronounced when BMI increased. In VAT, lipogenic-related genes and PPARα were similar in both groups. Only PPARδ gene expression was significantly increased in moderately obese women. As far as inflammation is concerned, TNFα and IL6 were significantly increased in moderate obesity in both tissues. Our results indicate that there is a progressive downregulation in lipogenesis in SAT as BMI increases, which suggests that SAT decreases the synthesis of fatty acid de novo during the development of obesity, whereas in VAT lipogenesis remains active regardless of the degree of obesity. PMID:26694359

  14. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  15. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  16. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  17. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  18. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  19. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  20. MicroRNA-26a/b and their host genes synergistically regulate triacylglycerol synthesis by targeting the INSIG1 gene.

    PubMed

    Wang, Hui; Luo, Jun; Zhang, Tianying; Tian, Huibin; Ma, Yue; Xu, Huifen; Yao, Dawei; Loor, Juan J

    2016-05-01

    The microRNA-26 (miR-26) family is known to control adipogenesis in non-ruminants. The genomic loci of miR-26a and miR-26b have been localized in the introns of genes encoding for the proteins of the C-terminal domain RNA polymerase II polypeptide A small phosphatase (CTDSP) family. Insulin-induced gene 1 (INSIG1) encodes a protein with a key role in the regulation of lipogenesis in rodent liver. In the present study, we investigated the synergistic function of the miR-26 family and their host genes in goat mammary epithelial cells (GMEC). Downregulation of miR-26a/b and their host genes in GMEC decreased the expression of genes relate to fatty acid synthesis (PPARG, LXRA, SREBF1, FASN, ACACA, GPAM, LPIN1, DGAT1 and SCD1), triacylglycerol accumulation and unsaturated fatty acid synthesis. Luciferase reporter assays confirmed INSIG1 as a direct target of miR-26a/b. Furthermore, inhibition of the CTDSP family also downregulated the expression of INSIG1. Taken together, our findings highlight a functional association of miR-26a/b, their host genes and INSIG1, and provide new insights into the regulatory network controlling milk fat synthesis in GMEC. The data indicate that targeting this network via nutrition might be important for regulating milk fat synthesis in ruminants. PMID:27002347

  1. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  2. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  3. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats.

  4. Fatty Acid Phytyl Ester Synthesis in Chloroplasts of Arabidopsis[W

    PubMed Central

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-01-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. PMID:22623494

  5. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  6. Novel synthesis of steryl esters from phytosterols and amino Acid.

    PubMed

    Pang, Min; Jiang, Shaotong; Cao, Lili; Pan, Lijun

    2011-10-12

    The feasibility of esterification of phytosterol with the amino acid l-glutamic acid was established. The influence of various organic solvents was investigated, and n-butanol was selected as an ideal solvent for phytosteryl esters synthesis with l-glutamic acid. The reaction conditions were further optimized by orthogonal experiments, and a 92.3% degree of esterification was obtained when optimum conditions were used. FT-IR spectral, GC-MS, and NMR analyses were adopted to determine the steryl esters of l-glutamic acid. The FT-IR spectrum indicated the presence of ester bonds in the phytosteryl esters with l-glutamic acid, and on the basis of the detailed mass spectrography analysis, GC-MS and NMR offered an efficient and reliable way to confirm the steryl esters. This novel synthesis approach of phytosteryl esters with amino acid supplied a promising alternative to the substrate on esterification of phytosterols and thus can be readily applied to further studies of functional food ingredients of phytosteryl esters.

  7. Association of an ACSL1 gene variant with polyunsaturated fatty acids in bovine skeletal muscle

    PubMed Central

    2011-01-01

    Background The intramuscular fat deposition and the fatty acid profiles of beef affect meat quality. High proportions of unsaturated fatty acids are related to beef flavor and are beneficial for the nutritional value of meat. Moreover, a variety of clinical and epidemiologic studies showed that particularly long-chain omega-3 fatty acids from animal sources have a positive impact on human health and disease. Results To screen for genetic factors affecting fatty acid profiles in beef, we initially performed a microsatellite-based genome scan in a F2 Charolais × German Holstein resource population and identified a quantitative trait locus (QTL) for fatty acid composition in a region on bovine chromosome 27 where previously QTL affecting marbling score had been detected in beef cattle populations. The long-chain acyl-CoA synthetase 1 (ACSL1) gene was identified as the most plausible functional and positional candidate gene in the QTL interval due to its direct impact on fatty acid metabolism and its position in the QTL interval. ACSL1 is necessary for synthesis of long-chain acyl-CoA esters, fatty acid degradation and phospholipid remodeling. We validated the genomic annotation of the bovine ACSL1 gene by in silico comparative sequence analysis and experimental verification. Re-sequencing of the complete coding, exon-flanking intronic sequences, 3' untranslated region (3'UTR) and partial promoter region of the ACSL1 gene revealed three synonymous mutations in exons 6, 7, and 20, six noncoding intronic gene variants, six polymorphisms in the promoter region, and four variants in the 3' UTR region. The association analysis identified the gene variant in intron 5 of the ACSL1 gene (c.481-233A>G) to be significantly associated with the relative content of distinct fractions and ratios of fatty acids (e.g., n-3 fatty acids, polyunsaturated, n-3 long-chain polyunsaturated fatty acids, trans vaccenic acid) in skeletal muscle. A tentative association of the ACSL1 gene

  8. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  9. Acyl-CoA sensing by FasR to adjust fatty acid synthesis in Corynebacterium glutamicum.

    PubMed

    Irzik, Kristina; van Ooyen, Jan; Gätgens, Jochem; Krumbach, Karin; Bott, Michael; Eggeling, Lothar

    2014-12-20

    Corynebacterium glutamicum, like Mycobacterium tuberculosis, is a member of the Corynebacteriales, which have linear fatty acids and as branched fatty acids the mycolic acids. We identified accD1 and fasA as key genes of fatty acid synthesis, encoding the β-subunit of the acetyl-CoA carboxylase and a type-I fatty acid synthase, respectively, and observed their repression during growth on minimal medium with acetate. We also identified the transcriptional regulator FasR and its binding sites in the 5′ upstream regions of accD1 and fasA. In the present work we establish by co-isolation and gel-mobility shifts oleoyl-CoA and palmitoyl-CoA as effectors of FasR, and show by DNA microarray analysis that in presence of exogeneous fatty acids accD1 and fasA are repressed. These results are evidence that acyl-CoA derivatives derived from extracellular fatty acids interact with FasR to repress the genes of fatty acid synthesis. This model also explains the observed repression of accD1 and fasA during growth on acetate, where apparently the known high intracellular acetyl-CoA concentration during growth on this substrate requires reduced accD1 and fasA expression for fine control of de novo fatty acid synthesis. Consequently, this mechanism ensures that membrane lipid homeostasis is maintained when specific nutrients are available resulting in increased acetyl-CoA concentration, as is the case with acetate, or when fatty acids are directly available from the extracellular environment. However, the genes specific to mycolic acid synthesis, which are in part shared with linear fatty acid synthesis, are not controlled by FasR, which is in agreement with the fact that they can not be supplied from the extracellular environment but that their synthesis fully depends on a constant supply of linear fatty acid chains. PMID:25449109

  10. Molecular genetic and molecular evolutionary studies on the bacteriochlorophyll synthesis genes of Rhodobacter capsulatus

    SciTech Connect

    Burke-Agueero, D.H.

    1992-08-01

    Rhodobacter capsulatus, purple bacterium capable of either aerobic or photosynthetic growth, has proven to be very useful in genetic studies of photosynthesis. Forty-four genes clustered together within a 46 kilobase region are required to establish photosynthetic ability in R. capsulatus. Approximately twenty of these genes are involved in bacteriochlorophyll synthesis of which eight bch'' genes are the subject of this thesis. Six of these genes were found to code for the two ring reductases. The first converts protochlorophyllide (PChlide) into a chlorin, the immediate precursor to chlorophyll a, and then into a bacteriochlorin. Each reductase is shown to be made up of three subunits. PChlide reductase is coded by the genes bchN, bchB, and bchL. Proteins with amino acid sequences markedly similar to those of bchN and bchL have been shown in other organisms to be required for chlorophyll synthesis; hence, their designation as chlN and chlB. A third chloroplast-encoded gene of heretofore unknown function shares amino acid identities with bchB and is probably the third subunit of the plant PChlide reductase. The bchA locus, which encodes the chlorin reductase, is found to be made up of three separate, translationally coupled genes, referred to as bchX, bchY, and bchZ. Amino acid similarities between bchX, bchL, and the nitrogenase reductase protein nifH suggest that all three classes of proteins share certain three-dimensional structural features, including elements that are central to the enzymatic mechanism of nifH. PChlide reductase and chlorin reductase are clearly derived from a common ancestor. Several lines of analysis suggests the ancestor of both enzyme systems reduced PChlide twice to produce bacteriochlorophyll supporting the concept bacteriochlorophyll as the ancestral reaction center pigment.

  11. Molecular genetic and molecular evolutionary studies on the bacteriochlorophyll synthesis genes of Rhodobacter capsulatus

    SciTech Connect

    Burke-Agueero, D.H.

    1992-08-01

    Rhodobacter capsulatus, purple bacterium capable of either aerobic or photosynthetic growth, has proven to be very useful in genetic studies of photosynthesis. Forty-four genes clustered together within a 46 kilobase region are required to establish photosynthetic ability in R. capsulatus. Approximately twenty of these genes are involved in bacteriochlorophyll synthesis of which eight ``bch`` genes are the subject of this thesis. Six of these genes were found to code for the two ring reductases. The first converts protochlorophyllide (PChlide) into a chlorin, the immediate precursor to chlorophyll a, and then into a bacteriochlorin. Each reductase is shown to be made up of three subunits. PChlide reductase is coded by the genes bchN, bchB, and bchL. Proteins with amino acid sequences markedly similar to those of bchN and bchL have been shown in other organisms to be required for chlorophyll synthesis; hence, their designation as chlN and chlB. A third chloroplast-encoded gene of heretofore unknown function shares amino acid identities with bchB and is probably the third subunit of the plant PChlide reductase. The bchA locus, which encodes the chlorin reductase, is found to be made up of three separate, translationally coupled genes, referred to as bchX, bchY, and bchZ. Amino acid similarities between bchX, bchL, and the nitrogenase reductase protein nifH suggest that all three classes of proteins share certain three-dimensional structural features, including elements that are central to the enzymatic mechanism of nifH. PChlide reductase and chlorin reductase are clearly derived from a common ancestor. Several lines of analysis suggests the ancestor of both enzyme systems reduced PChlide twice to produce bacteriochlorophyll supporting the concept bacteriochlorophyll as the ancestral reaction center pigment.

  12. Transcriptome analysis of acetic-acid-treated yeast cells identifies a large set of genes whose overexpression or deletion enhances acetic acid tolerance.

    PubMed

    Lee, Yeji; Nasution, Olviyani; Choi, Eunyong; Choi, In-Geol; Kim, Wankee; Choi, Wonja

    2015-08-01

    Acetic acid inhibits the metabolic activities of Saccharomyces cerevisiae. Therefore, a better understanding of how S. cerevisiae cells acquire the tolerance to acetic acid is of importance to develop robust yeast strains to be used in industry. To do this, we examined the transcriptional changes that occur at 12 h post-exposure to acetic acid, revealing that 56 and 58 genes were upregulated and downregulated, respectively. Functional categorization of them revealed that 22 protein synthesis genes and 14 stress response genes constituted the largest portion of the upregulated and downregulated genes, respectively. To evaluate the association of the regulated genes with acetic acid tolerance, 3 upregulated genes (DBP2, ASC1, and GND1) were selected among 34 non-protein synthesis genes, and 54 viable mutants individually deleted for the downregulated genes were retrieved from the non-essential haploid deletion library. Strains overexpressing ASC1 and GND1 displayed enhanced tolerance to acetic acid, whereas a strain overexpressing DBP2 was sensitive. Fifty of 54 deletion mutants displayed enhanced acetic acid tolerance. Three chosen deletion mutants (hsps82Δ, ato2Δ, and ssa3Δ) were also tolerant to benzoic acid but not propionic and sorbic acids. Moreover, all those five (two overexpressing and three deleted) strains were more efficient in proton efflux and lower in membrane permeability and internal hydrogen peroxide content than controls. Individually or in combination, those physiological changes are likely to contribute at least in part to enhanced acetic acid tolerance. Overall, information of our transcriptional profile was very useful to identify molecular factors associated with acetic acid tolerance.

  13. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  14. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  15. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  16. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  17. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  18. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  19. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  20. Is Acetylcarnitine a Substrate for Fatty Acid Synthesis in Plants?

    PubMed

    Roughan, G.; Post-Beittenmiller, D.; Ohlrogge, J.; Browse, J.

    1993-04-01

    Long-chain fatty acid synthesis from [1-14C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-14C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-14C]-Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-14C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-14C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-14C]acetylcarnitine and 47 to 57% of the [1-14C]acetate taken up was incorporated into lipids. Most (78-82%) of the [1-14C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants.

  1. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  2. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  3. Synthesis of rosin acid starch catalyzed by lipase.

    PubMed

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2:1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch.

  4. Pterandric acid--its isolation, synthesis and stereochemistry.

    PubMed

    Haleem, Muhammad A; Capellari, Simone C; Sympson, Beryl B; Marsaioli, Anita J

    2015-01-01

    Some plant families have a specialized type of pollination system, with floral lipid rewards for pollinators, which is common. In neotropical Malpighiaceae species like Pterandra pyroidea, this specialized type of pollination system is apparently shifting from floral oils/lipids to pollen reward. Mass spectrometric analysis (GC/MS-EI) indicated that P. pyroidea floral oil has a unique chemical composition, i.e., few fatty acid constituents possessing acetoxy groups at positions 5 and 7, which is distinct from the other floral oils of sympatric Malpighiaceae species. The structure of the major floral oil constituent, a novel fatty acid, anti-5,7-diacetoxydocosanoic acid, was confirmed based on synthesis, mass fragmentation, and 1H and 13C NMR analyses; the compound is herein named pterandric acid.

  5. Very long chain fatty acid synthesis in sunflower kernels.

    PubMed

    Salas, Joaquín J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Most common seed oils contain small amounts of very long chain fatty acids (VLCFAs), the main components of oils from species such as Brassica napus or Lunnaria annua. These fatty acids are synthesized from acyl-CoA precursors in the endoplasmic reticulum through the activity of a dissociated enzyme complex known as fatty acid elongase. We studied the synthesis of the arachidic, behenic, and lignoceric VLCFAs in sunflower kernels, in which they account for 1-3% of the saturated fatty acids. These VLCFAs are synthesized from 18:0-CoA by membrane-bound fatty acid elongases, and their biosynthesis is mainly dependent on NADPH equivalents. Two condensing enzymes appear to be responsible for the synthesis of VLCFAs in sunflower kernels, beta-ketoacyl-CoA synthase-I (KCS-I) and beta-ketoacyl-CoA synthase-II (KCS-II). Both of these enzymes were resolved by ion exchange chromatography and display different substrate specificities. While KCS-I displays a preference for 20:0-CoA, 18:0-CoA was more efficiently elongated by KCS-II. Both enzymes have different sensitivities to pH and Triton X-100, and their kinetic properties indicate that both are strongly inhibited by the presence of their substrates. In light of these results, the VLCFA composition of sunflower oil is considered in relation to that in other commercially exploited oils.

  6. Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis.

    PubMed

    Cleary, Michele A; Kilian, Kristopher; Wang, Yanqun; Bradshaw, Jeff; Cavet, Guy; Ge, Wei; Kulkarni, Amit; Paddison, Patrick J; Chang, Kenneth; Sheth, Nihar; Leproust, Eric; Coffey, Ernest M; Burchard, Julja; McCombie, W Richard; Linsley, Peter; Hannon, Gregory J

    2004-12-01

    Generation of complex libraries of defined nucleic acid sequences can greatly aid the functional analysis of protein and gene function. Previously, such studies relied either on individually synthesized oligonucleotides or on cellular nucleic acids as the starting material. As each method has disadvantages, we have developed a rapid and cost-effective alternative for construction of small-fragment DNA libraries of defined sequences. This approach uses in situ microarray DNA synthesis for generation of complex oligonucleotide populations. These populations can be recovered and either used directly or immortalized by cloning. From a single microarray, a library containing thousands of unique sequences can be generated. As an example of the potential applications of this technology, we have tested the approach for the production of plasmids encoding short hairpin RNAs (shRNAs) targeting numerous human and mouse genes. We achieved high-fidelity clone retrieval with a uniform representation of intended library sequences. PMID:15782200

  7. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  8. Metabolic switch during adipogenesis: From branched chain amino acid catabolism to lipid synthesis.

    PubMed

    Halama, Anna; Horsch, Marion; Kastenmüller, Gabriele; Möller, Gabriele; Kumar, Pankaj; Prehn, Cornelia; Laumen, Helmut; Hauner, Hans; Hrabĕ de Angelis, Martin; Beckers, Johannes; Suhre, Karsten; Adamski, Jerzy

    2016-01-01

    Fat cell metabolism has an impact on body homeostasis and its proper function. Nevertheless, the knowledge about simultaneous metabolic processes, which occur during adipogenesis and in mature adipocytes, is limited. Identification of key metabolic events associated with fat cell metabolism could be beneficial in the field of novel drug development, drug repurposing, as well as for the discovery of patterns predicting obesity risk. The main objective of our work was to provide comprehensive characterization of metabolic processes occurring during adipogenesis and in mature adipocytes. In order to globally determine crucial metabolic pathways involved in fat cell metabolism, metabolomics and transcriptomics approaches were applied. We observed significantly regulated metabolites correlating with significantly regulated genes at different stages of adipogenesis. We identified the synthesis of phosphatidylcholines, the metabolism of even and odd chain fatty acids, as well as the catabolism of branched chain amino acids (BCAA; leucine, isoleucine and valine) as key regulated pathways. Our further analysis led to identification of an enzymatic switch comprising the enzymes Hmgcs2 (3-hydroxy-3-methylglutaryl-CoA synthase) and Auh (AU RNA binding protein/enoyl-CoA hydratase) which connects leucine degradation with cholesterol synthesis. In addition, propionyl-CoA, a product of isoleucine degradation, was identified as a putative substrate for odd chain fatty acid synthesis. The uncovered crosstalks between BCAA and lipid metabolism during adipogenesis might contribute to the understanding of molecular mechanisms of obesity and have potential implications in obesity prediction. PMID:26408941

  9. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  10. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  11. Identification of genes and gene clusters involved in mycotoxin synthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Research methods to identify and characterize genes involved in mycotoxin biosynthetic pathways have evolved considerably over the years. Before whole genome sequences were available (e.g. pre-genomics), work focused primarily on chemistry, biosynthetic mutant strains and molecular analysis of sing...

  12. A microfluidic DNA computing processor for gene expression analysis and gene drug synthesis.

    PubMed

    Zhang, Yu; Yu, Hao; Qin, Jianhua; Lin, Bingcheng

    2009-11-06

    Boolean logic performs a logical operation on one or more logic input and produces a single logic output. Here, we describe a microfluidic DNA computing processor performing Boolean logic operations for gene expression analysis and gene drug synthesis. Multiple cancer-related genes were used as input molecules. Their expression levels were identified by interacting with the computing related DNA strands, which were designed according to the sequences of cancer-related genes and the suicide gene. When all the expressions of the cancer-related genes fit in with the diagnostic criteria, positive diagnosis would be confirmed and then a complete suicide gene (gene drug) could be synthesized as an output molecule. Microfluidic chip was employed as an effective platform to realize the computing process by integrating multistep biochemical reactions involving hybridization, displacement, denaturalization, and ligation. By combining the specific design of the computing related molecules and the integrated functions of the microfluidics, the microfluidic DNA computing processor is able to analyze the multiple gene expressions simultaneously and realize the corresponding gene drug synthesis with simplicity and fast speed, which demonstrates the potential of this platform for DNA computing in biomedical applications.

  13. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  14. An Arabidopsis Gene Regulatory Network for Secondary Cell Wall Synthesis

    PubMed Central

    Taylor-Teeples, M; Lin, L; de Lucas, M; Turco, G; Toal, TW; Gaudinier, A; Young, NF; Trabucco, GM; Veling, MT; Lamothe, R; Handakumbura, PP; Xiong, G; Wang, C; Corwin, J; Tsoukalas, A; Zhang, L; Ware, D; Pauly, M; Kliebenstein, DJ; Dehesh, K; Tagkopoulos, I; Breton, G; Pruneda-Paz, JL; Ahnert, SE; Kay, SA; Hazen, SP; Brady, SM

    2014-01-01

    Summary The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. Here, we present a protein-DNA network between Arabidopsis transcription factors and secondary cell wall metabolic genes with gene expression regulated by a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. These interactions will serve as a foundation for understanding the regulation of a complex, integral plant component. PMID:25533953

  15. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  16. Leaf Ests from Stevia rebaudiana: a resource for gene discovery in diterpene synthesis.

    PubMed

    Brandle, J E; Richman, A; Swanson, A K; Chapman, B P

    2002-11-01

    Expressed sequence tags (ESTs) are providing a new approach to gene discovery in plant secondary metabolism. Stevia rebaudiana Bert. leaves produce high concentrations of diterpene steviol glycosides and should be a rich source of transcripts involved in diterpene synthesis. In order to create a resource for gene discovery and increase our understanding of steviol glycoside biosynthesis, we sequenced 5,548 ESTs from a S. rebaudiana leaf cDNA library. The EST collection was fully annotated based on database search results. ESTs involved in diterpene synthesis were identified using published sequences as electronic probes, by keyword searches of search results, and by differential representation. A significant portion of the ESTs were specific for standard leaf metabolic pathways; energy and primary metabolism represented 17.6% and 13.1% of total transcripts respectively. Diterpene metabolism in S. rebaudiana represented 1.1% of total transcripts. This study identified candidate genes for 70% of the known steps in the steviol glycoside pathway. One candidate, kaurene oxidase, was the 8th most abundant EST in the collection. Identification of many candidate genes specific to the I -deoxyxylulose 5-phosphate pathway suggests that the primary source of isopentenyl diphosphate, a precursor of geranylgeranyl diphosphate, is via the non-mevalonic acid pathway. The use of ESTs has greatly facilitated the identification of candidate genes and increased our understanding of diterpene metabolism.

  17. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  18. Exopolysaccharide (EPS) synthesis by Oenococcus oeni: from genes to phenotypes.

    PubMed

    Dimopoulou, Maria; Vuillemin, Marlène; Campbell-Sills, Hugo; Lucas, Patrick M; Ballestra, Patricia; Miot-Sertier, Cécile; Favier, Marion; Coulon, Joana; Moine, Virginie; Doco, Thierry; Roques, Maryline; Williams, Pascale; Petrel, Melina; Gontier, Etienne; Moulis, Claire; Remaud-Simeon, Magali; Dols-Lafargue, Marguerite

    2014-01-01

    Oenococcus oeni is the bacterial species which drives malolactic fermentation in wine. The analysis of 50 genomic sequences of O. oeni (14 already available and 36 newly sequenced ones) provided an inventory of the genes potentially involved in exopolysaccharide (EPS) biosynthesis. The loci identified are: two gene clusters named eps1 and eps2, three isolated glycoside-hydrolase genes named dsrO, dsrV and levO, and three isolated glycosyltransferase genes named gtf, it3, it4. The isolated genes were present or absent depending on the strain and the eps gene clusters composition diverged from one strain to another. The soluble and capsular EPS production capacity of several strains was examined after growth in different culture media and the EPS structure was determined. Genotype to phenotype correlations showed that several EPS biosynthetic pathways were active and complementary in O. oeni. Can be distinguished: (i) a Wzy-dependent synthetic pathway, allowing the production of heteropolysaccharides made of glucose, galactose and rhamnose, mainly in a capsular form, (ii) a glucan synthase pathway (Gtf), involved in β-glucan synthesis in a free and a cell-associated form, giving a ropy phenotype to growth media and (iii) homopolysaccharide synthesis from sucrose (α-glucan or β-fructan) by glycoside-hydrolases of the GH70 and GH68 families. The eps gene distribution on the phylogenetic tree was examined. Fifty out of 50 studied genomes possessed several genes dedicated to EPS metabolism. This suggests that these polymers are important for the adaptation of O. oeni to its specific ecological niche, wine and possibly contribute to the technological performance of malolactic starters. PMID:24901216

  19. Exopolysaccharide (EPS) Synthesis by Oenococcus oeni: From Genes to Phenotypes

    PubMed Central

    Dimopoulou, Maria; Vuillemin, Marlène; Campbell-Sills, Hugo; Lucas, Patrick M.; Ballestra, Patricia; Miot-Sertier, Cécile; Favier, Marion; Coulon, Joana; Moine, Virginie; Doco, Thierry; Roques, Maryline; Williams, Pascale; Petrel, Melina; Gontier, Etienne; Moulis, Claire; Remaud-Simeon, Magali; Dols-Lafargue, Marguerite

    2014-01-01

    Oenococcus oeni is the bacterial species which drives malolactic fermentation in wine. The analysis of 50 genomic sequences of O. oeni (14 already available and 36 newly sequenced ones) provided an inventory of the genes potentially involved in exopolysaccharide (EPS) biosynthesis. The loci identified are: two gene clusters named eps1 and eps2, three isolated glycoside-hydrolase genes named dsrO, dsrV and levO, and three isolated glycosyltransferase genes named gtf, it3, it4. The isolated genes were present or absent depending on the strain and the eps gene clusters composition diverged from one strain to another. The soluble and capsular EPS production capacity of several strains was examined after growth in different culture media and the EPS structure was determined. Genotype to phenotype correlations showed that several EPS biosynthetic pathways were active and complementary in O. oeni. Can be distinguished: (i) a Wzy -dependent synthetic pathway, allowing the production of heteropolysaccharides made of glucose, galactose and rhamnose, mainly in a capsular form, (ii) a glucan synthase pathway (Gtf), involved in β-glucan synthesis in a free and a cell-associated form, giving a ropy phenotype to growth media and (iii) homopolysaccharide synthesis from sucrose (α-glucan or β-fructan) by glycoside-hydrolases of the GH70 and GH68 families. The eps gene distribution on the phylogenetic tree was examined. Fifty out of 50 studied genomes possessed several genes dedicated to EPS metabolism. This suggests that these polymers are important for the adaptation of O. oeni to its specific ecological niche, wine and possibly contribute to the technological performance of malolactic starters. PMID:24901216

  20. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1). PMID:27519121

  1. Suppressing Sorbitol Synthesis Substantially Alters the Global Expression Profile of Stress Response Genes in Apple (Malus domestica) Leaves.

    PubMed

    Wu, Ting; Wang, Yi; Zheng, Yi; Fei, Zhangjun; Dandekar, Abhaya M; Xu, Kenong; Han, Zhenhai; Cheng, Lailiang

    2015-09-01

    Sorbitol is a major product of photosynthesis in apple (Malus domestica) that is involved in carbohydrate metabolism and stress tolerance. However, little is known about how the global transcript levels in apple leaves respond to decreased sorbitol synthesis. In this study we used RNA sequencing (RNA-seq) profiling to characterize the transcriptome of leaves from transgenic lines of the apple cultivar 'Greensleeves' exhibiting suppressed expression of aldose-6-phosphate reductase (A6PR) to gain insights into sorbitol function and the consequences of decreased sorbitol synthesis on gene expression. We observed that, although the leaves of the low sorbitol transgenic lines accumulate higher levels of various primary metabolites, only very limited changes were found in the levels of transcripts associated with primary metabolism. We suggest that this is indicative of post-transcriptional and/or post-translational regulation of primary metabolite accumulation and central carbon metabolism. However, we identified significantly enriched gene ontology terms belonging to the 'stress related process' category in the antisense lines (P-value < 0.05). These include genes involved in the synthesis/degradation of abscisic acid, salicylic acid and jasmonic acid, nucleotide-binding site leucine-rich repeat (NBS-LRR) disease resistance genes and ATP-binding cassette (ABC) transporter genes. This suggests that sorbitol plays a role in the responses of apple trees to abiotic and biotic stresses. PMID:26076968

  2. Suppressing Sorbitol Synthesis Substantially Alters the Global Expression Profile of Stress Response Genes in Apple (Malus domestica) Leaves.

    PubMed

    Wu, Ting; Wang, Yi; Zheng, Yi; Fei, Zhangjun; Dandekar, Abhaya M; Xu, Kenong; Han, Zhenhai; Cheng, Lailiang

    2015-09-01

    Sorbitol is a major product of photosynthesis in apple (Malus domestica) that is involved in carbohydrate metabolism and stress tolerance. However, little is known about how the global transcript levels in apple leaves respond to decreased sorbitol synthesis. In this study we used RNA sequencing (RNA-seq) profiling to characterize the transcriptome of leaves from transgenic lines of the apple cultivar 'Greensleeves' exhibiting suppressed expression of aldose-6-phosphate reductase (A6PR) to gain insights into sorbitol function and the consequences of decreased sorbitol synthesis on gene expression. We observed that, although the leaves of the low sorbitol transgenic lines accumulate higher levels of various primary metabolites, only very limited changes were found in the levels of transcripts associated with primary metabolism. We suggest that this is indicative of post-transcriptional and/or post-translational regulation of primary metabolite accumulation and central carbon metabolism. However, we identified significantly enriched gene ontology terms belonging to the 'stress related process' category in the antisense lines (P-value < 0.05). These include genes involved in the synthesis/degradation of abscisic acid, salicylic acid and jasmonic acid, nucleotide-binding site leucine-rich repeat (NBS-LRR) disease resistance genes and ATP-binding cassette (ABC) transporter genes. This suggests that sorbitol plays a role in the responses of apple trees to abiotic and biotic stresses.

  3. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described.

  4. Activation of PPARα by Fatty Acid Accumulation Enhances Fatty Acid Degradation and Sulfatide Synthesis.

    PubMed

    Yang, Yang; Feng, Yuyao; Zhang, Xiaowei; Nakajima, Takero; Tanaka, Naoki; Sugiyama, Eiko; Kamijo, Yuji; Aoyama, Toshifumi

    2016-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) catalyzes the first reaction in the mitochondrial fatty acid β-oxidation pathway. VLCAD deficiency is associated with the accumulation of fat in multiple organs and tissues, which results in specific clinical features including cardiomyopathy, cardiomegaly, muscle weakness, and hepatic dysfunction in infants. We speculated that the abnormal fatty acid metabolism in VLCAD-deficient individuals might cause cell necrosis by fatty acid toxicity. The accumulation of fatty acids may activate peroxisome proliferator-activated receptor (PPAR), a master regulator of fatty acid metabolism and a potent nuclear receptor for free fatty acids. We examined six skin fibroblast lines, derived from VLCAD-deficient patients and identified fatty acid accumulation and PPARα activation in these cell lines. We then found that the expression levels of three enzymes involved in fatty acid degradation, including long-chain acyl-CoA synthetase (LACS), were increased in a PPARα-dependent manner. This increased expression of LACS might enhance the fatty acyl-CoA supply to fatty acid degradation and sulfatide synthesis pathways. In fact, the first and last reactions in the sulfatide synthesis pathway are regulated by PPARα. Therefore, we also measured the expression levels of enzymes involved in sulfatide metabolism and the regulation of cellular sulfatide content. The levels of these enzymes and cellular sulfatide content both increased in a PPARα-dependent manner. These results indicate that PPARα activation plays defensive and compensative roles by reducing cellular toxicity associated with fatty acids and sulfuric acid. PMID:27644403

  5. [Synthesis of new mandelic acid derivatives with preservative action. Synthesis and acute toxicity study].

    PubMed

    Stan, Cătălina; Năstase, V; Pavelescu, M; Vasile, Cornelia; Dumitrache, M; Gherase, Florenţa; Năstasă, Veronica

    2004-01-01

    Starting from the antiseptic action of DL mandelic acid, there were synthesized a series of esters of the mandelic acid, esters which could have preservative action. This study present the synthesis, structure validation and the acute toxicity study, for the new synthesized compounds. The esters were obtained by acylating 4-hydroxybenzoic acid propyl, ethyl, methyl esters and salicylic acid with the DL mandelic chloride (that was protected initially by the hydroxylic group). The structure of the synthesized compounds was confirmed by quantitative elemental analysis and RMN 1H spectral measurements. The acute toxicity was determined for two of the esters, who proved to had a preservative action (previously studied) and indicated that these esters have a small toxicity.

  6. Gene Expressions for Signal Transduction under Acidic Conditions

    PubMed Central

    Fukamachi, Toshihiko; Ikeda, Syunsuke; Wang, Xin; Saito, Hiromi; Tagawa, Masatoshi; Kobayashi, Hiroshi

    2013-01-01

    Although it is now well known that some diseased areas, such as cancer nests, inflammation loci, and infarction areas, are acidified, little is known about cellular signal transduction, gene expression, and cellular functions under acidic conditions. Our group showed that different signal proteins were activated under acidic conditions compared with those observed in a typical medium of around pH 7.4 that has been used until now. Investigations of gene expression under acidic conditions may be crucial to our understanding of signal transduction in acidic diseased areas. In this study, we investigated gene expression in mesothelioma cells cultured at an acidic pH using a DNA microarray technique. After 24 h culture at pH 6.7, expressions of 379 genes were increased more than twofold compared with those in cells cultured at pH 7.5. Genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors numbered 35, 32, and 17 among the 379 genes, respectively. Since the functions of 78 genes are unknown, it can be argued that cells may have other genes for signaling under acidic conditions. The expressions of 37 of the 379 genes were observed to increase after as little as 2 h. After 24 h culture at pH 6.7, expressions of 412 genes were repressed more than twofold compared with those in cells cultured at pH 7.5, and the 412 genes contained 35, 76, and 7 genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors, respectively. These results suggest that the signal pathways in acidic diseased areas are different, at least in part, from those examined with cells cultured at a pH of around 7.4. PMID:24705103

  7. Bidirectional transcription of lipooligosaccharide synthesis genes from Campylobacter jejuni.

    PubMed

    Phongsisay, Vongsavanh; Fry, Benjamin N

    2007-10-01

    The lipooligosaccharide (LOS) molecules of Campylobacter jejuni are involved in virulence and induction of the Guillain-Barré syndrome (GBS). This study analysed the transcription of the LOS synthesis genes from the GBS-inducing C. jejuni strain HB 93-13 under microaerobic conditions. Fourteen consecutive genes Cj1132c, waaC, htrB, wlaNC, wlaND, cgtA, cgtB, cstII, neuB, neuC, neuA, wlaVA, wlaQA, and waaF were included. The results of rapid amplification of cDNA ends and single-stranded ligation of complementary ends showed initiation sites with potential promoter regions on both DNA strands in the Cj1132c/waaC, cgtB/cstII, and wlaQA/waaF strand-switch regions. Other termini without recognisable promoter region were also found throughout the LOS gene cluster, suggesting a low specificity of the polymerase during transcription. In addition, all gene junction regions were cloned into the shuttle vector pMW10 carrying the promoterless lacZ gene to identify functional promoter sites. Bidirectional active promoters were found in the strand-switch regions. The results of RT-PCR and cDNA blotting indicated that transcriptional linkage occurred between different operons, indicating a lack of transcription termination within the LOS gene cluster. Moreover, the results of semi-quantitative RT-PCR and real-time RT-PCR showed that both DNA strands were transcribed but transcription of the coding strand was at a higher rate. The results presented here provide an insight into transcription of the LOS synthesis gene cluster of C. jejuni.

  8. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  9. Limiting amino acid for protein synthesis with mammary cells in tissue culture.

    PubMed

    Park, C S; Chandler, P T; Norman, A W

    1976-05-01

    To identify the limiting amino acid in the minimal essential medium as published by Eagle (Science 130:432, 1959) for milk protein synthesis in rat mammary cells in tissue culture, two different experimental approaches were used. The first study involved the reduction of amino acids singly from the total amino acid complement of the medium for milk protein synthesis. The second study was to investigate the effect on milk protein synthesis of single amino acid addition to the basic complement of amino acids. Order of limiting amino acids was lysine (first) and possible methionine, valine, or arginine (second).

  10. A new method for the synthesis of a structural gene.

    PubMed Central

    Chen, H B; Weng, J M; Jiang, K; Bao, J S

    1990-01-01

    A novel method of synthesizing a structural gene or gene fragment, consisting of the first synthesis of a single-stranded DNA (ssDNA), has been developed. As a preliminary test of this method, four synthetic genes or gene fragments have been synthesized. The first one with 396 base pairs (b.p.) codes for the mature rbcS from wheat, the next two with 370 and 342 b.p. respectively, for two half molecules of a gene for trichosanthin and the last one with 315 b.p. for the N-terminal 1-102 residues of human prourokinase. In all these syntheses, a plus-stranded DNA of the target gene was generally assembled by a stepwise or one step T4 DNA ligase reaction of six oligonucleotides (A, *pB, *pC, *pD, *pE and *pF) of 30-71 nucleotides long in the presence of two terminal complementary oligonucleotides (Ab' and eF') and three short inter-fragment complementary oligonucleotides (bc, cd and de). After purification, the synthetic ssDNA was inserted into a cloning vector, pWR13. The resulting product was directly used to transform a host cell. The structure of the cloned synthetic gene was confirmed by DNA sequence analysis. Images PMID:2179872

  11. Rapamycin Inhibits Expression of Elongation of Very-long-chain Fatty Acids 1 and Synthesis of Docosahexaenoic Acid in Bovine Mammary Epithelial Cells

    PubMed Central

    Guo, Zhixin; Wang, Yanfeng; Feng, Xue; Bao, Chaogetu; He, Qiburi; Bao, Lili; Hao, Huifang; Wang, Zhigang

    2016-01-01

    Mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of cell growth and metabolism and is sufficient to induce specific metabolic processes, including de novo lipid biosynthesis. Elongation of very-long-chain fatty acids 1 (ELOVL1) is a ubiquitously expressed gene and the product of which was thought to be associated with elongation of carbon (C) chain in fatty acids. In the present study, we examined the effects of rapamycin, a specific inhibitor of mTORC1, on ELOVL1 expression and docosahexaenoic acid (DHA, C22:6 n-3) synthesis in bovine mammary epithelial cells (BMECs). We found that rapamycin decreased the relative abundance of ELOVL1 mRNA, ELOVL1 expression and the level of DHA in a time-dependent manner. These data indicate that ELOVL1 expression and DHA synthesis are regulated by mTORC1 in BMECs. PMID:26954224

  12. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  13. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  14. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  15. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  16. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  17. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  18. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  19. The fatty acid desaturase 2 (FADS2) gene product catalyzes Δ4 desaturation to yield n-3 docosahexaenoic acid and n-6 docosapentaenoic acid in human cells

    PubMed Central

    Park, Hui Gyu; Park, Woo Jung; Kothapalli, Kumar S. D.; Brenna, J. Thomas

    2015-01-01

    Docosahexaenoic acid (DHA) is a Δ4-desaturated C22 fatty acid and the limiting highly unsaturated fatty acid (HUFA) in neural tissue. The biosynthesis of Δ4-desaturated docosanoid fatty acids 22:6n-3 and 22:5n-6 are believed to proceed via a circuitous biochemical pathway requiring repeated use of a fatty acid desaturase 2 (FADS2) protein to perform Δ6 desaturation on C24 fatty acids in the endoplasmic reticulum followed by 1 round of β-oxidation in the peroxisomes. We demonstrate here that the FADS2 gene product can directly Δ4-desaturate 22:5n-3→22:6n-3 (DHA) and 22:4n-6→22:5n-6. Human MCF-7 cells lacking functional FADS2-mediated Δ6-desaturase were stably transformed with FADS2, FADS1, or empty vector. When incubated with 22:5n-3 or 22:4n-6, FADS2 stable cells produce 22:6n-3 or 22:5n-6, respectively. Similarly, FADS2 stable cells when incubated with d5-18:3n-3 show synthesis of d5-22:6n-3 with no labeling of 24:5n-3 or 24:6n-3 at 24 h. Further, both C24 fatty acids are shown to be products of the respective C22 fatty acids via elongation. Our results demonstrate that the FADS2 classical transcript mediates direct Δ4 desaturation to yield 22:6n-3 and 22:5n-6 in human cells, as has been widely shown previously for desaturation by fish and many other organisms.—Park, H. G., Park, W. J., Kothapalli, K. S. D., Brenna, J. T. The fatty acid desaturase 2 (FADS2) gene product catalyzes Δ4 desaturation to yield n-3 docosahexaenoic acid and n-6 docosapentaenoic acid in human cells. PMID:26065859

  20. Fatty acid regulates gene expression and growth of human prostate cancer PC-3 cells

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Chen, Y.; Tjandrawinata, R. R.

    2001-01-01

    It has been proposed that the omega-6 fatty acids increase the rate of tumor growth. Here we test that hypothesis in the PC-3 human prostate tumor. We found that the essential fatty acids, linoleic acid (LA) and arachidonic acid (AA), and the AA metabolite PGE(2) stimulate tumor growth while oleic acid (OA) and the omega-3 fatty acid, eicosapentaenoic acid (EPA) inhibited growth. In examining the role of AA in growth response, we extended our studies to analyze changes in early gene expression induced by AA. We demonstrate that c-fos expression is increased within minutes of addition in a dose-dependent manner. Moreover, the immediate early gene cox-2 is also increased in the presence of AA in a dose-dependent manner, while the constitutive cox-1 message was not increased. Three hours after exposure to AA, the synthesis of PGE(2) via COX-2 was also increased. Previous studies have demonstrated that AA was primarily delivered by low density lipoprotein (LDL) via its receptor (LDLr). Since it is known that hepatomas, acute myelogenous leukemia and colorectal tumors lack normal cholesterol feedback, we examined the role of the LDLr in growth regulation of the PC-3 prostate cancer cells. Analysis of ldlr mRNA expression and LDLr function demonstrated that human PC-3 prostate cancer cells lack normal feedback regulation. While exogenous LDL caused a significant stimulation of cell growth and PGE(2) synthesis, no change was seen in regulation of the LDLr by LDL. Taken together, these data show that normal cholesterol feedback of ldlr message and protein is lost in prostate cancer. These data suggest that unregulated over-expression of LDLr in tumor cells would permit increased availability of AA, which induces immediate early genes c-fos and cox-2 within minutes of uptake.

  1. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  2. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  3. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  4. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  5. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  6. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.

    PubMed

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-08-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  7. [Cephalosporin-Acid Synthetase of Escherichia coli Strain VKPM B-10182: Genomic Context, Gene Identification, Producer Strain Production].

    PubMed

    Eldarov M, A; Sklyarenko, A V; Mardanov, A V; Beletsky, A V; Zhgun, A A; Dumina, M V; Medvedeva, N V; Satarova, D E; Ravin, N V; Yarockii, S V

    2015-01-01

    An enzyme of cephalosporin-acid synthetase produced by the E. coli strain VKPM B-10182 has specificity for the synthesis of β-lactam antibiotics of the cephalosporin acids class (cefazolin, cefalotin, cefezole etc.). A comparison of the previously determined genomic sequence of E. coli VKPM B-10182 with a genome of the parent E. coli strain ATCC 9637 was performed. Multiple mutations indicating the long selection history of the strain were detected, including mutations in the genes of RNase and β-lactamases that could enhance the level of enzyme synthesis and reduce the degree of degradation of the synthesized cephalosporin acids. The CASA gene--a direct homolog of the penicillin G-acylase gene--was identified by bioinformatics methods. The homology of the gene was confirmed by gene cloning and the expression and determination of its enzymatic activity in the reaction of cefazolin synthesis. The CASA gene was isolated and cloned into the original expression vector, resulting in an effective E. coli BL2l(DE3) pMD0107 strain producing CASA. PMID:26596082

  8. Energy, genes and evolution: introduction to an evolutionary synthesis.

    PubMed

    Lane, Nick; Martin, William F; Raven, John A; Allen, John F

    2013-07-19

    Life is the harnessing of chemical energy in such a way that the energy-harnessing device makes a copy of itself. No energy, no evolution. The 'modern synthesis' of the past century explained evolution in terms of genes, but this is only part of the story. While the mechanisms of natural selection are correct, and increasingly well understood, they do little to explain the actual trajectories taken by life on Earth. From a cosmic perspective-what is the probability of life elsewhere in the Universe, and what are its probable traits?-a gene-based view of evolution says almost nothing. Irresistible geological and environmental changes affected eukaryotes and prokaryotes in very different ways, ones that do not relate to specific genes or niches. Questions such as the early emergence of life, the morphological and genomic constraints on prokaryotes, the singular origin of eukaryotes, and the unique and perplexing traits shared by all eukaryotes but not found in any prokaryote, are instead illuminated by bioenergetics. If nothing in biology makes sense except in the light of evolution, nothing in evolution makes sense except in the light of energetics. This Special Issue of Philosophical Transactions examines the interplay between energy transduction and genome function in the major transitions of evolution, with implications ranging from planetary habitability to human health. We hope that these papers will contribute to a new evolutionary synthesis of energetics and genetics.

  9. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  10. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  11. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  12. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    SciTech Connect

    Amikam, D.; Benziman, M. )

    1989-12-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of {sup 32}P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with ({sup 14}C)glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes.

  13. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  14. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  15. Nuclear receptors for retinoic acid and thyroid hormone regulate transcription of keratin genes.

    PubMed Central

    Tomic, M; Jiang, C K; Epstein, H S; Freedberg, I M; Samuels, H H; Blumenberg, M

    1990-01-01

    In the epidermis, retinoids regulate the expression of keratins, the intermediate filament proteins of epithelial cells. We have cloned the 5' regulatory regions of four human epidermal keratin genes, K#5, K#6, K#10, and K#14, and engineered constructs in which these regions drive the expression of the CAT reporter gene. By co-transfecting the constructs into epithelial cells along with the vectors expressing nuclear receptors for retinoic acid (RA) and thyroid hormone, we have demonstrated that the receptors can suppress the promoters of keratin genes. The suppression is ligand dependent; it is evident both in established cell lines and in primary cultures of epithelial cells. The three RA receptors have similar effects on keratin gene transcription. Our data indicate that the nuclear receptors for RA and thyroid hormone regulate keratin synthesis by binding to negative recognition elements in the upstream DNA sequences of the keratin genes. RA thus has a twofold effect on epidermal keratin expression: qualitatively, it regulates the regulators that effect the switch from basal cell-specific keratins to differentiation-specific ones; and quantitatively, it determines the level of keratin synthesis within the cell by direct interaction of its receptors with the keratin gene promoters. Images PMID:1712634

  16. Fatty acid synthesis and pyruvate metabolism pathways remain active in dihydroartemisinin-induced dormant ring stages of Plasmodium falciparum.

    PubMed

    Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin

    2014-08-01

    Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment.

  17. Influence of phenolic acids on indole acetic acid production and on the type III secretion system gene transcription in food-associated Pseudomonas fluorescens KM05.

    PubMed

    Myszka, Kamila; Schmidt, Marcin T; Olejnik-Schmidt, Agnieszka K; Leja, Katarzyna; Czaczyk, Katarzyna

    2014-12-01

    The purpose of these investigations was to evaluate the reduction capability of phenolic acids (ferulic, chlorogenic, gallic, and p-coumaric acids) on indole acetic acid synthesis by food-associated Pseudomonas fluorescens KM05. Specific genetic primer for the type III secretion system (TTSS) in P. fluorescens KM05 was designed and the influence of phenolic acids on its expression was investigated. In the work the ferulic and chlorogenic acids at the concentration of 0.02 and 0.04 μg/ml affected on bacterial growth pattern and the signal molecules production. The phenolic acids, that were appreciable effective against P. fluorescens KM05 indole acetic acid production, significantly suppressed TTSS gene.

  18. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  19. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173. PMID:15543522

  20. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173.

  1. Baker's Yeast Deficient in Storage Lipid Synthesis Uses cis-Vaccenic Acid to Reduce Unsaturated Fatty Acid Toxicity.

    PubMed

    Sec, Peter; Garaiova, Martina; Gajdos, Peter; Certik, Milan; Griac, Peter; Hapala, Ivan; Holic, Roman

    2015-07-01

    The role of cis-vaccenic acid (18:1n-7) in the reduction of unsaturated fatty acids toxicity was investigated in baker's yeast Saccharomyces cerevisiae. The quadruple mutant (QM, dga1Δ lro1Δ are1Δ are2Δ) deficient in enzymes responsible for triacylglycerol and steryl ester synthesis has been previously shown to be highly sensitive to exogenous unsaturated fatty acids. We have found that cis-vaccenic acid accumulated during cultivation in the QM cells but not in the corresponding wild type strain. This accumulation was accompanied by a reduction in palmitoleic acid (16:1n-7) content in the QM cells that is consistent with the proposed formation of cis-vaccenic acid by elongation of palmitoleic acid. Fatty acid analysis of individual lipid classes from the QM strain revealed that cis-vaccenic acid was highly enriched in the free fatty acid pool. Furthermore, production of cis-vaccenic acid was arrested if the mechanism of fatty acids release to the medium was activated. We also showed that exogenous cis-vaccenic acid did not affect viability of the QM strain at concentrations toxic for palmitoleic or oleic acids. Moreover, addition of cis-vaccenic acid to the growth medium provided partial protection against the lipotoxic effects of exogenous oleic acid. Transformation of palmitoleic acid to cis-vaccenic acid is thus a rescue mechanism enabling S. cerevisiae cells to survive in the absence of triacylglycerol synthesis as the major mechanism for unsaturated fatty acid detoxification.

  2. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life.

  3. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  4. Lipoic acid functionalized amino acids cationic lipids as gene vectors.

    PubMed

    Su, Rong-Chuan; Liu, Qiang; Yi, Wen-Jing; Zheng, Li-Ting; Zhao, Zhi-Gang

    2016-10-01

    A series of reducible cationic lipids 4a-4f with different amino acid polar-head groups were prepared. The novel lipid contains a hydrophobic lipoic acid (LA) moiety, which can be reduced under reductive conditions to release of the encapsulated plasmid DNA. The particle size, zeta potential and cellular uptake of lipoplexes formed with DNA, as well as the transfection efficacy (TE) were characterized. The TE of the cationic lipid based on arginine was especially high, and was 2.5times higher than that of a branched polyethylenimine in the presence of 10% serum.

  5. Activation of the Constitutive Androstane Receptor Inhibits Gluconeogenesis without Affecting Lipogenesis or Fatty Acid Synthesis in Human Hepatocytes

    PubMed Central

    Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

    2014-01-01

    Objective Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods Ligand-based structure-activity models were used for virtual screening of the Specs database (www.specs.net) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. PMID:24878338

  6. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  7. Metabolism of Very Long-Chain Fatty Acids: Genes and Pathophysiology

    PubMed Central

    Sassa, Takayuki; Kihara, Akio

    2014-01-01

    Fatty acids (FAs) are highly diverse in terms of carbon (C) chain-length and number of double bonds. FAs with C>20 are called very long-chain fatty acids (VLCFAs). VLCFAs are found not only as constituents of cellular lipids such as sphingolipids and glycerophospholipids but also as precursors of lipid mediators. Our understanding on the function of VLCFAs is growing in parallel with the identification of enzymes involved in VLCFA synthesis or degradation. A variety of inherited diseases, such as ichthyosis, macular degeneration, myopathy, mental retardation, and demyelination, are caused by mutations in the genes encoding VLCFA metabolizing enzymes. In this review, we describe mammalian VLCFAs by highlighting their tissue distribution and metabolic pathways, and we discuss responsible genes and enzymes with reference to their roles in pathophysiology. PMID:24753812

  8. Extensive horizontal gene transfer, duplication, and loss of chlorophyll synthesis genes in the algae

    DOE PAGES

    Hunsperger, Heather M.; Randhawa, Tejinder; Cattolico, Rose Ann

    2015-02-10

    Two non-homologous, isofunctional enzymes catalyze the penultimate step of chlorophyll a synthesis in oxygenic photosynthetic organisms such as cyanobacteria, eukaryotic algae and land plants: the light independent (LIPOR) and light-dependent (POR) protochlorophyllide oxidoreductases. Whereas the distribution of these enzymes in cyanobacteria and land plants is well understood, the presence, loss, duplication, and replacement of these genes have not been surveyed in the polyphyletic and remarkably diverse eukaryotic algal lineages.

  9. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  10. New stabilized FastPrep-CLEAs for sialic acid synthesis.

    PubMed

    García-García, María Inmaculada; Sola-Carvajal, Agustín; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2011-05-01

    N-acetyl-D-neuraminic acid aldolase, a key enzyme in the biotechnological production of N-acetyl-D-neuraminic acid (sialic acid) from N-acetyl-D-mannosamine and pyruvate, was immobilized as cross-linked enzyme aggregates (CLEAs) by precipitation with 90% ammonium sulfate and crosslinking with 1% glutaraldehyde. Because dispersion in a reciprocating disruptor (FastPrep) was only able to recover 40% of the activity, improved CLEAs were then prepared by co-aggregation of the enzyme with 10mg/mL bovine serum albumin followed by a sodium borohydride treatment and final disruption by FastPrep (FastPrep-CLEAs). This produced a twofold increase in activity up to 86%, which is a 30% more than that reported for this aldolase in cross-linked inclusion bodies (CLIBs). In addition, these FastPrep-CLEAs presented remarkable biotechnological features for Neu5Ac synthesis, including, good activity and stability at alkaline pHs, a high K(M) for ManNAc (lower for pyruvate) and good operational stability. These results reinforce the practicability of using FastPrep-CLEAs in biocatalysis, thus reducing production costs and favoring reusability.

  11. Most acid-tolerant chickpea mesorhizobia show induction of major chaperone genes upon acid shock.

    PubMed

    Brígido, Clarisse; Oliveira, Solange

    2013-01-01

    Our goals were to evaluate the tolerance of mesorhizobia to acid and alkaline conditions as well as to investigate whether acid tolerance is related to the species or the origin site of the isolates. In addition, to investigate the molecular basis of acid tolerance, the expression of chaperone genes groEL and dnaKJ was analyzed using acid-tolerant and sensitive mesorhizobia. Tolerance to pH 5 and 9 was evaluated in liquid medium for 98 Portuguese chickpea mesorhizobia belonging to four species clusters. All isolates showed high sensitivity to pH 9. In contrast, mesorhizobia revealed high diversity in terms of tolerance to acid stress: 35 % of the isolates were acid sensitive and 45 % were highly tolerant to pH 5 or moderately acidophilic. An association between mesorhizobia tolerance to acid conditions and the origin soil pH was found. Furthermore, significant differences between species clusters regarding tolerance to acidity were obtained. Ten isolates were used to investigate the expression levels of the chaperone genes by northern hybridization. Interestingly, most acid-tolerant isolates displayed induction of the dnaK and groESL genes upon acid shock while the sensitive ones showed repression. This study suggests that acid tolerance in mesorhizobia is related to the pH of the origin soil and to the species cluster of the isolates. Additionally, the transcriptional analysis suggests a relationship between induction of major chaperone genes and higher tolerance to acid pH in mesorhizobia. This is the first report on transcriptional analysis of the major chaperones genes in mesorhizobia under acidity, contributing to a better understanding of the molecular mechanisms of rhizobia acidity tolerance.

  12. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.

  13. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected. PMID:10841936

  14. Transcriptional profiling of canola developing embryo and identification of the important roles of BnDof5.6 in embryo development and fatty acids synthesis.

    PubMed

    Deng, Wei; Yan, Fang; Zhang, Xiaolan; Tang, Yuwei; Yuan, Yujin

    2015-08-01

    Canola is an important vegetable oil crop globally, and the understanding of the molecular mechanism underlying fatty acids biosynthesis during seed embryo development is an important research goal. Here we report the transcriptional profiling analysis of developing canola embryos using RNA-sequencing (RNA-Seq) method. RNA-Seq analysis generated 58,579,451 sequence reads aligned with 32,243 genes. It was found that a total of 55 differential expression genes (DEGs) encoding 28 enzymes function in carbon flow to fatty acids of storage TAG. Most of the DEGs encoding above enzymes showed similar expression pattern, indicating the DEGs are cooperatively involved in carbon flow into fatty acids. In addition, 41 DEGs associated with signal transductions, transport and metabolic processing of auxin, gibberellin, abscisic acid, cytokinin and salicylic acids were found in the RNA-Seq database, which indicates the important roles of the phytohormones in controlling embryo development and fatty acids synthesis. 122 DEGs encoding transcriptional factor family members were found in developing canola embryos. Furthermore, BnDOF5.6, a zinc finger transcriptional factor gene, found in RNA-Seq database was down-regulated in developing canola embryos. The transgenic plants displayed reduced embryo sizes, decreased fatty acids contents and altered seed fatty acids composition in canola. Down-regulated of BnDof5.6 also changed the expression levels of genes involved in fatty acids synthesis and desaturation. Our results indicate that BnDof5.6 is required for embryo development and fatty acids synthesis in canola. Overall this study presents new information on the global expression patterns of genes during embryo development and will expand our understanding of the complex molecular mechanism of carbon flow into fatty acids and embryo development in canola. PMID:26092973

  15. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  16. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  17. Analysis of ldh genes in Lactobacillus casei BL23: role on lactic acid production.

    PubMed

    Rico, Juan; Yebra, María Jesús; Pérez-Martínez, Gaspar; Deutscher, Josef; Monedero, Vicente

    2008-06-01

    Lactobacillus casei is a lactic acid bacterium that produces L-lactate as the main product of sugar fermentation via L-lactate dehydrogenase (Ldh1) activity. In addition, small amounts of the D-lactate isomer are produced by the activity of a D-hydroxycaproate dehydrogenase (HicD). Ldh1 is the main L-lactate producing enzyme, but mutation of its gene does not eliminate L-lactate synthesis. A survey of the L. casei BL23 draft genome sequence revealed the presence of three additional genes encoding Ldh paralogs. In order to study the contribution of these genes to the global lactate production in this organism, individual, as well as double mutants (ldh1 ldh2, ldh1 ldh3, ldh1 ldh4 and ldh1 hicD) were constructed and lactic acid production was assessed in culture supernatants. ldh2, ldh3 and ldh4 genes play a minor role in lactate production, as their single mutation or a mutation in combination with an ldh1 deletion had a low impact on L-lactate synthesis. A Deltaldh1 mutant displayed an increased production of D-lactate, which was probably synthesized via the activity of HicD, as it was abolished in a Deltaldh1 hicD double mutant. Contrarily to HicD, no Ldh1, Ldh2, Ldh3 or Ldh4 activities could be detected by zymogram assays. In addition, these assays revealed the presence of extra bands exhibiting D-/L-lactate dehydrogenase activity, which could not be attributed to any of the described genes. These results suggest that L. casei BL23 possesses a complex enzymatic system able to reduce pyruvic to lactic acid. PMID:18231816

  18. A systems biology approach for the identification of target genes for the improvement of itaconic acid production in Aspergillus species

    PubMed Central

    2013-01-01

    Background In this paper, a clone based transcriptome analysis towards the identification of genes related to itaconic acid production in Aspergillus terreus was carried out as an extension of a previously published a clone-based transcriptome analysis from a set of batch fermentation experiments. Also a publically available A. niger transcriptome dataset from cultures similar to those of the A. terreus data set was analyzed to evaluate the specificity of the approach followed for A. terreus. Results Besides the itaconic acid gene cluster (cis-aconitate decarboxylase, mitochondrial tri-carboxylic acid transporter and major facilitator superfamily transporter) discovered previously, additional genes of interest were identified in the A. terreus transcriptome data correlating to itaconic acid production, including 6 genes encoding enzymes in glycolysis and the pentose phosphate pathway, 4 genes functioning in vitamins synthesis, and a gene encoding a copper transporter. Only three of the 83 low pH specific genes identified from the A. niger dataset corresponded to high itaconic acid / low pH expressed genes identified from the A. terreus data set. However, in all three cases, the regulation of pH dependent gene expression was completely different between the two species. Conclusions An extended clone based transcriptome analysis using a clone based transcription array to identify genes correlating with itaconic acid production revealed novel genes both in the central metabolism and in other more secondary pathways such as vitamin biosynthesis and Cu2+ transport, providing targets for further metabolic and process engineering to optimize itaconic acid production. PMID:24304666

  19. Identification of a Geranylgeranyl reductase gene for chlorophyll synthesis in rice.

    PubMed

    Wang, Pingyu; Li, Chunmei; Wang, Yang; Huang, Rui; Sun, Changhui; Xu, Zhengjun; Zhu, Jianqing; Gao, Xiaoling; Deng, Xiaojian; Wang, Pingrong

    2014-01-01

    Geranylgeranyl reductase (CHL P) catalyzes the reduction of geranylgeranyl diphosphate to phytyl diphosphate, and provides phytol for both Chlorophyll (Chl) and tocopherol synthesis. In this study, we isolated a yellow-green leaf mutant, 502ys, in rice (Oryza sativa). The mutant exhibited reduced level of Chls, arrested development of chloroplasts, and retarded growth rate. The phenotype of the 502ys mutant was controlled by by a recessive mutation in a nuclear gene on the long arm of rice chromosome 2. Map-based cloning of the mutant resulted in the identification of an OsChl P gene (LOC_Os02g51080). In the 502ys mutant, a single base pair mutation was detected at residue 1279 in DNA sequence of the gene, resulting in an amino acid change (Gly-206 to Ser) in the encoded protein. HPLC analysis of Chls indicated that the majority of Chl molecules are conjugated with an unsaturated geranylgeraniol side chain, in addition to small amount of normal Chls in the mutant. Furthermore, the mutant phenotype was complemented by transformation with the wild-type gene. Therefore, this study has confirmed the 502ys mutant resulted from a single base pair mutation in OsChl P gene. PMID:24809003

  20. Embryonic retinoic acid synthesis is essential for early mouse post-implantation development.

    PubMed

    Niederreither, K; Subbarayan, V; Dollé, P; Chambon, P

    1999-04-01

    A number of studies have suggested that the active derivative of vitamin A, retinoic acid (RA), may be important for early development of mammalian embryos. Severe vitamin A deprivation in rodents results in maternal infertility, precluding a thorough investigation of the role of RA during embryogenesis. Here we show that production of RA by the retinaldehyde dehydrogenase-2 (Raldh2) enzyme is required for mouse embryo survival and early morphogenesis. Raldh2 is an NAD-dependent aldehyde dehydrogenase with high substrate specificity for retinaldehyde. Its pattern of expression during mouse development has suggested that it may be responsible for embryonic RA synthesis. We generated a targeted disruption of the mouse Raldh2 gene and found that Raldh2-/- embryos, which die at midgestation without undergoing axial rotation (body turning), exhibit shortening along the anterioposterior axis and do not form limb buds. Their heart consists of a single, medial, dilated cavity. Their frontonasal region is truncated and their otocysts are severely reduced. These defects result from a block in embryonic RA synthesis, as shown by the lack of activity of RA-responsive transgenes, the altered expression of an RA-target homeobox gene and the near full rescue of the mutant phenotype by maternal RA administration. Our data establish that RA synthesized by the post-implantation mammalian embryo is an essential developmental hormone whose lack leads to early embryo death. PMID:10192400

  1. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis.

    PubMed

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-04-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 (-) were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis.

  2. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis

    PubMed Central

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-01-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 − were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis. PMID:27162276

  3. Glutathione metabolic genes coordinately respond to heavy metals and jasmonic acid in Arabidopsis.

    PubMed Central

    Xiang, C; Oliver, D J

    1998-01-01

    Glutathione plays a pivotal role in protecting plants from environmental stresses, oxidative stress, xenobiotics, and some heavy metals. Arabidopsis plants treated with cadmium or copper responded by increasing transcription of the genes for glutathione synthesis, gamma-glutamylcysteine synthetase and glutathione synthetase, as well as glutathione reductase. The response was specific for those metals whose toxicity is thought to be mitigated through phytochelatins, and other toxic and nontoxic metals did not alter mRNA levels. Feeding experiments suggested that neither oxidative stress, as results from exposure to H2O2, nor oxidized or reduced glutathione levels were responsible for activating transcription of these genes. Jasmonic acid also activated the same suite of genes, which suggests that it might be involved in the signal transduction pathway for copper and cadmium. Jasmonic acid treatment increased mRNA levels and the capacity for glutathione synthesis but did not alter the glutathione content in unstressed plants, which supports the idea that the glutathione concentration is controlled at multiple levels. PMID:9724699

  4. Consequences of PPARα Invalidation on Glutathione Synthesis: Interactions with Dietary Fatty Acids

    PubMed Central

    Guelzim, Najoua; Huneau, Jean-François; Mathé, Véronique; Quignard-Boulangé, Annie; Martin, Pascal G.; Tomé, Daniel; Hermier, Dominique

    2011-01-01

    Glutathione (GSH) derives from cysteine and plays a key role in redox status. GSH synthesis is determined mainly by cysteine availability and γ-glutamate cysteine ligase (γGCL) activity. Because PPARα activation is known to control the metabolism of certain amino acids, GSH synthesis from cysteine and related metabolisms were explored in wild-type (WT) and PPARα-null (KO) mice, fed diets containing either saturated (COCO diet) or 18 : 3 n-3, LIN diet. In mice fed the COCO diet, but not in those fed the LIN diet, PPARα deficiency enhanced hepatic GSH content and γGCL activity, superoxide dismutase 2 mRNA levels, and plasma uric acid concentration, suggesting an oxidative stress. In addition, in WT mice, the LIN diet increased the hepatic GSH pool, without effect on γGCL activity, or change in target gene expression, which rules out a direct effect of PPARα. This suggests that dietary 18 : 3 n-3 may regulate GSH metabolism and thus mitigate the deleterious effects of PPARα deficiency on redox status, without direct PPARα activation. PMID:21915176

  5. Compound-gene interaction mapping reveals distinct roles for Staphylococcus aureus teichoic acids

    PubMed Central

    Santa Maria, John P.; Sadaka, Ama; Moussa, Samir H.; Brown, Stephanie; Zhang, Yanjia J.; Rubin, Eric J.; Gilmore, Michael S.; Walker, Suzanne

    2014-01-01

    Staphylococcus aureus contains two distinct teichoic acid (TA) polymers, lipoteichoic acid (LTA) and wall teichoic acid (WTA), which are proposed to play redundant roles in regulating cell division. To gain insight into the underlying biology of S. aureus TAs, we used a small molecule inhibitor to screen a highly saturated transposon library for cellular factors that become essential when WTA is depleted. We constructed an interaction network connecting WTAs with genes involved in LTA synthesis, peptidoglycan synthesis, surface protein display, and D-alanine cell envelope modifications. Although LTAs and WTAs are synthetically lethal, we report that they do not have the same synthetic interactions with other cell envelope genes. For example, D-alanylation, a tailoring modification of both WTAs and LTAs, becomes essential when the former, but not the latter, are removed. Therefore, D-alanine–tailored LTAs are required for survival when WTAs are absent. Examination of terminal phenotoypes led to the unexpected discovery that cells lacking both LTAs and WTAs lose their ability to form Z rings and can no longer divide. We have concluded that the presence of either LTAs or WTAs on the cell surface is required for initiation of S. aureus cell division, but these polymers act as part of distinct cellular networks. PMID:25104751

  6. Chlamydia trachomatis Scavenges Host Fatty Acids for Phospholipid Synthesis via an Acyl-Acyl Carrier Protein Synthetase*

    PubMed Central

    Yao, Jiangwei; Dodson, V. Joshua; Frank, Matthew W.; Rock, Charles O.

    2015-01-01

    The obligate intracellular parasite Chlamydia trachomatis has a reduced genome but relies on de novo fatty acid and phospholipid biosynthesis to produce its membrane phospholipids. Lipidomic analyses showed that 8% of the phospholipid molecular species synthesized by C. trachomatis contained oleic acid, an abundant host fatty acid that cannot be made by the bacterium. Mass tracing experiments showed that isotopically labeled palmitic, myristic, and lauric acids added to the medium were incorporated into C. trachomatis-derived phospholipid molecular species. HeLa cells did not elongate lauric acid, but infected HeLa cell cultures elongated laurate to myristate and palmitate. The elongated fatty acids were incorporated exclusively into C. trachomatis-produced phospholipid molecular species. C. trachomatis has adjacent genes encoding the separate domains of the bifunctional acyl-acyl carrier protein (ACP) synthetase/2-acylglycerolphosphoethanolamine acyltransferase gene (aas) of Escherichia coli. The CT775 gene encodes an acyltransferase (LpaT) that selectively transfers fatty acids from acyl-ACP to the 1-position of 2-acyl-glycerophospholipids. The CT776 gene encodes an acyl-ACP synthetase (AasC) with a substrate preference for palmitic compared with oleic acid in vitro. Exogenous fatty acids were elongated and incorporated into phospholipids by Escherichia coli-expressing AasC, illustrating its function as an acyl-ACP synthetase in vivo. These data point to an AasC-dependent pathway in C. trachomatis that selectively scavenges host saturated fatty acids to be used for the de novo synthesis of its membrane constituents. PMID:26195634

  7. Chlamydia trachomatis Scavenges Host Fatty Acids for Phospholipid Synthesis via an Acyl-Acyl Carrier Protein Synthetase.

    PubMed

    Yao, Jiangwei; Dodson, V Joshua; Frank, Matthew W; Rock, Charles O

    2015-09-01

    The obligate intracellular parasite Chlamydia trachomatis has a reduced genome but relies on de novo fatty acid and phospholipid biosynthesis to produce its membrane phospholipids. Lipidomic analyses showed that 8% of the phospholipid molecular species synthesized by C. trachomatis contained oleic acid, an abundant host fatty acid that cannot be made by the bacterium. Mass tracing experiments showed that isotopically labeled palmitic, myristic, and lauric acids added to the medium were incorporated into C. trachomatis-derived phospholipid molecular species. HeLa cells did not elongate lauric acid, but infected HeLa cell cultures elongated laurate to myristate and palmitate. The elongated fatty acids were incorporated exclusively into C. trachomatis-produced phospholipid molecular species. C. trachomatis has adjacent genes encoding the separate domains of the bifunctional acyl-acyl carrier protein (ACP) synthetase/2-acylglycerolphosphoethanolamine acyltransferase gene (aas) of Escherichia coli. The CT775 gene encodes an acyltransferase (LpaT) that selectively transfers fatty acids from acyl-ACP to the 1-position of 2-acyl-glycerophospholipids. The CT776 gene encodes an acyl-ACP synthetase (AasC) with a substrate preference for palmitic compared with oleic acid in vitro. Exogenous fatty acids were elongated and incorporated into phospholipids by Escherichia coli-expressing AasC, illustrating its function as an acyl-ACP synthetase in vivo. These data point to an AasC-dependent pathway in C. trachomatis that selectively scavenges host saturated fatty acids to be used for the de novo synthesis of its membrane constituents. PMID:26195634

  8. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  9. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    SciTech Connect

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  10. SpeedyGenes: Exploiting an Improved Gene Synthesis Method for the Efficient Production of Synthetic Protein Libraries for Directed Evolution.

    PubMed

    Currin, Andrew; Swainston, Neil; Day, Philip J; Kell, Douglas B

    2017-01-01

    Gene synthesis is a fundamental technology underpinning much research in the life sciences. In particular, synthetic biology and biotechnology utilize gene synthesis to assemble any desired DNA sequence, which can then be incorporated into novel parts and pathways. Here, we describe SpeedyGenes, a gene synthesis method that can assemble DNA sequences with greater fidelity (fewer errors) than existing methods, but that can also be used to encode extensive, statistically designed sequence variation at any position in the sequence to create diverse (but accurate) variant libraries. We summarize the integrated use of GeneGenie to design DNA and oligonucleotide sequences, followed by the procedure for assembling these accurately and efficiently using SpeedyGenes.

  11. SpeedyGenes: Exploiting an Improved Gene Synthesis Method for the Efficient Production of Synthetic Protein Libraries for Directed Evolution.

    PubMed

    Currin, Andrew; Swainston, Neil; Day, Philip J; Kell, Douglas B

    2017-01-01

    Gene synthesis is a fundamental technology underpinning much research in the life sciences. In particular, synthetic biology and biotechnology utilize gene synthesis to assemble any desired DNA sequence, which can then be incorporated into novel parts and pathways. Here, we describe SpeedyGenes, a gene synthesis method that can assemble DNA sequences with greater fidelity (fewer errors) than existing methods, but that can also be used to encode extensive, statistically designed sequence variation at any position in the sequence to create diverse (but accurate) variant libraries. We summarize the integrated use of GeneGenie to design DNA and oligonucleotide sequences, followed by the procedure for assembling these accurately and efficiently using SpeedyGenes. PMID:27671932

  12. Synthesis and secretion of the mouse whey acidic protein in transgenic sheep.

    PubMed

    Wall, R J; Rexroad, C E; Powell, A; Shamay, A; McKnight, R; Hennighausen, L

    1996-01-01

    The synthesis of foreign proteins can be targeted to the mammary gland of transgenic animals, thus permitting commercial purification of otherwise unavailable proteins from milk. Genetic regulatory elements from the mouse whey acidic protein (WAP) gene have been used successfully to direct expression of transgenes to the mammary gland of mice, goats and pigs. To extend the practical usefulness of WAP promoter-driven fusion genes and further characterize WAP expression in heterologous species, we introduced a 6.8 kb DNA fragment containing the genomic form of the mouse WAP gene into sheep zygotes. Two lines of transgenic sheep were produced. The transgene was expressed in mammary tissue of both lines and intact WAP was secreted into milk at concentrations estimated to range from 100 to 500 mg/litre. Ectopic WAP gene expression was found in salivary gland, spleen, liver, lung, heart muscle, kidney and bone marrow of one founder ewe. WAP RNA was not detected in skeletal muscle and intestine. These data suggest that unlike pigs, sheep may possess nuclear factors in a variety of tissues that interact with WAP regulatory sequences. Though the data presented are based on only two lines, these findings suggest WAP regulatory sequences may not be suitable as control elements for transgenes in sheep bioreactors. PMID:8589741

  13. Starch synthesis in Arabidopsis is achieved by spatial cotranscription of core starch metabolism genes.

    PubMed

    Tsai, Huang-Lung; Lue, Wei-Ling; Lu, Kuan-Jen; Hsieh, Ming-Hsiun; Wang, Shue-Mei; Chen, Jychian

    2009-11-01

    Starch synthesis and degradation require the participation of many enzymes, occur in both photosynthetic and nonphotosynthetic tissues, and are subject to environmental and developmental regulation. We examine the distribution of starch in vegetative tissues of Arabidopsis (Arabidopsis thaliana) and the expression of genes encoding core enzymes for starch synthesis. Starch is accumulated in plastids of epidermal, mesophyll, vascular, and root cap cells but not in root proper cells. We also identify cells that can synthesize starch heterotrophically in albino mutants. Starch synthesis in leaves is regulated by developmental stage and light. Expression of gene promoter-beta-glucuronidase fusion constructs in transgenic seedlings shows that starch synthesis genes are transcriptionally active in cells with starch synthesis and are inactive in root proper cells except the plastidial phosphoglucose isomerase. In addition, ADG2 (for ADPG PYROPHOSPHORYLASE2) is not required for starch synthesis in root cap cells. Expression profile analysis reveals that starch metabolism genes can be clustered into two sets based on their tissue-specific expression patterns. Starch distribution and expression pattern of core starch synthesis genes are common in Arabidopsis and rice (Oryza sativa), suggesting that the regulatory mechanism for starch metabolism genes may be conserved evolutionarily. We conclude that starch synthesis in Arabidopsis is achieved by spatial coexpression of core starch metabolism genes regulated by their promoter activities and is fine-tuned by cell-specific endogenous and environmental controls.

  14. Detection of genes involved in fatty acid elongation and desaturation in thraustochytrid marine eukaryotes.

    PubMed

    Nagano, Naoki; Sakaguchi, Keishi; Taoka, Yousuke; Okita, Yuji; Honda, Daiske; Ito, Makoto; Hayashi, Masahiro

    2011-01-01

    Heterotrophic marine protists known as thraustochytrids can synthesize polyunsaturated fatty acids (PUFAs) such as docosahexaenoic acid (DHA). The biosynthetic pathways of PUFAs in thraustochytrids are poorly understood, however. In this study, we attempted to reveal the enzymes involved in DHA synthesis in thraustochytrids. Nine thraustochytrid strains representing 3 genera (Aurantiochytrium, Schizochytrium, and Thraustochytrium) were used for PCR-based detection of the genes encoding Δ5-elongase and Δ4-desaturase and for fatty acid analysis. The degenerate primers were designed to amplify the Δ5-elongase and Δ4-desaturase genes, and the partial sequences of the enzymes were obtained from the genera Thraustochytrium and Schizochytrium. These fragments were identical to those of known Δ5-elongase and Δ4-desaturase. Neither Δ5-elongase nor Δ4-desaturase was detected in the strains belonging to the genus Aurantiochytrium, however, suggesting that this group likely synthesizes DHA not via the elongation/desaturation pathway but via an alternate pathway such as the polyketide synthase pathway. The fatty acid profiles of thraustochytrids were consistent with the presence of genes involved in PUFA biosynthesis in thraustochytrid genera. Thus, our findings suggest that two biosynthetic pathways for PUFAs exist in these organisms.

  15. Highly expressed amino acid biosynthesis genes revealed by global gene expression analysis of Salmonella enterica serovar Enteritidis during growth in whole egg are not essential for this growth.

    PubMed

    Jakočiūnė, Džiuginta; Herrero-Fresno, Ana; Jelsbak, Lotte; Olsen, John Elmerdahl

    2016-05-01

    Salmonella enterica serovar Enteritidis (S. Enteritidis) is the most common cause of egg borne salmonellosis in many parts of the world. This study analyzed gene expression of this bacterium during growth in whole egg, and whether highly expressed genes were essential for the growth. High quality RNA was extracted from S. Enteritidis using a modified RNA-extraction protocol. Global gene expression during growth in whole egg was compared to growth in LB-medium using DNA array method. Twenty-six genes were significantly upregulated during growth in egg; these belonged to amino acid biosynthesis, di/oligopeptide transport system, biotin synthesis, ferrous iron transport system, and type III secretion system. Significant downregulation of 15 genes related to formate hydrogenlyase (FHL) and trehalose metabolism was observed. The results suggested that S. Enteritidis is starved for amino-acids, biotin and iron when growing in egg. However, site specific mutation of amino acid biosynthesis genes asnA (17.3 fold upregulated), asnB (18.6 fold upregulated), asnA/asnB and, serA (12.0 fold upregulated) and gdhA (3.7 fold upregulated), did not result in growth attenuation, suggesting that biosynthesis using the enzymes encoded from these genes may represent the first choice for S. Enteritidis when growing in egg, but when absent, the bacterium could use alternative ways to obtain the amino acids. PMID:26945769

  16. Highly expressed amino acid biosynthesis genes revealed by global gene expression analysis of Salmonella enterica serovar Enteritidis during growth in whole egg are not essential for this growth.

    PubMed

    Jakočiūnė, Džiuginta; Herrero-Fresno, Ana; Jelsbak, Lotte; Olsen, John Elmerdahl

    2016-05-01

    Salmonella enterica serovar Enteritidis (S. Enteritidis) is the most common cause of egg borne salmonellosis in many parts of the world. This study analyzed gene expression of this bacterium during growth in whole egg, and whether highly expressed genes were essential for the growth. High quality RNA was extracted from S. Enteritidis using a modified RNA-extraction protocol. Global gene expression during growth in whole egg was compared to growth in LB-medium using DNA array method. Twenty-six genes were significantly upregulated during growth in egg; these belonged to amino acid biosynthesis, di/oligopeptide transport system, biotin synthesis, ferrous iron transport system, and type III secretion system. Significant downregulation of 15 genes related to formate hydrogenlyase (FHL) and trehalose metabolism was observed. The results suggested that S. Enteritidis is starved for amino-acids, biotin and iron when growing in egg. However, site specific mutation of amino acid biosynthesis genes asnA (17.3 fold upregulated), asnB (18.6 fold upregulated), asnA/asnB and, serA (12.0 fold upregulated) and gdhA (3.7 fold upregulated), did not result in growth attenuation, suggesting that biosynthesis using the enzymes encoded from these genes may represent the first choice for S. Enteritidis when growing in egg, but when absent, the bacterium could use alternative ways to obtain the amino acids.

  17. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  18. A yeast acetyl coenzyme A carboxylase mutant links very-long-chain fatty acid synthesis to the structure and function of the nuclear membrane-pore complex.

    PubMed Central

    Schneiter, R; Hitomi, M; Ivessa, A S; Fasch, E V; Kohlwein, S D; Tartakoff, A M

    1996-01-01

    The conditional mRNA transport mutant of Saccharomyces cerevisiae, acc1-7-1 (mtr7-1), displays a unique alteration of the nuclear envelope. Unlike nucleoporin mutants and other RNA transport mutants, the intermembrane space expands, protuberances extend from the inner membrane into the intermembrane space, and vesicles accumulate in the intermembrane space. MTR7 is the same gene as ACC1, encoding acetyl coenzyme A (CoA) carboxylase (Acc1p), the rate-limiting enzyme of de novo fatty acid synthesis. Genetic and biochemical analyses of fatty acid synthesis mutants and acc1-7-1 indicate that the continued synthesis of malonyl-CoA, the enzymatic product of acetyl-CoA carboxylase, is required for an essential pathway which is independent from de novo synthesis of fatty acids. We provide evidence that synthesis of very-long-chain fatty acids (C26 atoms) is inhibited in acc1-7-1, suggesting that very-long-chain fatty acid synthesis is required to maintain a functional nuclear envelope. PMID:8943372

  19. Differential Contribution of Endoplasmic Reticulum and Chloroplast ω-3 Fatty Acid Desaturase Genes to the Linolenic Acid Content of Olive (Olea europaea) Fruit.

    PubMed

    Hernández, M Luisa; Sicardo, M Dolores; Martínez-Rivas, José M

    2016-01-01

    Linolenic acid is a polyunsaturated fatty acid present in plant lipids, which plays key roles in plant metabolism as a structural component of storage and membrane lipids, and as a precursor of signaling molecules. The synthesis of linolenic acid is catalyzed by two different ω-3 fatty acid desaturases, which correspond to microsomal- (FAD3) and chloroplast- (FAD7 and FAD8) localized enzymes. We have investigated the specific contribution of each enzyme to the linolenic acid content in olive fruit. With that aim, we isolated two different cDNA clones encoding two ω-3 fatty acid desaturases from olive (Olea europaea cv. Picual). Sequence analysis indicates that they code for microsomal (OepFAD3B) and chloroplast (OepFAD7-2) ω-3 fatty acid desaturase enzymes, different from the previously characterized OekFAD3A and OekFAD7-1 genes. Functional expression in yeast of the corresponding OepFAD3A and OepFAD3B cDNAs confirmed that they encode microsomal ω-3 fatty acid desaturases. The linolenic acid content and transcript levels of olive FAD3 and FAD7 genes were measured in different tissues of Picual and Arbequina cultivars, including mesocarp and seed during development and ripening of olive fruit. Gene expression and lipid analysis indicate that FAD3A is the gene mainly responsible for the linolenic acid present in the seed, while FAD7-1 and FAD7-2 contribute mostly to the linolenic acid present in the mesocarp and, therefore, in the olive oil. These results also indicate the relevance of lipid trafficking between the endoplasmic reticulum and chloroplast in determining the linolenic acid content of membrane and storage lipids in oil-accumulating photosynthetic tissues.

  20. Characterization of salicylic acid-induced genes in Chinese cabbage.

    PubMed

    Park, Y-S; Min, H-J; Ryang, S-H; Oh, K-J; Cha, J-S; Kim, H Y; Cho, T-J

    2003-06-01

    Salicylic acid is a messenger molecule in the activation of defense responses in plants. In this study, we isolated four cDNA clones representing salicylic acid-induced genes in Chinese cabbage (Brassica rapa subsp. pekinensis) by subtractive hybridization. Of the four clones, the BC5-2 clone encodes a putative glucosyltransferase protein. The BC5-3 clone is highly similar to an Arabidopsis gene encoding a putative metal-binding farnesylated protein. The BC6-1 clone is a chitinase gene with similarities to a rapeseed class IV chitinase. Class IV chitinases have deletions in the chitin-binding and catalytic domains and the BC6-1 chitinase has an additional deletion in the catalytic domain. The BCP8-1 clone is most homologous to an Arabidopsis gene that contains a tandem array of two thiJ-like sequences. These four cabbage genes were barely expressed in healthy leaves, but were strongly induced by salicylic acid and benzothiadiazole. Expression of the three genes represented by the BC5-2, BC5-3 and BCP8-1 clones were also induced by Pseudomonas syringae pv. tomato, a nonhost pathogen that elicits a hypersensitive response in Chinese cabbage. None of these four genes, however, was strongly induced by methyl jasmonate or by ethylene.

  1. Production of γ-linolenic acid and stearidonic acid by Synechococcus sp. PCC7002 containing cyanobacterial fatty acid desaturase genes

    NASA Astrophysics Data System (ADS)

    Dong, Xuewei; He, Qingfang; Peng, Zhenying; Yu, Jinhui; Bian, Fei; Li, Youzhi; Bi, Yuping

    2016-07-01

    Genetic modification is useful for improving the nutritional qualities of cyanobacteria. To increase the total unsaturated fatty acid content, along with the ratio of ω-3/ω-6 fatty acids, genetic engineering can be used to modify fatty acid metabolism. Synechococcus sp. PCC7002, a fast-growing cyanobacterium, does not contain a Δ6 desaturase gene and is therefore unable to synthesize γ-linolenic acid (GLA) and stearidonic acid (SDA), which are important in human health. In this work, we constructed recombinant vectors Syd6D, Syd15D and Syd6Dd15D to express the Δ15 desaturase and Δ6 desaturase genes from Synechocystis PCC6803 in Synechococcus sp. PCC7002, with the aim of expressing polyunsaturated fatty acids. Overexpression of the Δ15 desaturase gene in Synechococcus resulted in 5.4 times greater accumulation of α-linolenic acid compared with the wild-type while Δ6 desaturase gene expression produced both GLA and SDA. Co-expression of the two genes resulted in low-level accumulation of GLA but much larger amounts of SDA, accounting for as much to 11.64% of the total fatty acid content.

  2. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  3. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  4. Mycobacterium tuberculosis SigM positively regulates Esx secreted protein and nonribosomal peptide synthetase genes and down regulates virulence-associated surface lipid synthesis.

    PubMed

    Raman, Sahadevan; Puyang, Xiaoling; Cheng, Tan-Yun; Young, David C; Moody, D Branch; Husson, Robert N

    2006-12-01

    The Mycobacterium tuberculosis genome encodes 12 alternative sigma factors, several of which regulate stress responses and are required for virulence in animal models of acute infection. In this work we investigated M. tuberculosis SigM, a member of the extracytoplasmic function subfamily of alternative sigma factors. This sigma factor is expressed at low levels in vitro and does not appear to function in stress response regulation. Instead, SigM positively regulates genes required for the synthesis of surface or secreted molecules. Among these are genes encoding two pairs of Esx secreted proteins, a multisubunit nonribosomal peptide synthetase operon, and genes encoding two members of the proline-proline-glutamate (PPE) family of proteins. Genes up regulated in a sigM mutant strain include a different PPE gene, as well as several genes involved in surface lipid synthesis. Among these are genes involved in synthesis of phthiocerol dimycocerosate (PDIM), a surface lipid critical for virulence during acute infection, and the kasA-kasB operon, which is required for mycolic acid synthesis. Analysis of surface lipids showed that PDIM synthesis is increased in a sigM-disrupted strain and is undetectable in a sigM overexpression strain. These findings demonstrate that SigM positively and negatively regulates cell surface and secreted molecules that are likely to function in host-pathogen interactions. PMID:17028284

  5. Structure and expression of the Drosophila ubiquitin-80-amino-acid fusion-protein gene.

    PubMed Central

    Barrio, R; del Arco, A; Cabrera, H L; Arribas, C

    1994-01-01

    In the fruitfly Drosophila, as in all eukaryotes examined so far, some ubiquitin-coding sequences appear fused to unrelated open reading frames. Two of these fusion genes have been previously described (the homologues of UBI1-UBI2 and UBI4 in yeast), and we report here the organization and expression of a third one, the DUb80 gene (the homologue of UBI3 in yeast). This gene encodes a ubiquitin monomer fused to an 80-amino-acid extension which is homologous with the ribosomal protein encoded by the UB13 gene. The 5' regulatory region of DUb80 shares common features with another ubiquitin fusion gene, DUb52, and with the ribosomal protein genes of Drosophila, Xenopus and mouse. We also find helix-loop-helix protein-binding sequences (E-boxes). The DUb80 gene is transcribed to a 0.9 kb mRNA which is particularly abundant under conditions of high protein synthesis, such as in ovaries and exponentially growing cells. Images Figure 3 Figure 4 PMID:8068011

  6. Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

    PubMed

    Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

    2015-04-01

    D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

  7. Deletion of genes encoding fatty acid desaturases leads to alterations in stress sensitivity in Pichia pastoris.

    PubMed

    Zhang, Meng; Liu, Zhe; Yu, Qilin; Mao, Jiwei; Zhang, Biao; Xing, Laijun; Li, Mingchun

    2015-06-01

    Unsaturated fatty acids (UFAs) are key compounds which have important roles in maintaining cell membrane physiological functions and the adaption to tough conditions. Defects of fatty acid desaturases will change cellular UFA constitution. Pichia pastoris GS115 has four fatty acid desaturase genes, namely FAD9A, FAD9B, FAD12 and FAD15. Their products catalyze the synthesis of three kinds of UFAs, oleic acid (catalyzed by Fad9A and Fad9B), linoleic acid (catalyzed by Fad12) and α-linolenic acid (catalyzed by Fad15), respectively. In this study, we found that deletion of FAD12 led to increased resistance to oxidative stress. Cellular lipid peroxidation levels declined in the fad12Δ mutant upon H2O2 treatment. Cellular fatty acids compositions were changed with the increased expression of FAD9A. On the other hand, deletion of FAD9A resulted in increased tolerance to the plasma membrane (PM) damage agent SDS, and PM deformation was not detected in the fad9AΔ mutant under this stress. Our results showed that UFAs are related to cell adaption to adverse environmental changes.

  8. Sugar-mediated semidian oscillation of gene expression in the cassava storage root regulates starch synthesis

    PubMed Central

    Baguma, Yona; Sun, Chuanxin; Borén, Mats; Olsson, Helena; Rosenqvist, Sara; Mutisya, Joel; Rubaihayo, Patrick R

    2008-01-01

    Starch branching enzyme (SBE) activity in the cassava storage root exhibited a diurnal fluctuation, dictated by a transcriptional oscillation of the corresponding SBE genes. The peak of SBE activity coincided with the onset of sucrose accumulation in the storage, and we conclude that the oscillatory mechanism keeps the starch synthetic apparatus in the storage root sink in tune with the flux of sucrose from the photosynthetic source. When storage roots were uncoupled from the source, SBE expression could be effectively induced by exogenous sucrose. Turanose, a sucrose isomer that cannot be metabolized by plants, mimicked the effect of sucrose, demonstrating that downstream metabolism of sucrose was not necessary for signal transmission. Also glucose and glucose-1-P induced SBE expression. Interestingly, induction by sucrose, turanose and glucose but not glucose-1-P sustained an overt semidian (12-h) oscillation in SBE expression and was sensitive to the hexokinase (HXK) inhibitor glucosamine. These results suggest a pivotal regulatory role for HXK during starch synthesis. Abscisic acid (ABA) was another potent inducer of SBE expression. Induction by ABA was similar to that of glucose-1-P in that it bypassed the semidian oscillator. Both the sugar and ABA signaling cascades were disrupted by okadaic acid, a protein phosphatase inhibitor. Based on these findings, we propose a model for sugar signaling in regulation of starch synthesis in the cassava storage root. PMID:19513234

  9. Sugar-mediated semidian oscillation of gene expression in the cassava storage root regulates starch synthesis

    SciTech Connect

    Jansson, Christer; Baguma, Yona; Sun, Chuanxin; Boren, Mats; Olsson, Helena; Rosenqvist, Sara; Mutisya, Joel; Rubaihayo, Patrick R.; Jansson, Christer

    2008-01-15

    Starch branching enzyme (SBE) activity in the cassava storage root exhibited a diurnal fluctuation, dictated by a transcriptional oscillation of the corresponding SBE genes. The peak of SBE activity coincided with the onset of sucrose accumulation in the storage, and we conclude that the oscillatory mechanism keeps the starch synthetic apparatus in the storage root sink in tune with the flux of sucrose from the photosynthetic source. When storage roots were uncoupled from the source, SBE expression could be effectively induced by exogenous sucrose. Turanose, a sucrose isomer that cannot be metabolized by plants, mimicked the effect of sucrose, demonstrating that downstream metabolism of sucrose was not necessary for signal transmission. Also glucose and glucose-1-P induced SBE expression. Interestingly, induction by sucrose, turanose and glucose but not glucose-1-P sustained an overt semidian (12-h) oscillation in SBE expression and was sensitive to the hexokinase (HXK) inhibitor glucosamine. These results suggest a pivotal regulatory role for HXK during starch synthesis. Abscisic acid (ABA) was another potent inducer of SBE expression. Induction by ABA was similar to that of glucose-1-P in that it bypassed the semidian oscillator. Both the sugar and ABA signaling cascades were disrupted by okadaic acid, a protein phosphatase inhibitor. Based on these findings, we propose a model for sugar signaling in regulation of starch synthesis in the cassava storage root.

  10. Ribonucleic acid interference induced gene knockdown

    PubMed Central

    Gottumukkala, Sruthima N. V. S.; Dwarakanath, C. D.; Sudarsan, Sabitha

    2013-01-01

    Despite major advances in periodontal regeneration over the past three decades, complete regeneration of the lost periodontium on a regular and predictable basis in humans has still remained elusive. The identification of stem cells in the periodontal ligament together with the growing concept of tissue engineering has opened new vistas in periodontal regenerative medicine. In this regard, ribonucleic acid interference (RNAi) opens a new gate way for a novel RNA based approach in periodontal management. This paper aims to summarize the current opinion on the mechanisms underlying RNAi, in vitro and in vivo existing applications in the dental research, which could lead to their future use in periodontal regeneration. PMID:24174717

  11. Synthesis and application of acid labile anchor groups for the synthesis of peptide amides by Fmoc-solid-phase peptide synthesis.

    PubMed

    Breipohl, G; Knolle, J; Stüber, W

    1989-10-01

    The preparation and application of a new linker for the synthesis of peptide amides using a modified Fmoc-method is described. The new anchor group was developed based on our experience with 4,4'-dimethoxybenzhydryl (Mbh)-protecting group for amides. Lability towards acid treatment was increased dramatically and results in an easy cleavage procedure for the preparation of peptide amides. The synthesis of N-9-fluorenylmethoxycarbonyl- ([5-carboxylatoethyl-2.4-dimethoxyphenyl)- 4'-methoxyphenyl]-methylamin is reported in detail. This linker was coupled to a commercially available aminomethyl polystyrene resin. Peptide synthesis proceeded smoothly using HOOBt esters of Fmoc-amino acids. Release of the peptide amide and final cleavage of the side chain protecting groups was accomplished by treatment with trifluoroacetic acid-dichloromethane mixtures in the presence of scavengers. The synthesis of peptide amides such as LHRH and C-terminal hexapeptide of secretin are given as examples.

  12. Synthesis of elastic biodegradable polyesters of ethylene glycol and butylene glycol from sebacic acid.

    PubMed

    Park, Hyung-seok; Seo, Jung-a; Lee, Hye-Young; Kim, Hae-Won; Wall, Ivan B; Gong, Myoung-Seon; Knowles, Jonathan C

    2012-08-01

    High molecular weight biodegradable polyesters were prepared from sebacic acid, ethylene glycol and butylene glycol through a simple non-solvent polycondensation with a low toxicity catalyst. The successful synthesis of the polyesters was confirmed by gel permeation chromatography, (1)H-nuclear magnetic resonance and Fourier transform-infrared spectroscopies and differential scanning calorimetry. The degradation tests were performed at 37 °C in phosphate buffer solution (pH 7.4) and showed a mass loss of ~5% over 12 weeks compared with only 2% for polycaprolactone (PCL). Reverse transcription polymerase chain reaction results following culture of osteoblasts on the polymer surface showed that poly(ethylene sebacate) and poly(butylene sebacate) films were optimal for osteoblast formation in terms of Runx 2 and osteocalcin gene expression.

  13. Effects of oral eicosapentaenoic acid versus docosahexaenoic acid on human peripheral blood mononuclear cell gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objective: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have beneficial effects on inflammation and cardiovascular disease (CVD). Our aim was to assess the effect of a six-week supplementation with either olive oil, EPA, or DHA on gene expression in peripheral blood mononuclear cells (...

  14. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  15. Regulation of protein synthesis by amino acids in muscle of neonates.

    PubMed

    Suryawan, Agus; Davis, Teresa A

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed.

  16. Synthesis of L-ascorbic acid in the phloem

    PubMed Central

    Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto

    2003-01-01

    Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288

  17. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  18. Tailored fatty acid synthesis via dynamic control of fatty acid elongation.

    PubMed

    Torella, Joseph P; Ford, Tyler J; Kim, Scott N; Chen, Amanda M; Way, Jeffrey C; Silver, Pamela A

    2013-07-01

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  19. Thioacetic acid/NaSH-mediated synthesis of N-protected amino thioacids and their utility in peptide synthesis.

    PubMed

    Mali, Sachitanand M; Gopi, Hosahudya N

    2014-03-21

    Thioacids are recently gaining momentum due to their versatile reactivity. The reactivity of thioacids has been widely explored in the selective amide/peptide bond formation. Thioacids are generally synthesized from the reaction between activated carboxylic acids such as acid chlorides, active esters, etc., and Na2S, H2S, or NaSH. We sought to investigate whether the versatile reactivity of the thioacids can be tuned for the conversion of carboxylic acids into corresponding thioacids in the presence of NaSH. Herein, we report that thioacetic acid- and NaSH-mediated synthesis of N-protected amino thioacids from the corresponding N-protected amino acids, oxidative dimerization of thioacids, crystal conformations of thioacid oxidative dimers, and the utility of thioacids and oxidative dimers in peptide synthesis. Our results suggest that peptides can be synthesized without using standard coupling agents.

  20. [Control of gene expression by antisense nucleic acids].

    PubMed

    Lebleu, B; Clarenc, J P; Degols, G; Leonetti, J P; Milhaud, P

    1992-01-01

    The use of antisense RNA or of antisense oligonucleotides for the specific control of viral or cellular genes expression has undergone rapid developments recently; their respective advantages and drawbacks will be discussed. Progresses in oligonucleotides chemistry have lead to the synthesis of analogs with improved pharmacological properties. Besides the antisense approach, which usually targets translation initiation or splicing sites, it is possible to interfere specifically with gene expression through triple helix formation (anti-gene strategy) or through the titration of regulatory proteins (sense approach). A major problem encountered in the use of synthetic oligonucleotides is their delivery to their nuclear or cytoplasmic targets after cell uptake by an endocytic pathway; our own work in this field will be discussed. Finally, we will describe the strategies followed by our group to improve the bioavailability of antisense oligonucleotides, as for instance conjugation to poly (L-lysine) or encapsidation in antibody-targeted liposomes.

  1. Sinorhizobium meliloti Functionally Replaces 3-Oxoacyl-Acyl Carrier Protein Reductase (FabG) by Overexpressing NodG During Fatty Acid Synthesis.

    PubMed

    Mao, Ya-Hui; Li, Feng; Ma, Jin-Cheng; Hu, Zhe; Wang, Hai-Hong

    2016-06-01

    In Sinorhizobium meliloti, the nodG gene is located in the nodFEG operon of the symbiotic plasmid. Although strong sequence similarity (53% amino acid identities) between S. meliloti NodG and Escherichia coli FabG was reported in 1992, it has not been determined whether S. meliloti NodG plays a role in fatty acid synthesis. We report that expression of S. meliloti NodG restores the growth of the E. coli fabG temperature-sensitive mutant CL104 under nonpermissive conditions. Using in vitro assays, we demonstrated that NodG is able to catalyze the reduction of the 3-oxoacyl-ACP intermediates in E. coli fatty acid synthetic reaction. Moreover, although deletion of the S. meliloti nodG gene does not cause any growth defects, upon overexpression of nodG from a plasmid, the S. meliloti fabG gene encoding the canonical 3-oxoacyl-ACP reductase (OAR) can be disrupted without any effects on growth or fatty acid composition. This indicates that S. meliloti nodG encodes an OAR and can play a role in fatty acid synthesis when expressed at sufficiently high levels. Thus, a bacterium can simultaneously possess two or more OARs that can play a role in fatty acid synthesis. Our data also showed that, although SmnodG increases alfalfa nodulation efficiency, it is not essential for alfalfa nodulation. PMID:26975437

  2. Activation of the constitutive androstane receptor inhibits gluconeogenesis without affecting lipogenesis or fatty acid synthesis in human hepatocytes

    SciTech Connect

    Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

    2014-08-15

    Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches. • The role

  3. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  4. Identification of nitrogen-fixing genes and gene clusters from metagenomic library of acid mine drainage.

    PubMed

    Dai, Zhimin; Guo, Xue; Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community.

  5. Identification of Nitrogen-Fixing Genes and Gene Clusters from Metagenomic Library of Acid Mine Drainage

    PubMed Central

    Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community. PMID:24498417

  6. Identification and expression of a stearoyl-ACP desaturase gene responsible for oleic acid accumulation in Xanthoceras sorbifolia seeds.

    PubMed

    Zhao, Na; Zhang, Yuan; Li, Qiuqi; Li, Rufang; Xia, Xinli; Qin, Xiaowei; Guo, Huihong

    2015-02-01

    Xanthoceras sorbifolia Bunge is an oilseed tree that grows well on barren lands in dry climate. Its seeds contain a large amount of oil rich in oleic acid (18:1(Δ9)) and linoleic acid (18:2(Δ9, 12)). However, the molecular regulation of oil biosynthesis in X. sorbifolia seeds is poorly understood. Stearoyl-ACP desaturase (SAD, EC 1.14.99.6) is a plastid-localized soluble desaturase that catalyzes the conversion of stearic acid (18:0) to oleic acid, which plays a key role in determining the ratio of saturated to unsaturated fatty acids. In this study, a full-length cDNA of XsSAD was isolated from developing X. sorbifolia embryos. The XsSAD open reading frame had 1194-bp, encoding a polypeptide of 397 amino acids. XsSAD expression in Escherichia coli cells resulted in increased 18:1(Δ9) level, confirming the biological activity of the enzyme encoded by XsSAD. XsSAD expression in Arabidopsis ssi2 mutants partially restored the morphological phenotype and effectively increased the 18:1(Δ9) level. The levels of other unsaturated fatty acids synthesized with 18:1(Δ9) as the substrate also increased to some degree. XsSAD in X. sorbifolia had a much higher expression in embryos than in leaves and petals. XsSAD expression also correlated well with the oleic acid, unsaturated fatty acid, and total fatty acid levels in developing embryos. These data suggested that XsSAD determined the synthesis of oleic acid and contributed to the accumulation of unsaturated fatty acid and total oil in X. sorbifolia seeds. A preliminary tobacco rattle virus-based virus-induced gene silencing system established in X. sorbifolia can also be helpful for further analyzing the functions of XsSAD and other oil synthesis-related genes in woody plants.

  7. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  8. Versatile Multicomponent Reaction Macrocycle Synthesis Using α-Isocyano-ω-carboxylic Acids.

    PubMed

    Liao, George P; Abdelraheem, Eman M M; Neochoritis, Constantinos G; Kurpiewska, Katarzyna; Kalinowska-Tłuścik, Justyna; McGowan, David C; Dömling, Alexander

    2015-10-16

    The direct macrocycle synthesis of α-isocyano-ω-carboxylic acids via an Ugi multicomponent reaction is introduced. This multicomponent reaction (MCR) protocol differs by being especially short, convergent, and versatile, giving access to 12-22 membered rings.

  9. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  10. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  11. Cadmium Induces Retinoic Acid Signaling by Regulating Retinoic Acid Metabolic Gene Expression*

    PubMed Central

    Cui, Yuxia; Freedman, Jonathan H.

    2009-01-01

    The transition metal cadmium is an environmental teratogen. In addition, cadmium and retinoic acid can act synergistically to induce forelimb malformations. The molecular mechanism underlying the teratogenicity of cadmium and the synergistic effect with retinoic acid has not been addressed. An evolutionarily conserved gene, β,β-carotene 15,15′-monooxygenase (BCMO), which is involved in retinoic acid biosynthesis, was studied in both Caenorhabditis elegans and murine Hepa 1–6 cells. In C. elegans, bcmo-1 was expressed in the intestine and was cadmium inducible. Similarly, in Hepa 1–6 cells, Bcmo1 was induced by cadmium. Retinoic acid-mediated signaling increased after 24-h exposures to 5 and 10 μm cadmium in Hepa 1–6 cells. Examination of gene expression demonstrated that the induction of retinoic acid signaling by cadmium may be mediated by overexpression of Bcmo1. Furthermore, cadmium inhibited the expression of Cyp26a1 and Cyp26b1, which are involved in retinoic acid degradation. These results indicate that cadmium-induced teratogenicity may be due to the ability of the metal to increase the levels of retinoic acid by disrupting the expression of retinoic acid-metabolizing genes. PMID:19556237

  12. Thymine, adenine and lipoamino acid based gene delivery systems.

    PubMed

    Skwarczynski, Mariusz; Ziora, Zyta M; Coles, Daniel J; Lin, I-Chun; Toth, Istvan

    2010-05-14

    A novel class of thymine, adenine and lipoamino acid based non-viral carriers for gene delivery has been developed. Their ability to bind to DNA by hydrogen bonding was confirmed by NMR diffusion, isothermal titration calorimetry and transmission electron microscopy experiments.

  13. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing.

    PubMed

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-21

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au(+) complexes, and then a class of ∼2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ∼1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au(+) complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe(3+) with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe(3+), and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs. PMID:26391420

  14. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  15. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  16. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement. PMID:21157681

  17. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed.

  18. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  19. Polymer production by Klebsiella pneumoniae 4-hydroxyphenylacetic acid hydroxylase genes cloned in Escherichia coli.

    PubMed Central

    Gibello, A; Ferrer, E; Sanz, J; Martin, M

    1995-01-01

    The expression of Klebsiella pneumoniae hpaA and hpaH genes, which code for 4-hydroxyphenylacetic acid hydroxylase in Escherichia coli K-12 derivative strains, is associated with the production of a dark brown pigment in the cultures. This pigment has been identified as a polymer which shows several of the characteristics reported for microbial melanins and results from the oxidative activity of 4-hydroxyphenylacetic acid hydroxylase on some dihydroxylated compounds to form o-quinones. A dibenzoquinone is formed from the oxidation of different mono- or dihydroxylated aromatic compounds by the enzyme prior to polymerization. We report a hydroxylase activity, other than tyrosinase, that is associated with the synthesis of a bacterial melanin. PMID:8534083

  20. A Δ-9 Fatty Acid Desaturase Gene in the Microalga Myrmecia incisa Reisigl: Cloning and Functional Analysis.

    PubMed

    Xue, Wen-Bin; Liu, Fan; Sun, Zheng; Zhou, Zhi-Gang

    2016-01-01

    The green alga Myrmecia incisa is one of the richest natural sources of arachidonic acid (ArA). To better understand the regulation of ArA biosynthesis in M. incisa, a novel gene putatively encoding the Δ9 fatty acid desaturase (FAD) was cloned and characterized for the first time. Rapid-amplification of cDNA ends (RACE) was employed to yield a full length cDNA designated as MiΔ9FAD, which is 2442 bp long in sequence. Comparing cDNA open reading frame (ORF) sequence to genomic sequence indicated that there are 8 introns interrupting the coding region. The deduced MiΔ9FAD protein is composed of 432 amino acids. It is soluble and localized in the chloroplast, as evidenced by the absence of transmembrane domains as well as the presence of a 61-amino acid chloroplast transit peptide. Multiple sequence alignment of amino acids revealed two conserved histidine-rich motifs, typical for Δ9 acyl-acyl carrier protein (ACP) desaturases. To determine the function of MiΔ9FAD, the gene was heterologously expressed in a Saccharomyces cerevisiae mutant strain with impaired desaturase activity. Results of GC-MS analysis indicated that MiΔ9FAD was able to restore the synthesis of monounsaturated fatty acids, generating palmitoleic acid and oleic acid through the addition of a double bond in the Δ9 position of palmitic acid and stearic acid, respectively. PMID:27438826

  1. A Δ-9 Fatty Acid Desaturase Gene in the Microalga Myrmecia incisa Reisigl: Cloning and Functional Analysis

    PubMed Central

    Xue, Wen-Bin; Liu, Fan; Sun, Zheng; Zhou, Zhi-Gang

    2016-01-01

    The green alga Myrmecia incisa is one of the richest natural sources of arachidonic acid (ArA). To better understand the regulation of ArA biosynthesis in M. incisa, a novel gene putatively encoding the Δ9 fatty acid desaturase (FAD) was cloned and characterized for the first time. Rapid-amplification of cDNA ends (RACE) was employed to yield a full length cDNA designated as MiΔ9FAD, which is 2442 bp long in sequence. Comparing cDNA open reading frame (ORF) sequence to genomic sequence indicated that there are 8 introns interrupting the coding region. The deduced MiΔ9FAD protein is composed of 432 amino acids. It is soluble and localized in the chloroplast, as evidenced by the absence of transmembrane domains as well as the presence of a 61-amino acid chloroplast transit peptide. Multiple sequence alignment of amino acids revealed two conserved histidine-rich motifs, typical for Δ9 acyl-acyl carrier protein (ACP) desaturases. To determine the function of MiΔ9FAD, the gene was heterologously expressed in a Saccharomyces cerevisiae mutant strain with impaired desaturase activity. Results of GC-MS analysis indicated that MiΔ9FAD was able to restore the synthesis of monounsaturated fatty acids, generating palmitoleic acid and oleic acid through the addition of a double bond in the Δ9 position of palmitic acid and stearic acid, respectively. PMID:27438826

  2. Fluorine containing amino acids: synthesis and peptide coupling of amino acids containing the all-cis tetrafluorocyclohexyl motif.

    PubMed

    Ayoup, Mohammed Salah; Cordes, David B; Slawin, Alexandra M Z; O'Hagan, David

    2015-05-28

    A synthesis of two (S)-phenylalanine derivatives is described which have the all-cis, 2,3,5,6-tetrafluorocyclohexyl motif attached to the aromatic ring at the meta and para positions; the para substituted isomer is elaborated into illustrative dipeptides via the free amine and carboxylate respectively demonstrating its utility as a novel amino acid for peptide synthesis and offering a vehicle for incorporation of this unique and facially polarized ring system into bioactive compounds.

  3. Highly efficient procedure for the synthesis of fructone fragrance using a novel carbon based acid.

    PubMed

    Hu, Baowei; Li, Chunqing; Zhao, Sheng-Xian; Rong, Lin-Mei; Lv, Shao-Qin; Liang, Xuezheng; Qi, Chenze

    2010-08-01

    The novel carbon based acid has been synthesized via one-step hydrothermal carbonization of furaldehyde and hydroxyethylsulfonic acid. A highly efficient procedure for the synthesis of fructone has been developed using the novel carbon based acid. The results showed that the catalyst possessed high activity for the reaction, giving a yield of over 95%. The advantages of high activity, stability, reusability and low cost for a simple synthesis procedure and wide applicability to various diols and beta-keto esters make this novel carbon based acid one of the best choices for the reaction.

  4. The role of submarine hydrothermal systems in the synthesis of amino acids.

    PubMed

    Aubrey, A D; Cleaves, H J; Bada, Jeffrey L

    2009-04-01

    There is little consensus regarding the plausibility of organic synthesis in submarine hydrothermal systems (SHSs) and its possible relevance to the origin of life. The primary reason for the persistence of this debate is that most experimental high temperature and high-pressure organic synthesis studies have neglected important geochemical constraints with respect to source material composition. We report here the results of experiments exploring the potential for amino acid synthesis at high temperature from synthetic seawater solutions of varying composition. The synthesis of amino acids was examined as a function of temperature, heating time, starting material composition and concentration. Using very favorable reactant conditions (high concentrations of reactive, reduced species), small amounts of a limited set of amino acids are generated at moderate temperature conditions ( approximately 125-175 degrees C) over short heating times of a few days, but even these products are significantly decomposed after exposure times of approximately 1 week. The high concentration dependence observed for these synthetic reactions are demonstrated by the fact that a 10-fold drop in concentration results in orders of magnitude lower yields of amino acids. There may be other synthetic mechanisms not studied herein that merit investigation, but the results are likely to be similar. We conclude that although amino acids can be generated from simple likely environmentally available precursors under SHS conditions, the equilibrium at high temperatures characteristic of SHSs favors net amino acid degradation rather than synthesis, and that synthesis at lower temperatures may be more favorable. PMID:19034685

  5. Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Gurvitz, Aner; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2008-08-01

    We describe the physiological function of heterologously expressed Mycobacterium tuberculosis InhA during de novo lipoic acid synthesis in yeast (Saccharomyces cerevisiae) mitochondria. InhA, representing 2-trans-enoyl-acyl carrier protein reductase and the target for the front-line antituberculous drug isoniazid, is involved in the activity of dissociative type 2 fatty acid synthase (FASII) that extends associative type 1 fatty acid synthase (FASI)-derived C(20) fatty acids to form C(60)-to-C(90) mycolic acids. Mycolic acids are major constituents of the protective layer around the pathogen that contribute to virulence and resistance to certain antimicrobials. Unlike FASI, FASII is thought to be incapable of de novo biosynthesis of fatty acids. Here, the genes for InhA (Rv1484) and four similar proteins (Rv0927c, Rv3485c, Rv3530c, and Rv3559c) were expressed in S. cerevisiae etr1Delta cells lacking mitochondrial 2-trans-enoyl-thioester reductase activity. The phenotype of the yeast mutants includes the inability to produce sufficient levels of lipoic acid, form mitochondrial cytochromes, respire, or grow on nonfermentable carbon sources. Yeast etr1Delta cells expressing mitochondrial InhA were able to respire, grow on glycerol, and produce lipoic acid. Commensurate with a role in mitochondrial de novo fatty acid biosynthesis, InhA could accept in vivo much shorter acyl-thioesters (C(4) to C(8)) than was previously thought (>C(12)). Moreover, InhA functioned in the absence of AcpM or protein-protein interactions with its native FASII partners KasA, KasB, FabD, and FabH. None of the four proteins similar to InhA complemented the yeast mutant phenotype. We discuss the implications of our findings with reference to lipoic acid synthesis in M. tuberculosis and the potential use of yeast FASII mutants for investigating the physiological function of drug-targeted pathogen enzymes involved in fatty acid biosynthesis. PMID:18552191

  6. Identification of a fourth gene involved in dTDP-rhamnose synthesis in Streptococcus mutans.

    PubMed Central

    Tsukioka, Y; Yamashita, Y; Nakano, Y; Oho, T; Koga, T

    1997-01-01

    We had isolated three genes (rmlA, rmlB, and rmlC) involved in dTDP-rhamnose synthesis in Streptococcus mutans and found that three genes were insufficient for dTDP-rhamnose synthesis (Y. Tsukioka, Y. Yamashita, T. Oho, Y. Nakano, and T. Koga, J. Bacteriol. 179:1126-1134, 1997). The rmlD gene of S. mutans, encoding the enzyme which catalyzes the last step of dTDP-rhamnose synthesis, has been cloned and sequenced. The cell extract of Escherichia coli expressing the rmlD gene of S. mutans exhibited enzymatic activity corresponding to its counterpart in Shigella flexneri, a gram-negative bacterium. Rhamnose was not detected in the cell wall preparation purified from the mutant in which the cloned gene was insertionally inactivated. Rabbit antiserum against S. mutans serotype c-specific antigen did not react with autoclaved extracts from the mutant. The rmlD gene product of S. mutans compensated for the incompleteness of dTDP-rhamnose synthesis by the three previously isolated genes. These results indicate that the rmlD gene product is indispensable for the dTDP-rhamnose pathway and subsequently for the synthesis of serotype-specific antigen in S. mutans. Furthermore, conservation of the rmlD gene in Streptococcus species was demonstrated by Southern blot analysis. PMID:9209063

  7. Coordinated regulation of melatonin synthesis and degradation genes in rice leaves in response to cadmium treatment.

    PubMed

    Byeon, Yeong; Lee, Hyoung Yool; Hwang, Ok Jin; Lee, Hye-Jung; Lee, Kyungjin; Back, Kyoungwhan

    2015-05-01

    We investigated the expression patterns of genes involved in melatonin synthesis and degradation in rice leaves upon cadmium (Cd) treatment and the subcellular localization sites of melatonin 2-hydroxylase (M2H) proteins. The Cd-induced synthesis of melatonin coincided with the increased expression of melatonin biosynthetic genes including tryptophan decarboxylase (TDC), tryptamine 5-hydroxylase (T5H), and N-acetylserotonin methyltransferase (ASMT). However, the expression of serotonin N-acetyltransferase (SNAT), the penultimate gene in melatonin biosynthesis, was downregulated, suggesting that melatonin synthesis was counter-regulated by SNAT. Notably, the induction of melatonin biosynthetic gene expression was coupled with the induction of four M2H genes involved in melatonin degradation, which suggests that genes for melatonin synthesis and degradation are coordinately regulated. The induced M2H gene expression was correlated with enhanced M2H enzyme activity. Three of the M2H proteins were localized to the cytoplasm and one M2H protein was localized to chloroplasts, indicating that melatonin degradation occurs both in the cytoplasm and in chloroplasts. The biological activity of 2-hydroxymelatonin in the induction of the plant defense gene expression was 50% less than that of melatonin, which indicates that 2-hydroxymelatonin may be a metabolite of melatonin. Overall, our data demonstrate that melatonin synthesis occurs in parallel with melatonin degradation in both chloroplasts and cytoplasm, and the resulting melatonin metabolite 2-hydroxymelatonin also acts as a signaling molecule for defense gene induction.

  8. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.

    PubMed

    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc

    2015-09-01

    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica.

  9. Synthesis and characterization of Fatty acid/amino Acid self-assemblies.

    PubMed

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; Fray, Miroslawa El

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as "R" (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196-239 nm and critical micelle concentration (CMC) of 0.125-0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  10. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  11. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  12. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited.

    PubMed

    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy

    2014-01-01

    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding. PMID:25310287

  13. HFA1 encoding an organelle-specific acetyl-CoA carboxylase controls mitochondrial fatty acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Hoja, Ursula; Marthol, Sandra; Hofmann, Jörg; Stegner, Sabine; Schulz, Rainer; Meier, Sandra; Greiner, Eva; Schweizer, Eckhart

    2004-05-21

    The Saccharomyces cerevisiae gene, HFA1, encodes a >250-kDa protein, which is required for mitochondrial function. Hfa1p exhibits 72% overall sequence similarity (54% identity) to ACC1-encoded yeast cytoplasmic acetyl-CoA carboxylase. Nevertheless, HFA1 and ACC1 functions are not overlapping because mutants of the two genes have different phenotypes and do not complement each other. Whereas ACC1 is involved in cytoplasmic fatty acid synthesis, the phenotype of hfa1Delta disruptants resembles that of mitochondrial fatty-acid synthase mutants. They fail to grow on lactate or glycerol, and the mitochondrial cofactor, lipoic acid, is reduced to <10% of its normal cellular concentration. Other than Acc1p, the N-terminal sequence of Hfa1p comprises a canonical mitochondrial targeting signal together with a matrix protease cleavage site. Accordingly, the HFA1-encoded protein was specifically assigned by Western blotting of appropriate cell fractions to the mitochondrial compartment. Removal of the mitochondrial targeting sequence abolished the competence of HFA1 DNA to complement hfal null mutants. Conversely and in contrast to the intact HFA1 sequence, the signal sequence-free HFA1 gene complemented the mutational loss of cytoplasmic acetyl-CoA carboxylase. Expression of HFA1 under the control of the ACC1 promoter restored cellular ACC activity in ACC1-defective yeast mutants to wild type levels. From this finding, it is concluded that HFA1 encodes a specific mitochondrial acetyl-CoA carboxylase providing malonyl-CoA for intraorganellar fatty acid and, in particular, lipoic acid synthesis. PMID:14761959

  14. Synthesis of amino-acid derivatives and dipeptides with an original peptidase enzyme.

    PubMed

    Auriol, D; Paul, F; Yoshpe, I; Gripon, J C; Monsan, P

    1991-01-01

    A peptidase from the non pathogenic Staphylococcus sp. strain BEC 299 was purified to a final specific activity of 84,400 U/mg protein. Its molecular weight is 450 kDa and optimum pH 10.0. This enzyme catalyzes the synthesis of dipeptides (aspartame) and alpha-amino acid derivatives (N-L-malyl-L-tyrosine ethyl ester). The influence of cosolvents and pH on dipeptides and alpha-amino acid derivative synthesis is described. Finally, we detail the use of the peptidase as a reagent in protease-catalyzed peptide synthesis.

  15. Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria1[OPEN

    PubMed Central

    Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.

    2016-01-01

    Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016

  16. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    NASA Astrophysics Data System (ADS)

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-01

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

  17. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  18. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  19. Identification of a conserved protein involved in anaerobic unsaturated fatty acid synthesis in Neiserria gonorrhoeae: implications for facultative and obligate anaerobes that lack FabA.

    PubMed

    Isabella, Vincent M; Clark, Virginia L

    2011-10-01

    Transcriptome analysis of the facultative anaerobe, Neisseria gonorrhoeae, revealed that many genes of unknown function were induced under anaerobic conditions. Mutation of one such gene, NGO1024, encoding a protein belonging to the 2-nitropropane dioxygenase-like superfamily of proteins, was found to result in an inability of gonococci to grow anaerobically. Anaerobic growth of an NG1024 mutant was restored upon supplementation with unsaturated fatty acids (UFA), but not with the saturated fatty acid palmitate. Gonococcal fatty acid profiles confirmed that NGO1024 was involved in UFA synthesis anaerobically, but not aerobically, demonstrating that gonococci contain two distinct pathways for the production of UFAs, with a yet unidentified aerobic mechanism, and an anaerobic mechanism involving NGO1024. Expression of genes involved in classical anaerobic UFA synthesis, fabA, fabM and fabB, was toxic in gonococci and unable to complement a NGO1024 mutation, suggesting that the chemistry involved in gonococcal anaerobic UFA synthesis is distinct from that of the classical pathway. NGO1024 homologues, which we suggest naming UfaA, form a distinct lineage within the 2-nitropropane dioxygenase-like superfamily, and are found in many facultative and obligate anaerobes that produce UFAs but lack fabA, suggesting that UfaA is part of a widespread pathway involved in UFA synthesis. PMID:21895795

  20. Ferulic acid, an efficient inhibitor of type B trichothecene biosynthesis and Tri gene expression in Fusarium liquid cultures.

    PubMed

    Boutigny, Anne-Laure; Barreau, Christian; Atanasova-Penichon, Vessela; Verdal-Bonnin, Marie-Noëlle; Pinson-Gadais, Laëtitia; Richard-Forget, Florence

    2009-01-01

    The effect of ferulic acid, the most abundant phenolic acid in wheat bran, was studied in vitro on type B trichothecene biosynthesis by Fusarium. It was demonstrated that ferulic acid is an efficient inhibitor of mycotoxin production by all strains of Fusarium tested, including different chemotypes and species. To analyse the mechanism of toxin biosynthesis inhibition by ferulic acid, expression of representative Tri genes, involved in the trichothecene biosynthesis pathway, was monitored by real-time RT-PCR. A decrease in the level of Tri gene expression was measured, suggesting that inhibition of toxin synthesis by ferulic acid could be regulated at the transcriptional level. Moreover, toxin production was shown to be reduced proportionally to the initial amount of ferulic acid added in the culture medium. Addition of ferulic acid either at the spore germination step or to a mycelial culture resulted in the same final inhibitory effect on mycotoxin accumulation. A cumulative inhibitory effect on trichothecene biosynthesis was even observed with successive supplementation of ferulic acid. Ferulic acid, which content varies among wheat varieties, could then play an important role in modulating trichothecene biosynthesis by Fusarium in some wheat varieties.

  1. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  2. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  3. Efficient synthesis of L-lactic acid from glycerol by metabolically engineered Escherichia coli

    PubMed Central

    2013-01-01

    Background Due to its abundance and low-price, glycerol has become an attractive carbon source for the industrial production of value-added fuels and chemicals. This work reports the engineering of E. coli for the efficient conversion of glycerol into L-lactic acid (L-lactate). Results Escherichia coli strains have previously been metabolically engineered for the microaerobic production of D-lactic acid from glycerol in defined media by disrupting genes that minimize the synthesis of succinate, acetate, and ethanol, and also overexpressing the respiratory route of glycerol dissimilation (GlpK/GlpD). Here, further rounds of rationale design were performed on these strains for the homofermentative production of L-lactate, not normally produced in E. coli. Specifically, L-lactate production was enabled by: 1), replacing the native D-lactate specific dehydrogenase with Streptococcus bovis L-lactate dehydrogenase (L-LDH), 2) blocking the methylglyoxal bypass pathways to avoid the synthesis of a racemic mixture of D- and L-lactate and prevent the accumulation of toxic intermediate, methylglyoxal, and 3) the native aerobic L-lactate dehydrogenase was blocked to prevent the undesired utilization of L-lactate. The engineered strain produced 50 g/L of L-lactate from 56 g/L of crude glycerol at a yield 93% of the theoretical maximum and with high optical (99.9%) and chemical (97%) purity. Conclusions This study demonstrates the efficient conversion of glycerol to L-lactate, a microbial process that had not been reported in the literature prior to our work. The engineered biocatalysts produced L-lactate from crude glycerol in defined minimal salts medium at high chemical and optical purity. PMID:23347598

  4. T7 Endonuclease I Mediates Error Correction in Artificial Gene Synthesis.

    PubMed

    Sequeira, Ana Filipa; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A

    2016-09-01

    Efficacy of de novo gene synthesis largely depends on the quality of overlapping oligonucleotides used as template for PCR assembly. The error rate associated with current gene synthesis protocols limits the efficient and accurate production of synthetic genes, both in the small and large scales. Here, we analysed the ability of different endonuclease enzymes, which specifically recognize and cleave DNA mismatches resulting from incorrect impairments between DNA strands, to remove mutations accumulated in synthetic genes. The gfp gene, which encodes the green fluorescent protein, was artificially synthesized using an integrated protocol including an enzymatic mismatch cleavage step (EMC) following gene assembly. Functional and sequence analysis of resulting artificial genes revealed that number of deletions, insertions and substitutions was strongly reduced when T7 endonuclease I was used for mutation removal. This method diminished mutation frequency by eightfold relative to gene synthesis not incorporating an error correction step. Overall, EMC using T7 endonuclease I improved the population of error-free synthetic genes, resulting in an error frequency of 0.43 errors per 1 kb. Taken together, data presented here reveal that incorporation of a mutation-removal step including T7 endonuclease I can effectively improve the fidelity of artificial gene synthesis. PMID:27334914

  5. Enhanced Prostacyclin Synthesis by Adenoviral Gene Transfer Reduced Glial Activation and Ameliorated Dopaminergic Dysfunction in Hemiparkinsonian Rats

    PubMed Central

    Tsai, May-Jywan; Weng, Ching-Feng; Yu, Nien-Chu; Liou, Dann-Ying; Kuo, Fu-San; Huang, Ming-Chao; Huang, Wen-Cheng; Tam, Kabik; Shyue, Song-Kun; Cheng, Henrich

    2013-01-01

    Prostacyclin (PGI2), a potent vasodilator and platelet antiaggregatory eicosanoid, is cytoprotective in cerebral circulation. It is synthesized from arachidonic acid (AA) by the sequential action of cyclooxygenase- (COX-) 1 or 2 and prostacyclin synthase (PGIS). Because prostacyclin is unstable in vivo, PGI2 analogs have been developed and demonstrated to protect against brain ischemia. This work attempts to selectively augment PGI2 synthesis in mixed glial culture or in a model of Parkinson's disease (PD) by direct adenoviral gene transfer of prostacyclin biosynthetic enzymes and examines whether it confers protection in cultures or in vivo. Confluent mixed glial cultures actively metabolized exogenous AA into PGE2 and PGD2. These PGs were largely NS398 sensitive and considered as COX-2 products. Gene transfer of AdPGIS to the cultures effectively shunted the AA catabolism to prostacyclin synthesis and concurrently reduced cell proliferation. Furthermore, PGIS overexpression significantly reduced LPS stimulation in cultures. In vivo, adenoviral gene transfer of bicistronic COX-1/PGIS to substantia nigra protected 6-OHDA- induced dopamine depletion and ameliorated behavioral deficits. Taken together, this study shows that enhanced prostacyclin synthesis reduced glial activation and ameliorated motor dysfunction in hemiparkinsonian rats. Prostacyclin may have a neuroprotective role in modulating the inflammatory response in degenerating nigra-striatal pathway. PMID:23691265

  6. Defects in mitochondrial fatty acid synthesis result in failure of multiple aspects of mitochondrial biogenesis in Saccharomyces cerevisiae.

    PubMed

    Kursu, V A Samuli; Pietikäinen, Laura P; Fontanesi, Flavia; Aaltonen, Mari J; Suomi, Fumi; Raghavan Nair, Remya; Schonauer, Melissa S; Dieckmann, Carol L; Barrientos, Antoni; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2013-11-01

    Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild haem deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a co-ordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell.

  7. Analysis of porcine adipose tissue transcriptome reveals differences in de novo fatty acid synthesis in pigs with divergent muscle fatty acid composition

    PubMed Central

    2013-01-01

    Background In pigs, adipose tissue is one of the principal organs involved in the regulation of lipid metabolism. It is particularly involved in the overall fatty acid synthesis with consequences in other lipid-target organs such as muscles and the liver. With this in mind, we have used massive, parallel high-throughput sequencing technologies to characterize the porcine adipose tissue transcriptome architecture in six Iberian x Landrace crossbred pigs showing extreme phenotypes for intramuscular fatty acid composition (three per group). Results High-throughput RNA sequencing was used to generate a whole characterization of adipose tissue (backfat) transcriptome. A total of 4,130 putative unannotated protein-coding sequences were identified in the 20% of reads which mapped in intergenic regions. Furthermore, 36% of the unmapped reads were represented by interspersed repeats, SINEs being the most abundant elements. Differential expression analyses identified 396 candidate genes among divergent animals for intramuscular fatty acid composition. Sixty-two percent of these genes (247/396) presented higher expression in the group of pigs with higher content of intramuscular SFA and MUFA, while the remaining 149 showed higher expression in the group with higher content of PUFA. Pathway analysis related these genes to biological functions and canonical pathways controlling lipid and fatty acid metabolisms. In concordance with the phenotypic classification of animals, the major metabolic pathway differentially modulated between groups was de novo lipogenesis, the group with more PUFA being the one that showed lower expression of lipogenic genes. Conclusions These results will help in the identification of genetic variants at loci that affect fatty acid composition traits. The implications of these results range from the improvement of porcine meat quality traits to the application of the pig as an animal model of human metabolic diseases. PMID:24289474

  8. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  9. A Robust and Versatile Method of Combinatorial Chemical Synthesis of Gene Libraries via Hierarchical Assembly of Partially Randomized Modules.

    PubMed

    Popova, Blagovesta; Schubert, Steffen; Bulla, Ingo; Buchwald, Daniela; Kramer, Wilfried

    2015-01-01

    A major challenge in gene library generation is to guarantee a large functional size and diversity that significantly increases the chances of selecting different functional protein variants. The use of trinucleotides mixtures for controlled randomization results in superior library diversity and offers the ability to specify the type and distribution of the amino acids at each position. Here we describe the generation of a high diversity gene library using tHisF of the hyperthermophile Thermotoga maritima as a scaffold. Combining various rational criteria with contingency, we targeted 26 selected codons of the thisF gene sequence for randomization at a controlled level. We have developed a novel method of creating full-length gene libraries by combinatorial assembly of smaller sub-libraries. Full-length libraries of high diversity can easily be assembled on demand from smaller and much less diverse sub-libraries, which circumvent the notoriously troublesome long-term archivation and repeated proliferation of high diversity ensembles of phages or plasmids. We developed a generally applicable software tool for sequence analysis of mutated gene sequences that provides efficient assistance for analysis of library diversity. Finally, practical utility of the library was demonstrated in principle by assessment of the conformational stability of library members and isolating protein variants with HisF activity from it. Our approach integrates a number of features of nucleic acids synthetic chemistry, biochemistry and molecular genetics to a coherent, flexible and robust method of combinatorial gene synthesis.

  10. A Robust and Versatile Method of Combinatorial Chemical Synthesis of Gene Libraries via Hierarchical Assembly of Partially Randomized Modules

    PubMed Central

    Popova, Blagovesta; Schubert, Steffen; Bulla, Ingo; Buchwald, Daniela; Kramer, Wilfried

    2015-01-01

    A major challenge in gene library generation is to guarantee a large functional size and diversity that significantly increases the chances of selecting different functional protein variants. The use of trinucleotides mixtures for controlled randomization results in superior library diversity and offers the ability to specify the type and distribution of the amino acids at each position. Here we describe the generation of a high diversity gene library using tHisF of the hyperthermophile Thermotoga maritima as a scaffold. Combining various rational criteria with contingency, we targeted 26 selected codons of the thisF gene sequence for randomization at a controlled level. We have developed a novel method of creating full-length gene libraries by combinatorial assembly of smaller sub-libraries. Full-length libraries of high diversity can easily be assembled on demand from smaller and much less diverse sub-libraries, which circumvent the notoriously troublesome long-term archivation and repeated proliferation of high diversity ensembles of phages or plasmids. We developed a generally applicable software tool for sequence analysis of mutated gene sequences that provides efficient assistance for analysis of library diversity. Finally, practical utility of the library was demonstrated in principle by assessment of the conformational stability of library members and isolating protein variants with HisF activity from it. Our approach integrates a number of features of nucleic acids synthetic chemistry, biochemistry and molecular genetics to a coherent, flexible and robust method of combinatorial gene synthesis. PMID:26355961

  11. Aberrant synthesis of indole-3-acetic acid in Saccharomyces cerevisiae triggers morphogenic transition, a virulence trait of pathogenic fungi.

    PubMed

    Rao, Reeta Prusty; Hunter, Ally; Kashpur, Olga; Normanly, Jennifer

    2010-05-01

    Many plant-associated microbes synthesize the auxin indole-3-acetic acid (IAA), and several IAA biosynthetic pathways have been identified in microbes and plants. Saccharomyces cerevisiae has previously been shown to respond to IAA by inducing pseudohyphal growth. We observed that IAA also induced hyphal growth in the human pathogen Candida albicans and thus may function as a secondary metabolite signal that regulates virulence traits such as hyphal transition in pathogenic fungi. Aldehyde dehydrogenase (Ald) is required for IAA synthesis from a tryptophan (Trp) precursor in Ustilago maydis. Mutant S. cerevisiae with deletions in two ALD genes are unable to convert radiolabeled Trp to IAA, yet produce IAA in the absence of exogenous Trp and at levels higher than wild type. These data suggest that yeast may have multiple pathways for IAA synthesis, one of which is not dependent on Trp. PMID:20233857

  12. Assembly of the bacteriophage T4 replication machine requires the acidic carboxy terminus of gene 32 protein.

    PubMed

    Hurley, J M; Chervitz, S A; Jarvis, T C; Singer, B S; Gold, L

    1993-01-20

    The acidic carboxy-terminal 89-amino acid fragment of bacteriophage T4 gene 32 protein was expressed in Escherichia coli to high levels from an inducible plasmid construct. Infection of induced cells by wild-type T4 phage results in impaired phage DNA synthesis. The time at which DNA synthesis begins and the diminution in DNA synthesis rates correlate with the amount of carboxy-terminal peptide that accumulates intracellularly prior to infection. Correspondingly, when induced cells are infected with viable phage containing a small deletion near the carboxy-terminus of 32 protein (delta PR201), the inhibition of phage DNA synthesis was much more severe. The mutant 32 protein competes less well against overproduced wild-type acid peptide than does wild-type 32 protein. The purified acid peptide, when used as the attached ligand for affinity chromatography, binds several T4 proteins from phage-infected cells, including 43 protein (T4 DNA polymerase), Dda protein (a DNA helicase), and UvsX protein (a Rec-like recombination protein). Furthermore, at 50- to 100-fold molar excess of acid peptide over intact 32 protein, phage DNA synthesis was specifically inhibited at the initiation step in an in vitro 5-protein DNA replication experiment. We propose that one or more phage replication proteins are titrated as non-productive protein-protein complexes at a site away from the DNA template. This implies that the carboxy-terminal domain of 32 protein is involved in an obligate step of replication machine assembly when the protein is properly attached to ssDNA in the vicinity of a primer-template junction. The assembly defect we observe is strikingly similar to the repression, or "squelching", of the activity of certain eukaryotic transcriptional activators. PMID:8429554

  13. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  14. Identification of a critical determinant that enables efficient fatty acid synthesis in oleaginous fungi.

    PubMed

    Chen, Haiqin; Hao, Guangfei; Wang, Lei; Wang, Hongchao; Gu, Zhennan; Liu, Liming; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2015-06-10

    Microorganisms are valuable resources for lipid production. What makes one microbe but not the other able to efficiently synthesize and accumulate lipids is poorly understood. In the present study, global gene expression prior to and after the onset of lipogenesis was determined by transcriptomics using the oleaginous fungus Mortierella alpina as a model system. A core of 23 lipogenesis associated genes was identified and their expression patterns shared a high similarity among oleaginous microbes Chlamydomonas reinhardtii, Mucor circinelloides and Rhizopus oryzae but was dissimilar to the non-oleaginous Aspergillus nidulans. Unexpectedly, Glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) in the pentose phosphate pathway (PPP) were found to be the NADPH producers responding to lipogenesis in the oleaginous microbes. Their role in lipogenesis was confirmed by a knockdown experiment. Our results demonstrate, for the first time, that the PPP plays a significant role during fungal lipogenesis. Up-regulation of NADPH production by the PPP, especially G6PD, may be one of the critical determinants that enables efficiently fatty acid synthesis in oleaginous microbes.

  15. Identification of a critical determinant that enables efficient fatty acid synthesis in oleaginous fungi

    PubMed Central

    Chen, Haiqin; Hao, Guangfei; Wang, Lei; Wang, Hongchao; Gu, Zhennan; Liu, Liming; Zhang, Hao; Chen, Wei; Chen, Yong Q.

    2015-01-01

    Microorganisms are valuable resources for lipid production. What makes one microbe but not the other able to efficiently synthesize and accumulate lipids is poorly understood. In the present study, global gene expression prior to and after the onset of lipogenesis was determined by transcriptomics using the oleaginous fungus Mortierella alpina as a model system. A core of 23 lipogenesis associated genes was identified and their expression patterns shared a high similarity among oleaginous microbes Chlamydomonas reinhardtii, Mucor circinelloides and Rhizopus oryzae but was dissimilar to the non-oleaginous Aspergillus nidulans. Unexpectedly, Glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) in the pentose phosphate pathway (PPP) were found to be the NADPH producers responding to lipogenesis in the oleaginous microbes. Their role in lipogenesis was confirmed by a knockdown experiment. Our results demonstrate, for the first time, that the PPP plays a significant role during fungal lipogenesis. Up-regulation of NADPH production by the PPP, especially G6PD, may be one of the critical determinants that enables efficiently fatty acid synthesis in oleaginous microbes. PMID:26059272

  16. Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips.

    PubMed

    Kosuri, Sriram; Eroshenko, Nikolai; Leproust, Emily M; Super, Michael; Way, Jeffrey; Li, Jin Billy; Church, George M

    2010-12-01

    Development of cheap, high-throughput and reliable gene synthesis methods will broadly stimulate progress in biology and biotechnology. Currently, the reliance on column-synthesized oligonucleotides as a source of DNA limits further cost reductions in gene synthesis. Oligonucleotides from DNA microchips can reduce costs by at least an order of magnitude, yet efforts to scale their use have been largely unsuccessful owing to the high error rates and complexity of the oligonucleotide mixtures. Here we use high-fidelity DNA microchips, selective oligonucleotide pool amplification, optimized gene assembly protocols and enzymatic error correction to develop a method for highly parallel gene synthesis. We tested our approach by assembling 47 genes, including 42 challenging therapeutic antibody sequences, encoding a total of ∼35 kilobase pairs of DNA. These assemblies were performed from a complex background containing 13,000 oligonucleotides encoding ∼2.5 megabases of DNA, which is at least 50 times larger than in previously published attempts.

  17. Synthesis of Long Chain Unsaturated-alpha,omega-Dicarboxylic Acids from Renewable Materials via Olefin Metathesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The self-metathesis reaction of soy, rapeseed, tall, and linseed oil fatty acids was investigated for the synthesis of symmetrical long-chain unsaturated-alpha,omega-dicarboxylic acids. The metathesis reactions were carried out in the presence of a Grubbs catalyst under solvent-free conditions at a...

  18. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.

    PubMed

    van Ameijde, Jeroen; Liskamp, Rob M J

    2003-08-01

    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  19. Synthesis and antibacterial evaluation of anziaic acid and analogues as topoisomerase I inhibitors

    PubMed Central

    Lin, Hao; Annamalai, Thirunavukkarasu; Bansod, Priyanka; Tse-Dinh, Yuk-Ching

    2013-01-01

    Naturally occurring anziaic acid was very recently reported as a topoisomerase I inhibitor with antibacterial activity. Herein total synthesis of anziaic acid and structural analogues is described and the preliminary structure-activity relationship (SAR) has been developed based on topoisomerase inhibition and whole cell antibacterial activity. PMID:24363888

  20. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  1. Amino acid recognition and gene regulation by riboswitches

    PubMed Central

    Serganov, Alexander; Patel, Dinshaw J.

    2012-01-01

    Riboswitches specifically control expression of genes predominantly involved in biosynthesis, catabolism and transport of various cellular metabolites in organisms from all three kingdoms of life. Amongst many classes of identified riboswitches, two riboswitches respond to amino acids lysine and glycine to date. Though these riboswitches recognize small compounds, they both belong to the largest riboswitches and have unique structural and functional characteristics. In this review, we attempt to characterize molecular recognition principles employed by amino acid-responsive riboswitches to selectively bind their cognate ligands and to effectively perform a gene regulation function. We summarize up-to-date biochemical and genetic data available for the lysine and glycine riboswitches and correlate these results with recent high-resolution structural information obtained for the lysine riboswitch. We also discuss the contribution of lysine riboswitches to antibiotic resistance and outline potential applications of riboswitches in biotechnology and medicine. PMID:19619684

  2. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  3. Pyrazinamide Induced Rat Cholestatic Liver Injury through Inhibition of FXR Regulatory Effect on Bile Acid Synthesis and Transport.

    PubMed

    Guo, Hong-Li; Hassan, Hozeifa M; Zhang, Yun; Dong, Si-Zhe; Ding, Ping-Ping; Wang, Tao; Sun, Li-Xin; Zhang, Lu-Yong; Jiang, Zhen-Zhou

    2016-08-01

    Pyrazinamide (PZA) is an indispensable first-line drug used for the treatment of tuberculosis which may cause serious hepatotoxicity; however, the mechanisms underlying these toxicities are poorly understood. Cholestasis plays an important role in drug-induced liver injury. Since there were no previous published works reported cholestasis and PZA hepatotoxicity relationship, this study aimed to identify whether PZA can induce liver injury with characterized evidences of cholestasis and to clarify expression changes of proteins related to both bile acid synthesis and transport in PZA-induced liver injury. PZA (2 g/kg) was administered for 7 consecutive days by oral gavage. Results showed there were 2-fold elevation in both ALT and AST serum levels in PZA-treated rats. In addition, a 10-fold increment in serum total bile acid was observed after PZA administration. The mRNA and protein expressions of bile acid synthesis and transport parameters were markedly altered, in which FXR, Bsep, Mrp2, Mdr2, Ostα/β, Oatp1a1, Oatp1b2, and Cyp8b1 were decreased (P < .05), while Mrp3, Ntcp, Oatp1a4, and Cyp7a1 were increased (P < .05). Moreover, treatment with the FXR agonist obeticholic acid (OCA) generated obvious reductions in serum ALT, AST, and TBA levels in PZA-treated rats. Those effects were due to transcriptional regulation of pre-mentioned target genes by OCA. Taken together, these results suggested that PZA-induced cholestatic liver injury was related to FXR inhibition, leading to the dysfunction in bile acid synthesis and transport. PMID:27255380

  4. NO synthesis from arginine is favored by α-linolenic acid in mice fed a high-fat diet.

    PubMed

    Hermier, Dominique; Guelzim, Najoua; Martin, Pascal G P; Huneau, Jean-François; Mathé, Véronique; Quignard-Boulangé, Annie; Lasserre, Frédéric; Mariotti, François

    2016-09-01

    Alterations in NO availability and signaling play a pivotal role at early stages of the metabolic syndrome (MetSynd). We hypothesized that dietary α-linolenic acid (ALA, 18:3 n-3) favors NO availability by modulating amino acid metabolism, with a specific impact on the arginine-NO pathway. Mice were fed a hyperlipidic diet (285 g lipid/kg, 51.1 % energy), rich in either saturated fatty acids (SFA, provided by palm oil, PALM group) or ALA (provided by linseed oil, LIN group). We measured whole-body NO synthesis and systemic arginine hydrolysis with a tracer-based method, plasma concentration of related metabolites, and hepatic mRNA level of related enzymes, and the study was completed by a transcriptomic analysis in the liver. As expected with this model, hyperlipidic diets resulted in increased adiposity and glycemia after 5 weeks. As compared to PALM mice, LIN mice had a higher plasma nitrite and nitrate concentration, a higher whole-body conversion of arginine into NO vs urea, and a similar plasma concentration of asymmetric dimethylarginine (ADMA), despite a higher expression of the liver dimethylargininase-1. In LIN mice, there was a higher expression of genes involved in PPARα signaling, but a little impact on gene expression related to amino acids and arginine metabolism. This effect cannot be directly ascribed to changes in arginase activity in the liver or ADMA metabolism, nor to direct regulation of the related target genes. In conclusion, dietary ALA favors NO synthesis, which could contribute to rescue NO availability when jeopardized by the nutritional conditions in relation with the initiation of the MetSynd. PMID:27178023

  5. Effects of bovine fatty acid synthase, stearoyl-coenzyme A desaturase, sterol regulatory element-binding protein 1, and growth hormone gene polymorphisms on fatty acid composition and carcass traits in Japanese Black cattle.

    PubMed

    Matsuhashi, T; Maruyama, S; Uemoto, Y; Kobayashi, N; Mannen, H; Abe, T; Sakaguchi, S; Kobayashi, E

    2011-01-01

    The quality of fat is an important factor in defining the quality of meat. Fat quality is determined by the composition of fatty acids. Among lipid metabolism-related genes, including fatty acid synthesis genes, several genetic variations have been reported in the bovine fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD), sterol regulatory element-binding protein 1 (SREBP1), and GH genes. In the present study, we evaluated the single and epistatic effects of 5 genetic variations (4 SNP and 1 insertion/deletion) in 4 genes (FASN, SCD, SREBP1, and GH) on the fatty acid composition of the longissimus thoracis muscle and carcass and meat quality traits in 480 commercial Japanese Black cattle. Significant single effects of FASN, SCD, and GH(L127V) polymorphisms on the fatty acid composition of the longissimus thoracis muscle were detected. The A293V polymorphism of SCD had the largest effect on myristic acid (C14:0, P < 0.001), myristoleic acid (C14:1, P < 0.001), stearic acid (C18:0, P < 0.001), oleic acid (C18:1, P < 0.001), and MUFA (P < 0.001). Polymorphisms in the FASN, SCD, and SREBP1 genes showed no effect on any meat yield trait. There were no significant epistatic effects on fatty acid composition among pairs of the 3 genes (FASN, SCD, and SREBP1) involved in fatty acid synthesis. No epistatic interactions (P > 0.1) were detected between FASN and SCD for any carcass trait. When the genotypes of 3 markers (FASN, SCD, and GH(L127V)) were substituted from the lesser effect allele to the greater effect allele, the proportion of C18:1 increased by 4.46%. More than 20% of the genetic variance in the C18:1 level could be accounted for by these 3 genetic markers. The present results revealed that polymorphisms in 2 fatty acid synthesis genes (FASN and SCD) independently influenced fatty acid composition in the longissimus thoracis muscle. These results suggest that SNP in the FASN and SCD genes are useful markers for the improvement of fatty acid composition in

  6. An improved method of gene synthesis based on DNA works software and overlap extension PCR.

    PubMed

    Dong, Bingxue; Mao, Runqian; Li, Baojian; Liu, Qiuyun; Xu, Peilin; Li, Gang

    2007-11-01

    A bottleneck in recent gene synthesis technologies is the high cost of oligonucleotide synthesis and post-synthesis sequencing. In this article, a simple and rapid method for low-cost gene synthesis technology was developed based on DNAWorks program and an improved single-step overlap extension PCR (OE-PCR). This method enables any DNA sequence to be synthesized with few errors, then any mutated sites could be corrected by site-specific mutagenesis technology or PCR amplification-assembly method, which can amplify different DNA fragments of target gene followed by assembly into an entire gene through their overlapped region. Eventually, full-length DNA sequence without error was obtained via this novel method. Our method is simple, rapid and low-cost, and also easily amenable to automation based on a DNAWorks design program and defined set of OE-PCR reaction conditions suitable for different genes. Using this method, several genes including Manganese peroxidase gene (Mnp) of Phanerochaete chrysosporium (P. chrysosporium), Laccase gene (Lac) of Trametes versicolor (T. versicolor) and Cip1 peroxidase gene (cip 1) of Coprinus cinereus (C. cinereus) with sizes ranging from 1.0 kb to 1.5 kb have been synthesized successfully.

  7. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  8. Abscisic acid (ABA) regulation of Arabidopsis SR protein gene expression.

    PubMed

    Cruz, Tiago M D; Carvalho, Raquel F; Richardson, Dale N; Duque, Paula

    2014-01-01

    Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622

  9. Abscisic Acid (ABA) Regulation of Arabidopsis SR Protein Gene Expression

    PubMed Central

    Cruz, Tiago M. D.; Carvalho, Raquel F.; Richardson, Dale N.; Duque, Paula

    2014-01-01

    Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622

  10. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  11. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity. PMID:23230650

  12. β-Ketoacyl-acyl Carrier Protein Synthase I (KASI) Plays Crucial Roles in the Plant Growth and Fatty Acids Synthesis in Tobacco

    PubMed Central

    Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong

    2016-01-01

    Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494

  13. β-Ketoacyl-acyl Carrier Protein Synthase I (KASI) Plays Crucial Roles in the Plant Growth and Fatty Acids Synthesis in Tobacco.

    PubMed

    Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong

    2016-01-01

    Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494

  14. Roles of the early genes of bacteriophage T7 in shutoff of host macromolecular synthesis.

    PubMed

    McAllister, W T; Barrett, C L

    1977-09-01

    Through the use of phage mutants in which various combinations of the early genes are active, and in which late gene expression is blocked, we have examined the roles of each of the five early gene products of bacteriophage T7 in regulating the synthesis of host RNA and proteins. At least two independent transcriptional controls operate during bacteriophage T7 development. The product of gene 0.7, acting alone, leads to a rapid (by 5 min) shutoff of host transcription. In the absence of gene 0.7 function, and in the absence of the phage-specified RNA polymerase, a delayed shutoff of host-dependent transcription begins at approximately 15 min after infection. This secondary control element requires either a functional gene 0.3 or gene 1.1. In the absence of any early gene products, host shutoff is not observed until much later in infection (>30 min). The delayed manner in which the products of genes 0.3 and 1.1 exert their effect suggests that their mode of action is indirect. Under conditions in which the late genes are transcribed (inefficiently) by the host RNA polymerase, gene 1.1 is observed to stimulate the synthesis of lysozyme (the product of a late phage gene). In contrast, when the late genes are transcribed by the phage-specified RNA polymerase (the product of gene 1), the kinetics of synthesis of the phage RNA polymerase itself, and of lysozyme, are not affected by the deletion of genes 0.3, 0.7, 1.1, and 1.3. We conclude that under these conditions, the products of these genes are required neither for regulation of expression of the late genes nor for the shutoff of early phage gene expression.

  15. On the Mechanism by which Alkaline pH Prevents Expression of an Acid-Expressed Gene

    PubMed Central

    Espeso, Eduardo A.; Arst, Herbert N.

    2000-01-01

    Previous work has shown that zinc finger transcription factor PacC mediates the regulation of gene expression by ambient pH in the fungus Aspergillus nidulans. This regulation ensures that the syntheses of molecules functioning in the external environment, such as permeases, secreted enzymes, and exported metabolites, are tailored to the pH of the growth environment. A direct role for PacC in activating the expression of an alkaline-expressed gene has previously been demonstrated, but the mechanism by which alkaline ambient pH prevents the expression of any eukaryotic acid-expressed gene has never been reported. Here we show that a double PacC binding site in the promoter of the acid-expressed gabA gene, encoding γ-aminobutyrate (GABA) permease, overlaps the binding site for the transcriptional activator IntA, which mediates ω-amino acid induction. Using bacterially expressed fusion proteins, we have shown that PacC competes with IntA for DNA binding in vitro at this site. Thus, PacC repression of GABA permease synthesis is direct and occurs by blocking induction. A swap of IntA sites between promoters for gabA and amdS, a gene not subject to pH regulation, makes gabA expression pH independent and amdS acid expressed. PMID:10779325

  16. Benzoic Acid-Inducible Gene Expression in Mycobacteria

    PubMed Central

    Dragset, Marte S.; Barczak, Amy K.; Kannan, Nisha; Mærk, Mali; Flo, Trude H.; Valla, Svein; Rubin, Eric J.; Steigedal, Magnus

    2015-01-01

    Conditional expression is a powerful tool to investigate the role of bacterial genes. Here, we adapt the Pseudomonas putida-derived positively regulated XylS/Pm expression system to control inducible gene expression in Mycobacterium smegmatis and Mycobacterium tuberculosis, the causative agent of human tuberculosis. By making simple changes to a Gram-negative broad-host-range XylS/Pm-regulated gene expression vector, we prove that it is possible to adapt this well-studied expression system to non-Gram-negative species. With the benzoic acid-derived inducer m-toluate, we achieve a robust, time- and dose-dependent reversible induction of Pm-mediated expression in mycobacteria, with low background expression levels. XylS/Pm is thus an important addition to existing mycobacterial expression tools, especially when low basal expression is of particular importance. PMID:26348349

  17. Identification of genes regulated by UV/salicylic acid.

    SciTech Connect

    Paunesku, T.; Chang-Liu, C.-M.; Shearin-Jones, P.; Watson, C.; Milton, J.; Oryhon, J.; Salbego, D.; Milosavljevic, A.; Woloschak, G. E.; CuraGen Corp.

    2000-02-01

    Purpose : Previous work from the authors' group and others has demonstrated that some of the effects of UV irradiation on gene expression are modulated in response to the addition of salicylic acid to irradiated cells. The presumed effector molecule responsible for this modulation is NF-kappaB. In the experiments described here, differential-display RT-PCR was used to identify those cDNAs that are differentially modulated by UV radiation with and without the addition of salicylic acid. Materials and methods : Differential-display RT-PCR was used to identify differentially expressed genes. Results : Eight such cDNAs are presented: lactate dehydrogenase (LDH-beta), nuclear encoded mitochondrial NADH ubiquinone reductase 24kDa (NDUFV2), elongation initiation factor 4B (eIF4B), nuclear dots protein SP100, nuclear encoded mitochondrial ATPase inhibitor (IF1), a cDNA similar to a subunit of yeast CCAAT transcription factor HAP5, and two expressed sequence tags (AA187906 and AA513156). Conclusions : Sequences of four of these genes contained NF-kappaB DNA binding sites of the type that may attract transrepressor p55/p55 NF-kappaB homodimers. Down-regulation of these genes upon UV irradiation may contribute to increased cell survival via suppression of p53 independent apoptosis.

  18. The pea gene NA encodes ent-kaurenoic acid oxidase.

    PubMed

    Davidson, Sandra E; Elliott, Robert C; Helliwell, Chris A; Poole, Andrew T; Reid, James B

    2003-01-01

    The gibberellin (GA)-deficient dwarf na mutant in pea (Pisum sativum) has severely reduced internode elongation, reduced root growth, and decreased leaflet size. However, the seeds develop normally. Two genes, PsKAO1 and PsKAO2, encoding cytochrome P450 monooxygenases of the subfamily CYP88A were isolated. Both PsKAO1 and PsKAO2 had ent-kaurenoic acid oxidase (KAO) activity, catalyzing the three steps of the GA biosynthetic pathway from ent-kaurenoic acid to GA(12) when expressed in yeast (Saccharomyces cerevisiae). In addition to the intermediates ent-7alpha-hydroxykaurenoic acid and GA(12)-aldehyde, some additional products of the pea KAO activity were detected, including ent-6alpha,7alpha-dihydroxykaurenoic acid and 7beta-hydroxykaurenolide. The NA gene encodes PsKAO1, because in two independent mutant alleles, na-1 and na-2, PsKAO1 had altered sequences and the five-base deletion in PsKAO1 associated with the na-1 allele cosegregated with the dwarf na phenotype. PsKAO1 was expressed in the stem, apical bud, leaf, pod, and root, organs in which GA levels have previously been shown to be reduced in na plants. PsKAO2 was expressed only in seeds and this may explain the normal seed development and normal GA biosynthesis in seeds of na plants.

  19. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  20. Indole-3-acetic acid (IAA) induced changes in oil content, fatty acid profiles and expression of four fatty acid biosynthetic genes in Chlorella vulgaris at early stationary growth phase.

    PubMed

    Jusoh, Malinna; Loh, Saw Hong; Chuah, Tse Seng; Aziz, Ahmad; Cha, Thye San

    2015-03-01

    Microalgae lipids and oils are potential candidates for renewable biodiesel. Many microalgae species accumulate a substantial amount of lipids and oils under environmental stresses. However, low growth rate under these adverse conditions account for the decrease in overall biomass productivity which directly influence the oil yield. This study was undertaken to investigate the effect of exogenously added auxin (indole-3-acetic acid; IAA) on the oil content, fatty acid compositions, and the expression of fatty acid biosynthetic genes in Chlorella vulgaris (UMT-M1). Auxin has been shown to regulate growth and metabolite production of several microalgae. Results showed that oil accumulation was highest on days after treatment (DAT)-2 with enriched levels of palmitic (C16:0) and stearic (C18:0) acids, while the linoleic (C18:2) and α-linolenic (C18:3n3) acids levels were markedly reduced by IAA. The elevated levels of saturated fatty acids (C16:0 and C18:0) were consistent with high expression of the β-ketoacyl ACP synthase I (KAS I) gene, while low expression of omega-6 fatty acid desaturase (ω-6 FAD) gene was consistent with low production of C18:2. However, the increment of stearoyl-ACP desaturase (SAD) gene expression upon IAA induction did not coincide with oleic acid (C18:1) production. The expression of omega-3 fatty acid desaturase (ω-3 FAD) gene showed a positive correlation with the synthesis of PUFA and C18:3n3.

  1. De novo synthesis of amino acids by the ruminal anaerobic fungi, Piromyces communis and Neocallimastix frontalis.

    PubMed

    Atasoglu, Cengiz; Wallace, R John

    2002-07-01

    Anaerobic fungi are an important component of the cellulolytic ruminal microflora. Ammonia alone as N source supports growth, but amino acid mixtures are stimulatory. In order to evaluate the extent of de novo synthesis of individual amino acids in Piromyces communis and Neocallimastix frontalis, isotope enrichment in amino acids was determined during growth on (15)NH(4)Cl in different media. Most cell N (0.78 and 0.63 for P. communis and N. frontalis, respectively) and amino acid N (0.73 and 0.59) continued to be formed de novo from ammonia when 1 g l(-1) trypticase was added to the medium; this concentration approximates the peak concentration of peptides in the rumen after feeding. Higher peptide/amino acid concentrations decreased de novo synthesis. Lysine was exceptional, in that its synthesis decreased much more than other amino acids when Trypticase or amino acids were added to the medium, suggesting that lysine synthesis might limit fungal growth in the rumen.

  2. Synthesis and optical resolution of an allenoic acid by diastereomeric salt formation induced by chiral alkaloids.

    PubMed

    Nyhlén, Jonas; Eriksson, Lars; Bäckvall, Jan-E

    2008-01-01

    A synthetic procedure for the preparation of 4-cyclohexyl-2-methyl-buta-2,3-dienoic acid in the two optically active forms has been developed. Synthesis of the racemic allenoic acid was made by an efficient route with good overall yield. Resolution of the enantiomers was achieved by forming the cinchonidine and cinchonine diastereomeric salt, respectively, and the enantiomers were isolated in up to 95% enantiomeric excess. The absolute configuration of the allenoic acid was determined by X-ray crystallography.

  3. Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

    PubMed

    Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

    2016-09-01

    α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

  4. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  5. Deciphering ascorbic acid regulatory pathways in ripening tomato fruit using a weighted gene correlation network analysis approach.

    PubMed

    Gao, Chao; Ju, Zheng; Li, Shan; Zuo, Jinhua; Fu, Daqi; Tian, Huiqin; Luo, Yunbo; Zhu, Benzhong

    2013-11-01

    Genotype is generally determined by the co-expression of diverse genes and multiple regulatory pathways in plants. Gene co-expression analysis combining with physiological trait data provides very important information about the gene function and regulatory mechanism. L-Ascorbic acid (AsA), which is an essential nutrient component for human health and plant metabolism, plays key roles in diverse biological processes such as cell cycle, cell expansion, stress resistance, hormone synthesis, and signaling. Here, we applied a weighted gene correlation network analysis approach based on gene expression values and AsA content data in ripening tomato (Solanum lycopersicum L.) fruit with different AsA content levels, which leads to identification of AsA relevant modules and vital genes in AsA regulatory pathways. Twenty-four modules were compartmentalized according to gene expression profiling. Among these modules, one negatively related module containing genes involved in redox processes and one positively related module enriched with genes involved in AsA biosynthetic and recycling pathways were further analyzed. The present work herein indicates that redox pathways as well as hormone-signal pathways are closely correlated with AsA accumulation in ripening tomato fruit, and allowed us to prioritize candidate genes for follow-up studies to dissect this interplay at the biochemical and molecular level.

  6. Direct microwave-assisted amino acid synthesis by reaction of succinic acid and ammonia in the presence of magnetite

    NASA Astrophysics Data System (ADS)

    Jiang, Nan; Liu, Dandan; Shi, Weiguang; Hua, Yingjie; Wang, Chongtai; Liu, Xiaoyang

    2013-10-01

    Since the discovery of submarine hot vents in the late 1970s, it has been postulated that submarine hydrothermal environments would be suitable for emergence of life on Earth. To simulate warm spring conditions, we designed a series of microwave-assisted amino acid synthesis involving direct reactions between succinic acid and ammonia in the presence of the magnetite catalyst. These reactions which generated aspartic acid and glycine were carried out under mild temperatures and pressures (90-180 °C, 4-19 bar). We studied this specific reaction inasmuch as succinic acid and ammonia were traditionally identified as prebiotic compounds in primitive deep-sea hydrothermal systems on Earth. The experimental results were discussed in both biochemical and geochemical context to offer a possible route for abiotic amino acid synthesis. With extremely diluted starting materials (0.002 M carboxylic acid and 0.002 M ammonia) and catalyst loading, an obvious temperature dependency was observed in both cases [neither product was detected at 90 °C in comparison with 21.08 μmol L-1 (aspartic acid) and 70.25 umol L-1 (glycine) in 180 °C]. However, an opposite trend presented for reaction time factor, namely a positive correlation for glycine, but a negative one for aspartic acid.

  7. Inducible gene expression and environmentally regulated genes in lactic acid bacteria.

    PubMed

    Kok, J

    1996-10-01

    Relatively recently, a number of genes and operons have been identified in lactic acid bacteria that are inducible and respond to environmental factors. Some of these genes/operons had been isolated and analysed because of their importance in the fermentation industry and, consequently, their transcription was studied and found to be regulatable. Examples are the lactose operon, the operon for nisin production, and genes in the proteolytic pathway of Lactococcus lactis, as well as xylose metabolism in Lactobacillus pentosus. Some other operons were specifically targetted with the aim to compare their mode of regulation with known regulatory mechanisms in other well-studied bacteria. These studies, dealing with the biosynthesis of histidine, tryptophan, and of the branched chain amino acids in L. lactis, have given new insights in gene regulation and in the occurrence of auxotrophy in these bacteria. Also, nucleotide sequence analyses of a number of lactococcal bacteriophages was recently initiated to, among other things, specifically learn more about regulation of the phage life cycle. Yet another approach in the analysis of regulated genes is the 'random' selection of genetic elements that respond to environmental stimuli and the first of such sequences from lactic acid bacteria have been identified and characterized. The potential of these regulatory elements in fundamental research and practical (industrial) applications will be discussed.

  8. Synthesis of multi-functional large pore mesoporous silica nanoparticles as gene carriers

    NASA Astrophysics Data System (ADS)

    Hartono, Sandy B.; Yu, Meihua; Gu, Wenyi; Yang, Jie; Strounina, Ekaterina; Wang, Xiaolin; Qiao, Shizhang; Yu, Chengzhong

    2014-02-01

    The development of functional nanocarriers that can enhance the cellular delivery of a variety of nucleic acid agents is important in many biomedical applications such as siRNA therapy. We report the synthesis of large pore mesoporous silica nanoparticles (LPMSN) loaded with iron oxide and covalently modified by polyethyleneimine (denoted PEI-Fe-LPMSN) as carriers for gene delivery. The LPMSN have a particle size of ˜200 nm and a large pore size of 11 nm. The large pore size is essential for the formation of large iron oxide nanoparticles to increase the magnetic properties and the adsorption capacity of siRNA molecules. The magnetic property facilitates the cellular uptake of nanocarriers under an external magnetic field. PEI is covalently grafted on the silica surface to enhance the nanocarriers’ affinity against siRNA molecules and to improve gene silencing performance. The PEI-Fe-LPMSN delivered siRNA-PLK1 effectively into osteosarcoma cancer cells, leading to cell viability inhibition of 80%, higher compared to the 50% reduction when the same dose of siRNA was delivered by a commercial product, oligofectamine.

  9. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.

    2008-01-01

    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  10. Cloning, sequencing and overexpression of the gene for prokaryotic factor EF-P involved in peptide bond synthesis.

    PubMed Central

    Aoki, H; Adams, S L; Chung, D G; Yaguchi, M; Chuang, S E; Ganoza, M C

    1991-01-01

    A soluble protein EF-P (elongation factor P) from Escherichia coli has been purified and shown to stimulate efficient translation and peptide-bond synthesis on native or reconstituted 70S ribosomes in vitro. Based on the partial amino acid sequence of EF-P, 18- and 24-nucleotide DNA probes were synthesized and used to screen lambda phage clones from the Kohara Gene Bank. The entire EF-P gene was detected on lambda clone #650 which contains sequences from the 94 minute region of the E.coli genome. Two DNA fragments, 3.0 and 0.78 kilobases in length encompassing the gene, were isolated and cloned into pUC18 and pUC19. Partially purified extracts from cells transformed with these plasmids overrepresented a protein which co-migrates with EF-P upon SDS polyacrylamide gel electrophoresis, and also exhibited increased EF-P mediated peptide-bond synthetic activity. Based on DNA sequence analysis of this gene, the EF-P protein consists of 187 amino acids with a calculated molecular weight of 20,447. The sequence and chromosomal location of EF-P establishes it as a unique gene product. Images PMID:1956781

  11. Gene cloning and molecular characterization of the Talaromyces thermophilus lipase catalyzed efficient hydrolysis and synthesis of esters.

    PubMed

    Romdhane, Ines Belhaj-Ben; Frikha, Fakher; Maalej-Achouri, Inès; Gargouri, Ali; Belghith, Hafedh

    2012-02-15

    A genomic bank from Talaromyces thermophilus fungus was constructed and screened using a previously isolated fragment lipase gene as probe. From several clones isolated, the nucleotide sequence of the lipase gene (TTL gene) was completed and sequenced. The TTL coding gene consists of an open reading frame (ORF) of 1083bp encoding a protein of 269 Aa with an estimated molecular mass of 30kDa. The TTL belongs to the same gene family as Thermomyces lanuginosus lipase (TLL, Lipolase®), a well known lipase with multiple applications. The promoter sequence of the TTL gene showed the conservation of known consensus sequences PacC, CreA, Hap2-3-4 and the existence of a particular sequence like the binding sites of Oleate Response Element (ORE) and Fatty acids Responsis Element (FARE) which are similar to that already found to be specific of lipolytic genes in Candida and Fusarium, respectively. Northern blot analysis showed that the TTL expression was much higher on wheat bran than on olive oil as sole carbon source. Compared to the Lipolase®, this enzyme was found to be more efficient for the hydrolysis and the synthesis of esters; and its synthetic efficiency even reached 91.6% from Waste Cooking Oil triglycerides. PMID:22178764

  12. Gene cloning and molecular characterization of the Talaromyces thermophilus lipase catalyzed efficient hydrolysis and synthesis of esters.

    PubMed

    Romdhane, Ines Belhaj-Ben; Frikha, Fakher; Maalej-Achouri, Inès; Gargouri, Ali; Belghith, Hafedh

    2012-02-15

    A genomic bank from Talaromyces thermophilus fungus was constructed and screened using a previously isolated fragment lipase gene as probe. From several clones isolated, the nucleotide sequence of the lipase gene (TTL gene) was completed and sequenced. The TTL coding gene consists of an open reading frame (ORF) of 1083bp encoding a protein of 269 Aa with an estimated molecular mass of 30kDa. The TTL belongs to the same gene family as Thermomyces lanuginosus lipase (TLL, Lipolase®), a well known lipase with multiple applications. The promoter sequence of the TTL gene showed the conservation of known consensus sequences PacC, CreA, Hap2-3-4 and the existence of a particular sequence like the binding sites of Oleate Response Element (ORE) and Fatty acids Responsis Element (FARE) which are similar to that already found to be specific of lipolytic genes in Candida and Fusarium, respectively. Northern blot analysis showed that the TTL expression was much higher on wheat bran than on olive oil as sole carbon source. Compared to the Lipolase®, this enzyme was found to be more efficient for the hydrolysis and the synthesis of esters; and its synthetic efficiency even reached 91.6% from Waste Cooking Oil triglycerides.

  13. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-05-17

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids.

  14. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  15. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  16. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  17. Identification of Cell Wall Synthesis Regulatory Genes Controlling Biomass Characteristics and Yield in Rice (Oryza Sativa)

    SciTech Connect

    Peng, Zhaohua PEng; Ronald, Palmela; Wang, Guo-Liang

    2013-04-26

    This project aims to identify the regulatory genes of rice cell wall synthesis pathways using a cell wall removal and regeneration system. We completed the gene expression profiling studies following the time course from cell wall removal to cell wall regeneration in rice suspension cells. We also completed, total proteome, nuclear subproteome and histone modification studies following the course from cell wall removal and cell wall regeneration process. A large number of differentially expressed regulatory genes and proteins were identified. Meanwhile, we generated RNAi and over-expression transgenic rice for 45 genes with at least 10 independent transgenic lines for each gene. In addition, we ordered T-DNA and transposon insertion mutants for 60 genes from Korea, Japan, and France and characterized the mutants. Overall, we have mutants and transgenic lines for over 90 genes, exceeded our proposed goal of generating mutants for 50 genes. Interesting Discoveries a) Cell wall re-synthesis in protoplasts may involve a novel cell wall synthesis mechanism. The synthesis of the primary cell wall is initiated in late cytokinesis with further modification during cell expansion. Phragmoplast plays an essential role in cell wall synthesis. It services as a scaffold for building the cell plate and formation of a new cell wall. Only one phragmoplast and one new cell wall is produced for each dividing cell. When the cell wall was removed enzymatically, we found that cell wall re-synthesis started from multiple locations simultaneously, suggesting that a novel mechanism is involved in cell wall re-synthesis. This observation raised many interesting questions, such as how the starting sites of cell wall synthesis are determined, whether phragmoplast and cell plate like structures are involved in cell wall re-synthesis, and more importantly whether the same set of enzymes and apparatus are used in cell wall re-synthesis as during cytokinesis. Given that many known cell wall

  18. SpeedyGenes: an improved gene synthesis method for the efficient production of error-corrected, synthetic protein libraries for directed evolution.

    PubMed

    Currin, Andrew; Swainston, Neil; Day, Philip J; Kell, Douglas B

    2014-09-01

    The de novo synthesis of genes is becoming increasingly common in synthetic biology studies. However, the inherent error rate (introduced by errors incurred during oligonucleotide synthesis) limits its use in synthesising protein libraries to only short genes. Here we introduce SpeedyGenes, a PCR-based method for the synthesis of diverse protein libraries that includes an error-correction procedure, enabling the efficient synthesis of large genes for use directly in functional screening. First, we demonstrate an accurate gene synthesis method by synthesising and directly screening (without pre-selection) a 747 bp gene for green fluorescent protein (yielding 85% fluorescent colonies) and a larger 1518 bp gene (a monoamine oxidase, producing 76% colonies with full catalytic activity, a 4-fold improvement over previous methods). Secondly, we show that SpeedyGenes can accommodate multiple and combinatorial variant sequences while maintaining efficient enzymatic error correction, which is particularly crucial for larger genes. In its first application for directed evolution, we demonstrate the use of SpeedyGenes in the synthesis and screening of large libraries of MAO-N variants. Using this method, libraries are synthesised, transformed and screened within 3 days. Importantly, as each mutation we introduce is controlled by the oligonucleotide sequence, SpeedyGenes enables the synthesis of large, diverse, yet controlled variant sequences for the purposes of directed evolution.

  19. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.

    PubMed

    Klisch, M; Häder, D-P

    2002-02-01

    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption.

  20. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  1. Evolution of Mycolic Acid Biosynthesis Genes and Their Regulation during Starvation in Mycobacterium tuberculosis

    PubMed Central

    Jamet, Stevie; Quentin, Yves; Coudray, Coralie; Texier, Pauline; Laval, Françoise; Daffé, Mamadou

    2015-01-01

    ABSTRACT Mycobacterium tuberculosis, the etiological agent of tuberculosis, is a Gram-positive bacterium with a unique cell envelope composed of an essential outer membrane. Mycolic acids, which are very-long-chain (up to C100) fatty acids, are the major components of this mycomembrane. The enzymatic pathways involved in the biosynthesis and transport of mycolates are fairly well documented and are the targets of the major antituberculous drugs. In contrast, only fragmented information is available on the expression and regulation of the biosynthesis genes. In this study, we report that the hadA, hadB, and hadC genes, which code for the mycolate biosynthesis dehydratase enzymes, are coexpressed with three genes that encode proteins of the translational apparatus. Consistent with the well-established control of the translation potential by nutrient availability, starvation leads to downregulation of the hadABC genes along with most of the genes required for the synthesis, modification, and transport of mycolates. The downregulation of a subset of the biosynthesis genes is partially dependent on RelMtb, the key enzyme of the stringent response. We also report the phylogenetic evolution scenario that has shaped the current genetic organization, characterized by the coregulation of the hadABC operon with genes of the translational apparatus and with genes required for the modification of the mycolates. IMPORTANCE Mycobacterium tuberculosis infects one-third of the human population worldwide, and despite the available therapeutic arsenal, it continues to kill millions of people each year. There is therefore an urgent need to identify new targets and develop a better understanding of how the bacterium is adapting itself to host defenses during infection. A prerequisite of this understanding is knowledge of how this adaptive skill has been implanted by evolution. Nutrient scarcity is an environmental condition the bacterium has to cope with during infection. In many

  2. Salicylic acid differently impacts ethylene and polyamine synthesis in the glycophyte Solanum lycopersicum and the wild-related halophyte Solanum chilense exposed to mild salt stress.

    PubMed

    Gharbi, Emna; Martínez, Juan-Pablo; Benahmed, Hela; Fauconnier, Marie-Laure; Lutts, Stanley; Quinet, Muriel

    2016-10-01

    This study aimed to determine the effects of exogenous application of salicylic acid (SA) on the toxic effects of salt in relation to ethylene and polyamine synthesis, and to correlate these traits with the expression of genes involved in ethylene and polyamine metabolism in two tomato species differing in their sensitivity to salt stress, Solanum lycopersicum cv Ailsa Craig and its wild salt-resistant relative Solanum chilense. In S. chilense, treatment with 125 mM NaCl improved plant growth, increased production of ethylene, endogenous salicylic acid and spermine. The production was related to a modification of expression of genes involved in ethylene and polyamine metabolism. In contrast, salinity decreased plant growth in S. lycopersicum without affecting endogenous ethylene, salicylic or polyamine concentrations. Exogenous application of salicylic acid at 0.01 mM enhanced shoot growth in both species and affected ethylene and polyamine production in S. chilense. Concomitant application of NaCl and salicylic acid improved osmotic adjustment, thus suggesting that salt and SA may act in synergy on osmolyte synthesis. However, the beneficial impact of exogenous application of salicylic acid was mitigated by salt stress since NaCl impaired endogenous SA accumulation in the shoot and salicylic acid did not improve plant growth in salt-treated plants. Our results thus revealed that both species respond differently to salinity and that salicylic acid, ethylene and polyamine metabolisms are involved in salt resistance in S. chilense. PMID:27105808

  3. Salicylic acid differently impacts ethylene and polyamine synthesis in the glycophyte Solanum lycopersicum and the wild-related halophyte Solanum chilense exposed to mild salt stress.

    PubMed

    Gharbi, Emna; Martínez, Juan-Pablo; Benahmed, Hela; Fauconnier, Marie-Laure; Lutts, Stanley; Quinet, Muriel

    2016-10-01

    This study aimed to determine the effects of exogenous application of salicylic acid (SA) on the toxic effects of salt in relation to ethylene and polyamine synthesis, and to correlate these traits with the expression of genes involved in ethylene and polyamine metabolism in two tomato species differing in their sensitivity to salt stress, Solanum lycopersicum cv Ailsa Craig and its wild salt-resistant relative Solanum chilense. In S. chilense, treatment with 125 mM NaCl improved plant growth, increased production of ethylene, endogenous salicylic acid and spermine. The production was related to a modification of expression of genes involved in ethylene and polyamine metabolism. In contrast, salinity decreased plant growth in S. lycopersicum without affecting endogenous ethylene, salicylic or polyamine concentrations. Exogenous application of salicylic acid at 0.01 mM enhanced shoot growth in both species and affected ethylene and polyamine production in S. chilense. Concomitant application of NaCl and salicylic acid improved osmotic adjustment, thus suggesting that salt and SA may act in synergy on osmolyte synthesis. However, the beneficial impact of exogenous application of salicylic acid was mitigated by salt stress since NaCl impaired endogenous SA accumulation in the shoot and salicylic acid did not improve plant growth in salt-treated plants. Our results thus revealed that both species respond differently to salinity and that salicylic acid, ethylene and polyamine metabolisms are involved in salt resistance in S. chilense.

  4. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )

    1989-12-01

    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  5. Approach to Merosesquiterpenes via Lewis Acid Catalyzed Nazarov-Type Cyclization: Total Synthesis of Akaol A.

    PubMed

    Kakde, Badrinath N; Kumar, Nivesh; Mondal, Pradip Kumar; Bisai, Alakesh

    2016-04-15

    A Lewis acid catalyzed Nazarov-type cyclization of arylvinylcarbinol has been developed for the asymmetric synthesis of carbotetracyclic core of merosesquiterpenes. The reaction works only in the presence of 2 mol % of Sn(OTf)2 and Bi(OTf)3 in dichloroethane under elevated temperature. The methodology offers the synthesis of a variety of enantioenriched arylvinylcarbinols from commercially available (3aR)-sclareolide 9 in six steps with an eventual concise total synthesis of marine sesquiterpene quinol, akaol A (1a). PMID:27028314

  6. Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer

    PubMed Central

    Getino, María; Sanabria-Ríos, David J.; Fernández-López, Raúl; Campos-Gómez, Javier; Sánchez-López, José M.; Fernández, Antonio; Carballeira, Néstor M.

    2015-01-01

    ABSTRACT Bacterial conjugation constitutes a major horizontal gene transfer mechanism for the dissemination of antibiotic resistance genes among human pathogens. Antibiotic resistance spread could be halted or diminished by molecules that interfere with the conjugation process. In this work, synthetic 2-alkynoic fatty acids were identified as a novel class of conjugation inhibitors. Their chemical properties were investigated by using the prototype 2-hexadecynoic acid and its derivatives. Essential features of effective inhibitors were the carboxylic group, an optimal long aliphatic chain of 16 carbon atoms, and one unsaturation. Chemical modification of these groups led to inactive or less-active derivatives. Conjugation inhibitors were found to act on the donor cell, affecting a wide number of pathogenic bacterial hosts, including Escherichia, Salmonella, Pseudomonas, and Acinetobacter spp. Conjugation inhibitors were active in inhibiting transfer of IncF, IncW, and IncH plasmids, moderately active against IncI, IncL/M, and IncX plasmids, and inactive against IncP and IncN plasmids. Importantly, the use of 2-hexadecynoic acid avoided the spread of a derepressed IncF plasmid into a recipient population, demonstrating the feasibility of abolishing the dissemination of antimicrobial resistances by blocking bacterial conjugation. PMID:26330514

  7. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  8. Solvent-free lipase-catalyzed synthesis of a novel hydroxyl-fatty acid derivative of kojic acid.

    PubMed

    El-Boulifi, Noureddin; Ashari, Siti Efliza; Serrano, Marta; Aracil, Jose; Martínez, Mercedes

    2014-02-01

    The aim of this work was the synthesis of a novel hydroxyl-fatty acid derivative of kojic acid rich in kojic acid monoricinoleate (KMR) which can be widely used in the cosmetic and food industry. The synthesis of KMR was carried out by lipase-catalysed esterification of ricinoleic and kojic acids in solvent-free system. Three immobilized lipases were tested and the best KMR yields were attained with Lipozyme TL IM and Novozym 435. Since Lipozyme TL IM is the cheapest, it was selected to optimize the reaction conditions. The optimal reaction conditions were 80 °C for the temperature, 1:1 for the alcohol/acid molar ratio, 600 rpm for stirring speed and 7.8% for the catalyst concentration. Under these conditions, the reaction was scaled up in a 5×10⁻³ m³ stirred tank reactor. ¹H-¹³C HMBC-NMR showed that the primary hydroxyl group of kojic acid was regioselectively esterified. The KMR has more lipophilicity than kojic acid and showed antioxidant activity that improves the oxidation stability of biodiesel.

  9. The Riia Gene of Bacteriophage T4. II. Regulation of Its Messenger RNA Synthesis

    PubMed Central

    Daegelen, P.; Brody, E.

    1990-01-01

    When the rII genes are first introduced into cells which had been previously infected by T4 phage deleted for these genes, the kinetics of synthesis of rIIA and rIIB RNA are rapid and identical. We show that this rapid synthesis depends on a functional motA gene for rIIB, but not for rIIA, RNA synthesis. By primer-extension mapping of T4 messenger RNA, we find three promoters close to the rIIA gene. One of them is an early promoter just before the rIIA.1 gene; it is used under all conditions tested. Another is in the coding portion of the rIIA.1 gene; it is weak, primarily because of a 19-bp spacing between the -10 and -35 elements, and its use is stimulated by T4 functions. The third is a motA-dependent (middle) promoter which has an unusual CCCGCTT box at -33. We present results which suggest that none of these promoters is likely to be the site at which the motB and motC gene products exercise their major influence on rIIA RNA synthesis. PMID:2379818

  10. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-01

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  11. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.

    PubMed

    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György

    2016-01-01

    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  12. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  13. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  14. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  15. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  16. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  17. Vitamin B12 Synthesis and Salvage Pathways Were Acquired by Horizontal Gene Transfer to the Thermotogales

    PubMed Central

    Swithers, Kristen S.; Petrus, Amanda K.; Secinaro, Michael A.; Nesbø, Camilla L.; Gogarten, J. Peter; Noll, Kenneth M.; Butzin, Nicholas C.

    2012-01-01

    The availability of genome sequences of Thermotogales species from across the order allows an examination of the evolutionary origins of phenotypic characteristics in this lineage. Several studies have shown that the Thermotogales have acquired large numbers of genes from distantly related lineages, particularly Firmicutes and Archaea. Here, we report the finding that some Thermotogales acquired the ability to synthesize vitamin B12 by acquiring the requisite genes from these distant lineages. Thermosipho species, uniquely among the Thermotogales, contain genes that encode the means to synthesize vitamin B12 de novo from glutamate. These genes are split into two gene clusters: the corrinoid synthesis gene cluster, that is unique to the Thermosipho and the cobinamide salvage gene cluster. The corrinoid synthesis cluster was acquired from the Firmicutes lineage, whereas the salvage pathway is an amalgam of bacteria- and archaea-derived proteins. The cobinamide salvage gene cluster has a patchy distribution among Thermotogales species, and ancestral state reconstruction suggests that this pathway was present in the common Thermotogales ancestor. We show that Thermosipho africanus can grow in the absence of vitamin B12, so its de novo pathway is functional. We detected vitamin B12 in the extracts of T. africanus cells to verify the synthetic pathway. Genes in T. africanus with apparent B12 riboswitches were found to be down-regulated in the presence of vitamin B12 consistent with their roles in B12 synthesis and cobinamide salvage. PMID:22798452

  18. Selenium Catalyzed Oxidation of Aldehydes: Green Synthesis of Carboxylic Acids and Esters.

    PubMed

    Sancineto, Luca; Tidei, Caterina; Bagnoli, Luana; Marini, Francesca; Lenardão, Eder J; Santi, Claudio

    2015-01-01

    The stoichiometric use of hydrogen peroxide in the presence of a selenium-containing catalyst in water is here reported as a new ecofriendly protocol for the synthesis of variously functionalized carboxylic acids and esters. The method affords the desired products in good to excellent yields under very mild conditions starting directly from commercially available aldehydes. Using benzaldehyde as a prototype the gram scale synthesis of benzoic acid is described, in which the aqueous medium and the catalyst could be recycled at last five times while achieving an 87% overall yield.

  19. Communic acids: occurrence, properties and use as chirons for the synthesis of bioactive compounds.

    PubMed

    Barrero, Alejandro F; Herrador, M Mar; Arteaga, Pilar; Arteaga, Jesús F; Arteaga, Alejandro F

    2012-01-01

    Communic acids are diterpenes with labdane skeletons found in many plant species, mainly conifers, predominating in the genus Juniperus (fam. Cupresaceae). In this review we briefly describe their distribution and different biological activities (anti- bacterial, antitumoral, hypolipidemic, relaxing smooth muscle, etc.). This paper also includes a detailed explanation of their use as chiral building blocks for the synthesis of bioactive natural products. Among other uses, communic acids have proven useful as chirons for the synthesis of quassinoids (formal), abietane antioxidants, ambrox and other perfume fixatives, podolactone herbicides, etc., featuring shorter and more efficient processes.

  20. Measurement of Microbial Activity and Growth in the Ocean by Rates of Stable Ribonucleic Acid Synthesis

    PubMed Central

    Karl, David M.

    1979-01-01

    A relatively simple and extremely sensitive technique for measuring rates of stable ribonucleic acid (RNA) synthesis was devised and applied to bacterial cultures and seawater samples. The procedure is based upon the uptake and incorporation of exogenous radiolabeled adenine into cellular RNA. To calculate absolute rates of synthesis, measurements of the specific radioactivity of the intracellular adenosine 5′-triphosphate pools (precursor to RNA) and of the total amount of radioactivity incorporated into stable cellular RNA per unit time are required. Since the rate of RNA synthesis is positively correlated with growth rate, measurements of RNA synthesis should be extremely useful for estimating and comparing the productivities of microbial assemblages in nature. Adenosine 5′-triphosphate, adenylate energy charge, and rates of stable RNA synthesis have been measured at a station located in the Columbian Basin of the Caribbean Sea. A subsurface peak in RNA synthesis (and therefore growth) was located within the dissolved oxygen minimum zone (450 m), suggesting in situ microbiological utilization of dissolved molecular oxygen. Calculations of the specific rates of RNA synthesis (i.e., RNA synthesis per unit of biomass) revealed that the middepth maximum corresponded to the highest specific rate of growth (420 pmol of adenine incorporated into RNA·day−1) of all depths sampled, including the euphotic zone. The existence of an intermediate depth zone of active microbial growth may be an important site for nutrient regeneration and may serve as a source of reduced carbon for mesopelagic and deep sea environments. PMID:16345461

  1. Genetic diversity analysis of buffalo fatty acid synthase (FASN) gene and its differential expression among bovines.

    PubMed

    Niranjan, S K; Goyal, S; Dubey, P K; Kumari, N; Mishra, S K; Mukesh, M; Kataria, R S

    2016-01-10

    Fatty Acid Synthase (FASN) gene seems to be structurally and functionally different in bovines in view of their distinctive fatty acid synthesis process. Structural variation and differential expression of FASN gene is reported in buffalo (Bubalus bubalis), a bovine species close to cattle, in this study. Amino acid sequence and phylogenetic analysis of functionally important thioesterase (TE) domain of FASN revealed its conserved nature across mammals. Amino acid residues at TE domain, responsible for substrate binding and processing, were found to be invariant in all the mammalian species. A total of seven polymorphic nucleotide sites, including two in coding region of TE domain were identified across the 10 buffalo populations of riverine and swamp types. G and C alleles were found almost fixed at g18996 and g19056 loci, respectively in riverine buffaloes. Principal component analysis of three SNPs (g18433, g18996 and g19056) revealed distinct classification of riverine and swamp buffalo populations. Reverse Transcription-PCR amplification of mRNA corresponding to exon 8-10 region of buffalo FASN helped in identification of two transcript variants; one transcript of 565 nucleotides and another alternate transcript of 207 nucleotides, seems to have arisen through alternative splicing. Both the transcripts were found to be expressed in most of the vital tissues of buffalo with the highest expression in mammary gland. Semi-quantitative and real-time expression analysis across 13 different buffalo tissues revealed its highest expression in lactating mammary gland. When compared, expression of FASN was also found to be higher in liver, adipose and skeletal muscle of buffalo tissues, than cattle. However, the FASN expression was highest in adipose among the three tissues in both the species. Results indicate structural and functional distinctiveness of bovine FASN. Presence of alternate splicing in buffalo FASN also seems to be a unique phenomenon to the bovines

  2. Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon activator.

    PubMed Central

    James, D W; Lim, E; Keller, J; Plooy, I; Ralston, E; Dooner, H K

    1995-01-01

    The FATTY ACID ELONGATION1 (FAE1) gene of Arabidopsis is required for the synthesis of very long chain fatty acids in the seed. The product of the FAE1 gene is presumed to be a condensing enzyme that extends the chain length of fatty acids from C18 to C20 and C22. We report here the cloning of FAE1 by directed transposon tagging with the maize element Activator (Ac). An unstable fae1 mutant was isolated in a line carrying Ac linked to the FAE1 locus on chromosome 4. Cosegregation and reversion analyses established that the new mutant was tagged by Ac. A DNA fragment flanking Ac was cloned by inverse polymerase chain reaction and used to isolate FAE1 genomic clones and a cDNA clone from a library made from immature siliques. The predicted amino acid sequence of the FAE1 protein shares homology with those of other condensing enzymes (chalcone synthase, stilbene synthases, and beta-ketoacyl-acyl carrier protein synthase III), supporting the notion that FAE1 is the structural gene for a synthase or condensing enzyme. FAE1 is expressed in developing seed, but not in leaves, as expected from the effect of the fae1 mutation on the fatty acid compositions of those tissues. PMID:7734965

  3. A gene network engineering platform for lactic acid bacteria.

    PubMed

    Kong, Wentao; Kapuganti, Venkata S; Lu, Ting

    2016-02-29

    Recent developments in synthetic biology have positioned lactic acid bacteria (LAB) as a major class of cellular chassis for applications. To achieve the full potential of LAB, one fundamental prerequisite is the capacity for rapid engineering of complex gene networks, such as natural biosynthetic pathways and multicomponent synthetic circuits, into which cellular functions are encoded. Here, we present a synthetic biology platform for rapid construction and optimization of large-scale gene networks in LAB. The platform involves a copy-controlled shuttle for hosting target networks and two associated strategies that enable efficient genetic editing and phenotypic validation. By using a nisin biosynthesis pathway and its variants as examples, we demonstrated multiplex, continuous editing of small DNA parts, such as ribosome-binding sites, as well as efficient manipulation of large building blocks such as genes and operons. To showcase the platform, we applied it to expand the phenotypic diversity of the nisin pathway by quickly generating a library of 63 pathway variants. We further demonstrated its utility by altering the regulatory topology of the nisin pathway for constitutive bacteriocin biosynthesis. This work demonstrates the feasibility of rapid and advanced engineering of gene networks in LAB, fostering their applications in biomedicine and other areas. PMID:26503255

  4. A gene network engineering platform for lactic acid bacteria

    PubMed Central

    Kong, Wentao; Kapuganti, Venkata S.; Lu, Ting

    2016-01-01

    Recent developments in synthetic biology have positioned lactic acid bacteria (LAB) as a major class of cellular chassis for applications. To achieve the full potential of LAB, one fundamental prerequisite is the capacity for rapid engineering of complex gene networks, such as natural biosynthetic pathways and multicomponent synthetic circuits, into which cellular functions are encoded. Here, we present a synthetic biology platform for rapid construction and optimization of large-scale gene networks in LAB. The platform involves a copy-controlled shuttle for hosting target networks and two associated strategies that enable efficient genetic editing and phenotypic validation. By using a nisin biosynthesis pathway and its variants as examples, we demonstrated multiplex, continuous editing of small DNA parts, such as ribosome-binding sites, as well as efficient manipulation of large building blocks such as genes and operons. To showcase the platform, we applied it to expand the phenotypic diversity of the nisin pathway by quickly generating a library of 63 pathway variants. We further demonstrated its utility by altering the regulatory topology of the nisin pathway for constitutive bacteriocin biosynthesis. This work demonstrates the feasibility of rapid and advanced engineering of gene networks in LAB, fostering their applications in biomedicine and other areas. PMID:26503255

  5. Higher transcription levels in ascorbic acid biosynthetic and recycling genes were associated with higher ascorbic acid accumulation in blueberry.

    PubMed

    Liu, Fenghong; Wang, Lei; Gu, Liang; Zhao, Wei; Su, Hongyan; Cheng, Xianhao

    2015-12-01

    In our preliminary study, the ripe fruits of two highbush blueberry (Vaccinium corymbosum L.) cultivars, cv 'Berkeley' and cv 'Bluecrop', were found to contain different levels of ascorbic acid. However, factors responsible for these differences are still unknown. In the present study, ascorbic acid content in fruits was compared with expression profiles of ascorbic acid biosynthetic and recycling genes between 'Bluecrop' and 'Berkeley' cultivars. The results indicated that the l-galactose pathway was the predominant route of ascorbic acid biosynthesis in blueberry fruits. Moreover, higher expression levels of the ascorbic acid biosynthetic genes GME, GGP, and GLDH, as well as the recycling genes MDHAR and DHAR, were associated with higher ascorbic acid content in 'Bluecrop' compared with 'Berkeley', which indicated that a higher efficiency ascorbic acid biosynthesis and regeneration was likely to be responsible for the higher ascorbic acid accumulation in 'Bluecrop'.

  6. CHS5, a gene involved in chitin synthesis and mating in Saccharomyces cerevisiae.

    PubMed Central

    Santos, B; Duran, A; Valdivieso, M H

    1997-01-01

    The CHS5 locus of Saccharomyces cerevisiae is important for wild-type levels of chitin synthase III activity. chs5 cells have reduced levels of this activity. To further understand the role of CHS5 in yeast, the CHS5 gene was cloned by complementation of the Calcofluor resistance phenotype of a chs5 mutant. Transformation of the mutant with a plasmid carrying CHS5 restored Calcofluor sensitivity, wild-type cell wall chitin levels, and chitin synthase III activity levels. DNA sequence analysis reveals that CHS5 encodes a unique polypeptide of 671 amino acids with a molecular mass of 73,642 Da. The predicted sequence shows a heptapeptide repeated 10 times, a carboxy-terminal lysine-rich tail, and some similarity to neurofilament proteins. The effects of deletion of CHS5 indicate that it is not essential for yeast cell growth; however, it is important for mating. Deletion of CHS3, the presumptive structural gene for chitin synthase III activity, results in a modest decrease in mating efficiency, whereas chs5delta cells exhibit a much stronger mating defect. However, chs5 cells produce more chitin than chs3 mutants, indicating that CHS5 plays a role in other processes besides chitin synthesis. Analysis of mating mixtures of chs5 cells reveals that cells agglutinate and make contact but fail to undergo cell fusion. The chs5 mating defect can be partially rescued by FUS1 and/or FUS2, two genes which have been implicated previously in cell fusion, but not by FUS3. In addition, mating efficiency is much lower in fus1 fus2 x chs5 than in fus1 fus2 x wild type crosses. Our results indicate that Chs5p plays an important role in the cell fusion step of mating. PMID:9111317

  7. Modulation of medium-chain fatty acid synthesis in Synechococcus sp. PCC 7002 by replacing FabH with a Chaetoceros Ketoacyl-ACP synthase

    DOE PAGES

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-05-26

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less

  8. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase

    PubMed Central

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  9. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase.

    PubMed

    Gu, Huiya; Jinkerson, Robert E; Davies, Fiona K; Sisson, Lyle A; Schneider, Philip E; Posewitz, Matthew C

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  10. Squaric acid ester-based total synthesis of echinochrome A.

    PubMed

    Peña-Cabrera, Eduardo; Liebeskind, Lanny S

    2002-03-01

    The total synthesis of echinochrome A is described. Both key intermediates 5 and 8 were efficiently prepared from diisopropyl squarate 7. Nucleophilic addition of aryllithium 8 to 5, followed by thermal ring-expansion/cyclization of the 1,2-adduct 4, furnished hydroquinone 3. Oxidation and full deprotection of 3 gave the title compound.

  11. Racemic synthesis and solid phase peptide synthesis application of the chimeric valine/leucine derivative 2-amino-3,3,4-trimethyl-pentanoic acid.

    PubMed

    Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R

    2014-07-01

    The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.

  12. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  13. Associations between variants of FADS genes and omega-3 and omega-6 milk fatty acids of Canadian Holstein cows

    PubMed Central

    2014-01-01

    Background Fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes code respectively for the enzymes delta-5 and delta-6 desaturases which are rate limiting enzymes in the synthesis of polyunsaturated omega-3 and omega-6 fatty acids (FAs). Omega-3 and-6 FAs as well as conjugated linoleic acid (CLA) are present in bovine milk and have demonstrated positive health effects in humans. Studies in humans have shown significant relationships between genetic variants in FADS1 and 2 genes with plasma and tissue concentrations of omega-3 and-6 FAs. The aim of this study was to evaluate the extent of sequence variations within these two genes in Canadian Holstein cows as well as the association between sequence variants and health promoting FAs in milk. Results Thirty three SNPs were detected within the studied regions of genes including a synonymous mutation (FADS1-07, rs42187261, 306Tyr > Tyr) in exon 8 of FADS1, a non-synonymous mutation (FADS2-14, rs211580559, 294Ala > Val) within FADS2 exon 7, a splice site SNP (FADS2-05, rs211263660), a 3′UTR SNP (FADS2-23, rs109772589), and another 3′UTR SNP with an effect on a microRNA binding site within FADS2 gene (FADS2-19, rs210169303). Association analyses showed significant relations between three out of seven tested SNPs and several FAs. Significant associations (FDR P < 0.05) were recorded between FADS2-23 (rs109772589) and two omega-6 FAs (dihomogamma linolenic acid [C20:3n6] and arachidonic acid [C20:4n6]), FADS1-07 (rs42187261) and one omega-3 FA (eicosapentaenoic acid, C20:5n3) and tricosanoic acid (C23:0), and one intronic SNP, FADS1-01 (rs136261927) and C20:3n6. Conclusion Our study has demonstrated positive associations between three SNPs within FADS1 and FADS2 genes (a SNP within the 3’UTR, a synonymous SNP and an intronic SNP), with three milk PUFAs of Canadian Holstein cows thus suggesting possible involvement of synonymous and non-coding region variants in FA synthesis. These SNPs may serve as

  14. T-box binding protein type two (TBX2) is an immediate early gene target in retinoic-acid-treated B16 murine melanoma cells.

    PubMed

    Boskovic, Goran; Niles, Richard M

    2004-05-01

    Retinoic acid induces growth arrest and differentiation in B16 mouse melanoma cells. Using gene arrays, we identified several early response genes whose expression is altered by retinoic acid. One of the genes, tbx2, is a member of T-box nuclear binding proteins that are important morphogens in developing embryos. Increased TBX2 mRNA is seen within 2 h after addition of retinoic acid to B16 cells. The effect of retinoic acid on gene expression is direct since it does not require any new protein synthesis. We identified a degenerate retinoic acid response element (RARE) between -186 and -163 in the promoter region of the tbx2 gene. A synthetic oligonucleotide spanning this region was able to drive increased expression of a luciferase reporter gene in response to retinoic acid; however, this induction was lost when a point mutation was introduced into the RARE. This oligonucleotide also specifically bound RAR in nuclear extracts from B16 cells. TBX2 expression and its induction by retinoic acid was also observed in normal human and nonmalignant mouse melanocytes. PMID:15093729

  15. Peptide nucleic acids (PNAs) patterning by an automated microarray synthesis system through photolithography.

    PubMed

    Wu, Yan-Qi; Yang, Fei-Peng; Wang, Hong-Yin; Liu, Jian-Xin; Liu, Zheng-Chun

    2013-03-01

    Peptide nucleic acids (PNA) microarray assembled with hundreds of unique PNA oligomers has been regarded as a new and mighty competitor of DNA chip in gene analyzing. However, PNA microarray is still a luxury art due to the difficult and laborious chemical synthesis. Herein, we have developed a fully-automated synthesizer for PNA microarray through photolithography. A preactivation mixer was designed and integrated into the synthesizer in order to get rid of the annoying manual process and increase the coupling efficiency of PNA monomers. The PNA patterning model was carried out to check the performance of the automated synthesizer, revealing that an exposure time of 3 min was sufficient for the complete removal of o-nitroveratryloxycarbonyl (NVOC) groups from the synthetic sites with the help of photosensitizer isopropylthioxanthone and the stepwise yield was measured to be about 98.0%, which is comparable with that from conventional fluorenyl-methyloxycarbonyl (FMOC) chemistry. Those results have definitely demonstrated the possibility and capability of this fully-automated synthesizer to fabricate high-quality PNA microarrays.

  16. The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry ▿

    PubMed Central

    Keller, Ullrich; Lang, Manuel; Crnovcic, Ivana; Pfennig, Frank; Schauwecker, Florian

    2010-01-01

    A gene cluster was identified which contains genes involved in the biosynthesis of actinomycin encompassing 50 kb of contiguous DNA on the chromosome of Streptomyces chrysomallus. It contains 28 genes with biosynthetic functions and is bordered on both sides by IS elements. Unprecedentedly, the cluster consists of two large inverted repeats of 11 and 13 genes, respectively, with four nonribosomal peptide synthetase genes in the middle. Nine genes in each repeat have counterparts in the other, in the same arrangement but in the opposite orientation, suggesting an inverse duplication of one of the arms during the evolution of the gene cluster. All of the genes appear to be organized into operons, each corresponding to a functional section of actinomycin biosynthesis, such as peptide assembly, regulation, resistance, and biosynthesis of the precursor of the actinomycin chromophore 4-methyl-3-hydroxyanthranilic acid (4-MHA). For 4-MHA synthesis, functional analysis revealed genes that encode pathway-specific isoforms of tryptophan dioxygenase, kynurenine formamidase, and hydroxykynureninase, which are distinct from the corresponding enzyme activities of cellular tryptophan catabolism in their regulation and in part in their substrate specificity. Phylogenetic analysis indicates that the pathway-specific tryptophan metabolism in Streptomyces most probably evolved divergently from the normal pathway of tryptophan catabolism to provide an extra or independent supply of building blocks for the synthesis of tryptophan-derived secondary metabolites. PMID:20304989

  17. A Nitrogen-Assisted One-Pot Heteroaryl Ketone Synthesis from Carboxylic Acids and Heteroaryl Halides.

    PubMed

    Demkiw, Krystyna; Araki, Hirofumi; Elliott, Eric L; Franklin, Christopher L; Fukuzumi, Yoonjoo; Hicks, Frederick; Hosoi, Kazushi; Hukui, Tadashi; Ishimaru, Yoichiro; O'Brien, Erin; Omori, Yoshimasa; Mineno, Masahiro; Mizufune, Hideya; Sawada, Naotaka; Sawai, Yasuhiro; Zhu, Lei

    2016-04-15

    A practical and highly effective one-pot synthesis of versatile heteroaryl ketones directly from carboxylic acids and heteroaryl halides under mild conditions is reported. This method does not require derivatization of carboxylic acids (preparation of acid chlorides, Weinreb amides, etc.) or the use of any additives/catalysts. A wide substrate scope of carboxylic acids with high functional group tolerance has also been demonstrated. The results reveal that the presence of an α-nitrogen on the halide substrate greatly improves the desired ketone formation.

  18. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  19. Conversion of 5-formyltetrahydrofolic acid to 5-methyltetrahydrofolic acid is unimpaired in folate-adequate persons homozygous for the C677T mutation in the methylenetetrahydrofolate reductase gene.

    PubMed

    Stern, L L; Bagley, P J; Rosenberg, I H; Selhub, J

    2000-09-01

    Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolic acid (5-CH(3)-H(4) folic acid), the methyl donor for the formation of methionine from homocysteine. A common C677T transition in the MTHFR gene results in a variant with a lower specific activity and a greater sensitivity to heat than the normal enzyme, as measured in vitro. This study was undertaken to determine the capacity of homozygotes for the MTHFR C677T transition to convert 5-formyltetrahydrofolic acid (5-HCO-H(4) folic acid) to 5-CH(3)-H(4) folic acid, a process that requires the action of MTHFR. Six subjects homozygous for the C677T transition (T/T) and 6 subjects with wild-type MTHFR (C/C) were given a 5-mg oral dose of (6R:,S:)-5-HCO-H(4) folic acid. Plasma and urine were analyzed for 5-CH(3)-H(4) folic acid concentrations using affinity/HPLC coupled with fluorescence or UV detection. The mean areas under the curves created by the rise and fall of plasma 5-CH(3)-H(4) folic acid after the oral dose did not differ between the two genotypes, 424.5 +/- 140.3 (T/T) vs. 424.1+/- 202.4 h.nmol/L (C/C). There also was no significant difference in the mean cumulative 7-h urinary excretion of 5-CH(3)-H(4) folic acid between the T/T (2.5 +/- 1.4 micromol) and C/C (1.9 +/- 1.0 micromol) genotypes. Under the conditions employed, the conversion of oral 5-HCO-H(4) folic acid to 5-CH(3)-H(4) folic acid is not impaired in persons with the T/T MTHFR genotype. Possible reasons for these findings are discussed. PMID:10958818

  20. Mutations in a delta9-Stearoyl-ACP-Desaturase Gene Are Associated with Enhanced Stearic Acid Levels in Soybean Seeds

    SciTech Connect

    Zhang, P.; Shanklin, J.; Burton, J. W.; Upchurch, R. G.; Whittle, E.; Dewey, R. E.

    2008-11-01

    Stearic acid (18:0) is typically a minor component of soybean [Glycine max (L.) Merr.] oil, accounting for only 2 to 4% of the total fatty acid content. Increasing stearic acid levels of soybean oil would lead to enhanced oxidative stability, potentially reducing the need for hydrogenation, a process leading to the formation of undesirable trans fatty acids. Although mutagenesis strategies have been successful in developing soybean germplasm with elevated 18:0 levels in the seed oil, the specific gene mutations responsible for this phenotype were not known. We report a newly identified soybean gene, designated SACPD-C, that encodes a unique isoform of {Delta}{sup 9}-stearoyl-ACP-desaturase, the enzyme responsible for converting stearic acid to oleic acid (18:1). High levels of SACPD-C transcript were only detected in developing seed tissue, suggesting that the encoded desaturase functions to enhance oleic acid biosynthetic capacity as the immature seed is actively engaged in triacylglycerol production and storage. The participation of SACPD-C in storage triacylglycerol synthesis is further supported by the observation of mutations in this gene in two independent sources of elevated 18:0 soybean germplasm, A6 (30% 18:0) and FAM94-41 (9% 18:0). A molecular marker diagnostic for the FAM94-41 SACPD-C gene mutation strictly associates with the elevated 18:0 phenotype in a segregating population, and could thus serve as a useful tool in the development of cultivars with oils possessing enhanced oxidative stability.

  1. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials. PMID:27482849

  2. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials.

  3. Fatty acid-gene interactions, adipokines and obesity.

    PubMed

    Stryjecki, C; Mutch, D M

    2011-03-01

    It is now recognized that the low-grade inflammation observed with obesity is associated with the development of a wide range of downstream complications. As such, there is considerable interest in elucidating the regulatory mechanisms underlying the production of inflammatory molecules to improve the prevention and treatment of obesity and its co-morbidities. White adipose tissue is no longer considered a passive reservoir for storing lipids, but rather an important organ influencing energy metabolism, insulin sensitivity and inflammation by the secretion of proteins, commonly referred to as adipokines. Dysregulation of several adipokines, such as tumor necrosis factor-alpha (TNF-α), interleukin-6 (IL-6) and adiponectin, contributes to the low-grade inflammation that is a hallmark of obesity. Evidence now suggests that fatty acids represent a class of molecules that can modulate adipokine production, thereby influencing inflammatory status. Although the precise molecular mechanisms by which dietary fats regulate adipokine production remain unclear, recent findings indicate that diet-gene interactions may have an important role in the transcriptional and secretory regulation of adipokines. Single-nucleotide polymorphisms in the genes encoding TNF-α, IL-6 and adiponectin can modify circulating levels of these adipokines and, subsequently, obesity-related phenotypes. This genetic variation can also alter the influence of dietary fatty acids on adipokine production. Therefore, the current review will show that it is paramount to consider both genetic information and dietary fat intake to unravel the inter-individual variability in inflammatory response observed in intervention protocols targeting obesity.

  4. Abscisic acid is involved in the iron-induced synthesis of maize ferritin.

    PubMed

    Lobréaux, S; Hardy, T; Briat, J F

    1993-02-01

    The ubiquitous iron storage protein ferritin has a highly conserved structure in plants and animals, but a distinct cytological location and a different level of control in response to iron excess. Plant ferritins are plastid-localized and transcriptionally regulated in response to iron, while animal ferritins are found in the cytoplasm and have their expression mainly controlled at the translational level. In order to understand the basis of these differences, we developed hydroponic cultures of maize plantlets which allowed an increase in the intracellular iron concentration, leading to a transient accumulation of ferritin mRNA and protein (Lobréaux,S., Massenet,O. and Briat,J.F., 1992, Plant Mol. Biol., 19, 563-575). Here, it is shown that iron induces ferritin and RAB (Responsive to Abscisic Acid) mRNA accumulation relatively with abscisic acid (ABA) accumulation. Ferritin mRNA also accumulates in response to exogenous ABA. Synergistic experiments demonstrate that the ABA and iron responses are linked, although full expression of the ferritin genes cannot be entirely explained by an increase in ABA concentration. Inducibility of ferritin mRNA accumulation by iron is dramatically decreased in the maize ABA-deficient mutant vp2 and can be rescued by addition of exogenous ABA, confirming the involvement of ABA in the iron response in plants. Therefore, it is concluded that a major part of the iron-induced biosynthesis of ferritin is achieved through a pathway involving an increase in the level of the plant hormone ABA. The general conclusion of this work is that the synthesis of the same protein in response to the same environmental signal can be controlled by separate and distinct mechanisms in plants and animals.

  5. Polymers from fatty acids: poly(ω-hydroxyl tetradecanoic acid) synthesis and physico-mechanical studies.

    PubMed

    Liu, Chen; Liu, Fei; Cai, Jiali; Xie, Wenchun; Long, Timothy E; Turner, S Richard; Lyons, Alan; Gross, Richard A

    2011-09-12

    This Article describes the synthesis and physicomechanical properties of bioplastics prepared from methyl ω-hydroxytetradecanoic acid (Me-ω-OHC14), a new monomer available by a fermentation process using an engineered Candida tropicalis strain. Melt-condensation experiments were conducted using titanium tetraisopropoxide (Ti[OiPr](4)) as a catalyst in a two-stage polymerization (2 h at 200 °C under N(2), 4 h at 220 °C under 0.1 mmHg). Poly(ω-hydroxytetradecanoate), P(ω-OHC14), M(w), determined by SEC-MALLS, increased from 53K to 110K as the Ti(OiPr)(4) concentration increased from 50 to 300 ppm. By varying the polymerization conditions (catalyst concentration, reaction time, second-stage reaction temperature) a series of P(ω-OHC14) samples were prepared with M(w) values from 53K to 140K. The synthesized polyesters with M(w) ranging from 53K to 140K were subjected to characterization by DSC, TGA, DMTA, and tensile testing. Influences of P(ω-OHC14) molecular weight, melting point, and enthalpies of melting/crystallization on material tensile properties were explored. Cold-drawing tensile tests at room temperature for P(ω-OHC14) with M(w) 53K-78K showed a brittle-to-ductile transition. In contrast, P(ω-OHC14) with M(w) 53K undergoes brittle fracture. Increasing P(ω-OHC14) M(w) above 78K resulted in a strain-hardening phenomena and tough properties with elongation at break ~700% and true tensile strength of ~50 MPa. Comparisons between high density polyethylene and P(ω-OHC14) mechanical and thermal properties as a function of their respective molecular weights are discussed. PMID:21793591

  6. [Synthesis, characterization and application of polyglycerols and polyglycerol fatty acid esters].

    PubMed

    Behrens, H; Mieth, G

    1984-01-01

    The current state of knowledge in the field of synthesis and properties of polyglycerols and polyglycerol fatty acid esters is presented. Alternatives for the analytical characterization of these families by means of physico-chemical methods, with special reference to chromatography and spectroscopy, are described. Furthermore, the use of polyglycerol fatty acid esters as food additives is considered from the view-points of the physiology of nutrition and of processing technology.

  7. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  8. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  9. Novel enzymatic synthesis of 4-O-cinnamoyl quinic and shikimic acid derivatives.

    PubMed

    Armesto, Nuria; Ferrero, Miguel; Fernández, Susana; Gotor, Vicente

    2003-07-11

    The first direct synthesis of 4-O-cinnamoyl derivatives of quinic and shikimic acids were accomplished by regioselective esterification with Candida antarctica lipase A. For hydrocinnamic esters, enzymatic transesterification with vinyl esters gave excellent yields. However, more reactive acylating agents such as anhydrides were used to synthesize cinnamic derivatives of both acids. An inhibitory effect was observed with this lipase for p-methoxy, p-hydroxy, and p-acetoxy vinyl ester and anhydride derivatives (coumarate and ferulate derivatives).

  10. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  11. Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs.

    PubMed

    Suryawan, Agus; O'Connor, Pamela M J; Bush, Jill A; Nguyen, Hanh V; Davis, Teresa A

    2009-05-01

    The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose-amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8-12/group) with insulin at 0, 10, 22, and 110 ng kg(-0.66) min(-1) to achieve approximately 0, 2, 6 and 30 muU ml(-1) insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L: -[4-(3)H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids.

  12. Abscisic acid regulates pinoresinol-lariciresinol reductase gene expression and secoisolariciresinol accumulation in developing flax (Linum usitatissimum L.) seeds.

    PubMed

    Renouard, Sullivan; Corbin, Cyrielle; Lopez, Tatiana; Montguillon, Josiane; Gutierrez, Laurent; Lamblin, Frédéric; Lainé, Eric; Hano, Christophe

    2012-01-01

    Secoisolariciresinol diglucoside (SDG), the main phytoestrogenic lignan of Linum usitatissimum, is accumulated in the seed coat of flax during its development and pinoresinol-lariciresinol reductase (PLR) is a key enzyme in flax for its synthesis. The promoter of LuPLR1, a flax gene encoding a pinoresinol lariciresinol reductase, contains putative regulatory boxes related to transcription activation by abscisic acid (ABA). Gel mobility shift experiments evidenced an interaction of nuclear proteins extracted from immature flax seed coat with a putative cis-acting element involved in ABA response. As ABA regulates a number of physiological events during seed development and maturation we have investigated its involvement in the regulation of this lignan synthesis by different means. ABA and SDG accumulation time courses in the seed as well as LuPLR1 expression were first determined in natural conditions. These results showed that ABA timing and localization of accumulation in the flax seed coat could be correlated with the LuPLR1 gene expression and SDG biosynthesis. Experimental modulations of ABA levels were performed by exogenous application of ABA or fluridone, an inhibitor of ABA synthesis. When submitted to exogenous ABA, immature seeds synthesized 3-times more SDG, whereas synthesis of SDG was reduced in immature seeds treated with fluridone. Similarly, the expression of LuPLR1 gene in the seed coat was up-regulated by exogenous ABA and down-regulated when fluridone was applied. These results demonstrate that SDG biosynthesis in the flax seed coat is positively controlled by ABA through the transcriptional regulation of LuPLR1 gene.

  13. Nucleotide sequence and genetic analysis of the neuD and neuB genes in region 2 of the polysialic acid gene cluster of Escherichia coli K1.

    PubMed Central

    Annunziato, P W; Wright, L F; Vann, W F; Silver, R P

    1995-01-01

    The K1 capsular polysaccharide, a polymer of sialic acid, is an important virulence determinant of extraintestinal pathogenic Escherichia coli. The genes responsible for the synthesis and expression of the polysialic acid capsule of E. coli K1 are located on the 17-kb kps gene cluster, which is functionally divided into three regions. Central region 2 encodes proteins necessary for the synthesis, activation, and polymerization of sialic acid, while flanking regions 1 and 3 are involved in polymer transport to the cell surface. In this study, we identified two genes at the proximal end of region 2, neuD and neuB, which encode proteins with predicted sizes of 22.7 and 38.7 kDa, respectively. Several observations suggest that the neuB gene encodes sialic acid synthase. EV24, a neuB chromosomal mutant that expresses a capsule when provided exogenous sialic acid, could be complemented in trans by the cloned neuB gene. In addition, NeuB has significant sequence similarity to the product of the cpsB gene of Neisseria meningitidis group B, which is postulated to encode sialic acid synthase. We also present data indicating that neuD has an essential role in K1 polymer production. Cells harboring pSR426, which contains all of region 2 but lacks region 1 and 3 genes, produce an intracellular polymer. In contrast, no polymer accumulated in cells carrying a derivative of pSR426 lacking a functional neuD gene. Unlike strains with mutations in neuB, however, neuD mutants are not complemented by exogenous sialic acid, suggesting that NeuD is not involved in sialic acid synthesis. Additionally, cells harboring a mutation in neuD accumulated sialic acid and CMP-sialic acid. We also found no significant differences between the endogenous and exogenous sialyltransferase activities of a neuD mutant and the wild-type organism. NeuD shows significant similarity to a family of bacterial acetyltransferases, leading to the theory that NeuD is an acetyltransferase which may exert its

  14. [Gene cloning and bioinformatics analysis of new gene for chlorogenic acid biosynthesis of Lonicera hypoglauca].

    PubMed

    Yu, Shu-lin; Huang, Lu-qi; Yuan, Yuan; Qi, Lin-jie; Liu, Da-hui

    2015-03-01

    To obtain the key genes for chlorogenic acid biosynthesis of Lonicera hypoglauca, four new genes ware obtained from the our dataset of L. hypoglauca. And we also predicted the structure and function of LHPAL4, LHHCT1 , LHHCT2 and LHHCT3 proteins. The phylogenetic tree showed that LHPAL4 was closely related with LHPAL1, LHHCT1 was closely related with LHHCT3, LHHCT2 clustered into a single group. By Real-time PCR to detect the gene expressed level in different organs of L. hypoglauca, we found that the transcripted level of LHPAL4, LHHCT1 and LHHCT3 was the highest in defeat flowers, and the transcripted level of LHHCT2 was the highest in leaves. These result provided a basis to further analysis the mechanism of active ingredients in different organs, as well as the element for in vitro biosynthesis of active ingredients.

  15. [Gene cloning and bioinformatics analysis of new gene for chlorogenic acid biosynthesis of Lonicera hypoglauca].

    PubMed

    Yu, Shu-lin; Huang, Lu-qi; Yuan, Yuan; Qi, Lin-jie; Liu, Da-hui

    2015-03-01

    To obtain the key genes for chlorogenic acid biosynthesis of Lonicera hypoglauca, four new genes ware obtained from the our dataset of L. hypoglauca. And we also predicted the structure and function of LHPAL4, LHHCT1 , LHHCT2 and LHHCT3 proteins. The phylogenetic tree showed that LHPAL4 was closely related with LHPAL1, LHHCT1 was closely related with LHHCT3, LHHCT2 clustered into a single group. By Real-time PCR to detect the gene expressed level in different organs of L. hypoglauca, we found that the transcripted level of LHPAL4, LHHCT1 and LHHCT3 was the highest in defeat flowers, and the transcripted level of LHHCT2 was the highest in leaves. These result provided a basis to further analysis the mechanism of active ingredients in different organs, as well as the element for in vitro biosynthesis of active ingredients. PMID:26087546

  16. Mutation affecting regulation of synthesis of acetohydroxy acid synthetase in Escherichia coli K-12.

    PubMed Central

    Jackson, J H; Henderson, E K

    1975-01-01

    Altered regulation of synthesis of acetohydroxy acid synthetase (AHAS) was previously reported in a mutant of Escherichia coli strain K-12. The mutant strain, growing in minimal medium, exhibits a partial growth limiatation and derepression of AHAS, owing to deficient synthesis of isoleucine. The genetic lesion (ilvE503) causing the isoleucine limitation was shown to cause derepression of a valine-sensitive AHAS activity. The derepression effect of the ilvE503 mutation upon synthesis of AHAS was conclusively demonstrated by introducing both the ilvE503 allele and an altered AHAS (ilv-521) into the same cell. Evidence is presented that suggests the presence of multiple genetic regions for synthesis and control of the valine-sensitive AHAS activity. PMID:1089632

  17. Phylogenetic distribution of compatible solute synthesis genes support a freshwater origin for cyanobacteria.

    PubMed

    Blank, Carrine E

    2013-10-01

    Previous work using ancestral state reconstruction of habitat salinity preference proposed that the early cyanobacteria likely lived in a freshwater environment. The aim of this study was to test that hypothesis by performing phylogenetic analyses of the genes underlying salinity preferences in the cyanobacteria. Phylogenetic analysis of compatible solute genes shows that sucrose synthesis genes were likely ancestral in the cyanobacteria, and were also likely inherited during the cyanobacterial endosymbiosis and into the photosynthetic algae and land plants. In addition, the genes for the synthesis of compatible solutes that are necessary for survival in marine and hypersaline environments (such as glucosylglycerol, glucosylglycerate, and glycine betaine) were likely acquired independently high up (i.e., more recently) in the cyanobacterial tree. Because sucrose synthesis is strongly associated with growth in a low salinity environment, this independently supports a freshwater origin for the cyanobacteria. It is also consistent with geologic evidence showing that the early oceans were much warmer and saltier than modern oceans-sucrose synthesis alone would have been insufficient for early cyanobacteria to have colonized early Precambrian oceans that had a higher ionic strength. Indeed, the acquisition of an expanded set of new compatible solute genes may have enabled the historical colonization of marine and hypersaline environments by cyanobacteria, midway through their evolutionary history. PMID:27007313

  18. Asymmetric synthesis of aromatic β-amino acids using ω-transaminase: Optimizing the lipase concentration to obtain thermodynamically unstable β-keto acids.

    PubMed

    Mathew, Sam; Jeong, Seong-Su; Chung, Taeowan; Lee, Sang-Hyeup; Yun, Hyungdon

    2016-01-01

    Synthesized aromatic β-amino acids have recently attracted considerable attention for their application as precursors in many pharmacologically relevant compounds. Previous studies on asymmetric synthesis of aromatic β-amino acids using ω-transaminases could not be done efficiently due to the instability of β-keto acids. In this study, a strategy to circumvent the instability problem of β-keto acids was utilized to generate β-amino acids efficiently via asymmetric synthesis. In this work, thermodynamically stable β-ketoesters were initially converted to β-keto acids using lipase, and the β-keto acids were subsequently aminated using ω-transaminase. By optimizing the lipase concentration, we successfully overcame the instability problem of β-keto acids and enhanced the production of β-amino acids. This strategy can be used as a general approach to efficiently generate β-amino acids from β-ketoesters.

  19. Oxidative allylic rearrangement of cycloalkenols: Formal total synthesis of enantiomerically pure trisporic acid B

    PubMed Central

    Dubberke, Silke; Abbas, Muhammad

    2011-01-01

    Summary Enantiomerically highly enriched unsaturated β-ketoesters bearing a quaternary stereocenter can be utilized as building blocks for the synthesis of natural occurring terpenes, i. a., trisporic acid and its derivatives. An advanced building block has been synthesized in a short reaction sequence, which involves an oxidative allylic rearrangement initiated by pyridinium dichromate (PDC) as the key step. PMID:21512603

  20. An Overview of Stereoselective Synthesis of α-Aminophosphonic Acids and Derivatives

    PubMed Central

    Ordóñez, Mario; Rojas-Cabrera, Haydée; Cativiela, Carlos

    2009-01-01

    An overview of all methodologies published during the last few years focused to the stereoselective (diastereoselective or enantioselective) synthesis of α-aminophosphonic acids and derivatives is reported. The procedures have been classified according a retrosynthetic strategy and taking into account the formation of each one of the bonds connected to the chiral centre. PMID:20871799

  1. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  2. o-Iodoxybenzoic acid mediated oxidative desulfurization initiated domino reactions for synthesis of azoles.

    PubMed

    Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G

    2012-04-20

    A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides.

  3. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  4. Efficient Enantioselective Synthesis of Oxahelicenes Using Redox/Acid Cooperative Catalysts.

    PubMed

    Sako, Makoto; Takeuchi, Yoshiki; Tsujihara, Tetsuya; Kodera, Junpei; Kawano, Tomikazu; Takizawa, Shinobu; Sasai, Hiroaki

    2016-09-14

    An efficient and enantioselective synthesis of oxa[9]helicenes has been established via vanadium(V)-catalyzed oxidative coupling/intramolecular cyclization of polycyclic phenols. A newly developed vanadium complex cooperatively functions as both a redox and Lewis acid catalyst to promote the present sequential reaction and afford oxa[9]helicenes in good yields with up to 94% ee. PMID:27574874

  5. Insulin and amino acids stimulate whole body protein synthesis in neonates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Insulin and amino acids (AA) stimulate muscle protein synthesis in neonatal pigs. To determine the effects of insulin and AA on whole body protein turnover, hyperinsulinemic (0 and 100 ng/(kg[0.66]/min))-euglycemic-AA clamps were performed during euaminoacidemia or hyperaminoacidemia in fasted 7-d-...

  6. A Synthesis Method of Gene Networks Having Cyclic Expression Pattern Sequences by Network Learning

    NASA Astrophysics Data System (ADS)

    Mori, Yoshihiro; Kuroe, Yasuaki

    Recently, synthesis of gene networks having desired functions has become of interest to many researchers because it is a complementary approach to understanding gene networks, and it could be the first step in controlling living cells. There exist several periodic phenomena in cells, e.g. circadian rhythm. These phenomena are considered to be generated by gene networks. We have already proposed synthesis method of gene networks based on gene expression. The method is applicable to synthesizing gene networks possessing the desired cyclic expression pattern sequences. It ensures that realized expression pattern sequences are periodic, however, it does not ensure that their corresponding solution trajectories are periodic, which might bring that their oscillations are not persistent. In this paper, in order to resolve the problem we propose a synthesis method of gene networks possessing the desired cyclic expression pattern sequences together with their corresponding solution trajectories being periodic. In the proposed method the persistent oscillations of the solution trajectories are realized by specifying passing points of them.

  7. [Cloning of structural genes involved in riboflavin synthesis of the yeast Candida famata].

    PubMed

    Dmytruk, K V; Abbas, C A; Voronovsky, A Y; Kshanovska, B V; Sybirna, K A; Sybirny, A A

    2004-01-01

    The riboflavin overproducing mutants of the flavinogenic yeast Candida famata isolated by conventional selection methods are used for the industrial production of vitamin B2. Recently, a transformation system was developed for C. famata using the leu2 mutant as a recipient strain and Saccharomyces cerevislae LEU2 gene as a selective marker. In this paper the cloning of C. famata genes for riboflavin synthesis on the basis of developed transformation system for this yeast species is described. Riboflavin autotrophic mutants were isolated from a previously selected C. famata leu2 strain. C. famata genomic DNA library was constructed and used for cloning of the corresponding structural genes for riboflavin synthesis by complementation of the growth defects on a medium without leucine and riboflavin. As a result, the DNA fragments harboring genes RIB1, RIB2, RIB5, RIB6 and RIB7 encoding GTP cyclohydrolase, reductase, dimethylribityllumazine synthase, dihydroxybutanone phosphate synthase and riboflavin synthase, were isolated and subsequently subcloned to the smallest possible fragments. The plasmids with these genes successfully complemented riboflavin auxotrophies of the corresponding mutants of another flavinogenic yeast Pichia guilliermondii. This suggested that C. famata structural genes for riboflavin synthesis and not some of the supressor genes were cloned. PMID:15909421

  8. Streptococcus pneumoniae arginine synthesis genes promote growth and virulence in pneumococcal meningitis.

    PubMed

    Piet, Jurgen R; Geldhoff, Madelijn; van Schaik, Barbera D C; Brouwer, Matthijs C; Valls Seron, Mercedes; Jakobs, Marja E; Schipper, Kim; Pannekoek, Yvonne; Zwinderman, Aeilko H; van der Poll, Tom; van Kampen, Antoine H C; Baas, Frank; van der Ende, Arie; van de Beek, Diederik

    2014-06-01

    Streptococcus pneumoniae (pneumococcus) is a major human pathogen causing pneumonia, sepsis and bacterial meningitis. Using a clinical phenotype based approach with bacterial whole-genome sequencing we identified pneumococcal arginine biosynthesis genes to be associated with outcome in patients with pneumococcal meningitis. Pneumococci harboring these genes show increased growth in human blood and cerebrospinal fluid (CSF). Mouse models of meningitis and pneumonia showed that pneumococcal strains without arginine biosynthesis genes were attenuated in growth or cleared, from lung, blood and CSF. Thus, S. pneumoniae arginine synthesis genes promote growth and virulence in invasive pneumococcal disease.

  9. Synthesis and transdermal properties of acetylsalicylic acid and selected esters.

    PubMed

    Gerber, Minja; Breytenbach, Jaco C; Hadgraft, Jonathan; du Plessis, Jeanetta

    2006-03-01

    The primary aim of this study was to determine the transdermal penetration of acetylsalicylic acid and some of its derivatives, to establish a correlation, if any, with selected physicochemical properties and to determine if transdermal application of acetylsalicylic acid and its derivatives will give therapeutic drug concentrations with respect to transdermal flux. Ten derivatives of acetylsalicylic acid were prepared by esterification of acetylsalicyloyl chloride with ten different alcohols. The experimental aqueous solubility, logD and transdermal flux values were determined for acetylsalicylic acid and its derivatives at pH 4.5. In vitro penetration was measured through excised female human abdominal skin in diffusion cells. The experimental aqueous solubility of acetylsalicylic acid (6.56 mg/ml) was higher than that of the synthesised acetylsalicylate derivatives (ranging from 1.76 x 10(-3) to 3.32 mg/ml), and the logD of acetylsalicylic acid (-0.85) was lower than that of its derivatives (ranging from -0.25 to 1.95). There was thus an inverse correlation between the aqueous solubility data and the logD values. The experimental transdermal flux of acetylsalicylic acid (263.83 nmol/cm(2)h) was much higher than that of its derivatives (ranging from 0.12 to 136.02 nmol/cm(2)h).

  10. [Asymmetric synthesis of aromatic L-amino acids catalyzed by transaminase].

    PubMed

    Xia, Wenna; Sun, Yu; Min, Cong; Han, Wei; Wu, Sheng

    2012-11-01

    Aromatic L-Amino acids are important chiral building blocks for the synthesis of many drugs, pesticides, fine chemicals and food additives. Due to the high activity and steroselectivity, enzymatic synthesis of chiral building blocks has become the main research direction in asymmetric synthesis field. Guided by the phylogenetic analysis of transaminases from different sources, two representative aromatic transaminases TyrB and Aro8 in type I subfamily, from the prokaryote Escherichia coli and eukaryote Saccharomyces cerevisia, respectively, were applied for the comparative study of asymmetric transamination reaction process and catalytic efficiency of reversely converting keto acids to the corresponding aromatic L-amino acid. Both TyrB and Aro8 could efficiently synthesize the natural aromatic amino acids phenylalanine and tyrosine as well as non-natural amino acid phenylglycine. The chiral HPLC analysis showed the produced amino acids were L-configuration and the e.e value was 100%. L-alanine was the optimal amino donor, and the transaminase TyrB and Aro8 could not use D-amino acids as amino donor. The optimal molar ratio of amino donor (L-alanine) and amino acceptor (aromatic alpha-keto acids) was 4:1. Both of the substituted group on the aromatic ring and the length of fatty acid carbon chain part in the molecular structure of aromatic substrate alpha-keto acid have the significant impact on the enzyme-catalyzed transamination efficiency. In the experiments of preparative-scale transamination synthesis of L-phenylglycine, L-phenylalanine and L-tyrosine, the specific production rate catalyzed by TryB were 0.28 g/(g x h), 0.31 g/(g x h) and 0.60 g/(g x h) and the specific production rate catalyzed by Aro8 were 0.61 g/(g x h), 0.48 g/(g x h) and 0.59 g/(g x h). The results obtained here were useful for applying the transaminases to asymmetric synthesis of L-amino acids by reversing the reaction balance in industry.

  11. Concurrent synthesis and release of nod-gene-inducing flavonoids from alfalfa roots. [Medicago sativa L. ; Rhizobium meliloti

    SciTech Connect

    Maxwell, C.A.; Phillips, D.A. )

    1990-08-01

    Flavonoid signals from alfalfa (Medicago sativa L.) induce transcription of nodulation (nod) genes in Rhizobium meliloti. Alfalfa roots release three major nod-gene inducers: 4{prime},7-dihydroxyflavanone, 4{prime},7-dihydroxyflavone, and 4,4{prime}-dihydroxy-2{prime}-methoxychalcone. The objective of the present study was to define temporal relationships between synthesis and exudation for those flavonoids. Requirements for concurrent flavonoid biosynthesis were assessed by treating roots of intact alfalfa seedlings with (U-{sup 14}C)-L-phenylalanine in the presence or absence of the phenylalanine ammonia-lyase inhibitor L-2-aminoxy-3-phenylpropionic acid (AOPP). In the absence of AOPP, each of the three flavonoids in exudates contained {sup 14}C. In the presence of AOPP, {sup 14}C labeling and release of all the exuded nod-gene inducers were reduced significantly. AOPP inhibited labeling and release of the strongest nod-gene inducer, methoxychalcone, by more than 90%. The release process responsible for exudation of nod-gene inducers appears to be specific rather than a general phenomenon such as a sloughing off of cells during root growth.

  12. The effects of Musk T on peroxisome proliferator-activated receptor [PPAR]-alpha activation, epidermal skin homeostasis and dermal hyaluronic acid synthesis.

    PubMed

    Kim, Seung Hun; Nam, Gae Won; Lee, Hae Kwang; Moon, Seong Joon; Chang, Ih Seop

    2006-11-01

    Peroxisome proliferators activated receptors (PPARs) are a family of nuclear hormone receptors that heterodimer with the retinoid X receptor and function as transcriptional regulators of genes. Topically Applied PPAR-alpha agonists possess receptor mediated, pro-differentiating/anti-proliferative effects, lipid metabolism stimulation, and anti-inflammatory activity, which suggest that they could be beneficial for the treatment of a variety of cutaneous diseases. Hyaluronan (HA), a high-molecular-weight linear glycosaminoglycan consisting of alternating D: -glucuronic acid and N-acetyl-D: -glucosamine residues, is one of the major extracellular matrix components in skin. Among the family of HA synthase genes (HAS1, 2, 3) so far identified, one group has demonstrated that the expressions of HAS2 and HAS3 play crucial roles in the regulation of HA synthesis in human skin fibroblasts and keratinocytes, respectively, but the precise regulatory mechanisms are still unknown. We examine Musk T called Ethylene brassylate, Astratone or 1,4-Dioxacycloheptadecane-5,17-dione, which used as just a perfume ingredient, plays a role as PPAR-alpha ligand in vitro and stimulates skin barrier recovery, ceramide synthesis, beta-Glucocerebrosidase, involucrin expression in epidermis in vivo; and examine that Musk T stimulates HAS expression and HA synthesis in human skin fibroblast. Through these experiments, we conclude that Musk T is PPAR-alpha ligand, effects on keratinocyte differentiation, intercellular lipid synthesis in epidermis, HA synthesis stimulation in dermis.

  13. Microbiologically produced carboxylic acids used as building blocks in organic synthesis.

    PubMed

    Aurich, Andreas; Specht, Robert; Müller, Roland A; Stottmeister, Ulrich; Yovkova, Venelina; Otto, Christina; Holz, Martina; Barth, Gerold; Heretsch, Philipp; Thomas, Franziska A; Sicker, Dieter; Giannis, Athanassios

    2012-01-01

    Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building blocks. Thereby, our biotechnological goal was the development of process fundamentals regarding the variable use of renewable raw materials, the development of a multi purpose bioreactor and application of a pilot plant with standard equipment for organic acid production to minimize the technological effort. Furthermore the development of new product isolation procedures, with the aim of direct product recovery, capture of products or single step operation, was necessary. The application of robust and approved microorganisms, also genetically modified, capable of using a wide range of substrates as well as producing a large spectrum of products, was of special importance. Microbiologically produced acids, like 2-oxo-glutaric acid and 2-oxo-D-gluconic acid, are useful educts for the chemical synthesis of hydrophilic triazines, spiro-connected heterocycles, benzotriazines, and pyranoic amino acids. The chiral intermediate of the tricarboxylic acid cycle, (2R,3S)-isocitric acid, is another promising compound. For the first time our process provides large quantities of enantiopure trimethyl (2R,3S)-isocitrate which was used in subsequent chemical transformations to provide new chiral entities for further usage in total synthesis and pharmaceutical research.Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building

  14. Synthesis and biological evaluation of novel lipoamino acid derivatives.

    PubMed

    Kaki, Shiva Shanker; Arukali, Sammaiah; Korlipara, Padmaja V; Prasad, R B N; Yedla, Poornachandra; Ganesh Kumar, C

    2016-01-01

    Seven novel lipoamino acid conjugates were synthesized from methyl oleate and amino acids. Methyl oleate was grafted to different amino acids using thioglycolic acid as a spacer group. Seven derivatives (3a-g) were prepared and characterized by spectral data (NMR, IR and MS spectral studies). All the derivatives were studied for their antimicrobial, anti-biofilm and anticancer activities. Among all the derivatives, it was found that compound 3b was the most potent antibacterial compound which showed good activity against four Gram positive bacterial strains and also exhibited excellent antifungal activity against a fungal strain. In the anti-biofilm assay, compound 3b showed promising activity with IC50 value of 2.8μM against Bacillus subtilis MTCC 121. All the compounds showed anticancer activities with 3c showing promising anticancer activity (IC50=15.3-22.4μM) against the four cell lines tested. PMID:26586599

  15. New multifunctional phosphonic acid for metal phosphonate synthesis

    NASA Astrophysics Data System (ADS)

    Garczarek, Piotr; Janczak, Jan; Zoń, Jerzy

    2013-03-01

    A new heterotopic phosphonic acid, 3-amino-5-(dihydroxyphosphoryl)benzoic acid (1) has been synthesized and obtained in the crystalline form. Second multifunctional phosphonic acid - namely 3-(dihydroxyphosphoryl)-5-nitrobenzoic acid (2) has also been obtained, following a different synthetic route than previously reported. Compound 1 crystallizes in a centrosymmetric space group of the triclinic system as monohydrate, sbnd C6H3(NH2)(COOH)PO3H2·H2O -1a. The molecule in the crystal exists in a zwitterionic form, in which one of the proton of the phosphonic group is transferred to the amine group. The zwitterionic molecules interact to each other and with water molecules via Nsbnd H…O and Osbnd H…O hydrogen bonds forming a three-dimensional network.

  16. Synthesis and evaluation of dioleoyl glyceric acids showing antitrypsin activity.

    PubMed

    Habe, Hiroshi; Fukuoka, Tokuma; Sato, Shun; Kitamoto, Dai; Sakaki, Keiji

    2011-01-01

    Previously, Lešová et al. reported the isolation and identification of metabolite OR-1, showing antitrypsin activity, produced during fermentation by Penicillium funiculosum. The structure of OR-1 was a mixture of glyceric acid (GA), esterified with C(14)-C(18) fatty acids, and oleic acid (C18:1) as the most predominant fatty acid (Folia Microbiol. 46, 21-23, 2001). In this study, dioleoyl D-GA and dioleoyl L-GA were synthesized via diesterification with oleoyl chloride, and their antitrypsin activities were evaluated using both a disk diffusion method and spectral absorption measurements. The results show that both compounds and their equivalent mixtures possess antitrypsin activities; however, their IC(50) values (approximately 2 mM) are much higher than that of OR-1 (4.25 µM), suggesting that dioleoyl GA does not play a major role in the OR-1 antitrypsin activity. PMID:21606621

  17. Selection on synthesis cost affects interprotein amino acid usage in all three domains of life.

    PubMed

    Swire, Jonathan

    2007-05-01

    Most investigations of the forces shaping protein evolution have focused on protein function. However, cells are typically 50%-75% protein by dry weight, with protein expression levels distributed over five orders of magnitude. Cells may, therefore, be under considerable selection pressure to incorporate amino acids that are cheap to synthesize into proteins that are highly expressed. Such selection pressure has been demonstrated to alter amino acid usage in a few organisms, but whether "cost selection" is a general phenomenon remains unknown. One reason for this is that reliable protein expression level data is not available for most organisms. Accordingly, I have developed a new method for detecting cost selection. This method depends solely on interprotein gradients in amino acid usage. Applying it to an analysis of 43 whole genomes from all three domains of life, I show that selection on the synthesis cost of amino acids is a pervasive force in shaping the composition of proteins. Moreover, some amino acids have different price tags for different organisms--the cost of amino acids is changed for organisms living in hydrothermal vents compared with those living at the sea surface or for organisms that have difficulty acquiring elements such as nitrogen compared with those that do not--so I also investigated whether differences between organisms in amino acid usage might reflect differences in synthesis or acquisition costs. The results suggest that organisms evolve to alter amino acid usage in response to environmental conditions.

  18. bchFNBH bacteriochlorophyll synthesis genes of Rhodobacter capsulatus and identification of the third subunit of light-independent protochlorophyllide reductase in bacteria and plants.

    PubMed Central

    Burke, D H; Alberti, M; Hearst, J E

    1993-01-01

    We present the nucleotide and deduced amino acid sequences of four contiguous bacteriochlorophyll synthesis genes from Rhodobacter capsulatus. Three of these genes code for enzymes which catalyze reactions common to the chlorophyll synthesis pathway and therefore are likely to be found in plants and cyanobacteria as well. The pigments accumulated in strains with physically mapped transposon insertion mutations are analyzed by absorbance and fluorescence spectroscopy, allowing us to assign the genes as bchF, bchN, bchB, and bchH, in that order. bchF encodes a bacteriochlorophyll alpha-specific enzyme that adds water across the 2-vinyl group. The other three genes are required for portions of the pathway that are shared with chlorophyll synthesis, and they were expected to be common to both pathways. bchN and bchB are required for protochlorophyllide reduction in the dark (along with bchL), a reaction that has been observed in all major groups of photosynthetic organisms except angiosperms, where only the light-dependent reaction has been clearly established. The purple bacterial and plant enzymes show 35% identity between the amino acids coded by bchN and chlN (gidA) and 49% identity between the amino acids coded by bchL and chlL (frxC). Furthermore, bchB is 33% identical to ORF513 from the Marchantia polymorpha chloroplast. We present arguments in favor of the probable role of ORF513 (chlB) in protochlorophyllide reduction in the dark. The further similarities of all three subunits of protochlorophyllide reductase and the three subunits of chlorin reductase in bacteriochlorophyll synthesis suggest that the two reductase systems are derived from a common ancestor. PMID:8385667

  19. Synthesis of an indole analog of folic acid

    SciTech Connect

    Shengeliya, M.S.; Avramenko, V.G.; Kuleshova, L.N.; Ershova, Yu.A.; Chernov, V.A.; Surorov, N.N.

    1987-06-01

    The authors study the replacement of the p-aminobenzoic acid (PABA) moiety. The authors synthesized an indole analog of folic acid, namely dimethyl N-(5-(2'-amino-4'-oxo-6'-pteridinyl)methylaminoindol-2-yl)glutamate. The physicochemical properties and the chemical shifts in the PMR spectra of the compounds obtained are shown. The examination of the compound for antitumor activity was carried out using rats and mice.

  20. Synthesis and antifungal activity of cinnamic acid esters.

    PubMed

    Tawata, S; Taira, S; Kobamoto, N; Zhu, J; Ishihara, M; Toyama, S

    1996-05-01

    Cinnamic, p-coumaric and ferulic acids were isolated from pineapple stems (Ananas comosus var. Cayenne). Twenty-four kinds of esters were prepared from these acids, alcohols and the components of Alpinia. Isopropyl 4-hydroxycinnamate (11) and butyl 4-hydroxycinnamate (12) were found to have almost the same effectiveness in antifungal activity against Pythium sp. at 10 ppm as that of the commercial fungicide iprobenfos (kitazin P).

  1. Synthesis of locked cyclohexene and cyclohexane nucleic acids (LCeNA and LCNA) with modified adenosine units.

    PubMed

    Šála, Michal; Dejmek, Milan; Procházková, Eliška; Hřebabecký, Hubert; Rybáček, Jiří; Dračínský, Martin; Novák, Pavel; Rosenbergová, Šárka; Fukal, Jiří; Sychrovský, Vladimír; Rosenberg, Ivan; Nencka, Radim

    2015-03-01

    We describe here the preparation of conformationally locked cyclohexane nucleic acids designed as hybrids between locked nucleic acids (LNAs) and cyclohexene nucleic acids (CeNAs), both of which excel in hybridization with complementary RNAs. We have accomplished the synthesis of these adenine derivatives starting from a simple ketoester and installed all four chiral centres by means of total synthesis. The acquired monomers were incorporated into nonamer oligonucleotides.

  2. Oxalic acid production by citric acid-producing Aspergillus niger overexpressing the oxaloacetate hydrolase gene oahA.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2014-05-01

    The filamentous fungus Aspergillus niger is used worldwide in the industrial production of citric acid. However, under specific cultivation conditions, citric acid-producing strains of A. niger accumulate oxalic acid as a by-product. Oxalic acid is used as a chelator, detergent, or tanning agent. Here, we sought to develop oxalic acid hyperproducers using A. niger as a host. To generate oxalic acid hyperproducers by metabolic engineering, transformants overexpressing the oahA gene, encoding oxaloacetate hydrolase (OAH; EC 3.7.1.1), were constructed in citric acid-producing A. niger WU-2223L as a host. The oxalic acid production capacity of this strain was examined by cultivation of EOAH-1 under conditions appropriate for oxalic acid production with 30 g/l glucose as a carbon source. Under all the cultivation conditions tested, the amount of oxalic acid produced by EOAH-1, a representative oahA-overexpressing transformant, exceeded that produced by A. niger WU-2223L. A. niger WU-2223L and EOAH-1 produced 15.6 and 28.9 g/l oxalic acid, respectively, during the 12-day cultivation period. The yield of oxalic acid for EOAH-1 was 64.2 % of the maximum theoretical yield. Our method for oxalic acid production gave the highest yield of any study reported to date. Therefore, we succeeded in generating oxalic acid hyperproducers by overexpressing a single gene, i.e., oahA, in citric acid-producing A. niger as a host.

  3. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  4. Synthesis of α,β-unsaturated esters via a chemo-enzymatic chain elongation approach by combining carboxylic acid reduction and Wittig reaction

    PubMed Central

    Duan, Yitao; Yao, Peiyuan; Du, Yuncheng; Feng, Jinhui

    2015-01-01

    Summary α,β-Unsaturated esters are versatile building blocks for organic synthesis and of significant importance for industrial applications. A great variety of synthetic methods have been developed, and quite a number of them use aldehydes as precursors. Herein we report a chemo-enzymatic chain elongation approach to access α,β-unsaturated esters by combining an enzymatic carboxylic acid reduction and Wittig reaction. Recently, we have found that Mycobacterium sp. was able to reduce phenylacetic acid (1a) to 2-phenyl-1-ethanol (1c) and two sequences in the Mycobacterium sp. genome had high identity with the carboxylic acid reductase (CAR) gene from Nocardia iowensis. These two putative CAR genes were cloned, overexpressed in E. coli and one of two proteins could reduce 1a. The recombinant CAR was purified and characterized. The enzyme exhibited high activity toward a variety of aromatic and aliphatic carboxylic acids, including ibuprofen. The Mycobacterium CAR catalyzed carboxylic acid reduction to give aldehydes, followed by a Wittig reaction to afford the products α,β-unsaturated esters with extension of two carbon atoms, demonstrating a new chemo-enzymatic method for the synthesis of these important compounds. PMID:26664647

  5. Metabolic analyses elucidate non-trivial gene targets for amplifying dihydroartemisinic acid production in yeast

    PubMed Central

    Misra, Ashish; Conway, Matthew F.; Johnnie, Joseph; Qureshi, Tabish M.; Lige, Bao; Derrick, Anne M.; Agbo, Eddy C.; Sriram, Ganesh

    2013-01-01

    Synthetic biology enables metabolic engineering of industrial microbes to synthesize value-added molecules. In this, a major challenge is the efficient redirection of carbon to the desired metabolic pathways. Pinpointing strategies toward this goal requires an in-depth investigation of the metabolic landscape of the organism, particularly primary metabolism, to identify precursor and cofactor availability for the target compound. The potent antimalarial therapeutic artemisinin and its precursors are promising candidate molecules for production in microbial hosts. Recent advances have demonstrated the production of artemisinin precursors in engineered yeast strains as an alternative to extraction from plants. We report the application of in silico and in vivo metabolic pathway analyses to identify metabolic engineering targets to improve the yield of the direct artemisinin precursor dihydroartemisinic acid (DHA) in yeast. First, in silico extreme pathway (ExPa) analysis identified NADPH-malic enzyme and the oxidative pentose phosphate pathway (PPP) as mechanisms to meet NADPH demand for DHA synthesis. Next, we compared key DHA-synthesizing ExPas to the metabolic flux distributions obtained from in vivo 13C metabolic flux analysis of a DHA-synthesizing strain. This comparison revealed that knocking out ethanol synthesis and overexpressing glucose-6-phosphate dehydrogenase in the oxidative PPP (gene YNL241C) or the NADPH-malic enzyme ME2 (YKL029C) are vital steps toward overproducing DHA. Finally, we employed in silico flux balance analysis and minimization of metabolic adjustment on a yeast genome-scale model to identify gene knockouts for improving DHA yields. The best strategy involved knockout of an oxaloacetate transporter (YKL120W) and an aspartate aminotransferase (YKL106W), and was predicted to improve DHA yields by 70-fold. Collectively, our work elucidates multiple non-trivial metabolic engineering strategies for improving DHA yield in yeast. PMID:23898325

  6. Metabolic analyses elucidate non-trivial gene targets for amplifying dihydroartemisinic acid production in yeast.

    PubMed

    Misra, Ashish; Conway, Matthew F; Johnnie, Joseph; Qureshi, Tabish M; Lige, Bao; Derrick, Anne M; Agbo, Eddy C; Sriram, Ganesh

    2013-01-01

    Synthetic biology enables metabolic engineering of industrial microbes to synthesize value-added molecules. In this, a major challenge is the efficient redirection of carbon to the desired metabolic pathways. Pinpointing strategies toward this goal requires an in-depth investigation of the metabolic landscape of the organism, particularly primary metabolism, to identify precursor and cofactor availability for the target compound. The potent antimalarial therapeutic artemisinin and its precursors are promising candidate molecules for production in microbial hosts. Recent advances have demonstrated the production of artemisinin precursors in engineered yeast strains as an alternative to extraction from plants. We report the application of in silico and in vivo metabolic pathway analyses to identify metabolic engineering targets to improve the yield of the direct artemisinin precursor dihydroartemisinic acid (DHA) in yeast. First, in silico extreme pathway (ExPa) analysis identified NADPH-malic enzyme and the oxidative pentose phosphate pathway (PPP) as mechanisms to meet NADPH demand for DHA synthesis. Next, we compared key DHA-synthesizing ExPas to the metabolic flux distributions obtained from in vivo (13)C metabolic flux analysis of a DHA-synthesizing strain. This comparison revealed that knocking out ethanol synthesis and overexpressing glucose-6-phosphate dehydrogenase in the oxidative PPP (gene YNL241C) or the NADPH-malic enzyme ME2 (YKL029C) are vital steps toward overproducing DHA. Finally, we employed in silico flux balance analysis and minimization of metabolic adjustment on a yeast genome-scale model to identify gene knockouts for improving DHA yields. The best strategy involved knockout of an oxaloacetate transporter (YKL120W) and an aspartate aminotransferase (YKL106W), and was predicted to improve DHA yields by 70-fold. Collectively, our work elucidates multiple non-trivial metabolic engineering strategies for improving DHA yield in yeast.

  7. Enhanced production of shikimic acid using a multi-gene co-expression system in Escherichia coli.

    PubMed

    Liu, Xiang-Lei; Lin, Jun; Hu, Hai-Feng; Zhou, Bin; Zhu, Bao-Quan

    2016-04-01

    Shikimic acid (SA) is the key synthetic material for the chemical synthesis of Oseltamivir, which is prescribed as the front-line treatment for serious cases of influenza. Multi-gene expression vector can be used for expressing the plurality of the genes in one plasmid, so it is widely applied to increase the yield of metabolites. In the present study, on the basis of a shikimate kinase genetic defect strain Escherichia coli BL21 (ΔaroL/aroK, DE3), the key enzyme genes aroG, aroB, tktA and aroE of SA pathway were co-expressed and compared systematically by constructing a series of multi-gene expression vectors. The results showed that different gene co-expression combinations (two, three or four genes) or gene orders had different effects on the production of SA. SA production of the recombinant BL21-GBAE reached to 886.38 mg·L(-1), which was 17-fold (P < 0.05) of the parent strain BL21 (ΔaroL/aroK, DE3). PMID:27114316

  8. Nitrogen metabolism and gas exchange parameters associated with zinc stress in tobacco expressing an ipt gene for cytokinin synthesis.

    PubMed

    Pavlíková, Daniela; Pavlík, Milan; Procházková, Dagmar; Zemanová, Veronika; Hnilička, František; Wilhelmová, Naďa

    2014-04-15

    Increased endogenous plant cytokinin (CK) content through transformation with an isopentyl transferase (ipt) gene has been associated with improved plant stress tolerance. The impact of zinc (tested levels Zn1=250, Zn2=500, Zn3=750mgkg(-1)soil) on gas exchange parameters (net photosynthetic rate, transpiration rate, stomatal conductance, intercellular CO2 concentration) and nitrogen utilization by plants resulted in changes of free amino acid concentrations (glutamic acid, glutamine, asparagine, aspartate, glycine, serine, cystein) and differed for transformed and non-transformed tobacco plants. For pot experiments, tobacco plants (Nicotiana tabacum L., cv. Wisconsin 38) transformed with a construct consisting of SAG12 promoter fused with the ipt gene for cytokinin synthesis (SAG plants) and its wild type (WT plants as a control) were used. Physiological analyses confirmed that SAG plants had improved zinc tolerance compared with the WT plants. The enhanced Zn tolerance of SAG plants was associated with the maintenance of accumulation of amino acids and with lower declines of photosynthetic and transpiration rates. In comparison to WT plants, SAG plants exposed to the highest Zn concentration accumulated lower concentrations of asparagine, which is a major metabolic product during senescence.

  9. In vitro synthesis of arachidonoyl amino acids by cytochrome c.

    PubMed

    McCue, Jeffrey M; Driscoll, William J; Mueller, Gregory P

    2009-11-01

    Arachidonoyl amino acids are a class of endogenous lipid messengers that are expressed in the mammalian central nervous system and peripherally. While several of their prominent pharmacologic effects have been documented, the mechanism by which arachidonoyl amino acids are biosynthesized has not been defined. We have previously observed that the mitochondrial protein, cytochrome c, is capable of catalyzing the formation of the prototypic arachidonoyl amino acid, arachidonoyl glycine, utilizing arachidonoyl CoA and glycine as substrates, in the presence of hydrogen peroxide. Here we report that cytochrome c is similarly able to catalyze the formation of N-arachidonoyl serine, N-arachidonoyl alanine, and N-arachidonoyl gamma aminobutyric acid from arachidonoyl CoA and the respective amino acids. The identities of the arachidonoyl amino acid products were verified by mass spectral fragmentation pattern analysis. The synthetic reactions exhibited Michaelis-Menten kinetics and continued favorably at physiologic temperature and pH. Spectral data indicate that both cytochrome c protein structure and a +3 heme iron oxidation state are required for the reaction mechanism to proceed optimally. Reactions designed to catalyze the formation of N-arachidonoyl dopamine were not efficient due to the rapid oxidation of dopamine substrate by hydrogen peroxide, consuming both reactants. Finally, under standard assay conditions, arachidonoyl CoA and ethanolamine were found to react spontaneously to form anandamide, independent of cytochrome c and hydrogen peroxide. Accordingly, it was not possible to demonstrate a potential role for cytochrome c in the biosynthetic mechanism for either arachidonoyl dopamine or anandamide. However, the ability of cytochrome c to effectively catalyze the formation of N-arachidonoyl serine, N-arachidonoyl alanine, and N-arachidonoyl gamma aminobutyric acid in vitro highlights its potential role for the generation of these lipid messengers in vivo.

  10. Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.

    PubMed

    Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko

    2016-09-01

    Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. PMID:27630308

  11. Nature's Starships: Amino Acid Synthesis, Frequency, and Delivery to Earth via Meteorites

    NASA Astrophysics Data System (ADS)

    Cobb, Alyssa; Pudritz, Ralph

    2013-07-01

    Understanding the origin of organic molecules on Earth is vital to our understanding of the origins of life. One proposed mechanism for the introduction of organic material to our planet is via meteorite impacts. Meteoritic parent bodies contain organic material and water ice, which, given radionuclide decay in their interiors, cause the ice to melt and the parent bodies to undergo a process called aqueous alteration. An example of this internal chemistry is Strecker synthesis, a process resulting in the production of various amino acids. Our work summarizes recent discoveries regarding amino acid synthesis and concentration data. We present the amino acid concentrations collated from a variety of meteorites (~20) covering a range of meteorite classes. We can use the dependence of amino acid frequency on variables such as temperature and pressure to model Strecker synthesis inside a theoretical parent body. Our modeling software takes a set of chemical species and outputs their relative frequencies based on a minimization of their Gibbs free energies. The goal of this work is to predict and quantify the presence of amino acids on a foreign landscape using thermodynamic principles.

  12. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids.

    PubMed

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D V S; Sharma, Rohit K

    2014-10-31

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  13. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  14. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  15. The Polymerase Step Reaction (PSR) Method for Gene and Library Synthesis.

    PubMed

    DeDecker, Brian S

    2017-01-01

    Current gene synthesis methods often incorporate a PCR-amplifying step in order to yield sufficient final product that is detectable and resolvable from multiple off-products. This amplification step can cause stochastic sampling effects that propagate errors during the synthesis and lower the variability when applied towards the construction of randomized libraries. We present the method for polymerase step reaction (PSR), a simple DNA polymerase-based gene synthesis reaction that assembles DNA oligonucleotides in a unidirectional fashion without the need for a PCR-type amplification (Lee et al., BioTechniques 59:163-166, 2015). The PSR method is simple and efficient with little off-product production, undetected stochastic sampling effects, and maximized variability when used to synthesize phage display libraries. PMID:27671937

  16. Characterization of the rcsB gene from Erwinia amylovora and its influence on exoploysaccharide synthesis and virulence of the fire blight pathogen.

    PubMed

    Bereswill, S; Geider, K

    1997-02-01

    RcsB belongs to a family of positive regulators of exopolysaccharide synthesis in various enterobacteria. The rcsB gene of the fire blight pathogen Erwinia amylovora was cloned by PCR amplification with consensus primers, and its role in exopolysaccharide (EPS) synthesis was investigated. Its overexpression from high-copy-number plasmids stimulated the synthesis of the acidic EPS amylovoran and suppressed expression of the levan-forming enzyme levansucrase. Inactivation of rcsB by site-directed mutagenesis created mutants that were deficient in amylovoran synthesis and avirulent on host plants. In addition, a cosmid which complemented rcsB mutants was selected from a genomic library. The spontaneous E. amylovora mutant E8 has a similar phenotype and was complemented by the cloned rcsB gene. The rcsB region of strain E8 was also amplified by PCR, and the mutation was characterized as a nine-nucleotide deletion at the start of the rcsB gene. Nucleotide sequence analysis of the E. amylovora rcsB region and the predicted amino acid sequence of RcsB revealed extensive homology to rcsB and the encoded protein of other bacteria such as Escherichia coli and Erwinia stewartii. In all three organisms, rcsB is localized adjacent to the rcsC gene, which is transcribed in the opposite direction of rcsB. The E. amylovora rcsB gene has now been shown to strongly affect the formation of disease symptoms of a plant pathogen.

  17. QUANTITATIVE CONTRIBUTIONS OF DIET AND LIVER SYNTHESIS TO DOCOSAHEXAENOIC ACID HOMEOSTASIS

    PubMed Central

    Rapoport, Stanley I.; Igarashi, Miki; Gao, Fei

    2010-01-01

    Dietary requirements for maintaining brain and heart docosahexaenoic acid (DHA, 22:6n-3) homeostasis are not agreed on, in part because rates of liver DHA synthesis from circulating α-linolenic acid (α-LNA, 18:2n-3) have not been quantified. These rates can be estimated in vivo using intravenous radiotracer- or heavy isotope-labeled α-LNA infusion. In adult unanesthetized male rats, such infusion shows that liver synthesis-secretion rates of DHA from α-LNA markedly exceed brain and heart DHA synthesis rates and brain DHA consumption rate, and that liver but not heart or brain synthesis is upregulated as dietary n-3 PUFA content is reduced. These differences in rate reflect much higher expression of DHA-synthesizing enzymes in liver, and upregulation of liver but not heart or brain enzyme expression by reduced dietary n-3 PUFA content. A noninvasive intravenous [U-13C]α-LNA infusion method that produces steady-state liver tracer metabolism gives exact liver DHA synthesis-secretion rates and could be extended for human studies. PMID:20226642

  18. [Influence of mutant genes on crystallin synthesis in the forming mouse lens. II. Fidget and ocular retardation genes].

    PubMed

    Iakovlev, M I; Platonov, E S; Koniukhov, B V

    1977-01-01

    The beginning of synthesis and the localization of alpha- and gamma-crystallins in the developing lenses of the 10-13 and 15 days old mouse embryos of the genotypes fi/fi +/+, +/+ or/or, fi/fi or/or and +/+ +/+ were studied by means of indirect immunofluorescence. The synthesis of crystallins in the mutant embryos with the exception of the embryo +/+ or/or was shown to begin somewhat later than in the normal ones but to proceed in all defective lenses, irrespective of the degree of defect. Hence, the activation of the genes controlling the synthesis of alpha-crystallins begins at the early stages of lens development and the synthesis of these proteins proceeds even during the abnormal with the slowing down of the formation of primary lens fibers. In the cases of strong defects of morphogenesis in the fi/fi +/+ and, especially, fi/fi or/or, embryos gamma-crystallins were not detected. The synthesis of gamma-crystallins appears to begin at the final stages of lens fiber differentiation.

  19. Synthesis of l-(+)-Tartaric Acid from l-Ascorbic Acid via 5-Keto-d-Gluconic Acid in Grapes

    PubMed Central

    Saito, Kazumi; Kasai, Zenzaburo

    1984-01-01

    5-Keto-l-idionic acid (≡5-keto-d-gluconic acid, d-xylo-5-hexulosonic acid) was found as a metabolic product of l-ascorbic acid in slices of immature grapes, Vitis labrusca L. cv `Delaware'. Specifically labeled compounds, recognized as metabolic products of l-ascorbic acid in grapes, were fed to young grape tissues to investigate the metabolic pathway from l-ascorbic acid to l-(+)-tartaric acid. Label from dehydro-l-[1-14C]ascorbic acid, 2-keto-l-[1-14C]idonic acid (l-xylo-2-hexulosonic acid), l-[1-14C]idonic acid, or 5-keto-l-[1-14C] idonic acid was incorporated into l-(+)-tartaric acid in high yields as it was in the l-[1-14C]ascorbic acid experiment. In a double label experiment involving a mixture of l-[1-14C]idonic acid and l-[2-3H]idonic acid, the 3H/14C ratios of 5-keto-l-idonic acid and l-(+)-tartaric acid synthesized in young grape leaves were almost the same as the value of the l-idonic acid fed. Label from 5-keto-l-[6-14C]idonic acid was incorporated into sugars and insoluble residue in the same way as l-[6-14C]ascorbic acid was metabolized in grapes. These results provide strong evidence that in grapes l-(+)-tartaric acid is synthesized from the C4 fragment that corresponds to the C1 to C4 group of the 5-keto-l-idonic acid derived from l-ascorbic acid via 2-keto-l-idonic acid and l-idonic acid. PMID:16663792

  20. Studies on chemical modification and biology of a natural product, gambogic acid (II): Synthesis and bioevaluation of gambogellic acid and its derivatives from gambogic acid as antitumor agents.

    PubMed

    Wang, Jinxin; Ma, Junhai; You, Qidong; Zhao, Li; Wang, Fan; Li, Chong; Guo, Qinglong

    2010-09-01

    Gambogic acid (GA) has been reported to be a potent apoptosis inducer. The fact that it is amenable to chemical modification makes GA an attractive molecule for the development of anticancer agents. We firstly reported the synthesis of gambogellic acid, which was generated under acid catalysis from readily available GA by a base-catalyzed diene intramolecular annelation. Sequentially, thirteen new compounds were synthesized and their inhibitory activity on HT-29, Bel-7402, BGC-823, and A549 cell lines were evaluated in vitro by MTT assay, and (38, 40)-epoxy-33-chlorogambogellic acid (4) was identified as a BGC-823 cell apoptosis inducer through MTT cell assay, observations of morphological changes, and Annexin-V/PI double-staining assay. Compound 4 showed significant effects in inducing apoptosis and might serve as a potential lead compound for discovery of new anticancer drugs. Further structure-activity relationships (SARs) of gambogic acid derivatives were discussed.

  1. Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in s...

  2. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  3. Synthesis and properties of synthetic fulvic acid derived from hematoxylin

    NASA Astrophysics Data System (ADS)

    Litvin, Valentina A.; Minaev, Boris F.; Baryshnikov, Gleb V.

    2015-04-01

    A model fulvic acid (FA) was synthesized from a natural dye, hematoxylin, in a slow oxidative polymerization/condensation reaction catalysed by OH- at pH ca. 12. The resulting dark-brown product, acidified to pH ca. 2, did not precipitate from the reaction solution. It was isolated and purified by cation-exchange resin. Its physicochemical and spectroscopic properties, as determined by means of elemental analysis, molecular weight analyses, Fourier transform infra red (FTIR) and ultraviolet-visible (UV-VIS) spectroscopy, X-ray diffraction and electron paramagnetic resonance (EPR) spectroscopy, showed a close resemblance to natural FA. The similarity and differences between synthetic fulvic acids derived from hematoxylin and the natural fulvic acids substances are discussed. Quantum-chemical calculations of the supposed primary oxidation products of hematoxylin are performed and compared with observations.

  4. Amino acids in a Fischer Tropsch type synthesis

    NASA Technical Reports Server (NTRS)

    Brown, D. L.; Lawless, J. G.

    1974-01-01

    One postulation is described for the presence of organic compounds in meteorites which states that they were formed during the condensation of the solar nebula. A viable laboratory simulation of these conditions can be modeled after the industrial Fischer Tropsch reaction, which is known to produce organic compounds called hydrocarbons. In this simulation, a mixture of carbon monoxide, hydrogen and ammonia is heated in the presence of iron meteorite. The reaction products for amino acids, a class of organic compounds important to life, were examined. A large number of these compounds is found in meteorites and other chemical evolution experiments, but only small quantities of a few amino acids were found in the present simulation work. These results are at odds with the existing literature in which many amino acids were reported.

  5. [Effect of citric acid on synthesis of surfactants in Rhodococcus erythropolis IMV Ac-5017].

    PubMed

    Pyroh, T P; Shevchuk, T A; Shuliakova, M O; Tarasenko, D O

    2011-01-01

    Expediency of sodium citrate (regulator of lipids synthesis) substitution is shown in the medium of cultivation of Rhodococcus erythropolis IMV Ac-5017 with ethanol (or hexadecane) and fumarate (gluconeogenesis precursor) by citric acid for pH maintenance at the level optimal for synthesis of surfactants. It has been established the maximum synthesis of surfactants of R. erythropolis IMV Ac-5017 was observed at pH 8.0. Introduction of 0.2% sodium fumarate at the end of experimental growth phase of the strain IMV Ac-5017 in the medium with 2% of ethanol with further periodic acidification of culture liquid by citric acid up to pH 8.0 was accompanied by the increase of conditional concentration of surfactants by 30, 40 and 95% as compared with an analogous process without pH regulation, by the use of sodium citrate as the regulator of lipids synthesis on the medium with ethanol as well as without organic acids, respectively.

  6. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  7. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  8. Synthesis, structure, and biological applications of α-fluorinated β-amino acids and derivatives.

    PubMed

    March, Taryn L; Johnston, Martin R; Duggan, Peter J; Gardiner, James

    2012-11-01

    This review gives a broad overview of the state of play with respect to the synthesis, conformational properties, and biological activity of α-fluorinated β-amino acids and derivatives. General methods are described for the preparation of monosubstituted α-fluoro-β-amino acids (Scheme 1). Nucleophilic methods for the introduction of fluorine predominantly involve the reaction of DAST with alcohols derived from α-amino acids, whereas electrophilic sources of fluorine such as NFSI have been used in conjunction with Arndt-Eistert homologation, conjugate addition or organocatalyzed Mannich reactions. α,α-Difluoro-β-amino acids have also been prepared using DAST; however, this area of synthesis is largely dominated by the use of difluorinated Reformatsky reagents to introduce the difluoro ester functionality (Scheme 9). α-Fluoro-β-amino acids and derivatives analyzed by X-ray crystal and NMR solution techniques are found to adopt preferred conformations which are thought to result from stereoelectronic effects associated with F located close to amines, amides, and esters (Figs. 2-6). α-Fluoro amide and β-fluoro ethylamide/amine effects can influence the secondary structure of α-fluoro-β-amino acid-containing derivatives including peptides and peptidomimetics (Figs. 7-9). α-Fluoro-β-amino acids are also components of a diverse range of bioactive anticancer (e.g., 5-fluorouracil), antifungal, and antiinsomnia agents as well as protease inhibitors where such fluorinated analogs have shown increased potency and spectrum of activity.

  9. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  10. Enhanced synthesis of alkyl amino acids in Miller's 1958 H2S experiment.

    PubMed

    Parker, Eric T; Cleaves, H James; Callahan, Michael P; Dworkin, Jason P; Glavin, Daniel P; Lazcano, Antonio; Bada, Jeffrey L

    2011-12-01

    Stanley Miller's 1958 H(2)S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH(4)), ammonia (NH(3)), carbon dioxide (CO(2)), and hydrogen sulfide (H(2)S) produced several alkyl amino acids, including the α-, β-, and γ-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H(2)S, aspartic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H(2)S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H(2)S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth. PMID:22139514

  11. Synthesis, antimicrobial evaluation and QSAR studies of stearic acid derivatives.

    PubMed

    Tahlan, S; Kumar, P; Narasimhan, B

    2014-02-01

    A series of Schiff bases (1-17) and esters (18-28) of stearic acid was synthesized and characterized by physicochemical as well as spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity by tube dilution method. The antimicrobial screening results indicated that the compounds having electron releasing groups on benzylidene nucleus were found to be more active against bacterial strains and compounds having electron withdrawing groups on benzylidene nucleus were found to be more active against fungal strains. QSAR studies demonstrated that electronic parameters dipole moment (µ) and total energy (Te) were the most important descriptors in describing the antimicrobial activity of synthesized stearic acid derivatives.

  12. Hybrubins: Bipyrrole Tetramic Acids Obtained by Crosstalk between a Truncated Undecylprodigiosin Pathway and Heterologous Tetramic Acid Biosynthetic Genes.

    PubMed

    Zhao, Zhilong; Shi, Ting; Xu, Min; Brock, Nelson L; Zhao, Yi-Lei; Wang, Yemin; Deng, Zixin; Pang, Xiuhua; Tao, Meifeng

    2016-02-01

    Heterologous expression of bacterial artificial chromosome (BAC) clones from the genomic library of Streptomyces variabilis Snt24 in Streptomyces lividans SBT5 which carried a truncated undecylprodigiosin biosynthetic gene cluster led to the identification of hybrubins A-C. The hybrubins represent a new carbon skeleton in which a tetramic acid moiety is fused to a 2,2'-dipyrrole building block. Gene knockout experiments confirmed that hybrubins are derived from two convergent biosynthetic pathways including the remaining genomic red genes of S. lividans SBT5 as well as the BAC encoded hbn genes for the production of 5-ethylidenetetramic acid. A possible biosynthetic pathway was also proposed.

  13. Okadaic acid disrupts Golgi structure and impairs enzyme synthesis and secretion in the rat pancreas.

    PubMed

    Waschulewski, I H; Kruse, M L; Agricola, B; Kern, H F; Schmidt, W E

    1996-06-01

    Okadaic acid, a serine/threonine phosphatase inhibitor, has been shown to inhibit rat pancreatic enzyme secretion by interference with late processes in stimulus-secretion coupling. To further characterize its action, we studied the effect of okadaic acid on secretion of newly synthesized proteins, protein synthesis, and cellular ultrastructure in pancreatic lobules derived from rats stimulated in vivo by feeding the synthetic proteinase inhibitor FOY-305. Okadaic acid completely blocked protein secretion at concentrations that inhibit the Ca2+/calmodulin-dependent protein phosphatase 2b, calcineurin. Protein synthesis was abolished at 10(-6) mol/l and reduced by 60% at 5 x 10(-7) mol/l okadaic acid. Pancreatic lobules exposed to 5 x 10(-7) mol/l okadaic acid for 20 min fully restored their secretory capacity on removal of the drug; whereas, after a preincubation with okadaic acid for > 40 min, protein secretion remained impaired during the recovery period. Electron microscopic examination of pancreatic acinar cells treated with 5 x 10(-7) mol/l okadaic acid revealed a dilated Golgi complex after 15 and 30 min and a subsequent fragmentation of Golgi cisternae into clouds of small uniform vesicles after 60 min. Reassembly of Golgi stacks occurred after a 60-min recovery without okadaic acid. These data indicate that serine/threonine phosphatases play an important role not only in the regulation of pancreatic enzyme synthesis and exocytosis but also are crucial for the maintenance of normal Golgi architecture and function in the exocrine rat pancreas. These effects are probably not exclusively mediated via type 2b calcineurin-like protein phosphatases.

  14. Alkaline stress and iron deficiency regulate iron uptake and riboflavin synthesis gene expression differently in root and leaf tissue: implications for iron deficiency chlorosis

    PubMed Central

    Hsieh, En-Jung; Waters, Brian M.

    2016-01-01

    Iron (Fe) is an essential mineral that has low solubility in alkaline soils, where its deficiency results in chlorosis. Whether low Fe supply and alkaline pH stress are equivalent is unclear, as they have not been treated as separate variables in molecular physiological studies. Additionally, molecular responses to these stresses have not been studied in leaf and root tissues simultaneously. We tested how plants with the Strategy I Fe uptake system respond to Fe deficiency at mildly acidic and alkaline pH by measuring root ferric chelate reductase (FCR) activity and expression of selected Fe uptake genes and riboflavin synthesis genes. Alkaline pH increased cucumber (Cucumis sativus L.) root FCR activity at full Fe supply, but alkaline stress abolished FCR response to low Fe supply. Alkaline pH or low Fe supply resulted in increased expression of Fe uptake genes, but riboflavin synthesis genes responded to Fe deficiency but not alkalinity. Iron deficiency increased expression of some common genes in roots and leaves, but alkaline stress blocked up-regulation of these genes in Fe-deficient leaves. In roots of the melon (Cucumis melo L.) fefe mutant, in which Fe uptake responses are blocked upstream of Fe uptake genes, alkaline stress or Fe deficiency up-regulation of certain Fe uptake and riboflavin synthesis genes was inhibited, indicating a central role for the FeFe protein. These results suggest a model implicating shoot-to-root signaling of Fe status to induce Fe uptake gene expression in roots. PMID:27605716

  15. Amino Acids Involved in Polyphosphate Synthesis and Its Mobilization Are Distinct in Polyphosphate Kinase-1 from Mycobacterium tuberculosis

    PubMed Central

    Mittal, Payal; Karthikeyan, Subramanian; Chakraborti, Pradip K.

    2011-01-01

    Background In bacteria polyphosphates (poly-P) are involved in cellular metabolism and development especially during stress. The enzyme, principally involved in polyphosphate biosynthesis and its mobilization leading to generation of NTPs, is known as polyphosphate kinase (PPK). Principal Findings Among two genes of polyphosphate kinases present in Mycobacterium tuberculosis, we cloned and expressed PPK1 in Escherichia coli as histidine-tagged protein. This ∼86 kDa protein is capable of autophosphorylation and synthesis of poly-P as well as NTP. Among 22 conserved histidine residues, we found only His-491 is autophosphorylated and crucial for any enzymatic activity. Substitution of His-510 caused mPPK1 protein deficient but not defective in autophosphorylation, thereby contrary to earlier reports negating any role of this residue in the process. However, mutation of His-510 with either Ala or Gln affected ATP or poly-P synthesis depending on the substitution; while such effects were severe with H510A but mild with H510Q. Furthermore, mPPK1 also renders auxiliary nucleotide diphosphate kinase function by synthesizing virtually all NTPs/dNTPs from their cognate NDPs/dNDPs by utilizing poly-P as the phosphate donor albeit with varied efficiency. To assess the influence of other catalytic domain residues of mPPK1 towards its functionality, we designed mutations based on E. coli PPK1 crystal structure since it owes 68% amino acid sequence similarity with mPPK1. Interestingly, our results revealed that mutations in mPPK1 affecting poly-P synthesis always affected its ATP synthesizing ability; however, the reverse may not be true. Conclusions/Significance We conclude that amino acid residues involved in poly-P and ATP synthesizing activities of mPPK1 are distinct. Considering conserved nature of PPK1, it seems our observations have broader implications and not solely restricted to M. tuberculosis only. PMID:22110640

  16. Effect of nerve growth factor on the synthesis of amino acids in PC12 cells

    SciTech Connect

    Zielke, H.R.; Tildon, J.T.; Kauffman, F.C.; Baab, P.J. )

    1989-04-01

    Radioactive short-chain fatty acids preferentially label glutamine relative to glutamate in brain due to compartmentation of glutamine and glutamate. To determine whether this phenomenon occurs in a single cell culture model, we examined the effect of fatty acid chain length on the synthesis as well as pool size of selected amino acids in rat pheochromocytoma PC12 cells, a cell culture model of the large glutamate compartment in neurons. Intracellular 14C-amino acids were quantitated by HPLC, and the incorporation of (U-14C)-glucose, (1-14C)-butyrate, (1-14C)-octanoate, and (1-14C)-palmitate into five amino acids was measured in native and NGF-treated PC12 cells. NGF pretreatment decreased the intracellular concentration of amino acids as did addition of fatty acids but these effects were not additive. Specific activities of amino acids in native cells labelled by 14C-octanoate were 1,300 DPM/nmol, 490 DPM/nmol, 200 DPM/nmol, and 110 DPM/nmol for glutamate, aspartate, glutamine, and serine, respectively. No radioactivity was detected in alanine. Similar specific activities were noted when 14C-butyrate was the precursor; however, there was at least 5-fold less if 14C-palmitate was the precursor. Pretreatment of cells with NGF decreased the specific activity of amino acids by 25-65%. Specific activities of amino acids synthesized from 14C-glucose decreased in the following order: glutamate, 1,640 DPM/nmol; aspartate, 1,210 DPM/nmol; alanine, 580 DPM/nmol; glutamine, 275 DPM/nmol; and serine, 80 DPM/nmol for native cells. NGF pretreatment decreased the specific activities of glutamate and glutamine, but not of the other 3 amino acids. The preferred precursor for glutamate synthesis in native PC12 cells was glucose followed by octanoate, butyrate and palmitate (16:6:3:1).

  17. Synthesis and phosphorylation of the glial fibrillary acidic protein during brain development: A tissue slice study

    SciTech Connect

    Noetzel, M.J. )

    1990-01-01

    Brain slices were incubated with either (3H) amino acids or (32P) orthophosphate in order to characterize the synthesis and phosphorylation of the glial fibrillary acidic protein (GFAP) in the rat nervous system. The incorporation of (3H) amino acids into GFAP was found to increase significantly during early postnatal development, reaching a peak of activity on day 5 of life and then declining over the next 2 weeks. Concomitant with this peak of synthetic activity the content of GFAP in rat brain was also observed to increase dramatically. GFAP continued to accumulate in brain through postnatal day 30 despite a decrease in the synthesis of the protein. These results indicate that the increase in GFAP during the first month of life cannot be ascribed solely to the rate of GFAP synthesis. The findings are consistent with the hypothesis that during later stages of astrocytic development the accumulation of GFAP may be primarily dependent upon a low rate of protein degradation. The pattern of GFAP phosphorylation in the developing rat brain differed from that observed for the incorporation of (3H) amino acids. The peak incorporation of 32P into GFAP occurred on postnatal day 10 at a time when synthesis of the protein had declined by 43%. These findings suggest that during development phosphorylation of GFAP is mediated by factors different from those directing its synthesis. In addition, phosphorylation of GFAP did not alter its solubility in cytoskeletal preparations indicating that GFAP phosphorylation is probably not a major regulatory mechanism in disassembly of the astroglial filaments.

  18. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  19. Synthesis and characterization of ultraviolet light-emitting organic acids.

    PubMed

    An, Chun-Ai; Guo, Yanchao; Si, Zhenjun; Duan, Qian

    2014-05-01

    Three ultraviolet light-emitting organic acids of 3,3'-(4-phenyl-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-1), 4,4',4″-(4H-1,2,4-triazole-3,4,5-triyl)tribenzoic acid (Tz-2), and 4,4'-(4-(4'-carboxy-[1,1'-biphenyl]-4-yl)-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-3) were successfully synthesized and fully characterized by the (1)H NMR, the IR absorption spectra, and the X-ray single crystal diffraction. It was found that Tz-1, Tz-2, and Tz-3 could give out the ultraviolet photoluminescent spectra centered at 369 nm, 365 nm and 350 nm, respectively. The luminescence quantum yields of Tz-1 and Tz-2 were measured to be 0.20 and 0.14, respectively. Additionally, the density functional theory (DFT) and the time-dependent DFT calculations were also carried out for Tz-1, Tz-2, and Tz-3.

  20. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  1. Influence of virgin coconut oil-enriched diet on the transcriptional regulation of fatty acid synthesis and oxidation in rats - a comparative study.

    PubMed

    Arunima, Sakunthala; Rajamohan, Thankappan

    2014-05-28

    The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.

  2. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    PubMed

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  3. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  4. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipid