Science.gov

Sample records for acid synthesis inhibitor

  1. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  2. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  3. Synthesis and antibacterial evaluation of anziaic acid and analogues as topoisomerase I inhibitors

    PubMed Central

    Lin, Hao; Annamalai, Thirunavukkarasu; Bansod, Priyanka; Tse-Dinh, Yuk-Ching

    2013-01-01

    Naturally occurring anziaic acid was very recently reported as a topoisomerase I inhibitor with antibacterial activity. Herein total synthesis of anziaic acid and structural analogues is described and the preliminary structure-activity relationship (SAR) has been developed based on topoisomerase inhibition and whole cell antibacterial activity. PMID:24363888

  4. Synthesis of potent inhibitors of anthrax toxin based on poly-L-glutamic acid.

    PubMed

    Joshi, Amit; Saraph, Arundhati; Poon, Vincent; Mogridge, Jeremy; Kane, Ravi S

    2006-01-01

    We report the synthesis of biodegradable polyvalent inhibitors of anthrax toxin based on poly-L-glutamic acid (PLGA). These biocompatible polyvalent inhibitors are at least 4 orders of magnitude more potent than the corresponding monovalent peptides in vitro and are comparable in potency to polyacrylamide-based inhibitors of anthrax toxin assembly. We have elucidated the influence of peptide density on inhibitory potency and demonstrated that these inhibitory potencies are limited by kinetics, with even higher activities seen when the inhibitors are preincubated with the heptameric receptor-binding subunit of anthrax toxin prior to exposure to cells. These polyvalent inhibitors are also effective at neutralizing anthrax toxin in vivo and represent attractive leads for designing biocompatible anthrax therapeutics.

  5. Synthesis of potent inhibitors of anthrax toxin based on poly-L-glutamic acid.

    PubMed

    Joshi, Amit; Saraph, Arundhati; Poon, Vincent; Mogridge, Jeremy; Kane, Ravi S

    2006-01-01

    We report the synthesis of biodegradable polyvalent inhibitors of anthrax toxin based on poly-L-glutamic acid (PLGA). These biocompatible polyvalent inhibitors are at least 4 orders of magnitude more potent than the corresponding monovalent peptides in vitro and are comparable in potency to polyacrylamide-based inhibitors of anthrax toxin assembly. We have elucidated the influence of peptide density on inhibitory potency and demonstrated that these inhibitory potencies are limited by kinetics, with even higher activities seen when the inhibitors are preincubated with the heptameric receptor-binding subunit of anthrax toxin prior to exposure to cells. These polyvalent inhibitors are also effective at neutralizing anthrax toxin in vivo and represent attractive leads for designing biocompatible anthrax therapeutics. PMID:16984137

  6. Synthesis and characterization of phosphocitric acid, a potent inhibitor of hydroxylapatite crystal growth.

    PubMed

    Tew, W P; Mahle, C; Benavides, J; Howard, J E; Lehninger, A L

    1980-04-29

    Human urine and extracts of rat liver mitochondria contain apparently identical agents capable of inhibiting the precipitation or crystallization of calcium phosphate. Its general properties, as well as 1H NMR and mass spectra, have suggested that the agent is phosphocitric acid. This paper reports the synthesis of phosphocitric acid via the phosphorylation of triethyl citrate with o-phenylene phosphochloridate, hydrogenolysis of the product to yield triethyl phosphocitrate, hydrolytic removal of the blocking ethyl groups and also chromatographic purification. An enzymatic assay of phosphocitrate is described. Synthetic phosphocitrate was found to be an exceedingly potent inhibitor of the growth of hydroxylapatite seed crystals in a medium supersaturated with respect to Ca2+ and phosphate. Comparative assays showed phosphocitrate to be much more potent than the most active precipitation-crystallization inhibitors previously reported, which include pyrophosphate and ATP. 14C-Labeled phosphocitrate was bound very tightly to hydroxylapatite crystals. Such binding appeared to be essential for its inhibitory activity on crystal growth. Citrate added before but not after, phosphocitrate greatly enhanced the inhibitory potency of the latter. This enhancement effect was not given by other tricarboxylic acids. The monoethyl ester of phosphocitrate had no inhibitory effect on hydroxylapatite crystal growth.

  7. Synthesis and biological evaluation of enantiomerically pure glyceric acid derivatives as LpxC inhibitors.

    PubMed

    Tangherlini, Giovanni; Torregrossa, Tullio; Agoglitta, Oriana; Köhler, Jens; Melesina, Jelena; Sippl, Wolfgang; Holl, Ralph

    2016-03-01

    Inhibitors of the UDP-3-O-[(R)-3-hydroxymyristoyl]-N-acetylglucosamine deacetylase (LpxC) represent a promising class of novel antibiotics, selectively combating Gram-negative bacteria. In order to elucidate the impact of the hydroxymethyl groups of diol (S,S)-4 on the inhibitory activity against LpxC, glyceric acid ethers (R)-7a, (S)-7a, (R)-7b, and (S)-7b, lacking the hydroxymethyl group in benzylic position, were synthesized. The compounds were obtained in enantiomerically pure form by a chiral pool synthesis and a lipase-catalyzed enantioselective desymmetrization, respectively. The enantiomeric hydroxamic acids (R)-7b (Ki=230nM) and (S)-7b (Ki=390nM) show promising enzyme inhibition. However, their inhibitory activities do not substantially differ from each other leading to a low eudismic ratio. Generally, the synthesized glyceric acid derivatives 7 show antibacterial activities against two Escherichia coli strains exceeding the ones of their respective regioisomes 6.

  8. Treatment with the hyaluronic Acid synthesis inhibitor 4-methylumbelliferone suppresses LPS-induced lung inflammation.

    PubMed

    McKallip, Robert J; Ban, Hao; Uchakina, Olga N

    2015-01-01

    Exposure to bacterial endotoxins, such as lipopolysaccharide (LPS), can lead to the induction of acute lung injury/acute respiratory distress syndrome (ALI/ARDS). To date, there are no known effective treatments for LPS-induced inflammation. In the current study, we investigated the potential use of the hyaluronic acid (HA) synthesis inhibitor 4-methylumbelliferone (4-MU) on LPS-induced acute lung inflammation. Culturing LPS-activated immune cells with 4-MU led to reduced proliferation, reduced cytokine production, and an increase in apoptosis when compared to untreated cells. Treatment of mice with 4-MU led to protection from LPS-induced lung injury. Specifically, 4-MU treatment led to a reduction in LPS-induced hyaluronic acid synthase (HAS) messenger RNA (mRNA) levels, reduction in lung permeability, and reduction in proinflammatory cytokine production. Taken together, these results suggest that use of 4-MU to target HA production may be an effective treatment for the inflammatory response following exposure to LPS.

  9. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  10. Synthesis, modelling and kinetic assays of potent inhibitors of purple acid phosphatase.

    PubMed

    Mohd-Pahmi, Siti Hajar; Hussein, Waleed M; Schenk, Gerhard; McGeary, Ross P

    2011-05-15

    Purple acid phosphatases (PAPs) are binuclear metallohydrolases that have been isolated from various mammals, plants, fungi and bacteria. In mammals PAP activity is associated with bone resorption and can lead to bone metabolic disorders such as osteoporosis; thus human PAP is an attractive target to develop anti-osteoporotic drugs. Based on a previous lead compound and rational drug design, acyl derivatives of α-aminonaphthylmethylphosphonic acid were synthesised and tested as PAP inhibitors. Kinetic analysis showed that they are good PAP inhibitors whose potencies improve with increasing acyl chain length. Maximum potency is reached when the number of carbons in the acyl chain is between 12 and 14. The most potent inhibitor of red kidney bean PAP is the dodecyl-derivative with K(ic)=5 μM, while the most potent pig PAP inhibitor is the tetradecyl-derivative with K(ic)=8 μM, the most potent inhibitor of a mammalian PAP yet reported.

  11. Recent advances in inhibitors of bacterial fatty acid synthesis type II (FASII) system enzymes as potential antibacterial agents.

    PubMed

    Wang, Yi; Ma, Shutao

    2013-10-01

    Bacterial infections are a constant and serious threat to human health. With the increase of multidrug resistance of clinically pathogenic bacteria, common antibiotic therapies have been less effective. Fatty acid synthesis type II (FASII) system enzymes are essential for bacterial membrane lipid biosynthesis and represent increasingly promising targets for the discovery of antibacterial agents with new mechanisms of action. This review highlights recent advances in inhibitors of bacterial FASII as potential antibacterial agents, paying special attention to the activities, mechanisms, and structure-activity relationships of those inhibitors that mainly target β-ketoacyl-ACP synthase, β-ketoacyl-ACP reductase, β-hydroxyacyl-ACP dehydratase, and enoyl-ACP reductase. Although inhibitors with low nanomolar and selective activity against various bacterial FASII have entered clinical trials, further research is needed to expand upon both available and yet unknown scaffolds to identify new FASII inhibitors that may have antibacterial potential, particularly against resistant bacterial strains.

  12. Synthesis and evaluation of new omega-borono-alpha-amino acids as rat liver arginase inhibitors.

    PubMed

    Busnel, Olivier; Carreaux, François; Carboni, Bertrand; Pethe, Stephanie; Goff, Sandrine Vadon-Le; Mansuy, Daniel; Boucher, Jean-Luc

    2005-04-01

    Recent studies have demonstrated that arginase plays important roles in pathologies such as asthma or erectile dysfunctions. We have synthesized new omega-borono-alpha-amino acids that are analogues of the previously known arginase inhibitors S-(2-boronoethyl)-l-cysteine (BEC) and 2-amino-6-boronohexanoic acid (ABH) and evaluated them as inhibitors of purified rat liver arginase (RLA). In addition to the distance between the B(OH)(2) and the alpha-amino acid functions, the position of the sulfur atom in the side chain also appears as a key determinant for the interaction with the active site of RLA. Furthermore, substitution of the alkyl side chain of BEC by methyl groups and conformational restriction of ABH by incorporation of its side chain in a phenyl ring led to inactive compounds. These results suggest that subtle interactions govern the affinity of inhibitors for the active site of RLA.

  13. Synthesis of tartaric acid analogues of FR258900 and their evaluation as glycogen phosphorylase inhibitors.

    PubMed

    Varga, Gergely; Docsa, Tibor; Gergely, Pál; Juhász, László; Somsák, László

    2013-03-15

    Di-O-cinnamoylated, -p-coumaroylated, and -feruloylated d-, l- and meso-tartaric acids were synthesized as analogues of the natural product FR258900, a glycogen phosphorylase (GP) inhibitor with in vivo antihyperglycaemic activity. The new compounds inhibited rabbit muscle GP in the low micromolar range, and bound to the allosteric site of the enzyme. The best inhibitor was 2,3-di-O-feruloyl meso-tartaric acid and had Ki values of 2.0μM against AMP (competitive) and 3.36μM against glucose-1-phosphate (non-competitive).

  14. Design and synthesis of inhibitors incorporating beta -amino acids of metalloendopeptidase EC 3.4.24.15.

    PubMed

    Steer, D L; Lew, R A; Perlmutter, P; Smith, A I; Aguilar, M I

    2000-09-01

    Endopeptidase EC 3.4.24.15 (EP 24.15) is a thermolysin-like metalloendopeptidase which is expressed widely throughout the body, with the highest concentrations in the brain, pituitary and testis. While the precise role of EP 24.15 remains unknown, it is thought to participate in the regulated metabolism of a number of specific neuropeptides. Of the limited number of inhibitors described for EP 24.15, N-[1-(R,S)-carboxy-3-phenylpropyl]-Ala-Ala-Tyr-p-amino benzoate (CFP) is the most widely studied. CFP is a potent and specific inhibitor, but is unstable in vivo due to its cleavage between the alanine and tyrosine residues by the enzyme neprilysin (EP 24.11). The cpp-Ala-Ala N-terminal product of this cleavage is a potent inhibitor of angiotensin converting enzyme, which further limits the use of CFP in vivo. To generate specific inhibitors of EP 24.15 that are resistant to in vivo proteolysis by EP 24.11, beta-amino acids have been incorporated into the structure of CFP. We have prepared racemic mixtures of beta-amino acids containing proteogenic side chains, which are 9-fluorenylmethoxycarbonyl (Fmoc)-protected, and several analogues of CFP containing beta-amino acids have been synthesized by solid phase peptide synthesis. The results of stability and inhibitory studies of these new analogues show that the incorporation of beta-amino acids adjacent to the scissile bond can indeed stabilize the peptides against cleavage by EP 24.11 and still inhibit EP 24.15. The results obtained in these studies demonstrate the potential of these amino acids in the synthesis of peptidomimetics and in the design of new stable and specific therapeutics. PMID:11016884

  15. Inhibitors of Fatty Acid Synthesis Induce PPAR α -Regulated Fatty Acid β -Oxidative Genes: Synergistic Roles of L-FABP and Glucose.

    PubMed

    Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm

    2013-01-01

    While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.

  16. 3-Arylpropionylhydroxamic acid derivatives as Helicobacter pylori urease inhibitors: Synthesis, molecular docking and biological evaluation.

    PubMed

    Shi, Wei-Kang; Deng, Rui-Cheng; Wang, Peng-Fei; Yue, Qin-Qin; Liu, Qi; Ding, Kun-Ling; Yang, Mei-Hui; Zhang, Hong-Yu; Gong, Si-Hua; Deng, Min; Liu, Wen-Run; Feng, Qiu-Ju; Xiao, Zhu-Ping; Zhu, Hai-Liang

    2016-10-01

    Helicobacter pylori urease is involved in several physiologic responses such as stomach and duodenal ulcers, adenocarcinomas and stomach lymphomas. Thus, inhibition of urease is taken for a good chance to treat H. pylori-caused infections, we have therefore focused our efforts on seeking novel urease inhibitors. Here, a series of arylpropionylhydroxamic acids were synthesized and evaluated for urease inhibition. Out of these compounds, 3-(2-benzyloxy-5-chlorophenyl)-3-hydroxypropionylhydroxamic acid (d24) was the most active inhibitor with IC50 of 0.15±0.05μM, showing a mixed inhibition with both competitive and uncompetitive aspects. Non-linear fitting of kinetic data gives kinetics parameters of 0.13 and 0.12μg·mL(-1) for Ki and Ki', respectively. The plasma protein binding assays suggested that d24 exhibited moderate binding to human and rabbit plasma proteins. PMID:27492194

  17. Synthesis and evaluation of aminophosphinic acid derivatives as inhibitors of renal dipeptidase.

    PubMed

    Gurulingappa, Hallur; Buckhalts, Phillip; Kinzler, Kenneth W; Vogelstein, Bert; Khan, Saeed R

    2004-07-01

    Renal dipeptidase (RDP) is an enzyme overexpressed in benign and malignant colorectal tumors. In an effort to identify potent inhibitors of this enzyme, a series of aminophosphinic acid derivatives were synthesized. Compounds 3a and 3c in which the phenyl ring was para substituted with F and Br and olefin with Z geometry, showed better inhibitory activity against RDP enzyme (IC50 = 5-6 nM).

  18. How polyamine synthesis inhibitors and cinnamic acid affect tropane alkaloid production.

    PubMed

    Marconi, Patricia L; Alvarez, María A; Pitta-Alvarez, Sandra I

    2007-01-01

    Hairy roots of Brugmansia candida produce the tropane alkaloids scopolamine and hyoscyamine. In an attempt to divert the carbon flux from competing pathways and thus enhance productivity, the polyamine biosynthesis inhibitors cyclohexylamine (CHA) and methylglyoxal-bis-guanylhydrazone (MGBG) and the phenylalanine-ammonia-lyase inhibitor cinnamic acid were used. CHA decreased the specific productivity of both alkaloids but increased significantly the release of scopolamine (approx 500%) when it was added in the mid-exponential phase. However, when CHA was added for only 48 h during the exponential phase, the specific productivity of both alkaloids increased (approx 200%), favoring scopolamine. Treatment with MGBG was detrimental to growth but promoted release into the medium of both alkaloids. However, when it was added for 48 h during the exponential phase, MGBG increased the specific productivity (approx 200%) and release (250- 1800%) of both alkaloids. Cinnamic acid alone also favored release but not specific productivity. When a combination of CHA or MGBG with cinnamic acid was used, the results obtained were approximately the same as with each polyamine biosynthesis inhibitor alone, although to a lesser extent. Regarding root morphology, CHA inhibited growth of primary roots and ramification. However, it had a positive effect on elongation of lateral roots. PMID:17416978

  19. Novel 2-oxoimidazolidine-4-carboxylic acid derivatives as Hepatitis C virus NS3-4A serine protease inhibitors: synthesis, activity, and X-ray crystal structure of an enzyme inhibitor complex

    SciTech Connect

    Arasappan, Ashok; Njoroge, F. George; Parekh, Tejal N.; Yang, Xiaozheng; Pichardo, John; Butkiewicz, Nancy; Prongay, Andrew; Yao, Nanhua; Girijavallabhan, Viyyoor

    2008-06-30

    Synthesis and HCV NS3 serine protease inhibitory activity of some novel 2-oxoimidazolidine-4-carboxylic acid derivatives are reported. Inhibitors derived from this new P2 core exhibited activity in the low {micro}M range. X-ray structure of an inhibitor, 15c bound to the protease is presented.

  20. Novel quinolinonyl diketo acid derivatives as HIV-1 integrase inhibitors: design, synthesis, and biological activities.

    PubMed

    Di Santo, Roberto; Costi, Roberta; Roux, Alessandra; Miele, Gaetano; Crucitti, Giuliana Cuzzucoli; Iacovo, Alberto; Rosi, Federica; Lavecchia, Antonio; Marinelli, Luciana; Di Giovanni, Carmen; Novellino, Ettore; Palmisano, Lucia; Andreotti, Mauro; Amici, Roberta; Galluzzo, Clementina Maria; Nencioni, Lucia; Palamara, Anna Teresa; Pommier, Yves; Marchand, Christophe

    2008-08-14

    Novel quinolinonyl diketo acids were designed to obtain integrase (IN) inhibitors selectively active against the strand transfer (ST) step of the HIV integration process. Those new compounds are characterized by a single aryl diketo acid (DKA) chain in comparison to 4, a bifunctional diketo acid reported by our group as an anti-IN agent highly potent against both the 3'-processing and ST steps. Compound 6d was the most potent derivative in IN enzyme assays, while 6i showed the highest potency against HIV-1 in acutely infected cells. The selective inhibition of ST suggested the newly designed monofunctional DKAs bind the IN-DNA acceptor site without affecting the DNA donor site.

  1. Search for novel histone deacetylase inhibitors. Part II: design and synthesis of novel isoferulic acid derivatives.

    PubMed

    Lu, Wen; Wang, Fang; Zhang, Tao; Dong, Jinyun; Gao, Hongping; Su, Ping; Shi, Yaling; Zhang, Jie

    2014-05-01

    Previously, we described the discovery of potent ferulic acid-based histone deacetylase inhibitors (HDACIs) with halogeno-acetanilide as novel surface recognition moiety (SRM). In order to improve the affinity and activity of these HDACIs, twenty seven isoferulic acid derivatives were described herein. The majority of title compounds displayed potent HDAC inhibitory activity. In particular, IF5 and IF6 exhibited significant enzymatic inhibitory activities, with IC50 values of 0.73 ± 0.08 and 0.57 ± 0.16 μM, respectively. Furthermore, these compounds showed moderate antiproliferative activity against human cancer cells. Especially, IF6 displayed promising profile as an antitumor candidate with IC50 value of 3.91 ± 0.97 μM against HeLa cells. The results indicated that these isoferulic acid derivatives could serve as promising lead compounds for further optimization. PMID:24702857

  2. Effects of tumour necrosis factor-alpha synthesis inhibitors on rat trinitrobenzene sulphonic acid-induced chronic colitis.

    PubMed

    Bobin-Dubigeon, C; Collin, X; Grimaud, N; Robert, J M; Le Baut, G; Petit, J Y

    2001-11-01

    The fact that tumour necrosis factor-alpha (TNF-alpha) is clearly involved in the pathogenesis of intestinal bowel disease, especially Crohn's disease, suggests that TNF-alpha synthesis inhibitors could be beneficial for treatment. The present study assessed the effect of chronic oral gavage of two in vitro TNF-alpha synthesis inhibitors, JM 34 maleate or [N-(4,6-dimethylpyridin-2-yl)-furane-2-carboxamide)] maleate and XC 21 or (N-betapicolyl-tetrafluorophtalimide), on colonic inflammation in trinitrobenzene sulphonic acid-induced colitis in rats. Rats received JM 34 maleate (100 mg/kg) and XC 21 (50 mg/kg) 1 h before colitis induction and then daily for 8 days by oral gavage. The colon was removed on day 8 and processed for clinical score, myeloperoxidase activity, and soluble TNF-alpha release. Treatment with XC 21, as well as dexamethasone and sulphasalazine, reduced colonic damage and decreased (except with dexamethasone) the incidence of diarrhoea. JM 34 maleate failed to improve the clinical signs of chronic colitis. After trinitrobenzene sulphonic acid-induced colitis, myeloperoxidase activity and TNF-alpha colonic mucosal production were substantially increased compared to the control (saline instillation). Both of these inflammatory indicators were then significantly decreased (P< or =0.05) after the four chronic treatments (JM 34 maleate, XC 21, sulphasalazine, and dexamethasone). XC 21 appeared to be as efficient as sulphasalazine in improving colonic inflammation. PMID:11716848

  3. Design, synthesis and evaluation of semi-synthetic triazole-containing caffeic acid analogues as 5-lipoxygenase inhibitors.

    PubMed

    De Lucia, Daniela; Lucio, Oscar Méndez; Musio, Biagia; Bender, Andreas; Listing, Monika; Dennhardt, Sophie; Koeberle, Andreas; Garscha, Ulrike; Rizzo, Roberta; Manfredini, Stefano; Werz, Oliver; Ley, Steven V

    2015-08-28

    In this work the synthesis, structure-activity relationship (SAR) and biological evaluation of a novel series of triazole-containing 5-lipoxygenase (5-LO) inhibitors are described. The use of structure-guided drug design techniques provided compounds that demonstrated excellent 5-LO inhibition with IC50 of 0.2 and 3.2 μm in cell-based and cell-free assays, respectively. Optimization of binding and functional potencies resulted in the identification of compound 13d, which showed an enhanced activity compared to the parent bioactive compound caffeic acid 5 and the clinically approved zileuton 3. Compounds 15 and 16 were identified as lead compounds in inhibiting 5-LO products formation in neutrophils. Their interference with other targets on the arachidonic acid pathway was also assessed. Cytotoxicity tests were performed to exclude a relationship between cytotoxicity and the increased activity observed after structure optimization.

  4. Design, synthesis and SAR studies of GABA uptake inhibitors derived from 2-substituted pyrrolidine-2-yl-acetic acids.

    PubMed

    Steffan, Tobias; Renukappa-Gutke, Thejavathi; Höfner, Georg; Wanner, Klaus T

    2015-03-15

    In this paper, we disclose the design and synthesis of a series of 2-substituted pyrrolidine-2-yl-acetic acid as core structures and the N-arylalkyl derivatives thereof as potential GABA transport inhibitors. The 2-position in the side chain of pyrrolidine-2-yl-acetic acid derivatives was substituted with alkyl, hydroxy and amino groups to modulate the activity and selectivity to mGAT1 and mGAT4 proteins. SAR studies of the compounds performed for the four mouse GABA transporter proteins (mGAT1-mGAT4) implied significant potencies and subtype selectivities for 2-hydroxy-2-pyrrolidine-2-yl-acetic acid derivatives. The racemate rac-(u)-13c exhibited the highest potency (pIC50 5.67) at and selectivity for mGAT1 in GABA uptake assays. In fact, the potency of rac-(u)-13c at hGAT-1 (pIC50 6.14) was even higher than its potency at mGAT1. These uptake results for rac-(u)-13c are in line with the binding affinities to the aforesaid proteins mGAT1 (pKi 6.99) and hGAT-1 (pKi 7.18) determined by MS Binding Assay based on NO711 as marker quantified by LC-ESI-MS-MS analysis. Interestingly, the 2-hydroxy-2-pyrrolidine-2-yl-acetic acid rac-(u)-13d containing 2-{[tris(4-methoxyphenyl)]methoxy} ethyl group at the nitrogen atom of the pyrrolidine ring showed high potency at mGAT4 and a comparatively better selectivity for this protein (>15 against mGAT3) than the well known mGAT4 uptake inhibitor (S)-SNAP-5114.

  5. A lysophosphatidic acid analogue is revealed as a potent inhibitor of phosphatidylcholine synthesis, inducing apoptosis.

    PubMed Central

    Gueguen, Geneviéve; Granci, Virginie; Rogalle, Pierre; Briand-Mésange, Fabienne; Wilson, Michéle; Klaébé, Alain; Tercé, François; Chap, Hugues; Salles, Jean-Pierre; Simon, Marie-Françoise; Gaits, Frédérique

    2002-01-01

    A previous study demonstrated that cross-desensitization experiments performed with the lysophosphatidic acid (LPA) analogues (R)- and (S)-N-palmitoyl-norleucinol 1-phosphate (PNPAs) inhibited LPA-induced platelet aggregation without any stereospecificity. Here we report opposite biological effects of the two enantiomers on mitogenesis of IMR-90 fibroblasts in relation to their respective metabolism. (R)PNPA was proliferative, while (S)PNPA induced apoptosis by specifically inhibiting phosphatidylcholine biosynthesis at the last step of the CDP-choline pathway controlled by cholinephosphotransferase. This effect was not direct but required dephosphorylation of PNPAs by ecto-lipid phosphate phosphatase before cellular uptake of the generated N-palmitoyl-norleucinols (PNOHs). Inhibition of cholinephosphotransferase by the derivative (S)PNOH was confirmed by an in vitro assay. (S)PNPA proapoptotic effects led us to clarify the mechanism linking cholinephosphotransferase inhibition to apoptosis. Three proapoptotic responses were observed: the activation of caspase-3, the production of ceramides from newly synthesized pools (as demonstrated by the inhibitor Fumonisin B1) and finally the activation of stress-activated protein kinase, p38 and c-Jun N-terminal kinases 1/2, as a result of ceramide increase. Thus our data demonstrate that synthetic analogues of LPA might display stereospecific effects leading to apoptosis independently of classical LPA-activated pathways. PMID:12197836

  6. Synthesis of Lysine Methyltransferase Inhibitors

    NASA Astrophysics Data System (ADS)

    Ye, Tao; Hui, Chunngai

    2015-07-01

    Lysine methyltransferase which catalyze methylation of histone and nonhistone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting Lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery.

  7. Design, synthesis, and evaluation of 2 beta-alkenyl penam sulfone acids as inhibitors of beta-lactamases.

    PubMed

    Richter, H G; Angehrn, P; Hubschwerlen, C; Kania, M; Page, M G; Specklin, J L; Winkler, F K

    1996-09-13

    A general method for synthesis of 2 beta-alkenyl penam sulfones has been developed. The new compounds inhibited most of the common types of beta-lactamase. The level of activity depended very strongly on the nature of the substituent in the 2 beta-alkenyl group. The inhibited species formed with the beta-lactamase from Citrobacter freundii 1205 was sufficiently stable for X-ray crystallographic studies. These, together with UV absorption spectroscopy and studies of chemical degradation, suggested a novel reaction mechanism for the new inhibitors that might account for their broad spectrum of action. The (Z)-2 beta-acrylonitrile penam sulfone Ro 48-1220 was the most active inhibitor from this class of compound. The inhibitor enhanced the action of, for example, ceftriaxone against a broad selection of organisms producing beta-lactamases. The organisms included strains of Enterobacteriaceae that produce cephalosporinases, which is an exceptional activity for penam sulfones.

  8. N-Benzyl-indolo carboxylic acids: Design and synthesis of potent and selective adipocyte fatty-acid binding protein (A-FABP) inhibitors.

    PubMed

    Barf, Tjeerd; Lehmann, Fredrik; Hammer, Kristin; Haile, Saba; Axen, Eva; Medina, Carmen; Uppenberg, Jonas; Svensson, Stefan; Rondahl, Lena; Lundbäck, Thomas

    2009-03-15

    Small molecule inhibitors of adipocyte fatty-acid binding protein (A-FABP) have gained renewed interest following the recent publication of pharmacologically beneficial effects of such inhibitors. Despite the potential utility of selective A-FABP inhibitors within the fields of metabolic disease, inflammation and atherosclerosis, there are few examples of useful A-FABP inhibitors in the public domain. Herein, we describe the optimization of N-benzyl-tetrahydrocarbazole derivatives through the use of co-crystal structure guided medicinal chemistry efforts. This led to the identification of a potent and selective class of A-FABP inhibitors as illustrated by N-benzyl-hexahydrocyclohepta[b]indole 30. PMID:19217286

  9. Synthesis and evaluation of quinazoline amino acid derivatives as mono amine oxidase (MAO) inhibitors.

    PubMed

    Khattab, Sherine Nabil; Haiba, Nesreen Saied; Asal, Ahmed Mosaad; Bekhit, Adnan A; Amer, Adel; Abdel-Rahman, Hamdy M; El-Faham, Ayman

    2015-07-01

    A series of quinazolinone amino acid ester and quinazolinone amino acid hydrazides were prepared under microwave irradiation as well as conventional condition. The microwave irradiation afforded the product in less reaction time, higher yield and purity. The structures of the synthesized compounds were confirmed by IR, NMR, and elemental analysis. The new synthesized compounds were studied for their monoamine oxidase inhibitory activity. They showed more selective inhibitory activity toward MAO-A than MAO-B. Compounds 7, 10, and 15 showed MAO-A inhibition activity (IC50=3.6×10(-9), 2.8×10(-9), 2.1×10(-9) M, respectively) comparable to that of the standard clorgyline (IC50=2.9×10(-9)M). 2-(2-(Benzo[d][1,3]dioxol-5-yl)-4-oxo-1,2-dihydroquinazolin-3(4H)-yl)acetohydrazide 15 showed selective MAO-A inhibition activity (SI=39524) superior to that of the standard clorgyline (SI=33793). The acute toxicity of the synthesized compounds was determined. In addition, computer-assisted simulated docking experiments were performed to rationalize the biological activity. PMID:25922182

  10. Synthesis and evaluation of quinazoline amino acid derivatives as mono amine oxidase (MAO) inhibitors.

    PubMed

    Khattab, Sherine Nabil; Haiba, Nesreen Saied; Asal, Ahmed Mosaad; Bekhit, Adnan A; Amer, Adel; Abdel-Rahman, Hamdy M; El-Faham, Ayman

    2015-07-01

    A series of quinazolinone amino acid ester and quinazolinone amino acid hydrazides were prepared under microwave irradiation as well as conventional condition. The microwave irradiation afforded the product in less reaction time, higher yield and purity. The structures of the synthesized compounds were confirmed by IR, NMR, and elemental analysis. The new synthesized compounds were studied for their monoamine oxidase inhibitory activity. They showed more selective inhibitory activity toward MAO-A than MAO-B. Compounds 7, 10, and 15 showed MAO-A inhibition activity (IC50=3.6×10(-9), 2.8×10(-9), 2.1×10(-9) M, respectively) comparable to that of the standard clorgyline (IC50=2.9×10(-9)M). 2-(2-(Benzo[d][1,3]dioxol-5-yl)-4-oxo-1,2-dihydroquinazolin-3(4H)-yl)acetohydrazide 15 showed selective MAO-A inhibition activity (SI=39524) superior to that of the standard clorgyline (SI=33793). The acute toxicity of the synthesized compounds was determined. In addition, computer-assisted simulated docking experiments were performed to rationalize the biological activity.

  11. Synthesis of lysine methyltransferase inhibitors

    PubMed Central

    Hui, Chunngai; Ye, Tao

    2015-01-01

    Lysine methyltransferase which catalyze methylation of histone and non-histone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery. PMID:26258118

  12. Multicomponent click synthesis of new 1,2,3-triazole derivatives of pyrimidine nucleobases: promising acidic corrosion inhibitors for steel.

    PubMed

    González-Olvera, Rodrigo; Espinoza-Vázquez, Araceli; Negrón-Silva, Guillermo E; Palomar-Pardavé, Manuel E; Romero-Romo, Mario A; Santillan, Rosa

    2013-12-06

    A series of new mono-1,2,3-triazole derivatives of pyrimidine nucleobases were synthesized by one-pot copper(I)-catalyzed 1,3-dipolar cycloaddition reactions between N-1-propargyluracil and thymine, sodium azide and several benzyl halides. The desired heterocyclic compounds were obtained in good yields and characterized by NMR, IR, and high resolution mass spectrometry. These compounds were investigated as corrosion inhibitors for steel in 1 M HCl solution, using electrochemical impedance spectroscopy (EIS) technique. The results indicate that these heterocyclic compounds are promising acidic corrosion inhibitors for steel.

  13. Discovery, synthesis, and pharmacological evaluation of spiropiperidine hydroxamic acid based derivatives as structurally novel histone deacetylase (HDAC) inhibitors.

    PubMed

    Varasi, Mario; Thaler, Florian; Abate, Agnese; Bigogno, Chiara; Boggio, Roberto; Carenzi, Giacomo; Cataudella, Tiziana; Dal Zuffo, Roberto; Fulco, Maria Carmela; Rozio, Marco Giulio; Mai, Antonello; Dondio, Giulio; Minucci, Saverio; Mercurio, Ciro

    2011-04-28

    New spiro[chromane-2,4'-piperidine] and spiro[benzofuran-2,4'-piperidine] hydroxamic acid derivatives as HDAC inhibitors have been identified by combining privileged structures with a hydroxamic acid moiety as zinc binding group. The compounds were evaluated for their ability to inhibit nuclear extract HDACs and for their in vitro antiproliferative activity on different tumor cell lines. This work resulted in the discovery of spirocycle 30d that shows good oral bioavailability and tumor growth inhibition in an HCT-116 murine xenograft model.

  14. A new dioxime corrosion inhibitor for the protection and conservation of copper: synthesis, characterization and evaluation in acidic chloride solution

    NASA Astrophysics Data System (ADS)

    Abu-Baker, Ahmad N.; Al-Qudah, Mahmoud A.

    2016-08-01

    This study aimed to investigate a new dioxime compound as a corrosion inhibitor for copper. The compound (4,6-dihydroxy benzene-1,3-dicarbaldehyde dioxime) was synthesized and characterized by nuclear magnetic resonance spectroscopy. Electrochemical impedance spectroscopy and potentiodynamic polarization measurements were used to compare the dioxime compound with benzotriazole for their effectiveness as corrosion inhibitors for copper in 0.1 M HCl solution. Fourier transform infrared (FTIR) spectroscopy and scanning electron microscopy (SEM) were used to investigate the bonding mechanisms and morphological changes of the two inhibitors on the copper surface. The electrochemical techniques showed that the new dioxime compound was more effective than benzotriazole in inhibiting copper corrosion in the acidic chloride medium. The FTIR and SEM results indicated that the dioxime compound was able to coordinate with copper ions and formed a protective film on the copper surface. It was concluded that the new dioxime compound proved effectiveness to be used as a corrosion inhibitor for the protection and conservation of copper.

  15. Design and Synthesis of Potent N-Acylethanolamine-hydrolyzing Acid Amidase (NAAA) Inhibitor as Anti-Inflammatory Compounds

    PubMed Central

    Chen, Ling; Zhu, Chenggang; Huang, Rui; Zheng, Xiao; Qiu, Yan; Fu, Jin

    2012-01-01

    N-acylethanolamine-hydrolyzing acid amidase (NAAA) is a lysosomal enzyme involved in biological deactivation of N-palmitoylethanolamide (PEA), which exerts anti-inflammatory and analgesic effects through the activation of nuclear receptor peroxisome proliferator-activated receptor-alpha (PPAR-α). To develop selective and potent NAAA inhibitors, we designed and synthesized a series of derivatives of 1-pentadecanyl-carbonyl pyrrolidine (compound 1), a general amidase inhibitor. Structure activity relationship (SAR) studies have identified a compound 16, 1-(2-Biphenyl-4-yl)ethyl-carbonyl pyrrolidine, which has shown the highest inhibition on NAAA activity (IC50 = 2.12±0.41 µM) and is characterized as a reversible and competitive NAAA inhibitor. Computational docking analysis and mutagenesis study revealed that compound 16 interacted with Asparagine 209 (Asn209) residue flanking the catalytic pocket of NAAA so as to block the substrate entrance. In vitro pharmacological studies demonstrated that compound 16 dose-dependently reduced mRNA expression levels of iNOS and IL-6, along with an increase of intracellular PEA levels, in mouse macrophages with lipopolysaccharides (LPS) induced inflammation. Our study discovered a novel NAAA inhibitor, compound 16, that could serve as a potential anti-inflammatory agent. PMID:22916199

  16. Synthesis and QSAR of Fatty Acid Amide Hydrolase Inhibitors: Modulation at the N-Portion of Biphenyl-3-yl Alkylcarbamates

    PubMed Central

    Mor, Marco; Lodola, Alessio; Rivara, Silvia; Vacondio, Federica; Duranti, Andrea; Tontini, Andrea; Sanchini, Silvano; Piersanti, Giovanni; Clapper, Jason R.; King, Alvin R.; Tarzia, Giorgio; Piomelli, Daniele

    2013-01-01

    Alkylcarbamic acid biphenyl-3-yl esters are a class of fatty acid amide hydrolase (FAAH) inhibitors that comprises cyclohexylcarbamic acid 3′-carbamoylbiphenyl-3-yl ester (URB597), a compound with analgesic, anxiolytic-like and antidepressant-like properties in rat and mouse models. Here, we extended the structure-activity relationships (SARs) for this class of compounds by replacing the cyclohexyl ring of the parent compound cyclohexylcarbamic acid biphenyl-3-yl ester (URB524) (IC50, for FAAH = 63 nM) with a selected set of substituents of different size, shape, flexibility and lipophilicity. Docking experiments and Linear Interaction Energy (LIE) calculations indicated that the N-terminal group of O-arylcarbamates fits within the lipophilic region of the substrate-binding site, mimicking the arachidonoyl chain of anandamide. Significant potency improvements were observed for the β-naphthylmethyl derivative 4q (IC50 = 5.3 nM) and its 3′-carbamoylbiphenyl-3-yl ester 4z (URB880, IC50 = 0.63 nM), indicating that shape complementarity and hydrogen bonds are crucial to obtain highly potent inhibitors. PMID:18507372

  17. Synthesis and bioevaluation of 2-phenyl-4-methyl-1,3-selenazole-5-carboxylic acids as potent xanthine oxidase inhibitors.

    PubMed

    Guan, Qi; Cheng, Zengjin; Ma, Xiaoxue; Wang, Lijie; Feng, Dongjie; Cui, Yuanhang; Bao, Kai; Wu, Lan; Zhang, Weige

    2014-10-01

    A series of 2-phenyl-4-methyl-1,3-selenazole-5-carboxylic acid derivatives (8a-f, 9a-m) were synthesized and evaluated for inhibitory activity against xanthine oxidase in vitro. Structure-activity relationship analyses have also been presented. Most of the target compounds exhibited potency levels in the nanomolar range. Compound 9e emerged as the most potent xanthine oxidase inhibitor (IC50 = 5.5 nM) in comparison to febuxostat (IC50 = 18.6 nM). Steady-state kinetics measurements with the bovine milk enzyme indicated a mixed type inhibition with Ki and Ki' values of 0.9 and 2.3 nM, respectively. A molecular modeling study on compounds 9e was performed to gain an insight into its binding mode with xanthine oxidase, and to provide the basis for further structure-guided design of new non-purine xanthine oxidase inhibitors related with 2-phenyl-4-methyl-1,3-selenazole-5-carboxylic acid scaffold.

  18. Synthesis and In Vitro Evaluation of Aspartate Transcarbamoylase Inhibitors

    PubMed Central

    Coudray, Laëtitia; Pennebaker, Anne F.; Montchamp, Jean-Luc

    2009-01-01

    The design, synthesis, and evaluation of a series of novel inhibitors of aspartate transcarbamoylase (ATCase) are reported. Several submicromolar phosphorus-containing inhibitors are described, but all-carboxylate compounds are inactive. Compounds were synthesized to probe the postulated cyclic transition-state of the enzyme-catalyzed reaction. In addition, the associated role of the protonation state at the phosphorus acid moiety was evaluated using phosphinic and carboxylic acids. Although none of the synthesized inhibitors is more potent than N-phosphonacetyl-L-aspartate (PALA), the compounds provide useful mechanistic information, as well as the basis for the design of future inhibitors and/or prodrugs. PMID:19828320

  19. Design, synthesis and pharmacological characterization of coumarin-based fluorescent analogs of excitatory amino acid transporter subtype 1 selective inhibitors, UCPH-101 and UCPH-102.

    PubMed

    Huynh, Tri H V; Abrahamsen, Bjarke; Madsen, Karsten K; Gonzalez-Franquesa, Alba; Jensen, Anders A; Bunch, Lennart

    2012-12-01

    The excitatory amino acid transporters (EAATs) play a pivotal role in regulating the synaptic concentration of glutamate in the mammalian central nervous system. To date, five different subtypes have been identified, named EAAT15 in humans (and GLAST, GLT-1, EAAC1, EAAT4, and EAAT5, respectively, in rodents). Recently, we have published and presented a structure-activity relationship (SAR) study of a novel class of selective inhibitors of EAAT1 (and GLAST), with the analogs UCPH-101 (IC(50)=0.66μM) and UCPH-102 (IC(50)=0.43μM) being the most potent inhibitors in the series. In this paper, we present the design, synthesis and pharmacological evaluation of six coumarin-based fluorescent analogs of UCPH-101/102 as subtype-selective inhibitors at EAAT1. Analogs 1114 failed to inhibit EAAT1 function (IC(50) values >300μM), whereas analogs 15 and UCPH-102F inhibited EAAT1 with IC(50) values in the medium micromolar range (17μM and 14μM, respectively). Under physiological pH no fluorescence was observed for analog 15, while a bright blue fluorescence emission was observed for analog UCPH-102F. Regrettably, under confocal laser scanning microscopy selective visualization of expression of EAAT1 over EAAT3 was not possible due to nonspecific binding of UCPH-102F. PMID:23072958

  20. Multicomponent Synthesis and Evaluation of New 1,2,3-Triazole Derivatives of Dihydropyrimidinones as Acidic Corrosion Inhibitors for Steel.

    PubMed

    González-Olvera, Rodrigo; Román-Rodríguez, Viridiana; Negrón-Silva, Guillermo E; Espinoza-Vázquez, Araceli; Rodríguez-Gómez, Francisco Javier; Santillan, Rosa

    2016-02-22

    An efficient one-pot synthesis of 1,2,3-triazole derivatives of dihydropyrimidinones has been developed using two multicomponent reactions. The aldehyde-1,2,3-triazoles were obtained in good yields from in situ-generated organic azides and O-propargylbenzaldehyde. The target heterocycles were synthesized through the Biginelli reaction in which the aldehyde-1,2,3-triazoles reacted with ethyl acetoacetate and urea in the presence of Ce(OTf)₃ as the catalyst. The corrosion inhibition of steel grade API 5 L X52 in 1 M HCl by the synthesized compounds was investigated using the electrochemical impedance spectroscopy technique. The measurements revealed that these heterocycles are promising candidates to inhibit acidic corrosion of steel.

  1. Synthesis and biological evaluation of piperic acid amides as free radical scavengers and α-glucosidase inhibitors.

    PubMed

    Takao, Koichi; Miyashiro, Takaki; Sugita, Yoshiaki

    2015-01-01

    A series of piperic acid amides (4-24, 29, 30) were synthesized and their 1,1-diphenyl-2-picrylhydrazyl (DPPH) free radical scavenging and α-glucosidase inhibitory activities were evaluated. Among the synthesized compounds, the amides 11, 13 and 15, which contain o-methoxyphenol, catechol or 5-hydroxyindole moieties, showed potent DPPH free radical scavenging activity (11: EC50 140 µM; 13: EC50 28 µM; 15: EC50 20 µM). The amides 10, 18 and 23 showed higher inhibitory activity of α-glucosidase (10: IC50 21 µM; 18: IC50 21 µM; 23: IC50 12 µM). These data suggest that the hydrophobicity of the conjugated amines is an important determinant of α-glucosidase inhibitory activity. In addition, the amides 13 and 15 showed both potent DPPH free radical scavenging activity and α-glucosidase inhibitory activity (13: IC50 46 µM; 15: IC50 46 µM). This is the first report identifying the DPPH free radical scavenging and α-glucosidase inhibitory activities of piperic acid amides and suggests that these amides may serve as lead compounds for the development of novel α-glucosidase inhibitors with antioxidant activity.

  2. Synthesis and biological evaluation of piperic acid amides as free radical scavengers and α-glucosidase inhibitors.

    PubMed

    Takao, Koichi; Miyashiro, Takaki; Sugita, Yoshiaki

    2015-01-01

    A series of piperic acid amides (4-24, 29, 30) were synthesized and their 1,1-diphenyl-2-picrylhydrazyl (DPPH) free radical scavenging and α-glucosidase inhibitory activities were evaluated. Among the synthesized compounds, the amides 11, 13 and 15, which contain o-methoxyphenol, catechol or 5-hydroxyindole moieties, showed potent DPPH free radical scavenging activity (11: EC50 140 µM; 13: EC50 28 µM; 15: EC50 20 µM). The amides 10, 18 and 23 showed higher inhibitory activity of α-glucosidase (10: IC50 21 µM; 18: IC50 21 µM; 23: IC50 12 µM). These data suggest that the hydrophobicity of the conjugated amines is an important determinant of α-glucosidase inhibitory activity. In addition, the amides 13 and 15 showed both potent DPPH free radical scavenging activity and α-glucosidase inhibitory activity (13: IC50 46 µM; 15: IC50 46 µM). This is the first report identifying the DPPH free radical scavenging and α-glucosidase inhibitory activities of piperic acid amides and suggests that these amides may serve as lead compounds for the development of novel α-glucosidase inhibitors with antioxidant activity. PMID:25948326

  3. Rational Design, Synthesis, and Preliminary Structure-Activity Relationships of α-Substituted-2-Phenylcyclopropane Carboxylic Acids as Inhibitors of Salmonella typhimurium O-Acetylserine Sulfhydrylase.

    PubMed

    Pieroni, Marco; Annunziato, Giannamaria; Beato, Claudia; Wouters, Randy; Benoni, Roberto; Campanini, Barbara; Pertinhez, Thelma A; Bettati, Stefano; Mozzarelli, Andrea; Costantino, Gabriele

    2016-03-24

    Cysteine is a building block for several biomolecules that are crucial for living organisms. The last step of cysteine biosynthesis is catalyzed by O-acetylserine sulfydrylase (OASS), a highly conserved pyridoxal 5'-phosphate (PLP)-dependent enzyme, present in different isoforms in bacteria, plants, and nematodes, but absent in mammals. Beside the biosynthesis of cysteine, OASS exerts a series of "moonlighting" activities in bacteria, such as transcriptional regulation, contact-dependent growth inhibition, swarming motility, and induction of antibiotic resistance. Therefore, the discovery of molecules capable of inhibiting OASS would be a valuable tool to unravel how this protein affects the physiology of unicellular organisms. As a continuation of our efforts toward the synthesis of OASS inhibitors, in this work we have used a combination of computational and spectroscopic approaches to rationally design, synthesize, and test a series of substituted 2-phenylcyclopropane carboxylic acids that bind to the two S. typhymurium OASS isoforms at nanomolar concentrations.

  4. Rational Design, Synthesis, and Preliminary Structure-Activity Relationships of α-Substituted-2-Phenylcyclopropane Carboxylic Acids as Inhibitors of Salmonella typhimurium O-Acetylserine Sulfhydrylase.

    PubMed

    Pieroni, Marco; Annunziato, Giannamaria; Beato, Claudia; Wouters, Randy; Benoni, Roberto; Campanini, Barbara; Pertinhez, Thelma A; Bettati, Stefano; Mozzarelli, Andrea; Costantino, Gabriele

    2016-03-24

    Cysteine is a building block for several biomolecules that are crucial for living organisms. The last step of cysteine biosynthesis is catalyzed by O-acetylserine sulfydrylase (OASS), a highly conserved pyridoxal 5'-phosphate (PLP)-dependent enzyme, present in different isoforms in bacteria, plants, and nematodes, but absent in mammals. Beside the biosynthesis of cysteine, OASS exerts a series of "moonlighting" activities in bacteria, such as transcriptional regulation, contact-dependent growth inhibition, swarming motility, and induction of antibiotic resistance. Therefore, the discovery of molecules capable of inhibiting OASS would be a valuable tool to unravel how this protein affects the physiology of unicellular organisms. As a continuation of our efforts toward the synthesis of OASS inhibitors, in this work we have used a combination of computational and spectroscopic approaches to rationally design, synthesize, and test a series of substituted 2-phenylcyclopropane carboxylic acids that bind to the two S. typhymurium OASS isoforms at nanomolar concentrations. PMID:26894308

  5. Studies on bacterial cell wall inhibitors. VI. Screening method for the specific inhibitors of peptidoglycan synthesis.

    PubMed

    Omura, S; Tanaka, H; Oiwa, R; Nagai, T; Koyama, Y; Takahashi, Y

    1979-10-01

    A screening method was established for selecting new specific inhibitors of bacterial cell wall peptidoglycan synthesis. In the primary test, culture broths of soil isolates were selected based on relative microbial activity. A culture, to be retained, must be active against Bacillus subtilis and lack activities against Acholeplasma laidawii. In the secondary test, inhibitors of bacterial cell wall synthesis were identified by their ability to prevent the incorporation of meso-[3H]diaminopimelic acid but not to prevent the incorporation of L-[4C]leucine into the acid-insoluble macromolecular fraction of growing cells of Bacillus sp. ATCC 21206 (Dpm-). As the tertiary test, inhibitors with molecular weights under 1,000 were selected by passage through a Diaflo UM-2 membrane. By this screening procedure, six known antibiotics and one new one were picked out from ten thousand soil isolates. PMID:528376

  6. Synthesis of the (5Z)-5-Pentacosenoic and 5-Pentacosynoic Acids as Novel HIV-1 Reverse Transcriptase Inhibitors

    PubMed Central

    Moreira, Lizabeth Giménez; Orellano, Elsie A.; Rosado, Karolyna; Guido, Rafael V. C.; Andricopulo, Adriano D.; Soto, Gabriela O.; Rodríguez, José W.; Sanabria-Ríos, David J.; Carballeira, Néstor M.

    2016-01-01

    The natural fatty acids (5Z)-5-pentacosenoic and (9Z)-9-pentacosenoic acids were synthesized for the first time in eight steps starting from either 4-bromo-1-butanol or 8-bromo-1-butanol and in 20-58% overall yields, while the novel fatty acids 5-pentacosynoic and 9-pentacosynoic acids were also synthesized in six steps and in 34-43% overall yields. The Δ5 acids displayed the best IC50’s (24-38 µM) against the HIV-1 reverse transcriptase (RT) enzyme, comparable to nervonic acid (IC50 = 12 µM). The Δ9 acids were not as effective towards HIV-RT with the (9Z)-9-pentacosenoic acid displaying an IC50 = 54 µM. Fatty acid chain length and position of the unsaturation was critical for the observed inhibition. Molecular modeling studies indicated the structural determinants underlying the biological activity of the most potent compounds. These results provide new insights into the structural requirements that must be present in fatty acids so as to enhance their inhibitory potential towards HIV-RT. PMID:26345647

  7. Natural Product Total Synthesis in the Organic Laboratory: Total Synthesis of Caffeic Acid Phenethyl Ester (CAPE), a Potent 5-Lipoxygenase Inhibitor from Honeybee Hives

    ERIC Educational Resources Information Center

    Touaibia, Mohamed; Guay, Michel

    2011-01-01

    Natural products play a critical role in modern organic synthesis and learning synthetic techniques is an important component of the organic laboratory experience. In addition to traditional one-step organic synthesis laboratories, a multistep natural product synthesis is an interesting experiment to challenge students. The proposed three-step…

  8. Acid Mediated Ring Closing Metathesis: A Powerful Synthetic Tool Enabling the Synthesis of Clinical Stage Kinase Inhibitors.

    PubMed

    William, Anthony D; Lee, Angeline C-H

    2015-01-01

    The powerful olefin metathesis reaction was employed for the construction of late-phase clinical agents SB1317 and SB1518. In both cases RCM seems to proceed only in the presence of an acid and to predominantly furnish trans isomers. In case of SB1518 it proceeded in the presence of acid HCl, while for SB1317, it mainly proceeds in the presence of TFA (trifluroacetic acid).

  9. Acid Mediated Ring Closing Metathesis: A Powerful Synthetic Tool Enabling the Synthesis of Clinical Stage Kinase Inhibitors.

    PubMed

    William, Anthony D; Lee, Angeline C-H

    2015-01-01

    The powerful olefin metathesis reaction was employed for the construction of late-phase clinical agents SB1317 and SB1518. In both cases RCM seems to proceed only in the presence of an acid and to predominantly furnish trans isomers. In case of SB1518 it proceeded in the presence of acid HCl, while for SB1317, it mainly proceeds in the presence of TFA (trifluroacetic acid). PMID:26507218

  10. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  11. Design, synthesis, 3D pharmacophore, QSAR, and docking studies of carboxylic acid derivatives as Histone Deacetylase inhibitors and cytotoxic agents.

    PubMed

    Abdel-Atty, Mona M; Farag, Nahla A; Kassab, Shaymaa E; Serya, Rabah A T; Abouzid, Khaled A M

    2014-12-01

    In this study, five series of (E)-6-(4-substituted phenyl)-4-oxohex-5-enoic acids IIb-f (E), (E)-3-(4-(substituted)-phenyl)acrylic acids IIIa-g (E), 4-(4-(substituted)phenylamino)-4-oxobutanoic acids VIa,b,e, 5-(4-(substituted)phenylamino)-5-oxopentanoic acids VIIa,f and 2-[(4-(substituted)phenyl) carbamoyl]benzoic acids VIIIa,e were designed and synthesized. Selected compounds were screened in vitro for their cytotoxic effect on 60 human NCI tumor cell lines. Compound IIf (E) displayed significant inhibitory activity against NCI Non-Small Cell Lung A549/ATCC Cancer cell line (68% inhibition) and NCI-H460 Cancer cell line (66% inhibition). Moreover, the final compounds were evaluated in vitro for their cytotoxic activity on HepG2 Cancer cell line in which histone deacetylase (HDAC) is overexpressed. Compounds IIc (E), IIf (E), IIIb (E), and IIIg (E) exhibited the highest cytotoxic activity against HepG2 human cancer cell lines with IC50 ranging from 2.27 to 10.71μM. In addition, selected compounds were tested on histone deacetylase isoforms (HDAC1-11). Molecular docking simulation was also carried out for HDLP enzyme to investigate their HDAC binding affinity. In addition, generation of 3D-pharmacophore model and quantitative structure activity relationship (QSAR) models were combined to explore the structural requirements controlling the observed cytotoxic properties.

  12. Synthesis and Structure-activity Relationship Studies of O-Biphenyl-3-yl Carbamates as Peripherally Restricted Fatty Acid Amide Hydrolase Inhibitors

    PubMed Central

    Moreno-Sanz, Guillermo; Duranti, Andrea; Melzig, Laurin; Fiorelli, Claudio; Ruda, Gian Filippo; Colombano, Giampiero; Mestichelli, Paola; Sanchini, Silvano; Tontini, Andrea; Mor, Marco; Bandiera, Tiziano; Scarpelli, Rita; Tarzia, Giorgio; Piomelli, Daniele

    2014-01-01

    The peripherally restricted fatty acid amide hydrolase (FAAH) inhibitor URB937 (3, cyclohexylcarbamic acid 3’-carbamoyl-6-hydroxybiphenyl-3-yl ester) is extruded from the brain and spinal cord by the Abcg2 efflux transporter. Despite its inability to enter the central nervous system (CNS), 3 exerts profound antinociceptive effects in mice and rats, which result from the inhibition of FAAH in peripheral tissues and the consequent enhancement of anandamide signaling at CB1 cannabinoid receptors localized on sensory nerve endings. In the present study, we examined the structure-activity relationships (SAR) for the biphenyl region of compound 3, focusing on the carbamoyl and hydroxyl groups in the distal and proximal phenyl rings. Our SAR studies generated a new series of peripherally restricted FAAH inhibitors and identified compound 35 (cyclohexylcarbamic acid 3’-carbamoyl-5-hydroxybiphenyl-3-yl ester) as the most potent brain-impermeant FAAH inhibitor disclosed to date. PMID:23822179

  13. Effect of inhibitors of arachidonic acid metabolism on alpha-aminoisobutyric acid transport in human lymphocytes.

    PubMed

    Udey, M C; Parker, C W

    1982-02-01

    The role of arachidonic acid metabolism (or metabolites) in the modulation of alpha-aminoisobutyric acid transport in resting and concanavalin A-stimulated human peripheral blood lymphocytes was evaluated using previously characterized inhibitors of arachidonic acid metabolism. Nordihydroguairetic acid (a nonselective antioxidant), 5,8,11,14-eicosatetraynoic acid (an inhibitor of lipoxygenase and cyclooxygenase activities), indomethacin and acetylsalicylic acid (selective cyclooxygenase inhibitors), and 1-benzylimidazole, Ro-22-3581 and Ro-22-3582 (thromboxane synthetase inhibitors) proved to be potent inhibitors of amino acid transport activity in normal resting and lectin-activated lymphocytes at concentrations known to decrease thromboxane A2 production. The rank order of effectiveness of these various inhibitors compared favorably with their relative potencies as inhibitors of thromboxane B2 synthesis under the same conditions, as determined by radioimmunoassay. Inhibitory effects noted were not due to overt cytotoxicity and seemed to involve changes primarily in the Vmax and not the Km of the transport process. Drug-induced alterations in the magnitude of concanavalin A binding were not observed. These results suggest that the activity of amino acid transport systems can be influenced by certain arachidonic acid metabolites, probably thromboxanes, in both stimulated and unstimulated lymphocytes. In addition, these findings may provide a partial explanation for the observation that inhibitors of thromboxane formation prevent lymphocyte mitogenesis.

  14. An amphiphilic conjugate approach toward the design and synthesis of betulinic acid-polyphenol conjugates as inhibitors of the HIV-1 gp41 fusion core formation.

    PubMed

    Liu, Yan; Ke, Zhuofeng; Wu, Kwok Yiu; Liu, Shuwen; Chen, Wen-Hua; Jiang, Shibo; Jiang, Zhi-Hong

    2011-09-01

    Exploration of potent inhibitors of the HIV-1 gp41 fusion core formation is a promising strategy to discover small-molecule HIV-1 entry inhibitors for the treatment of HIV-1 infection. In this paper, a series of novel betulinic acid-polyphenol conjugates was designed, guided by molecular modeling of the binding of betulinic acid (BA) and phenolic galloyl/caffeoyl groups in the groove on the gp41 N-terminal heptad repeat (NHR) trimeric coiled coil. These conjugates were synthesized via conjugation of galloyl and caffeoyl groups with BA at the C-28 position. Their inhibitory activities of HIV gp41 six-helix bundle (6-HB) formation between the NHR peptide N36 and the C-terminal heptad repeat (CHR) peptide C34 were evaluated with size-exclusion HPLC. Conjugates bearing a galloyl group were found to exhibit four to sixfold higher inhibitory activities than that of parent compound BA, suggesting that they may be exploitable as HIV-1 fusion/entry inhibitors targeting gp41. The docking study on BA and its derivatives suggests that hydrophobic and hydrogen-bonding pockets exist in the groove of the gp41 NHR trimeric coiled coil and that a potent inhibitor should have amphiphilic structures to cooperatively interact with both pockets. This possibility was explored by incorporating both lipophilic and hydrophilic groups into the conjugates in a well-defined orientation to bind with both pockets in the gp41 NHR-trimer.

  15. Heterocyclics as corrosion inhibitors for acid media

    SciTech Connect

    Ajmal, M.; Khan, M.A.W.; Ahmad, S.; Quraishi, M.A.

    1996-12-01

    The available literature on the use of heterocyclic compounds as corrosion inhibitors in acid media has been reviewed. It has been noted that the workers in this field have either used sulfur or nitrogen containing heterocyclic compounds for studying inhibition action. The authors have synthesized compounds containing sulfur and nitrogen both in the same ring and studied their inhibition action in acid media. These compounds were found to be better inhibitors than those containing either atoms alone.

  16. 3D-QSAR-aided design, synthesis, in vitro and in vivo evaluation of dipeptidyl boronic acid proteasome inhibitors and mechanism studies.

    PubMed

    Lei, Meng; Feng, Huayun; Wang, Cheng; Li, Hailing; Shi, Jingmiao; Wang, Jia; Liu, Zhaogang; Chen, Shanshan; Hu, Shihe; Zhu, Yongqiang

    2016-06-01

    Proteasome had been clinically validated as an effective target for the treatment of cancers. Up to now, many structurally diverse proteasome inhibitors were discovered. And two of them were launched to treat multiple myeloma (MM) and mantle cell lymphoma (MCL). Based on our previous biological results of dipeptidyl boronic acid proteasome inhibitors, robust 3D-QSAR models were developed and structure-activity relationship (SAR) was summarized. Several structurally novel compounds were designed based on the theoretical models and finally synthesized. Biological results showed that compound 12e was as active as the standard bortezomib in enzymatic and cellular activities. In vivo pharmacokinetic profiles suggested compound 12e showed a long half-life, which indicated that it could be administered intravenously. Cell cycle analysis indicated that compound 12e inhibited cell cycle progression at the G2M stage. PMID:27117691

  17. Synthesis and Structure–Activity Relationships of N-(2-Oxo-3-oxetanyl)amides as N-Acylethanolamine-hydrolyzing Acid Amidase Inhibitors

    PubMed Central

    Solorzano, Carlos; Antonietti, Francesca; Duranti, Andrea; Tontini, Andrea; Rivara, Silvia; Lodola, Alessio; Vacondio, Federica; Tarzia, Giorgio; Piomelli, Daniele; Mor, Marco

    2010-01-01

    The fatty acid ethanolamides (FAEs) are a family of bioactive lipid mediators that include the endogenous agonist of peroxisome proliferator-activated receptor-α, palmitoylethanolamide (PEA). FAEs are hydrolyzed intracellularly by either fatty acid amide hydrolase or N-acylethanolamine-hydrolyzing acid amidase (NAAA). Selective inhibition of NAAA by (S)-N-(2-oxo-3-oxetanyl)-3-phenylpropionamide [(S)-OOPP, 7a] prevents PEA degradation in mouse leukocytes and attenuates responses to proinflammatory stimuli. Starting from the structure of 7a a series of β-lactones was prepared and tested on recombinant rat NAAA to explore structure-activity relationships (SARs) for this class of inhibitors and improve their in vitro potency. Following the hypothesis that these compounds inhibit NAAA by acylation of the catalytic cysteine, we identified several requirements for recognition at the active site and obtained new potent inhibitors. In particular, (S)-N-(2-oxo-3-oxetanyl)biphenyl-4-carboxamide (7h) was more potent than 7a at inhibiting recombinant rat NAAA activity (7a, IC50 = 420 nM; 7h, IC50 = 115 nM) in vitro and at reducing carrageenan-induced leukocyte infiltration in vivo. PMID:20604568

  18. Protein synthesis inhibitor from potato tuber

    SciTech Connect

    Romaen, R. )

    1989-04-01

    A protein fraction capable of inhibit in vitro protein synthesis was found in potato tubers in fresh and wounded tissue. Inhibitor activity from fresh tissue decays with wounding. Inhibition activity was detected absorbed to ribsomal fraction and cytosol of potato tuber tissue by a partially reconstituted in vitro system from potato tuber and wheat germ. Adsorbed ribosomal fraction was more suitable of purification. This fraction was washed from ribosomes with 0.3M KCl, concentrated with ammonium sulfate precipitation and purified through sephadex G100 and sephadex G-75 columns chromatography. After 61 fold purification adsorbed protein fraction can inhibit germination of maize, wheat and sesame seeds, as well as {sup 3}H-leucine incorporation into protein by imbibed maize embryos. Inhibition activity was lost by temperature, alkali and protease-K hydrolysis. Preliminar analysis could not show presence of reductor sugars. Physiological role of this inhibitor in relation to rest and active tissue remains to be studied.

  19. 5'-azido-N-1-naphthylphthalamic acid, a photolabile analog of the auxin transport inhibitor, N-1-naphthylphthalamic acid: synthesis and binding properties

    SciTech Connect

    Voet, J.G.; Howley, K.; Shumsky, J.S.

    1987-05-01

    The polar transport of the plant growth regulator, auxin (indole-3-acetic acid, IAAH), is thought to involve the participation of several proteins in the plasma membrane, including a specific, saturable, voltage independent H/sup +//IAA/sup -/ efflux carrier located preferentially at the basal end of each cell. Auxin transport is specifically inhibited by the herbicide, N-1-naphthylphthalamic acid (NPA), which binds specifically to a protein in the plasma membrane, thought to be either the IAA/sup -/ efflux carrier or an allosteric effector protein. They have synthesized and characterized a photolabile analog of NPA, 5'-azido-N-1-naphthylphthalamic acid (Az-NPA). This potential photoaffinity label for the NPA binding protein competes with /sup 3/H-NPA for binding sites on Curcurbita pepo L. (zucchini) stem cell membranes with K/sub j/ = 1.5 x 10/sup -7/ M. The K/sub i/ for NPA under these conditions is 2 x 10/sup -8/M, indicating that the affinity of Az-NPA for the membranes is only 7.5 fold lower than NPA. While the binding of 4.6 x 10/sup -6/ M Az-NPA to NPA binding sites is reversible in the dark, exposure to light results in a 30% loss in /sup 3/H-NPA binding ability. Pretreatment with 10/sup -4/ M NPA protects the membranes against photodestruction of /sup 3/H-NPA binding sites by Az-NPA, supporting the conclusion that Az-NPA destroys these sites by specific covalent attachment.

  20. Tools for Characterizing Bacterial Protein Synthesis Inhibitors

    PubMed Central

    Orelle, Cédric; Carlson, Skylar; Kaushal, Bindiya; Almutairi, Mashal M.; Liu, Haipeng; Ochabowicz, Anna; Quan, Selwyn; Pham, Van Cuong; Squires, Catherine L.; Murphy, Brian T.

    2013-01-01

    Many antibiotics inhibit the growth of sensitive bacteria by interfering with ribosome function. However, discovery of new protein synthesis inhibitors is curbed by the lack of facile techniques capable of readily identifying antibiotic target sites and modes of action. Furthermore, the frequent rediscovery of known antibiotic scaffolds, especially in natural product extracts, is time-consuming and expensive and diverts resources that could be used toward the isolation of novel lead molecules. In order to avoid these pitfalls and improve the process of dereplication of chemically complex extracts, we designed a two-pronged approach for the characterization of inhibitors of protein synthesis (ChIPS) that is suitable for the rapid identification of the site and mode of action on the bacterial ribosome. First, we engineered antibiotic-hypersensitive Escherichia coli strains that contain only one rRNA operon. These strains are used for the rapid isolation of resistance mutants in which rRNA mutations identify the site of the antibiotic action. Second, we show that patterns of drug-induced ribosome stalling on mRNA, monitored by primer extension, can be used to elucidate the mode of antibiotic action. These analyses can be performed within a few days and provide a rapid and efficient approach for identifying the site and mode of action of translation inhibitors targeting the bacterial ribosome. Both techniques were validated using a bacterial strain whose culture extract, composed of unknown metabolites, exhibited protein synthesis inhibitory activity; we were able to rapidly detect the presence of the antibiotic chloramphenicol. PMID:24041905

  1. Design, synthesis and biological evaluation of di-substituted cinnamic hydroxamic acids bearing urea/thiourea unit as potent histone deacetylase inhibitors.

    PubMed

    Ning, Chengqing; Bi, Yanjing; He, Yujun; Huang, WenYuan; Liu, Lifei; Li, Yi; Zhang, Sihan; Liu, Xiaoyu; Yu, Niefang

    2013-12-01

    A novel class of di-substituted cinnamic hydroxamic acid derivatives containing urea or thiourea unit was designed, synthesized and evaluated as HDAC inhibitors. All tested compounds demonstrated significant HDAC inhibitory activities and anti-proliferative effects against diverse human tumor cell lines. Among them, 7l exhibited most potent pan-HDAC inhibitory activity, with an IC50 value of 130 nM. It also showed strong cellular inhibition against diverse cell lines including HCT-116, MCF-7, MDB-MB-435 and NCI-460, with GI50 values of 0.35, 0.22, 0.51 and 0.48 μM, respectively.

  2. Synthesis of screening substrates for the directed evolution of sialic acid aldolase: towards tailored enzymes for the preparation of influenza A sialidase inhibitor analogues.

    PubMed

    Woodhall, Thomas; Williams, Gavin; Berry, Alan; Nelson, Adam

    2005-05-01

    The stereoselective synthesis of two epimeric screening substrates, (4R, 5R, 6R)- and (4S, 5R, 6R)-6-dipropylcarbamoyl-2-oxo-4,5,6-trihydroxy-hexanoic acid, for the directed evolution of sialic acid aldolase is described. The complementary methods relied on stereoselective indium-mediated additions of ethyl alpha-bromomethyl acrylate to functionalised aldehydes. With an alpha-hydroxy aldehyde, (2R, 3R)-2,3-dihydroxy-4-oxo butanoic acid dipropylamide, the addition was chelation controlled, and the syn product, (6R, 5R, 4S)-6-dipropylcarbamoyl-2-methylidene-4,5,6-trihydroxy-hexanoic acid ethyl ester, was obtained. In contrast, the stereochemical outcome of the addition to (2R, 3R)-N,N-dipropyl-2,3-O-isopropylidene-4-oxobutyramide was consistent with Felkin-Anh control, and the anti adduct, (4R, 5R, 6R)-6-dipropylcarbamoyl-2-methylidene-4-hydroxy-5,6-O-isopropylidene-hexanoic acid ethyl ester, was the major product. Ozonolysis and deprotection gave the screening substrates as mixtures of furanose and pyranose forms, in good yields.

  3. Hypolipidemic drugs are inhibitors of phosphatidylcholine synthesis.

    PubMed Central

    Parthasarathy, S; Kritchevsky, D; Baumann, W J

    1982-01-01

    Clofibric acid (CPIB) and several other systemic hypolipidemic drugs are shown to block phosphatidylcholine synthesis by inhibiting cholinephosphotransferase (ChoPTase; CDPcholine:1,2-diacylglycerol cholinephosphotransferase, EC 2.7.8.2) and particularly lysolecithin acyltransferase (LLAcylTase; acyl-CoA:1-acylglycero-3-phosphocholine O-acyltransferase, EC 2.3.1.23) of rat liver microsomes. Whereas millimolar drug concentrations are required to affect de novo lecithin synthesis catalyzed by ChoPTase, reacylation of lysolecithin by LLAcylTase is inhibited at micromolar levels. Increasing effectiveness in ChoPTase inhibition is observed in the series CPIB, SaH-42-348, tibric acid, S-321328, WY-14643, S-8527, and DH-990, with IC50 ranging from 22 mM (CPIB) to 0.3 mM (DH-990). LLAcylTase inhibition by the hypolipidemic drugs follows the same general pattern, but IC50 concentrations range from 9 mM (CPIB) to 40 microM (DH-990). The agents inhibit ChoPTase (Ki, 25-0.25 mM) and LLAcylTase (Ki, 10-0.025 mM) noncompetitively. The data suggest that inhibition of phosphatidylcholine synthesis, particularly by the LLAcylTase pathway, may be related to a drug's effectiveness in decreasing serum triglyceride and cholesterol levels by blocking lipoprotein synthesis. PMID:6294663

  4. Discovery of potent wall teichoic acid early stage inhibitors.

    PubMed

    Labroli, Marc A; Caldwell, John P; Yang, Christine; Lee, Sang Ho; Wang, Hao; Koseoglu, Sandra; Mann, Paul; Yang, Shu-Wei; Xiao, Jing; Garlisi, Charles G; Tan, Christopher; Roemer, Terry; Su, Jing

    2016-08-15

    The widespread emergence of methicillin-resistant Staphylococcus aureus (MRSA) has dramatically eroded the efficacy of current β-lactam antibiotics and created an urgent need for novel treatment options. Using an S. aureus phenotypic screening strategy, we have identified small molecule early stage wall teichoic acid (WTA) pathway-specific inhibitors predicted to be chemically synergistic with β-lactams. These previously disclosed inhibitors, termed tarocins, demonstrate by genetic and biochemical means inhibition of TarO, the first step in WTA biosynthesis. Tarocins demonstrate potent bactericidal synergy in combination with broad spectrum β-lactam antibiotics across diverse clinical isolates of methicillin-resistant Staphylococci. The synthesis and structure-activity relationships (SAR) of a tarocin series will be detailed. Tarocins and other WTA inhibitors may provide a rational strategy to develop Gram-positive bactericidal β-lactam combination agents active against methicillin-resistant Staphylococci. PMID:27436582

  5. Design, synthesis and biological evaluation of novel L-ascorbic acid-conjugated pentacyclic triterpene derivatives as potential influenza virus entry inhibitors.

    PubMed

    Wang, Han; Xu, Renyang; Shi, Yongying; Si, Longlong; Jiao, Pingxuan; Fan, Zibo; Han, Xu; Wu, Xingyu; Zhou, Xiaoshu; Yu, Fei; Zhang, Yongmin; Zhang, Liangren; Zhang, Lihe; Zhou, Demin; Xiao, Sulong

    2016-03-01

    Since the influenza viruses can rapidly evolve, it is urgently required to develop novel anti-influenza agents possessing a novel mechanism of action. In our previous study, two pentacyclic triterpene derivatives (Q8 and Y3) have been found to have anti-influenza virus entry activities. Keeping the potential synergy of biological activity of pentacyclic triterpenes and l-ascorbic acid in mind, we synthesized a series of novel l-ascorbic acid-conjugated pentacyclic triterpene derivatives (18-26, 29-31, 35-40 and 42-43). Moreover, we evaluated these novel compounds for their anti-influenza activities against A/WSN/33 virus in MDCK cells. Among all evaluated compounds, the 2,3-O,O-dibenzyl-6-deoxy-l-ascorbic acid-betulinic acid conjugate (30) showed the most significant anti-influenza activity with an EC50 of 8.7 μM, and no cytotoxic effects on MDCK cells were observed. Time-of-addition assay indicated that compound 30 acted at an early stage of the influenza life cycle. Further analyses revealed that influenza virus-induced hemagglutination of chicken red blood cells was inhibited by treatment of compound 30, and the interaction between the influenza hemagglutinin (HA) and compound 30 was determined by surface plasmon resonance (SPR) with a dissociation constant of KD = 3.76 μM. Finally, silico docking studies indicated that compound 30 and its derivative 31 were able to occupy the binding pocket of HA for sialic acid receptor. Collectively, these results suggested that l-ascorbic acid-conjugated pentacyclic triterpenes were promising anti-influenza entry inhibitors, and HA protein associated with viral entry was a promising drug target. PMID:26866456

  6. Design, synthesis and biological evaluation of novel L-ascorbic acid-conjugated pentacyclic triterpene derivatives as potential influenza virus entry inhibitors.

    PubMed

    Wang, Han; Xu, Renyang; Shi, Yongying; Si, Longlong; Jiao, Pingxuan; Fan, Zibo; Han, Xu; Wu, Xingyu; Zhou, Xiaoshu; Yu, Fei; Zhang, Yongmin; Zhang, Liangren; Zhang, Lihe; Zhou, Demin; Xiao, Sulong

    2016-03-01

    Since the influenza viruses can rapidly evolve, it is urgently required to develop novel anti-influenza agents possessing a novel mechanism of action. In our previous study, two pentacyclic triterpene derivatives (Q8 and Y3) have been found to have anti-influenza virus entry activities. Keeping the potential synergy of biological activity of pentacyclic triterpenes and l-ascorbic acid in mind, we synthesized a series of novel l-ascorbic acid-conjugated pentacyclic triterpene derivatives (18-26, 29-31, 35-40 and 42-43). Moreover, we evaluated these novel compounds for their anti-influenza activities against A/WSN/33 virus in MDCK cells. Among all evaluated compounds, the 2,3-O,O-dibenzyl-6-deoxy-l-ascorbic acid-betulinic acid conjugate (30) showed the most significant anti-influenza activity with an EC50 of 8.7 μM, and no cytotoxic effects on MDCK cells were observed. Time-of-addition assay indicated that compound 30 acted at an early stage of the influenza life cycle. Further analyses revealed that influenza virus-induced hemagglutination of chicken red blood cells was inhibited by treatment of compound 30, and the interaction between the influenza hemagglutinin (HA) and compound 30 was determined by surface plasmon resonance (SPR) with a dissociation constant of KD = 3.76 μM. Finally, silico docking studies indicated that compound 30 and its derivative 31 were able to occupy the binding pocket of HA for sialic acid receptor. Collectively, these results suggested that l-ascorbic acid-conjugated pentacyclic triterpenes were promising anti-influenza entry inhibitors, and HA protein associated with viral entry was a promising drug target.

  7. Synthesis and biological activities of novel 5-substituted-1,3,4-oxadiazole Mannich bases and bis-Mannich bases as ketol-acid reductoisomerase inhibitors.

    PubMed

    Zhang, Yan; Liu, Xing-Hai; Zhan, Yi-Zhou; Zhang, Li-Yuan; Li, Zheng-Ming; Li, Yong-Hong; Zhang, Xiao; Wang, Bao-Lei

    2016-10-01

    A series of novel 5-substituted-1,3,4-oxadiazole Mannich bases and bis-Mannich bases have been conveniently synthesized in good yields. Their structures were characterized by IR, (1)H NMR, (13)C NMR and elemental analysis. The preliminary bioassay results indicated that some of the compounds showed promising in vitro fungicidal activities towards several test plant fungi; some of them exhibited significant herbicidal activities against Brassica campestris and excellent in vitro inhibitory activities against rice ketol-acid reductoisomerase (KARI). Among 14 novel compounds, 8c, 8d and 8m showed potent KARI inhibitory activities with Ki value of (0.96±0.42), (3.86±0.49) and (3.10±0.71) μmol/L, respectively, and were comparable with IpOHA. These compounds could be novel KARI inhibitors for further investigation. The density functional theory (DFT) calculations and molecular docking were carried out to study the structure-activity relationship (SAR) of the active inhibitors in this Letter. PMID:27575481

  8. Design, Synthesis, and Crystal Structures of 6-Alkylidene-2 -Substituted Penicillanic Acid Sulfones as Potent Inhibitors of Acinetobacter baumannii OXA-24 Carbapenemase

    SciTech Connect

    Bou, G.; Santillana, E; Sheri, A; Beceiro, A; Sampson, J; Kalp, M; Bethel, C; Distler, A; Drawz, S; et. al.

    2010-01-01

    Class D {beta}-lactamases represent a growing and diverse class of penicillin-inactivating enzymes that are usually resistant to commercial {beta}-lactamase inhibitors. As many such enzymes are found in multi-drug resistant (MDR) Acinetobacter baumannii and Pseudomonas aeruginosa, novel {beta}-lactamase inhibitors are urgently needed. Five unique 6-alkylidene-2{prime}-substituted penicillanic acid sulfones (1-5) were synthesized and tested against OXA-24, a clinically important {beta}-lactamase that inactivates carbapenems and is found in A. baumannii. Based upon the roles Tyr112 and Met223 play in the OXA-24 {beta}-lactamase, we also engineered two variants (Tyr112Ala and Tyr112Ala,Met223Ala) to test the hypothesis that the hydrophobic tunnel formed by these residues influences inhibitor recognition. IC{sub 50} values against OXA-24 and two OXA-24 {beta}-lactamase variants ranged from 10 {+-} 1 (4 vs WT) to 338 {+-} 20 nM (5 vs Tyr112Ala, Met223Ala). Compound 4 possessed the lowest K{sub i} (500 {+-} 80 nM vs WT), and 1 possessed the highest inactivation efficiency (k{sub inact}/K{sub i} = 0.21 {+-} 0.02 {micro}M{sup -1}s{sup -1}). Electrospray ionization mass spectrometry revealed a single covalent adduct, suggesting the formation of an acyl-enzyme intermediate. X-ray structures of OXA-24 complexed to four inhibitors (2.0-2.6 {angstrom}) reveal the formation of stable bicyclic aromatic intermediates with their carbonyl oxygen in the oxyanion hole. These data provide the first structural evidence that 6-alkylidene-2{prime}-substituted penicillin sulfones are effective mechanism-based inactivators of class D {beta}-lactamases. Their unique chemistry makes them developmental candidates. Mechanisms for class D hydrolysis and inhibition are discussed, and a pathway for the evolution of the BlaR1 sensor of Staphylococcus aureus to the class D {beta}-lactamases is proposed.

  9. Hydrazides of carboxylic acids as inhibitors of steel acidic corrosion

    SciTech Connect

    Aitov, R.G.; Shein, A.B.; Lesnov, A.E.

    1994-09-01

    Hydrazides of carboxylic acids (HCA) inhibit the corrosion of ferrous materials in acids and netral solutions such as stratum and waste waters of oil deposits. In this work, the authors try to explain the above-mentioned difference and to consider HCA as inhibitors of steel hydrogenation.

  10. Synthesis, molecular modeling and biological evaluation of novel 2-allyl amino 4-methyl sulfanyl butyric acid as α-amylase and α-glucosidase inhibitor

    NASA Astrophysics Data System (ADS)

    Balan, Kannan; Perumal, Perumal; Sundarabaalaji, Narayanan; Palvannan, Thayumanavan

    2015-02-01

    In the present study 2-allyl amino 4-methyl sulfanyl butyric acid (AMSB) was synthesized in good yield. AMSB was characterized by Fourier transforms infrared spectroscopy (FTIR), Nuclear magnetic resonance (NMR) (1H and 13C) and Liquid chromatography mass spectrometry (LCMS). The radical scavenging activity and reducing power assay of AMSB was assessed using 1-1-diphenyl 2-picryl hydrazyl (DPPH), 2,2‧-azino-bis (3-ethyl benzothiazoline-6-sulfonic acid) (ABTS) and ferric ion reducing antioxidant power assay (FRAP) and was found to be 44.1, 34.71 and 41.7 μg/ml respectively. The compound showed effective inhibition against α-amylase and α-glucosidase. AMSB was identified to be a reversible mixed noncompetitive inhibitor of α-amylase and α-glucosidase. The molecular docking study was carried out to evaluate the specific groove binding properties and affords valuable information of AMSB binding mode in the active site of α-glucosidase the study may lead to the which leads to the rational design of new class of antidiabetic drugs targeting α-glucosidase based on AMSB in near future.

  11. Penicillin inhibitors of purple acid phosphatase.

    PubMed

    Faridoon; Hussein, Waleed M; Ul Islam, Nazar; Guddat, Luke W; Schenk, Gerhard; McGeary, Ross P

    2012-04-01

    Purple acid phosphatases (PAPs) are binuclear metallohydrolases that have a multitude of biological functions and are found in fungi, bacteria, plants and animals. In mammals, PAP activity is linked with bone resorption and over-expression can lead to bone disorders such as osteoporosis. PAP is therefore an attractive target for the development of drugs to treat this disease. A series of penicillin conjugates, in which 6-aminopenicillanic acid was acylated with aromatic acid chlorides, has been prepared and assayed against pig PAP. The binding mode of most of these conjugates is purely competitive, and some members of this class have potencies comparable to the best PAP inhibitors yet reported. The structurally related penicillin G was shown to be neither an inhibitor nor a substrate for pig PAP. Molecular modelling has been used to examine the binding modes of these compounds in the active site of the enzyme and to rationalise their activities.

  12. Probing for improved potency and in vivo bioavailability of excitatory amino acid transporter subtype 1 inhibitors UCPH-101 and UCPH-102: design, synthesis and pharmacological evaluation of substituted 7-biphenyl analogs.

    PubMed

    Erichsen, Mette N; Hansen, Jeanette; Ruiz, Josep A; Demmer, Charles S; Abrahamsen, Bjarke; Bastlund, Jesper F; Bundgaard, Christoffer; Jensen, Anders A; Bunch, Lennart

    2014-10-01

    Uptake of the major excitatory neurotransmitter in the CNS, (S)-glutamate, is mediated by a family of excitatory amino acid transporters (EAAT). Previously we have explored the structure-activity relationship (SAR) of a series of EAAT1 selective inhibitors, leading to the development of the potent inhibitors UCPH-101 and UCPH-102. In the present study, we set out to improve the solubility properties of these EAAT1 inhibitors with the objective to develop analogs more suited as pharmacological tools for in vivo studies of EAAT1 in terms of their bioavailability. A total of 23 novel UCPH-101/102 analogs were designed, synthesized and characterized pharmacologically at EAAT1-3 in a [(3)H]-D-aspartate uptake assay. Most notably, the potent EAAT1 inhibition displayed of UCPH-101 and UCPH-102 was retained in analog 1d in which the napht-1-yl group in the 7-position of UCPH-102 has been replaced by an o-biphenyl moiety. In contrast, EAAT1 activity was dramatically compromised in analogs 1e and 1f comprising m- and p-biphenyl groups as 7-substituents, respectively. Analog 1d displayed low bioavailability after oral administration in rats, and this problem was addressed by the synthesis of a series of analogs with different chloro, fluoro, methoxy, triflouromethyl and carboxy substitution patterns at the o-biphenyl group of 1d (1h-1s) and m- and p-pyridine analogs of 1d (1t and 1v). Unfortunately, all of the modifications resulted in substantial decreased EAAT1 inhibitory activity, which supports the notion of a very lipophilic binding pocket in EAAT1 for the aromatic 7-substituent in these ligands. In conclusion, while we have not succeeded in developing UCPH-101/102 analogs possessing improved bioavailability properties, this study does offer interesting SAR information about this inhibitor class, and analog 1d seems to be an interesting lead for future SAR studies with focus on the development of more potent EAAT1 inhibitors. PMID:24682739

  13. HCV NS5b RNA-dependent RNA polymerase inhibitors: from alpha,gamma-diketoacids to 4,5-dihydroxypyrimidine- or 3-methyl-5-hydroxypyrimidinonecarboxylic acids. Design and synthesis.

    PubMed

    Summa, Vincenzo; Petrocchi, Alessia; Matassa, Victor G; Taliani, Marina; Laufer, Ralph; De Francesco, Raffaele; Altamura, Sergio; Pace, Paola

    2004-10-21

    A new class of the HCV NS5b RNA-dependent RNA polymerase inhibitors, the dihyroxypyrimidinecarboxylic acid derivative, was designed from a diketoacid and meconic acid derivative discovered by screening. Mechanism of action and essential moieties required for activity were identified. The corresponding N-methylpyrimidinone was also prepared; both classes are novel, reversible, and selective inhibitors of the HCV NS5b polymerase with improved druglike characteristics.

  14. Soraphen A, an inhibitor of acetyl CoA carboxylase activity, interferes with fatty acid elongation

    PubMed Central

    Jump, Donald B.; Torres-Gonzalez, Moises; Olson, L. Karl

    2010-01-01

    Acetyl CoA carboxylase (ACC1 & ACC2) generates malonyl CoA, a substrate for de novo lipogenesis (DNL) and an inhibitor of mitochondrial fatty acid β-oxidation (FAO). Malonyl CoA is also a substrate for microsomal fatty acid elongation, an important pathway for saturated (SFA), mono- (MUFA) and polyunsaturated fatty acid (PUFA) synthesis. Despite the interest in ACC as a target for obesity and cancer therapy, little attention has been given to the role ACC plays in long chain fatty acid synthesis. This report examines the effect of pharmacological inhibition of ACC on DNL & palmitate (16:0) and linoleate (18:2,n-6) metabolism in HepG2 and LnCap cells. The ACC inhibitor, soraphen A, lowers cellular malonyl CoA, attenuates DNL and the formation of fatty acid elongation products derived from exogenous fatty acids, i.e., 16:0 & 18:2,n-6; IC50 ~ 5 nM. Elevated expression of fatty acid elongases (Elovl5, Elovl6) or desaturases (FADS1, FADS2) failed to override the soraphen A effect on SFA, MUFA or PUFA synthesis. Inhibition of fatty acid elongation leads to the accumulation of 16- and 18-carbon unsaturated fatty acids derived from 16:0 and 18:2,n-6, respectively. Pharmacological inhibition of ACC activity will not only attenuate DNL and induce FAO, but will also attenuate the synthesis of very long chain saturated, mono- and polyunsaturated fatty acids. PMID:21184748

  15. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  16. 2-Aminoimidazole Amino Acids as Inhibitors of the Binuclear Manganese Metalloenzyme Human Arginase I

    SciTech Connect

    Ilies, M.; Di Costanzo, L; North, M; Scott, J; Christianson, D

    2010-01-01

    Arginase, a key metalloenzyme of the urea cycle that converts L-arginine into L-ornithine and urea, is presently considered a pharmaceutical target for the management of diseases associated with aberrant L-arginine homeostasis, such as asthma, cardiovascular diseases, and erectile dysfunction. We now report the design, synthesis, and evaluation of a series of 2-aminoimidazole amino acid inhibitors in which the 2-aminoimidazole moiety serves as a guanidine mimetic. These compounds represent a new class of arginase inhibitors. The most potent inhibitor identified in this study, 2-(S)-amino-5-(2-aminoimidazol-1-yl)pentanoic acid (A1P, 10), binds to human arginase I with K{sub d} = 2 {micro}M and significantly attenuates airways hyperresponsiveness in a murine model of allergic airways inflammation. These findings suggest that 2-aminoimidazole amino acids represent new leads for the development of arginase inhibitors with promising pharmacological profiles.

  17. Asparagine Synthesis in Pea Leaves, and the Occurrence of an Asparagine Synthetase Inhibitor 1

    PubMed Central

    Joy, Kenneth W.; Ireland, Robert J.; Lea, Peter J.

    1983-01-01

    Asparagine is present in the mature leaves of young pea (Pisum sativum cv Little Marvel) seedlings, and is synthesized in detached shoots. This accumulation and synthesis is greatly enhanced by darkening. In detached control shoots, [14C]aspartate was metabolized predominantly to organic acids and, as other workers have shown, there was little labeling of asparagine (after 5 hours, 3.1% of metabolized label). Addition of the aminotransferase inhibitor aminooxyacetate decreased the flow of aspartate carbon to organic acids and enhanced (about 3-fold) the labeling of asparagine. The same treatment applied to darkened shoots resulted in a substantial conversion of [14C]aspartate to asparagine, over 10-fold greater than in control shoots (66% of metabolized label), suggesting that aspartate is the normal precursor of asparagine. Only traces of glutamine-dependent asparagine synthetase activity could be detected in pea leaf or root extracts; activity was not enhanced by sulfhydryl reagents, oxidizing conditions, or protease inhibitors. Asparagine synthetase is readily extracted from lupin cotyledons, but yield was greatly reduced by extraction in the presence of pea leaf tissue; pea leaf homogenates contained an inhibitor which produced over 95% inhibition of an asparagine synthetase preparation from lupin cotyledons. The inhibitor was heat stable, with a low molecular weight. Presence of an inhibitor may prevent detection of asparagine synthetase in pea extracts and in Asparagus, where a cyanide-dependent pathway has been proposed to account for asparagine synthesis: an inhibitor with similar properties was present in Asparagus shoot tissue. PMID:16663168

  18. Novel inhibitors of fatty acid amide hydrolase.

    PubMed

    Sit, S Y; Conway, Charlie; Bertekap, Robert; Xie, Kai; Bourin, Clotilde; Burris, Kevin; Deng, Hongfeng

    2007-06-15

    A class of bisarylimidazole derivatives are identified as potent inhibitors of the enzyme fatty acid amide hydrolase (FAAH). Compound 17 (IC(50)=2 nM) dose-dependently (0.1-10mg/kg, iv) potentiates the effects of exogenous anandamide (1 mg/kg, iv) in a rat thermal escape test (Hargreaves test), and shows robust antinociceptive activity in animal models of persistent (formalin test) and neuropathic (Chung model) pain. Compound 17 (20 mg/kg, iv) demonstrates activity in the formalin test that is comparable to morphine (3mg/kg, iv), and is dose-dependently inhibited by the CB1 antagonist SR141716A. In the Chung model, compound 17 shows antineuropathic effects similar to high-dose (100 mg/kg) gabapentin. FAAH inhibition shows potential utility for the clinical treatment of persistent and neuropathic pain.

  19. Development of Inhibitors of Salicylic Acid Signaling.

    PubMed

    Jiang, Kai; Kurimoto, Tetsuya; Seo, Eun-kyung; Miyazaki, Sho; Nakajima, Masatoshi; Nakamura, Hidemitsu; Asami, Tadao

    2015-08-19

    Salicylic acid (SA) plays important roles in the induction of systemic acquired resistance (SAR) in plants. Determining the mechanism of SAR will extend our understanding of plant defenses against pathogens. We recently reported that PAMD is an inhibitor of SA signaling, which suppresses the expression of the pathogenesis-related PR genes and is expected to facilitate the understanding of SA signaling. However, PAMD strongly inhibits plant growth. To minimize the side effects of PAMD, we synthesized a number of PAMD derivatives, and identified compound 4 that strongly suppresses the expression of the PR genes with fewer adverse effects on plant growth than PAMD. We further showed that the adverse effects on plant growth were partially caused the stabilization of DELLA, which is also related to the pathogen responses. These results indicate that compound 4 would facilitate our understanding of SA signaling and its cross talk with other plant hormones.

  20. Synthesis and biological evaluation of ring A and/or C expansion and opening echinocystic acid derivatives for anti-HCV entry inhibitors.

    PubMed

    Wang, Han; Yu, Fei; Peng, Yiyun; Wang, Qi; Han, Xu; Xu, Renyang; Zhou, Xiaoshu; Wan, Chuanxing; Fan, Zibo; Jiao, Pingxuan; Zhang, Yongmin; Zhang, Lihe; Zhou, Demin; Xiao, Sulong

    2015-09-18

    Echinocystic acid (EA), a naturally occurring oleanane-type triterpene isolated from Dipsacus asperoides, was found to have anti-HCV entry activity in our previous study. Expansion of triterpene structural diversity, including the ring A and/or C expansion and opening, was performed. To elucidate the pharmacophore of EA, seven lactones (8, 16, 17, 24, 26, 35 and 41), three 3,28-dioic acids (9, 36 and 42) and two pentols (10 and 27) were synthesized. The anti-HCV entry activities of those derivatives, along with their parental compound EA and analogs α,β-unsaturated ketone (18), were evaluated. All the products showed no improvement but detrimental effect on potency of EA. The results demonstrated that ring A and C of EA are highly conserved, indicating the steric effects of the rigid skeleton have a profound effect on the potency. PMID:26318066

  1. Synthesis and biological evaluation of ring A and/or C expansion and opening echinocystic acid derivatives for anti-HCV entry inhibitors.

    PubMed

    Wang, Han; Yu, Fei; Peng, Yiyun; Wang, Qi; Han, Xu; Xu, Renyang; Zhou, Xiaoshu; Wan, Chuanxing; Fan, Zibo; Jiao, Pingxuan; Zhang, Yongmin; Zhang, Lihe; Zhou, Demin; Xiao, Sulong

    2015-09-18

    Echinocystic acid (EA), a naturally occurring oleanane-type triterpene isolated from Dipsacus asperoides, was found to have anti-HCV entry activity in our previous study. Expansion of triterpene structural diversity, including the ring A and/or C expansion and opening, was performed. To elucidate the pharmacophore of EA, seven lactones (8, 16, 17, 24, 26, 35 and 41), three 3,28-dioic acids (9, 36 and 42) and two pentols (10 and 27) were synthesized. The anti-HCV entry activities of those derivatives, along with their parental compound EA and analogs α,β-unsaturated ketone (18), were evaluated. All the products showed no improvement but detrimental effect on potency of EA. The results demonstrated that ring A and C of EA are highly conserved, indicating the steric effects of the rigid skeleton have a profound effect on the potency.

  2. Synthesis and Assays of Inhibitors of Methyltransferases.

    PubMed

    Cai, X-C; Kapilashrami, K; Luo, M

    2016-01-01

    Epigenetic regulation requires site-specific modification of the genome and is involved in multiple physiological processes and disease etiology. Methyltransferases, which catalyze the transfer of a methyl group from S-adenosyl-l-methionine (SAM) to various substrates, are critical components of the epigenetic machinery. This group of enzymes can methylate diverse substrates including DNA, RNA, proteins, and small-molecule metabolites. Their dysregulation has also been implicated in multiple disease states such as cancer, neurological, and cardiovascular disorders. Developing potent and selective small-molecule inhibitors of methyltransferases is valuable not only for therapeutic intervention but also for investigating the roles of these enzymes in disease progression. In this chapter, we will discuss the strategies of designing and synthesizing methyltransferases inhibitors based on the SAM scaffold. Following the section of inhibitor design, we will briefly review representative assays that are available to evaluate the potency of these inhibitors along with a detailed description of the most commonly used radiometric assay. PMID:27423865

  3. Synthesis, biological characterization and molecular modeling insights of spirochromanes as potent HDAC inhibitors.

    PubMed

    Thaler, Florian; Moretti, Loris; Amici, Raffaella; Abate, Agnese; Colombo, Andrea; Carenzi, Giacomo; Fulco, Maria Carmela; Boggio, Roberto; Dondio, Giulio; Gagliardi, Stefania; Minucci, Saverio; Sartori, Luca; Varasi, Mario; Mercurio, Ciro

    2016-01-27

    In the last decades, inhibitors of histone deacetylases (HDAC) have become an important class of anti-cancer agents. In a previous study we described the synthesis of spiro[chromane-2,4'-piperidine]hydroxamic acid derivatives able to inhibit histone deacetylase enzymes. Herein, we present our exploration for new derivatives by replacing the piperidine moiety with various cycloamines. The goal was to obtain highly potent compounds with a good in vitro ADME profile. In addition, molecular modeling studies unravelled the binding mode of these inhibitors.

  4. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  5. Diversity-Oriented Synthesis for Novel, Selective and Drug-like Inhibitors for a Phosphatase from Mycobacterium Tuberculosis

    PubMed Central

    He, Rongjun; Bai, Yunpeng; Yu, Zhi-Hong; Wu, Li; Gunawan, Andrea Michelle; Zhang, Zhong-Yin

    2014-01-01

    Mycobacterium protein tyrosine phosphatase B (mPTPB) is a potential drug target of Tuberculosis (TB). Small molecule inhibitors of mPTPB could be a treatment to overcome emerging TB drug resistance. Using a Diversity-Oriented Synthesis (DOS) strategy, we successfully developed a salicylic acid based and drug-like mPTPB inhibitor with an IC50 of 2 μM and >20-fold specificity over many human PTPs, making it an excellent lead molecule for anti-TB drug discovery. In addition, DOS generated bicyclic salicylic acids are also promising starting points for acquiring inhibitors targeting other PTPs. PMID:25505942

  6. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  7. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  8. A Microplate-Based Nonradioactive Protein Synthesis Assay: Application to TRAIL Sensitization by Protein Synthesis Inhibitors

    PubMed Central

    Henrich, Curtis J.

    2016-01-01

    Non-radioactive assays based on incorporation of puromycin into newly synthesized proteins and subsequent detection using anti-puromycin antibodies have been previously reported and well-validated. To develop a moderate- to high-throughput assay, an adaptation is here described wherein cells are puromycin-labeled followed by simultaneously probing puromycin-labeled proteins and a reference protein in situ. Detection using a pair of near IR-labeled secondary antibodies (InCell western, ICW format) allows quantitative analysis of protein synthesis in 384-well plates. After optimization, ICW results were compared to western blot analysis using cycloheximide as a model protein synthesis inhibitor and showed comparable results. The method was then applied to several protein synthesis inhibitors and revealed good correlation between potency as protein synthesis inhibitors to their ability to sensitize TRAIL-resistant renal carcinoma cells to TRAIL-induced apoptosis. PMID:27768779

  9. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  10. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  11. Total synthesis of thapsigargin, a potent SERCA pump inhibitor.

    PubMed

    Ball, Matthew; Andrews, Stephen P; Wierschem, Frank; Cleator, Ed; Smith, Martin D; Ley, Steven V

    2007-02-15

    The enantioselective total synthesis of thapsigargin, a potent, selective inhibitor of the Ca2+ pump SERCA, is described. Starting from ketoalcohol 8, key steps involve regioselective introduction of the internal olefin at C4-C5, judicious protecting group choice to allow chelation-controlled reduction at C3, and chemoselective introduction of the angelate ester function at C3-O. A selective esterification approach completes the total synthesis in a total of 42 steps and 0.61% overall yield (88.6% average yield per step). [reaction: see text].

  12. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  13. Synthesis of the Pitstop family of clathrin inhibitors.

    PubMed

    Robertson, Mark J; Deane, Fiona M; Stahlschmidt, Wiebke; von Kleist, Lisa; Haucke, Volker; Robinson, Phillip J; McCluskey, Adam

    2014-07-01

    This protocol describes the synthesis of two classes of clathrin inhibitors, Pitstop 1 and Pitstop 2, along with two inactive analogs that can be used as negative controls (Pitstop inactive controls, Pitnot-2 and Pitnot-2-100). Pitstop-induced inhibition of clathrin TD function acutely interferes with clathrin-mediated endocytosis (CME), synaptic vesicle recycling and cellular entry of HIV, whereas clathrin-independent internalization pathways and secretory traffic proceed unperturbed; these reagents can, therefore, be used to investigate clathrin function, and they have potential pharmacological applications. Pitstop 1 is synthesized in two steps: sulfonation of 1,8-naphthalic anhydride and subsequent reaction with 4-amino(methyl)aniline. Pitnot-1 results from the reaction of 4-amino(methyl)aniline with commercially available 4-sulfo-1,8-naphthalic anhydride potassium salt. Reaction of 1-naphthalene sulfonyl chloride with pseudothiohydantoin followed by condensation with 4-bromobenzaldehyde yields Pitstop 2. The synthesis of the inactive control commences with the condensation of 4-bromobenzaldehyde with the rhodanine core. Thioketone methylation and displacement with 1-napthylamine affords the target compound. Although Pitstop 1-series compounds are not cell permeable, they can be used in biochemical assays or be introduced into cells via microinjection. The Pitstop 2-series compounds are cell permeable. The synthesis of these compounds does not require specialist equipment and can be completed in 3-4 d. Microwave irradiation can be used to reduce the synthesis time. The synthesis of the Pitstop 2 family is easily adaptable to enable the synthesis of related compounds such as Pitstop 2-100 and Pitnot-2-100. The procedures are also simple, efficient and amenable to scale-up, enabling cost-effective in-house synthesis for users of these inhibitor classes. PMID:24922269

  14. Synthesis of the Pitstop family of clathrin inhibitors.

    PubMed

    Robertson, Mark J; Deane, Fiona M; Stahlschmidt, Wiebke; von Kleist, Lisa; Haucke, Volker; Robinson, Phillip J; McCluskey, Adam

    2014-07-01

    This protocol describes the synthesis of two classes of clathrin inhibitors, Pitstop 1 and Pitstop 2, along with two inactive analogs that can be used as negative controls (Pitstop inactive controls, Pitnot-2 and Pitnot-2-100). Pitstop-induced inhibition of clathrin TD function acutely interferes with clathrin-mediated endocytosis (CME), synaptic vesicle recycling and cellular entry of HIV, whereas clathrin-independent internalization pathways and secretory traffic proceed unperturbed; these reagents can, therefore, be used to investigate clathrin function, and they have potential pharmacological applications. Pitstop 1 is synthesized in two steps: sulfonation of 1,8-naphthalic anhydride and subsequent reaction with 4-amino(methyl)aniline. Pitnot-1 results from the reaction of 4-amino(methyl)aniline with commercially available 4-sulfo-1,8-naphthalic anhydride potassium salt. Reaction of 1-naphthalene sulfonyl chloride with pseudothiohydantoin followed by condensation with 4-bromobenzaldehyde yields Pitstop 2. The synthesis of the inactive control commences with the condensation of 4-bromobenzaldehyde with the rhodanine core. Thioketone methylation and displacement with 1-napthylamine affords the target compound. Although Pitstop 1-series compounds are not cell permeable, they can be used in biochemical assays or be introduced into cells via microinjection. The Pitstop 2-series compounds are cell permeable. The synthesis of these compounds does not require specialist equipment and can be completed in 3-4 d. Microwave irradiation can be used to reduce the synthesis time. The synthesis of the Pitstop 2 family is easily adaptable to enable the synthesis of related compounds such as Pitstop 2-100 and Pitnot-2-100. The procedures are also simple, efficient and amenable to scale-up, enabling cost-effective in-house synthesis for users of these inhibitor classes.

  15. [Effect of prostaglandin synthesis inhibitors of diabetic cystoid macular edema].

    PubMed

    Kieselbach, G; Juen, S

    1990-01-01

    In most cases, diabetic macular edema is treated successfully with central laser photocoagulation. However, only few studies report such favorable results in cystoid macular edema, which has a poor visual prognosis. In the present prospective study on diabetics with cystoid macular edema, aged less than 40 years, a better visual outcome was obtained in patients treated with prostaglandin synthesis inhibitors than in an untreated group. PMID:2345629

  16. Synthesis of brequinar analogue inhibitors of malaria parasite dihydroorotate dehydrogenase.

    PubMed

    Boa, Andrew N; Canavan, Shane P; Hirst, Paul R; Ramsey, Christopher; Stead, Andrew M W; McConkey, Glenn A

    2005-03-15

    A series of 2-phenyl quinoline-4-carboxylic acid derivatives related to brequinar, an inhibitor of human dihydroorotate dehydrogenase (DHODH), has been prepared and evaluated as inhibitors of DHODH from the malaria parasite Plasmodium falciparum. Brequinar was essentially inactive against PfDHODH (IC(50) 880 microM) whereas several members of the series inhibited PfDHODH. Unexpectedly, replacement of the carboxylic acid required for brequinar to inhibit hDHODH was not essential in the diisopropylamides that inhibited PfDHODH.

  17. New peptide deformylase inhibitors design, synthesis and pharmacokinetic assessment.

    PubMed

    Lv, Fengping; Chen, Chen; Tang, Yang; Wei, Jianhai; Zhu, Tong; Hu, Wenhao

    2016-08-01

    The docking approach for the screening of designed small molecule ligands, led to the identification of a critical arginine residue in peptide deformylase for spiro cyclopropyl PDF inhibitor's extra hydrophobic binding, providing us a useful tool for searching more efficient PDF inhibitors to fight for horrifying antibiotics resistance. Further synthetic modification was undertaken to optimize the potency of amide compounds. To lower metabolic susceptibility and in turn reduce unwanted metabolic toxicity that was observed clinically, while retaining desired antibacterial activity, the use of azoles as amide bioisosteres had also been investigated. After the completion of chemical synthesis, all the compounds were evaluated through in vitro antibacterial activity assay, some of which were further subject to in vivo rat pharmacokinetic assessment. Those findings in this letter showed that spiro cyclopropyl proline N-formyl hydroxylamines, and especially the bioisosteric azoles, can represent a promising class of PDF inhibitors. PMID:27293070

  18. Natural fatty acid synthase inhibitors as potent therapeutic agents for cancers: A review.

    PubMed

    Zhang, Jia-Sui; Lei, Jie-Ping; Wei, Guo-Qing; Chen, Hui; Ma, Chao-Ying; Jiang, He-Zhong

    2016-09-01

    Context Fatty acid synthase (FAS) is the only mammalian enzyme to catalyse the synthesis of fatty acid. The expression level of FAS is related to cancer progression, aggressiveness and metastasis. In recent years, research on natural FAS inhibitors with significant bioactivities and low side effects has increasingly become a new trend. Herein, we present recent research progress on natural fatty acid synthase inhibitors as potent therapeutic agents. Objective This paper is a mini overview of the typical natural FAS inhibitors and their possible mechanism of action in the past 10 years (2004-2014). Method The information was collected and compiled through major databases including Web of Science, PubMed, and CNKI. Results Many natural products induce cancer cells apoptosis by inhibiting FAS expression, with fewer side effects than synthetic inhibitors. Conclusion Natural FAS inhibitors are widely distributed in plants (especially in herbs and foods). Some natural products (mainly phenolics) possessing potent biological activities and stable structures are available as lead compounds to synthesise promising FAS inhibitors.

  19. Design and synthesis of conformationally restricted inhibitors of active thrombin activatable fibrinolysis inhibitor (TAFIa).

    PubMed

    Brink, Mikael; Dahlén, Anders; Olsson, Thomas; Polla, Magnus; Svensson, Tor

    2014-04-01

    A series of 4,5,6,7-tetrahydro-1H-benzimidazole-5-carboxylic acid and 5,6,7,8-tetrahydroimidazo[1,2-a]pyridine-7-carboxylic acid derivatives designed as inhibitors of TAFIa has been prepared via a common hydrogenation-alkylation sequence starting from the appropriate benzimidazole and imidazopyridine system. We present a successful design strategy using a conformational restriction approach resulting in potent and selective inhibitors of TAFIa. The X-ray structure of compound 5 in complex with a H333Y/H335Q double mutant TAFI indicate that the conformational restriction is responsible for the observed potency increase. PMID:24588961

  20. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  1. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  2. Synthesis and Isolation of Chelidonic Acid

    ERIC Educational Resources Information Center

    Gagan, J. M. F.; Herbert, R. B.

    1976-01-01

    Described is an undergraduate laboratory experiment involving synthesis of chelidonic acid and its identification in plants. The experiment is offered as an ancillary topic for biology or chemistry classes. (SL)

  3. Stereocontrolled Synthesis of a Potential Transition-State Inhibitor of the Salicylate Synthase MbtI from Mycobacterium tuberculosis.

    PubMed

    Liu, Zheng; Liu, Feng; Aldrich, Courtney C

    2015-07-01

    Mycobactins are small-molecule iron chelators (siderophores) produced by Mycobacterium tuberculosis (Mtb) for iron mobilization. The bifunctional salicylate synthase MbtI catalyzes the first step of mycobactin biosynthesis through the conversion of the primary metabolite chorismate into salicylic acid via isochorismate. We report the design, synthesis, and biochemical evaluation of an inhibitor based on the putative transition state (TS) for the isochorismatase partial reaction of MbtI. The inhibitor mimics the hypothesized charge buildup at C-4 of chorismate in the TS as well as C-O bond formation at C-6. Another important design element of the inhibitor is replacement of the labile pyruvate side chain in chorismate with a stable C-linked propionate isostere. We developed a stereocontrolled synthesis of the highly functionalized cyclohexene inhibitor that features an asymmetric aldol reaction using a titanium enolate, diastereoselective Grignard addition to a tert-butanesulfinyl aldimine, and ring closing olefin metathesis as key steps. PMID:26035083

  4. Microwave-Assisted Synthesis of a MK2 Inhibitor by Suzuki-Miyaura Coupling for Study in Werner Syndrome Cells

    PubMed Central

    Bagley, Mark C.; Baashen, Mohammed; Chuckowree, Irina; Dwyer, Jessica E.; Kipling, David; Davis, Terence

    2015-01-01

    Microwave-assisted Suzuki-Miyaura cross-coupling reactions have been employed towards the synthesis of three different MAPKAPK2 (MK2) inhibitors to study accelerated aging in Werner syndrome (WS) cells, including the cross-coupling of a 2-chloroquinoline with a 3-pyridinylboronic acid, the coupling of an aryl bromide with an indolylboronic acid and the reaction of a 3-amino-4-bromopyrazole with 4-carbamoylphenylboronic acid. In all of these processes, the Suzuki-Miyaura reaction was fast and relatively efficient using a palladium catalyst under microwave irradiation. The process was incorporated into a rapid 3-step microwave-assisted method for the synthesis of a MK2 inhibitor involving 3-aminopyrazole formation, pyrazole C-4 bromination using N-bromosuccinimide (NBS), and Suzuki-Miyaura cross-coupling of the pyrazolyl bromide with 4-carbamoylphenylboronic acid to give the target 4-arylpyrazole in 35% overall yield, suitable for study in WS cells. PMID:26046488

  5. Synthesis and metabolism of inhibitors of ribonucleotide reductase

    SciTech Connect

    Smith, F.T.

    1985-01-01

    In an effort to prepare more effective inhibitors of ribo-nucleotide reductase a series of 2-substituted-4,6-dihydroxypyrimidines was prepared via the appropriately substituted benzamidine. None of the compounds exhibited in vivo activity against L1210 leukemia. No further testing was performed. In order to investigate the metabolism of 3,4-dihydroxybenzohydroxamic acid, a known inhibitor of ribonucleotide reductase, radiolabeled 3,4-dihydroxybenzohydroxamic acid was synthesized by a modification of the procedure of Pichat and Tostain. /sup 14/C-3,4-Dihydroxybenzoic acid was converted to the methyl ester and subsequently reacted with hydroxylamine to give the hydroxamic acid. /sup 14/C-3,4-Dihydroxybenzohydroxamic acid was given i.p. to Sprague-Dawley rats. Excretion occurred mainly (72%) via the urine. HPLC coupled with GC/MS analyses showed that the compound was excreted mainly unchanged. The compound was metabolized to 3,4-dihydroxybenzamide, 4-methoxy-3-hydroxybenzohydroxamic acid, and 4-hydroxy-3-methoxybenzohydroxamic acid. HPLC analysis also showed the lack of formation of any glucuronide or sulfate conjugates through either the hydroxamic acid or catechol functionalities.

  6. A Sulfhydryl Reagent Modulates Systemic Signaling for Wound-Induced and Systemin-Induced Proteinase Inhibitor Synthesis.

    PubMed Central

    Narvaez-Vasquez, J.; Orozco-Cardenas, M. L.; Ryan, C. A.

    1994-01-01

    The sulfhydryl group reagent p-chloromecuribenzene sulfonic acid (PCMBS), an established inhibitor of active apoplastic phloem loading of sucrose in several plant species, is shown to be a powerful inhibitor of wound-induced and systemin-induced activation of proteinase inhibitor synthesis and accumulation in leaves of tomato plants (Lycopersicon esculentum cv Castlemart). PCMBS, supplied to young tomato plants through their cut stems, blocks accumulation of proteinase inhibitors in leaves in response to wounding. The application of systemin directly to fresh wounds enhances systemic accumulation of proteinase inhibitors to levels higher than wounding alone. Placed on fresh wounds, PCMBS severely inhibits systemic induction of proteinase inhibitors, in both the presence and absence of exogenous systemin. PCMBS inhibition can be reversed by cysteine, dithiothreitol, and glutathione. Radiolabeled systemin placed on fresh wounds is readily transported from the wounded leaves to upper leaves. However, in the presence of PCMBS, radiolabeled systemin is not transported away from wound sites. Induction of proteinase inhibitor I synthesis by oligouronides (degree of polymerization [almost equal to] 20), linolenic acid, or methyl jasmonate was not inhibited by PCMBS. The cumulative data support a possible role for sulfhydryl groups in mediating the translocation of systemin from wound sites to distal receptor sites in tomato plants and further support a role for systemin as a systemic wound signal. PMID:12232239

  7. A PHGDH inhibitor reveals coordination of serine synthesis and 1-carbon unit fate

    PubMed Central

    Pacold, Michael E.; Brimacombe, Kyle R.; Chan, Sze Ham; Rohde, Jason M.; Lewis, Caroline A.; Swier, Lotteke J.Y.M.; Possemato, Richard; Chen, Walter W.; Sullivan, Lucas B.; Fiske, Brian P.; Cho, Sung Won; Freinkman, Elizaveta; Birsoy, Kıvanç; Abu-Remaileh, Monther; Shaul, Yoav D.; Liu, Chieh Min; Zhou, Minerva; Koh, Min Jung; Chung, Haeyoon; Davidson, Shawn M.; Luengo, Alba; Wang, Amy Q.; Xu, Xin; Yasgar, Adam; Liu, Li; Rai, Ganesha; Westover, Kenneth D.; Vander Heiden, Matthew G.; Shen, Min; Gray, Nathanael S.; Boxer, Matthew B.; Sabatini, David M.

    2016-01-01

    Serine is a both a proteinogenic amino acid and the source of one-carbon units essential for de novo purine and deoxythymidine synthesis. In the canonical glucose-derived serine synthesis pathway, Homo sapiens phosphoglycerate dehydrogenase (PHGDH) catalyzes the first, rate-limiting step. Genetic loss of PHGDH is toxic towards PHGDH-overexpressing breast cancer cell lines even in the presence of exogenous serine. Here, we use a quantitative high-throughput screen to identify small molecule PHGDH inhibitors. These compounds reduce the production of glucose-derived serine in cells and suppress the growth of PHGDH-dependent cancer cells in culture and in orthotopic xenograft tumors. Surprisingly, PHGDH inhibition reduced the incorporation into nucleotides of one-carbon units from glucose-derived and exogenous serine. We conclude that glycolytic serine synthesis coordinates the use of one-carbon units from endogenous and exogenous serine in nucleotide synthesis, and suggest that one-carbon unit wasting may contribute to the efficacy of PHGDH inhibitors in vitro and in vivo. PMID:27110680

  8. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  9. Binding of α,α-disubstituted amino acids to arginase suggests new avenues for inhibitor design.

    PubMed

    Ilies, Monica; Di Costanzo, Luigi; Dowling, Daniel P; Thorn, Katherine J; Christianson, David W

    2011-08-11

    Arginase is a binuclear manganese metalloenzyme that hydrolyzes L-arginine to form L-ornithine and urea, and aberrant arginase activity is implicated in various diseases such as erectile dysfunction, asthma, atherosclerosis, and cerebral malaria. Accordingly, arginase inhibitors may be therapeutically useful. Continuing our efforts to expand the chemical space of arginase inhibitor design and inspired by the binding of 2-(difluoromethyl)-L-ornithine to human arginase I, we now report the first study of the binding of α,α-disubstituted amino acids to arginase. Specifically, we report the design, synthesis, and assay of racemic 2-amino-6-borono-2-methylhexanoic acid and racemic 2-amino-6-borono-2-(difluoromethyl)hexanoic acid. X-ray crystal structures of human arginase I and Plasmodium falciparum arginase complexed with these inhibitors reveal the exclusive binding of the L-stereoisomer; the additional α-substituent of each inhibitor is readily accommodated and makes new intermolecular interactions in the outer active site of each enzyme. Therefore, this work highlights a new region of the protein surface that can be targeted for additional affinity interactions, as well as the first comparative structural insights on inhibitor discrimination between a human and a parasitic arginase.

  10. Binding of [alpha, alpha]-Disubstituted Amino Acids to Arginase Suggests New Avenues for Inhibitor Design

    SciTech Connect

    Ilies, Monica; Di Costanzo, Luigi; Dowling, Daniel P.; Thorn, Katherine J.; Christianson, David W.

    2011-10-21

    Arginase is a binuclear manganese metalloenzyme that hydrolyzes L-arginine to form L-ornithine and urea, and aberrant arginase activity is implicated in various diseases such as erectile dysfunction, asthma, atherosclerosis, and cerebral malaria. Accordingly, arginase inhibitors may be therapeutically useful. Continuing our efforts to expand the chemical space of arginase inhibitor design and inspired by the binding of 2-(difluoromethyl)-L-ornithine to human arginase I, we now report the first study of the binding of {alpha},{alpha}-disubstituted amino acids to arginase. Specifically, we report the design, synthesis, and assay of racemic 2-amino-6-borono-2-methylhexanoic acid and racemic 2-amino-6-borono-2-(difluoromethyl)hexanoic acid. X-ray crystal structures of human arginase I and Plasmodium falciparum arginase complexed with these inhibitors reveal the exclusive binding of the L-stereoisomer; the additional {alpha}-substituent of each inhibitor is readily accommodated and makes new intermolecular interactions in the outer active site of each enzyme. Therefore, this work highlights a new region of the protein surface that can be targeted for additional affinity interactions, as well as the first comparative structural insights on inhibitor discrimination between a human and a parasitic arginase.

  11. Design, synthesis and biological characterization of selective LIMK inhibitors.

    PubMed

    Boland, Sandro; Bourin, Arnaud; Alen, Jo; Geraets, Jacques; Schroeders, Pieter; Castermans, Karolien; Kindt, Nele; Boumans, Nicki; Panitti, Laura; Vanormelingen, Jessica; Fransen, Silke; Van de Velde, Sarah; Defert, Olivier

    2015-09-15

    Inhibitors of LIM kinases are considered of interest for several indications, including elevated intraocular pressure (IOP), cancer, or infection by HIV-1. LX-7101 (Lexicon Pharmaceuticals) was advanced to Phase-I clinical trials as an IOP-lowering agent for treatment of glaucoma. We here discuss the design, synthesis and evaluation of LIMK inhibitors based on a pyrrolopyrimidine scaffold, which represent close analogs of LX-7101. Exploration of structure-activity relationships revealed that many of such compounds, including LX-7101, cause potent inhibition of LIMK1 and LIMK2, and also ROCK2 and PKA. Molecular variations around the various structural elements of LX-7101 were attempted. Substitution on position 6 of the pyrrolopyrimidine scaffold led to the identification of LX-7101 analogs displaying good selectivity versus ROCK, PKA and Akt.

  12. Sulfotyrosine dipeptide: Synthesis and evaluation as HIV-entry inhibitor.

    PubMed

    Ju, Tong; Hu, Duoyi; Xiang, Shi-Hua; Guo, Jiantao

    2016-10-01

    Human immunodeficiency virus type 1 (HIV-1) is responsible for the worldwide AIDS pandemic. Due to the lack of prophylactic HIV-1 vaccine, drug treatment of the infected patients becomes essential to reduce the viral load and to slow down progression of the disease. Because of drug resistance, finding new antiviral agents is necessary for AIDS drug therapies. The interaction of gp120 and co-receptor (CCR5/CXCR4) mediates the entry of HIV-1 into host cells, which has been increasingly exploited in recent years as the target for new antiviral agents. A conserved co-receptor binding site on gp120 that recognizes sulfotyrosine (sTyr) residues represents a structural target to design novel HIV entry inhibitors. In this work, we developed an efficient synthesis of sulfotyrosine dipeptide and evaluated it as an HIV-1 entry inhibitor. PMID:27475281

  13. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  14. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  15. The intracellular Ca(2+)-pump inhibitors thapsigargin and cyclopiazonic acid induce stress proteins in mammalian chondrocytes.

    PubMed

    Cheng, T C; Benton, H P

    1994-07-15

    Primary cultures of mammalian articular chondrocytes respond to treatment with the intracellular Ca(2+)-pump inhibitors thapsigargin (TG) and cyclopiazonic acid by specific changes in protein synthesis consistent with a stress response. Two-dimensional gel electrophoresis of newly synthesized proteins confirmed that the response was consistent with the induction of glucose-regulated proteins. The effects of low-dose TG (10 nM), measured by changes in [35S]methionine labelling of newly synthesized proteins, can first be observed by 10 h and are maximal by 24 h. The pattern of changes induced by TG is shared with cyclopiazonic acid, but effects of both perturbants differ significantly from changes induced by heat shock. Upon removal of TG, normal protein synthesis is restored by 48 h. Immunoblots showed increased concentrations of the stress proteins HSP90, HSP72/73 and HSP60 in chondrocytes treated with TG, but induction of newly synthesized heat-shock proteins by TG was not apparent on [35S]methionine-labelled gels. The alterations in protein synthesis induced by Ca(2+)-pump inhibitors were unaffected by BAPTA-AM loading, which clamped cytosolic Ca2+ at resting levels. We conclude that inhibition of intracellular Ca(2+)-pump activity can elicit a stress response, which has important implications for the interpretation of chronic use of Ca(2+)-pump inhibitors. In particular, the activation of the cellular shock response should be considered in interpreting the regulation of protein synthesis and cell survival by Ca(2+)-pump inhibitors such as TG. PMID:8043004

  16. Converting maslinic acid into an effective inhibitor of acylcholinesterases.

    PubMed

    Schwarz, Stefan; Loesche, Anne; Lucas, Susana Dias; Sommerwerk, Sven; Serbian, Immo; Siewert, Bianka; Pianowski, Elke; Csuk, René

    2015-10-20

    During the last decade, maslinic acid has been evaluated for many biological properties, e.g. as an anti-tumor or an anti-viral agent but also as a nutraceutical. The potential of maslinic acid and related derivatives to act as inhibitors of acetyl- or butyryl-cholinesterase was examined in this communication in more detail. Cholinesterases do still represent an interesting group of target enzymes with respect to the investigation and treatment of the Alzheimer's disease and other dementia illnesses as well. Although other triterpenoic acids have successfully been tested for their ability to act as inhibitors of cholinesterases, up to now maslinic acid has not been part of such studies. For this reason, three series of maslinic acid derivatives possessing modifications at different centers were synthesized and subjected to Ellman's assay to determine their inhibitory strength and type of inhibitory action. While parent compound maslinic acid was no inhibitor in these assays, some of the compounds exhibited an inhibition of acetylcholinesterase in the single-digit micro-molar range. Two compounds were identified as inhibitors of butyrylcholinesterase showing inhibition constants comparable to those of galantamine, a drug often used in the treatment of Alzheimer's disease. Furthermore, additional selectivity as well as cytotoxicity studies were performed underlining the potential of several derivatives and qualifying them for further investigations. Docking studies revealed that the different kinetic behavior within the same compound series may be explained by the ability of the compounds to enter the active site gorge of AChE. PMID:26383128

  17. Identification of sulfonic acids as efficient ecto-5'-nucleotidase inhibitors.

    PubMed

    Iqbal, Jamshed; Saeed, Aamer; Raza, Rabia; Matin, Abdul; Hameed, Abdul; Furtmann, Norbert; Lecka, Joanna; Sévigny, Jean; Bajorath, Jürgen

    2013-01-01

    Ecto-5'-nucleotidase (CD73) is well known for its implication in cancer. Inhibition of ecto-5'-nucleotidases is thought to provide an attractive approach to cancer therapy. This study identifies sulfonic acid compounds as efficient inhibitors of ecto-5'-nucleotidases. The compounds were tested against recombinant human and rat ecto-5'-nucleotidases. The most potent new sulfonic acid inhibitor 6-amino-4-hydroxynaphthalene-2-sulfonic acid (1) of ecto-5'-nucleotidase had an IC₅₀ of 1.32 ± 0.09 μM for the human and 10.4 ± 3.3 μM for the rat enzyme. Generally, all compounds were more active against the human enzyme. Plausible binding mode models were developed for this new class of inhibitors. Furthermore, several sulfonic acid inhibitors were efficient cytotoxic agents when tested on H157 cancer cell lines. Hence, new ecto-5'-nucleotidases inhibitors displayed significant potential for further development as compounds for anti-cancer therapy.

  18. Discovery of a novel acyl-CoA: cholesterol acyltransferase inhibitor: the synthesis, biological evaluation, and reduced adrenal toxicity of (4-phenylcoumarin)acetanilide derivatives with a carboxylic acid moiety.

    PubMed

    Ogino, Masaki; Nakada, Yoshihisa; Negoro, Nobuyuki; Itokawa, Shigekazu; Nishimura, Satoshi; Sanada, Tsukasa; Satomi, Tomoko; Kita, Shunbun; Kubo, Kazuki; Marui, Shogo

    2011-01-01

    As a part of our research for novel potent and orally available acyl-CoA: cholesterol acyltransferase (ACAT) inhibitors that can be used as anti-atherosclerotic agents, we recently reported the discovery of the (4-phenylcoumarine)acetanilide derivative 1. However, compound 1 showed adrenal toxicity in animal models. In order to search for safer ACAT inhibitors that do not have adrenal toxicity, we examined the inhibitory activity of ACAT in human macrophage and adrenal cells. The introduction of a carboxylic acid moiety on the pendant phenyl ring and the adjustment of the lipophilicity led to the discovery of (2E)-3-[7-chloro-3-[2-[[4-fluoro-2-(trifluoromethyl)phenyl]amino]-2-oxoethyl]-6-methyl-2-oxo-2H-chromen-4-yl]phenyl]acrylic acid (21e), which showed potent ACAT inhibitory activity in macrophages and a selectivity of around 30-fold over adrenal cells. In addition, compound 21e showed high adrenal safety in guinea pigs. PMID:22041073

  19. Synthesis, chiral high performance liquid chromatographic resolution and enantiospecific activity of a potent new geranylgeranyl transferase inhibitor, 2-hydroxy-3-imidazo[1,2-a]pyridin-3-yl-2-phosphonopropionic acid.

    PubMed

    McKenna, Charles E; Kashemirov, Boris A; Błazewska, Katarzyna M; Mallard-Favier, Isabelle; Stewart, Charlotte A; Rojas, Javier; Lundy, Mark W; Ebetino, Frank H; Baron, Rudi A; Dunford, James E; Kirsten, Marie L; Seabra, Miguel C; Bala, Joy L; Marma, Mong S; Rogers, Michael J; Coxon, Fraser P

    2010-05-13

    3-(3-Pyridyl)-2-hydroxy-2-phosphonopropanoic acid (3-PEHPC, 1) is a phosphonocarboxylate (PC) analogue of 2-(3-pyridyl)-1-hydroxyethylidenebis(phosphonic acid) (risedronic acid, 2), an osteoporosis drug that decreases bone resorption by inhibiting farnesyl pyrophosphate synthase (FPPS) in osteoclasts, preventing protein prenylation. 1 has lower bone affinity than 2 and weakly inhibits Rab geranylgeranyl transferase (RGGT), selectively preventing prenylation of Rab GTPases. We report here the synthesis and biological studies of 2-hydroxy-3-imidazo[1,2-a]pyridin-3-yl-2-phosphonopropionic acid (3-IPEHPC, 3), the PC analogue of minodronic acid 4. Like 1, 3 selectively inhibited Rab11 vs. Rap 1A prenylation in J774 cells, and decreased cell viability, but was 33-60x more active in these assays. After resolving 3 by chiral HPLC (>98% ee), we found that (+)-3-E1 was much more potent than (-)-3-E2 in an isolated RGGT inhibition assay, approximately 17x more potent (LED 3 microM) than (-)-3-E2 in inhibiting Rab prenylation in J774 cells and >26x more active in the cell viability assay. The enantiomers of 1 exhibited a 4-fold or smaller potency difference in the RGGT and prenylation inhibition assays.

  20. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  1. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  2. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  3. Structure-based Design and In-Parallel Synthesis of Inhibitors of AmpC b-lactamase

    SciTech Connect

    Tondi, D.; Powers, R.A.; Negri, M.C.; Caselli, M.C.; Blazquez, J.; Costi, M.P.; Shoichet, B.K.

    2010-03-08

    Group I {beta}-lactamases are a major cause of antibiotic resistance to {beta}-lactams such as penicillins and cephalosporins. These enzymes are only modestly affected by classic {beta}-lactam-based inhibitors, such as clavulanic acid. Conversely, small arylboronic acids inhibit these enzymes at sub-micromolar concentrations. Structural studies suggest these inhibitors bind to a well-defined cleft in the group I {beta}-lactamase AmpC; this cleft binds the ubiquitous R1 side chain of {beta}-lactams. Intriguingly, much of this cleft is left unoccupied by the small arylboronic acids. To investigate if larger boronic acids might take advantage of this cleft, structure-guided in-parallel synthesis was used to explore new inhibitors of AmpC. Twenty-eight derivatives of the lead compound, 3-aminophenylboronic acid, led to an inhibitor with 80-fold better binding (2; K{sub i} 83 nM). Molecular docking suggested orientations for this compound in the R1 cleft. Based on the docking results, 12 derivatives of 2 were synthesized, leading to inhibitors with K{sub i} values of 60 nM and with improved solubility. Several of these inhibitors reversed the resistance of nosocomial Gram-positive bacteria, though they showed little activity against Gram-negative bacteria. The X-ray crystal structure of compound 2 in complex with AmpC was subsequently determined to 2.1 {angstrom} resolution. The placement of the proximal two-thirds of the inhibitor in the experimental structure corresponds with the docked structure, but a bond rotation leads to a distinctly different placement of the distal part of the inhibitor. In the experimental structure, the inhibitor interacts with conserved residues in the R1 cleft whose role in recognition has not been previously explored. Combining structure-based design with in-parallel synthesis allowed for the rapid exploration of inhibitor functionality in the R1 cleft of AmpC. The resulting inhibitors differ considerably from {beta}-lactams but

  4. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  5. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  6. Polyamines are Inhibitors of Gastric Acid Secretion

    NASA Astrophysics Data System (ADS)

    Ray, Tushar K.; Nandi, Jyotirmoy; Pidhorodeckyj, Nykolai; Meng-Ai, Zhou

    1982-03-01

    The naturally occurring organic polycations such as spermine and spermidine inhibit histamine-stimulated gastric acid secretion by bullfrog gastric mucosa in vitro; spermine is much more potent than spermidine. Unlike the H2 receptor antagonists, the polyamines are completely ineffective from the nutrient side and are effective only from the secretory side of the chambered mucosa. The polyamine effects could be reversed by increasing K+ concentration in the secretory solution. Studies with isolated gastric microsomal vesicles demonstrate that the polyamines do not inhibit the gastric H+,K+-ATPase but greatly decrease the ATPase-mediated uptake of H+ under appropriate conditions. For the latter effects the presence of polyamine within the vesicle interior was found to be essential. Our data strongly suggest an uncoupling of the gastric H+,K+-ATPase system by the polyamines. The therapeutic potential of these and similar compounds in the treatment of hyperacidity and peptic ulcer is discussed.

  7. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  8. Rational Design Synthesis and Evaluation of New Selective Inhibitors of Microbial Class II (Zinc Dependent) Fructose Bis-phosphate Aldolases

    SciTech Connect

    R Daher; M Coincon; M Fonvielle; P Gest; M Guerin; M Jackson; J Sygusch; M Therisod

    2011-12-31

    We report the synthesis and biochemical evaluation of several selective inhibitors of class II (zinc dependent) fructose bis-phosphate aldolases (Fba). The products were designed as transition-state analogues of the catalyzed reaction, structurally related to the substrate fructose bis-phosphate (or sedoheptulose bis-phosphate) and based on an N-substituted hydroxamic acid, as a chelator of the zinc ion present in active site. The compounds synthesized were tested on class II Fbas from various pathogenic microorganisms and, by comparison, on a mammalian class I Fba. The best inhibitor shows Ki against class II Fbas from various pathogens in the nM range, with very high selectivity (up to 105). Structural analyses of inhibitors in complex with aldolases rationalize and corroborate the enzymatic kinetics results. These inhibitors represent lead compounds for the preparation of new synthetic antibiotics, notably for tuberculosis prophylaxis.

  9. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  10. Inhibitors to Polyhydroxyalkanoate (PHA) Synthases: Synthesis, Molecular Docking, and Implications

    PubMed Central

    Cao, Ruikai; Maurmann, Leila; Li, Ping

    2015-01-01

    Polyhydroxyalkanoate (PHA) synthases (PhaCs) catalyze the formation of biodegradable PHAs that are considered as an ideal alternative to nonbiodegradable synthetic plastics. However, study of PhaC has been challenging because the rate of PHA chain elongation is much faster than that of initiation. This difficulty along with lack of a structure has become the main hurdle to understand and engineer PhaCs for economical PHA production. Here we reported the synthesis of two carbadethia CoA analogs, sT-CH2-CoA 26a and sTet-CH2-CoA 26b as well as sT-aldehyde 29 as new PhaC inhibitors. Study of these analogs with PhaECAv revealed that 26a/b and 29 are competitive and mixed inhibitors, respectively. It was observed that CoA moiety and PHA chain extension can increase binding affinity, which is consistent with the docking study. Estimation from Kic of 26a/b predicts that a CoA analog attached with an octameric-HB chain may facilitate the formation of a kinetically well-behaved synthase. PMID:25394180

  11. Inhibitors of polyhydroxyalkanoate (PHA) synthases: synthesis, molecular docking, and implications.

    PubMed

    Zhang, Wei; Chen, Chao; Cao, Ruikai; Maurmann, Leila; Li, Ping

    2015-01-01

    Polyhydroxyalkanoate (PHA) synthases (PhaCs) catalyze the formation of biodegradable PHAs that are considered to be ideal alternatives to non-biodegradable synthetic plastics. However, study of PhaCs has been challenging because the rate of PHA chain elongation is much faster than that of initiation. This difficulty, along with lack of a crystal structure, has become the main hurdle to understanding and engineering PhaCs for economical PHA production. Here we report the synthesis of two carbadethia CoA analogues--sT-CH2-CoA (26 a) and sTet-CH2-CoA (26 b)--as well as sT-aldehyde (saturated trimer aldehyde, 29), as new PhaC inhibitors. Study of these analogues with PhaECAv revealed that 26 a/b and 29 are competitive and mixed inhibitors, respectively. Both the CoA moiety and extension of PHA chain will increase binding affinity; this is consistent with our docking study. Estimation of the Kic values of 26 a and 26 b predicts that a CoA analogue incorporating an octameric hydroxybutanoate (HB) chain might facilitate the formation of a kinetically well-behaved synthase.

  12. Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.

    PubMed

    Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko

    2016-09-01

    Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. PMID:27630308

  13. Tanzawaic Acids, a Chemically Novel Set of Bacterial Conjugation Inhibitors

    PubMed Central

    Getino, María; Fernández-López, Raúl; Palencia-Gándara, Carolina; Campos-Gómez, Javier; Sánchez-López, Jose M.; Martínez, Marta; Fernández, Antonio; de la Cruz, Fernando

    2016-01-01

    Bacterial conjugation is the main mechanism for the dissemination of multiple antibiotic resistance in human pathogens. This dissemination could be controlled by molecules that interfere with the conjugation process. A search for conjugation inhibitors among a collection of 1,632 natural compounds, identified tanzawaic acids A and B as best hits. They specially inhibited IncW and IncFII conjugative systems, including plasmids mobilized by them. Plasmids belonging to IncFI, IncI, IncL/M, IncX and IncH incompatibility groups were targeted to a lesser extent, whereas IncN and IncP plasmids were unaffected. Tanzawaic acids showed reduced toxicity in bacterial, fungal or human cells, when compared to synthetic conjugation inhibitors, opening the possibility of their deployment in complex environments, including natural settings relevant for antibiotic resistance dissemination. PMID:26812051

  14. Potent inhibitors of HCV-NS3 protease derived from boronic acids

    SciTech Connect

    Venkatraman, Srikanth; Wu, Wanli; Prongay, Andrew; Girijavallabhan, Viyyoor; Njoroge, F. George

    2009-07-23

    Chronic hepatitis C infection is the leading causes for cirrhosis of the liver and hepatocellular carcinoma, leading to liver failure and liver transplantation. The etiological agent, HCV virus produces a single positive strand of RNA that is processed with the help of serine protease NS3 to produce mature virus. Inhibition of NS3 protease can be potentially used to develop effective drugs for HCV infections. Numerous efforts are now underway to develop potent inhibitors of HCV protease that contain ketoamides as serine traps. Herein we report the synthesis of a series of potent inhibitors that contain a boronic acid as a serine trap. The activity of these compounds were optimized to 200 pM. X-ray structure of compound 17 bound to NS3 protease is also discussed.

  15. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  16. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  17. Bisphosphonic acids as effective inhibitors of Mycobacterium tuberculosis glutamine synthetase.

    PubMed

    Kosikowska, Paulina; Bochno, Marta; Macegoniuk, Katarzyna; Forlani, Giuseppe; Kafarski, Paweł; Berlicki, Łukasz

    2016-12-01

    Inhibition of glutamine synthetase (GS) is one of the most promising strategies for the discovery of novel drugs against tuberculosis. Forty-three bisphosphonic and bis-H-phosphinic acids of various scaffolds, bearing aromatic substituents, were screened against recombinant GS from Mycobacterium tuberculosis. Most of the studied compounds exhibited activities in micromolar range, with N-(3,5-dichlorophenyl)-2-aminoethylidenebisphoshonic acid, N-(3,5-difluorophenyl)-2-aminoethylidene-bisphoshonic acid and N-(3,4-dichlorophenyl)-1-hydroxy-1,1-ethanebisphosphonic acid showing the highest potency with kinetic parameters similar to the reference compound - L-methionine-S-sulfoximine. Moreover, these inhibitors were found to be much more effective against pathogen enzyme than against the human ortholog. Thus, with the bone-targeting properties of the bisphosphonate compounds in mind, this activity/selectivity profile makes these compounds attractive agents for the treatment of bone tuberculosis.

  18. Behavior of aspartic acid as a corrosion inhibitor for steel

    SciTech Connect

    Kalota, D.J.; Silverman, D.C. )

    1994-02-01

    Corrosion inhibition of steel by aspartic acid (C[sub 4]H[sub 7]NO[sub 4]), an amino acid of low molecular weight, was found to depend strongly on pH. At a pH less than the ionization constant at [approximately]9.5 to 10 (measured at 25 C), C[sub 4]H[sub 7]NO[sub 4] appeared to accelerate corrosion. Above the pH, it acted as a corrosion inhibitor for steel. A specially constructed potential-pH diagram for iron (Fe) that incorporated C[sub 4]H[sub 7]NO[sub 4] showed the change in behavior was accompanied by the most stable thermodynamic state changing from an iron aspartate complex to iron oxide. Polymerized C[sub 4]H[sub 7]NO[sub 4] (polyaspartic acid) behaved in a similar manner. Some other amino acids of low molecular weight behaved similarly.

  19. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  20. Inhibitors of ethylene synthesis inhibit auxin-induced stomatal opening in epidermis detached from leaves of Vicia faba L.

    PubMed

    Merritt, F; Kemper, A; Tallman, G

    2001-02-01

    Using leaf epidermis from Vicia faba, we tested whether auxin-induced stomatal opening was initiated by auxin-induced ethylene synthesis. Epidermis was dark-incubated in buffered KNO3 containing 0.1 mM alpha-napthalene acetic acid or 1 mM indole-3-acetic acid. Maximum net opening was ca. 4 micron after 6 h. Opening was reversed by 20 microM ABA, 0.1 mM CaCl2. 1-Aminocyclopropane carboxylic acid (ACC) synthase catalyzes synthesis of ACC, the immediate precursor to ethylene. Auxin-induced stomatal opening was fully inhibited by 10 microM 1-aminoethoxyvinylglycine (AVG), an ACC synthase inhibitor. In solutions containing AVG, auxin-induced opening was restored in a concentration-dependent manner by exogenous ACC, but not in control solutions lacking an auxin. ACC-mediated reversal of AVG-inhibition of stomatal opening was inhibited by alpha-aminoisobutyric acid (AIB), an inhibitor of ACC oxidase, the last enzyme in the ethylene biosynthetic pathway, by 10 microM silver thiosulfate (STS), an inhibitor of ethylene action, and by 20 microM ABA, 0.1 mM CaCl2. CoCl2, an inhibitor of ethylene synthesis, also inhibited auxin-induced opening. Both STS and CoCl2 inhibited opening induced by light or by fusicoccin, but neither light- nor fusicoccin-induced opening was inhibited by AVG. These results support the hypothesis that auxin-induced stomatal opening is mediated through auxin-induced ethylene production by guard cells.

  1. Synthesis and biological characterization of amidopropenyl hydroxamates as HDAC inhibitors.

    PubMed

    Thaler, Florian; Varasi, Mario; Colombo, Andrea; Boggio, Roberto; Munari, Davide; Regalia, Nickolas; Rozio, Marco G; Reali, Veronica; Resconi, Anna E; Mai, Antonello; Gagliardi, Stefania; Dondio, Giulio; Minucci, Saverio; Mercurio, Ciro

    2010-08-01

    A series of amidopropenyl hydroxamic acid derivatives were prepared as novel inhibitors of human histone deacetylases (HDACs). Several compounds showed potency at <100 nM in the HDAC inhibition assays, sub-micromolar IC(50) values in tests against three tumor cell lines, and remarkable stability in human and mouse microsomes was observed. Three representative compounds were selected for further characterization and submitted to a selectivity profile against a series of class I and class II HDACs as well as to preliminary in vivo pharmacokinetic (PK) experiments. Despite their high microsomal stability, the compounds showed medium-to-high clearance rates in in vivo PK studies as well as in rat and human hepatocytes, indicating that a major metabolic pathway is catalyzed by non-microsomal enzymes.

  2. Large-scale asymmetric synthesis of a cathepsin S inhibitor.

    PubMed

    Lorenz, Jon C; Busacca, Carl A; Feng, XuWu; Grinberg, Nelu; Haddad, Nizar; Johnson, Joe; Kapadia, Suresh; Lee, Heewon; Saha, Anjan; Sarvestani, Max; Spinelli, Earl M; Varsolona, Rich; Wei, Xudong; Zeng, Xingzhong; Senanayake, Chris H

    2010-02-19

    A potent reversible inhibitor of the cysteine protease cathepsin-S was prepared on large scale using a convergent synthetic route, free of chromatography and cryogenics. Late-stage peptide coupling of a chiral urea acid fragment with a functionalized aminonitrile was employed to prepare the target, using 2-hydroxypyridine as a robust, nonexplosive replacement for HOBT. The two key intermediates were prepared using a modified Strecker reaction for the aminonitrile and a phosphonation-olefination-rhodium-catalyzed asymmetric hydrogenation sequence for the urea. A palladium-catalyzed vinyl transfer coupled with a Claisen reaction was used to produce the aldehyde required for the side chain. Key scale up issues, safety calorimetry, and optimization of all steps for multikilogram production are discussed. PMID:20102230

  3. Prostaglandin synthesis inhibitors reduce Cannabis and restraint stress induced increase in rat brain serotonin concentrations.

    PubMed

    Bhattacharya, S K; Bhattacharya, D

    1983-01-01

    Cannabis resin (CI) produced a dose-related increase in rat brain serotonin concentrations, whereas restraint stress produced maximal rise of the neurotransmitter concentrations at 1 h, followed by a tendency to normalise by 4 h. The prostaglandin (PG) synthesis inhibitors, diclofenac and paracetamol, antagonized CI and restraint stress induced rise in serotonin concentrations. The findings lend credence to earlier reports that PG synthesis inhibitors antagonize serotonin-mediated neuropharmacological actions of CI and restraint stress in rats.

  4. Enantioselective synthesis of the novel chiral sulfoxide derivative as a glycogen synthase kinase 3beta inhibitor.

    PubMed

    Saitoh, Morihisa; Kunitomo, Jun; Kimura, Eiji; Yamano, Toru; Itoh, Fumio; Kori, Masakuni

    2010-09-01

    Glycogen synthase kinase 3beta (GSK-3beta) inhibitors are expected to be attractive therapeutic agents for the treatment of Alzheimer's disease (AD). Recently we discovered sulfoxides (S)-1 as a novel GSK-3beta inhibitor having in vivo efficacy. We investigated practical asymmetric preparation methods for the scale-up synthesis of (S)-1. The highly enantioselective synthesis of (S)-1 (94% ee) was achieved by titanium-mediated oxidation with D-(-)-diethyl tartrate on gram scale.

  5. Design and synthesis of potent and multifunctional aldose reductase inhibitors based on quinoxalinones.

    PubMed

    Qin, Xiangyu; Hao, Xin; Han, Hui; Zhu, Shaojuan; Yang, Yanchun; Wu, Bobin; Hussain, Saghir; Parveen, Shagufta; Jing, Chaojun; Ma, Bing; Zhu, Changjin

    2015-02-12

    Quinoxalin-2(1H)-one based design and synthesis produced several series of aldose reductase (ALR2) inhibitor candidates. In particular, phenolic structure was installed in the compounds for the combination of antioxidant activity and strengthening the ability to fight against diabetic complications. Most of the series 6 showed potent and selective effects on ALR2 inhibition with IC50 values in the range of 0.032-0.468 μM, and 2-(3-(2,4-dihydroxyphenyl)-7-fluoro-2-oxoquinoxalin-1(2H)-yl)acetic acid (6e) was the most active. More significantly, most of the series 8 revealed not only good activity in the ALR2 inhibition but also potent antioxidant activity, and 2-(3-(3-methoxy-4-hydroxystyryl)-2-oxoquinoxalin-1(2H)-yl)acetic acid (8d) was even as strong as the well-known antioxidant Trolox at a concentration of 100 μM, verifying the C3 p-hydroxystyryl side chain as the key structure for alleviating oxidative stress. These results therefore suggest an achievement of multifunctional ALR2 inhibitors having both potency for ALR2 inhibition and as antioxidants. PMID:25602762

  6. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  7. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  8. Secretion of high-mannose-type alpha 1-proteinase inhibitor and alpha 1-acid glycoprotein by primary cultures of rat hepatocytes in the presence of the mannosidase I inhibitor 1-deoxymannojirimycin.

    PubMed

    Gross, V; Steube, K; Tran-Thi, T A; McDowell, W; Schwarz, R T; Decker, K; Gerok, W; Heinrich, P C

    1985-07-01

    Two different forms of alpha 1-proteinase inhibitor and alpha 1-acid glycoprotein were found in primary cultures of rat hepatocytes. After a 2.5-h labeling period with [35S]methionine the high-mannose-type precursor of alpha 1-proteinase inhibitor (Mr 49000) and alpha 1-acid glycoprotein (Mr 39 000) and the mature-complex-type alpha 1-proteinase inhibitor (Mr 54 000) and alpha 1-acid glycoprotein (Mr 43 000-60 000) could be immunoprecipitated from the cells, but only the complex-type forms of the two glycoproteins were secreted into the hepatocyte media. When hepatocytes were incubated with the mannosidase I inhibitor 1-deoxymannojirimycin at a concentration of 4 mM, the 49 000-Mr form of alpha 1-proteinase inhibitor and the 39 000-Mr form of alpha 1-acid glycoprotein could be detected in the cells as well as in their media. Neither the secretion of alpha 1-proteinase inhibitor nor that of alpha 1-acid glycoprotein was impaired by 1-deoxymannojirimycin. While alpha 1-proteinase inhibitor and alpha 1-acid glycoprotein, secreted by control cells, were resistant to endoglucosaminidase H, alpha 1-proteinase inhibitor and alpha 1-acid glycoprotein, secreted by hepatocytes treated with 4 mM 1-deoxymannojirimycin, could be deglycosylated by endoglucosaminidase H. When the [3H]mannose-labeled oligosaccharides of alpha 1-proteinase inhibitor, secreted by 1-deoxymannojirimycin-treated hepatocytes, were cleaved off by endoglucosaminidase H and analyzed by Bio-Gel P-4 chromatography, they eluted at the position of Man9GlcNAc, indicating that mannosidase I had been efficiently inhibited. 1-Deoxymannojirimycin did not inhibit the synthesis or the cotranslational N-glycosylation of alpha 1-proteinase inhibitor or alpha 1-acid glycoprotein. PMID:3160588

  9. Thermal copoly/amino acids/ as inhibitors of glyoxalase I

    NASA Technical Reports Server (NTRS)

    Fox, S. W.; Syren, R. M.; Windsor, C. R.

    1979-01-01

    A number of copoly(alpha-amino acids) have been prepared thermally; some have been found to function as inhibitors of glyoxalase I, an enzyme which occupies a central position in Szent-Gyorgyi's theory of tumour genesis. These polymers are also of interest in the search for synthetic peptides having carcinostatic activity, since many natural peptides are active. The way in which the inhibitory activity varies with composition of the synthetic polymers has been investigated. Various properties (hydrophobicity, molecular weight, UV absorption, kinetic type) have been examined in a search for correlates of inhibitory activity.

  10. Rapid, Microwave-Assisted Organic Synthesis of Selective V600EBRAF Inhibitors for Preclinical Cancer Research

    PubMed Central

    Buck, Jason R.; Saleh, Sam; Uddin, Md. Imam; Manning, H. Charles

    2012-01-01

    We report a dramatically improved total synthesis of two highly selective V600EBRAF inhibitors, PLX4720 and PLX4032, that leverages microwave-assisted organic synthesis (MAOS). Compared with previously reported approaches, our novel MAOS method significantly reduces overall reaction time without compromising yield. In addition to providing a gram-scale route to these compounds for preclinical oncology research, we anticipate this approach could accelerate the synthesis of azaindoles in high-throughput, library-based formats. PMID:23180892

  11. Stimulation of small proteoglycan synthesis by the hyaluronan synthesis inhibitor 4-methylumbelliferone in human skin fibroblasts.

    PubMed

    Funahashi, Masaru; Nakamura, Toshiya; Kakizaki, Ikuko; Mizunuma, Hideki; Endo, Masahiko

    2009-01-01

    Human skin fibroblasts cultured with 4-methylumbelliferone (MU), a hyaluronan synthesis inhibitor, produce a hyaluronan-deficient extracellular matrix (See [9]). Our present study investigated the effects of MU on proteoglycan, which is the other main component of the extracellular matrix, and interacts with hyaluronan. Proteoglycans isolated from culture medium in the presence or absence of MU were characterized by gel-filtration chromatography, ion-exchange HPLC, electrophoresis, and immunoblotting. We found that MU had only a negligible effect on the synthesis of large proteoglycan but increased the production of small proteoglycan in comparison with cultures lacking MU. This small proteoglycan was identified by immunoblotting as decorin. The structures of decorin synthesized in the presence and absence of MU were compared by gel-filtration chromatography, and the data indicated that cells incubated with MU produced a larger decorin molecule than cells incubated without MU. Furthermore, the two decorins had galactosaminoglycan chains of different sizes. These results suggest that MU inhibits the synthesis of hyaluronan and accelerates production of the larger decorin in the extracellular matrix.

  12. Inhibitors of fatty acid biosynthesis in sunflower seeds.

    PubMed

    Pleite, Rafael; Martínez-Force, Enrique; Garcés, Rafael

    2006-09-01

    During de novo fatty acid synthesis in sunflower seeds, saturated fatty acid production is influenced by the competition between the enzymes of the principal pathways and the saturated acyl-ACP thioesterases. Genetic backgrounds with more efficient saturated acyl-ACP thioesterase alleles only express their phenotypic effects when the alleles for the enzymes in the main pathway are less efficient. For this reason, we studied the incorporation of [2-(14)C]acetate into the lipids of developing sunflower seeds (Helianthus annuus L.) from several mutant lines in vivo. The labelling of different triacylglycerol fatty acids in different oilseed mutants reflects the fatty acid composition of the seed and supports the channelling theory of fatty acid biosynthesis. Incubation with methyl viologen diminished the conversion of stearoyl-ACP to oleoyl-ACP in vivo through a decrease in the available reductant power. In turn, this led to the accumulation of stearoyl-ACP to the levels detected in seeds from high stearic acid mutants. The concomitant reduction of oleoyl-ACP content inside the plastid allowed us to study the activity of acyl-ACP thioesterases on saturated fatty acids. In these mutants, we verified that the accumulation of saturated fatty acids requires efficient thioesterase activity on saturated-ACPs. By studying the effects of cerulenin on the in vivo incorporation of [2-(14)C]acetate into lipids and on the in vitro activity of beta-ketoacyl-ACP synthase II, we found that elongation to very long chain fatty acids can occur both inside and outside of the plastid in sunflower seeds. PMID:16500723

  13. Combined kinetic studies and computational analysis on kojic acid analogous as tyrosinase inhibitors.

    PubMed

    Lima, Carlyle Ribeiro; Silva, José Rogério A; de Tássia Carvalho Cardoso, Erica; Silva, Edilene O; Lameira, Jerônimo; do Nascimento, José Luiz Martins; do Socorro Barros Brasil, Davi; Alves, Cláudio N

    2014-01-01

    Tyrosinase is a key enzyme in melanin synthesis and widely distributed in plants and animals tissues. In mammals, this enzyme is related to pigment production, involved in wound healing, primary immune response and it can also contribute to catecholamines synthesis in the brain. Consequently, tyrosinase enzyme represents an attractive and selective target in the field of the medicine, cosmetics and bio-insecticides. In this paper, experimental kinetics and computational analysis were used to study the inhibition of tyrosinase by analogous of Kojic acid. The main interactions occurring between inhibitors-tyrosinase complexes and the influence of divalent cation (Cu2+) in enzymatic inhibition were investigated by using molecular docking, molecular dynamic simulations and electrostatic binding free energy by using the Linear Interaction Energy (LIE) method. The results showed that the electrostatic binding free energy are correlated with values of constant inhibition (r2 = 0.97).Thus, the model obtained here could contribute to future studies of this important system and, therefore, eventually facilitate development of tyrosinase inhibitors. PMID:25004069

  14. Synthesis and biological evaluation of novel substituted pyrrolo[1,2-a]quinoxaline derivatives as inhibitors of the human protein kinase CK2.

    PubMed

    Guillon, Jean; Le Borgne, Marc; Rimbault, Charlotte; Moreau, Stéphane; Savrimoutou, Solène; Pinaud, Noël; Baratin, Sophie; Marchivie, Mathieu; Roche, Séverine; Bollacke, Andre; Pecci, Adali; Alvarez, Lautaro; Desplat, Vanessa; Jose, Joachim

    2013-07-01

    Herein we describe the synthesis and properties of substituted phenylaminopyrrolo[1,2-a]quinoxaline-carboxylic acid derivatives as a novel class of potent inhibitors of the human protein kinase CK2. A set of 15 compounds was designed and synthesized using convenient and straightforward synthesis protocols. The compounds were tested for inhibition of human protein kinase CK2, which is a potential drug target for many diseases including inflammatory disorders and cancer. New inhibitors with IC50 in the micro- and sub-micromolar range were identified. The most promising compound, the 4-[(3-chlorophenyl)amino]pyrrolo[1,2-a]quinoxaline-3-carboxylic acid 1c inhibited human CK2 with an IC50 of 49 nM. Our findings indicate that pyrrolo[1,2-a]quinoxalines are a promising starting scaffold for further development and optimization of human protein kinase CK2 inhibitors.

  15. Stereocontrolled Synthesis of a Potential Transition-State Inhibitor of the Salicylate Synthase MbtI from Mycobacterium tuberculosis

    PubMed Central

    Liu, Zheng; Liu, Feng; Aldrich, Courtney C.

    2015-01-01

    Mycobactins are small-molecule iron chelators (siderophores) produced by Mycobacterium tuberculosis (Mtb) for iron mobilization. The bifunctional salicylate synthase MbtI catalyzes the first step of mycobactin biosynthesis through the conversion of the primary metabolite chorismate into salicylic acid via isochorismate. We report the design, synthesis and biochemical evaluation of an inhibitor based on the putative transition-state (TS) for the isochorismatase partial reaction of MbtI. The inhibitor mimics the hypothesized charge build-up at C-4 of chorismate in the TS as well as C-O bond-formation at C-6. Another important design element of the inhibitor is replacement of the labile pyruvate side-chain in chorismate with a stable C-linked propionate isostere. We developed a stereocontrolled synthesis of the highly functionalized cyclohexene inhibitor that features an asymmetric aldol reaction using a titanium enolate, diastereoselective Grignard addition to a tert-butanesulfinyl aldimine, and ring closing olefin metathesis as key steps. PMID:26035083

  16. Binding of α,α-Disubstituted Amino Acids to Arginase Suggests New Avenues for Inhibitor Design1

    PubMed Central

    Ilies, Monica; Di Costanzo, Luigi; Dowling, Daniel P.; Thorn, Katherine J.; Christianson, David W.

    2011-01-01

    Arginase is a binuclear manganese metalloenzyme that hydrolyzes L-arginine to form L-ornithine and urea, and aberrant arginase activity is implicated in various diseases such as erectile dysfunction, asthma, atherosclerosis, and cerebral malaria. Accordingly, arginase inhibitors may be therapeutically useful. Continuing our efforts to expand the chemical space of arginase inhibitor design, and inspired by the binding of 2-(difluoromethyl)-L-ornithine to human arginase I, we now report the first study of the binding of α,α-disubstituted amino acids to arginase. Specifically, we report the design, synthesis, and assay of racemic 2-amino-6-borono-2- methylhexanoic acid and racemic 2-amino-6-borono-2-(difluoromethyl)hexanoic acid. X-ray crystal structures of human arginase I and Plasmodium falciparum arginase complexed with these inhibitors reveal the exclusive binding of the L-stereoisomer; the additional α-substituent of each inhibitor is readily accommodated and makes new intermolecular interactions in the outer active site of each enzyme. Therefore, this work highlights a new region of the protein surface that can be targeted for additional affinity interactions, as well as the first comparative structural insights on inhibitor discrimination between a human and a parasitic arginase. PMID:21728378

  17. Angiotensin-converting enzyme inhibitors modulate kynurenic acid production in rat brain cortex in vitro.

    PubMed

    Zakrocka, Izabela; Turski, Waldemar A; Kocki, Tomasz

    2016-10-15

    It is well established that the renin-angiotensin system (RAS) is present in the brain and that glutamate activates the brain centers responsible for blood pressure control. An antagonist of glutamate, kynurenic acid (KYNA) was shown to decrease blood pressure after intracerebral administration. KYNA is an endogenous metabolite of tryptophan produced from the breakdown of kynurenine by kynurenine aminotransferases (KAT), mainly within astrocytes. The purpose of this study was to evaluate the influence of three angiotensin-converting enzyme inhibitors (lisinopril, perindopril and ramipril) on KYNA production and KAT activity in the rat brain cortex in vitro. The effect of the angiotensin-converting enzyme inhibitors on KYNA production was examined on rat brain cortical slices incubated for 2h in the presence of l-kynurenine and the angiotensin-converting enzyme inhibitors. To analyze KAT I and KAT II activity, brain cortical homogenates were incubated for 2h with L-kynurenine and the tested drugs. KYNA was separated by HPLC and quantified fluorometrically. Among the examined angiotensin-converting enzyme inhibitors, lisinopril increased KYNA production, perindopril was ineffective, and ramipril decreased KYNA synthesis in rat brain cortical slices. Lisinopril increased KAT I activity and perindopril did not affect it. However, ramipril lowered KAT I activity in rat brain cortex in vitro. Neither lisinopril nor perindopril affected KAT II activity, but ramipril decreased KAT II activity in the rat brain cortex in vitro. Our study reveals that angiotensin-converting enzyme inhibitors show various influences on KYNA production in rat brain cortical slices and activity of KATs.

  18. Synthesis and anti-HIV activity of some [Nucleoside Reverse Transcriptase Inhibitor]-C5'-linker-[Integrase Inhibitor] heterodimers as inhibitors of HIV replication.

    PubMed

    Sugeac, Elena; Fossey, Christine; Ladurée, Daniel; Schmidt, Sylvie; Laumond, Geraldine; Aubertin, Anne-Marie

    2004-12-01

    Selected for their expected ability to inhibit HIV replication, a series of eight heterodimers containing a Nucleoside Reverse Transcriptase Inhibitor (NRTI) and an Integrase Inhibitor (INI), bound by a linker, were designed and synthesized. For the NRTIs, d4U, d2U and d4T were chosen. For the INIs, 4-[1-(4-fluorobenzyl)-1H-pyrrol-2-yl]-2,4-dioxobutyric acid (6) and 4-(3,5-dibenzyloxyphenyl)-2,4-dioxobutyric acid (9) (belonging to the beta-diketo acids class) were chosen. The conjugation of the two different inhibitors (NRTI and INI) was performed using an amino acid (glycine or beta-alanine) as a cleavable linker.

  19. Mass Spectrometry-Based Systems Approach for Identification of Inhibitors of Plasmodium falciparum Fatty Acid Synthase▿

    PubMed Central

    Sharma, Shilpi; Sharma, Shailendra Kumar; Modak, Rahul; Karmodiya, Krishanpal; Surolia, Namita; Surolia, Avadhesha

    2007-01-01

    The emergence of strains of Plasmodium falciparum resistant to the commonly used antimalarials warrants the development of new antimalarial agents. The discovery of type II fatty acid synthase (FAS) in Plasmodium distinct from the FAS in its human host (type I FAS) opened up new avenues for the development of novel antimalarials. The process of fatty acid synthesis takes place by iterative elongation of butyryl-acyl carrier protein (butyryl-ACP) by two carbon units, with the successive action of four enzymes constituting the elongation module of FAS until the desired acyl length is obtained. The study of the fatty acid synthesis machinery of the parasite inside the red blood cell culture has always been a challenging task. Here, we report the in vitro reconstitution of the elongation module of the FAS of malaria parasite involving all four enzymes, FabB/F (β-ketoacyl-ACP synthase), FabG (β-ketoacyl-ACP reductase), FabZ (β-ketoacyl-ACP dehydratase), and FabI (enoyl-ACP reductase), and its analysis by matrix-assisted laser desorption-time of flight mass spectrometry (MALDI-TOF MS). That this in vitro systems approach completely mimics the in vivo machinery is confirmed by the distribution of acyl products. Using known inhibitors of the enzymes of the elongation module, cerulenin, triclosan, NAS-21/91, and (−)-catechin gallate, we demonstrate that accumulation of intermediates resulting from the inhibition of any of the enzymes can be unambiguously followed by MALDI-TOF MS. Thus, this work not only offers a powerful tool for easier and faster throughput screening of inhibitors but also allows for the study of the biochemical properties of the FAS pathway of the malaria parasite. PMID:17485508

  20. Characterization of Lassa Virus Cell Entry Inhibitors: Determination of the Active Enantiomer by Asymmetric Synthesis

    PubMed Central

    Whitby, Landon R.; Lee, Andrew M.; Kunz, Stefan; Oldstone, Michael B. A.; Boger, Dale L.

    2009-01-01

    The comparative characterization of a series of 4-acyl-1,6-dialkylpiperazin-2-ones as potent cell entry inhibitors of the hemorrhagic fever arenavirus Lassa (LASV) is disclosed. The resolution and examination of the individual enantiomers of the prototypical LASV cell entry inhibitor 3 (16G8) is reported and the more potent (–)-enantiomer was found to be 15-fold more active than the corresponding (+)-enantiomer. The absolute configuration of (–)-3 was established by asymmetric synthesis of the active inhibitor (–)-(S)-3 (lassamycin-1). A limited deletion scan of lassamycin-1 defined key structural features required of the prototypical inhibitors. PMID:19428249

  1. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  2. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  3. Discovery of Bacterial Fatty Acid Synthase Type II Inhibitors Using a Novel Cellular Bioluminescent Reporter Assay

    PubMed Central

    Wallace, Joselynn; Bowlin, Nicholas O.; Mills, Debra M.; Saenkham, Panatda; Kwasny, Steven M.; Opperman, Timothy J.; Williams, John D.; Rock, Charles O.; Bowlin, Terry L.

    2015-01-01

    Novel, cellular, gain-of-signal, bioluminescent reporter assays for fatty acid synthesis type II (FASII) inhibitors were constructed in an efflux-deficient strain of Pseudomonas aeruginosa and based on the discovery that FASII genes in P. aeruginosa are coordinately upregulated in response to pathway disruption. A screen of 115,000 compounds identified a series of sulfonamidobenzamide (SABA) analogs, which generated strong luminescent signals in two FASII reporter strains but not in four control reporter strains designed to respond to inhibitors of pathways other than FASII. The SABA analogs selectively inhibited lipid biosynthesis in P. aeruginosa and exhibited minimal cytotoxicity to mammalian cells (50% cytotoxic concentration [CC50] ≥ 80 μM). The most potent SABA analogs had MICs of 0.5 to 7.0 μM (0.2 to 3.0 μg/ml) against an efflux-deficient Escherichia coli (ΔtolC) strain but had no detectable MIC against efflux-proficient E. coli or against P. aeruginosa (efflux deficient or proficient). Genetic, molecular genetic, and biochemical studies revealed that SABA analogs target the enzyme (AccC) catalyzing the biotin carboxylase half-reaction of the acetyl coenzyme A (acetyl-CoA) carboxylase step in the initiation phase of FASII in E. coli and P. aeruginosa. These results validate the capability and the sensitivity of this novel bioluminescent reporter screen to identify inhibitors of E. coli and P. aeruginosa FASII. PMID:26169404

  4. Synthesis of Lipoteichoic Acids in Bacillus anthracis

    PubMed Central

    Garufi, Gabriella; Hendrickx, Antoni P.; Beeri, Karen; Kern, Justin W.; Sharma, Anshika; Richter, Stefan G.; Schneewind, Olaf

    2012-01-01

    Lipoteichoic acid (LTA), a glycerol phosphate polymer, is a component of the envelope of Gram-positive bacteria that has hitherto not been identified in Bacillus anthracis, the causative agent of anthrax. LTA synthesis in Staphylococcus aureus and other microbes is catalyzed by the product of the ltaS gene, a membrane protein that polymerizes polyglycerol phosphate from phosphatidyl glycerol. Here we identified four ltaS homologues, designated ltaS1 to -4, in the genome of Bacillus anthracis. Polyglycerol phosphate-specific monoclonal antibodies were used to detect LTA in the envelope of B. anthracis strain Sterne (pXO1+ pXO2−) vegetative forms. B. anthracis mutants lacking ltaS1, ltaS2, ltaS3, or ltaS4 did not display defects in growth or LTA synthesis. In contrast, B. anthracis strains lacking both ltaS1 and ltaS2 were unable to synthesize LTA and exhibited reduced viability, altered envelope morphology, aberrant separation of vegetative forms, and decreased sporulation efficiency. Expression of ltaS1 or ltaS2 alone in B. anthracis as well as in other microbes was sufficient for polyglycerol phosphate synthesis. Thus, similar to S. aureus, B. anthracis employs LtaS enzymes to synthesize LTA, an envelope component that promotes bacterial growth and cell division. PMID:22685279

  5. Enzymatic synthesis of hyaluronan hybrid urinary trypsin inhibitor.

    PubMed

    Kakizaki, Ikuko; Takahashi, Ryoki; Yanagisawa, Miho; Yoshida, Futaba; Takagaki, Keiichi

    2015-09-01

    Human urinary trypsin inhibitor is a proteoglycan that has a single low-sulfated chondroitin 4-sulfate chain at the seryl residue in position 10 of the core protein as a glycosaminoglycan moiety, and is used as an anti-inflammatory medicine based on the protease inhibitory activity of the core protein. However, the functions of the glycosaminoglycan moiety have not yet been elucidated in detail. In the present study, the glycosaminoglycan chains of a native urinary trypsin inhibitor were remodeled to hyaluronan chains, with no changes to the core protein, using transglycosylation as a reverse reaction of the hydrolysis of bovine testicular hyaluronidase, and the properties of the hybrid urinary trypsin inhibitor were then analyzed. The trypsin inhibitory activitiy of the hyaluronan hybrid urinary trypsin inhibitor was similar to that of the native type; however, its inhibitory effect on the hydrolysis of hyaluronidase were not as strong as that of the native type. This result demonstrated that the native urinary trypsin inhibitor possessed hyaluronidase inhibitory activity on its chondroitin sulfate chain. The hyaluronan hybrid urinary trypsin inhibitors obtained affinity to a hyaluronan-binding protein not exhibited by the native type. The interactions between the hyaluronan hybrid urinary trypsin inhibitors and phosphatidylcholine (abundant in the outer layer of plasma membrane) were stronger than that of the native type. Hyaluronan hybrid urinary trypsin inhibitors may be useful for investigating the functions of the glycosaminoglycan chains of urinary trypsin inhibitors and hyaluronan, and our hybrid synthesizing method may be used widely in research for future medical applications.

  6. cis-Cinnamic acid selective suppressors distinct from auxin inhibitors.

    PubMed

    Okuda, Katsuhiro; Nishikawa, Keisuke; Fukuda, Hiroshi; Fujii, Yoshiharu; Shindo, Mitsuru

    2014-01-01

    The activity of cis-cinnamic acid (cis-CA), one of the allelochemicals, in plants is very similar to that of indole-3-acetic acid (IAA), a natural auxin, and thus cis-CA has long been believed to be an analog of auxin. We have reported some structure-activity relationships studies by synthesizing over 250 cis-CA derivatives and estimating their inhibitory activities on root growth inhibition in lettuce. In this study, the compounds that showed low- or no-activity on root growth inhibition were recruited as candidates suppressors against cis-CA and/or auxin and tested for their activity. In the presence of cis-CA, lettuce root growth was inhibited; however, the addition of some cis-CA derivatives restored control-level root growth. Four compounds, (Z)-3-(4-isopropylphenyl)acrylic acid, (Z)-3-(3-butoxyphenyl)acrylic acid, (Z)-3-[3-(pentyloxy)phenyl]acrylic acid, and (Z)-3-(naphthalen-1-yl)acrylic acid were selected as candidates for a cis-CA selective suppressor they allowed the recovery of root growth from inhibition by cis-CA treatment without any effects on the IAA-induced effect or elongating activity by themselves. Three candidates significantly ameliorated the root shortening by the potent inhibitor derived from cis-CA. In brief, we have found some cis-CA selective suppressors which have never been reported from inactive cis-CA derivatives for root growth inhibition. cis-CA selective suppressors will play an important role in elucidating the mechanism of plant growth regulation.

  7. Synthesis and activity of 2-oxoamides containing long chain beta-amino acids.

    PubMed

    Constantinou-Kokotou, Violetta; Peristeraki, Anna; Kokotos, Christoforos G; Six, David A; Dennis, Edward A

    2005-07-01

    2-Oxoamides based on long chain beta-amino acids were synthesized. 1-Benzyl substituted long chain amines, needed for such synthesis, were synthesized starting from Boc-phenylalaninol. The oxidative conversion of a phenyl group to a carboxyl group was used as the key transformation synthetic step. The compounds synthesized were studied for their activity against GIVA PLA(2), and were proven to be weak inhibitors. PMID:15635664

  8. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  9. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  10. Identification of Bidentate Salicylic Acid Inhibitors of PTP1B

    PubMed Central

    2015-01-01

    PTP1B is a master regulator in the insulin and leptin metabolic pathways. Hyper-activated PTP1B results in insulin resistance and is viewed as a key factor in the onset of type II diabetes and obesity. Moreover, inhibition of PTP1B expression in cancer cells dramatically inhibits cell growth in vitro and in vivo. Herein, we report the computationally guided optimization of a salicylic acid-based PTP1B inhibitor 6, identifying new and more potent bidentate PTP1B inhibitors, such as 20h, which exhibited a > 4-fold improvement in activity. In CHO-IR cells, 20f, 20h, and 20j suppressed PTP1B activity and restored insulin receptor phosphorylation levels. Notably, 20f, which displayed a 5-fold selectivity for PTP1B over the closely related PTPσ protein, showed no inhibition of PTP-LAR, PRL2 A/S, MKPX, or papain. Finally, 20i and 20j displayed nanomolar inhibition of PTPσ, representing interesting lead compounds for further investigation. PMID:26396684

  11. Study on polyepoxysuccinic acid reverse osmosis scale inhibitor.

    PubMed

    Sun, Yonghong; Xiang, Wenhua; Wang, Ying

    2009-01-01

    The effectiveness and applicability of polyepoxysuccinic acid (PESA) as a reverse osmosis (RO) scale inhibitor were studied using static and dynamic methods. In the static study, PESA performed very well in the treatment of water samples with various types of scale that commonly exist in RO water (i.e., CaCO3, CaSO4, BaSO4, SrSO4), showing an average scale inhibition ratio of above 90% at a dosage of 10 mg/L. SEM analysis showed a disordered CaCO3 crystal in the presence of PESA, suggesting the scale-inhibiting mechanism. In the dynamic experiment, PESA also showed great performance in the treatment of 10 samples of synthetic tap water or sea water with different ion composition (i.e., Ca(2+), HCO3(-), Fe(3+), Al(3+)). After one cycle (7 d) of RO treatment of each sample at full recycle operation mode under a constant pressure of 1×10(6) Pa, the differences in water permeability and desalination ratio among samples are within 5%, suggesting that PESA is capable of treating waters of different quality, and has a strong resistance to ions that are harmful to scale inhibiting (i.e., Fe(3+) and Al(3+)). All these results suggest that PESA should be an effective scale inhibitor that is applicable to RO treatment of waters with a wide range of ion compositions.

  12. Sulfonyl Fluoride Inhibitors of Fatty Acid Amide Hydrolase

    PubMed Central

    Alapafuja, Shakiru O.; Nikas, Spyros P.; Bharatan, Indu; Shukla, Vidyanand G.; Nasr, Mahmoud L.; Bowman, Anna L.; Zvonok, Nikolai; Li, Jing; Shi, Xiaomeng; Engen, John R.; Makriyannis, Alexandros

    2013-01-01

    Sulfonyl fluorides are known to inhibit esterases. Early work from our laboratory has identified hexadecyl sulfonylfluoride (AM374) as a potent in vitro and in vivo inhibitor of fatty acid amide hydrolase (FAAH). We now report on later generation sulfonyl fluoride analogs that exhibit potent and selective inhibition of FAAH. Using recombinant rat and human FAAH we show that 5-(4-hydroxyphenyl)pentanesulfonyl fluoride (AM3506) has similar inhibitory activity for both the rat and the human enzyme, while rapid dilution assays and mass spectrometry analysis suggest that the compound is a covalent modifier for FAAH and inhibits its action in an irreversible manner. Our SAR results are highlighted by molecular docking of key analogs. PMID:23083016

  13. Synthesis and anti-HIV evaluation of hybrid-type prodrugs conjugating HIV integrase inhibitors with d4t by self-cleavable spacers containing an amino acid residue.

    PubMed

    Fossey, Christine; Huynh, Ngoc-Trinh; Vu, Anh-Hoang; Vidu, Anamaria; Zarafu, Irina; Laduree, Daniel; Schmidt, Sylvie; Laumond, Geraldine; Aubertin, Anne-Marie

    2007-10-01

    In an attempt to combine the anti-HIV inhibitory capacity of reverse transcriptase (RT) inhibitors (NRTIs) and integrase (IN) inhibitors (INIs), several heterodimer analogues of the previously reported [d4T]-PABC-[INI] and [d4T]-OABC-[INI] prototypes have been prepared. In these novel series, we wished to extend our results to conjugates which incorporated an enzymatically labile aminoacid unit (L-alanine) connected to d4T through a self-immolative para- or ortho-aminobenzyl carbonate (PABC or OABC) spacer. Among the novel heterodimers, several derivatives show a potent anti-HIV-1 activity, which proved comparable to that of the [L-708,906]-PABC-[d4T] Heterodimer A prototype. However, although the compounds proved inhibitory to HIV-1, they were less potent than the parent compounds from which they were derived.

  14. Selective Inhibition of the Synthesis of Sindbis Virion Proteins by an Inhibitor of Chymotrypsin

    PubMed Central

    Pfefferkorn, E. R.; Boyle, Mary K.

    1972-01-01

    Treatment of chick embryo fibroblasts infected with Sindbis virus with TPCK, the choloromethyl ketone derivative of tosyl-phenylalanine and an inhibitor of chymotrypsin, resulted in reduced synthesis of viral structural proteins and the accumulation of a high-molecular-weight polypeptide, thought to be a precursor. The analogous inhibitor of trypsin, TLCK, the chloromethyl ketone derivative of tosyllysine, had no such effect. PMID:5061988

  15. 4,5-Diarylisoxazol-3-carboxylic acids: A new class of leukotriene biosynthesis inhibitors potentially targeting 5-lipoxygenase-activating protein (FLAP).

    PubMed

    Banoglu, Erden; Çelikoğlu, Erşan; Völker, Susanna; Olgaç, Abdurrahman; Gerstmeier, Jana; Garscha, Ulrike; Çalışkan, Burcu; Schubert, Ulrich S; Carotti, Andrea; Macchiarulo, Antonio; Werz, Oliver

    2016-05-01

    In this article, we report novel leukotriene (LT) biosynthesis inhibitors that may target 5-lipoxygenase-activating protein (FLAP) based on the previously identified isoxazole derivative (8). The design and synthesis was directed towards a subset of 4,5-diaryl-isoxazole-3-carboxylic acid derivatives as LT biosynthesis inhibitors. Biological evaluation disclosed a new skeleton of potential anti-inflammatory agents, exemplified by 39 and 40, which potently inhibit cellular 5-LO product synthesis (IC50 = 0.24 μM, each) seemingly by targeting FLAP with weak inhibition on 5-LO (IC50 ≥ 8 μM). Docking studies and molecular dynamic simulations with 5-LO and FLAP provide valuable insights into potential binding modes of the inhibitors. Together, these diaryl-isoxazol-3-carboxylic acids may possess potential as leads for development of effective anti-inflammatory drugs through inhibition of LT biosynthesis. PMID:26922224

  16. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  17. Synthesis of chromone, quinolone, and benzoxazinone sulfonamide nucleosides as conformationally constrained inhibitors of adenylating enzymes required for siderophore biosynthesis.

    PubMed

    Engelhart, Curtis A; Aldrich, Courtney C

    2013-08-01

    MbtA catalyzes the first committed step of mycobactin biosynthesis in Mycobacterium tuberculosis (Mtb) and is responsible for the incorporation of salicylic acid into the mycobactin siderophores. 5'-O-[N-(Salicyl)sulfamoyl]adenosine (Sal-AMS) is an extremely potent nucleoside inhibitor of MbtA that possesses excellent activity against whole-cell Mtb but suffers from poor bioavailability. In an effort to improve the bioavailability, we have designed four conformationally constrained analogues of Sal-AMS that remove two rotatable bonds and the ionized sulfamate group on the basis of computational and structural studies. Herein we describe the synthesis, biochemical, and microbiological evaluation of chromone-, quinolone-, and benzoxazinone-3-sulfonamide derivatives of Sal-AMS. We developed new chemistry to assemble these three heterocycles from common β-ketosulfonamide intermediates. The synthesis of the chromone- and quinolone-3-sulfonamide intermediates features formylation of a β-ketosulfonamide employing dimethylformamide dimethyl acetal to afford an enaminone that can react intramolecularly with a phenol or intermolecularly with a primary amine via addition-elimination reaction(s). The benzoxazinone-3-sulfonamide was prepared by nitrosation of a β-ketosulfonamide followed by intramolecular nucleophilic aromatic substitution. Mitsunobu coupling of these bicyclic sulfonamides with a protected adenosine derivative followed by global deprotection provides a concise synthesis of the respective inhibitors.

  18. Synthesis of Chromone, Quinolone, and Benzoxazinone Sulfonamide Nucleosides as Conformationally Constrained Inhibitors of Adenylating Enzymes Required for Siderophore Biosynthesis

    PubMed Central

    Engelhart, Curtis A.; Aldrich, Courtney C.

    2013-01-01

    MbtA catalyzes the first committed step of mycobactin biosynthesis in Mycobacterium tuberculosis (Mtb) and is responsible for the incorporation of salicylic acid into the mycobactin siderophores. 5′-O-[N-(Salicyl)sulfamoyl]adenosine (Sal-AMS) is an extremely potent nucleoside inhibitor of MbtA that possesses excellent activity against whole-cell Mtb, but suffers from poor bioavailability. In an effort to improve the bioavailability, we have designed four conformationally constrained analogues of Sal-AMS that remove two rotatable bonds and the ionized sulfamate group based on computational and structural studies. Herein we describe the synthesis, biochemical, and microbiological evaluation of chromone-, quinolone-, and benzoxazinone-3-sulfonamide derivatives of Sal-AMS. We developed new chemistry to assemble these three heterocycles from common β-ketosulfonamide intermediates. The synthesis of the chromone- and quinolone-3-sulfonamide intermediates features formylation of a β-ketosulfonamide employing dimethylformamide dimethyl acetal to afford an enaminone that can react intramolecularly with a phenol or intermolecularly with a primary amine via addition-elimination reaction(s). The benzoxazinone-3-sulfonamide was prepared by nitrosation of a β-ketosulfonamide followed by intramolecular nucleophilic aromatic substitution. Mitsunobu coupling of these bicyclic sulfonamides with a protected adenosine derivative followed by global deprotection provides a concise synthesis of the respective inhibitors. PMID:23805993

  19. Effects of norflurazon, an inhibitor of carotenogenesis, on abscisic acid and xanthoxin in the caps of gravistimulated maize roots

    NASA Technical Reports Server (NTRS)

    Feldman, L. J.; Sun, P. S.

    1986-01-01

    Maize seeds were germinated in the dark in the presence of the carotenoid synthesis inhibitor norflurazon and the levels of abscisic acid, xanthoxin and total carotenoids were measured in the root cap and in the adjacent 1.5 mm segment. In norflurazon-treated roots abscisic acid levels were markedly reduced, but an increase occurred in the levels of xanthoxin, a compound structurally and physiologically similar to abscisic acid. In the cultivar of maize (Zea mays L. cv. Merit) used for this work, brief illumination of the root is required for gravitropic curving. Following illumination both control and norflurazon-treated roots showed normal gravitropic curvature; however, the rate of curvature was delayed in norflurazon-treated roots. Our data from norflurazon-treated roots are consistent with a role for xanthoxin in maize root gravitropism. The increase in xanthoxin in the presence of an inhibitor of carotenoid synthesis suggests that xanthoxin and abscisic acid originate, at least in part, via different metabolic pathways.

  20. Boronic acid-based enzyme inhibitors: a review of recent progress.

    PubMed

    Fu, H; Fang, H; Sun, Jie; Wang, H; Liu, A; Sun, J; Wu, Z

    2014-01-01

    Since Bortezomib was approved by US FDA as the first drug to treat multiple myeloma, various boronic acid compounds have been developed as enzyme inhibitors. This paper reviewed the progress of boronic acid-based inhibitors against enzymes including proteasome, serine protease, HDACs and other enzymes in the past decade.

  1. Design, synthesis, and evaluation of oxazole transthyretin amyloidogenesis inhibitors.

    PubMed

    Razavi, Hossein; Powers, Evan T; Purkey, Hans E; Adamski-Werner, Sara L; Chiang, Kyle P; Dendle, Maria T A; Kelly, Jeffery W

    2005-02-15

    Ten oxazoles bearing a C(4) carboxyl group were synthesized and evaluated as transthyretin (TTR) amyloid fibril inhibitors. Substituting aryls at the C(2) position of the oxazole ring reveals that a 3,5-dichlorophenyl substituent significantly reduced amyloidogenesis. The efficacy of these inhibitors was enhanced further by installing an ethyl, a propyl, or a CF(3) group at the C(5) position. The CF(3) substitution at C(5) also improves the TTR binding selectivity over all the other proteins in human blood.

  2. Synthesis and preliminary evaluation of 5,7-dimethyl-2-aryl-3H-pyrrolizin-3-ones as angiogenesis inhibitors.

    PubMed

    Kirk, Nicholas S; Bezos, Anna; Willis, Anthony C; Sudta, Pichit; Suksamrarn, Sunit; Parish, Christopher R; Ranson, Marie; Kelso, Michael J

    2016-04-01

    Sunitinib (Sutent®) is a receptor tyrosine kinase (RTK) and angiogenesis inhibitor approved for the treatment of renal cell carcinomas, gastrointestinal stromal tumours and pancreatic neuroendocrine tumours. A key structural motif retained throughout medicinal chemistry efforts during sunitinib's development was the indoline-2-one group. In the search for new anti-angiogenic scaffolds, we previously reported that non-indoline-2-one-based derivatives of semaxanib (SU5416, a structurally simpler sunitinib predecessor that underwent Phase III trials) are active as angiogenesis inhibitors, indicating that the group is not essential for activity. This Letter describes the synthesis and structure-activity relationships of another class of non-indoline-2-one angiogenesis inhibitors related to sunitinib/semaxanib; the 5,7-dimethyl-2-aryl-3H-pyrrolizin-3-ones. A focussed library of 19 analogues was prepared using a simple novel process, wherein commercially available substituted arylacetic acids activated with an amide coupling reagent (HBTU) were reacted with the potassium salt of 3,5-dimethyl-1H-pyrrole-2-carbaldehyde in one-pot. Screening of the library using a cell-based endothelial tube formation assay identified 6 compounds with anti-angiogenesis activity. Two of the compounds were advanced to the more physiologically relevant rat aortic ring assay, where they showed similar inhibitory effects to semaxanib at 10μg/mL, confirming that 5,7-dimethyl-2-aryl-3H-pyrrolizin-3-ones represent a new class of angiogenesis inhibitors. PMID:26912111

  3. Okadaic acid disrupts Golgi structure and impairs enzyme synthesis and secretion in the rat pancreas.

    PubMed

    Waschulewski, I H; Kruse, M L; Agricola, B; Kern, H F; Schmidt, W E

    1996-06-01

    Okadaic acid, a serine/threonine phosphatase inhibitor, has been shown to inhibit rat pancreatic enzyme secretion by interference with late processes in stimulus-secretion coupling. To further characterize its action, we studied the effect of okadaic acid on secretion of newly synthesized proteins, protein synthesis, and cellular ultrastructure in pancreatic lobules derived from rats stimulated in vivo by feeding the synthetic proteinase inhibitor FOY-305. Okadaic acid completely blocked protein secretion at concentrations that inhibit the Ca2+/calmodulin-dependent protein phosphatase 2b, calcineurin. Protein synthesis was abolished at 10(-6) mol/l and reduced by 60% at 5 x 10(-7) mol/l okadaic acid. Pancreatic lobules exposed to 5 x 10(-7) mol/l okadaic acid for 20 min fully restored their secretory capacity on removal of the drug; whereas, after a preincubation with okadaic acid for > 40 min, protein secretion remained impaired during the recovery period. Electron microscopic examination of pancreatic acinar cells treated with 5 x 10(-7) mol/l okadaic acid revealed a dilated Golgi complex after 15 and 30 min and a subsequent fragmentation of Golgi cisternae into clouds of small uniform vesicles after 60 min. Reassembly of Golgi stacks occurred after a 60-min recovery without okadaic acid. These data indicate that serine/threonine phosphatases play an important role not only in the regulation of pancreatic enzyme synthesis and exocytosis but also are crucial for the maintenance of normal Golgi architecture and function in the exocrine rat pancreas. These effects are probably not exclusively mediated via type 2b calcineurin-like protein phosphatases.

  4. Design, Synthesis and Inhibitory Activity of Photoswitchable RET Kinase Inhibitors

    NASA Astrophysics Data System (ADS)

    Ferreira, Rubén; Nilsson, Jesper R.; Solano, Carlos; Andréasson, Joakim; Grøtli, Morten

    2015-05-01

    REarranged during Transfection (RET) is a transmembrane receptor tyrosine kinase required for normal development and maintenance of neurons of the central and peripheral nervous systems. Deregulation of RET and hyperactivity of the RET kinase is intimately connected to several types of human cancers, most notably thyroid cancers, making it an attractive therapeutic target for small-molecule kinase inhibitors. Novel approaches, allowing external control of the activity of RET, would be key additions to the signal transduction toolbox. In this work, photoswitchable RET kinase inhibitors based on azo-functionalized pyrazolopyrimidines were developed, enabling photonic control of RET activity. The most promising compound displays excellent switching properties and stability with good inhibitory effect towards RET in cell-free as well as live-cell assays and a significant difference in inhibitory activity between its two photoisomeric forms. As the first reported photoswitchable small-molecule kinase inhibitor, we consider the herein presented effector to be a significant step forward in the development of tools for kinase signal transduction studies with spatiotemporal control over inhibitor concentration in situ.

  5. Design, Synthesis and Inhibitory Activity of Photoswitchable RET Kinase Inhibitors

    PubMed Central

    Ferreira, Rubén; Nilsson, Jesper R.; Solano, Carlos; Andréasson, Joakim; Grøtli, Morten

    2015-01-01

    REarranged during Transfection (RET) is a transmembrane receptor tyrosine kinase required for normal development and maintenance of neurons of the central and peripheral nervous systems. Deregulation of RET and hyperactivity of the RET kinase is intimately connected to several types of human cancers, most notably thyroid cancers, making it an attractive therapeutic target for small-molecule kinase inhibitors. Novel approaches, allowing external control of the activity of RET, would be key additions to the signal transduction toolbox. In this work, photoswitchable RET kinase inhibitors based on azo-functionalized pyrazolopyrimidines were developed, enabling photonic control of RET activity. The most promising compound displays excellent switching properties and stability with good inhibitory effect towards RET in cell-free as well as live-cell assays and a significant difference in inhibitory activity between its two photoisomeric forms. As the first reported photoswitchable small-molecule kinase inhibitor, we consider the herein presented effector to be a significant step forward in the development of tools for kinase signal transduction studies with spatiotemporal control over inhibitor concentration in situ. PMID:25944708

  6. Asymmetric Synthesis of the Aminocyclitol Pactamycin, a Universal Translocation Inhibitor

    PubMed Central

    Sharpe, Robert J.; Malinowski, Justin T.; Johnson, Jeffrey S.

    2014-01-01

    An asymmetric total synthesis of the aminocyclopentitol pactamycin is described, which delivers the title compound in 15 steps from 2,4-pentanedione. Critical to this approach was the exploitation of a complex symmetry-breaking reduction strategy to assemble the C1, C2, and C7 relative stereochemistry within the first four steps of the synthesis. Multiple iterations of this reduction strategy are described, and a thorough analysis of stereochemical outcomes is detailed. In the final case, an asymmetric Mannich reaction was developed to install a protected amine directly at the C2 position. Symmetry-breaking reduction of this material gave way to a remarkable series of stereochemical outcomes leading to the title compound without recourse to non-strategic downstream manipulations. This synthesis is immediately accommodating to the facile preparation of structural analogs. PMID:24245656

  7. Evaluation of epigallocatechin gallate and related plant polyphenols as inhibitors of the FabG and FabI reductases of bacterial type II fatty-acid synthase.

    PubMed

    Zhang, Yong-Mei; Rock, Charles O

    2004-07-23

    Epigallocatechin gallate (EGCG) is the major component of green tea extracts and possesses antibacterial, antiviral, and antitumor activity. Our study focused on validating the inhibition of the bacterial type II fatty acid synthesis system as a mechanism for the antibacterial effects of EGCG and related plant polyphenols. EGCG and the related tea catechins potently inhibited both the FabG and FabI reductase steps in the fatty acid elongation cycle with IC(50) values between 5 and 15 microm. The presence of the galloyl moiety was essential for activity, and EGCG was a competitive inhibitor of FabI and a mixed type inhibitor of FabG demonstrating that EGCG interfered with cofactor binding in both enzymes. EGCG inhibited acetate incorporation into fatty acids in vivo, although it was much less potent than thiolactomycin, a validated fatty acid synthesis inhibitor, and overexpression of FabG, FabI, or both did not confer resistance. A panel of other plant polyphenols was screened for FabG/FabI inhibition and antibacterial activity. Most of these inhibited both reductase steps, possessed antibacterial activity, and inhibited cellular fatty acid synthesis. The ability of the plant secondary metabolites to interfere with the activity of multiple NAD(P)-dependent cellular processes must be taken into account when assessing the specificity of their effects.

  8. Terreic Acid, a Quinone Epoxide Inhibitor of Bruton's Tyrosine Kinase

    NASA Astrophysics Data System (ADS)

    Kawakami, Yuko; Hartman, Stephen E.; Kinoshita, Eiji; Suzuki, Hidefumi; Kitaura, Jiro; Yao, Libo; Inagaki, Naoki; Franco, Alessandra; Hata, Daisuke; Maeda-Yamamoto, Mari; Fukamachi, Hiromi; Nagai, Hiroichi; Kawakami, Toshiaki

    1999-03-01

    Bruton's tyrosine kinase (Btk) plays pivotal roles in mast cell activation as well as in B cell development. Btk mutations lead to severe impairments in proinflammatory cytokine production induced by cross-linking of high-affinity IgE receptor on mast cells. By using an in vitro assay to measure the activity that blocks the interaction between protein kinase C and the pleckstrin homology domain of Btk, terreic acid (TA) was identified and characterized in this study. This quinone epoxide specifically inhibited the enzymatic activity of Btk in mast cells and cell-free assays. TA faithfully recapitulated the phenotypic defects of btk mutant mast cells in high-affinity IgE receptor-stimulated wild-type mast cells without affecting the enzymatic activities and expressions of many other signaling molecules, including those of protein kinase C. Therefore, this study confirmed the important roles of Btk in mast cell functions and showed the usefulness of TA in probing into the functions of Btk in mast cells and other immune cell systems. Another insight obtained from this study is that the screening method used to identify TA is a useful approach to finding more efficacious Btk inhibitors.

  9. Protein synthesis inhibitors prevent both spontaneous and hormone-dependent maturation of isolated mouse oocytes

    SciTech Connect

    Downs, S.M. )

    1990-11-01

    The present study was carried out to examine the role of protein synthesis in mouse oocyte maturation in vitro. In the first part of this study, the effects of cycloheximide (CX) were tested on spontaneous meiotic maturation when oocytes were cultured in inhibitor-free medium. CX reversibly suppressed maturation of oocytes as long as maturation was either initially prevented by the phosphodiesterase inhibitor, 3-isobutyl-1-methyl-xanthine (IBMX), or delayed by follicle-stimulating hormone (FSH). In the second part of this study, the actions of protein synthesis inhibitors were tested on hormone-induced maturation. CEO were maintained in meiotic arrest for 21-22 h with hypoxanthine, and germinal vesicle breakdown (GVB) was induced with follicle-stimulating hormone (FSH). Three different protein synthesis inhibitors (CX, emetine (EM), and puromycin (PUR)) each prevented the stimulatory action of FSH on GVB in a dose-dependent fashion. This was accompanied by a dose-dependent suppression of 3H-leucine incorporation by oocyte-cumulus cell complexes. The action of these inhibitors on FSH- and epidermal growth factor (EGF)-induced GVB was next compared. All three drugs lowered the frequency of GVB in the FSH-treated groups, below even that of the controls (drug + hypoxanthine); the drugs maintained meiotic arrest at the control frequencies in the EGF-treated groups. Puromycin aminonucleoside, an analog of PUR with no inhibitory action on protein synthesis, had no effect. The three inhibitors also suppressed the stimulatory action of FSH on oocyte maturation when meiotic arrest was maintained with the cAMP analog, dbcAMP.

  10. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  11. Design and synthesis of procollagen C-proteinase inhibitors.

    PubMed

    Turtle, Eric; Chow, Nicholas; Yang, Charles; Sosa, Sergio; Bauer, Udo; Brenner, Mitch; Solow-Cordero, David; Ho, Wen-Bin

    2012-12-15

    Non-peptidic inhibitors of procollagen C-proteinase (PCP) were designed from substrate leads. Compounds were optimized for potency and selectivity, with N-substituted aryl sulfonamide hydroxamates having the best combination of these properties. Compounds 89 and 60 have IC(50) values of 10 and 80 nM, respectively, against PCP; excellent selectivity over MMP's 1, 2, and 9; and activity in cell-based collagen deposition assays.

  12. Design, synthesis, anti-TMV, fungicidal, and insecticidal activity evaluation of 1,2,3,4-tetrahydro-β-carboline-3-carboxylic acid derivatives based on virus inhibitors of plant sources.

    PubMed

    Song, Hong-jian; Liu, Yong-xian; Liu, Yu-xiu; Huang, Yuan-qiong; Li, Yong-qiang; Wang, Qing-min

    2014-11-15

    By drawing the creation ideas of botanical pesticides, a series of tetrahydro-β-carboline-3-carboxylic acid derivatives were designed and synthesized, and first evaluated for their anti-TMV, fungicidal and insecticidal activities. Most of these derivatives exhibited good antiviral activity against TMV both in vitro and in vivo. Especially, the activities of compounds 8 and 15 in vivo were higher than that of ribavirin. The compound 8 exhibited more than 70% fungicidal activities against Cercospora arachidicola Hori, Alternaria solani, Bipolaris maydis, and Rhizoctonia solani at 50mg/kg, compounds 16 and 20 exhibited more than 60% insecticidal activities against Mythimna separate and Ostrinia nubilalis. PMID:25442317

  13. Inhibition of plant fatty acid synthesis by nitroimidazoles.

    PubMed Central

    Jones, A V; Harwood, J L; Stratford, M R; Stumpf, P K

    1981-01-01

    1. The effect of the addition of a number of nitroimidazoles was tested on fatty acid synthesis by germinating pea seeds, isolated lettuce chloroplasts and a soluble fraction from pea seeds. 2. All the compounds tested had a marked inhibition on stearate desaturation by lettuce chloroplasts and on the synthesis of very-long-chain fatty acids by pea seeds. 3. In contrast, the effect of the drugs on total fatty acid synthesis from [14C]acetate in chloroplasts was related to the compound's electron reduction potentials. 4. Of the compounds used, only metronidazole had a marked inhibition on palmitate elongation in the systems tested. 5. The mechanism of inhibition of plant fatty acid synthesis by nitroimidazoles is discussed and the possible relevance of these findings to their neurotoxicity is suggested. PMID:7325993

  14. Ferulic acid, an efficient inhibitor of type B trichothecene biosynthesis and Tri gene expression in Fusarium liquid cultures.

    PubMed

    Boutigny, Anne-Laure; Barreau, Christian; Atanasova-Penichon, Vessela; Verdal-Bonnin, Marie-Noëlle; Pinson-Gadais, Laëtitia; Richard-Forget, Florence

    2009-01-01

    The effect of ferulic acid, the most abundant phenolic acid in wheat bran, was studied in vitro on type B trichothecene biosynthesis by Fusarium. It was demonstrated that ferulic acid is an efficient inhibitor of mycotoxin production by all strains of Fusarium tested, including different chemotypes and species. To analyse the mechanism of toxin biosynthesis inhibition by ferulic acid, expression of representative Tri genes, involved in the trichothecene biosynthesis pathway, was monitored by real-time RT-PCR. A decrease in the level of Tri gene expression was measured, suggesting that inhibition of toxin synthesis by ferulic acid could be regulated at the transcriptional level. Moreover, toxin production was shown to be reduced proportionally to the initial amount of ferulic acid added in the culture medium. Addition of ferulic acid either at the spore germination step or to a mycelial culture resulted in the same final inhibitory effect on mycotoxin accumulation. A cumulative inhibitory effect on trichothecene biosynthesis was even observed with successive supplementation of ferulic acid. Ferulic acid, which content varies among wheat varieties, could then play an important role in modulating trichothecene biosynthesis by Fusarium in some wheat varieties.

  15. Design, synthesis, and characterization of peptide-based rab geranylgeranyl transferase inhibitors.

    PubMed

    Tan, Kui-Thong; Guiu-Rozas, Ester; Bon, Robin S; Guo, Zhong; Delon, Christine; Wetzel, Stefan; Arndt, Sabine; Alexandrov, Kirill; Waldmann, Herbert; Goody, Roger S; Wu, Yao-Wen; Blankenfeldt, Wulf

    2009-12-24

    Rab geranylgeranyl transferase (RabGGTase) catalyzes the attachment of geranylgeranyl isoprenoids to Rab guanine triphosphatases, which are key regulators in vesicular transport. Because geranylgeranylation is required for proper function and overexpression of Rabs has been observed in various cancers, RabGGTase may be a target for novel therapeutics. The development of selective inhibitors is, however, difficult because two related enzymes involved in other cellular processes exist in eukaryotes and because RabGGTase recognizes protein substrates indirectly, resulting in relaxed specificity. We report the synthesis of a peptidic library based on the farnesyl transferase inhibitor pepticinnamin E. Of 469 compounds investigated, several were identified as selective for RabGGTase with low micromolar IC(50) values. The compounds were not generally cytotoxic and inhibited Rab isoprenylation in COS-7 cells. Crystal structure analysis revealed that selective inhibitors interact with a tunnel unique to RabGGTase, implying that this structural motif is an attractive target for improved RabGGTase inhibitors.

  16. Carborane-containing urea-based inhibitors of glutamate carboxypeptidase II: Synthesis and structural characterization.

    PubMed

    Youn, Sihyun; Kim, Kyung Im; Ptacek, Jakub; Ok, Kiwon; Novakova, Zora; Kim, YunHye; Koo, JaeHyung; Barinka, Cyril; Byun, Youngjoo

    2015-11-15

    Glutamate carboxypeptidase II (GCPII) is a zinc metalloprotease on the surface of astrocytes which cleaves N-acetylaspartylglutamate to release N-acetylaspartate and glutamate. GCPII inhibitors can decrease glutamate concentration and play a protective role against apoptosis or degradation of brain neurons. Herein, we report the synthesis and structural analysis of novel carborane-based GCPII inhibitors. We determined the X-ray crystal structure of GCPII in complex with a carborane-containing inhibitor at 1.79Å resolution. The X-ray analysis revealed that the bulky closo-carborane cluster is located in the spacious entrance funnel region of GCPII, indicating that the carborane cluster can be further structurally modified to identify promising lead structures of novel GCPII inhibitors.

  17. Inhibition of PAF synthesis by stimulated human polymorphonuclear leucocytes with cloricromene, an inhibitor of phospholipase A2 activation.

    PubMed Central

    Ribaldi, E.; Mezzasoma, A. M.; Francescangeli, E.; Prosdocimi, M.; Nenci, G. G.; Goracci, G.; Gresele, P.

    1996-01-01

    1. A phospholipase A2 (PLA2) represents the key enzyme in the remodelling pathway of platelet-activating factor (PAF) synthesis in human polymorphonuclear (PMN) leucocytes. 2. PLA2 activation is also the rate-limiting step for the release of the arachidonic acid utilized for the synthesis of leukotrienes in stimulated leucocytes; however, it is unknown whether the PLA2s involved in the two biosynthetic pathways are identical. 3. Cloricromene (8-monochloro-3-beta-diethylaminoethyl-4-methyl-7-ethoxy- carbonylmethoxy coumarin) is an antithrombotic coumarin derivative which inhibits platelet and leucocyte function and suppresses arachidonic acid liberation by interfering with PLA2 activation. 4. The aim of the present study was to assess whether chloricromene inhibits PAF synthesis by stimulated human polymorphonuclear leucocytes (PMNs). 5. Cloricromene (50-500 microM) inhibited in a concentration-dependent manner the release of PAF, as measured by h.p.l.c. bioassay, from A23187-stimulated PMNs. Significant inhibition (45%) of PAF-release was obtained with 50 microM cloricromene and the IC50 was 85 microM. Mepacrine (500 microM), a non-specific PLA2 inhibitor, strikingly reduced PAF release. 6. The incorporation of [3H]-acetate into [3H]-PAF induced by serum-treated zymosan in human PMNs was also inhibited concentration-dependently by cloricromene, with an IC50 of 105 microM. Mepacrine also suppressed [3H]-acetate incorporation into [3H]-PAF. 7. Cloricromene did not affect the activities of the enzymes involved in PAF-synthesis acetyltransferase or phosphocholine transferase. 8. Our data demonstrate that cloricromene, an inhibitor of PLA2-activation in human leucocytes, reduces the synthesis of PAF by stimulated PMNs. This finding has a twofold implication: the PLA2s (or the mechanisms that regulate their activation) involved in PAF synthesis and arachidonate release in human leucocytes are either identical or else indistinguishable by their sensitivity to cloricromene

  18. Synthesis and biological evaluation of salicylic acid and N-acetyl-2-carboxybenzenesulfonamide regioisomers possessing a N-difluoromethyl-1,2-dihydropyrid-2-one pharmacophore: dual inhibitors of cyclooxygenases and 5-lipoxygenase with anti-inflammatory activity.

    PubMed

    Chowdhury, Morshed A; Abdellatif, Khaled R A; Dong, Ying; Das, Dipankar; Yu, Gang; Velázquez, Carlos A; Suresh, Mavanur R; Knaus, Edward E

    2009-12-15

    A novel class of salicylic acid and N-acetyl-2-carboxybenzenesulfonamide regioisomers possessing a N-difluoromethyl-1,2-dihydropyrid-2-one pharmacophore attached to its C-4 or C-5 position was designed for evaluation as anti-inflammatory (AI) agents. Replacement of the 2,4-difluorophenyl ring in diflunisal by the N-difluoromethyl-1,2-dihydropyrid-2-one moiety provided compounds showing dual selective cyclooxygenase-2 (COX-2)/5-lipoxygenase (5-LOX) inhibitory activities. AI structure-activity studies showed that the C-4 (14a) and C-5 (14b) salicylate regioisomers were 1.4- and 1.6-fold more potent than aspirin, and the C-5 N-acetyl-2-carboxybenzenesulfonamide regioisomer (22b) was 1.3- and 2.8-fold more potent than ibuprofen and aspirin, respectively. In vivo ulcer index (UI) studies showed that the 4- and 5-(N-difluoromethyl-1,2-dihydropyrid-2-one-4-yl)salicylic acids (14a and 14b) were completely non-ulcerogenic since no gastric lesions were present (UI=0) relative to aspirin (UI=57) at an equivalent mumol/kg oral dose. The N-difluoromethyl-1,2-dihydropyridin-2-one moiety provides a novel 5-LOX pharmacophore for the design of cyclic hydroxamic mimetics for exploitation in the development of dual COX-2/5-LOX inhibitory AI drugs.

  19. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  20. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  1. Substituent effects of cis-cinnamic acid analogues as plant growh inhibitors.

    PubMed

    Nishikawa, Keisuke; Fukuda, Hiroshi; Abe, Masato; Nakanishi, Kazunari; Taniguchi, Tomoya; Nomura, Takashi; Yamaguchi, Chihiro; Hiradate, Syuntaro; Fujii, Yoshiharu; Okuda, Katsuhiro; Shindo, Mitsuru

    2013-12-01

    1-O-cis-Cinnamoyl-β-D-glucopyranose is one of the most potent allelochemicals that has been isolated from Spiraea thunbergii Sieb by Hiradate et al. It derives its strong inhibitory activity from cis-cinnamic acid (cis-CA), which is crucial for phytotoxicity. By preparing and assaying a series of cis-CA analogues, it was previously found that the key features of cis-CA for lettuce root growth inhibition are a phenyl ring, cis-configuration of the alkene moiety, and carboxylic acid. On the basis of a structure-activity relationship study, the substituent effects on the aromatic ring of cis-CA were examined by systematic synthesis and the lettuce root growth inhibition assay of a series of cis-CA analogues having substituents on the aromatic ring. While ortho- and para-substituted analogues exhibited low potency in most cases, meta-substitution was not critical for potency, and analogues having a hydrophobic and sterically small substituent were more likely to be potent. Finally, several cis-CA analogues were found to be more potent root growth inhibitors than cis-CA.

  2. Synthesis and Biological Evaluation of Resveratrol Derivatives as Melanogenesis Inhibitors.

    PubMed

    Liu, Qing; Kim, CheongTaek; Jo, Yang Hee; Kim, Seon Beom; Hwang, Bang Yeon; Lee, Mi Kyeong

    2015-09-17

    Resveratrol (1), a naturally occurring stilbene compound, has been suggested as a potential whitening agent with strong inhibitory activity on melanin synthesis. However, the use of resveratrol in cosmetics has been limited due to its chemical instability and poor bioavailability. Therefore, resveratrol derivatives were prepared to improve bioavailability and anti-melanogenesis activity. Nine resveratrol derivatives including five alkyl ether derivatives with C₂H₅, C₄H₉, C₅H11, C₆H13, and C₈H17 (2a-2e) and four ester derivatives with CH₃, CH=C(CH₃)₂, CH(C₂H₅)C₄H₉, C₇H15 (3a-3d) were newly synthesized and their effect on melanin synthesis were assessed. All the synthetic derivatives efficiently reduced the melanin content in α-MSH stimulated B16F10 melanoma cells. Further investigation showed that the inhibitory effect of 2a on melanin synthesis was achieved not by the inhibition of tyrosinase activity but by the inhibition of melanogenic enzyme expressions such as tyrosinase and tyrosinase-related protein (TRP)-1. Our synthetic resveratrol derivatives have more lipophilic properties than resveratrol by the addition of alkyl or acyl chains to free hydroxyl moiety of resveratrol; thus, they are expected to show better bioavailability in skin application. Therefore, we suggest that our synthetic resveratrol derivatives might be promising candidates for better practical application to skin-whitening cosmetics.

  3. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  4. The BRAFV600E inhibitor, PLX4032, increases type I collagen synthesis in melanoma cells

    PubMed Central

    Jenkins, Molly H.; Croteau, Walburga; Mullins, David W.; Brinckerhoff, Constance E.

    2016-01-01

    Vertical growth phase (VGP) melanoma is frequently metastatic, a process mediated by changes in gene expression, which are directed by signal transduction pathways in the tumor cells. A prominent signaling pathway is the Ras-Raf-Mek-Erk MAPK pathway, which increases expression of genes that promote melanoma progression. Many melanomas harbor a mutation in this pathway, BRAFV600E, which constitutively activates MAPK signaling and expression of downstream target genes that facilitate tumor progression. In BRAFV600E melanoma, the small molecule inhibitor, vemurafenib (PLX4032), has revolutionized therapy for melanoma by inducing rapid tumor regression. This compound down-regulates the expression of many genes. However, in this study, we document that blocking the Ras-Raf-Mek-Erk MAPK pathway, either with an ERK (PLX4032) or a MEK (U1026) signaling inhibitor, in BRAFV600E human and murine melanoma cell lines increases collagen synthesis in vitro and collagen deposition in vivo. Since TGFβ signaling is a major mediator of collagen synthesis, we examined whether blocking TGFβ signaling with a small molecule inhibitor would block this increase in collagen. However, there was minimal reduction in collagen synthesis in response to blocking TGFβ signaling, suggesting additional mechanism(s), which may include activation of the p38 MAPK pathway. Presently, it is unclear whether this increased collagen synthesis and deposition in melanomas represent a therapeutic benefit or an unwanted “off target” effect of inhibiting the Ras-Raf-Erk-Mek pathway. PMID:25989506

  5. Gliotoxin: inhibitor of poliovirus RNA synthesis that blocks the viral RNA polymerase 3Dpol.

    PubMed Central

    Rodriguez, P L; Carrasco, L

    1992-01-01

    The mode of action of gliotoxin against poliovirus has been analyzed in detail. This fungal metabolite inhibits the appearance of poliovirus proteins when present from the beginning of infection but has no effect on viral translation when added at late times. In agreement with previous findings, this toxin potently inhibited the incorporation of [3H]uridine into poliovirus RNA soon after its addition to the culture medium. Analysis of the synthesis of poliovirus plus- or minus-stranded RNA in the presence of gliotoxin suggests that this compound effectively hampered both processes. This result contrasts with the mode of action of other inhibitors of poliovirus RNA synthesis, such as guanidine or flavones, that selectively block plus-stranded RNA synthesis and suggests that the target of gliotoxin differs from the target of guanidine, i.e., poliovirus protein 2C. Indeed, gliotoxin was found to be a potent inhibitor of poliovirus RNA synthesis in cell-free systems, using membranous crude replication complexes, a reaction that is not blocked by guanidine or Ro 09-0179. Moreover, in vitro activity of the purified poliovirus polymerase 3Dpol was efficiently inhibited by gliotoxin. These results indicate that this toxin acts on the poliovirus polymerase 3Dpol, providing the first description of an inhibitor of this viral enzyme. Images PMID:1372367

  6. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  7. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

    PubMed

    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

    2016-01-01

    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  8. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  9. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing.

    PubMed

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-21

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au(+) complexes, and then a class of ∼2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ∼1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au(+) complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe(3+) with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe(3+), and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs. PMID:26391420

  10. Purification, characterization, and complete amino acid sequence of a trypsin inhibitor from amaranth (Amaranthus hypochondriacus) seeds.

    PubMed Central

    Valdes-Rodriguez, S; Segura-Nieto, M; Chagolla-Lopez, A; Verver y Vargas-Cortina, A; Martinez-Gallardo, N; Blanco-Labra, A

    1993-01-01

    A protein proteinase inhibitor was purified from a seed extract of amaranth (Amaranthus hypochondriacus) by precipitation with (NH4)2SO4, gel-filtration chromatography, ion-exchange chromatography, and reverse-phase high-performance liquid chromatography. It is a 69-amino acid protein with a high content of valine, arginine, and glutamic acid, but lacking in methionine. The inhibitor has a relative molecular weight of 7400 and an isoelectric point of 7.5. It is a serine proteinase inhibitor that recognizes chymotrypsin, trypsin, and trypsin-like proteinase activities extracted from larvae of the insect Prostephanus truncatus. This inhibitor belongs to the potato-I inhibitor family, showing the closest homology (59.5%) with the Lycopersicum peruvianum trypsin inhibitor, and (51%) with the proteinase inhibitor 5 extracted from the seeds of Cucurbita maxima. The position of the lysine-aspartic acid residues present in the active site of the amaranth inhibitor are found in almost the same relative position as in the inhibitor from C. maxima. PMID:8290633

  11. Synthesis and Biological Evaluation of Botulinum Neurotoxin A Protease Inhibitors

    PubMed Central

    Li, Bing; Pai, Ramdas; Cardinale, Steven C.; Butler, Michelle M.; Peet, Norton P.; Moir, Donald T.; Bavari, Sina; Bowlin, Terry L.

    2010-01-01

    NSC 240898 was previously identified as a botulinum neurotoxin A light chain (BoNT/A LC) endopeptidase inhibitor by screening the National Cancer Institute Open Repository diversity set. Two types of analogs have been synthesized and shown to inhibit BoNT/A LC in a FRET-based enzyme assay, with confirmation in an HPLC-based assay. These two series of compounds have also been evaluated for inhibition of anthrax lethal factor (LF), an unrelated metalloprotease, to examine enzyme specificity of the BoNT/A LC inhibition. The most potent inhibitor against BoNT/A LC in these two series is compound 12 (IC50 = 2.5 µM, FRET assay), which is 4.4-fold more potent than the lead structure, and 11.2-fold more selective for BoNT/A LC versus the anthrax LF metalloproteinase. Structure-activity relationship studies have revealed structural features important to potency and enzyme specificity. PMID:20155918

  12. Synthesis and SAR of Benzisothiazole- and Indolizine-β-d-glucopyranoside Inhibitors of SGLT2

    PubMed Central

    2010-01-01

    A series of benzisothiazole- and indolizine-β-d-glucopyranoside inhibitors of human SGLT2 are described. The synthesis of the C-linked heterocyclic glucosides took advantage of a palladium-catalyzed cross-coupling reaction between a glucal boronate and the corresponding bromo heterocycle. The compounds have been evaluated for their human SGLT2 inhibition potential using cell-based functional transporter assays, and their structure−activity relationships have been described. Benzisothiazole-C-glucoside 16d was found to be an inhibitor of SGLT2 with an IC50 of 10 nM. PMID:24900169

  13. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors. PMID:26134042

  14. Synthesis, structure, and biological applications of α-fluorinated β-amino acids and derivatives.

    PubMed

    March, Taryn L; Johnston, Martin R; Duggan, Peter J; Gardiner, James

    2012-11-01

    This review gives a broad overview of the state of play with respect to the synthesis, conformational properties, and biological activity of α-fluorinated β-amino acids and derivatives. General methods are described for the preparation of monosubstituted α-fluoro-β-amino acids (Scheme 1). Nucleophilic methods for the introduction of fluorine predominantly involve the reaction of DAST with alcohols derived from α-amino acids, whereas electrophilic sources of fluorine such as NFSI have been used in conjunction with Arndt-Eistert homologation, conjugate addition or organocatalyzed Mannich reactions. α,α-Difluoro-β-amino acids have also been prepared using DAST; however, this area of synthesis is largely dominated by the use of difluorinated Reformatsky reagents to introduce the difluoro ester functionality (Scheme 9). α-Fluoro-β-amino acids and derivatives analyzed by X-ray crystal and NMR solution techniques are found to adopt preferred conformations which are thought to result from stereoelectronic effects associated with F located close to amines, amides, and esters (Figs. 2-6). α-Fluoro amide and β-fluoro ethylamide/amine effects can influence the secondary structure of α-fluoro-β-amino acid-containing derivatives including peptides and peptidomimetics (Figs. 7-9). α-Fluoro-β-amino acids are also components of a diverse range of bioactive anticancer (e.g., 5-fluorouracil), antifungal, and antiinsomnia agents as well as protease inhibitors where such fluorinated analogs have shown increased potency and spectrum of activity.

  15. Synthesis and inhibitory activity of substrate-analog fructosyl peptide oxidase inhibitors.

    PubMed

    Watanabe, Bunta; Ichiyanagi, Atsushi; Hirokawa, Kozo; Gomi, Keiko; Nakatsu, Toru; Kato, Hiroaki; Kajiyama, Naoki

    2015-09-15

    Fructosyl peptide oxidases (FPOXs) play a crucial role in the diagnosis of diabetes. Their main function is to cleave fructosyl amino acids or fructosyl peptides into glucosone and the corresponding amino acids/dipeptides. In this study, the substrate-analog FPOX inhibitors 1a-c were successfully designed and synthesized. These inhibitors mimic N(α)-fructosyl-L-valine (Fru-Val), [N(α)-fructosyl-L-valyl]-L-histidine (Fru-ValHis), and N(ε)-fructosyl-L-lysine (εFru-Lys), respectively. The secondary nitrogen atom in the natural substrates, linking fructose and amino acid or dipeptide moieties, was substituted in 1a-c with a sulfur atom to avoid enzymatic cleavage. Kinetic studies revealed that 1a-c act as competitive inhibitors against an FPOX obtained from Coniochaeta sp., and Ki values of 11.1, 66.8, and 782 μM were obtained for 1a-c, respectively.

  16. Azorhodanine derivatives as inhibitors for acidic corrosion of nickel.

    PubMed

    Fouda, Abd El-Aziz S; Al-Sarawy, Ahmed A; Omar, Tark M

    2005-01-01

    Azorhodanine derivatives (HL1-HL5) were tested as corrosion inhibitors for nickel in 2M HNO3 solution using weight loss and galvanostatic polarization techniques. The results showed that these derivatives act as inhibitors for nickel in this medium. The inhibition was assumed to occur via adsorption of the inhibitor molecule on the metal surface. Polarization measurements indicated that these compounds act as mixed-type inhibitors, but the cathode is more polarized when an external current was applied. This means that these compounds retard the rate of hydrogen evolution and the rate of dissolution of the metal. Results showed that azorhodanine derivatives are adsorbed on the nickel surface following Temkin's adsorption isotherm. The activation energy and thermodynamic parameters were calculated and discussed at different temperatures (30-45 degrees C).

  17. Synthesis of aminoalkyl-substituted aurone derivatives as acetylcholinesterase inhibitors.

    PubMed

    Lee, Young Hun; Shin, Min Cheol; Yun, Yong Don; Shin, Seo Young; Kim, Jong Min; Seo, Jeong Moo; Kim, Nam-Jung; Ryu, Jong Hoon; Lee, Yong Sup

    2015-01-01

    Alzheimer's disease (AD), a progressive and neurodegenerative disorder of the brain, is the most common cause of dementia among elderly people. To date, the successful therapeutic strategy to treat AD is maintaining the levels of acetylcholine by inhibiting acetylcholinesterase (AChE). In the present study, aurone derivatives were designed and synthesized as AChE inhibitors based on the lead structure of sulfuretin. Of those synthesized, compound 10d showed ca. 1700-fold and 6-fold higher AChE inhibitory activity than sulfuretin and galantamine, respectively. This compound also ameliorated scopolamine-induced memory deficit in mice when administered orally at the dose of 1 and 2mg/kg. PMID:25468034

  18. Amino Compounds as Inhibitors of De Novo Synthesis of Chlorobenzenes

    NASA Astrophysics Data System (ADS)

    Wang, Si-Jia; He, Pin-Jing; Lu, Wen-Tao; Shao, Li-Ming; Zhang, Hua

    2016-04-01

    The inhibitory effects of four amino compounds on the formation of chlorobenzenes (CBzs) - dioxin precursors and indicators, and the inhibitory mechanisms were explored. The results show NH4H2PO4 can decrease the total yields of CBzs (1,2di-CBz, 1,3di-CBz, 1,4di-CBz, penta-CBz and hexa-CBz) by 98.1%±1.6% and 96.1%±0.7% under air and nitrogen flow. The inhibitory effects indicated by the total yields of CBzs follow the order NH4H2PO4 > NH4HF2 > (NH4)2SO4 > NH4Br under air flow and NH4H2PO4 ≈ (NH4)2SO4 ≈ NH4HF2 >NH4Br under nitrogen flow. The inhibition mechanism revealed by thermal analysis that CuCl2 was converted to CuPO3 by reacting with NH4H2PO4 below 200 °C, which can block the transfer of chlorine and formation of C–Cl bonds at 350 °C. The effects of the other three inhibitors were weaker because their reactions with CuCl2, which form other copper compounds, and the reaction of CuCl2 with carbon, which forms C–Cl bonds, were almost simultaneous and competitive. Oxygen influenced the yield of CBzs obviously, and the total yield of five CBzs sharply increased with oxygen. Because of their high efficiency, low environmental impact, low cost, and availability, amino compounds - especially NH4H2PO4 - can be utilized as inhibitors of CBzs during incineration.

  19. Amino Compounds as Inhibitors of De Novo Synthesis of Chlorobenzenes

    PubMed Central

    Wang, Si-Jia; He, Pin-Jing; Lu, Wen-Tao; Shao, Li-Ming; Zhang, Hua

    2016-01-01

    The inhibitory effects of four amino compounds on the formation of chlorobenzenes (CBzs) - dioxin precursors and indicators, and the inhibitory mechanisms were explored. The results show NH4H2PO4 can decrease the total yields of CBzs (1,2di-CBz, 1,3di-CBz, 1,4di-CBz, penta-CBz and hexa-CBz) by 98.1%±1.6% and 96.1%±0.7% under air and nitrogen flow. The inhibitory effects indicated by the total yields of CBzs follow the order NH4H2PO4 > NH4HF2 > (NH4)2SO4 > NH4Br under air flow and NH4H2PO4 ≈ (NH4)2SO4 ≈ NH4HF2 >NH4Br under nitrogen flow. The inhibition mechanism revealed by thermal analysis that CuCl2 was converted to CuPO3 by reacting with NH4H2PO4 below 200 °C, which can block the transfer of chlorine and formation of C–Cl bonds at 350 °C. The effects of the other three inhibitors were weaker because their reactions with CuCl2, which form other copper compounds, and the reaction of CuCl2 with carbon, which forms C–Cl bonds, were almost simultaneous and competitive. Oxygen influenced the yield of CBzs obviously, and the total yield of five CBzs sharply increased with oxygen. Because of their high efficiency, low environmental impact, low cost, and availability, amino compounds - especially NH4H2PO4 - can be utilized as inhibitors of CBzs during incineration. PMID:27034259

  20. Amino Compounds as Inhibitors of De Novo Synthesis of Chlorobenzenes.

    PubMed

    Wang, Si-Jia; He, Pin-Jing; Lu, Wen-Tao; Shao, Li-Ming; Zhang, Hua

    2016-01-01

    The inhibitory effects of four amino compounds on the formation of chlorobenzenes (CBzs)--dioxin precursors and indicators, and the inhibitory mechanisms were explored. The results show NH4H2PO4 can decrease the total yields of CBzs (1,2di-CBz, 1,3di-CBz, 1,4di-CBz, penta-CBz and hexa-CBz) by 98.1%±1.6% and 96.1%±0.7% under air and nitrogen flow. The inhibitory effects indicated by the total yields of CBzs follow the order NH4H2PO4 > NH4HF2 > (NH4)2SO4 > NH4Br under air flow and NH4H2PO4 ≈ (NH4)2SO4 ≈ NH4HF2 >NH4Br under nitrogen flow. The inhibition mechanism revealed by thermal analysis that CuCl2 was converted to CuPO3 by reacting with NH4H2PO4 below 200 °C, which can block the transfer of chlorine and formation of C-Cl bonds at 350 °C. The effects of the other three inhibitors were weaker because their reactions with CuCl2, which form other copper compounds, and the reaction of CuCl2 with carbon, which forms C-Cl bonds, were almost simultaneous and competitive. Oxygen influenced the yield of CBzs obviously, and the total yield of five CBzs sharply increased with oxygen. Because of their high efficiency, low environmental impact, low cost, and availability, amino compounds--especially NH4H2PO4--can be utilized as inhibitors of CBzs during incineration.

  1. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  2. Concise Asymmetric Synthesis and Pharmacological Characterization of All Stereoisomers of Glutamate Transporter Inhibitor TFB-TBOA and Synthesis of EAAT Photoaffinity Probes.

    PubMed

    Leuenberger, Michele; Ritler, Andreas; Simonin, Alexandre; Hediger, Matthias A; Lochner, Martin

    2016-05-18

    Glutamate is the major excitatory neurotransmitter in the mammalian brain. Its rapid clearance after the release into the synaptic cleft is vital in order to avoid toxic effects and is ensured by several transmembrane transport proteins, so-called excitatory amino acid transporters (EAATs). Impairment of glutamate removal has been linked to several neurodegenerative diseases and EAATs have therefore received increased attention as therapeutic targets. O-Benzylated l-threo-β-hydroxyaspartate derivatives have been developed previously as highly potent inhibitors of EAATs with TFB-TBOA ((2S,3S)-2-amino-3-((3-(4-(trifluoromethyl)benzamido)benzyl)oxy)succinic acid) standing out as low-nanomolar inhibitor. We report the stereoselective synthesis of all four stereoisomers of TFB-TBOA in less than a fifth of synthetic steps than the published route. For the first time, the inhibitory activity and isoform selectivity of these TFB-TBOA enantio- and diastereomers were assessed on human glutamate transporters EAAT1-3. Furthermore, we synthesized potent photoaffinity probes based on TFB-TBOA using our novel synthetic strategy. PMID:26918289

  3. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  4. Synthesis and biological evaluation of analogues of the kinase inhibitor nilotinib as Abl and Kit inhibitors

    PubMed Central

    Duveau, Damien Y.; Hu, Xin; Walsh, Martin J.; Shukla, Suneet; Skoumbourdis, Amanda P.; Boxer, Matthew B.; Ambudkar, Suresh V.; Shen, Min; Thomas, Craig J.

    2013-01-01

    The importance of the trifluoromethyl group in the polypharmacological profile of nilotinib was investigated. Molecular editing of nilotinib led to the design, synthesis and biological evaluation of analogues where the trifluoromethyl group was replaced by a proton, fluorine and a methyl group. While these analogues were less active than nilotinib toward Abl, their activity toward Kit was comparable, with the monofluorinated analogue being the most active. Docking of nilotinib and of analogues 2a–c to the binding pocket of Abl and of Kit showed that the lack of shape complementarity in Kit is compensated by the stabilizing effect from its juxtamembrane region. PMID:23273517

  5. One-pot green synthesis of 1,3,5-triarylpentane-1,5-dione and triarylmethane derivatives as a new class of tyrosinase inhibitors.

    PubMed

    Zheng, Zong-Ping; Zhang, Yi-Nan; Zhang, Shuang; Chen, Jie

    2016-02-01

    A new method was developed for one-pot green synthesis 1,3,5-triarylpentane-1,5-dione, triarylmethane, and flavonoid derivatives from the reaction between 2,4-dihydroxybenzaldehyde and hydroxyacetophenones via Aldol, Michael, and Friedel-Crafts additions using boric acid as catalyst in polyethylene glycol 400. The synthetic compounds demonstrated significant tyrosinase inhibitory activities much stronger than that of kojic acid. More important, 1,3,5-triarylpentane-1,5-dione and triarylmethane derivatives were found to be a new class of tyrosinase inhibitors. PMID:26754613

  6. One-pot green synthesis of 1,3,5-triarylpentane-1,5-dione and triarylmethane derivatives as a new class of tyrosinase inhibitors.

    PubMed

    Zheng, Zong-Ping; Zhang, Yi-Nan; Zhang, Shuang; Chen, Jie

    2016-02-01

    A new method was developed for one-pot green synthesis 1,3,5-triarylpentane-1,5-dione, triarylmethane, and flavonoid derivatives from the reaction between 2,4-dihydroxybenzaldehyde and hydroxyacetophenones via Aldol, Michael, and Friedel-Crafts additions using boric acid as catalyst in polyethylene glycol 400. The synthetic compounds demonstrated significant tyrosinase inhibitory activities much stronger than that of kojic acid. More important, 1,3,5-triarylpentane-1,5-dione and triarylmethane derivatives were found to be a new class of tyrosinase inhibitors.

  7. Development of imidazole alkanoic acids as mGAT3 selective GABA uptake inhibitors.

    PubMed

    Hack, Silke; Wörlein, Babette; Höfner, Georg; Pabel, Jörg; Wanner, Klaus T

    2011-05-01

    A new series of potential GABA uptake inhibitors starting from of 1H-imidazol-4-ylacetic acid with the carboxylic acid side chain originating from different positions and varying in length have been synthesized and tested for the inhibitory potency at the four GABA uptake transporters mGAT1-4 stably expressed in HEK cells. Further two bicyclic compounds with a rigidified carboxylic acid side chain were included in this study. The results of the biological tests indicated that most ω-imidazole alkanoic and alkenoic acid derivatives exhibit the highest potencies as GABA uptake inhibitors at mGAT3.

  8. Design, synthesis and biological evaluation of sugar-derived Ras inhibitors.

    PubMed

    Peri, Francesco; Airoldi, Cristina; Colombo, Sonia; Martegani, Enzo; van Neuren, Anske Stephanie; Stein, Matthias; Marinzi, Chiara; Nicotra, Francesco

    2005-10-01

    The design and synthesis of novel Ras inhibitors with a bicyclic scaffold derived from the natural sugar D-arabinose are presented. Molecular modelling showed that these ligands can bind Ras by accommodating the aromatic moieties and the phenylhydroxylamino group in a cavity near the Switch II region of the protein. All the synthetic compounds were active in inhibiting nucleotide exchange on p21 human Ras in vitro, and two of them selectively inhibited Ras-dependent cell growth in vivo.

  9. Induction of DNA synthesis in isolated nuclei by cytoplasmic factors: inhibition by protease inhibitors

    SciTech Connect

    Wong, R.L.; Gutowski, J.K.; Katz, M.; Goldfarb, R.H.; Cohen, S.

    1987-01-01

    Cytoplasmic extracts from spontaneously proliferating and mitogen-activated lymphoid cells contain a protein factor called ADR (activator of DNA replication) that induces DNA synthesis in isolated quiescent nuclei. ADR-containing preparations have proteolytic activity, as indicated by their ability to degrade fibrin in a plasminogen-independent and plasminogen-dependent manner. In addition, aprotinin, a nonspecific protease inhibitor, abrogates ADR-induced DNA synthesis in a dose-dependent fashion. Preincubation studies demonstrated that the effect of aprotinin is not due to its suppressive effects on the nuclei themselves. Other protease inhibitors such as leupeptin, p-aminobenzamidine, and N-..cap alpha..-tosyllysine chloromethyl ketone are also inhibitory, but soybean trypsin inhibitor is without effect. ADR activity can be removed from active extracts by adsorption with aprotinin-conjugated agarose beads and can be recovered by elution with an acetate buffer (pH 5). These finding are consistent with the interpretation that the initiation of DNA synthesis in resting nuclei may be protease dependent and, further, that the cytoplasmic stimulatory factor the authors have called ADR may be a protease itself.

  10. Design, synthesis, and biological evaluation of novel, highly active soft ROCK inhibitors.

    PubMed

    Boland, Sandro; Bourin, Arnaud; Alen, Jo; Geraets, Jacques; Schroeders, Pieter; Castermans, Karolien; Kindt, Nele; Boumans, Nicki; Panitti, Laura; Fransen, Silke; Vanormelingen, Jessica; Stassen, Jean Marie; Leysen, Dirk; Defert, Olivier

    2015-05-28

    ROCK1 and ROCK2 play important roles in numerous cellular functions, including smooth muscle cell contraction, cell proliferation, adhesion, and migration. Consequently, ROCK inhibitors are of interest for treating multiple indications including cardiovascular diseases, inflammatory and autoimmune diseases, lung diseases, and eye diseases. However, systemic inhibition of ROCK is expected to result in significant side effects. Strategies allowing reduced systemic exposure are therefore of interest. In a continuing effort toward identification of ROCK inhibitors, we here report the design, synthesis, and evaluation of novel soft ROCK inhibitors displaying an ester function allowing their rapid inactivation in the systemic circulation. Those compounds display subnanomolar activity against ROCK and strong differences of functional activity between parent compounds and expected metabolites. The binding mode of a representative compound was determined experimentally in a single-crystal X-ray diffraction study. Enzymes responsible for inactivation of these compounds once they enter systemic circulation are also discussed.

  11. Synthesis and in vitro/in vivo Evaluation of the Antitrypanosomal Activity of 3-Bromoacivicin, a Potent CTP Synthetase Inhibitor

    PubMed Central

    Conti, Paola; Pinto, Andrea; Wong, Pui E; Major, Louise L; Tamborini, Lucia; Iannuzzi, Maria C; De Micheli, Carlo; Barrett, Michael P; Smith, Terry K

    2011-01-01

    Abstract The first convenient synthesis of enantiomerically pure (αS,5S)-α-amino-3-bromo-4,5-dihydroisoxazol-5-yl acetic acid (3-bromoacivicin) is described. We demonstrate that 3-bromoacivicin is a CTP synthetase inhibitor three times as potent as its 3-chloro analogue, the natural antibiotic acivicin. Because CTP synthetase was suggested to be a potential drug target in African trypanosomes, the in vitro/in vivo antitrypanosomal activity of 3-bromoacivicin was assessed in comparison with acivicin. Beyond expectation, we observed a 12-fold enhancement in the in vitro antitrypanosomal activity, while toxicity against mammalian cells remained unaffected. Despite its good in vitro activity and selectivity, 3-bromoacivicin proved to be trypanostatic and failed to completely eradicate the infection when tested in vivo at its maximum tolerable dose. PMID:21275056

  12. Microsomal triglyceride transfer protein (MTP) inhibitors: discovery of clinically active inhibitors using high-throughput screening and parallel synthesis paradigms.

    PubMed

    Chang, George; Ruggeri, Roger B; Harwood, H James

    2002-07-01

    The inhibition of microsomal triglyceride transfer protein (MTP) blocks the hepatic secretion of very low density lipoproteins (VLDL) and the intestinal secretion of chylomicrons. Consequently, this mechanism provides a highly efficacious pharmacological target for the lowering of low density lipoprotein (LDL) cholesterol and reduction of postprandial lipemia. The combination of these effects could afford unprecedented benefit in the treatment of atherosclerosis and consequent cardiovascular disease. The promise of this therapeutic target has attracted widespread interest in the pharmaceutical industry. Independent efforts have yielded strikingly similar series of lipophilic amide inhibitors. The way in which the evolutionary paths of distinct inhibitor series have tended to converge through the course of robotics-assisted synthesis efforts is illustrated with candidates from Bristol-Myers Squibb and Pfizer. Hanging in the balance with the exceptional potency of the compounds presented are the potential adverse effects due to blockage of intestinal fat absorption and hepatic lipid secretion. Finding a degree of efficacy that can be safely tolerated defines the dilemma surrounding the advancement of these compounds to clinical practice.

  13. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  14. West Nile virus replication requires fatty acid synthesis but is independent on phosphatidylinositol-4-phosphate lipids.

    PubMed

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; Jiménez de Oya, Nereida; Escribano-Romero, Estela; Saiz, Juan-Carlos

    2011-01-01

    West Nile virus (WNV) is a neurovirulent mosquito-borne flavivirus, which main natural hosts are birds but it also infects equines and humans, among other mammals. As in the case of other plus-stranded RNA viruses, WNV replication is associated to intracellular membrane rearrangements. Based on results obtained with a variety of viruses, different cellular processes have been shown to play important roles on these membrane rearrangements for efficient viral replication. As these processes are related to lipid metabolism, fatty acid synthesis, as well as generation of a specific lipid microenvironment enriched in phosphatidylinositol-4-phosphate (PI4P), has been associated to it in other viral models. In this study, intracellular membrane rearrangements following infection with a highly neurovirulent strain of WNV were addressed by means of electron and confocal microscopy. Infection of WNV, and specifically viral RNA replication, were dependent on fatty acid synthesis, as revealed by the inhibitory effect of cerulenin and C75, two pharmacological inhibitors of fatty acid synthase, a key enzyme of this process. However, WNV infection did not induce redistribution of PI4P lipids, and PI4P did not localize at viral replication complex. Even more, WNV multiplication was not inhibited by the use of the phosphatidylinositol-4-kinase inhibitor PIK93, while infection by the enterovirus Coxsackievirus B5 was reduced. Similar features were found when infection by other flavivirus, the Usutu virus (USUV), was analyzed. These features of WNV replication could help to design specific antiviral approaches against WNV and other related flaviviruses.

  15. Effects of inhibitors of key enzymes of sphingolipid metabolism on insulin-induced glucose uptake and glycogen synthesis in liver cells of old rats.

    PubMed

    Babenko, N A; Kharchenko, V S

    2015-01-01

    Sphingolipids play an important role in the development of insulin resistance. Ceramides are the most potent inhibitors of insulin signal transduction. Ceramides are generated in response to stress stimuli and in old age. In this work, we studied the possible contribution of different pathways of sphingolipid metabolism in age-dependent insulin resistance development in liver cells. Inhibition of key enzymes of sphingolipid synthesis (serine palmitoyl transferase, ceramide synthase) and degradation (neutral and acidic SMases) by means of specific inhibitors (myriocin, fumonisin B1, imipramine, and GW4869) was followed with the reduction of ceramide level and partly improved insulin regulation of glucose metabolism in "old" hepatocytes. Imipramine and GW4869 decreased significantly the acidic and neutral SMase activities, respectively. Treatment of "old" cells with myriocin or fumonisin B1 reduced the elevated in old age ceramide and SM synthesis. Ceramide and SM levels and glucose metabolism regulation by insulin could be improved with concerted action of all tested inhibitors of sphingolipid turnover on hepatocytes. The data demonstrate that not only newly synthesized ceramide and SM but also neutral and acidic SMase-dependent ceramide accumulation plays an important role in development of age-dependent insulin resistance.

  16. Enantioselective Synthesis of (+)-Chamaecypanone C, a Novel Microtubule Inhibitor**

    PubMed Central

    Dong, Suwei; Hamel, Ernest; Bai, Ruoli; Covell, David G.; Beutler, John A.; Porco, John A.

    2009-01-01

    A number of bicyclo[2.2.2]octenone-containing natural products have been isolated from the heartwood of Chamaecyparis obtusa var. formosana (Figure 1) including the Diels-Alder adducts[1] obtunone (1),[2] chamaecypanone C (2),[3] and the [4+2] dimer (+)-3.[2],[4] Compound (+)-2 was shown to exhibit potent cytotoxicity against several human cancer cells including human oral epidermoid carcinoma (KB) (IC50 = 190 nM).[3] The biosynthesis of 2 was proposed[3] to occur via endo [4+2] cycloaddition between 1-hydroxymentha-3,5-dien-2-one 4 (Figure 2) and 1,3-bis-arylcyclopenta-1,3-diene 5, followed by oxidation to an enone in accord with literature reports of cyclopentadienes as biosynthetic precursors to natural products.[1b] An alternative possibility involving the corresponding cyclopentadienone 6 as dienophile may also be considered in light of known biosyntheses involving reactive cyclopentadienones.[5] Herein, we report a concise synthesis of both enantiomers of chamaecypanone C involving a retro-DA/DA cascade of dimer 3, obtained utilizing copper-mediated asymmetric oxidative dearomatization,[6] as well as biological studies documenting that the cytotoxic action of (+)-2 involves mitotic arrest as a consequence of its binding in the colchicine site of tubulin. PMID:19140149

  17. Inhibitors of Fatty Acid Amide Hydrolase and Monoacylglycerol Lipase: New Targets for Future Antidepressants.

    PubMed

    Ogawa, Shintaro; Kunugi, Hiroshi

    2015-01-01

    Cannabis and analogs of Δ9-tetrahydrocannabinol have been used for therapeutic purposes, but their therapeutic use remains limited because of various adverse effects. Endogenous cannabinoids have been discovered, and dysregulation of endocannabinoid signaling is implicated in the pathophysiology of major depressive disorder (MDD). Recently, endocannabinoid hydrolytic enzymes such as fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL) have become new therapeutic targets in the treatment of MDD. Several FAAH or MAGL inhibitors are reported to have no cannabimimetic side effects and, therefore, are new potential therapeutic options for patients with MDD who are resistant to first-line antidepressants (selective serotonin and serotonin-norepinephrine reuptake inhibitors). In this review, we focus on the possible relationships between MDD and the endocannabinoid system as well as the inhibitors' therapeutic potential. MAGL inhibitors may reduce inflammatory responses through activation of cannabinoid receptor type 2. In the hypothalamic-pituitary-adrenal axis, repeated FAAH inhibitor administration may be beneficial for reducing circulating glucocorticoid levels. Both FAAH and MAGL inhibitors may contribute to dopaminergic system regulation. Recently, several new inhibitors have been developed with strong potency and selectivity. FAAH inhibitor, MAGL inhibitor, or dual blocker use would be promising new treatments for MDD. Further pre-clinical studies and clinical trials using these inhibitors are warranted. PMID:26630956

  18. The design and synthesis of novel N-hydroxyformamide inhibitors of ADAM-TS4 for the treatment of osteoarthritis.

    PubMed

    De Savi, Chris; Pape, Andrew; Cumming, John G; Ting, Attilla; Smith, Peter D; Burrows, Jeremy N; Mills, Mark; Davies, Chris; Lamont, Scott; Milne, David; Cook, Calum; Moore, Peter; Sawyer, Yvonne; Gerhardt, Stefan

    2011-03-01

    Two series of N-hydroxyformamide inhibitors of ADAM-TS4 were identified from screening compounds previously synthesised as inhibitors of matrix metalloproteinase-13 (collagenase-3). Understanding of the binding mode of this class of compound using ADAM-TS1 as a structural surrogate has led to the discovery of potent and very selective inhibitors with favourable DMPK properties. Synthesis, structure-activity relationships, and strategies to improve selectivity and lower in vivo metabolic clearance are described.

  19. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly.

    PubMed

    Bates, Philip D; Johnson, Sean R; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G; Ohlrogge, John B; Browse, John

    2014-01-21

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [(14)C]acetate and [(3)H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [(14)C]acetate and [(14)C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl-CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl-CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid.

  20. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  1. Design and synthesis of potent inhibitors of the malaria parasite dihydroorotate dehydrogenase.

    PubMed

    Heikkilä, Timo; Ramsey, Christopher; Davies, Matthew; Galtier, Christophe; Stead, Andrew M W; Johnson, A Peter; Fishwick, Colin W G; Boa, Andrew N; McConkey, Glenn A

    2007-01-25

    Pyrimidine biosynthesis presents an attractive drug target in malaria parasites due to the absence of a pyrimidine salvage pathway. A set of compounds designed to inhibit the Plasmodium falciparum pyrimidine biosynthetic enzyme dihydroorotate dehydrogenase (PfDHODH) was synthesized. PfDHODH-specific inhibitors with low nanomolar binding affinities were identified that bind in the N-terminal hydrophobic channel of dihydroorotate dehydrogenase, the presumed site of ubiquinone binding during oxidation of dihydroorotate to orotate. These compounds also prevented growth of cultured parasites at low micromolar concentrations. Models that suggest the mode of inhibitor binding is based on shape complementarity, matching hydrophobic regions of inhibitor and enzyme, and interaction of inhibitors with amino acid residues F188, H185, and R265 are supported by mutagenesis data. These results further highlight PfDHODH as a promising new target for chemotherapeutic intervention in prevention of malaria and provide better understanding of the factors that determine specificity over human dihydroorotate dehydrogenase.

  2. Quorum sensing in Vibrio fischeri: evidence that S-adenosylmethionine is the amino acid substrate for autoinducer synthesis.

    PubMed

    Hanzelka, B L; Greenberg, E P

    1996-09-01

    Synthesis of the autoinducer signal involved in the cell density-dependent activation of Vibrio fischeri luminescence is directed by luxI. The autoinducer is N-(3-oxohexanoyl)homoserine lactone, and little is known about its synthesis. We have measured autoinducer synthesis by amino acid auxotrophs of Escherichia coli that contained luxI on a high-copy-number plasmid. Experiments with cell suspensions starved for methionine or homoserine show that either methionine or S-adenosylmethionine but not homoserine or homoserine lactone is required for autoinducer synthesis. The S-adenosylmethionine synthesis inhibitor cycloleucine blocks methionine-dependent autoinducer synthesis. Thus, it appears that S-adenosylmethionine rather than methionine is the molecule required for autoinducer synthesis. The amount of 15N-labeled methionine incorporated into the autoinducer by growing cultures of a homoserine and a methionine auxotroph was measured by mass spectrometry. The labeling studies show that even in the presence of homoserine, almost all of the autoinducer produced contains the 15N label from methionine. Thus, it appears that S-adenosylmethionine serves as the amino acid substrate in the luxI-dependent synthesis of the V. fischeri autoinducer.

  3. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  4. Inhibitor of DNA synthesis is present in normal chicken serum

    SciTech Connect

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-03-05

    The authors have found that heat-inactivated serum (57/sup 0/C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in /sup 3/H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of /sup 3/H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both /sup 3/H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines.

  5. Kinetic investigation of erucamide synthesis using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Upadhayay, Santosh K; Singh, R P

    2008-01-01

    Fatty acid amides like erucamide are mainly used for lubrication and as slip agent to decrease friction in polymer and plastic industry. Erucamide is normally synthesized by ammonolysis of triglycerides or fatty acids at 200 degrees C and at high pressure (345-690 kPa.). However using urea in place of ammonia the economic synthesis of erucamide is possible at atmospheric pressure at approx 190 degrees C. In present investigation, the kinetics of synthesis of erucamide by ammonolysis of erucic acid has been investigated. The optimum conditions for the synthesis of erucamide have also been determined. 1:4 molar ratio of erucic acid to urea, 190 degrees C temperature and catalyst [P2O5 with (NH4)2H PO4, {(1:1) w/w }] concentration 3% (by wt. of erucic acid) were the optimum condition for synthesis of erucamide from erucic acid and can obtain a maximum yield of 92% of pure erucamide. Some other catalysts as titanium-iso -propoxide, phosphorus pent oxide were also tried but these catalysts were not economical. PMID:18685229

  6. Design, Synthesis and Characterization of a Highly Effective Inhibitor for Analog-Sensitive (as) Kinases

    PubMed Central

    Klein, Michael; Morillas, Montse; Vendrell, Alexandre; Brive, Lars; Gebbia, Marinella; Wallace, Iain M.; Giaever, Guri; Nislow, Corey; Posas, Francesc; Grøtli, Morten

    2011-01-01

    Highly selective, cell-permeable and fast-acting inhibitors of individual kinases are sought-after as tools for studying the cellular function of kinases in real time. A combination of small molecule synthesis and protein mutagenesis, identified a highly potent inhibitor (1-Isopropyl-3-(phenylethynyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine) of a rationally engineered Hog1 serine/threonine kinase (Hog1T100G). This inhibitor has been successfully used to study various aspects of Hog1 signaling, including a transient cell cycle arrest and gene expression changes mediated by Hog1 in response to stress. This study also underscores that the general applicability of this approach depends, in part, on the selectivity of the designed the inhibitor with respect to activity versus the engineered and wild type kinases. To explore this specificity in detail, we used a validated chemogenetic assay to assess the effect of this inhibitor on all gene products in yeast in parallel. The results from this screen emphasize the need for caution and for case-by-case assessment when using the Analog-Sensitive Kinase Allele technology to assess the physiological roles of kinases. PMID:21698101

  7. Synthesis, kinetic mechanism and docking studies of vanillin derivatives as inhibitors of mushroom tyrosinase.

    PubMed

    Ashraf, Zaman; Rafiq, Muhammad; Seo, Sung-Yum; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf

    2015-09-01

    The purpose of the present study was to discover the extent of contribution to antityrosinase activity by adding hydroxy substituted benzoic acid, cinnamic acid and piperazine residues to vanillin. The study showed the transformation of vanillin into esters as shown in (4a-4d), (6a-6b), and (8a-8b). In addition, the relationship between structures of these esters and their mushroom tyrosinase inhibitory activity was explored. The kinetics of inhibition on mushroom tyrosinase by these esters was also investigated. It was found that hydroxyl substituted benzoic acid derivatives were weak inhibitors; however hydroxy or chloro substituted cinnamic acid and piperazine substituted derivatives were able to induce significant tyrosinase inhibition. The mushroom tyrosinase (PDBID 2ZWE) was docked with synthesized vanillin derivatives and their calculated binding energies were compared with experimental IC50 values which provided positive correlation. The most potent derivative 2-(4-formyl-2-methoxyphenoxy)-2-oxoethyl (2E)-3-(4-hydroxyphenyl)prop-2-enoate (6a) possesses hydroxy substituted cinnamic acid scaffold having IC50 value 16.13 μM with binding energy of -7.2 kcal/mol. The tyrosinase inhibitory activity of (6a) is comparable with standard kojic acid. Kinetic analysis indicated that compound 6a was mixed-type tyrosinase inhibitor with inhibition constant values Ki (13 μM) and Ki' (53 μM) and formed reversible enzyme inhibitor complex. The active vanillin analog (6a) was devoid of toxic effects as shown in cytotoxic studies.

  8. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  9. Regulation of collagen synthesis by ascorbic acid.

    PubMed Central

    Murad, S; Grove, D; Lindberg, K A; Reynolds, G; Sivarajah, A; Pinnell, S R

    1981-01-01

    After prolonged exposure to ascorbate, collagen synthesis in cultured human skin fibroblasts increased approximately 8-fold with no significant change in synthesis of noncollagen protein. This effect of ascorbate appears to be unrelated to its cofactor function in collagen hydroxylation. The collagenous protein secreted in the absence of added ascorbate was normal in hydroxylysine but was mildly deficient in hydroxyproline. In parallel experiments, lysine hydroxylase (peptidyllysine, 2-oxoglutarate:oxygen 5-oxidoreductase, EC 1.14.11.4) activity increased 3-fold in response to ascorbate administration whereas proline hydroxylase (prolyl-glycyl-peptide, 2-oxoglutarate:oxygen oxidoreductase, EC 1.14.11.2) activity decreased considerably. These results suggest that collage polypeptide synthesis, posttranslational hydroxylations, and activities of the two hydroxylases are independently regulated by ascorbate. PMID:6265920

  10. Cholesterol synthesis inhibitors protect against platelet-activating factor-induced neuronal damage

    PubMed Central

    Bate, Clive; Rumbold, Louis; Williams, Alun

    2007-01-01

    Background Platelet-activating factor (PAF) is implicated in the neuronal damage that accompanies ischemia, prion disease and Alzheimer's disease (AD). Since some epidemiological studies demonstrate that statins, drugs that reduce cholesterol synthesis, have a beneficial effect on mild AD, we examined the effects of two cholesterol synthesis inhibitors on neuronal responses to PAF. Methods Primary cortical neurons were treated with cholesterol synthesis inhibitors (simvastatin or squalestatin) prior to incubation with different neurotoxins. The effects of these drugs on neuronal cholesterol levels and neuronal survival were measured. Immunoblots were used to determine the effects of simvastatin or squalestatin on the distribution of the PAF receptor and an enzyme linked immunoassay was used to quantify the amounts of PAF receptor. Results PAF killed primary neurons in a dose-dependent manner. Pre-treatment with simvastatin or squalestatin reduced neuronal cholesterol and increased the survival of PAF-treated neurons. Neuronal survival was increased 50% by 100 nM simvastatin, or 20 nM squalestatin. The addition of mevalonate restored cholesterol levels, and reversed the protective effect of simvastatin. Simvastatin or squalestatin did not affect the amounts of the PAF receptor but did cause it to disperse from within lipid rafts. Conclusion Treatment of neurons with cholesterol synthesis inhibitors including simvastatin and squalestatin protected neurons against PAF. Treatment caused a percentage of the PAF receptors to disperse from cholesterol-sensitive domains. These results raise the possibility that the effects of statins on neurodegenerative disease are, at least in part, due to desensitisation of neurons to PAF. PMID:17233902

  11. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  12. 4-Quinolone-3-carboxylic acids as cell-permeable inhibitors of protein tyrosine phosphatase 1B.

    PubMed

    Zhi, Ying; Gao, Li-Xin; Jin, Yi; Tang, Chun-Lan; Li, Jing-Ya; Li, Jia; Long, Ya-Qiu

    2014-07-15

    Protein tyrosine phosphatase 1B is a negative regulator in the insulin and leptin signaling pathways, and has emerged as an attractive target for the treatment of type 2 diabetes and obesity. However, the essential pharmacophore of charged phosphotyrosine or its mimetic confer low selectivity and poor cell permeability. Starting from our previously reported aryl diketoacid-based PTP1B inhibitors, a drug-like scaffold of 4-quinolone-3-carboxylic acid was introduced for the first time as a novel surrogate of phosphotyrosine. An optimal combination of hydrophobic groups installed at C-6, N-1 and C-3 positions of the quinolone motif afforded potent PTP1B inhibitors with low micromolar IC50 values. These 4-quinolone-3-carboxylate based PTP1B inhibitors displayed a 2-10 fold selectivity over a panel of PTP's. Furthermore, the bidentate inhibitors of 4-quinolone-3-carboxylic acids conjugated with aryl diketoacid or salicylic acid were cell permeable and enhanced insulin signaling in CHO/hIR cells. The kinetic studies and molecular modeling suggest that the 4-quinolone-3-carboxylates act as competitive inhibitors by binding to the PTP1B active site in the WPD loop closed conformation. Taken together, our study shows that the 4-quinolone-3-carboxylic acid derivatives exhibit improved pharmacological properties over previously described PTB1B inhibitors and warrant further preclinical studies.

  13. Inhibitors of Fatty Acid Amide Hydrolase and Monoacylglycerol Lipase: New Targets for Future Antidepressants

    PubMed Central

    Ogawa, Shintaro; Kunugi, Hiroshi

    2015-01-01

    Cannabis and analogs of Δ9-tetrahydrocannabinol have been used for therapeutic purposes, but their therapeutic use remains limited because of various adverse effects. Endogenous cannabinoids have been discovered, and dysregulation of endocannabinoid signaling is implicated in the pathophysiology of major depressive disorder (MDD). Recently, endocannabinoid hydrolytic enzymes such as fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL) have become new therapeutic targets in the treatment of MDD. Several FAAH or MAGL inhibitors are reported to have no cannabimimetic side effects and, therefore, are new potential therapeutic options for patients with MDD who are resistant to first-line antidepressants (selective serotonin and serotonin-norepinephrine reuptake inhibitors). In this review, we focus on the possible relationships between MDD and the endocannabinoid system as well as the inhibitors’ therapeutic potential. MAGL inhibitors may reduce inflammatory responses through activation of cannabinoid receptor type 2. In the hypothalamic–pituitary–adrenal axis, repeated FAAH inhibitor administration may be beneficial for reducing circulating glucocorticoid levels. Both FAAH and MAGL inhibitors may contribute to dopaminergic system regulation. Recently, several new inhibitors have been developed with strong potency and selectivity. FAAH inhibitor, MAGL inhibitor, or dual blocker use would be promising new treatments for MDD. Further pre-clinical studies and clinical trials using these inhibitors are warranted. PMID:26630956

  14. 2-aminohydroxamic acid derivatives as inhibitors of Bacillus cereus phosphatidylcholine preferred phospholipase C PC-PLC(Bc).

    PubMed

    González-Bulnes, Patricia; González-Roura, Albert; Canals, Daniel; Delgado, Antonio; Casas, Josefina; Llebaria, Amadeu

    2010-12-15

    Phosphatidylcholine preferring phospholipase C (PC-PLC) is an important enzyme that plays a key role in a variety of cellular events and lipid homoeostases. Bacillus cereus phospholipase C (PC-PLC(Bc)) has antigenic similarity with the elusive mammalian PC-PLC, which has not thus far been isolated and purified. Therefore the discovery of inhibitors of PC-PLC(Bc) is of current interest. Here, we describe the synthesis and biological evaluation of a new type of compounds inhibiting PC-PLC(Bc). These compounds have been designed by evolution of previously described 2-aminohydroxamic acid PC-PLC(Bc) inhibitors that block the enzyme by coordination of the zinc active site atoms present in PC-PLC(Bc) [Gonzalez-Roura, A.; Navarro, I.; Delgado, A.; Llebaria, A.; Casas, J. Angew. Chem. Int. Ed.2004, 43, 862]. The new compounds maintain the zinc coordinating groups and possess an extra trimethylammonium function, linked to the hydroxyamide nitrogen by an alkyl chain, which is expected to mimic the trimethylammonium group of the phosphatidylcholine PC-PLC(Bc) substrates. Some of the compounds described inhibit the enzyme with IC(50)'s in the low micromolar range. Unexpectedly, the most potent inhibitors found are those that possess a trimethylammonium group but have chemically blocked the zinc coordinating functionalities. The results obtained suggest that PC-PLC(Bc) inhibition is not due to the interaction of compounds with the phospholipase catalytic zinc atoms, but rather results from the inhibitor cationic group recognition by the PC-PLC(Bc) amino acids involved in choline lipid binding.

  15. Towards the synthesis of bisubstrate inhibitors of protein farnesyltransferase: Synthesis and biological evaluation of new farnesylpyrophosphate analogues.

    PubMed

    Duez, Stéphanie; Coudray, Laëtitia; Mouray, Elisabeth; Grellier, Philippe; Dubois, Joëlle

    2010-01-15

    Protein farnesyltransferase (FTase) has recently appeared as a new target of parasitic diseases, a field poor in drugs in development. With the aim of creating new bisubstrate inhibitors of FTase, new farnesyl pyrophosphate analogues have been studied. Farnesyl analogues with a malonic acid function exhibited the best inhibitory activity on FTase. This group was introduced into our imidazole-containing model leading to new compounds with submicromolar activities. Kinetic experiments have been realized to determine their binding mode to the enzyme.

  16. Inhibitors

    MedlinePlus

    ... Community Counts Blood Safety Inhibitors Articles & Key Findings Free Materials Videos Starting the Conversation Playing it Safe A Look at Hemophilia Joint Range of Motion My Story Links to Other Websites ...

  17. In Organello Transcription in Maize Mitochondria and Its Sensitivity to Inhibitors of RNA Synthesis 1

    PubMed Central

    Finnegan, Patrick M.; Brown, Gregory G.

    1987-01-01

    Purified mitochondrial preparations from etiolated maize shoots support the incorporation of radioactivity from labeled UTP into RNA. The incorporation is linear with time for up to 2 hours, shows Michaelis-Menton kinetics with respect to the concentration of the labeled substrate, UTP, and has salt and pH optima which are different than those previously reported for RNA synthesis by isolated chloroplasts. When a crude mitochondrial preparation is subjected to isopycnic sucrose gradient centrifugation, the bulk of the RNA synthetic activity co-sediments with mitochondrial marker enzymes and with the mitochondrial 26S and 18S rRNAs. Maize mitochondrial RNA synthesis is prevented by actinomycin D and ethidium bromide but unaffected by α-amanitin. It is strongly inhibited by rifampicin at concentrations which have no effect on nuclear and chloroplast RNA synthesis, but only moderately inhibited by rifampicin at concentrations which completely inhibit bacterial RNA synthesis. The optimization, cell fractionation, and inhibitor data all suggest that contaminating organelles and bacteria do not contribute appreciably to the RNA synthesis in purified mitochondrial preparations. Images Fig. 4 PMID:16665676

  18. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  19. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  20. Fat Metabolism in Higher Plants. XXXIV. Development of Fatty Acid Synthetase as a Function of Protein Synthesis in Aging Potato Tuber Slices

    PubMed Central

    Willemot, Claude; Stumpf, P. K.

    1967-01-01

    Experiments with inhibitors of protein synthesis (actinomycin D, puromycin, actidione) showed that the increase and the change in fatty acid synthetase activity, observed during the aging of potato disks, were accompanied by and related to a temporary rise in the rate of protein and RNA synthesis. These results concur with the earlier suggestion by Click and Hackett that the aging process involves a type of derepression. A possible course of events during aging, and possible derepression mechanisms are suggested and discussed. PMID:6045298

  1. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains.

  2. Lichen secondary metabolite evernic acid as potential quorum sensing inhibitor against Pseudomonas aeruginosa.

    PubMed

    Gökalsın, Barış; Sesal, Nüzhet Cenk

    2016-09-01

    Cystic Fibrosis is a genetic disease and it affects the respiratory and digestive systems. Pseudomonas aeruginosa infections in Cystic Fibrosis are presented as the main cause for high mortality and morbidity rates. Pseudomonas aeruginosa populations can regulate their virulence gene expressions via the bacterial communication system: quorum sensing. Inhibition of quorum sensing by employing quorum sensing inhibitors can leave the bacteria vulnerable. Therefore, determining natural sources to obtain potential quorum sensing inhibitors is essential. Lichens have ethnobotanical value for their medicinal properties and it is possible that their secondary metabolites have quorum sensing inhibitor properties. This study aims to investigate an alternative treatment approach by utilizing lichen secondary metabolite evernic acid to reduce the expressions of Pseudomonas aeruginosa virulence factors by inhibiting quorum sensing. For this purpose, fluorescent monitor strains were utilized for quorum sensing inhibitor screens and quantitative reverse-transcriptase PCR analyses were conducted for comparison. Results indicate that evernic acid is capable of inhibiting Pseudomonas aeruginosa quorum sensing systems.

  3. Identification of small molecule sulfonic acids as ecto-5'-Nucleotidase inhibitors.

    PubMed

    Raza, Rabia; Saeed, Aamer; Lecka, Joanna; Sévigny, Jean; Iqbal, Jamshed

    2012-11-01

    Ecto-5'-Nucleotidase inhibitors have great potential as anti-tumor agents. We have investigated biochemical properties of human and rat ecto-5'-Nucleotidases and characterized 19 small molecule sulfonic acid derivatives as potential inhibitors of ecto-5'-Nucleotidases. We identified 11 potent inhibitors of human and rat ecto-5'-Nucleotidases and checked their selectivity. Compound 10 (Sodium 2,4-dinitrobenzenesulfonate) with K(i) value of 0.66 μM and 19 (N-(4-sulfamoylphenylcarbamothioyl) pivalamide) with K(i) value of 0.78 μM were identified as the most potent inhibitors for human and rat ecto-5'-Nucleotidase, respectively. The present compounds have low molecular weights, water solubility and equal potency as compared to the reported inhibitors.

  4. The identification of translesion DNA synthesis regulators: Inhibitors in the spotlight.

    PubMed

    Bertolin, A P; Mansilla, S F; Gottifredi, V

    2015-08-01

    Over the past half-century, we have become increasingly aware of the ubiquity of DNA damage. Under the constant exposure to exogenous and endogenous genomic stress, cells must attempt to replicate damaged DNA. The encounter of replication forks with DNA lesions triggers several cellular responses, including the activation of translesion DNA synthesis (TLS), which largely depends upon specialized DNA polymerases with flexible active sites capable of accommodating bulky DNA lesions. A detrimental aspect of TLS is its intrinsic mutagenic nature, and thus the activity of the TLS polymerases must ideally be restricted to synthesis on damaged DNA templates. Despite their potential clinical importance in chemotherapy, TLS inhibitors have been difficult to identify since a direct assay designed to quantify genomic TLS events is still unavailable. Herein we discuss the methods that have been used to validate TLS inhibitors such as USP1, p21 and Spartan, highlighting research that has revealed their contribution to the control of DNA synthesis on damaged and undamaged templates.

  5. A Two-Step Synthesis of Virstatin, a Virulence Inhibitor of "Vibrio cholerae"

    ERIC Educational Resources Information Center

    McDonald, Chriss E.

    2009-01-01

    Virstatin, an "N"-butanoic acid substituted naphthalimide, inhibits the ability of "Vibrio cholerae" to cause disease. A three-week experiment involving synthesis, purification, and spectral characterization of this compound is described. This experiment is appropriate for organic chemistry. It has been performed with three lab sections of about…

  6. Synthesis, antiviral activity, and bioavailability studies of gamma-lactam derived HIV protease inhibitors.

    PubMed

    Hungate, R W; Chen, J L; Starbuck, K E; Vacca, J P; McDaniel, S L; Levin, R B; Dorsey, B D; Guare, J P; Holloway, M K; Whitter, W

    1994-09-01

    Incorporation of a gamma-lactam in hydroxyethylene isosteres results in modest inhibitors of HIV-1 protease. Additional structural activity studies have produced significantly more potent inhibitors with the introduction of the trisubstituted cyclopentane (see compound 20) as the optimum substituent for the C-terminus. This new amino acid amide surrogate can be readily prepared in large scale from (R)-pulegone. Optimized compounds (36) and (60) are potent antiviral agents and are well absorbed (15-20%) in a dog model after oral administration. PMID:7712123

  7. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  8. Synthesis of the proteinase inhibitor LEKTI domain 6 by the fragment condensation method and regioselective disulfide bond formation.

    PubMed

    Vasileiou, Zoe; Barlos, Kostas K; Gatos, Dimitrios; Adermann, Knut; Deraison, Celine; Barlos, Kleomenis

    2010-01-01

    Proteinase inhibitors are of high pharmaceutical interest and are drug candidates for a variety of indications. Specific kallikrein inhibitors are important for their antitumor activity and their potential application to the treatment of skin diseases. In this study we describe the synthesis of domain 6 of the kallikrein inhibitor Lympho-Epithilial Kazal-Type Inhibitor (LEKTI) by the fragment condensation method and site-directed cystine bridge formation. To obtain the linear LEKTI precursor, the condensation was best performed in solution, coupling the protected fragment 1-22 to 23-68. This method yielded LEKTI domain 6 of high purity and equipotent to the recombinantly produced peptide. PMID:20069636

  9. Rapamycin Inhibits Expression of Elongation of Very-long-chain Fatty Acids 1 and Synthesis of Docosahexaenoic Acid in Bovine Mammary Epithelial Cells

    PubMed Central

    Guo, Zhixin; Wang, Yanfeng; Feng, Xue; Bao, Chaogetu; He, Qiburi; Bao, Lili; Hao, Huifang; Wang, Zhigang

    2016-01-01

    Mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of cell growth and metabolism and is sufficient to induce specific metabolic processes, including de novo lipid biosynthesis. Elongation of very-long-chain fatty acids 1 (ELOVL1) is a ubiquitously expressed gene and the product of which was thought to be associated with elongation of carbon (C) chain in fatty acids. In the present study, we examined the effects of rapamycin, a specific inhibitor of mTORC1, on ELOVL1 expression and docosahexaenoic acid (DHA, C22:6 n-3) synthesis in bovine mammary epithelial cells (BMECs). We found that rapamycin decreased the relative abundance of ELOVL1 mRNA, ELOVL1 expression and the level of DHA in a time-dependent manner. These data indicate that ELOVL1 expression and DHA synthesis are regulated by mTORC1 in BMECs. PMID:26954224

  10. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  11. A crystallographic fragment screen identifies cinnamic acid derivatives as starting points for potent Pim-1 inhibitors.

    PubMed

    Schulz, Michèle N; Fanghänel, Jörg; Schäfer, Martina; Badock, Volker; Briem, Hans; Boemer, Ulf; Nguyen, Duy; Husemann, Manfred; Hillig, Roman C

    2011-03-01

    A crystallographic fragment screen was carried out to identify starting points for the development of inhibitors of protein kinase Pim-1, a potential target for tumour therapy. All fragment hits identified via soaking in this study turned out to bind to the unusually hydrophobic pocket at the hinge region. The most potent fragments, two cinnamic acid derivatives (with a best IC(50) of 130 µM), additionally form a well defined hydrogen bond. The balance between hydrophobic and polar interactions makes these molecules good starting points for further optimization. Pim-2 inhibitors from a recently reported high-throughput screening campaign also feature a cinnamic acid moiety. Two of these Pim-2 inhibitors were synthesized, their potencies against Pim-1 were determined and their cocrystal structures were elucidated in order to determine to what degree the binding modes identified by fragment screening are conserved in optimized inhibitors. The structures show that the cinnamic acid moieties indeed adopt the same binding mode. Fragment screening thus correctly identified binding modes which are maintained when fragments are grown into larger and higher affinity inhibitors. The high-throughput screening-derived compound (E)-3-{3-[6-(4-aminocyclohexylamino)-pyrazin-2-yl]phenyl}acrylic acid (compound 1) is the most potent inhibitor of the cinnamic acid series for which the three-dimensional binding mode is known (IC(50) = 17 nM, K(d) = 28 nM). The structure reveals the molecular basis for the large gain in potency between the initial fragment hit and this optimized inhibitor.

  12. Synthesis of sulfonate analogs of bile acids.

    PubMed

    Kihira, K; Mikami, T; Ikawa, S; Okamoto, A; Yoshii, M; Miki, S; Mosbach, E H; Hoshita, T

    1992-04-01

    Sulfonate analogs of C23 and C24 bile acids were synthesized from norcholic, norchenodeoxycholic, norursodeoxycholic, nordeoxycholic, norhyodeoxycholic, cholic, deoxycholic, hyodeoxycholic, and lithocholic acids. The principal reactions used were (1) reduction of the bile acids with NaBH4 to the corresponding bile alcohols, (2) selective tosylation of the terminal hydroxyl group, (3) iodination of the tosyl esters with NaI, and (4) treatment of the iodides with Na2SO3 to form the sulfonate analogs of the bile acids. The sulfonate analogs showed polarity similar to that of taurine-conjugated bile acids on thin-layer chromatography. The carbon 13 nuclear magnetic resonance spectral data for the sulfonate analogs were tabulated.

  13. Synthesis of kojic acid derivatives as secondary binding site probes of D-amino acid oxidase

    PubMed Central

    Raje, Mithun; Hin, Niyada; Duvall, Bridget; Ferraris, Dana V.; Berry, James F.; Thomas, Ajit G.; Alt, Jesse; Rojas, Camilo; Slusher, Barbara S.; Tsukamoto, Takashi

    2013-01-01

    A series of kojic acid (5-hydroxy-2-hydroxymethyl-4H-pyran-4-one) derivatives were synthesized and tested for their ability to inhibit D-amino acid oxidase (DAAO). Various substituents were incorporated into kojic acid at its 2-hydroxymethyl group. These analogs serve as useful molecular probes to explore the secondary binding site, which can be exploited in designing more potent DAAO inhibitors. PMID:23683589

  14. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  15. The juxtamembrane sequence of the Hepatitis C virus polymerase can affect RNA synthesis and inhibition by allosteric polymerase inhibitors.

    PubMed

    Wen, Y; Lin, X; Fan, B; Ranjith-Kumar, C T; Kao, C C

    2015-08-01

    The Hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp), nonstructural protein 5B (NS5B), is anchored in the membrane through a C-terminal helix. A sequence of ca. 12 residues that connects the catalytically competent portion of the RdRp and the C-terminal helix, the juxtamembrane sequence (JMS), has a poorly defined role in RdRp function in a large part since it is translated from a cis-acting RNA element (CRE) that is essential for HCV replication. Using a HCV replicon that transposed a second copy of CRE to the 3' UTR of the HCV replicon, we demonstrate that amino acid substitutions in the JMS were detrimental for HCV replicon replication. Substitutions in the JMS also resulted in a defect in de novo-initiated RNAs synthesis in vitro and in a cell-based reporter assay. A nonnucleoside inhibitor of the NS5B that binds to the catalytic pocket was less potent in inhibiting NS5B in the presence of JMS mutations. The JMS mutants exhibit reduced stability in thermodenaturation assays, suggesting that the JMS helps confer a more stable conformation to NS5B that could impact RNA synthesis. PMID:25895103

  16. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  17. Synthesis and characterization of potent inhibitors of Trypanosoma cruzi dihydrofolate reductase

    SciTech Connect

    Schormann, Norbert; Velu, Sadanandan E.; Murugesan, Srinivasan; Senkovich, Olga; Walker, Kiera; Chenna, Bala C.; Shinkre, Bidhan; Desai, Amar; Chattopadhyay, Debasish

    2010-09-17

    Dihydrofolate reductase (DHFR) of the parasite Trypanosoma cruzi (T. cruzi) is a potential target for developing drugs to treat Chagas disease. We have undertaken a detailed structure-activity study of this enzyme. We report here synthesis and characterization of six potent inhibitors of the parasitic enzyme. Inhibitory activity of each compound was determined against T. cruzi and human DHFR. One of these compounds, ethyl 4-(5-[(2,4-diamino-6-quinazolinyl)methyl]amino-2-methoxyphenoxy)butanoate (6b) was co-crystallized with the bifunctional dihydrofolate reductase-thymidylate synthase enzyme of T. cruzi and the crystal structure of the ternary enzyme:cofactor:inhibitor complex was determined. Molecular docking was used to analyze the potential interactions of all inhibitors with T. cruzi DHFR and human DHFR. Inhibitory activities of these compounds are discussed in the light of enzyme-ligand interactions. Binding affinities of each inhibitor for the respective enzymes were calculated based on the experimental or docked binding mode. An estimated 60-70% of the total binding energy is contributed by the 2,4-diaminoquinazoline scaffold.

  18. Inhibitors of the Hydrolytic Enzyme Dimethylarginine Dimethylaminohydrolase (DDAH): Discovery, Synthesis and Development.

    PubMed

    Murphy, Rhys B; Tommasi, Sara; Lewis, Benjamin C; Mangoni, Arduino A

    2016-01-01

    Dimethylarginine dimethylaminohydrolase (DDAH) is a highly conserved hydrolytic enzyme found in numerous species, including bacteria, rodents, and humans. In humans, the DDAH-1 isoform is known to metabolize endogenous asymmetric dimethylarginine (ADMA) and monomethyl arginine (l-NMMA), with ADMA proposed to be a putative marker of cardiovascular disease. Current literature reports identify the DDAH family of enzymes as a potential therapeutic target in the regulation of nitric oxide (NO) production, mediated via its biochemical interaction with the nitric oxide synthase (NOS) family of enzymes. Increased DDAH expression and NO production have been linked to multiple pathological conditions, specifically, cancer, neurodegenerative disorders, and septic shock. As such, the discovery, chemical synthesis, and development of DDAH inhibitors as potential drug candidates represent a growing field of interest. This review article summarizes the current knowledge on DDAH inhibition and the derived pharmacokinetic parameters of the main DDAH inhibitors reported in the literature. Furthermore, current methods of development and chemical synthetic pathways are discussed. PMID:27187323

  19. Synthesis and biological evaluation of a new family of anti-benzylanilinosulfonamides as CA IX inhibitors.

    PubMed

    Thiry, Anne; Delayen, Aurélie; Goossens, Laurence; Houssin, Raymond; Ledecq, Marie; Frankart, Aurélie; Dogné, Jean-Michel; Wouters, Johan; Supuran, Claudiu T; Hénichart, Jean-Pierre; Masereel, Bernard

    2009-02-01

    We report the synthesis and the pharmacological evaluation of a new class of human carbonic anhydrase (hCA) inhibitors prepared regio- and stereoselectively by reacting sulfanilamide with ethyl trans-phenylglycidate in the presence of cobalt(II) chloride. Various derivatizations of the ester moiety in the parent compound led to a small library of derivatives (2R,3R and 2S,3S) which displayed interesting inhibitory activities towards the human tumor-associated isoform CA IX. One of the new compounds shows high selectivity in inhibiting hCA IX compared to the two physiologically relevant, cytosolic isozymes hCA I and hCA II. A molecular modeling study was conducted in order to simulate the binding mode of this new family of enzyme inhibitors within the active sites of hCA IX and hCA II. PMID:18479784

  20. Synthesis of Novel Tricyclic Chromenone-Based Inhibitors of IRE-1 RNase Activity

    PubMed Central

    2015-01-01

    Inositol-requiring enzyme 1 (IRE-1) is a kinase/RNase ER stress sensor that is activated in response to excessive accumulation of unfolded proteins, hypoxic conditions, calcium imbalance, and other stress stimuli. Activation of IRE-1 RNase function exerts a cytoprotective effect and has been implicated in the progression of cancer via increased expression of the transcription factor XBP-1s. Here, we describe the synthesis and biological evaluation of novel chromenone-based covalent inhibitors of IRE-1. Preparation of a family of 8-formyltetrahydrochromeno[3,4-c]pyridines was achieved via a Duff formylation that is attended by an unusual cyclization reaction. Biological evaluation in vitro and in whole cells led to the identification of 30 as a potent inhibitor of IRE-1 RNase activity and XBP-1s expression in wild type B cells and human mantle cell lymphoma cell lines. PMID:24749861

  1. Solanocapsine derivatives as potential inhibitors of acetylcholinesterase: Synthesis, molecular docking and biological studies.

    PubMed

    García, Manuela E; Borioni, José L; Cavallaro, Valeria; Puiatti, Marcelo; Pierini, Adriana B; Murray, Ana P; Peñéñory, Alicia B

    2015-12-01

    The investigation of natural products in medicinal chemistry is essential today. In this context, acetylcholinesterase (AChE) inhibitors comprise one type of the compounds most actively studied in the search for an effective treatment of symptoms of Alzheimer's disease. This work describes the isolation of a natural compound, solanocapsine, the preparation of its chemical derivatives, the evaluation of AChE inhibitory activity, and the structure-activity analysis of relevant cases. The influence of structural variations on the inhibitory potency was carefully investigated by modifying different reactive parts of the parent molecule. A theoretical study was also carried out into the binding mode of representative compounds to the enzyme through molecular modeling. The biological properties of the series were investigated. Through this study valuable information was obtained of steroidal alkaloid-type compounds as a starting point for the synthesis of AChE inhibitors. PMID:26362598

  2. Inhibitors of the Hydrolytic Enzyme Dimethylarginine Dimethylaminohydrolase (DDAH): Discovery, Synthesis and Development.

    PubMed

    Murphy, Rhys B; Tommasi, Sara; Lewis, Benjamin C; Mangoni, Arduino A

    2016-01-01

    Dimethylarginine dimethylaminohydrolase (DDAH) is a highly conserved hydrolytic enzyme found in numerous species, including bacteria, rodents, and humans. In humans, the DDAH-1 isoform is known to metabolize endogenous asymmetric dimethylarginine (ADMA) and monomethyl arginine (l-NMMA), with ADMA proposed to be a putative marker of cardiovascular disease. Current literature reports identify the DDAH family of enzymes as a potential therapeutic target in the regulation of nitric oxide (NO) production, mediated via its biochemical interaction with the nitric oxide synthase (NOS) family of enzymes. Increased DDAH expression and NO production have been linked to multiple pathological conditions, specifically, cancer, neurodegenerative disorders, and septic shock. As such, the discovery, chemical synthesis, and development of DDAH inhibitors as potential drug candidates represent a growing field of interest. This review article summarizes the current knowledge on DDAH inhibition and the derived pharmacokinetic parameters of the main DDAH inhibitors reported in the literature. Furthermore, current methods of development and chemical synthetic pathways are discussed.

  3. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  4. Phenotypic Screening Identifies Protein Synthesis Inhibitors as H-Ras-Nanocluster-Increasing Tumor Growth Inducers.

    PubMed

    Najumudeen, Arafath K; Posada, Itziar M D; Lectez, Benoit; Zhou, Yong; Landor, Sebastian K-J; Fallarero, Adyary; Vuorela, Pia; Hancock, John; Abankwa, Daniel

    2015-12-15

    Ras isoforms H-, N-, and K-ras are each mutated in specific cancer types at varying frequencies and have different activities in cell fate control. On the plasma membrane, Ras proteins are laterally segregated into isoform-specific nanoscale signaling hubs, termed nanoclusters. As Ras nanoclusters are required for Ras signaling, chemical modulators of nanoclusters represent ideal candidates for the specific modulation of Ras activity in cancer drug development. We therefore conducted a chemical screen with commercial and in-house natural product libraries using a cell-based H-ras-nanoclustering FRET assay. Next to established Ras inhibitors, such as a statin and farnesyl-transferase inhibitor, we surprisingly identified five protein synthesis inhibitors as positive regulators. Using commonly employed cycloheximide as a representative compound, we show that protein synthesis inhibition increased nanoclustering and effector recruitment specifically of active H-ras but not of K-ras. Consistent with these data, cycloheximide treatment activated both Erk and Akt kinases and specifically promoted H-rasG12V-induced, but not K-rasG12V-induced, PC12 cell differentiation. Intriguingly, cycloheximide increased the number of mammospheres, which are enriched for cancer stem cells. Depletion of H-ras in combination with cycloheximide significantly reduced mammosphere formation, suggesting an exquisite synthetic lethality. The potential of cycloheximide to promote tumor cell growth was also reflected in its ability to increase breast cancer cell tumors grown in ovo. These results illustrate the possibility of identifying Ras-isoform-specific modulators using nanocluster-directed screening. They also suggest an unexpected feedback from protein synthesis inhibition to Ras signaling, which might present a vulnerability in certain tumor cell types. PMID:26568031

  5. Phenotypic Screening Identifies Protein Synthesis Inhibitors as H-Ras-Nanocluster-Increasing Tumor Growth Inducers.

    PubMed

    Najumudeen, Arafath K; Posada, Itziar M D; Lectez, Benoit; Zhou, Yong; Landor, Sebastian K-J; Fallarero, Adyary; Vuorela, Pia; Hancock, John; Abankwa, Daniel

    2015-12-15

    Ras isoforms H-, N-, and K-ras are each mutated in specific cancer types at varying frequencies and have different activities in cell fate control. On the plasma membrane, Ras proteins are laterally segregated into isoform-specific nanoscale signaling hubs, termed nanoclusters. As Ras nanoclusters are required for Ras signaling, chemical modulators of nanoclusters represent ideal candidates for the specific modulation of Ras activity in cancer drug development. We therefore conducted a chemical screen with commercial and in-house natural product libraries using a cell-based H-ras-nanoclustering FRET assay. Next to established Ras inhibitors, such as a statin and farnesyl-transferase inhibitor, we surprisingly identified five protein synthesis inhibitors as positive regulators. Using commonly employed cycloheximide as a representative compound, we show that protein synthesis inhibition increased nanoclustering and effector recruitment specifically of active H-ras but not of K-ras. Consistent with these data, cycloheximide treatment activated both Erk and Akt kinases and specifically promoted H-rasG12V-induced, but not K-rasG12V-induced, PC12 cell differentiation. Intriguingly, cycloheximide increased the number of mammospheres, which are enriched for cancer stem cells. Depletion of H-ras in combination with cycloheximide significantly reduced mammosphere formation, suggesting an exquisite synthetic lethality. The potential of cycloheximide to promote tumor cell growth was also reflected in its ability to increase breast cancer cell tumors grown in ovo. These results illustrate the possibility of identifying Ras-isoform-specific modulators using nanocluster-directed screening. They also suggest an unexpected feedback from protein synthesis inhibition to Ras signaling, which might present a vulnerability in certain tumor cell types.

  6. The Fatty Acid Synthase Inhibitor Platensimycin Improves Insulin Resistance without Inducing Liver Steatosis in Mice and Monkeys

    PubMed Central

    Nawrocki, Andrea R.; Zhou, Dan; Wu, Margaret; Previs, Stephen; Miller, Corey; Liu, Haiying; Hines, Catherine D. G.; Madeira, Maria; Cao, Jin; Herath, Kithsiri; Wang, Liangsu; Kelley, David E.; Li, Cai

    2016-01-01

    Objectives Platensimycin (PTM) is a natural antibiotic produced by Streptomyces platensis that selectively inhibits bacterial and mammalian fatty acid synthase (FAS) without affecting synthesis of other lipids. Recently, we reported that oral administration of PTM in mouse models (db/db and db/+) with high de novo lipogenesis (DNL) tone inhibited DNL and enhanced glucose oxidation, which in turn led to net reduction of liver triglycerides (TG), reduced ambient glucose, and improved insulin sensitivity. The present study was conducted to explore translatability and the therapeutic potential of FAS inhibition for the treatment of diabetes in humans. Methods We tested PTM in animal models with different DNL tones, i.e. intrinsic synthesis rates, which vary among species and are regulated by nutritional and disease states, and confirmed glucose-lowering efficacy of PTM in lean NHPs with quantitation of liver lipid by MRS imaging. To understand the direct effect of PTM on liver metabolism, we performed ex vivo liver perfusion study to compare FAS inhibitor and carnitine palmitoyltransferase 1 (CPT1) inhibitor. Results The efficacy of PTM is generally reproduced in preclinical models with DNL tones comparable to humans, including lean and established diet-induced obese (eDIO) mice as well as non-human primates (NHPs). Similar effects of PTM on DNL reduction were observed in lean and type 2 diabetic rhesus and lean cynomolgus monkeys after acute and chronic treatment of PTM. Mechanistically, PTM lowers plasma glucose in part by enhancing hepatic glucose uptake and glycolysis. Teglicar, a CPT1 inhibitor, has similar effects on glucose uptake and glycolysis. In sharp contrast, Teglicar but not PTM significantly increased hepatic TG production, thus caused liver steatosis in eDIO mice. Conclusions These findings demonstrate unique properties of PTM and provide proof-of-concept of FAS inhibition having potential utility for the treatment of diabetes and related metabolic

  7. Optimization of amino acid thioesters as inhibitors of metallo-β-lactamase L1.

    PubMed

    Liu, Xiao-Long; Yang, Ke-Wu; Zhang, Yue-Juan; Ge, Ying; Xiang, Yang; Chang, Ya-Nan; Oelschlaeger, Peter

    2016-10-01

    The emergence of antibiotic resistance caused by metallo-β-lactamases (MβLs) is a global public health problem. Recently, we found amino acid thioesters to be a highly promising scaffold for inhibitors of the MβL L1. In order to optimize this series of inhibitors, nine new amino acid thioesters were developed by modifying the substituents on the N-terminus of the thioesters and the groups representing the amino acid side chain. Biological activity assays indicate that all of them are very potent inhibitors of L1 with an IC50 value range of 20-600nM, lower than those of most of the previously reported inhibitors of this scaffold. Analysis of structure-activity relationship reveals that big hydrophobic substituents on the N-terminus and a methionine amino acid side chain improves inhibitory activity of the thioesters. All these inhibitors are able to restore antibacterial activity of a β-lactam antibiotic against Escherichia coli BL21(DE3) cells producing L1 to that against E. coli cells lacking a β-lactamase. Docking studies reveal that a large N-terminal hydrophobic group results in a slightly different binding mode than smaller hydrophobic groups at the same position. PMID:27595424

  8. Inhibitors of amino acids biosynthesis as antifungal agents.

    PubMed

    Jastrzębowska, Kamila; Gabriel, Iwona

    2015-02-01

    Fungal microorganisms, including the human pathogenic yeast and filamentous fungi, are able to synthesize all proteinogenic amino acids, including nine that are essential for humans. A number of enzymes catalyzing particular steps of human-essential amino acid biosynthesis are fungi specific. Numerous studies have shown that auxotrophic mutants of human pathogenic fungi impaired in biosynthesis of particular amino acids exhibit growth defect or at least reduced virulence under in vivo conditions. Several chemical compounds inhibiting activity of one of these enzymes exhibit good antifungal in vitro activity in minimal growth media, which is not always confirmed under in vivo conditions. This article provides a comprehensive overview of the present knowledge on pathways of amino acids biosynthesis in fungi, with a special emphasis put on enzymes catalyzing particular steps of these pathways as potential targets for antifungal chemotherapy.

  9. Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells.

    PubMed

    Göttlicher, M; Minucci, S; Zhu, P; Krämer, O H; Schimpf, A; Giavara, S; Sleeman, J P; Lo Coco, F; Nervi, C; Pelicci, P G; Heinzel, T

    2001-12-17

    Histone deacetylases (HDACs) play important roles in transcriptional regulation and pathogenesis of cancer. Thus, HDAC inhibitors are candidate drugs for differentiation therapy of cancer. Here, we show that the well-tolerated antiepileptic drug valproic acid is a powerful HDAC inhibitor. Valproic acid relieves HDAC-dependent transcriptional repression and causes hyperacetylation of histones in cultured cells and in vivo. Valproic acid inhibits HDAC activity in vitro, most probably by binding to the catalytic center of HDACs. Most importantly, valproic acid induces differentiation of carcinoma cells, transformed hematopoietic progenitor cells and leukemic blasts from acute myeloid leukemia patients. More over, tumor growth and metastasis formation are significantly reduced in animal experiments. Therefore, valproic acid might serve as an effective drug for cancer therapy. PMID:11742974

  10. Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells

    PubMed Central

    Göttlicher, Martin; Minucci, Saverio; Zhu, Ping; Krämer, Oliver H.; Schimpf, Annemarie; Giavara, Sabrina; Sleeman, Jonathan P.; Lo Coco, Francesco; Nervi, Clara; Pelicci, Pier Giuseppe; Heinzel, Thorsten

    2001-01-01

    Histone deacetylases (HDACs) play important roles in transcriptional regulation and pathogenesis of cancer. Thus, HDAC inhibitors are candidate drugs for differentiation therapy of cancer. Here, we show that the well-tolerated antiepileptic drug valproic acid is a powerful HDAC inhibitor. Valproic acid relieves HDAC-dependent transcriptional repression and causes hyperacetylation of histones in cultured cells and in vivo. Valproic acid inhibits HDAC activity in vitro, most probably by binding to the catalytic center of HDACs. Most importantly, valproic acid induces differentiation of carcinoma cells, transformed hematopoietic progenitor cells and leukemic blasts from acute myeloid leukemia patients. More over, tumor growth and metastasis formation are significantly reduced in animal experiments. Therefore, valproic acid might serve as an effective drug for cancer therapy. PMID:11742974

  11. A Synthesis of a Spirocyclic Macrocyclic Protease Inhibitor for the Treatment of Hepatitis C.

    PubMed

    Chung, Cheol K; Cleator, Ed; Dumas, Aaron M; Hicks, Jacqueline D; Humphrey, Guy R; Maligres, Peter E; Nolting, Andrew F; Rivera, Nelo; Ruck, Rebecca T; Shevlin, Michael

    2016-03-18

    The development of a convergent and highly stereoselective synthesis of an HCV NS3/4a protease inhibitor possessing a unique spirocyclic and macrocyclic architecture is described. A late-stage spirocyclization strategy both enabled rapid structure-activity relationship studies in the drug discovery phase and simultaneously served as the basis for the large scale drug candidate preparation for clinical use. Also reported is the discovery of a novel InCl3-catalyzed carbonyl reduction with household aluminum foil or zinc powder as the terminal reductant. PMID:26950496

  12. Enantioselective Synthesis and Profiling of Two Novel Diazabicyclooctanone β-Lactamase Inhibitors

    PubMed Central

    2014-01-01

    The enantioselective synthesis of two novel cyclopropane-fused diazabicyclooctanones is reported here. Starting from butadiene monoxide, the key enone intermediate 7 was prepared in six steps. Subsequent stereoselective introduction of the cyclopropane group and further transformation led to compounds 1a and 1b as their corresponding sodium salt. The great disparity regarding their hydrolytic stability was rationalized by the steric interaction between the cyclopropyl methylene and urea carbonyl. These two novel β-lactamase inhibitors were active against class A, C, and D enzymes. PMID:25313328

  13. Rational Design, Synthesis and Evaluation of Coumarin Derivatives as Protein-protein Interaction Inhibitors.

    PubMed

    De Luca, Laura; Agharbaoui, Fatima E; Gitto, Rosaria; Buemi, Maria Rosa; Christ, Frauke; Debyser, Zeger; Ferro, Stefania

    2016-09-01

    Herein we describe the design and synthesis of a new series of coumarin derivatives searching for novel HIV-1 integrase (IN) allosteric inhibitors. All new obtained compounds were tested in order to evaluate their ability to inhibit the interaction between the HIV-1 IN enzyme and the nuclear protein lens epithelium growth factor LEDGF/p75. A combined approach of docking and molecular dynamic simulations has been applied to clarify the activity of the new compounds. Specifically, the binding free energies by using the method of molecular mechanics-generalized Born surface area (MM-GBSA) was calculated, whereas hydrogen bond occupancies were monitored throughout simulations methods.

  14. Design, synthesis, and molecular modelling of pyridazinone and phthalazinone derivatives as protein kinases inhibitors.

    PubMed

    Elagawany, Mohamed; Ibrahim, Mohamed A; Ali Ahmed, Hany Emary; El-Etrawy, A Sh; Ghiaty, Adel; Abdel-Samii, Zakaria K; El-Feky, Said A; Bajorath, Jürgen

    2013-04-01

    The design and synthesis of pyridazinone and phthalazinone derivatives are described. Newly synthesized compounds were tested on a panel of four kinases in order to evaluate their activity and potential selectivity. In addition, the promising compounds were tested on four cancer cell lines to examine cytotoxic effects. The compounds inhibited DYRK1A and GSK3 with different activity. SAR analysis and docking calculations were carried out to aid in the interpretation of the results. Taken together, our findings suggest that pyridazinone and phthalazinone scaffolds are interesting starting points for design of potent GSK3 and DYRK1A inhibitors. PMID:23453843

  15. Rational Design, Synthesis and Evaluation of Coumarin Derivatives as Protein-protein Interaction Inhibitors.

    PubMed

    De Luca, Laura; Agharbaoui, Fatima E; Gitto, Rosaria; Buemi, Maria Rosa; Christ, Frauke; Debyser, Zeger; Ferro, Stefania

    2016-09-01

    Herein we describe the design and synthesis of a new series of coumarin derivatives searching for novel HIV-1 integrase (IN) allosteric inhibitors. All new obtained compounds were tested in order to evaluate their ability to inhibit the interaction between the HIV-1 IN enzyme and the nuclear protein lens epithelium growth factor LEDGF/p75. A combined approach of docking and molecular dynamic simulations has been applied to clarify the activity of the new compounds. Specifically, the binding free energies by using the method of molecular mechanics-generalized Born surface area (MM-GBSA) was calculated, whereas hydrogen bond occupancies were monitored throughout simulations methods. PMID:27546050

  16. A multigram chemical synthesis of the γ-secretase inhibitor LY411575 and its diastereoisomers

    PubMed Central

    Simpson, Katherine; Maharvi, Ghulam M.; Golde, Todd; Das, Pritam

    2009-01-01

    An improved chemical synthesis of N-2((2S)-2-(3,5-difluorophenyl)-2-hydroxyethanoyl)-N1-((7S)-5-methyl-6-oxo-6,7-dihydro-5H-dibenzo[b,d]azepin-7-yl)-L-alaninamide (LY411,575, 9a), a known γ-secretase inhibitor, is described. The key synthetic steps, which used no chiral chromatography in the entire sequence, involved 1) improved microwave-assisted synthesis of a seven-membered lactam (±)-(5,7-dihydro-6H-dibenz-[b,d]azepin-6-one 2, and, 2) convenient isolation of pure LY411575 from a mixture of four diastereomers by simple flash silica gel chromatography. Starting from the resolved aminolactams 5a and 5b, all four diastereomers were produced in enantiomerically pure form. PMID:17897827

  17. Synthesis and biological evaluation of C(5)-substituted derivatives of leukotriene biosynthesis inhibitor BRP-7.

    PubMed

    Levent, Serkan; Gerstmeier, Jana; Olgaç, Abdurrahman; Nikels, Felix; Garscha, Ulrike; Carotti, Andrea; Macchiarulo, Antonio; Werz, Oliver; Banoglu, Erden; Çalışkan, Burcu

    2016-10-21

    Pharmacological intervention with 5-lipoxygenase (5-LO) pathway leading to suppression of leukotriene (LT) biosynthesis is a clinically validated strategy for treatment of respiratory and cardiovascular diseases such as asthma and atherosclerosis. Here we describe the synthesis of a series of C(5)-substituted analogues of the previously described 5-LO-activating protein (FLAP) inhibitor BRP-7 (IC50 = 0.31 μM) to explore the effects of substitution at the C(5)-benzimidazole (BI) ring as a strategy to increase the potency against FLAP-mediated 5-LO product formation. Incorporation of polar substituents on the C(5) position of the BI core, exemplified by compound 11 with a C(5)-nitrile substituent, significantly enhances the potency for suppression of 5-LO product synthesis in human neutrophils (IC50 = 0.07 μM) and monocytes (IC50 = 0.026 μM). PMID:27423639

  18. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  19. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  20. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  1. Cinnamide Derivatives as Mammalian Arginase Inhibitors: Synthesis, Biological Evaluation and Molecular Docking

    PubMed Central

    Pham, Thanh-Nhat; Bordage, Simon; Pudlo, Marc; Demougeot, Céline; Thai, Khac-Minh; Girard-Thernier, Corine

    2016-01-01

    Arginases are enzymes that are involved in many human diseases and have been targeted for new treatments. Here a series of cinnamides was designed, synthesized and evaluated in vitro and in silico for their inhibitory activity against mammalian arginase. Using a microassay on purified liver bovine arginase (b-ARG I), (E)-N-(2-phenylethyl)-3,4-dihydroxycinnamide, also named caffeic acid phenylamide (CAPA), was shown to be slightly more active than our natural reference inhibitor, chlorogenic acid (IC50 = 6.9 ± 1.3 and 10.6 ± 1.6 µM, respectively) but it remained less active that the synthetic reference inhibitor Nω-hydroxy-nor-l-arginine nor-NOHA (IC50 = 1.7 ± 0.2 µM). Enzyme kinetic studies showed that CAPA was a competitive inhibitor of arginase with Ki = 5.5 ± 1 µM. Whereas the activity of nor-NOHA was retained (IC50 = 5.7 ± 0.6 µM) using a human recombinant arginase I (h-ARG I), CAPA showed poorer activity (IC50 = 60.3 ± 7.8 µM). However, our study revealed that the cinnamoyl moiety and catechol function were important for inhibitory activity. Docking results on h-ARG I demonstrated that the caffeoyl moiety could penetrate into the active-site pocket of the enzyme, and the catechol function might interact with the cofactor Mn2+ and several crucial amino acid residues involved in the hydrolysis mechanism of arginase. The results of this study suggest that 3,4-dihydroxycinnamides are worth being considered as potential mammalian arginase inhibitors, and could be useful for further research on the development of new arginase inhibitors. PMID:27690022

  2. Synthesis and Pharmacological Evaluation of the Stereoisomersof 3-Carba Cyclic-Phosphatidic Acid

    PubMed Central

    Gupte, Renuka; Siddam, Anjaih; Lu, Yan; Li, Wei; Fujiwara, Yuko; Panupinthu, Nattapon; Truc-ChiPham; Baker, Daniel L.; Parrill, Abby L.; Gotoh, Mari; Murakami-Murofushi, Kimiko; Mills, Gordon B.; Tigyi, Gabor; Miller, Duane D.

    2010-01-01

    Cyclic phosphatidic acid (CPA) is a naturally occurring analog of lysophosphatidic acid (LPA) in which the sn-2 hydroxy group forms a 5-membered ring with the sn-3 phosphate. Here we describe the synthesis of R-3-CCPA and S-3-CCPA along with their pharmacological properties as inhibitors of lysophospholipase D/autotaxin, agonists of the LPA5 GPCR, and blockers of lung metastasis of B16-F10 melanoma cells in a C57BL/6 mouse model. S-3CCPA was significantly more efficacious in the activation of LPA5 compared to the R stereoisomer. In contrast, no stereoselective differences were found between the two isomers toward the inhibition of autotaxin or lung metastasis of B16-F10 melanoma cells in vivo. These results extend the potential utility of these compounds as potential lead compounds warranting evaluation as cancer therapeutics. PMID:21051230

  3. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  4. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  5. Evidence for separate elongation enzymes for very-long-chain-fatty-acid synthesis in potato (Solanum tuberosum).

    PubMed Central

    Walker, K A; Harwood, J L

    1986-01-01

    Aging potato (Solanum tuberosum) tuber discs in a Ca2+-containing medium resulted in increased rates of fatty acid labelling from [1-14C]acetate with time. Maximal labelling rates were seen after 6-8 h aging in a number of varieties. Saturated very-long-chain fatty acids (C20 and particularly C22 and C24) were very poorly labelled in freshly cut tissue. They were synthesized in increasing amounts and in a homologous sequence with progressive aging times. Use of increasing induction times and cycloheximide or puromycin as protein-synthesis inhibitors indicated that the sequence of fatty acid elongation was dependent on protein synthesis de novo and was controlled by three separate specific elongase enzymes. PMID:3800889

  6. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  7. Thiol containing compounds and amino acid hydroxamates as reversible synthetic inhibitors of Astacus protease.

    PubMed

    Wolz, R L; Zeggaf, C; Stöcker, W; Zwilling, R

    1990-09-01

    Reversible synthetic inhibitors are characterized for Astacus protease, a 22,614-Da zinc containing neutral endopeptidase from the digestive tract of crayfish. Effective inhibition was demonstrated for several simple thiol containing compounds and a series of amino acid hydroxamates. Both classes of inhibitors had ID50 values ranging from 10(-2) to 10(-4) M for inhibition of hydrolysis of succinyl-Ala-Ala-Ala-p-nitroanilide. Tyrosine hydroxamate was found to be the most effective inhibitor with an ID50 of 175 microM and the mode of inhibition by this compound was determined to be of the simple noncompetitive type. In contrast to the other inhibitors tested, cysteine was seen to partially inactivate the enzyme in a time-dependent manner. The kinetics of this process was studied in detail using progress curve analysis. It was determined that cysteine was acting as a weak chelator and slowly establishing an equilibrium between metallo- and apoenzyme. In the presence of the strong zinc scavenger EDTA, cysteine can, in effect, function as a catalyst in transferring the metal from the protein to the secondary chelator at a rate 10,000 times faster than the rate of unassisted zinc dissociation. The series of amino acid hydroxamates served as probes into the microenvironment of the active site. Possible binding modes of the inhibitors are discussed on the basis of the relationship between the chemical nature of the inhibitor side chains and the strength of inhibition.

  8. Impacts of lignocellulose-derived inhibitors on L-lactic acid fermentation by Rhizopus oryzae.

    PubMed

    Zhang, Li; Li, Xin; Yong, Qiang; Yang, Shang-Tian; Ouyang, Jia; Yu, Shiyuan

    2016-03-01

    Inhibitors generated in the pretreatment and hydrolysis of corn stover and corn cob were identified. In general, they inhibited cell growth, lactate dehydrogenase, and lactic acid production but with less or no adverse effect on alcohol dehydrogenase and ethanol production in batch fermentation by Rhizopus oryzae. Furfural and 5-hydroxymethyl furfural (HMF) were highly toxic at 0.5-1 g L(-1), while formic and acetic acids at less than 4 g L(-1) and levulinic acid at 10 g L(-1) were not toxic. Among the phenolic compounds at 1 g L(-1), trans-cinnamic acid and syringaldehyde had the highest toxicity while syringic, ferulic and p-coumaric acids were not toxic. Although these inhibitors were present at concentrations much lower than their separately identified toxic levels, lactic acid fermentation with the hydrolysates showed much inferior performance compared to the control without inhibitor, suggesting synergistic or compounded effects of the lignocellulose-degraded compounds on inhibiting lactic acid fermentation. PMID:26724548

  9. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  10. Curcumin Derivatives as Green Corrosion Inhibitors for α-Brass in Nitric Acid Solution

    NASA Astrophysics Data System (ADS)

    Fouda, A. S.; Elattar, K. M.

    2012-11-01

    1,7- Bis-(4-hydroxy-3-methoxy-phenyl)-hepta-1,6-diene-4-arylazo-3,5-dione I-V have been investigated as corrosion inhibitors for α-brass in 2 M nitric acid solution using weight-loss and galvanostatic polarization techniques. The efficiency of the inhibitors increases with the increase in the inhibitor concentration but decreases with a rise in temperature. The conjoint effect of the curcumin derivatives and KSCN has also been studied. The apparent activation energy ( E a*) and other thermodynamic parameters for the corrosion process have also been calculated. The galvanostatic polarization data indicated that the inhibitors were of mixed-type, but the cathode is more polarized than the anode. The slopes of the cathodic and anodic Tafel lines ( b c and b a) are maintained approximately equal for various inhibitor concentrations. However, the value of the Tafel slopes increases together as inhibitor concentration increases. The adsorption of these compounds on α-brass surface has been found to obey the Frumkin's adsorption isotherm. The mechanism of inhibition was discussed in the light of the chemical structure of the undertaken inhibitors.

  11. Synthesis and Evaluation of 5-Lipoxygenase Translocation Inhibitors from Acylnitroso Hetero-Diels-Alder Cycloadducts†

    PubMed Central

    Bolger, Joshua K.; Tian, Wen; Wolter, William R.; Cho, Wonhwa; Suckow, Mark A.

    2012-01-01

    Acylnitroso cycloadducts have proven to be valuable intermediates in the syntheses of a plethora of biologically active molecules. Recently, organometallic reagents were shown to open bicyclic acylnitroso cycloadducts and, more interestingly, the prospect of highly regioselective openings was raised. This transformation was employed in the synthesis of a compound with excellent inhibitory activity against 5-lipoxygenase ((±)-4a, IC50 51 nM), an important mediator of inflammation intimately involved in a number of disease states including asthma and cancer. Optimization of the copper-mediated organometallic ring opening reaction was accomplished allowing the further exploration of the biological activity. Synthesis of a number of derivatives with varying affinity for metal binding as well as pendant groups in a range of sizes was accomplished. Analogues were tested in a whole cell assay which revealed a subset of the compounds to be inhibitors of enzyme translocation, a mode of action not previously known and, potentially, extremely important for better understanding of the enzyme and inhibitor development. Additionally, the lead compound was tested in vivo in an established colon cancer model and showed very encouraging anti-tumorogenic properties. PMID:21365098

  12. Protein synthesis inhibitors attenuate water flow in vasopressin-stimulated toad urinary bladder

    SciTech Connect

    Hoch, B.S.; Ast, M.B.; Fusco, M.J.; Jacoby, M.; Levine, S.D. )

    1988-01-01

    Vasopressin stimulates the introduction of aggregated particles, which may represent pathways for water flow, into the luminal membrane of toad urinary bladder. It is not known whether water transport pathways are degraded on removal from membrane or whether they are recycled. The authors examined the effect of the protein synthesis inhibitors cycloheximide and puromycin using repeated 30-min cycles of vasopressin followed by washout of vasopressin, all in the presence of an osmotic gradient, a protocol that maximizes aggregate turnover. High dose cycloheximide inhibited flow immediately. Low dose cycloheximide did not affect initial flow. In the absence of vasopressin, inhibition did not develop. Despite the inhibition of flow in vasopressin-treated tissues, the cAMP-dependent protein kinase ratio was elevated in cycloheximide-treated tissues, suggesting modulation at a distal site in the stimulatory cascade. ({sup 14}C)urea permeability was not inhibited by cycloheximide. Puromycin also inhibited water flow by the fourth challenge with vasopressin. The data suggest that protein synthesis inhibitors attenuate flow at a site that is distal to cAMP-dependent protein kinase. However, the reversal of inhibition in MIX-treated tissues suggests that the water pathway can be fully manifested given suitable stimulation. They conclude that either large stores of the transport system are available or that the transport system is extensively recycled on retrieval from the membrane.

  13. Laboratory Evaluation of Five Chitin Synthesis Inhibitors Against the Colorado Potato Beetle, Leptinotarsa decemlineata

    PubMed Central

    Karimzadeh, R.; Hejazi, M. J.; Rahimzadeh Khoei, F.; Moghaddam, M.

    2007-01-01

    Results of laboratory experiments are reported that tested the effects of five chitin synthesis inhibitors, diflubenzuron, cyromazine, lufenuron, hexaflumuron and triflumuron. on second instars of the Colorado potato beetle, Leptinotarsa decemlineata (Say) (Coleoptera: Crysomelidae), originally collected from potato fields of Bostanabaad, a town 66 km southeast of Tabriz, Iran. In bioassays, the larvae were fed potato leaves dipped in aqueous solutions containing chitin synthesis inhibitors. The mortalities and abnormalities of the treated larvae were recorded 72 hours after treatments. LC50 values were 58.6, 69.6, 27.3, 0.79 and 81.4 mg ai/ L for diflubenzuron, cyromazine, lufenuron, hexaflumuron and triflumuron, respectively. Compared with phosalone, which is one of the common insecticides used for controlling this pest in Iran, lufenuron and hexaflumuron seem to be much more potent, and if they perform equally well in the field, they would be suitable candidates to be considered as reduced risk insecticides in management programs for L. decemlineata due to much wider margin of safety for mammals and considerably fewer undesirable environmental side effects. PMID:20345285

  14. Laboratory evaluation of five chitin synthesis inhibitors against the colorado potato beetle, Leptinotarsa decemlineata.

    PubMed

    Karimzadeh, R; Hejazi, M J; Rahimzadeh Khoei, F; Moghaddam, M

    2007-01-01

    Results of laboratory experiments are reported that tested the effects of five chitin synthesis inhibitors, diflubenzuron, cyromazine, lufenuron, hexaflumuron and triflumuron. on second instars of the Colorado potato beetle, Leptinotarsa decemlineata (Say) (Coleoptera: Crysomelidae), originally collected from potato fields of Bostanabaad, a town 66 km southeast of Tabriz, Iran. In bioassays, the larvae were fed potato leaves dipped in aqueous solutions containing chitin synthesis inhibitors. The mortalities and abnormalities of the treated larvae were recorded 72 hours after treatments. LC(50) values were 58.6, 69.6, 27.3, 0.79 and 81.4 mg ai/ L for diflubenzuron, cyromazine, lufenuron, hexaflumuron and triflumuron, respectively. Compared with phosalone, which is one of the common insecticides used for controlling this pest in Iran, lufenuron and hexaflumuron seem to be much more potent, and if they perform equally well in the field, they would be suitable candidates to be considered as reduced risk insecticides in management programs for L. decemlineata due to much wider margin of safety for mammals and considerably fewer undesirable environmental side effects. PMID:20345285

  15. Utilization of Putrescine in Tobacco Cell Lines Resistant to Inhibitors of Polyamine Synthesis 1

    PubMed Central

    Hiatt, Andrew; Malmberg, Russell L.

    1988-01-01

    Three tobacco cell lines have been analyzed which are resistant to lethal inhibitors of either putrescine production or conversion of putrescine into polyamines. Free and conjugated putrescine pools, the enzymic activities (arginine, ornithine, and S-adenosylmethionine decarboxylases), and the growth characteristics during acidic stress were measured in suspension cultures of each cell line. One cell line, resistant to difluoromethylornithine (Dfr1) had a very low level of ornithine decarboxylase activity which was half insensitive to the inhibitor in vitro. Intracellular free putrescine in Dfr1 was elevated 10-fold which was apparently due to a 20-fold increase in the arginine decarboxylase activity. The increased free putrescine titer was not reflected in an increased level of spermidine, spermine, or putrescine conjugation. Dfr1 cultures survived acidic stress at molarities which were lethal to wild type cultures. Two other mutants, resistant to methylglyoxal bis(guanylhydrazone) (Mgr3, Mgr12), had near normal levels of the three decarboxylases and normal titers of free putrescine, spermidine, and spermine. Both mutants however had elevated levels of conjugated putrescine. Mgr12 had an increased sensitivity to acidic medium. These results suggest that increased levels of free putrescine production may enhance the ability of tobacco cells to survive acid stress. This was supported by the observation that cytotoxic effects of inhibiting arginine decarboxylase in wild type cell lines were dependent on the acidity of the medium. Images Fig. 1 PMID:16665927

  16. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  17. Trypsin inhibitors from ridged gourd (Luffa acutangula Linn.) seeds: purification, properties, and amino acid sequences.

    PubMed

    Haldar, U C; Saha, S K; Beavis, R C; Sinha, N K

    1996-02-01

    Two trypsin inhibitors, LA-1 and LA-2, have been isolated from ridged gourd (Luffa acutangula Linn.) seeds and purified to homogeneity by gel filtration followed by ion-exchange chromatography. The isoelectric point is at pH 4.55 for LA-1 and at pH 5.85 for LA-2. The Stokes radius of each inhibitor is 11.4 A. The fluorescence emission spectrum of each inhibitor is similar to that of the free tyrosine. The biomolecular rate constant of acrylamide quenching is 1.0 x 10(9) M-1 sec-1 for LA-1 and 0.8 x 10(9) M-1 sec-1 for LA-2 and that of K2HPO4 quenching is 1.6 x 10(11) M-1 sec-1 for LA-1 and 1.2 x 10(11) M-1 sec-1 for LA-2. Analysis of the circular dichroic spectra yields 40% alpha-helix and 60% beta-turn for La-1 and 45% alpha-helix and 55% beta-turn for LA-2. Inhibitors LA-1 and LA-2 consist of 28 and 29 amino acid residues, respectively. They lack threonine, alanine, valine, and tryptophan. Both inhibitors strongly inhibit trypsin by forming enzyme-inhibitor complexes at a molar ratio of unity. A chemical modification study suggests the involvement of arginine of LA-1 and lysine of LA-2 in their reactive sites. The inhibitors are very similar in their amino acid sequences, and show sequence homology with other squash family inhibitors. PMID:8924202

  18. Beyond gastric acid reduction: Proton pump inhibitors induce heme oxygenase-1 in gastric and endothelial cells

    SciTech Connect

    Becker, Jan C. . E-mail: beckeja@uni-muenster.de; Grosser, Nina; Waltke, Christian; Schulz, Stephanie; Erdmann, Kati; Domschke, Wolfram; Schroeder, Henning; Pohle, Thorsten

    2006-07-07

    Proton pump inhibitors (PPIs) have been demonstrated to prevent gastric mucosal injury by mechanisms independent of acid inhibition. Here we demonstrate that both omeprazole and lansoprazole protect human gastric epithelial and endothelial cells against oxidative stress. This effect was abrogated in the presence of the heme oxygenase-1 (HO-1) inhibitor ZnBG. Exposure to either PPI resulted in a strong induction of HO-1 expression on mRNA and protein level, and led to an increased activity of this enzyme. Expression of cyclooxygenase isoforms 1 and 2 remained unaffected, and COX-inhibitors did not antagonize HO-1 induction by PPIs. Our results suggest that the antioxidant defense protein HO-1 is a target of PPIs in both endothelial and gastric epithelial cells. HO-1 induction might account for the gastroprotective effects of PPIs independently of acid inhibition, especially in NSAID gastropathy. Moreover, our findings provide additional perspectives for a possible but yet unexplored use of PPIs in vasoprotection.

  19. Organic corrosion inhibitors for aluminum in perchloric acid

    SciTech Connect

    Metikos-Hukovic, M.; Stupnisek-Lisac, E. . Dept. of Electrochemistry); Grubac, Z. . Dept. of Inorganic Chemistry)

    1994-02-01

    Substituted N-arylpyrroles containing carbaldehyde groups on a pyrrole ring and their inhibitive effects on the corrosion of aluminum (Al) in perchloric acid (HCIO[sub 4]) were investigated. Electrochemical measurements showed the organic compounds examined had good inhibiting properties at 40 C. The high inhibition effect of the N-aryl-2,5-dimethylpyrroles containing carbaldehyde groups on a pyrrole ring on corrosion of Al in acid media was explained on the basis of the electronic structure of the molecule and by the condensation characteristic of the carbaldehydes. Investigation of the influence of substitution type ([minus]F,[minus]Cl,[minus]NH[sub 2]) on the inhibiting characteristics of examined organic compounds showed the best inhibiting effect was from substituted N-arylpyrrole with fluorine in the ortho position of the phenyl ring.

  20. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats.

  1. Inhibitors of poly(ADP-ribose) synthesis enhance X-ray killing of log-phase Chinese hamster cells

    SciTech Connect

    Ben-Hur, E.; Utsumi, H.; Elkind, M.M.

    1984-03-01

    Postirradiation incubation of V79 Chinese hamster cells with inhibitors of poly(ADP-ribose) synthesis was found to potentiate the killing of cells by X rays. Potentiation increased with incubation time and with concentration of the inhibitor. Preirradiation incubation had only a small effect. The enhanced response correlated well with the known extent of the inhibition of poly(ADP-ribose) synthesis. A radiation-sensitive line, V79-AL162/S-10, was affected to a lesser extent than the normal cells. Cells repaired the radiation damage with which the inhibitors interacted within 1 hr, a process that has similar kinetics to what is observed when a postirradiation treatment with hypertonic buffer is used. However, the sectors of damage affected by inhibitors of poly(ADP-ribose) synthesis and hypertonic buffer do not entirely overlap. The inhibitor nicotinamide enhanced the killing mainly of late S-phase cells and did not affect cells at the G/sub 1//S border. It is concluded that the repair process(es) involving poly(ADP-ribose) synthesis is important for cell survival in repair-competent cells and that the radiation-sensitive cells that were examined are partially deficient in a repair pathway in which poly(ADP-ribose) participates.

  2. Design, synthesis and evaluation of 2,4-diaminoquinazolines as inhibitors of trypanosomal and leishmanial dihydrofolate reductase.

    PubMed

    Khabnadideh, Soghra; Pez, Didier; Musso, Alexander; Brun, Reto; Pérez, Luis M Ruiz; González-Pacanowska, Dolores; Gilbert, Ian H

    2005-04-01

    This paper describes the design, synthesis and evaluation of a series of 2,4-diaminoquinazolines as inhibitors of leishmanial and trypanosomal dihydrofolate reductase. Compounds were designed by a generating virtual library of compounds and docking them into the enzyme active site. Following their synthesis, they were found to be potent and selective inhibitors of leishmanial dihydrofolate reductase. The compounds were also found to have potent activity against Trypanosoma brucei rhodesiense, a causative organism of African trypanosomiasis and also against Trypanosoma cruzi, the causative organism of Chagas disease. There was significantly lower activity against Leishmania donovani, one of the causative organisms of leishmaniasis. PMID:15755663

  3. Synthesis, biological evaluation and molecular docking of calix[4]arene-based β-diketo derivatives as HIV-1 integrase inhibitors.

    PubMed

    Luo, Zaigang; Zhao, Yu; Ma, Chao; Li, Zhipeng; Xu, Xuemei; Hu, Liming; Huang, Nianyu; He, Hongqiu

    2015-03-01

    In this publication, we design and report the synthesis of calix[4]arene-based β-diketo derivatives as novel HIV-1 integrase (IN) inhibitors. The target compounds were obtained using Claisen condensation, and their structures were characterized by NMR and ESI-MS. Preliminary bioassays showed that calix[4]arene-based β-diketo derivatives inhibit strand transfer (ST) with IC50 values between 5.9 and 21.2 µM. Docking studies revealed the predominant binding modes that were distinct from the binding modes of raltegravir, which suggests a novel binding region in the IN active site. Moreover, these compounds are predicted not to interact with some of the key amino acids (GLN148 and ASN155) implicated in viral resistance. Therefore, this series of compounds can further be investigated for a possible chemotype to circumvent resistance to clinical HIV-1 IN inhibitors.

  4. HALOACETIC ACIDS AND KINASE INHIBITORS PERTURB MOUSE NEURAL CREST CELLS IN VITRO

    EPA Science Inventory

    HUNTER, E.S.1, J. SMITH2, J. ANDREWS1. 1 Reproductive Toxicology Division, NHEERL, US EPA, Research Triangle Park and 2 Department of Cell and Developmental Biology, UNC-CH, Chapel Hill, North Carolina. Haloacetic acids and kinase inhibitors perturb mouse neural crest cells in vi...

  5. Synergism of antifungal activity between mitochondrial respiration inhibitors and kojic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Co-application of certain types of compounds with conventional antimicrobial drugs results in the enhancement of efficacy of drugs through a mechanism termed chemosensitization. We show that kojic acid (KA), a natural product, is a potent chemosensitizer to complex III inhibitors of mitochondrial re...

  6. Novel inhibitors of Rad6 ubiquitin conjugating enzyme: design, synthesis, identification, and functional characterization.

    PubMed

    Sanders, Matthew A; Brahemi, Ghali; Nangia-Makker, Pratima; Balan, Vitaly; Morelli, Matteo; Kothayer, Hend; Westwell, Andrew D; Shekhar, Malathy P V

    2013-04-01

    Protein ubiquitination is important for cell signaling, DNA repair, and proteasomal degradation, and it is not surprising that alterations in ubiquitination occur frequently in cancer. Ubiquitin-conjugating enzymes (E2) mediate ubiquitination by selective interactions with ubiquitin-activating (E1) and ubiquitin ligase (E3) enzymes, and thus selective E2 small molecule inhibitor (SMI) will provide specificity unattainable with proteasome inhibitors. Here we describe synthesis and functional characterization of the first SMIs of human E2 Rad6B, a fundamental component of translesion synthesis DNA repair. A pharmacophore model for consensus E2 ubiquitin-binding sites was generated for virtual screening to identify E2 inhibitor candidates. Twelve triazine (TZ) analogs screened in silico by molecular docking to the Rad6B X-ray structure were verified by their effect on Rad6B ubiquitination of histone H2A. TZs #8 and 9 docked to the Rad6B catalytic site with highest complementarity. TZs #1, 2, 8, and 9 inhibited Rad6B-ubiquitin thioester formation and subsequent ubiquitin transfer to histone H2A. SMI #9 inhibition of Rad6 was selective as BCA2 ubiquitination by E2 UbcH5 was unaffected by SMI #9. SMI #9 more potently inhibited proliferation, colony formation, and migration than SMI #8, and induced MDA-MB-231 breast cancer cell G2-M arrest and apoptosis. Ubiquitination assays using Rad6 immunoprecipitated from SMI #8- or 9-treated cells confirmed inhibition of endogenous Rad6 activity. Consistent with our previous data showing Rad6B-mediated polyubiquitination stabilizes β-catenin, MDA-MB-231 treatment with SMIs #8 or 9 decreased β-catenin protein levels. Together these results describe identification of the first Rad6 SMIs.

  7. Synthesis of novel fluorocarbocyclic nucleosides and nucleotides as potential inhibitors of human immunodeficiency virus

    SciTech Connect

    Hilpert, H.

    1989-01-01

    3[prime]-Azido-3[prime]-deoxythymidine (AZT) and 2[prime], 3[prime]-dideoxycytidine (DDC) are potent in vivo inhibitors of human immunodeficiency virus. Due to their short half-life in the body and undesired side-effects compounds with improved bioavailability were designed. A feature of these analogues was the replacement of the heterocyclic oxygen atom by an isosteric CHF-group thus stabilizing the labile glycosidic bond against metabolic breakdown. A versatile and short synthesis, starting from ketone, serves to construct the highly functionalized and protected key intermediates. These ([alpha]- and [beta]-fluoro epimeric) intermediates were elaborated to eight fluorocarbocyclic nucleoside analogues linked with a thymine base, an adenine base, and a guanine base. An attempt was made to prepare analogues of the potent HIV inhibitor carbovir c. The unexpected oxidation of the double bond of compound d, instead of the desired Baeyer-Villiger ring-expansion, meant that the synthetic scheme was redundant. A second total synthesis involves the preparation of the three fluorocarbocyclic phosphonates. These analogues possess additionally a P-C linkage which should markedly enhance the stability of the side chain. To perform enzyme inhibition tests, three analogues were chemically activated to the biologically active triphosphates. Inhibition tests on HIV associated reverse transcriptase confirmed the high activity of one of the AZT triphosphates. The fluorocarbocyclic counterpart was two orders of magnitude less active. A fluorocarbocyclic phosphonate was twice as active as the AZT triphosphate. Neither the eight nucleoside analogues nor the three phosphonates displayed significant activity against HIV infected cells. Crystallographic data of two fluorocarbocyclic nucleosides, two potent HIV inhibitors, and some 20 examples of 2[prime]-deoxyribonucleosides have been compared.

  8. In vivo protection against soman toxicity by known inhibitors of acetylcholine synthesis in vitro.

    PubMed

    Sterling, G H; Doukas, P H; Sheldon, R J; O'Neill, J J

    1988-02-01

    Soman inhibits the enzyme acetylcholinesterase, essentially irreversibly, producing an accumulation of acetylcholine (ACh) which is responsible for many of its toxic effects. Current approaches to treatment include: (1) atropine, a muscarinic receptor blocker; (2) pyridine-2-aldoxime methylchloride (2-PAM), an enzyme reactivator; and (3) carbamate protection of the enzyme. However, no fully satisfactory regimen has been found, primarily because of the rapid aging process. In this study, compounds known to inhibit ACh synthesis in vitro were evaluated in combination with atropine and 2-PAM so as to assess their potential utility in protection against soman toxicity in rats. Acetylsecohemicholinium (100 micrograms/kg, i.c.v.t., 30 min prior to soman), an inhibitor of high affinity choline uptake (HAChU) and cholineacetyltransferase (ChAT) activity in vitro, enhanced the protective effects of atropine and 2-PAM, reducing the mortality within the first 2 hr following soman. N-Hydroxyethylnaphthylvinylpyridine (NHENVP), a quaternary ChAT inhibitor (1.7 mumol/kg, i.m.), significantly reduced the overall percent mortality due to soman from 80% to 20%. The compound was most effective when administered 2-3 min prior to soman and was effective only by the intramuscular route. N-Allyl-3-quinuclidinol, a potent HAChU inhibitor (1 mumol/kg, i.m.) was the most effective quinuclidine analog evaluated, also reducing the percent mortality for a 24-hr period. Unlike NHENVP, it was most effective when given 30-60 min prior to soman. It is suggested from the data that compounds that disrupt presynaptic ACh synthesis in vitro may prove effective in treating organophosphate poisoning. The results demonstrate interesting differences among the compounds studied and provide insight for the design of protectants against soman toxicity. These findings further underscore the need to examine the structure activity and pharmacokinetic properties of these compounds, i.e. comparison of routes of

  9. In vivo protection against soman toxicity by known inhibitors of acetylcholine synthesis in vitro.

    PubMed

    Sterling, G H; Doukas, P H; Sheldon, R J; O'Neill, J J

    1988-02-01

    Soman inhibits the enzyme acetylcholinesterase, essentially irreversibly, producing an accumulation of acetylcholine (ACh) which is responsible for many of its toxic effects. Current approaches to treatment include: (1) atropine, a muscarinic receptor blocker; (2) pyridine-2-aldoxime methylchloride (2-PAM), an enzyme reactivator; and (3) carbamate protection of the enzyme. However, no fully satisfactory regimen has been found, primarily because of the rapid aging process. In this study, compounds known to inhibit ACh synthesis in vitro were evaluated in combination with atropine and 2-PAM so as to assess their potential utility in protection against soman toxicity in rats. Acetylsecohemicholinium (100 micrograms/kg, i.c.v.t., 30 min prior to soman), an inhibitor of high affinity choline uptake (HAChU) and cholineacetyltransferase (ChAT) activity in vitro, enhanced the protective effects of atropine and 2-PAM, reducing the mortality within the first 2 hr following soman. N-Hydroxyethylnaphthylvinylpyridine (NHENVP), a quaternary ChAT inhibitor (1.7 mumol/kg, i.m.), significantly reduced the overall percent mortality due to soman from 80% to 20%. The compound was most effective when administered 2-3 min prior to soman and was effective only by the intramuscular route. N-Allyl-3-quinuclidinol, a potent HAChU inhibitor (1 mumol/kg, i.m.) was the most effective quinuclidine analog evaluated, also reducing the percent mortality for a 24-hr period. Unlike NHENVP, it was most effective when given 30-60 min prior to soman. It is suggested from the data that compounds that disrupt presynaptic ACh synthesis in vitro may prove effective in treating organophosphate poisoning. The results demonstrate interesting differences among the compounds studied and provide insight for the design of protectants against soman toxicity. These findings further underscore the need to examine the structure activity and pharmacokinetic properties of these compounds, i.e. comparison of routes of

  10. A review on ROCK-II inhibitors: From molecular modelling to synthesis.

    PubMed

    Shah, Surmil; Savjani, Jignasa

    2016-05-15

    Rho kinase enzyme expressed in different disease conditions and involved in mediating vasoconstriction and vascular remodeling in the pathogenesis. There are two isoforms of Rho kinases, namely ROCK I and ROCK II, responsible for different physiological function due to difference in distribution, but almost similar in structure. The Rho kinase 2 belongs to AGC family and is widely distributed in brain, heart and muscles. It is responsible for contraction of vascular smooth muscles by calcium sensitization. Its defective and unwanted expression can lead to many medical conditions like multiple sclerosis, myocardial ischemia, inflammatory responses, etc. Many Rho kinase 1 and 2 inhibitors have been designed for Rho/Rho kinase pathway by use of molecular modeling studies. Most of the designed compounds have been modeled based on ROCK 1 enzyme. This article is focused on Rho kinase 2 inhibitors as there are many ways to improvise by use of Computer aided drug designing as very less quantum of research work carried out. Herein, the article highlights different stages of designing like docking, SAR and synthesis of ROCK inhibitors and recent advances. It also highlights future prospective to improve the activity.

  11. Design, Synthesis, and Protein Crystallography of Biaryltriazoles as Potent Tautomerase Inhibitors of Macrophage Migration Inhibitory Factor

    PubMed Central

    Dziedzic, Pawel; Cisneros, José A.; Robertson, Michael J.; Hare, Alissa A.; Danford, Nadia E.; Baxter, Richard H. G.; Jorgensen, William L.

    2015-01-01

    Optimization is reported for biaryltriazoles as inhibitors of the tautomerase activity of human macrophage migration inhibitory factor (MIF), a proinflammatory cytokine associated with numerous inflammatory diseases and cancer. A combined approach was taken featuring organic synthesis, enzymatic assaying, crystallography, and modeling including free-energy perturbation (FEP) calculations. X-ray crystal structures for 3a and 3b bound to MIF are reported and provided a basis for the modeling efforts. The accommodation of the inhibitors in the binding site is striking with multiple hydrogen bonds and aryl–aryl interactions. Additional modeling encouraged pursuit of 5-phenoxyquinolinyl analogues, which led to the very potent compound 3s. Activity was further enhanced by addition of a fluorine atom adjacent to the phenolic hydroxyl group as in 3w, 3z, 3aa, and 3bb to strengthen a key hydrogen bond. It is also shown that physical properties of the compounds can be modulated by variation of solvent-exposed substituents. Several of the compounds are likely the most potent known MIF tautomerase inhibitors; the most active ones are more than 1000-fold more active than the well-studied (R)-ISO-1 and more than 200-fold more active than the chromen-4-one Orita-13. PMID:25697265

  12. Synthesis, structure and antibiotic activity of aryl-substituted LpxC inhibitors

    PubMed Central

    Zhao, Jinshi; Toone, Eric J.; Zhou, Pei

    2013-01-01

    The zinc-dependent deacetylase LpxC catalyzes the committed step of lipid A biosynthesis in Gram-negative bacteria and is a validated target for development of novel antibiotics to combat multidrug-resistant Gram-negative infections. Many potent LpxC inhibitors contain an essential threonyl-hydroxamate head group for high-affinity interaction with LpxC. We report the synthesis, antibiotic activity, and structural and enzymatic characterization of novel LpxC inhibitors containing an additional aryl-group in the threonyl-hydroxamate moiety, which expands the inhibitor-binding surface in LpxC. These compounds display enhanced potency against LpxC in enzymatic assays and superior antibiotic activity against F. novicida in cell culture. Comparison of the antibiotic activities of these compounds against a leaky E. coli strain and the wild-type strain reveals the contribution of the formidable outer membrane permeability barrier that reduces the compound efficacy in cell culture and emphasizes the importance of maintaining a balanced hydrophobicity and hydrophilicity profile in developing effective LpxC-targeting antibiotics. PMID:23914798

  13. The Design, Synthesis and Structure-Activity Relationship of Mixed Serotonin, Norepinephrine and Dopamine Uptake Inhibitors

    NASA Astrophysics Data System (ADS)

    Chen, Zhengming; Yang, Ji; Skolnick, Phil

    The evolution of antidepressants over the past four decades has involved the replacement of drugs with a multiplicity of effects (e.g., TCAs) by those with selective actions (i.e., SSRIs). This strategy was employed to reduce the adverse effects of TCAs, largely by eliminating interactions with certain neurotransmitters or receptors. Although these more selective compounds may be better tolerated by patients, selective drugs, specifically SSRIs, are not superior to older drugs in treating depressed patients as measured by response and remission rates. It may be an advantage to increase synaptic levels of both serotonin and norepinephrine, as in the case of dual uptake inhibitors like duloxetine and venlafaxine. An important recent development has been the emergence of the triple-uptake inhibitors (TUIs/SNDRIs), which inhibit the uptake of the three neurotransmitters most closely linked to depression: serotonin, norepinephrine, and dopamine. Preclinical studies and clinical trials indicate that a drug inhibiting the reuptake of all three of these neurotransmitters could produce more rapid onset of action and greater efficacy than traditional antidepressants. This review will detail the medicinal chemistry involved in the design, synthesis and discovery of mixed serotonin, norepinephrine and dopamine transporter uptake inhibitors.

  14. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  15. Novel synthesis of steryl esters from phytosterols and amino Acid.

    PubMed

    Pang, Min; Jiang, Shaotong; Cao, Lili; Pan, Lijun

    2011-10-12

    The feasibility of esterification of phytosterol with the amino acid l-glutamic acid was established. The influence of various organic solvents was investigated, and n-butanol was selected as an ideal solvent for phytosteryl esters synthesis with l-glutamic acid. The reaction conditions were further optimized by orthogonal experiments, and a 92.3% degree of esterification was obtained when optimum conditions were used. FT-IR spectral, GC-MS, and NMR analyses were adopted to determine the steryl esters of l-glutamic acid. The FT-IR spectrum indicated the presence of ester bonds in the phytosteryl esters with l-glutamic acid, and on the basis of the detailed mass spectrography analysis, GC-MS and NMR offered an efficient and reliable way to confirm the steryl esters. This novel synthesis approach of phytosteryl esters with amino acid supplied a promising alternative to the substrate on esterification of phytosterols and thus can be readily applied to further studies of functional food ingredients of phytosteryl esters.

  16. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  17. Fatty acid amide hydrolase inhibitors confer anti-invasive and antimetastatic effects on lung cancer cells

    PubMed Central

    Winkler, Katrin; Ramer, Robert; Dithmer, Sophie; Ivanov, Igor; Merkord, Jutta; Hinz, Burkhard

    2016-01-01

    Inhibition of endocannabinoid degradation has been suggested as tool for activation of endogenous tumor defense. One of these strategies lies in blockade of fatty acid amide hydrolase (FAAH) which catalyzes the degradation of endocannabinoids (anandamide [AEA], 2-arachidonoylglycerol [2-AG]) and endocannabinoid-like substances (N-oleoylethanolamine [OEA], N-palmitoylethanolamine [PEA]). This study addressed the impact of two FAAH inhibitors (arachidonoyl serotonin [AA-5HT], URB597) on A549 lung cancer cell metastasis and invasion. LC-MS analyses revealed increased levels of FAAH substrates (AEA, 2-AG, OEA, PEA) in cells incubated with either FAAH inhibitor. In athymic nude mice FAAH inhibitors were shown to elicit a dose-dependent antimetastatic action yielding a 67% and 62% inhibition of metastatic lung nodules following repeated administration of 15 mg/kg AA-5HT and 5 mg/kg URB597, respectively. In vitro, a concentration-dependent anti-invasive action of either FAAH inhibitor was demonstrated, accompanied with upregulation of tissue inhibitor of matrix metalloproteinases-1 (TIMP-1). Using siRNA approaches, a causal link between the TIMP-1-upregulating and anti-invasive action of FAAH inhibitors was confirmed. Moreover, knockdown of FAAH by siRNA was shown to confer decreased cancer cell invasiveness and increased TIMP-1 expression. Inhibitor experiments point toward a role of CB2 and transient receptor potential vanilloid 1 in conferring anti-invasive effects of FAAH inhibitors and FAAH siRNA. Finally, antimetastatic and anti-invasive effects were confirmed for all FAAH substrates with AEA and OEA causing a TIMP-1-dependent anti-invasive action. Collectively, the present study provides first-time proof for an antimetastatic action of FAAH inhibitors. As mechanism of its anti-invasive properties an upregulation of TIMP-1 was identified. PMID:26930716

  18. A practical synthesis of renin inhibitor MK-1597 (ACT-178882) via catalytic enantioselective hydrogenation and epimerization of piperidine intermediate.

    PubMed

    Molinaro, Carmela; Shultz, Scott; Roy, Amélie; Lau, Stephen; Trinh, Thao; Angelaud, Rémy; O'Shea, Paul D; Abele, Stefan; Cameron, Mark; Corley, Ed; Funel, Jacques-Alexis; Steinhuebel, Dietrich; Weisel, Mark; Krska, Shane

    2011-02-18

    A practical enantioselective synthesis of renin inhibitor MK-1597 (ACT-178882), a potential new treatment for hypertension, is described. The synthetic route provided MK-1597 in nine steps and 29% overall yield from commercially available p-cresol (7). The key features of this sequence include a catalytic asymmetric hydrogenation of a tetrasubstituted ene-ester, a highly efficient epimerization/saponification sequence of 4 which sets both stereocenters of the molecule, and a short synthesis of amine fragment 2.

  19. Total synthesis of (29S,37S)-isomer of malevamide E, a potent ion-channel inhibitor.

    PubMed

    Gajula, Praveen Kumar; Sharma, Shrikant; Ampapathi, Ravi Sankar; Chakraborty, Tushar Kanti

    2013-01-14

    The first total synthesis of (29S,37S)-malevamide E (1), a potent ion channel inhibitor, has been achieved in a convergent fashion involving Julia-Kocienski olefination, Urpi acetal aldol and Shiina macrolactonization reactions as the key steps. The strategy developed herein is amenable for the synthesis of the other possible isomers in search for the correct stereoisomer of the naturally occurring molecule.

  20. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  1. Synthesis of deleobuvir, a potent hepatitis C virus polymerase inhibitor, and its major metabolites labeled with carbon-13 and carbon-14.

    PubMed

    Latli, Bachir; Hrapchak, Matt; Chevliakov, Maxim; Li, Guisheng; Campbell, Scot; Busacca, Carl A; Senanayake, Chris H

    2015-05-30

    Deleobuvir, (2E)-3-(2-{1-[2-(5-bromopyrimidin-2-yl)-3-cyclopentyl-1-methyl-1H-indole-6-carboxamido]cyclobutyl}-1-methyl-1H-benzimidazol-6-yl)prop-2-enoic acid (1), is a non-nucleoside, potent, and selective inhibitor of hepatitis C virus NS5B polymerase. Herein, we describe the detailed synthesis of this compound labeled with carbon-13 and carbon-14. The synthesis of its three major metabolites, namely, the reduced double bond metabolite (2) and the acyl glucuronide derivatives of (1) and (2), is also reported. Aniline-(13) C6 was the starting material to prepare butyl (E)-3-(3-methylamino-4-nitrophenyl-(13) C6 )acrylate [(13) C6 ]-(11) in six steps. This intermediate was then used to obtain [(13) C6 ]-(1) and [(13) C6 ]-(2) in five and four more steps, respectively. For the radioactive synthesis, potassium cyanide-(14) C was used to prepare 1-cylobutylaminoacid [(14) C]-(23) via Buchrer-Bergs reaction. The carbonyl chloride of this acid was then used to access both [(14) C]-(1) and [(14) C]-(2) in four steps. The acyl glucuronide derivatives [(13) C6 ]-(3), [(13) C6 ]-(4) and [(14) C]-(3) were synthesized in three steps from the acids [(13) C6 ]-(1), [(13) C6 ]-(2) and [(14) C]-(1) using known procedures. PMID:25964148

  2. Synthesis and evaluation of 2,5-dihydrochorismate analogues as inhibitors of the chorismate-utilising enzymes.

    PubMed

    Payne, Richard J; Bulloch, Esther M M; Toscano, Miguel M; Jones, Michelle A; Kerbarh, Olivier; Abell, Chris

    2009-06-01

    A library of 2,5-dihydrochorismate analogues were designed as inhibitors of the chorismate-utilising enzymes including anthranilate synthase, isochorismate synthase, salicylate synthase and 4-amino-4-deoxychorismate synthase. The inhibitors were synthesised in seven or eight steps from shikimic acid, sourced from star anise. The compounds exhibited moderate but differential inhibition against the four chorismate-utilising enzymes.

  3. Amnesia produced by altered release of neurotransmitters after intraamygdala injections of a protein synthesis inhibitor

    PubMed Central

    Canal, Clinton E.; Chang, Qing; Gold, Paul E.

    2007-01-01

    Amnesia produced by protein synthesis inhibitors such as anisomycin provides major support for the prevalent view that the formation of long-lasting memories requires de novo protein synthesis. However, inhibition of protein synthesis might disrupt other neural functions to interfere with memory formation. Intraamygdala injections of anisomycin before inhibitory avoidance training impaired memory in rats tested 48 h later. Release of norepinephrine (NE), dopamine (DA), and serotonin, measured at the site of anisomycin infusions, increased quickly by ≈1,000–17,000%, far above the levels seen under normal conditions. NE and DA release later decreased far below baseline for several hours before recovering at 48 h. Intraamygdala injections of a β-adrenergic receptor antagonist or agonist, each timed to blunt effects of increases and decreases in NE release after anisomycin, attenuated anisomycin-induced amnesia. In addition, similar to the effects on memory seen with anisomycin, intraamygdala injections of a high dose of NE before training impaired memory tested at 48 h after training. These findings suggest that altered release of neurotransmitters may mediate amnesia produced by anisomycin and, further, raise important questions about the empirical bases for many molecular theories of memory formation. PMID:17640910

  4. West Nile Virus Replication Requires Fatty Acid Synthesis but Is Independent on Phosphatidylinositol-4-Phosphate Lipids

    PubMed Central

    Martín-Acebes, Miguel A.; Blázquez, Ana-Belén; Jiménez de Oya, Nereida; Escribano-Romero, Estela; Saiz, Juan-Carlos

    2011-01-01

    West Nile virus (WNV) is a neurovirulent mosquito-borne flavivirus, which main natural hosts are birds but it also infects equines and humans, among other mammals. As in the case of other plus-stranded RNA viruses, WNV replication is associated to intracellular membrane rearrangements. Based on results obtained with a variety of viruses, different cellular processes have been shown to play important roles on these membrane rearrangements for efficient viral replication. As these processes are related to lipid metabolism, fatty acid synthesis, as well as generation of a specific lipid microenvironment enriched in phosphatidylinositol-4-phosphate (PI4P), has been associated to it in other viral models. In this study, intracellular membrane rearrangements following infection with a highly neurovirulent strain of WNV were addressed by means of electron and confocal microscopy. Infection of WNV, and specifically viral RNA replication, were dependent on fatty acid synthesis, as revealed by the inhibitory effect of cerulenin and C75, two pharmacological inhibitors of fatty acid synthase, a key enzyme of this process. However, WNV infection did not induce redistribution of PI4P lipids, and PI4P did not localize at viral replication complex. Even more, WNV multiplication was not inhibited by the use of the phosphatidylinositol-4-kinase inhibitor PIK93, while infection by the enterovirus Coxsackievirus B5 was reduced. Similar features were found when infection by other flavivirus, the Usutu virus (USUV), was analyzed. These features of WNV replication could help to design specific antiviral approaches against WNV and other related flaviviruses. PMID:21949814

  5. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  6. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  7. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  8. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  9. Structure-based design of non-natural amino-acid inhibitors of amyloid fibril formation

    SciTech Connect

    Sievers, Stuart A.; Karanicolas, John; Chang, Howard W.; Zhao, Anni; Jiang, Lin; Zirafi, Onofrio; Stevens, Jason T.; Münch, Jan; Baker, David; Eisenberg, David

    2011-09-20

    Many globular and natively disordered proteins can convert into amyloid fibrils. These fibrils are associated with numerous pathologies as well as with normal cellular functions, and frequently form during protein denaturation. Inhibitors of pathological amyloid fibril formation could be useful in the development of therapeutics, provided that the inhibitors were specific enough to avoid interfering with normal processes. Here we show that computer-aided, structure-based design can yield highly specific peptide inhibitors of amyloid formation. Using known atomic structures of segments of amyloid fibrils as templates, we have designed and characterized an all-D-amino-acid inhibitor of the fibril formation of the tau protein associated with Alzheimer's disease, and a non-natural L-amino-acid inhibitor of an amyloid fibril that enhances sexual transmission of human immunodeficiency virus. Our results indicate that peptides from structure-based designs can disrupt the fibril formation of full-length proteins, including those, such as tau protein, that lack fully ordered native structures. Because the inhibiting peptides have been designed on structures of dual-{beta}-sheet 'steric zippers', the successful inhibition of amyloid fibril formation strengthens the hypothesis that amyloid spines contain steric zippers.

  10. Is Acetylcarnitine a Substrate for Fatty Acid Synthesis in Plants?

    PubMed

    Roughan, G.; Post-Beittenmiller, D.; Ohlrogge, J.; Browse, J.

    1993-04-01

    Long-chain fatty acid synthesis from [1-14C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-14C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-14C]-Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-14C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-14C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-14C]acetylcarnitine and 47 to 57% of the [1-14C]acetate taken up was incorporated into lipids. Most (78-82%) of the [1-14C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants.

  11. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  12. A new 5-lipoxygenase selective inhibitor derived from Artocarpus communis strongly inhibits arachidonic acid-induced ear edema.

    PubMed

    Koshihara, Y; Fujimoto, Y; Inoue, H

    1988-06-01

    Natural compounds isolated from the Indonesian plant, Artocarpus communis, inhibit 5-lipoxygenase of cultured mastocytoma cells. One of five compounds, AC-5-1, strongly inhibits 5-lipoxygenase with a half-inhibition dose of 5 +/- 0.12 X 10(-8) M. However, prostaglandin synthesizing activity is not inhibited until 10(-5) M. AC-5-1 is a highly selective inhibitor for 5-lipoxygenase. The AC-5-1 at 10(-5) M inhibits 96% of leukotriene C4 synthesis of mouse peritoneal cells facilitated by calcium-ionophore. Arachidonic acid-induced ear edema of mice, an in vivo inflammatory model, involving leukotriene induction, is strongly inhibited by AC-5-1 in a dose-dependent manner. The inhibition is the strongest of any inhibitors of 5-lipoxygenase reported previously. Since the natural compound AC-5-1 can selectively inhibit 5-lipoxygenase and affect in vivo inflammation, it will be interesting to investigate the role of leukotrienes on inflammation and other physiological processes.

  13. Discovery and molecular basis of potent noncovalent inhibitors of fatty acid amide hydrolase (FAAH)

    PubMed Central

    Min, Xiaoshan; Thibault, Stephen T.; Porter, Amy C.; Gustin, Darin J.; Carlson, Timothy J.; Xu, Haoda; Lindstrom, Michelle; Xu, Guifen; Uyeda, Craig; Ma, Zhihua; Li, Yihong; Kayser, Frank; Walker, Nigel P. C.; Wang, Zhulun

    2011-01-01

    Fatty acid amide hydrolase (FAAH), an amidase-signature family member, is an integral membrane enzyme that degrades lipid amides including the endogenous cannabinoid anandamide and the sleep-inducing molecule oleamide. Both genetic knock out and pharmacological administration of FAAH inhibitors in rodent models result in analgesic, anxiolytic, and antiinflammatory phenotypes. Targeting FAAH activity, therefore, presents a promising new therapeutic strategy for the treatment of pain and other neurological-related or inflammatory disorders. Nearly all FAAH inhibitors known to date attain their binding potency through a reversible or irreversible covalent modification of the nucleophile Ser241 in the unusual Ser-Ser-Lys catalytic triad. Here, we report the discovery and mechanism of action of a series of ketobenzimidazoles as unique and potent noncovalent FAAH inhibitors. Compound 2, a representative of these ketobenzimidazoles, was designed from a series of ureas that were identified from high-throughput screening. While urea compound 1 is characterized as an irreversible covalent inhibitor, the cocrystal structure of FAAH complexed with compound 2 reveals that these ketobenzimidazoles, though containing a carbonyl moiety, do not covalently modify Ser241. These inhibitors achieve potent inhibition of FAAH activity primarily from shape complementarity to the active site and through numerous hydrophobic interactions. These noncovalent compounds exhibit excellent selectivity and good pharmacokinetic properties. The discovery of this distinctive class of inhibitors opens a new avenue for modulating FAAH activity through nonmechanism-based inhibition. PMID:21502526

  14. Fatty acid synthesis: from CO2 to functional genomics.

    PubMed

    Ohlrogge, J; Pollard, M; Bao, X; Focke, M; Girke, T; Ruuska, S; Mekhedov, S; Benning, C

    2000-12-01

    For over 25 years there has been uncertainty over the pathway from CO(2) to acetyl-CoA in chloroplasts. On the one hand, free acetate is the most effective substrate for fatty acid synthesis by isolated chloroplasts, and free acetate concentrations reported in leaf tissue (0.1-1 mM) appear adequate to saturate fatty acid synthase. On the other hand, a clear mechanism to generate sufficient free acetate for fatty acid synthesis is not established and direct production of acetyl-CoA from pyruvate by a plastid pyruvate dehydrogenase seems a more simple and direct path. We have re-examined this question and attempted to distinguish between the alternatives. The kinetics of (13)CO(2) and (14)CO(2) movement into fatty acids and the absolute rate of fatty acid synthesis in leaves was determined in light and dark. Because administered (14)C appears in fatty acids within < 2-3 min our results are inconsistent with a large pool of free acetate as an intermediate in leaf fatty acid synthesis. In addition, these studies provide an estimate of the turnover rate of fatty acid in leaves. Studies similar to the above are more complex in seeds, and some questions about the regulation of plant lipid metabolism seem difficult to solve using conventional biochemical or molecular approaches. For example, we have little understanding of why or how some seeds produce >50% oil whereas other seeds store largely carbohydrate or protein. Major control over complex plant biochemical pathways may only become possible by understanding regulatory networks which provide 'global' control over these pathways. To begin to discover such networks and provide a broad analysis of gene expression in developing oilseeds, we have produced microarrays that display approx. 5000 seed-expressed Arabidopsis genes. Sensitivity of the arrays was 1-2 copies of mRNA/cell. The arrays have been hybridized with probes derived from seeds, leaves and roots, and analysis of expression ratios between the different tissues

  15. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  16. A Novel Pulse-Chase SILAC Strategy Measures Changes in Protein Decay and Synthesis Rates Induced by Perturbation of Proteostasis with an Hsp90 Inhibitor

    PubMed Central

    Fierro-Monti, Ivo; Racle, Julien; Hernandez, Celine; Waridel, Patrice; Hatzimanikatis, Vassily; Quadroni, Manfredo

    2013-01-01

    Standard proteomics methods allow the relative quantitation of levels of thousands of proteins in two or more samples. While such methods are invaluable for defining the variations in protein concentrations which follow the perturbation of a biological system, they do not offer information on the mechanisms underlying such changes. Expanding on previous work [1], we developed a pulse-chase (pc) variant of SILAC (stable isotope labeling by amino acids in cell culture). pcSILAC can quantitate in one experiment and for two conditions the relative levels of proteins newly synthesized in a given time as well as the relative levels of remaining preexisting proteins. We validated the method studying the drug-mediated inhibition of the Hsp90 molecular chaperone, which is known to lead to increased synthesis of stress response proteins as well as the increased decay of Hsp90 “clients”. We showed that pcSILAC can give information on changes in global cellular proteostasis induced by treatment with the inhibitor, which are normally not captured by standard relative quantitation techniques. Furthermore, we have developed a mathematical model and computational framework that uses pcSILAC data to determine degradation constants kd and synthesis rates Vs for proteins in both control and drug-treated cells. The results show that Hsp90 inhibition induced a generalized slowdown of protein synthesis and an increase in protein decay. Treatment with the inhibitor also resulted in widespread protein-specific changes in relative synthesis rates, together with variations in protein decay rates. The latter were more restricted to individual proteins or protein families than the variations in synthesis. Our results establish pcSILAC as a viable workflow for the mechanistic dissection of changes in the proteome which follow perturbations. Data are available via ProteomeXchange with identifier PXD000538. PMID:24312217

  17. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  18. Synthesis of rosin acid starch catalyzed by lipase.

    PubMed

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2:1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch.

  19. Pterandric acid--its isolation, synthesis and stereochemistry.

    PubMed

    Haleem, Muhammad A; Capellari, Simone C; Sympson, Beryl B; Marsaioli, Anita J

    2015-01-01

    Some plant families have a specialized type of pollination system, with floral lipid rewards for pollinators, which is common. In neotropical Malpighiaceae species like Pterandra pyroidea, this specialized type of pollination system is apparently shifting from floral oils/lipids to pollen reward. Mass spectrometric analysis (GC/MS-EI) indicated that P. pyroidea floral oil has a unique chemical composition, i.e., few fatty acid constituents possessing acetoxy groups at positions 5 and 7, which is distinct from the other floral oils of sympatric Malpighiaceae species. The structure of the major floral oil constituent, a novel fatty acid, anti-5,7-diacetoxydocosanoic acid, was confirmed based on synthesis, mass fragmentation, and 1H and 13C NMR analyses; the compound is herein named pterandric acid.

  20. Very long chain fatty acid synthesis in sunflower kernels.

    PubMed

    Salas, Joaquín J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Most common seed oils contain small amounts of very long chain fatty acids (VLCFAs), the main components of oils from species such as Brassica napus or Lunnaria annua. These fatty acids are synthesized from acyl-CoA precursors in the endoplasmic reticulum through the activity of a dissociated enzyme complex known as fatty acid elongase. We studied the synthesis of the arachidic, behenic, and lignoceric VLCFAs in sunflower kernels, in which they account for 1-3% of the saturated fatty acids. These VLCFAs are synthesized from 18:0-CoA by membrane-bound fatty acid elongases, and their biosynthesis is mainly dependent on NADPH equivalents. Two condensing enzymes appear to be responsible for the synthesis of VLCFAs in sunflower kernels, beta-ketoacyl-CoA synthase-I (KCS-I) and beta-ketoacyl-CoA synthase-II (KCS-II). Both of these enzymes were resolved by ion exchange chromatography and display different substrate specificities. While KCS-I displays a preference for 20:0-CoA, 18:0-CoA was more efficiently elongated by KCS-II. Both enzymes have different sensitivities to pH and Triton X-100, and their kinetic properties indicate that both are strongly inhibited by the presence of their substrates. In light of these results, the VLCFA composition of sunflower oil is considered in relation to that in other commercially exploited oils.

  1. Identification of Anziaic Acid, a Lichen Depside from Hypotrachyna sp., as a New Topoisomerase Poison Inhibitor

    PubMed Central

    Cheng, Bokun; Cao, Shugeng; Vasquez, Victor; Annamalai, Thirunavukkarasu; Tamayo-Castillo, Giselle; Clardy, Jon; Tse-Dinh, Yuk-Ching

    2013-01-01

    Topoisomerase inhibitors are effective for antibacterial and anticancer therapy because they can lead to the accumulation of the intermediate DNA cleavage complex formed by the topoisomerase enzymes, which trigger cell death. Here we report the application of a novel enzyme-based high-throughput screening assay to identify natural product extracts that can lead to increased accumulation of the DNA cleavage complex formed by recombinant Yersinia pestis topoisomerase I as part of a larger effort to identify new antibacterial compounds. Further characterization and fractionation of the screening positives from the primary assay led to the discovery of a depside, anziaic acid, from the lichen Hypotrachyna sp. as an inhibitor for both Y. pestis and Escherichia coli topoisomerase I. In in vitro assays, anziaic acid exhibits antibacterial activity against Bacillus subtilis and a membrane permeable strain of E. coli. Anziaic acid was also found to act as an inhibitor of human topoisomerase II but had little effect on human topoisomerase I. This is the first report of a depside with activity as a topoisomerase poison inhibitor and demonstrates the potential of this class of natural products as a source for new antibacterial and anticancer compounds. PMID:23593306

  2. Design and synthesis of orally bioavailable serum and glucocorticoid-regulated kinase 1 (SGK1) inhibitors

    SciTech Connect

    Hammond, Marlys; Washburn, David G.; Hoang, Tram H.; Manns, Sharada; Frazee, James S.; Nakamura, Hiroko; Patterson, Jaclyn R.; Trizna, Walter; Wu, Charlene; Azzarano, Leonard M.; Nagilla, Rakesh; Nord, Melanie; Trejo, Rebecca; Head, Martha S.; Zhao, Baoguang; Smallwood, Angela M.; Hightower, Kendra; Laping, Nicholas J.; Schnackenberg, Christine G.; Thompson, Scott K.

    2010-09-27

    The lead serum and glucocorticoid-related kinase 1 (SGK1) inhibitors 4-(5-phenyl-1H-pyrrolo[2,3-b]pyridin-3-yl)benzoic acid (1) and {l_brace}4-[5-(2-naphthalenyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]phenyl{r_brace}acetic acid (2) suffer from low DNAUC values in rat, due in part to formation and excretion of glucuronic acid conjugates. These PK/glucuronidation issues were addressed either by incorporating a substituent on the 3-phenyl ring ortho to the key carboxylate functionality of 1 or by substituting on the group in between the carboxylate and phenyl ring of 2. Three of these analogs have been identified as having good SGK1 inhibition potency and have DNAUC values suitable for in vivo testing.

  3. Design and synthesis of orally bioavailable serum and glucocorticoid-regulated kinase 1 (SGK1) inhibitors.

    PubMed

    Hammond, Marlys; Washburn, David G; Hoang, H Tram; Manns, Sharada; Frazee, James S; Nakamura, Hiroko; Patterson, Jaclyn R; Trizna, Walter; Wu, Charlene; Azzarano, Leonard M; Nagilla, Rakesh; Nord, Melanie; Trejo, Rebecca; Head, Martha S; Zhao, Baoguang; Smallwood, Angela M; Hightower, Kendra; Laping, Nicholas J; Schnackenberg, Christine G; Thompson, Scott K

    2009-08-01

    The lead serum and glucocorticoid-related kinase 1 (SGK1) inhibitors 4-(5-phenyl-1H-pyrrolo[2,3-b]pyridin-3-yl)benzoic acid (1) and {4-[5-(2-naphthalenyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]phenyl}acetic acid (2) suffer from low DNAUC values in rat, due in part to formation and excretion of glucuronic acid conjugates. These PK/glucuronidation issues were addressed either by incorporating a substituent on the 3-phenyl ring ortho to the key carboxylate functionality of 1 or by substituting on the group in between the carboxylate and phenyl ring of 2. Three of these analogs have been identified as having good SGK1 inhibition potency and have DNAUC values suitable for in vivo testing.

  4. Triacontanol negatively modulates the jasmonic acid-stimulated proteinase inhibitors in tomato (Lycopersicon esculentum).

    PubMed

    Ramanarayan, Krishnamurthy; Swamy, Gangadharamurthy Sivakumar

    2004-04-01

    Triacontanol (TRIA), a long chain aliphatic alcohol (C30H61OH) reverses the effect of jasmonic acid (JA) in inducing proteinase inhibitors (PIs) in tomato leaves. Porcine pancreas trypsin and Spodoptera litura gut proteinases were inhibited in the presence of leaf proteins treated with JA, and TRIA partially reverses this effect. Spodoptera litura larvae fed with tomato leaves treated with JA were reduced in body weight and TRIA is able to partially reverse this JA-induced effect. These results reflect the partial reversal effect of TRIA in down regulating the JA-induced production of proteinase inhibitors.

  5. Thiadiazole Carbamates: Potent Inhibitors of Lysosomal Acid Lipase and Potential Niemann-Pick Type C Disease Therapeuticsa

    PubMed Central

    Rosenbaum, Anton I.; Cosner, Casey C.; Mariani, Christopher J.; Maxfield, Frederick R.; Wiest, Olaf; Helquist, Paul

    2010-01-01

    Niemann-Pick type C (NPC) disease is a lysosomal storage disorder characterized at the cellular level by abnormal accumulation of cholesterol and other lipids in lysosomal storage organelles. Lysosomal acid lipase (LAL) has been recently identified as a potential therapeutic target for NPC. LAL can be specifically inhibited by a variety of 3,4-disubstituted thiadiazole carbamates. An efficient synthesis of the C(3) oxygenated/C(4) aminated analogues has been developed that furnishes the products in high yields and high degrees of purity. Common intermediates can also be used for the synthesis of the C(3) carbon substituted derivatives. Herein we tested various thiadiazole carbamates, amides, esters, and ketones for inhibition of LAL. In addition, we tested a diverse selection of commercially available non-thiadiazole carbamates. Our studies show that, among the compounds examined herein, only thiadiazole carbamates are effective inhibitors of LAL. We present a mechanism for LAL inhibition by these compounds whereby LAL transiently carbamoylates the enzyme similarly to previously described inhibition of acetylcholinesterase by rivastigmine and other carbamates as well as acylation of various lipases by orlistat. PMID:20557099

  6. A dual inhibitor of cyclooxygenase and 5-lipoxygenase protects against kainic acid-induced brain injury.

    PubMed

    Minutoli, Letteria; Marini, Herbert; Rinaldi, Mariagrazia; Bitto, Alessandra; Irrera, Natasha; Pizzino, Gabriele; Pallio, Giovanni; Calò, Margherita; Adamo, Elena Bianca; Trichilo, Vincenzo; Interdonato, Monica; Galfo, Federica; Squadrito, Francesco; Altavilla, Domenica

    2015-06-01

    Systemic administration of kainic acid causes inflammation and apoptosis in the brain, resulting in neuronal loss. Dual cyclooxygenase/5-lipoxygenase (COX/5-LOX) inhibitors could represent a possible neuroprotective approach in preventing glutamate excitotoxicity. Consequently, we investigated the effects of a dual inhibitor of COX/5-LOX following intraperitoneal administration of kainic acid (KA, 10 mg/kg) in rats. Animals were randomized to receive either the dual inhibitor of COX/5-LOX (flavocoxid, 20 mg/kg i.p.) or its vehicle (1 ml/kg i.p.) 30 min after KA administration. Sham brain injury rats were used as controls. We evaluated protein expression of phosphorylated extracellular signal-regulated kinase (p-ERK1/2) and tumor necrosis factor alpha (TNF-α) as well as levels of malondialdehyde (MDA), prostaglandin E2 (PGE2) and leukotriene B4 (LTB4) in the hippocampus. Animals were also observed for monitoring behavioral changes according to Racine Scale. Finally, histological analysis and brain edema evaluation were carried out. Treatment with the dual inhibitor of COX/5-LOX decreased protein expression of p-ERK1/2 and TNF-α in hippocampus, markedly reduced MDA, LTB4 and PGE2 hippocampal levels, and also ameliorated brain edema. Histological analysis showed a reduction in cell damage in rats treated with the dual inhibitor of COX/5-LOX, particularly in hippocampal subregion CA3c. Moreover, flavocoxid significantly improved behavioral signs following kainic acid administration. Our results suggest that dual inhibition of COX/5-LOX by flavocoxid has neuroprotective effects during kainic acid-induced excitotoxicity. PMID:25893744

  7. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  8. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  9. Development and Characterization of Novel and Selective Inhibitors of Cytochrome P450 CYP26A1, the Human Liver Retinoic Acid Hydroxylase.

    PubMed

    Diaz, Philippe; Huang, Weize; Keyari, Charles M; Buttrick, Brian; Price, Lauren; Guilloteau, Nicolas; Tripathy, Sasmita; Sperandio, Vanessa G; Fronczek, Frank R; Astruc-Diaz, Fanny; Isoherranen, Nina

    2016-03-24

    Cytochrome P450 CYP26 enzymes are responsible for all-trans-retinoic acid (atRA) clearance. Inhibition of CYP26 enzymes will increase endogenous atRA concentrations and is an attractive therapeutic target. However, the selectivity and potency of the existing atRA metabolism inhibitors toward CYP26A1 and CYP26B1 is unknown, and no selective CYP26A1 or CYP26B1 inhibitors have been developed. Here the synthesis and potent inhibitory activity of the first CYP26A1 selective inhibitors is reported. A series of nonazole CYP26A1 selective inhibitors was identified with low nM potency. The lead compound 3-{4-[2-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)-1,3-dioxolan-2-yl] phenyl}4-propanoic acid (24) had 43-fold selectivity toward CYP26A1 with an IC50 of 340 nM. Compound 24 and its two structural analogues also inhibited atRA metabolism in HepG2 cells, resulting in increased potency of atRA toward RAR activation. The identified compounds have potential to become novel treatments aiming to elevate endogenous atRA concentrations and may be useful as cotreatment with atRA to combat therapy resistance.

  10. Interference of L-α-aminoocy-β-phenylpropionic acid with cold-induced sphagnorubin synthesis in Sphagnum magellanicum BRID.

    PubMed

    Tutschek, R

    1982-08-01

    The ability of the phenylalanine ammonia-lyase (PAL)-inhibitor L-α-aminooxy-β-phenyl-propionic acid (AOPP) to suppress the synthesis of the main reddish-violet wall pigment of Sphagnum magellanicum (sphagnorubin) was investigated. Fifty percent inhibition is achieved with 14 μM AOPP in mosses stimulated to intensive coloring by sugar feeding. AOPP does not affect the content of free amino acids, except for phenylalanine, during cold-induced sphagnorubin synthesis. AOPP dramatically amplifies the increase in extractable PAL activity in response to cold treatment. Phenylalanine applied in vivo causes an eminent increase in PAL activity, above the level of the cold-treated mosses. The results from the feeding experiments are discussed in connection with a possible end-product repression in PAL activity with sphagnorubin-synthesizing mosses. These results are correspond best to the theory that the enzyme level is regulated independently from a mechanism of feedback repression. PMID:24271864

  11. Infusion of protein synthesis inhibitors in the entorhinal cortex blocks consolidation but not reconsolidation of object recognition memory.

    PubMed

    Lima, Ramón H; Rossato, Janine I; Furini, Cristiane R; Bevilaqua, Lia R; Izquierdo, Iván; Cammarota, Martín

    2009-05-01

    Memory consolidation and reconsolidation require the induction of protein synthesis in some areas of the brain. Here, we show that infusion of the protein synthesis inhibitors anisomycin, emetine and cycloheximide in the entorhinal cortex immediately but not 180 min or 360 min after training in an object recognition learning task hinders long-term memory retention without affecting short-term memory or behavioral performance. Inhibition of protein synthesis in the entorhinal cortex after memory reactivation involving either a combination of familiar and novel objects or two familiar objects does not affect retention. Our data suggest that protein synthesis in the entorhinal cortex is necessary early after training for consolidation of object recognition memory. However, inhibition of protein synthesis in this cortical region after memory retrieval does not seem to affect the stability of the recognition trace.

  12. Low survival of mice following lethal gamma-irradiation after administration of inhibitors of prostaglandin synthesis.

    PubMed

    Hofer, M; Pospísil, M; Tkadlecek, L; Viklická, S; Pipalová, I; Holá, J

    1992-01-01

    An impairment of the survival of mice subjected to whole-body gamma-irradiation with a lethal dose of 10 Gy and treated with a repeated postirradiation administration of prostaglandin synthesis inhibitors (PGSIs), indomethacin or diclofenac, was observed. Morphological examination of the gastrointestinal tract and the estimation of blood loss into its lumen in animals treated with diclofenac did not show serious damage such as haemorrhages or perforation, but revealed structural injury to the intestinal mucosa indicating inflammatory processes. The lesions found are supposed to be connected with increased intestinal permeability which leads to endotoxin escape from the gut and a subsequent increased mortality rate of irradiated animals. It may be concluded that PGSIs are not suitable for the management of radiation sickness after an exposure to lethal doses of ionizing radiation.

  13. Laboratory Evaluation of Flurox, a Chitin Synthesis Inhibitor, on the Termite, Microcerotermes diversus

    PubMed Central

    Habibpour, Behzad

    2010-01-01

    Microcerotermes diversus (Silvestri) (Isoptera: Termitidae) is the most economically destructive termite in structures in southwest Iran. One sustainable control strategy that usually helps to reduce subterranean termite damage in buildings, is the use of insect growth regualtors in a suitable bait matrix that are safe to the user and the environment. In the laboratory assays described here, the delayed toxicity of Flurox, a chitin synthesis inhibitor, to M. diversus was evaluated under force-feeding and choice trials. Flurox induced worker and nymph mortality and incomplete ecdysis in nymphs of M. diversus under no-choice and two-choice feeding tests. These adverse effects may cause disruption of the caste balance in M. diversus, leading to the collapse of the colony. These assays determined concentrations of Flurox that can be used in bait formulations. PMID:20569123

  14. Laboratory evaluation of Flurox, a chitin synthesis inhibitor, on the termite, Microcerotermes diversus.

    PubMed

    Habibpour, Behzad

    2010-01-01

    Microcerotermes diversus (Silvestri) (Isoptera: Termitidae) is the most economically destructive termite in structures in southwest Iran. One sustainable control strategy that usually helps to reduce subterranean termite damage in buildings, is the use of insect growth regualtors in a suitable bait matrix that are safe to the user and the environment. In the laboratory assays described here, the delayed toxicity of Flurox, a chitin synthesis inhibitor, to M. diversus was evaluated under force-feeding and choice trials. Flurox induced worker and nymph mortality and incomplete ecdysis in nymphs of M. diversus under no-choice and two-choice feeding tests. These adverse effects may cause disruption of the caste balance in M. diversus, leading to the collapse of the colony. These assays determined concentrations of Flurox that can be used in bait formulations.

  15. An inhibitor of chondroitin sulfate proteoglycan synthesis promotes central nervous system remyelination

    PubMed Central

    Keough, Michael B.; Rogers, James A.; Zhang, Ping; Jensen, Samuel K.; Stephenson, Erin L.; Chen, Tieyu; Hurlbert, Mitchel G.; Lau, Lorraine W.; Rawji, Khalil S.; Plemel, Jason R.; Koch, Marcus; Ling, Chang-Chun; Yong, V. Wee

    2016-01-01

    Remyelination is the generation of new myelin sheaths after injury facilitated by processes of differentiating oligodendrocyte precursor cells (OPCs). Although this repair phenomenon occurs in lesions of multiple sclerosis patients, many lesions fail to completely remyelinate. A number of factors have been identified that contribute to remyelination failure, including the upregulated chondroitin sulfate proteoglycans (CSPGs) that comprise part of the astrogliotic scar. We show that in vitro, OPCs have dramatically reduced process outgrowth in the presence of CSPGs, and a medication library that includes a number of recently reported OPC differentiation drugs failed to rescue this inhibitory phenotype on CSPGs. We introduce a novel CSPG synthesis inhibitor to reduce CSPG content and find rescued process outgrowth from OPCs in vitro and accelerated remyelination following focal demyelination in mice. Preventing CSPG deposition into the lesion microenvironment may be a useful strategy to promote repair in multiple sclerosis and other neurological disorders. PMID:27115988

  16. Isolation and Synthesis of a Bacterially Produced Inhibitor of Rosette Development in Choanoflagellates.

    PubMed

    Cantley, Alexandra M; Woznica, Arielle; Beemelmanns, Christine; King, Nicole; Clardy, Jon

    2016-04-01

    The choanoflagellate Salpingoeca rosetta is a microbial marine eukaryote that can switch between unicellular and multicellular states. As one of the closest living relatives of animals, this organism has become a model for understanding how multicellularity evolved in the animal lineage. Previously our laboratories isolated and synthesized a bacterially produced sulfonolipid that induces S. rosetta to form multicellular "rosettes." In this study, we report the identification of a bacterially produced inhibitor of rosettes (IOR-1) as well as the total synthesis of this molecule and all of its stereoisomers. Our results confirm the previously noted specificity and potency of rosette-modulating molecules, expand our understanding of the complex chemical ecology between choanoflagellates and rosette-inducing bacteria, and provide a synthetic probe template for conducting further mechanistic studies on the emergence of multicellularity. PMID:26998963

  17. Isolation and Synthesis of a Bacterially Produced Inhibitor of Rosette Development in Choanoflagellates

    PubMed Central

    2016-01-01

    The choanoflagellate Salpingoeca rosetta is a microbial marine eukaryote that can switch between unicellular and multicellular states. As one of the closest living relatives of animals, this organism has become a model for understanding how multicellularity evolved in the animal lineage. Previously our laboratories isolated and synthesized a bacterially produced sulfonolipid that induces S. rosetta to form multicellular “rosettes.” In this study, we report the identification of a bacterially produced inhibitor of rosettes (IOR-1) as well as the total synthesis of this molecule and all of its stereoisomers. Our results confirm the previously noted specificity and potency of rosette-modulating molecules, expand our understanding of the complex chemical ecology between choanoflagellates and rosette-inducing bacteria, and provide a synthetic probe template for conducting further mechanistic studies on the emergence of multicellularity. PMID:26998963

  18. Discovery of highly potent acid ceramidase inhibitors with in vitro tumor chemosensitizing activity

    PubMed Central

    Realini, Natalia; Solorzano, Carlos; Pagliuca, Chiara; Pizzirani, Daniela; Armirotti, Andrea; Luciani, Rosaria; Costi, Maria Paola; Bandiera, Tiziano; Piomelli, Daniele

    2013-01-01

    The expression of acid ceramidase (AC) – a cysteine amidase that hydrolyses the proapoptotic lipid ceramide – is abnormally high in several human tumors, which is suggestive of a role in chemoresistance. Available AC inhibitors lack, however, the potency and drug-likeness necessary to test this idea. Here we show that the antineoplastic drug carmofur, which is used in the clinic to treat colorectal cancers, is a potent AC inhibitor and that this property is essential to its anti-proliferative effects. Modifications in the chemical scaffold of carmofur yield new AC inhibitors that act synergistically with standard antitumoral drugs to prevent cancer cell proliferation. These findings identify AC as an unexpected target for carmofur, and suggest that this molecule can be used as starting point for the design of novel chemosensitizing agents. PMID:23301156

  19. Amino acid sequence of a protease inhibitor isolated from Sarcophaga bullata determined by mass spectrometry.

    PubMed

    Papayannopoulos, I A; Biemann, K

    1992-02-01

    The amino acid sequence of a protease inhibitor isolated from the hemolymph of Sarcophaga bullata larvae was determined by tandem mass spectrometry. Homology considerations with respect to other protease inhibitors with known primary structures assisted in the choice of the procedure followed in the sequence determination and in the alignment of the various peptides obtained from specific chemical cleavage at cysteines and enzyme digests of the S. bullata protease inhibitor. The resulting sequence of 57 residues is as follows: Val Asp Lys Ser Ala Cys Leu Gln Pro Lys Glu Val Gly Pro Cys Arg Lys Ser Asp Phe Val Phe Phe Tyr Asn Ala Asp Thr Lys Ala Cys Glu Glu Phe Leu Tyr Gly Gly Cys Arg Gly Asn Asp Asn Arg Phe Asn Thr Lys Glu Glu Cys Glu Lys Leu Cys Leu.

  20. Circadian control of bile acid synthesis by a KLF15-Fgf15 axis

    PubMed Central

    Han, Sean (Shuxin); Zhang, Rongli; Jain, Rajan; Shi, Hong; Zhang, Lilei; Zhou, Guangjin; Sangwung, Panjamaporn; Tugal, Derin; Atkins, G. Brandon; Prosdocimo, Domenick A.; Lu, Yuan; Han, Xiaonan; Tso, Patrick; Liao, Xudong; Epstein, Jonathan A.; Jain, Mukesh K.

    2015-01-01

    Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15 signalling axis that regulates circadian BA production. Systemic Klf15 deficiency disrupted circadian expression of key BA synthetic enzymes, tissue BA levels and triglyceride/cholesterol absorption. Studies in liver-specific Klf15-knockout mice suggested a non-hepatic basis for regulation of BA production. Ileal Fgf15 is a potent inhibitor of BA synthesis. Using a combination of biochemical, molecular and functional assays (including ileectomy and bile duct catheterization), we identify KLF15 as the first endogenous negative regulator of circadian Fgf15 expression. Elucidation of this novel pathway controlling circadian BA production has important implications for physiologic control of nutrient availability and metabolic homeostasis. PMID:26040986

  1. Design, Synthesis and Evaluation of Marinopyrrole Derivatives as Selective Inhibitors of Mcl-1 Binding to Pro-apoptotic Bim and Dual Mcl-1/Bcl-xL Inhibitors

    PubMed Central

    Li, Rongshi; Daniel, Kenyon G.; Li, Jerry; Qin, Yong; Gavathiotis, Evripidis; Sebti, Said M.

    2015-01-01

    Inhibition of anti-apoptotic Mcl-1 is a promising anticancer strategy to overcome the survival and chemoresistance of a broad spectrum of human cancers. We previously reported on the identification of a natural product marinopyrrole A (1) that induces apoptosis in Mcl-1-dependent cells through Mcl-1 degradation. Here, we report the design and synthesis of novel marinopyrrole-based analogues and their evaluation as selective inhibitors of Mcl-1 as well as dual Mcl-1/Bcl-xL inhibitors. The most selective Mcl-1 antagonists were 34, 36 and 37 with 16-, 13- and 9-fold more selectivity for disrupting Mcl-1/Bim over Bcl-xL/Bim binding, respectively. Among the most potent dual inhibitors is 42 which inhibited Mcl-1/Bim and Bcl-xL/Bim binding 15-fold (IC50 = 600 nM) and 33-fold (500 nM) more potently than (±)-marinopyrrole A (1), respectively. Fluorescence quenching, NMR analysis and molecular docking indicated binding of marinopyrroles to the BH3 binding site of Mcl-1. Several marinopyrroles potently decreased Mcl-1 cellular levels and induced caspase 3 activation in human breast cancer cells. Our studies provide novel “lead” marinopyrroles for further optimization as selective Mcl-1 inhibitors and dual Mcl-1 and Bcl-xL inhibitors. PMID:25437618

  2. Anti-amyloidogenic effects of glycosphingolipid synthesis inhibitors occur independently of ganglioside alterations.

    PubMed

    Noel, Anastasia; Ingrand, Sabrina; Barrier, Laurence

    2016-09-01

    Evidence has suggested that ganglioside abnormalities may be linked to the proteolytic processing of amyloid precursor protein (APP) in Alzheimer's disease (AD) and that pharmacological inhibition of ganglioside synthesis may reduce amyloid β-peptide (Aβ) production. In this study, we assessed the usefulness of two well-established glycosphingolipid (GSL) synthesis inhibitors, the synthetic ceramide analog D-PDMP (1-phenyl 2-decanoylamino-3-morpholino-1-propanol) and the iminosugar N-butyldeoxynojirimycin (NB-DNJ or miglustat), as anti-amyloidogenic drugs in a human cellular model of AD. We found that both GSL inhibitors were able to markedly inhibit Aβ production, although affecting differently the APP cleavage. Surprisingly, the L-enantiomer of PDMP, which promotes ganglioside accumulation, acted similarly to D-PDMP to inhibit Aβ production. Concurrently, both D- and L-PDMP strongly and equally reduced the levels of long-chain ceramides. Altogether, our data suggested that the anti-amyloidogenic effects of PDMP agents are independent of the altered cellular ganglioside composition, but may result, at least in part, from their ability to reduce ceramide levels. Moreover, our current study established for the first time that NB-DNJ, a drug already used as a therapeutic for Gaucher disease (a lysosomal storage disorder), was also able to reduce Aβ production in our cellular model. Therefore, our study provides novel information regarding the possibilities to target amyloidogenic processing of APP through modulation of sphingolipid metabolism and emphasizes the potential of the iminosugar NB-DNJ as a disease modifying therapy for AD. PMID:27373967

  3. Protein synthesis inhibitors attenuate water flow in vasopressin-stimulated toad urinary bladder.

    PubMed

    Hoch, B S; Ast, M B; Fusco, M J; Jacoby, M; Levine, S D

    1988-01-01

    Vasopressin stimulates the introduction of aggregated particles, which may represent pathways for water flow, into the luminal membrane of toad urinary bladder. It is not known whether water transport pathways are degraded on removal from membrane or whether they are recycled. We examined the effect of the protein synthesis inhibitors cycloheximide and puromycin using repeated 30-min cycles of vasopressin followed by washout of vasopressin, all in the presence of an osmotic gradient, a protocol that maximizes aggregate turnover. "High dose" cycloheximide (200 micrograms/ml) inhibited flow immediately. "Low dose" cycloheximide (1 microgram/ml) did not affect initial flow; however, flow was inhibited by the fourth restimulation. On further rechallenge, inhibition persisted but did not increase. In the absence of vasopressin, inhibition did not develop. Despite the inhibition of flow in vasopressin-treated tissues, the cAMP-dependent protein kinase ratio (-cAMP/+cAMP), an index of in vivo cAMP effect, was elevated in cycloheximide-treated tissues, suggesting modulation at a distal site in the stimulatory cascade. Cycloheximide inhibited flow when 10 microM forskolin or 0.2 mM 8-BrcAMP was substituted for vasopressin in the fourth period; however, MIX (4 mM)-stimulated flow was enhanced by 1 microgram/ml cycloheximide but inhibited by 200 micrograms/ml cycloheximide. [14C]urea permeability was not inhibited by cycloheximide. Puromycin (0.5 mM) also inhibited water flow by the fourth challenge with vasopressin. The data suggest that protein synthesis inhibitors attenuate flow at a site that is distal to cAMP-dependent protein kinase.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Differential proteomic analysis of lymphocytes treated with mycophenolic acid reveals caspase 3-induced cleavage of rho GDP dissociation inhibitor 2.

    PubMed

    Heller, Tanja; Asif, Abdul R; Petrova, Darinka Todorova; Doncheva, Yuliana; Wieland, E; Oellerich, Michael; Shipkova, Maria; Armstrong, Victor William

    2009-04-01

    The antiproliferative immunosuppressive drug mycophenolic acid (MPA) is an uncompetitive inhibitor of inosine monophosphate dehydrogenase, a key enzyme in de novo synthesis of purine nucleotides. The latter are not only required for synthesis of DNA and RNA but also are essential for the regulation of numerous cellular signaling pathways modulated by guanine nucleotide binding proteins (G proteins). We undertook an analysis of the influence of MPA on protein expression in a T-lymphoblast cell line (CCRF-CEM), which displays concentration-dependent inhibition of proliferation by MPA to obtain insight into the influence of MPA on the cellular proteome. Cells were stimulated with phorbol myristate acetate/ionomycin and incubated in the presence or absence of MPA. Two-dimensional electrophoresis and densitometric imaging revealed 11 differentially expressed protein spots (P < 0.05) on MPA treatment, 6 with increased and 5 with decreased abundance. After in-gel tryptic digestion, proteins were identified by quadrupole time-of-flight mass spectrometry. Proteins displaying increased abundance after MPA treatment included splicing factor arginine/serine-rich 2, prostaglandin E synthase 3, peptidyl-prolyl cis-trans isomerase A, and deoxyuridine 5'-triphosphate nucleotidohydrolase. Endoplasmin, proliferating cell nuclear antigen, acidic leucine-rich nuclear phosphoprotein 32 family member A, and cofilin 1 showed decreased abundance after MPA treatment. Three separate spots (1 decreased and 2 increased abundance) were identified as Rho guanosine diphosphate dissociation inhibitor 2 (Rho GDI 2) proteins. Western blotting with a monoclonal antibody directed against the Rho GDI 2 site cleaved by caspase 3 demonstrated 1 spot with increased abundance to be the caspase 3-cleaved product of Rho GDI 2 lacking the first 19 amino acids. Rho GDI 2 plays a central regulatory role in the activation of Rho guanosine triphosphatases that function as molecular switches in cell signaling

  5. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  6. Synthesis and bioactivity of 2',3'-benzoabscisic acid analogs.

    PubMed

    Han, Xiaoqiang; Wan, Chuan; Li, Xiuyun; Li, Hong; Yang, Dongyan; Du, Shijie; Xiao, Yumei; Qin, Zhaohai

    2015-06-01

    2',3'-Benzoabscisic acid 4a is significantly more active than (±)-ABA and can be potentially used as a plant growth regulator for agriculture. In this study, six 4a analogs were designed and synthesized. Bioassay showed that 4a displayed greater activity than (±)-ABA and the six analogs produced less inhibition than 4a itself. Specially, some analogs displayed markedly different activities to different physiological and biochemical process, which were largely different from ABA and 4a. Compared to (±)-ABA, 4b and 4c were more effective germination inhibitors for lettuce, but less effective inhibitors for rice elongation. Five-membered analog 5 was higher or slightly weaker in inhibiting Arabidopsis seed germination and rice elongation, respectively, but at least 10 times less effective than (±)-ABA in lettuce seed germination. Dual acid 6 and alkyne acid 20 nearly produced no inhibitory activity for Arabidopsis seed germination, but displayed excellent activity in inhibiting rice seedling growth. The preference of the analogs to different physiology process indicated that they might provide a strategy to develop novel ABA agonists or antagonist and be used as probe to investigate the function of different ABA receptors. PMID:25913114

  7. Synthesis and biological activities of vitamin D-like inhibitors of CYP24 hydroxylase

    PubMed Central

    Chiellini, Grazia; Rapposelli, Simona; Zhu, Jinge; Massarelli, Ilaria; Saraceno, Marilena; Bianucci, Anna Maria; Plum, Lori A.; Clagett-Dame, Margaret; DeLuca, Hector F.

    2012-01-01

    Selective inhibitors of CYP24A1 represent an important synthetic target in a search for novel vitamin D compounds of therapeutic value. In the present work, we show the synthesis and biological properties of two novel side chain modified 2-methylene-19-nor-1,25(OH)2D3 analogs, the 22-imidazole-1-yl derivative 2 (VIMI) and the 25-N-cyclopropylamine compound 3 (CPA1), which were efficiently prepared in convergent syntheses utilizing the Lythgoe type Horner–Wittig olefination reaction. When tested in a cell-free assay, both compounds were found to be potent competitive inhibitors of CYP24A1, with the cyclopropylamine analog 3 exhibiting an 80–1 selective inhibition of CYP24A1 over CYP27B1. Addition of 3 to a mouse osteoblast culture sustained the level of 1,25(OH)2D3, further demonstrating its effectiveness in CYP24A1 inhibition. Importantly, the in vitro effects on human promyeloid leukemia (HL-60) cell differentiation by 3 were nearly identical to those of 1,25(OH)2D3 and in vivo the compound showed low calcemic activity. Finally, the results of preliminary theoretical studies provide useful insights to rationalize the ability of analog 3 to selectively inhibit the cytochrome P450 isoform CYP24A1. PMID:22133546

  8. Stimulators and inhibitors of lymphocyte DNA synthesis in supernatants from human lymphoid cell lines.

    PubMed

    Vesole, D H; Goust, J M; Fett, J W; Fudenberg, H H

    1979-09-01

    Some T and B lymphoid cell lines (LCL) were found to secrete into their supernatants a substance able to stimulate lymphocyte proliferation. This substance produced an increase in [3H]thymidine uptake by mononuclear cells when added to unstimulated cultures (mitogenic effect) or when added to cultures stimulated with phytohemagglutinin (PHA) or pokeweed mitogen (PWM) (potentiating effect). When complete supernatants were used, the potentiating effect was sometimes masked by an inhibitor of DNA synthesis. Fractionation on Sephadex G-100 separated these two activities. The stimulatory substance eluted at a m.w. range of 15,000 to 30,000, and the inhibitor eluted with the albumin peak. B cells with or without monocytes were the most sensitive to the mitogenic effect, whereas T cells were unaffected. Responses to PHA and PWM were potentiated when T cells were present, but the maximum effect was observed when the proportion of T cells was less than 50%. The stimulatory material may be similar to lymphocyte mitogenic factor and may function as a T cell-replacing factor in B cell stimulation. PMID:313950

  9. Discovery of a small-molecule inhibitor of {beta}-1,6-glucan synthesis.

    PubMed

    Kitamura, Akihiro; Someya, Kazuhiko; Hata, Masato; Nakajima, Ryohei; Takemura, Makoto

    2009-02-01

    It is possible that antifungal drugs with novel modes of action will provide favorable options to treat fungal infections. In the course of our screening for antifungal compounds acting on the cell wall, a pyridobenzimidazole derivative with unique activities, named D75-4590, was discovered. During treatment of Saccharomyces cerevisiae with D75-4590, (i) incorporation of [(14)C]glucose into the beta-1,6-glucan component was selectively reduced, (ii) proteins released from the cell had lost the beta-1,6-glucan moiety, and (iii) cells tended to clump, resulting in impaired cell growth. Genetic analysis of a D75-4590-resistant mutant of S. cerevisiae indicated that its primary target was Kre6p, which is considered to be one of the beta-1,6-glucan synthases. These results strongly suggest that D75-4590 is a specific inhibitor of beta-1,6-glucan synthesis. D75-4590 showed potent activities against various Candida species. It inhibited hyphal elongation of C. albicans as well. KRE6 is conserved in various fungi, but no homologue has been found in mammalian cells. These lines of evidence indicate that D75-4590 is a promising lead compound for novel antifungal drugs. To our knowledge, this is the first report of a beta-1,6-glucan inhibitor. PMID:19015325

  10. Synthesis and biological evaluation of di-aryl urea derivatives as c-Kit inhibitors.

    PubMed

    Ravez, Séverine; Arsenlis, Stéphane; Barczyk, Amélie; Dupont, Anthony; Frédérick, Raphaël; Hesse, Stéphanie; Kirsch, Gilbert; Depreux, Patrick; Goossens, Laurence

    2015-11-15

    Inhibition of receptor tyrosine kinases (RTKs) continued to be a successful approach for the treatment of many types of human cancers and many potent small molecules kinase inhibitors have been discovered the last decade. In the present study, we describe the synthesis of thienopyrimidine derivatives and their pharmacological evaluation against nine kinases (EGFR, PDGFR-ß, c-Kit, c-Met, Src, Raf, VEGFR-1, -2 and -3). Most of the synthesized compounds showed from moderate to potent activities against c-Kit with IC50 values in the nanomolar range. Among them, 4-anilino(urea)thienopyrimidine analogs showed selectivity and potent c-Kit inhibition with IC50 values less than 6 nM. Docking simulation was performed for the most promising compound 9 into the c-Kit active site to determine the potential binding mode. This study reveal that the 4-anilino(urea)thienopyrimidine is an interesting scaffold to design novel potent and selective c-Kit inhibitors which may make promising candidates for cancers where c-Kit receptors are overexpressed.

  11. The DNA methylation inhibitor 5-azacytidine decreases melanin synthesis by inhibiting CREB phosphorylation.

    PubMed

    Shin, Jun Seob; Jeong, Hyo-Soon; Kim, Myo-Kyoung; Yun, Hye-Young; Baek, Kwang Jin; Kwon, Nyoun Soo; Kim, Dong-Seok

    2015-10-01

    Here we examined the effects of a DNA methylation inhibitor, 5-azacytidine, on melanogenesis in Mel-Ab cells. We found that 5-azacytidine decreased the melanin content and tyrosinase activity in these cells in a dose-dependent manner; importantly, 5-azacytidine was not cytotoxic at the concentrations used in these experiments. On the other hand, 5-azacytidine did not affect tyrosinase activity in a cell-free system, indicating that 5-azacytidine is not a direct tyrosinase inhibitor. Instead, 5-azacytidine decreased the protein levels of microphthalmia-associated transcription factor (MITF) and tyrosinase. Thus, we investigated the effects of 5-azacytidine on signal transduction pathways related to melanogenesis. However, 5-azacytidine did not have any effect on either Akt or glycogen synthase kinase 3β (GSK3β) phosphorylation. The phosphorylation of cAMP response element-binding protein (CREB) is well known to regulate MITF expression, thereby also regulating tyrosinase expression. We found that 5-azacytidine decreased the phosphorylation of CREB. Therefore, we propose that 5-azacytidine may decrease melanin synthesis by downregulating MITF and tyrosinase via CREB inactivation.

  12. Synthesis of a Poly-hydroxypyrolidine-Based inhibitor of Mycobacterium tuberculosis GlgE

    PubMed Central

    2015-01-01

    Long treatment times, poor drug compliance, and natural selection during treatment of Mycobacterium tuberculosis (Mtb) have given rise to extensively drug-resistant tuberculosis (XDR-TB). As a result, there is a need to identify new antituberculosis drug targets. Mtb GlgE is a maltosyl transferase involved in α-glucan biosynthesis. Mutation of GlgE in Mtb increases the concentration of maltose-1-phosphate (M1P), one substrate for GlgE, causing rapid cell death. We have designed 2,5-dideoxy-3-O-α-d-glucopyranosyl-2,5-imino-d-mannitol (9) to act as an inhibitor of GlgE. Compound 9 was synthesized using a convergent synthesis by coupling thioglycosyl donor 14 and 5-azido-3-O-benzyl-5-deoxy-1,2-O-isopropylidene-β-d-fructopyranose (23) to form disaccharide 24. A reduction and intramolecular reductive amination transformed the intermediate disaccharide 24 to the desired pyrolidine 9. Compound 9 inhibited both Mtb GlgE and a variant of Streptomyces coelicolor (Sco) GlgEI with Ki = 237 ± 27 μM and Ki = 102 ± 7.52 μM, respectively. The results confirm that a Sco GlgE-V279S variant can be used as a model for Mtb GlgE. In conclusion, we designed a lead transition state inhibitor of GlgE, which will be instrumental in further elucidation of the enzymatic mechanism of Mtb GlgE. PMID:25137149

  13. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  14. Lichen secondary metabolite evernic acid as potential quorum sensing inhibitor against Pseudomonas aeruginosa.

    PubMed

    Gökalsın, Barış; Sesal, Nüzhet Cenk

    2016-09-01

    Cystic Fibrosis is a genetic disease and it affects the respiratory and digestive systems. Pseudomonas aeruginosa infections in Cystic Fibrosis are presented as the main cause for high mortality and morbidity rates. Pseudomonas aeruginosa populations can regulate their virulence gene expressions via the bacterial communication system: quorum sensing. Inhibition of quorum sensing by employing quorum sensing inhibitors can leave the bacteria vulnerable. Therefore, determining natural sources to obtain potential quorum sensing inhibitors is essential. Lichens have ethnobotanical value for their medicinal properties and it is possible that their secondary metabolites have quorum sensing inhibitor properties. This study aims to investigate an alternative treatment approach by utilizing lichen secondary metabolite evernic acid to reduce the expressions of Pseudomonas aeruginosa virulence factors by inhibiting quorum sensing. For this purpose, fluorescent monitor strains were utilized for quorum sensing inhibitor screens and quantitative reverse-transcriptase PCR analyses were conducted for comparison. Results indicate that evernic acid is capable of inhibiting Pseudomonas aeruginosa quorum sensing systems. PMID:27465850

  15. Iminothiazoline-Sulfonamide Hybrids as Jack Bean Urease Inhibitors; Synthesis, Kinetic Mechanism and Computational Molecular Modeling.

    PubMed

    Saeed, Aamer; Mahmood, Shams-Ul; Rafiq, Muhammad; Ashraf, Zaman; Jabeen, Farukh; Seo, Sung-Yum

    2016-03-01

    The present work reports the synthesis of several 2-iminothiazoline derivatives of sulfanilamide (3a-j) as inhibitors of jack bean ureases. The title compounds were synthesized by the heterocyclization of sulfanilamide thioureas with propragyl bromide in dry ethanol in the presence of 1,8-Diazabicyclo[5.4.0]undec-7-ene as a base. All of the compounds showed higher urease inhibitory activity than the standard thiourea. The compounds (3h) and (3i) exhibited excellent enzyme inhibitory activity with IC50 0.064 and 0.058 μm, respectively, while IC50 of thiourea is 20.9 μm. The kinetic mechanism analyzed by Dixon plot showed that compound (3h) is a mixed-type inhibitor while (3i) is a competitive one. Docking studies suggested that Asp633, Ala636, His492, Ala440, Lue523, Asp494 and Arg439 are the major interacting residues in the binding site of the protein and may have an instrumental role in the inhibition of enzyme's function. 2-iminothiazoline analogues (3a-j) showed good docking score (-10.6466 to -8.7215 Kcal/mol) and binding energy (London dG ranging from -14.4825 to -10.4087 Kcal/mol) which is far better than the standard thiourea (binding score in S field -4.5790 Kcal/mol London dG -4.7726 Kcal/mol). Our results inferred compound (3i) may serve as a structural model for the design of most potent urease inhibitors. PMID:26496515

  16. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1). PMID:27519121

  17. The role of iron in prostaglandin synthesis: ferrous iron mediated oxidation of arachidonic acid.

    PubMed

    Rao, G H; Gerrard, J M; Eaton, J W; White, J G

    1978-07-01

    Arachidonic acid (AA) is the essential substrate for production of platelet endoperoxides and thromboxanes. Iron or heme is an essential cofactor for the peroxidase, lipoxygenase and cyclo-oxygenase enzymes involved in formation of these products. The present study has examined the direct interactions between iron and arachidonic acid. Iron caused the oxidation of AA into more polar products which could be detected by UV absorbtion at 232 nM or the thiobarbituric acid (TBA) reaction. High pressure liquid chromatography, chem-ionization and electron-impact mass spectrometry and nuclear magnetic resonance spectroscopy suggest that the major product was a hydroperoxide of AA. Ferrous iron (Fe++) and oxygen were absolute requirements. Fe++ was converted to the ferric iron (Fe+++) state during oxidation of AA, but Fe+++ could not substitute for Fe++. No other enzymes, cofactors or ions were involved. Conversion of AA to a hydroperoxide by Fe++ was inhibited by the antioxidant, 2, (3)-Tert-butyl-4-hydroxyanisole, the radical scavenger, nitroblue tetrazolium, and iron chelating agents, including EDTA, imidazole and dihydroxybenzoic acid. The reaction was not affected by superoxide dismutase, catalase or aspirin. These findings and preliminary studies of the Fe++ induced oxidation product of AA as a substrate for prostaglandin synthesis and inhibitor of prostacyclin production indicate the critical role of Fe++ in AA activation.

  18. Green Synthesis and Urease Inhibitory Activity of Spiro-Pyrimidinethiones/Spiro-Pyrimidinones-Barbituric Acid Derivatives

    PubMed Central

    Mohammadi Ziarani, Ghodsi; Asadi, Shima; Faramarzi, Sakineh; Amanlou, Massoud

    2015-01-01

    Sulfonic acid functionalized SBA-15 (SBA-Pr-SO3H) with pore size 6 nm as an efficient heterogeneous nanoporous solid acid catalyst exhibited good catalytic activity in the Biginelli-like reaction in the synthesis of spiroheterobicyclic rings with good yield and good recyclability. Spiro-pyrimidinethiones/spiro-pyrimidinones-barbituric acid derivatives were synthesized in a simple and efficient method using the one-pot three-component reaction of a cyclic 1,3- dicarbonyl compounds (barbituric acid), an aromatic aldehyde and urea or thiourea in the presence of nanoporous silica SBA-Pr-SO3H under solvent free conditions. Urease inhibitory activity of spiro compounds were tested against Jack bean urease using Berthelot alkaline phenol–hypochlorite method. Five of 13 compounds were inhibitor and two of them were enzyme activators. Analysis of the docking results showed that, in most of the spiro molecules, one of the carbonyl groups is coordinated with both nickel atoms, while the other one is involved in the formation of hydrogen bonds with important active-site residues. The effect of inserting two methyl groups on N atoms of barbiturate ring, S substituted, ortho, meta and para substituted compounds were investigated too. PMID:26664377

  19. Design, Synthesis and Evaluation of Fe-S Targeted Adenosine 5′-Phosphosulfate Reductase Inhibitors

    PubMed Central

    Paritala, Hanumantharao; Suzuki, Yuta; Carroll, Kate S.

    2015-01-01

    Adenosine 5′-phosphosulfate reductase (APR) is an iron-sulfur enzyme that is vital for survival of Mycobacterium tuberculosis during dormancy and is an attractive target for the treatment of latent tuberculosis (TB) infection. The 4Fe-4S cluster is coordinated to APR by sulfur atoms of four cysteine residues, is proximal to substrate, adenosine 5′-phopsphosulfate (APS), and is essential for catalytic activity. Herein, we present an approach for the development of a new class of APR inhibitors. As an initial step, we have employed an improved solid-phase chemistry method to prepare a series of N6-substituted adenosine analogues and their 5′-phosphates as well as adenosine 5′-phosphate diesters bearing different Fe and S binding groups, such as thiols or carboxylic and hydroxamic acid moieties. Evaluation of the resulting compounds indicates a clearly defined spacing requirement between the Fe-S targeting group and adenosine scaffold and that smaller Fe-S targeting groups are better tolerated. Molecular docking analysis suggests that the S atom of the most potent inhibitor may establish a favorable interaction with an S atom in the cluster. In summary, this study showcases an improved solid-phase method that expedites the preparation of adenosine and related 5′-phosphate derivatives and presents a unique Fe-S targeting strategy for the development of APR inhibitors. PMID:25710356

  20. The NADPH oxidase inhibitor apocynin induces nitric oxide synthesis via oxidative stress

    SciTech Connect

    Riganti, Chiara

    2008-05-01

    We have recently shown that apocynin elicits an oxidative stress in N11 mouse glial cells and other cell types. Here we report that apocynin increased the accumulation of nitrite, the stable derivative of nitric oxide (NO), in the extracellular medium of N11 cell cultures, and the NO synthase (NOS) activity in cell lysates. The increased synthesis of NO was associated with increased expression of inducible NOS (iNOS) mRNA, increased nuclear translocation of the redox-sensitive transcription factor NF-{kappa}B and decreased intracellular level of its inhibitor IkB{alpha}. These effects, accompanied by increased production of H{sub 2}O{sub 2}, were very similar to those observed after incubation with bacterial lipopolysaccharide (LPS) and were inhibited by catalase. These results suggest that apocynin, similarly to LPS, induces increased NO synthesis by eliciting a generation of reactive oxygen species (ROS), which in turn causes NF-{kappa}B activation and increased expression of iNOS. Therefore, the increased bioavailability of NO reported in the literature after in vivo or in vitro treatments with apocynin might depend, at least partly, on the drug-elicited induction of iNOS, and not only on the inhibition of NADPH oxidase and the subsequent decreased scavenging of NO by oxidase-derived ROS, as it is often supposed.

  1. Isolation of 4,5-O-Dicaffeoylquinic Acid as a Pigmentation Inhibitor Occurring in Artemisia capillaris Thunberg and Its Validation In Vivo

    PubMed Central

    Tabassum, Nadia; Lee, Ji-Hyung; Yim, Soon-Ho; Batkhuu, Galzad Javzan

    2016-01-01

    There is a continual need to develop novel and effective melanogenesis inhibitors for the prevention of hyperpigmentation disorders. The plant Artemisia capillaris Thunberg (Oriental Wormwood) was screened for antipigmentation activity using murine cultured cells (B16-F10 malignant melanocytes). Activity-based fractionation using HPLC and NMR analyses identified the compound 4,5-O-dicaffeoylquinic acid as an active component in this plant. 4,5-O-Dicaffeoylquinic acid significantly reduced melanin synthesis and tyrosinase activity in a dose-dependent manner in the melanocytes. In addition, 4,5-O-dicaffeoylquinic acid treatment reduced the expression of tyrosinase-related protein-1. Significantly, we could validate the antipigmentation activity of this compound in vivo, using a zebrafish model. Moreover, 4,5-O-dicaffeoylquinic acid did not show toxicity in this animal model. Our discovery of 4,5-O-dicaffeoylquinic acid as an inhibitor of pigmentation that is active in vivo shows that this compound can be developed as an active component for formulations to treat pigmentation disorders. PMID:27528883

  2. Isolation of 4,5-O-Dicaffeoylquinic Acid as a Pigmentation Inhibitor Occurring in Artemisia capillaris Thunberg and Its Validation In Vivo.

    PubMed

    Tabassum, Nadia; Lee, Ji-Hyung; Yim, Soon-Ho; Batkhuu, Galzad Javzan; Jung, Da-Woon; Williams, Darren R

    2016-01-01

    There is a continual need to develop novel and effective melanogenesis inhibitors for the prevention of hyperpigmentation disorders. The plant Artemisia capillaris Thunberg (Oriental Wormwood) was screened for antipigmentation activity using murine cultured cells (B16-F10 malignant melanocytes). Activity-based fractionation using HPLC and NMR analyses identified the compound 4,5-O-dicaffeoylquinic acid as an active component in this plant. 4,5-O-Dicaffeoylquinic acid significantly reduced melanin synthesis and tyrosinase activity in a dose-dependent manner in the melanocytes. In addition, 4,5-O-dicaffeoylquinic acid treatment reduced the expression of tyrosinase-related protein-1. Significantly, we could validate the antipigmentation activity of this compound in vivo, using a zebrafish model. Moreover, 4,5-O-dicaffeoylquinic acid did not show toxicity in this animal model. Our discovery of 4,5-O-dicaffeoylquinic acid as an inhibitor of pigmentation that is active in vivo shows that this compound can be developed as an active component for formulations to treat pigmentation disorders. PMID:27528883

  3. Synthesis and biodistribution studies of technetium-99m-labeled aminopeptidase N inhibitor conjugates.

    PubMed

    Pathuri, Gopal; Hedrick, Andria F; Disch, Bryan C; Ihnat, Michael A; Awasthi, Vibhudutta; Gali, Hariprasad

    2012-07-15

    Probestin is a potent aminopeptidase N (APN) inhibitor. Four probestin conjugates containing a tripeptide chelator (N(3)S) and a PEG(2) linker were synthesized and radiolabeled with Tc-99m. The number of -COOH groups on the chelator was altered to increase the excretion of the radiotracer from blood stream via the renal-urinary pathway and to decrease its hepatobiliary uptake. Biodistribution of the radiolabeled conjugates was evaluated in healthy CF-1™ mice at 1h post-injection. The results revealed that the Tc-99m labeled probestin conjugate preferentially (>85% injected dose) excreted via the renal route when an aspartic acid residue was added to the linker (conjugate 4). These results suggest that the pharmacokinetic properties of probestin-based APN-targeted agents could be optimized by adding an appropriate amino acid residue in between the linker and the payload.

  4. Lipid phosphate phosphatases regulate lysophosphatidic acid production and signaling in platelets: studies using chemical inhibitors of lipid phosphate phosphatase activity.

    PubMed

    Smyth, Susan S; Sciorra, Vicki A; Sigal, Yury J; Pamuklar, Zehra; Wang, Zuncai; Xu, Yong; Prestwich, Glenn D; Morris, Andrew J

    2003-10-31

    Blood platelets play an essential role in ischemic heart disease and stroke contributing to acute thrombotic events by release of potent inflammatory agents within the vasculature. Lysophosphatidic acid (LPA) is a bioactive lipid mediator produced by platelets and found in the blood and atherosclerotic plaques. LPA receptors on platelets, leukocytes, endothelial cells, and smooth muscle cells regulate growth, differentiation, survival, motility, and contractile activity. Definition of the opposing pathways of synthesis and degradation that control extracellular LPA levels is critical to understanding how LPA bioactivity is regulated. We show that intact platelets and platelet membranes actively dephosphorylate LPA and identify the major enzyme responsible as lipid phosphate phosphatase 1 (LPP1). Localization of LPP1 to the platelet surface is increased by exposure to LPA. A novel receptor-inactive sn-3-substituted difluoromethylenephosphonate analog of phosphatidic acid that is a potent competitive inhibitor of LPP1 activity potentiates platelet aggregation and shape change responses to LPA and amplifies LPA production by agonist-stimulated platelets. Our results identify LPP1 as a pivotal regulator of LPA signaling in the cardiovascular system. These findings are consistent with genetic and cell biological evidence implicating LPPs as negative regulators of lysophospholipid signaling and suggest that the mechanisms involve both attenuation of lysophospholipid actions at cell surface receptors and opposition of lysophospholipid production. PMID:12909631

  5. Products of the Black Sea alga Phyllophora nervosa as corrosion inhibitor for steel in acids

    SciTech Connect

    Popelyukh, G.M.; Andrianov, A.M.; Burtnenko, L.M.; Gazha, P.A.; Talavira, L.I.

    1986-05-01

    The authors have investigated the inhibiting properties of the processing products of the Black Sea red seaweed Phyllophora nervosa on specimens of steel St3 in phosphoric and hydrochloric acids of various concentrations at temperatures in the range from 30 to 95 /sup 0/C. They have studied how the concentrations of urotropin, sodium chloride, and Fe/sup 3 +/ ions influence the protective properties of the seaweed inhibitor. They have made preliminary investigations of the mechanisms of the protective action.

  6. Modulation of the equilibrative nucleoside transporter by inhibitors of DNA synthesis.

    PubMed Central

    Pressacco, J.; Wiley, J. S.; Jamieson, G. P.; Erlichman, C.; Hedley, D. W.

    1995-01-01

    Expression of the equilibrative, S-(p-nitrobenzyl)-6-thioinosine (NBMPR)-sensitive nucleoside transporter (es), a component of the nucleoside salvage pathway, was measured during unperturbed growth and following exposure to various antimetabolites at growth-inhibitory concentrations. The probe 5-(SAENTA-x8)-fluorescein is a highly modified form of adenosine incorporating a fluorescein molecule. It binds. with high affinity and specificity to the (es) nucleoside transporter at a 1:1 stoichiometry, allowing reliable estimates of es expression by flow cytometry. Using a dual labelling technique which combined the vital DNA dye Hoechst-33342 and 5-(SAENTA-x8)-fluorescein, we found that surface expression of es approximately doubled between G1 and G2 + M phases of the cell cycle. To address the question of whether es expression could be modulated in cells exposed to drugs which inhibit de novo synthesis of nucleotides, cells were exposed to antimetabolite drugs having different modes of action. Hydroxyurea and 5-fluorouracil (5-FU), which inhibit the de novo synthesis of DNA precursors, produced increases in the expression of es. In contrast, cytosine arabinoside (ara-C) and aphidicolin, which directly inhibit DNA synthesis, produced no significant increase in es expression. Thymidine (TdR), which is an allosteric inhibitor of ribonucleotide reductase that depletes dATP, dCTP and dGTP pools while repleting the dTTP pool, had no significant effect on es expression. These data suggest that surface expression of the es nucleoside transporter is regulated by a mechanism which is sensitive to the supply of deoxynucleotides. Because 5-FU (which specifically depletes dTTP pools) causes a large increase in expression whereas TdR (which depletes all precursors except dTTP) does not, this mechanism might be particularly sensitive to dTTP pools. PMID:7547244

  7. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described.

  8. Cinnamic Acid Derivatives as Inhibitors of Oncogenic Protein Kinases--Structure, Mechanisms and Biomedical Effects.

    PubMed

    Mielecki, Marcin; Lesyng, Bogdan

    2016-01-01

    Cinnamic acid belongs to phenolic-acid class of polyphenols, one of the most abundant plant secondary metabolites. These substances are widely studied because of plethora of their biological activities. In particular, their inhibition of protein kinases contributes to the pleiotropic effects in the cell. Protein kinases are essential in controlling cell signaling networks. Selective targeting of oncogenic protein kinases increases clinical anticancer efficacy. Cinnamic acid and related compounds have inspired researchers in the design of numerous synthetic and semisynthetic inhibitors of oncogenic protein kinases for the past three decades. Interest in cinnamoyl-scaffold-containing compounds revived in recent years, which was stimulated by modern drug design and discovery methodologies such as in vitro and in silico HTS. This review presents cinnamic acid derivatives and analogs for which direct inhibition of protein kinases was identified. We also summarize significance of the above protein kinase families - validated or promising targets for anticancer therapies. The inhibition mode may vary from ATP-competitive, through bisubstrate-competitive and mixedcompetitive, to non-competitive one. Kinase selectivity is often correlated with subtle chemical modifications, and may also be steered by an additional non-cinnamoyl fragment of the inhibitor. Specific cinnamic acid congeners may synergize their effects in the cell by a wider range of activities, like suppression of additional enzymes, e.g. deubiquitinases, influencing the same signaling pathways (e.g. JAK2/STAT). Cinnamic acid, due to its biological and physicochemical properties, provides nature-inspired ideas leading to novel inhibitors of oncogenic protein kinases and related enzymes, capable to target a variety of cancer cells.

  9. Activation of PPARα by Fatty Acid Accumulation Enhances Fatty Acid Degradation and Sulfatide Synthesis.

    PubMed

    Yang, Yang; Feng, Yuyao; Zhang, Xiaowei; Nakajima, Takero; Tanaka, Naoki; Sugiyama, Eiko; Kamijo, Yuji; Aoyama, Toshifumi

    2016-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) catalyzes the first reaction in the mitochondrial fatty acid β-oxidation pathway. VLCAD deficiency is associated with the accumulation of fat in multiple organs and tissues, which results in specific clinical features including cardiomyopathy, cardiomegaly, muscle weakness, and hepatic dysfunction in infants. We speculated that the abnormal fatty acid metabolism in VLCAD-deficient individuals might cause cell necrosis by fatty acid toxicity. The accumulation of fatty acids may activate peroxisome proliferator-activated receptor (PPAR), a master regulator of fatty acid metabolism and a potent nuclear receptor for free fatty acids. We examined six skin fibroblast lines, derived from VLCAD-deficient patients and identified fatty acid accumulation and PPARα activation in these cell lines. We then found that the expression levels of three enzymes involved in fatty acid degradation, including long-chain acyl-CoA synthetase (LACS), were increased in a PPARα-dependent manner. This increased expression of LACS might enhance the fatty acyl-CoA supply to fatty acid degradation and sulfatide synthesis pathways. In fact, the first and last reactions in the sulfatide synthesis pathway are regulated by PPARα. Therefore, we also measured the expression levels of enzymes involved in sulfatide metabolism and the regulation of cellular sulfatide content. The levels of these enzymes and cellular sulfatide content both increased in a PPARα-dependent manner. These results indicate that PPARα activation plays defensive and compensative roles by reducing cellular toxicity associated with fatty acids and sulfuric acid. PMID:27644403

  10. [Correlation between the synthesis of extracellular proteases and the synthesis of the red pigment prodigiosin in Serratia marcescens].

    PubMed

    Loriia, Zh K; Briukner, B; Egorov, N S

    1977-01-01

    A correlation has been established between synthesis of exocellular protease and synthesis of a red pigment prodigiosine by Serratia marcescens. Chloramphenicol, an inhibitor of protein synthesis, inhibits also synthesis of the pigment. Leucine, an inductor of synthesis of the exocellular protease by Serratia marcescens VI, induces also synthesis of the pigment. A mixture of 18 natural amino acids, asparagine and ammonium ions represses both synthesis of the enzyme and the pigment.

  11. [Synthesis of new mandelic acid derivatives with preservative action. Synthesis and acute toxicity study].

    PubMed

    Stan, Cătălina; Năstase, V; Pavelescu, M; Vasile, Cornelia; Dumitrache, M; Gherase, Florenţa; Năstasă, Veronica

    2004-01-01

    Starting from the antiseptic action of DL mandelic acid, there were synthesized a series of esters of the mandelic acid, esters which could have preservative action. This study present the synthesis, structure validation and the acute toxicity study, for the new synthesized compounds. The esters were obtained by acylating 4-hydroxybenzoic acid propyl, ethyl, methyl esters and salicylic acid with the DL mandelic chloride (that was protected initially by the hydroxylic group). The structure of the synthesized compounds was confirmed by quantitative elemental analysis and RMN 1H spectral measurements. The acute toxicity was determined for two of the esters, who proved to had a preservative action (previously studied) and indicated that these esters have a small toxicity.

  12. A novel lead of P-selectin inhibitor: Discovery, synthesis, bioassays and action mechanism.

    PubMed

    Wu, Jianhui; Zhao, Ming; Wang, Yuji; Wang, Yaonan; Zhu, Haimei; Zhao, Shurui; Peng, Shiqi

    2016-10-01

    By docking 126 derivatives of β-carboline-3-carboxylic acid, tetrahydro-β-carboline-3-carboxylic acid and indoloquinolizine into the active pocket of P-selectin (2-(3-(hydroxymethyl)-9H-pyrido[3,4-b]indol-1-yl)ethyl)-l-phenylalanine (HMCEF) was assigned a novel inhibitor. ELISA and flow cytometry experiments showed that HMCEF effectively down-regulated P-selectin expression and supported the rationality of the computer assistant screening, while UV spectrum experiments demonstrated that HMCEF directly bound to P-selectin. In vivo HMCEF dose dependently inhibited the rats and mice to form thrombus and had a minimal effective dose of 20nmol/kg, dose dependently inhibited inflammatory response of mice and had a minimal effective dose of 20nmol/kg. The decrease of serum TNFα and IL-8 of the treated mice was proposed to be the action mechanism of HMCEF inhibiting thrombosis and inflammation. All data imply that HMCEF is a novel lead of P-selectin inhibitor.

  13. Effects of VMAT2 inhibitors lobeline and GZ-793A on methamphetamine-induced changes in dopamine release, metabolism and synthesis in vivo.

    PubMed

    Meyer, Andrew C; Neugebauer, Nichole M; Zheng, Guangrong; Crooks, Peter A; Dwoskin, Linda P; Bardo, Michael T

    2013-10-01

    Vesicular monoamine transporter-2 (VMAT2) inhibitors reduce methamphetamine (METH) reward in rats. The current study determined the effects of VMAT2 inhibitors lobeline (LOB; 1 or 3 mg/kg) and N-(1,2R-dihydroxylpropyl)-2,6-cis-di(4-methoxyphenethyl)piperidine hydrochloride (GZ-793A; 15 or 30 mg/kg) on METH-induced (0.5 mg/kg, SC) changes in extracellular dopamine (DA) and its metabolite dihydroxyphenylacetic acid (DOPAC) in the reward-relevant nucleus accumbens (NAc) shell using in vivo microdialysis. The effect of GZ-793A (15 mg/kg) on DA synthesis in tissue also was investigated in NAc, striatum, medial prefrontal cortex and orbitofrontal cortex. In NAc shell, METH produced a time-dependent increase in extracellular DA and decrease in DOPAC. Neither LOB nor GZ-793A alone altered extracellular DA; however, both drugs increased extracellular DOPAC. In combination with METH, LOB did not alter the effects of METH on DA; however, GZ-793A, which has greater selectivity than LOB for inhibiting VMAT2, reduced the duration of the METH-induced increase in extracellular DA. Both LOB and GZ-793A enhanced the duration of the METH-induced decrease in extracellular DOPAC. METH also increased tissue DA synthesis in NAc and striatum, whereas GZ-793A decreased synthesis; no effect of METH or GZ-793A on DA synthesis was found in medial prefrontal cortex or orbitofrontal cortex. These results suggest that selective inhibition of VMAT2 produces a time-dependent decrease in DA release in NAc shell as a result of alterations in tyrosine hydroxylase activity, which may play a role in the ability of GZ-793A to decrease METH reward. PMID:23875705

  14. Effects of VMAT2 inhibitors lobeline and GZ-793A on methamphetamine-induced changes in dopamine release, metabolism and synthesis in vivo.

    PubMed

    Meyer, Andrew C; Neugebauer, Nichole M; Zheng, Guangrong; Crooks, Peter A; Dwoskin, Linda P; Bardo, Michael T

    2013-10-01

    Vesicular monoamine transporter-2 (VMAT2) inhibitors reduce methamphetamine (METH) reward in rats. The current study determined the effects of VMAT2 inhibitors lobeline (LOB; 1 or 3 mg/kg) and N-(1,2R-dihydroxylpropyl)-2,6-cis-di(4-methoxyphenethyl)piperidine hydrochloride (GZ-793A; 15 or 30 mg/kg) on METH-induced (0.5 mg/kg, SC) changes in extracellular dopamine (DA) and its metabolite dihydroxyphenylacetic acid (DOPAC) in the reward-relevant nucleus accumbens (NAc) shell using in vivo microdialysis. The effect of GZ-793A (15 mg/kg) on DA synthesis in tissue also was investigated in NAc, striatum, medial prefrontal cortex and orbitofrontal cortex. In NAc shell, METH produced a time-dependent increase in extracellular DA and decrease in DOPAC. Neither LOB nor GZ-793A alone altered extracellular DA; however, both drugs increased extracellular DOPAC. In combination with METH, LOB did not alter the effects of METH on DA; however, GZ-793A, which has greater selectivity than LOB for inhibiting VMAT2, reduced the duration of the METH-induced increase in extracellular DA. Both LOB and GZ-793A enhanced the duration of the METH-induced decrease in extracellular DOPAC. METH also increased tissue DA synthesis in NAc and striatum, whereas GZ-793A decreased synthesis; no effect of METH or GZ-793A on DA synthesis was found in medial prefrontal cortex or orbitofrontal cortex. These results suggest that selective inhibition of VMAT2 produces a time-dependent decrease in DA release in NAc shell as a result of alterations in tyrosine hydroxylase activity, which may play a role in the ability of GZ-793A to decrease METH reward.

  15. Limiting amino acid for protein synthesis with mammary cells in tissue culture.

    PubMed

    Park, C S; Chandler, P T; Norman, A W

    1976-05-01

    To identify the limiting amino acid in the minimal essential medium as published by Eagle (Science 130:432, 1959) for milk protein synthesis in rat mammary cells in tissue culture, two different experimental approaches were used. The first study involved the reduction of amino acids singly from the total amino acid complement of the medium for milk protein synthesis. The second study was to investigate the effect on milk protein synthesis of single amino acid addition to the basic complement of amino acids. Order of limiting amino acids was lysine (first) and possible methionine, valine, or arginine (second).

  16. Benzoic acid derivatives with improved antifungal activity: Design, synthesis, structure-activity relationship (SAR) and CYP53 docking studies.

    PubMed

    Berne, Sabina; Kovačič, Lidija; Sova, Matej; Kraševec, Nada; Gobec, Stanislav; Križaj, Igor; Komel, Radovan

    2015-08-01

    Previously, we identified CYP53 as a fungal-specific target of natural phenolic antifungal compounds and discovered several inhibitors with antifungal properties. In this study, we performed similarity-based virtual screening and synthesis to obtain benzoic acid-derived compounds and assessed their antifungal activity against Cochliobolus lunatus, Aspergillus niger and Pleurotus ostreatus. In addition, we generated structural models of CYP53 enzyme and used them in docking trials with 40 selected compounds. Finally, we explored CYP53-ligand interactions and identified structural elements conferring increased antifungal activity to facilitate the development of potential new antifungal agents that specifically target CYP53 enzymes of animal and plant pathogenic fungi. PMID:26154240

  17. H8-BINOL chiral imidodiphosphoric acids catalyzed enantioselective synthesis of dihydroindolo-/-pyrrolo[1,2-a]quinoxalines.

    PubMed

    Fan, Yan-Sen; Jiang, Yi-Jun; An, Dong; Sha, Di; Antilla, Jon C; Zhang, Suoqin

    2014-12-01

    The first enantioselective synthesis of 5,6-dihydroindolo[1,2-a]quinoxalines is achieved by using a newly developed H8-BINOL-type imidodiphosphoric acid catalyst with low catalyst loading through efficient Pictet-Spengler-type reactions of indolyl anilines with ketones. This methodology also generates phenyl-4,5-dihydropyrrolo[1,2-a]quinoxalines with high yields and excellent enantioselectivities. Moreover, this method was utilized to synthesize an HIV-1 inhibitor with high yield and good enantioselectivity through a one-step procedure. PMID:25415871

  18. Arabidopsis Bax inhibitor-1 promotes sphingolipid synthesis during cold stress by interacting with ceramide-modifying enzymes.

    PubMed

    Nagano, Minoru; Ishikawa, Toshiki; Ogawa, Yoshie; Iwabuchi, Mitsuru; Nakasone, Akari; Shimamoto, Ko; Uchimiya, Hirofumi; Kawai-Yamada, Maki

    2014-07-01

    Bax inhibitor-1 (BI-1) is a widely conserved cell death suppressor localized in the endoplasmic reticulum membrane. Our previous results revealed that Arabidopsis BI-1 (AtBI-1) interacts with not only Arabidopsis cytochrome b 5 (Cb5), an electron transfer protein, but also a Cb5-like domain (Cb5LD)-containing protein, Saccharomyces cerevisiae fatty acid 2-hydroxylase 1, which 2-hydroxylates sphingolipid fatty acids. We have now found that AtBI-1 binds Arabidopsis sphingolipid Δ8 long-chain base (LCB) desaturases AtSLD1 and AtSLD2, which are Cb5LD-containing proteins. The expression of both AtBI-1 and AtSLD1 was increased by cold exposure. However, different phenotypes were observed in response to cold treatment between an atbi-1 mutant and a sld1sld2 double mutant. To elucidate the reasons behind the difference, we analyzed sphingolipids and found that unsaturated LCBs in atbi-1 were not altered compared to wild type, whereas almost all LCBs in sld1sld2 were saturated, suggesting that AtBI-1 may not be necessary for the desaturation of LCBs. On the other hand, the sphingolipid content in wild type increased in response to low temperature, whereas total sphingolipid levels in atbi-1 were unaltered. In addition, the ceramide-modifying enzymes AtFAH1, sphingolipid base hydroxylase 2 (AtSBH2), acyl lipid desaturase 2 (AtADS2) and AtSLD1 were highly expressed under cold stress, and all are likely to be related to AtBI-1 function. These findings suggest that AtBI-1 contributes to synthesis of sphingolipids during cold stress by interacting with AtSLD1, AtFAH1, AtSBH2 and AtADS2.

  19. Discovery of Novel Oral Protein Synthesis Inhibitors of Mycobacterium tuberculosis That Target Leucyl-tRNA Synthetase

    PubMed Central

    Palencia, Andrés; Li, Xianfeng; Bu, Wei; Choi, Wai; Ding, Charles Z.; Easom, Eric E.; Feng, Lisa; Hernandez, Vincent; Houston, Paul; Liu, Liang; Meewan, Maliwan; Mohan, Manisha; Rock, Fernando L.; Sexton, Holly; Zhang, Suoming; Zhou, Yasheen; Wan, Baojie; Wang, Yuehong; Franzblau, Scott G.; Woolhiser, Lisa; Gruppo, Veronica; Lenaerts, Anne J.; O'Malley, Theresa; Parish, Tanya; Cooper, Christopher B.; Waters, M. Gerard; Ma, Zhenkun; Ioerger, Thomas R.; Sacchettini, James C.; Rullas, Joaquín; Angulo-Barturen, Iñigo; Pérez-Herrán, Esther; Mendoza, Alfonso; Barros, David; Cusack, Stephen; Plattner, Jacob J.

    2016-01-01

    The recent development and spread of extensively drug-resistant and totally drug-resistant resistant (TDR) strains of Mycobacterium tuberculosis highlight the need for new antitubercular drugs. Protein synthesis inhibitors have played an important role in the treatment of tuberculosis (TB) starting with the inclusion of streptomycin in the first combination therapies. Although parenteral aminoglycosides are a key component of therapy for multidrug-resistant TB, the oxazolidinone linezolid is the only orally available protein synthesis inhibitor that is effective against TB. Here, we show that small-molecule inhibitors of aminoacyl-tRNA synthetases (AARSs), which are known to be excellent antibacterial protein synthesis targets, are orally bioavailable and effective against M. tuberculosis in TB mouse infection models. We applied the oxaborole tRNA-trapping (OBORT) mechanism, which was first developed to target fungal cytoplasmic leucyl-tRNA synthetase (LeuRS), to M. tuberculosis LeuRS. X-ray crystallography was used to guide the design of LeuRS inhibitors that have good biochemical potency and excellent whole-cell activity against M. tuberculosis. Importantly, their good oral bioavailability translates into in vivo efficacy in both the acute and chronic mouse models of TB with potency comparable to that of the frontline drug isoniazid. PMID:27503647

  20. Discovery of Novel Oral Protein Synthesis Inhibitors of Mycobacterium tuberculosis That Target Leucyl-tRNA Synthetase.

    PubMed

    Palencia, Andrés; Li, Xianfeng; Bu, Wei; Choi, Wai; Ding, Charles Z; Easom, Eric E; Feng, Lisa; Hernandez, Vincent; Houston, Paul; Liu, Liang; Meewan, Maliwan; Mohan, Manisha; Rock, Fernando L; Sexton, Holly; Zhang, Suoming; Zhou, Yasheen; Wan, Baojie; Wang, Yuehong; Franzblau, Scott G; Woolhiser, Lisa; Gruppo, Veronica; Lenaerts, Anne J; O'Malley, Theresa; Parish, Tanya; Cooper, Christopher B; Waters, M Gerard; Ma, Zhenkun; Ioerger, Thomas R; Sacchettini, James C; Rullas, Joaquín; Angulo-Barturen, Iñigo; Pérez-Herrán, Esther; Mendoza, Alfonso; Barros, David; Cusack, Stephen; Plattner, Jacob J; Alley, M R K

    2016-10-01

    The recent development and spread of extensively drug-resistant and totally drug-resistant resistant (TDR) strains of Mycobacterium tuberculosis highlight the need for new antitubercular drugs. Protein synthesis inhibitors have played an important role in the treatment of tuberculosis (TB) starting with the inclusion of streptomycin in the first combination therapies. Although parenteral aminoglycosides are a key component of therapy for multidrug-resistant TB, the oxazolidinone linezolid is the only orally available protein synthesis inhibitor that is effective against TB. Here, we show that small-molecule inhibitors of aminoacyl-tRNA synthetases (AARSs), which are known to be excellent antibacterial protein synthesis targets, are orally bioavailable and effective against M. tuberculosis in TB mouse infection models. We applied the oxaborole tRNA-trapping (OBORT) mechanism, which was first developed to target fungal cytoplasmic leucyl-tRNA synthetase (LeuRS), to M. tuberculosis LeuRS. X-ray crystallography was used to guide the design of LeuRS inhibitors that have good biochemical potency and excellent whole-cell activity against M. tuberculosis Importantly, their good oral bioavailability translates into in vivo efficacy in both the acute and chronic mouse models of TB with potency comparable to that of the frontline drug isoniazid. PMID:27503647

  1. Dihydroasparagusic acid: antioxidant and tyrosinase inhibitory activities and improved synthesis.

    PubMed

    Venditti, Alessandro; Mandrone, Manuela; Serrilli, Anna Maria; Bianco, Armandodoriano; Iannello, Carmelina; Poli, Ferruccio; Antognoni, Fabiana

    2013-07-17

    Dihydroasparagusic acid (DHAA) is the reduced form of asparagusic acid, a sulfur-containing flavor component produced by Asparagus plants. In this work, DHAA was synthetically produced by modifying some published protocols, and the synthesized molecule was tested in several in vitro assays (DPPH, ABTS, FRAP-ferrozine, BCB, deoxyribose assays) to evaluate its radical scavenging activity. Results show that DHAA is endowed with a significant in vitro antioxidant activity, comparable to that of Trolox. DHAA was also evaluated for its inhibitory activity toward tyrosinase, an enzyme involved, among others, in melanogenesis and in browning processes of plant-derived foods. DHAA was shown to exert an inhibitory effect on tyrosinase activity, and the inhibitor kinetics, analyzed by a Lineweaver-Burk plot, exhibited a competitive mechanism. Taken together, these results suggest that DHAA may be considered as a potentially active molecule for use in various fields of application, such as pharmaceutical, cosmetics, agronomic and food. PMID:23790134

  2. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  3. [Cyclooxygenase inhibitors in some dietary vegetables inhibit platelet aggregation function induced by arachidonic acid].

    PubMed

    Wang, Xin-Hua; Shao, Dong-Hua; Liang, Guo-Wei; Zhang, Ru; Xin, Qin; Zhang, Tao; Cao, Qing-Yun

    2011-10-01

    The study was purposed to investigate whether the cyclooxygenase inhibitors from some dietary vegetables can inhibit platelet aggregation function by the arachidonic acid (AA). The vegetable juice was mixed with platelet rich plasma (PRP), and asprin was used as positive control. The maximum ratio of platelet aggregation induced by AA was measured on the aggregometer; heme and cyclooxygenase-1 (COX(1)) or cyclooxygenase-2 (COX(2)) were added to test tubes containing COX reaction buffer, the mixture was vortex-mixed and exposed to aspirin or vegetable juice, followed by addition of AA and then hydrochloric acid (1 mol/L) was added to stop the COX reaction, followed by chemical reduction with stannous chloride solution. The concentration of COX inhibitors was detected by the enzyme immunoassay kit; vegetable juice (aspirin as positive control) was mixed with whole blood, which was followed by the addition of AA, and then the reaction was stopped by adding indomethacin, centrifuged, then the supernatant was collected, and the plasma thromboxane B(2) (TXB(2)) was measured by radioimmunoassay. The results showed that spinach juice, garlic bolt juice, blanched garlic leave juice and Chinese leek juice could inhibit by 80% human platelet aggregation induced by AA. 4 kinds of vegetables were all found a certain amount of cyclooxygenase inhibitors, which COX(1) and COX(2) inhibitor concentrations of spinach were higher than that of aspirin; 4 vegetable juice could significantly reduce the human plasma concentrations of TXB(2) induced by AA (p < 0.05). It is concluded that 4 kinds of raw vegetables containing cyclooxygenase inhibitors inhibit the production of TXA(2) and thus hinder platelet aggregation. Raw spinach, garlic bolt, blanched garlic and chinese leek inhibit significantly AA-induced human platelet aggregation in vitro. 4 kinds of vegetables may have a good potential perspective of anti-platelet aggregation therapy or prevention of thrombosis.

  4. The antiviral drug acyclovir is a slow-binding inhibitor of (D)-amino acid oxidase.

    PubMed

    Katane, Masumi; Matsuda, Satsuki; Saitoh, Yasuaki; Sekine, Masae; Furuchi, Takemitsu; Koyama, Nobuhiro; Nakagome, Izumi; Tomoda, Hiroshi; Hirono, Shuichi; Homma, Hiroshi

    2013-08-20

    d-Amino acid oxidase (DAO) is a degradative enzyme that is stereospecific for d-amino acids, including d-serine and d-alanine, which are believed to be coagonists of the N-methyl-d-aspartate (NMDA) receptor. To identify a new class of DAO inhibitor(s) that can be used to elucidate the molecular details of the active site environment of DAO, manifold biologically active compounds of microbial origin and pre-existing drugs were screened for their ability to inhibit DAO activity, and several compounds were identified as candidates. One of these compounds, acyclovir (ACV), a well-known antiviral drug used for the treatment of herpesvirus infections, was characterized and evaluated as a novel DAO inhibitor in vitro. Analysis showed that ACV acts on DAO as a reversible slow-binding inhibitor, and interestingly, the time required to achieve equilibrium between DAO, ACV, and the DAO/ACV complex was highly dependent on temperature. The binding mechanism of ACV to DAO was investigated in detail by several approaches, including kinetic analysis, structural modeling of DAO complexed with ACV, and site-specific mutagenesis of an active site residue postulated to be involved in the binding of ACV. The results confirm that ACV is a novel, active site-directed inhibitor of DAO that can be a valuable tool for investigating the structure-function relationships of DAO, including the molecular details of the active site environment of DAO. In particular, it appears that ACV can serve as an active site probe to study the structural basis of temperature-induced conformational changes of DAO.

  5. Angiotensin converting enzyme inhibitors mitigate collagen synthesis induced by a single dose of radiation to the whole thorax.

    PubMed

    Kma, Lakhan; Gao, Feng; Fish, Brian L; Moulder, John E; Jacobs, Elizabeth R; Medhora, Meetha

    2012-01-01

    Our long-term goal is to use angiotensin converting enzyme (ACE) inhibitors to mitigate the increase in lung collagen synthesis that is induced by irradiation to the lung, which could result from accidental exposure or radiological terrorism. Rats (WAG/RijCmcr) were given a single dose of 13 Gy (dose rate of 1.43 Gy/min) of X-irradiation to the thorax. Three structurally-different ACE inhibitors, captopril, enalapril and fosinopril were provided in drinking water beginning 1 week after irradiation. Rats that survived acute pneumonitis (at 6-12 weeks) were evaluated monthly for synthesis of lung collagen. Other endpoints included breathing rate, wet to dry lung weight ratio, and analysis of lung structure. Treatment with captopril (145-207 mg/m(2)/day) or enalapril (19-28 mg/m(2)/day), but not fosinopril (19-28 mg/m(2)/day), decreased morbidity from acute pneumonitis. Lung collagen in the surviving irradiated rats was increased over that of controls by 7 months after irradiation. This increase in collagen synthesis was not observed in rats treated with any of the three ACE inhibitors. Analysis of the lung morphology at 7 months supports the efficacy of ACE inhibitors against radiation-induced fibrosis. The effectiveness of fosinopril against fibrosis, but not against acute pneumonitis, suggests that pulmonary fibrosis may not be a simple consequence of injury during acute pneumonitis. In summary, three structurally-different ACE inhibitors mitigate the increase in collagen synthesis 7 months following irradiation of the whole thorax and do so, even when therapy is started one week after irradiation. PMID:22302041

  6. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  7. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  8. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  9. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  10. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  11. Effects of protein synthesis inhibitors during reactivation of associative memory in the common snail induces reversible and irreversible amnesia.

    PubMed

    Solntseva, S V; Nikitin, V P; Kozyrev, S A; Shevelkin, A V; Lagutin, A V; Sherstnev, V V

    2007-11-01

    The effects of protein synthesis inhibitors on the reactivation of an associative skill consisting of refusing a particular food by common snails were studied. Animals were given single injections of a protein synthesis inhibitor (cycloheximide at 0.6 mg/snail or anisomycin at 0.4 mg) 24 h after three days of training, and were then presented with a "reminding" stimulus (the "conditioned reflex" food-banana) and tested for retention of the skill. Observations revealed an impairment of reproduction of the acquired skill 2.5 h after the "reminder," with spontaneous restoration at 4.5-5.5 h. Other snails were given single 1.8-mg doses of cycloheximide or three 0.6-mg doses with intervals of 2 h. "Reminders" were presented after each injection. In these conditions, impairment of reproduction of the conditioned reflex also appeared 2.5 h after the first "reminder," though amnesia lasted at least 30 days and repeat training of the animals produced only partial recovery of the skill. Thus, we have provided the first demonstration that recovery of a long-term memory "trace" on exposure to relatively low doses of protein synthesis inhibitors produces transient and short-lived amnesia, lasting 2-3 h, while long-term, irreversible amnesia occurs after longer-lasting or more profound suppression of protein synthesis. These results suggest that the "reminding" process induces reconsolidation of the " initial" memory, suppression of which by protein synthesis inhibitors leads to "erasure" of the memory "trace" and impairs consolidation on repeat training. PMID:17955385

  12. The effects of anisomycin (a protein synthesis inhibitor) on spatial learning and memory in CA1 region of rats hippocampus.

    PubMed

    Naghdi, Nasser; Majlessi, Nahid; Bozorgmehr, Tahereh

    2003-02-17

    Inhibition of protein synthesis has been shown to affect long-term memory in a wide variety of animal species. But little is known regarding the neuroanatomical location of protein synthesis in different memory tasks. In this study, the effect of intrahippocampal injection of anisomycin, an inhibitor of brain protein synthesis on spatial memory was examined in Morris Water Maze. At first, rats were connulated bilaterally into the CA1 region and then different doses of anisomycin (1.25-2.5 micro g/0.5 micro l) on its vehicle (saline) were injected bilaterally into the CA1 region of rats hippocampus 20 min before training each day. The results showed dose-dependent increases in latencies to find the invisible platform and traveled distances in anisomycin received group compared to the control group. Therefore, it appears that protein synthesis inhibition in the CA1 region of hippocampus impair spatial learning in Morris Water Maze.

  13. Design, synthesis, functional and structural characterization of an inhibitor of N-acetylneuraminate-9-phosphate phosphatase: observation of extensive dynamics in an enzyme/inhibitor complex.

    PubMed

    Kim, Soong-Hoon; Constantine, Keith L; Duke, Gerald J; Goldfarb, Valentina; Hunt, John T; Johnson, Stephen; Kish, Kevin; Klei, Herbert E; McDonnell, Patricia A; Metzler, William J; Mueller, Luciano; Poss, Michael A; Fairchild, Craig R; Bhide, Rajeev S

    2013-07-15

    The design, synthesis and characterization of a phosphonate inhibitor of N-acetylneuraminate-9-phosphate phosphatase (HDHD4) is described. Compound 3, where the substrate C-9 oxygen was replaced with a nonlabile CH2 group, inhibits HDHD4 with a binding affinity (IC50 11μM) in the range of the native substrate Neu5Ac-9-P (compound 1, Km 47μM). Combined SAR, modeling and NMR studies are consistent with the phosphonate group in inhibitor 3 forming a stable complex with native Mg(2+). In addition to this key interaction, the C-1 carboxylate of the sugar interacts with a cluster of basic residues, K141, R104 and R72. Comparative NMR studies of compounds 3 and 1 with Ca(2+) and Mg(2+) are indicative of a highly dynamic process in the active site for the HDHD4/Mg(2+)/3 complex. Possible explanations for this observation are discussed.

  14. L-Cysteine/D,L-homocysteine-regulated ileum motility via system L and B°(,+) transporter: Modification by inhibitors of hydrogen sulfide synthesis and dietary treatments.

    PubMed

    Yamane, Satoshi; Nomura, Ryouya; Yanagihara, Madoka; Nakamura, Hiroyuki; Fujino, Hiromichi; Matsumoto, Kenjiro; Horie, Syunji; Murayama, Toshihiko

    2015-10-01

    Previous studies including ours demonstrated that L-cysteine treatments decreased motility in gastrointestinal tissues including the ileum via hydrogen sulfide (H2S), which is formed from sulfur-containing amino acids such as L-cysteine and L-homocysteine. However, the amino acid transport systems involved in L-cysteine/L-homocysteine-induced responses have not yet been elucidated in detail; therefore, we investigated these systems pharmacologically by measuring electrical stimulation (ES)-induced contractions with amino acids in mouse ileum preparations. The treatments with L-cysteine and D,L-homocysteine inhibited ES-induced contractions in ileum preparations from fasted mice, and these responses were decreased by the treatment with 2-aminobicyclo[2.2.1]heptane-2-carboxylate (BCH), an inhibitor of systems L and B°(,+). The results obtained using ileum preparations and a model cell line (PC12 cells) with various amino acids and BCH showed that not only L-cysteine, but also aminooxyacetic acid and D,L-propargylglycine, which act as H2S synthesis inhibitors, appeared to be taken up by these preparations/cells in L and B°(,+) system-dependent manners. The L-cysteine and D,L-homocysteine responses were delayed and abolished, respectively, in ileum preparations from fed mice. Our results suggested that the regulation of ileum motility by L-cysteine and D,L-homocysteine was dependent on BCH-sensitive systems, and varied depending on feeding in mice. Therefore, the effects of aminooxyacetic acid and D,L-propargylglycine on transport systems need to be considered in pharmacological analyses.

  15. Zoledronic acid cooperates with a cyclooxygenase-2 inhibitor and gefitinib in inhibiting breast and prostate cancer.

    PubMed

    Melisi, Davide; Caputo, Rosa; Damiano, Vincenzo; Bianco, Roberto; Veneziani, Bianca Maria; Bianco, A Raffaele; De Placido, Sabino; Ciardiello, Fortunato; Tortora, Giampaolo

    2005-12-01

    Biphosphonates (BPs) are widely used to inhibit osteoclastic activity in malignant diseases such as bone metastatic breast and prostate carcinoma. Recent studies reported that BPs could also cause a direct antitumor effect, probably due to their ability to interfere with several intracellular signalling molecules. The enzyme cyclooxygenase-2 (COX-2) and the epidermal growth factor receptor (EGFR) play an important role in the control of cancer cell growth and inhibitors of COX-2 and EGFR have shown antitumor activity in vitro and in vivo in several tumor types. We, and others, have previously shown that EGFR and COX-2 may be directly related to each other and that their selective inhibitors may have a cooperative effect. In the present study we have evaluated the combined effect of zoledronic acid, the most potent nitrogen-containing BP, with the COX-2 inhibitor SC-236 and the selective EGFR-tyrosine kinase inhibitor gefitinib, on breast and prostate cancer models in vitro and in xenografted nude mice. We show that combination of zoledronic acid with SC-236 and gefitinib causes a cooperative antitumor effect accompanied by induction of apoptosis and regulation of the expression of mitogenic factors, proangiogenic factors and cell cycle controllers both in vitro and in xenografted nude mice. The modulatory effect on protein expression and the inhibitory effect on tumor growth is much more potent when the three agents are used together. Since studies are ongoing to explore the antitumor effect of zoledronic acid, our results provide new insights into the mechanism of action of these agents and a novel rationale to translate this feasible combination treatment strategy into a clinical setting.

  16. Discovery of novel, non-acidic mPGES-1 inhibitors by virtual screening with a multistep protocol

    PubMed Central

    Noha, Stefan M.; Fischer, Katrin; Koeberle, Andreas; Garscha, Ulrike; Werz, Oliver; Schuster, Daniela

    2015-01-01

    Microsomal prostaglandin E2 synthase-1 (mPGES-1) inhibitors are considered as potential therapeutic agents for the treatment of inflammatory pain and certain types of cancer. So far, several series of acidic as well as non-acidic inhibitors of mPGES-1 have been discovered. Acidic inhibitors, however, may have issues, such as loss of potency in human whole blood and in vivo, stressing the importance of the design and identification of novel, non-acidic chemical scaffolds of mPGES-1 inhibitors. Using a multistep virtual screening protocol, the Vitas-M compound library (∼1.3 million entries) was filtered and 16 predicted compounds were experimentally evaluated in a biological assay in vitro. This approach yielded two molecules active in the low micromolar range (IC50 values: 4.5 and 3.8 μM, respectively). PMID:26088337

  17. Suppression of asymmetric acid efflux and gravitropism in maize roots treated with auxin transport inhibitors of sodium orthovanadate

    NASA Technical Reports Server (NTRS)

    Mulkey, T. J.; Evans, M. L.

    1982-01-01

    In gravitropically stimulated roots of maize (Zea mays L., hybrid WF9 x 38MS), there is more acid efflux on the rapidly growing upper side than on the slowly growing lower side. In light of the Cholodny/Went hypothesis of gravitropism which states that gravitropic curvature results from lateral redistribution of auxin, the effects of auxin transport inhibitors on the development of acid efflux asymmetry and curvature in gravistimulated roots were examined. All the transport inhibitors tested prevented both gravitropism and the development of asymmetric acid efflux in gravistimulated roots. The results indicate that auxin redistribution may cause the asymmetry of acid efflux, a finding consistent with the Cholodny/Went hypothesis of gravitropism. As further evidence that auxin-induced acid efflux asymmetry may mediate gravitropic curvature, sodium orthovanadate, an inhibitor of auxin-induced H+ efflux was found to prevent both gravitropism and the development of asymmetric acid efflux in gravistimulated roots.

  18. Synthesis, in Vitro Covalent Binding Evaluation, and Metabolism of 14C-Labeled Inhibitors of 11β-HSD1

    PubMed Central

    2014-01-01

    In this letter, we reported the design and synthesis of three potent, selective, and orally bioavailable 11β-HSD1 inhibitors labeled with 14C: AMG 456 (1), AM-6949 (2), and AM-7715 (3). We evaluated the covalent protein binding of the labeled inhibitors in human liver microsomes in vitro and assessed their potential bioactivation risk in humans. We then studied the in vitro mechanism of 2 in human hepatocytes and the formation of reactive intermediates. Our study results suggest that 1 and 3 have low potential for metabolic bioactivation in humans, while 2 has relatively high risk. PMID:25408839

  19. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  20. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  1. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  2. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  3. Anaerobic microbial community response to methanogenic inhibitors 2-bromoethanesulfonate and propynoic acid.

    PubMed

    Webster, Tara M; Smith, Adam L; Reddy, Raghav R; Pinto, Ameet J; Hayes, Kim F; Raskin, Lutgarde

    2016-08-01

    Methanogenic inhibitors are often used to study methanogenesis in complex microbial communities or inhibit methanogens in the gastrointestinal tract of livestock. However, the resulting structural and functional changes in archaeal and bacterial communities are poorly understood. We characterized microbial community structure and activity in mesocosms seeded with cow dung and municipal wastewater treatment plant anaerobic digester sludge after exposure to two methanogenic inhibitors, 2-bromoethanesulfonate (BES) and propynoic acid (PA). Methane production was reduced by 89% (0.5 mmol/L BES), 100% (10 mmol/LBES), 24% (0.1 mmol/LPA), and 95% (10 mmol/LPA). Using modified primers targeting the methyl-coenzyme M reductase (mcrA) gene, changes in mcrA gene expression were found to correspond with changes in methane production and the relative activity of methanogens. Methanogenic activity was determined by the relative abundance of methanogen 16S rRNA cDNA as a percentage of the total community 16S rRNA cDNA. Overall, methanogenic activity was lower when mesocosms were exposed to higher concentrations of both inhibitors, and aceticlastic methanogens were inhibited to a greater extent than hydrogenotrophic methanogens. Syntrophic bacterial activity, measured by 16S rRNA cDNA, was also reduced following exposure to both inhibitors, but the overall structure of the active bacterial community was not significantly affected. PMID:26987552

  4. Chemical Genetics Uncovers Novel Inhibitors of Lignification, Including p-Iodobenzoic Acid Targeting CINNAMATE-4-HYDROXYLASE.

    PubMed

    Van de Wouwer, Dorien; Vanholme, Ruben; Decou, Raphaël; Goeminne, Geert; Audenaert, Dominique; Nguyen, Long; Höfer, René; Pesquet, Edouard; Vanholme, Bartel; Boerjan, Wout

    2016-09-01

    Plant secondary-thickened cell walls are characterized by the presence of lignin, a recalcitrant and hydrophobic polymer that provides mechanical strength and ensures long-distance water transport. Exactly the recalcitrance and hydrophobicity of lignin put a burden on the industrial processing efficiency of lignocellulosic biomass. Both forward and reverse genetic strategies have been used intensively to unravel the molecular mechanism of lignin deposition. As an alternative strategy, we introduce here a forward chemical genetic approach to find candidate inhibitors of lignification. A high-throughput assay to assess lignification in Arabidopsis (Arabidopsis thaliana) seedlings was developed and used to screen a 10-k library of structurally diverse, synthetic molecules. Of the 73 compounds that reduced lignin deposition, 39 that had a major impact were retained and classified into five clusters based on the shift they induced in the phenolic profile of Arabidopsis seedlings. One representative compound of each cluster was selected for further lignin-specific assays, leading to the identification of an aromatic compound that is processed in the plant into two fragments, both having inhibitory activity against lignification. One fragment, p-iodobenzoic acid, was further characterized as a new inhibitor of CINNAMATE 4-HYDROXYLASE, a key enzyme of the phenylpropanoid pathway synthesizing the building blocks of the lignin polymer. As such, we provide proof of concept of this chemical biology approach to screen for inhibitors of lignification and present a broad array of putative inhibitors of lignin deposition for further characterization. PMID:27485881

  5. Synthesis and Structure-activity Relationship of piperidine-derived non-urea soluble epoxide hydrolase inhibitors

    PubMed Central

    Pecic, Stevan; Pakhomova, Svetlana; Newcomer, Marcia E.; Morisseau, Christophe; Hammock, Bruce D.; Zhu, Zhengxiang; Rinderspacher, Alison; Deng, Shi-Xian

    2012-01-01

    A series of potent amide non-urea inhibitors of soluble epoxide hydrolase (sEH) is disclosed. The inhibition of soluble epoxide hydrolase leads to elevated levels of epoxyeicosatrienoic acids (EETs), and thus inhibitors of sEH represent one of a novel approach to the development of vasodilatory and anti-inflammatory drugs. Structure-activities studies guided optimization of a lead compound, identified through high-throughput screening, gave rise to sub-nanomolar inhibitors of human sEH with stability in human liver microsomal assay suitable for preclinical development. PMID:23237835

  6. Synthesis and structure-activity relationship of piperidine-derived non-urea soluble epoxide hydrolase inhibitors

    SciTech Connect

    Pecic, Stevan; Pakhomova, Svetlana; Newcomer, Marcia E.; Morisseau, Christophe; Hammock, Bruce D.; Zhu, Zhengxiang; Rinderspacher, Alison; Deng, Shi-Xian

    2013-09-27

    A series of potent amide non-urea inhibitors of soluble epoxide hydrolase (sEH) is disclosed. The inhibition of soluble epoxide hydrolase leads to elevated levels of epoxyeicosatrienoic acids (EETs), and thus inhibitors of sEH represent one of a novel approach to the development of vasodilatory and anti-inflammatory drugs. Structure–activities studies guided optimization of a lead compound, identified through high-throughput screening, gave rise to sub-nanomolar inhibitors of human sEH with stability in human liver microsomal assay suitable for preclinical development.

  7. Select microtubule inhibitors increase lysosome acidity and promote lysosomal disruption in acute myeloid leukemia (AML) cells.

    PubMed

    Bernard, Dannie; Gebbia, Marinella; Prabha, Swayam; Gronda, Marcela; MacLean, Neil; Wang, Xiaoming; Hurren, Rose; Sukhai, Mahadeo A; Cho, Eunice E; Manolson, Morris F; Datti, Alessandro; Wrana, Jeffrey; Minden, Mark D; Al-Awar, Rima; Aman, Ahmed; Nislow, Corey; Giaever, Guri; Schimmer, Aaron D

    2015-07-01

    To identify new biological vulnerabilities in acute myeloid leukemia, we screened a library of natural products for compounds cytotoxic to TEX leukemia cells. This screen identified the novel small molecule Deoxysappanone B 7,4' dimethyl ether (Deox B 7,4), which possessed nanomolar anti-leukemic activity. To determine the anti-leukemic mechanism of action of Deox B 7,4, we conducted a genome-wide screen in Saccharomyces cerevisiae and identified enrichment of genes related to mitotic cell cycle as well as vacuolar acidification, therefore pointing to microtubules and vacuolar (V)-ATPase as potential drug targets. Further investigations into the mechanisms of action of Deox B 7,4 and a related analogue revealed that these compounds were reversible microtubule inhibitors that bound near the colchicine site. In addition, Deox B 7,4 and its analogue increased lysosomal V-ATPase activity and lysosome acidity. The effects on microtubules and lysosomes were functionally important for the anti-leukemic effects of these drugs. The lysosomal effects were characteristic of select microtubule inhibitors as only the Deox compounds and nocodazole, but not colchicine, vinca alkaloids or paclitaxel, altered lysosome acidity and induced lysosomal disruption. Thus, our data highlight a new mechanism of action of select microtubule inhibitors on lysosomal function. PMID:25832785

  8. Synthesis and biological evaluation of several dephosphonated analogues of CMP-Neu5Ac as inhibitors of GM3-synthase.

    PubMed

    Rota, Paola; Cirillo, Federica; Piccoli, Marco; Gregorio, Antonio; Tettamanti, Guido; Allevi, Pietro; Anastasia, Luigi

    2015-10-01

    Previous studies demonstrated that reducing the GM3 content in myoblasts increased the cell resistance to hypoxic stress, suggesting that a pharmacological inhibition of the GM3 synthesis could be instrumental for the development of new treatments for ischemic diseases. Herein, the synthesis of several dephosphonated CMP-Neu5Ac congeners and their anti-GM3-synthase activity is reported. Biological activity testes revealed that some inhibitors almost completely blocked the GM3-synthase activity in vitro and reduced the GM3 content in living embryonic kidney 293A cells, eventually activating the epidermal growth factor receptor (EGFR) signaling cascade.

  9. Design and synthesis of disubstituted (4-piperidinyl)-piperazine derivatives as potent acetyl-CoA carboxylase inhibitors.

    PubMed

    Chonan, Tomomichi; Tanaka, Hiroaki; Yamamoto, Daisuke; Yashiro, Miyoko; Oi, Takahiro; Wakasugi, Daisuke; Ohoka-Sugita, Ayumi; Io, Fusayo; Koretsune, Hiroko; Hiratate, Akira

    2010-07-01

    Acetyl-CoA carboxylases (ACCs), the rate limiting enzymes in de novo lipid synthesis, play important roles in modulating energy metabolism. The inhibition of ACC has demonstrated promising therapeutic potential for treating obesity and type 2 diabetes mellitus in transgenic mice and preclinical animal models. We describe herein the structure-based design and synthesis of a novel series of disubstituted (4-piperidinyl)-piperazine derivatives as ACC inhibitors. Our structure-based approach led to the discovery of the indole derivatives 13i and 13j, which exhibited potent in vitro ACC inhibitory activity.

  10. Characterization of inhibitory effects of the potential therapeutic inhibitors, benzoic acid and pyridine derivatives, on the monophenolase and diphenolase activities of tyrosinase

    PubMed Central

    Gheibi, Nematollah; Taherkhani, Negar; Ahmadi, Abolfazl; Haghbeen, Kamahldin; Ilghari, Dariush

    2015-01-01

    Objective(s): Involvement of tyrosinase in the synthesis of melanin and cell signaling pathway has made it an attractive target in the search for therapeutic inhibitors for treatment of different skin hyperpigmentation disorders and melanoma cancers. Materials and Methods: In the present study, we conducted a comprehensive kinetic analysis to understand the mechanisms of inhibition imposed by 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid on the monophenolase and diphenolase activities of the mushroom tyrosinase, and then MTT assay was exploited to evaluate their toxicity on the melanoma cells. Results: Kinetic analysis revealed that nicotinic acid and picolinic acid competitively restricted the monophenolase activity with inhibition constants (Ki) of 1.21 mM and 1.97 mM and the diphenolase activity with Kis of 2.4 mM and 2.93 mM, respectively. 2-aminobenzoic acid and 4-aminobenzoic acid inhibited the monophenolase activity in a non-competitive fashion with Kis of 5.15 µM and 3.8 µM and the diphenolase activity with Kis of 4.72 µM and 20 µM, respectively. Conclusion: Our cell-based data revealed that only the pyridine derivatives imposed cytotoxicity in melanoma cells. Importantly, the concentrations of the inhibitors leading to 50% decrease in the cell density (IC50) were comparable to those causing 50% drop in the enzyme activity, implying that the observed cytotoxicity is highly likely due to the tyrosinase inhibition. Moreover, our cell-based data exhibited that the pyridine derivatives acted as anti-proliferative agents, perhaps inducing cytotoxicity in the melanoma cells through inhibition of the tyrosinase activities. PMID:25810885

  11. Synthesis, Pharmacological Profile and Docking Studies of New Sulfonamides Designed as Phosphodiesterase-4 Inhibitors

    PubMed Central

    Cardozo, Suzana Vanessa S.; Carvalho, Vinicius de Frias; Romeiro, Nelilma Correia; Silva, Patrícia Machado Rodrigues e; Martins, Marco Aurélio; Barreiro, Eliezer J.; Lima, Lídia Moreira

    2016-01-01

    Prior investigations showed that increased levels of cyclic AMP down-regulate lung inflammatory changes, stimulating the interest in phosphodiesterase (PDE)4 as therapeutic target. Here, we described the synthesis, pharmacological profile and docking properties of a novel sulfonamide series (5 and 6a-k) designed as PDE4 inhibitors. Compounds were screened for their selectivity against the four isoforms of human PDE4 using an IMAP fluorescence polarized protocol. The effect on allergen- or LPS-induced lung inflammation and airway hyper-reactivity (AHR) was studied in A/J mice, while the xylazine/ketamine-induced anesthesia test was employed as a behavioral correlate of emesis in rodents. As compared to rolipram, the most promising screened compound, 6a (LASSBio-448) presented a better inhibitory index concerning PDE4D/PDE4A or PDE4D/PDE4B. Accordingly, docking analyses of the putative interactions of LASSBio-448 revealed similar poses in the active site of PDE4A and PDE4C, but slight unlike orientations in PDE4B and PDE4D. LASSBio-448 (100 mg/kg, oral), 1 h before provocation, inhibited allergen-induced eosinophil accumulation in BAL fluid and lung tissue samples. Under an interventional approach, LASSBio-448 reversed ongoing lung eosinophilic infiltration, mucus exacerbation, peribronchiolar fibrosis and AHR by allergen provocation, in a mechanism clearly associated with blockade of pro-inflammatory mediators such as IL-4, IL-5, IL-13 and eotaxin-2. LASSBio-448 (2.5 and 10 mg/kg) also prevented inflammation and AHR induced by LPS. Finally, the sulfonamide derivative was shown to be less pro-emetic than rolipram and cilomilast in the assay employed. These findings suggest that LASSBio-448 is a new PDE4 inhibitor with marked potential to prevent and reverse pivotal pathological features of diseases characterized by lung inflammation, such as asthma. PMID:27695125

  12. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    SciTech Connect

    Amikam, D.; Benziman, M. )

    1989-12-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of {sup 32}P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with ({sup 14}C)glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes.

  13. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  14. Parthenolide and abscisic acid synthesis in feverfew are associated but environmental factors affect them dissimilarly.

    PubMed

    Fonseca, Jorge M; Rushing, James W; Rajapakse, Nihal C; Thomas, Ronald L; Riley, Melissa B

    2005-05-01

    The effect of harvest time, shading prior to harvest and water stress on parthenolide (PRT) concentration in feverfew and its possible connection with the abscisic acid (ABA) pathway were investigated. In plants harvested at different times of the day, acetumar the PRT levels were highest during late afternoon while ABA levels were greatest during morning hours. Shading plants during the afternoon prior to harvest caused a two-fold increase in ABA and no significant difference in PRT levels. ABA was higher in water-stressed plants while PRTcontent increased in plants following recovery from a water stress event. ABA inhibitors, norflurazon, sodium tungstate, naproxen and sodium bisulfite, were used to determine the connection between the biosynthesis of PRTand ABA. Norflurazon and naproxen reduced PRT concentration in cut flowers and in 2-month old plants. Sodium bisulfite and sodium tungstate reduced PRT only in cut flowers. Application of 2,4-D, a promoter of ABA synthesis, to potted plants resulted in a 2.5 fold increase in PRT levels. The inhibition of PRT formation in response to ABA inhibitors and the increase in PRT concentration observed with 2,4-D application indicated that PRT is derived from carotenoid synthesis similarly to ABA and not directly from farnesyl pyrosphosphate (FPP) as suggested for other sesquiterpene Lactones. However, PRT and ABA levels are affected dissimilarly by environmental conditions. The overall results of the study indicated that simple agricultural practices, such as harvesting during afternoon and subjecting plants to a single water stress event, can increase PRT concentration in the final feverfew product with no additional costs of production prior to harvest.

  15. Inhibition of protein synthesis may explain the bactericidal properties of hypochlorous acid produced by phagocytic cells

    SciTech Connect

    McKenna, S.M.; Davies, K.J.A.

    1986-05-01

    The authors find that hypochlorous acid (HOCl) and hydrogen peroxide (H/sub 2/O/sub 2/) inhibit protein synthesis in E. coli: HOCl is similarly ordered 10x more efficient than H/sub 2/O/sub 2/. This result may underlie the mechanism of bacterial killing by phagocytes, which use H/sub 2/O/sub 2/ and myeloperoxidase (MPO) to oxidize Cl/sup -/ to HOCl. Protein synthesis (/sup 3/H-leu incorporation) was completely inhibited by 50..mu..M HOCl, whereas 50..mu..M H/sub 2/O/sub 2/ only gave similarly ordered 10% inhibition. Complete inhibition by H/sub 2/O/sub 2/ was only observed at concentrations < 0.5 mM. HOCl was also a more potent inhibitor of cell growth (cultured in M9 medium + glucose) than was H/sub 2/O/sub 2/. No growth occurred at 50..mu..M HOCl: in contrast 0.5 mM H/sub 2/O/sub 2/ was required for similar results. During time-course experiments it was found that the inhibition of cell growth by both HOCl and H/sub 2/O/sub 2/ reached a maximum within 30 min (at any concentration used). HOCl reacts avidly with amino groups to form N-chloroamines but H/sub 2/O/sub 2/ is unreactive. Amino acids (ala, lys, met, trp) or taurine (all at 10 mM) prevented the effects of HOCl but did not affect H/sub 2/O/sub 2/ results. There was an excellent correlation between decreased protein synthesis and diminished cell growth. Inhibition of cell growth was not explained by proteolysis (release of acid-soluble counts), or by loss of membrane integrity. They propose that inhibition of protein synthesis may be a fundamental aspect of the bactericidal functions of phagocytes, and that the production of HOCl by MPO represents a quantitative advantage over H/sub 2/O/sub 2/.

  16. Development of novel ferulic acid derivatives as potent histone deacetylase inhibitors.

    PubMed

    Wang, Fang; Lu, Wen; Zhang, Tao; Dong, Jinyun; Gao, Hongping; Li, Pengfei; Wang, Sicen; Zhang, Jie

    2013-11-15

    Histone deacetylase inhibitors (HDACIs) offer a promising strategy for cancer therapy. The discovery of potent ferulic acid-based HDACIs with hydroxamic acid or 2-aminobenzamide group as zinc binding group was reported. The halogeno-acetanilide was introduced as novel surface recognition moiety (SRM). The majority of title compounds displayed potent HDAC inhibitory activity. In particular, FA6 and FA16 exhibited significant enzymatic inhibitory activities, with IC50 values of 3.94 and 2.82 μM, respectively. Furthermore, these compounds showed moderate antiproliferative activity against a panel of human cancer cells. FA17 displayed promising profile as an antitumor candidate. The results indicated that these ferulic acid derivatives could serve as promising lead compounds for further optimization. PMID:24095016

  17. [Prevention of colorectal cancer: acetylsalicyclic acid and cyclo-oxygenase-2 inhibitors are only partially effective].

    PubMed

    Kleibeuker, J H; de Vries, E G

    2003-11-01

    Acetylsalicylic acid was recently shown to inhibit the development of colorectal adenomas in subjects with a moderately increased risk for colorectal cancer. The mechanisms by which acetylsalicylic acid and other NSAIDs, including COX-2 inhibitors, exert this effect include: inhibition of COX-2, induction of apoptosis and induction of the P21 protein that controls the development of crypt cells. For the majority of the population, a healthy lifestyle and healthy eating habits are the best means of preventing colorectal cancer. In addition, population-wide screening should be encouraged. For people with an increased risk of colorectal cancer, acetylsalicylic acid only has a partial effect and therefore endoscopic surveillance is still indicated. Sulindac or celecoxib may be useful for patients with familial adenomatous polyposis and in particular for inhibiting the development of rectal adenomas after subtotal colectomy with ileorectal anastomosis. However, in these cases endoscopic surveillance is also still necessary.

  18. Design and synthesis of novel hydroxypyridinone derivatives as potential tyrosinase inhibitors.

    PubMed

    Zhao, De-Yin; Zhang, Ming-Xia; Dong, Xiao-Wu; Hu, Yong-Zhou; Dai, Xiao-Yan; Wei, Xiaoyi; Hider, Robert C; Zhang, Jin-Chao; Zhou, Tao

    2016-07-01

    Two groups of novel hydroxypyridinone derivatives 6(a-e) and 12(a-c), were designed as potential tyrosinase inhibitors, and synthesized using kojic acid as a starting material. The tyrosinase inhibitory activity of these two groups was demonstrated to be potent, especially compounds 6e and 12a, whose IC50 values for monophenolase activity were 1.95μM and 2.79μM, respectively. Both of these values are lower than that of kojic acid (IC50=12.50μM). Compounds 6e and 12a were investigated for the inhibitory effect on diphenolase activity. The results showed that the inhibitory mechanism of these two compounds was reversible and that the inhibitory type was a competitive-uncompetitive mixed-type. The values of IC50 of 6e and 12a on the diphenolase activity of tyrosinase were determined to be 8.97μM and 26.20μM, respectively. The inhibitory constants (KI and KIS) of 6e were determined as 17.17μM and 22.09μM, respectively; and the KI and KIS values of 12a were 34.41μM and 79.02μM, respectively. Compound 6e showed a greater ability to reduce copper and a stronger copper chelating ability than kojic acid. PMID:27185329

  19. Discovery of wall teichoic acid inhibitors as potential anti-MRSA β-lactam combination agents.

    PubMed

    Wang, Hao; Gill, Charles J; Lee, Sang H; Mann, Paul; Zuck, Paul; Meredith, Timothy C; Murgolo, Nicholas; She, Xinwei; Kales, Susan; Liang, Lianzhu; Liu, Jenny; Wu, Jin; Santa Maria, John; Su, Jing; Pan, Jianping; Hailey, Judy; Mcguinness, Debra; Tan, Christopher M; Flattery, Amy; Walker, Suzanne; Black, Todd; Roemer, Terry

    2013-02-21

    Innovative strategies are needed to combat drug resistance associated with methicillin-resistant Staphylococcus aureus (MRSA). Here, we investigate the potential of wall teichoic acid (WTA) biosynthesis inhibitors as combination agents to restore β-lactam efficacy against MRSA. Performing a whole-cell pathway-based screen, we identified a series of WTA inhibitors (WTAIs) targeting the WTA transporter protein, TarG. Whole-genome sequencing of WTAI-resistant isolates across two methicillin-resistant Staphylococci spp. revealed TarG as their common target, as well as a broad assortment of drug-resistant bypass mutants mapping to earlier steps of WTA biosynthesis. Extensive in vitro microbiological analysis and animal infection studies provide strong genetic and pharmacological evidence of the potential effectiveness of WTAIs as anti-MRSA β-lactam combination agents. This work also highlights the emerging role of whole-genome sequencing in antibiotic mode-of-action and resistance studies.

  20. Docking analysis of gallic acid derivatives as HIV-1 protease inhibitors.

    PubMed

    Singh, Anjali; Pal, Tapan Kumar

    2015-01-01

    HIV-1 Protease (HIV-1 PR) enzymes are essential for accurate assembly and maturation of infectious HIV retroviruses. The significant role of HIV-1 protease in viral replication has made it a potential drug target. In the recent past, phytochemical Gallic Acid (GA) derivatives have been screened for protease inhibitor activity. The present work aims to design and evaluate potential GA-based HIV-1 PR phytoinhibitors by docking approach. The ligands were prepared by ChemDraw and docking was performed in HEX software. In this present study, one of the GA analogues (GA4) emerged as a potent drug candidate for HIV-1 PR inhibition, and docking results showed it to be comparable with anti-HIV drugs, darunavir and amprenavir. The GA4 derivative provided a lead for designing more effective HIV-1 PR inhibitors.

  1. Fatty acid synthase inhibitors of phenolic constituents isolated from Garcinia mangostana.

    PubMed

    Jiang, He Zhong; Quan, Xiao Fang; Tian, Wei Xi; Hu, Jiang Miao; Wang, Peng Cheng; Huang, Sheng Zhuo; Cheng, Zhong Quan; Liang, Wen Juan; Zhou, Jun; Ma, Xiao Feng; Zhao, You Xing

    2010-10-15

    Natural inhibitors of fatty acid synthase (FAS) are emerging as potential therapeutic agents to treat cancer and obesity. The bioassay-guided chemical investigation of the hulls of Garcinia mangostana led to the isolation of 13 phenolic compounds (1-13) mainly including xanthone and benzophenone, in which compounds 7, 8, 9, 10, and 11 were isolated from this plant for the first time and compound 9 was a new natural product. These isolates possess strong inhibitory activity of FAS with the IC(50) values ranging from 1.24 to 91.07 μM. The study indicates that two types of natural products, xanthones and benzophenones, could be considered as promising FAS inhibitors.

  2. Discovery of Novel Types of Inhibitors of S-Adenosylmethionine Synthesis by Virtual Screening

    PubMed Central

    Taylor, John C.; Bock, Charles W.; Takusagawa, Fusao; Markham, George D.

    2010-01-01

    S-adenosylmethionine (AdoMet) lies at an intersection of nucleotide and amino acid metabolism, and performs a multitude of metabolic functions. AdoMet formation is catalyzed by S-adenosylmethionine synthetase (ATP : L-methionine S-adenosyltransferase (MAT)) which is a target for development of anti-cancer and antimicrobial agents. High affinity MAT inhibitors have been found through computational docking of more than 200,000 compounds for predicted binding to the crystallographically-defined nucleotide binding region of the enzyme's active site. Two of the top scoring candidate compounds had IC50 values less than 10 nM,, more than 10,000-fold lower than the substrates' KM values. The compounds are structurally unrelated to the natural ligands of the enzyme. The enzyme is protected from inhibition by ATP, but not by methionine, consistent with binding at the adenosyl region of the active site. These results validate in silico screening as a robust approach to the discovery of inhibitors of this chemotherapeutically relevant enzyme. PMID:19739644

  3. The design and clinical development of inhibitors of glycosphingolipid synthesis: will invention be the mother of necessity?

    PubMed

    Shayman, James A

    2013-01-01

    The treatment of glycosphingolipid storage diseases by synthesis inhibition was first proposed 40 years ago as an alternative approach to enzyme replacement therapy. We have pursued this strategy through the rational design of potent and selective inhibitors of glucosylceramide synthase, the first step in glycosphingolipid synthesis. Eliglustat tartrate was the result of these efforts and is currently the focus of phase 3 trials for type 1 Gaucher disease. Phase 2 studies showed a reduction in splenomegaly and hepatomegaly and improvements of anemia and thrombocytopenia at levels equivalent to or exceeding the historic response to imiglucerase. Structural analogues of eliglustat have also been designed that lack pgp-1 recognition and cross the blood brain barrier. These may have utility for central nervous system- based sphingolipidoses. Because glycosphingolipids are important regulators of receptor tyrosine kinases, glucosylceramide synthase inhibitors may also be beneficial for disorders such as type 2 diabetes mellitus and polycystic kidney disease. PMID:23874009

  4. Discovery of arjunolic acid as a novel non-zinc binding carbonic anhydrase II inhibitor.

    PubMed

    Kalyanavenkataraman, Subhalakshmi; Nanjan, Pandurangan; Banerji, Asoke; Nair, Bipin G; Kumar, Geetha B

    2016-06-01

    Elevated levels of carbonic anhydrase II (CA II) have been shown to be associated with cardiac hypertrophy and heart failure. Although arjunolic acid (AA) has a diverse range of therapeutic applications including cardio-protection, there have been no reports on the effect of AA on CA II. The present study describes for the first time, the novel zinc independent inhibition of CA II by AA. The molecular docking studies of AA indicated that the hydroxyl group at C2 of the A-ring, which hydrogen bonds with the catalytic site residues (His64, Asn62 and Asn67), along with the gem-dimethyl group at C20 of the E-ring, greatly influences the inhibitory activity, independent of the catalytic zinc, unlike the inhibition observed with most CA II inhibitors. Among the triterpenoids tested viz. arjunolic acid, arjunic acid, asiatic acid, oleanolic acid and ursolic acid, AA was the most potent in inhibiting CA II in vitro with an IC50 of 9μM. It was interesting to note, that in spite of exhibiting very little differences in their structures, these triterpenoids exhibited vast differences in their inhibitory activities, with IC50 values ranging from 9μM to as high as 333μM. Furthermore, AA also inhibited the cytosolic activity of CA in H9c2 cardiomyocytes, as reflected by the decrease in acidification of the intracellular pH (pHi). The decreased acidification reduced the intracellular calcium levels, which further prevented the mitochondrial membrane depolarization. Thus, these studies provide a better understanding for establishing the novel molecular mechanism involved in CA II inhibition by the non-zinc binding inhibitor AA. PMID:27038848

  5. Design, synthesis and characterization of novel inhibitors against mycobacterial β-ketoacyl CoA reductase FabG4.

    PubMed

    Banerjee, Deb Ranjan; Dutta, Debajyoti; Saha, Baisakhee; Bhattacharyya, Sudipta; Senapati, Kalyan; Das, Amit K; Basak, Amit

    2014-01-01

    We report the design and synthesis of triazole-polyphenol hybrid compounds 1 and 2 as inhibitors of the FabG4 (Rv0242c) enzyme of Mycobacterium tuberculosis for the first time. A major advance in this field occurred only a couple of years ago with the X-ray crystal structure of FabG4, which has helped us to design these inhibitors by the computational fragment-based drug design (FBDD) approach. Compound 1 has shown competitive inhibition with an inhibition constant (Ki) value of 3.97 ± 0.02 μM. On the other hand, compound 2 has been found to be a mixed type inhibitor with a Ki value of 0.88 ± 0.01 μM. Thermodynamic analysis using isothermal titration calorimetry (ITC) reveals that both inhibitors bind at the NADH co-factor binding domain. Their MIC values, as determined by resazurin assay against M. smegmatis, indicated their good anti-mycobacterial properties. A preliminary structure-activity relationship (SAR) study supports the design of these inhibitors. These compounds may be possible candidates as lead compounds for alternate anti-tubercular drugs. All of the reductase enzymes of the Mycobacterium family have a similar ketoacyl reductase (KAR) domain. Hence, this work may be extrapolated to find structure-based inhibitors of other reductase enzymes. PMID:24129589

  6. Solution structure of the squash aspartic acid proteinase inhibitor (SQAPI) and mutational analysis of pepsin inhibition.

    PubMed

    Headey, Stephen J; Macaskill, Ursula K; Wright, Michele A; Claridge, Jolyon K; Edwards, Patrick J B; Farley, Peter C; Christeller, John T; Laing, William A; Pascal, Steven M

    2010-08-27

    The squash aspartic acid proteinase inhibitor (SQAPI), a proteinaceous proteinase inhibitor from squash, is an effective inhibitor of a range of aspartic proteinases. Proteinaceous aspartic proteinase inhibitors are rare in nature. The only other example in plants probably evolved from a precursor serine proteinase inhibitor. Earlier work based on sequence homology modeling suggested SQAPI evolved from an ancestral cystatin. In this work, we determined the solution structure of SQAPI using NMR and show that SQAPI shares the same fold as a plant cystatin. The structure is characterized by a four-strand anti-parallel beta-sheet gripping an alpha-helix in an analogous manner to fingers of a hand gripping a tennis racquet. Truncation and site-specific mutagenesis revealed that the unstructured N terminus and the loop connecting beta-strands 1 and 2 are important for pepsin inhibition, but the loop connecting strands 3 and 4 is not. Using ambiguous restraints based on the mutagenesis results, SQAPI was then docked computationally to pepsin. The resulting model places the N-terminal strand of SQAPI in the S' side of the substrate binding cleft, whereas the first SQAPI loop binds on the S side of the cleft. The backbone of SQAPI does not interact with the pepsin catalytic Asp(32)-Asp(215) diad, thus avoiding cleavage. The data show that SQAPI does share homologous structural elements with cystatin and appears to retain a similar protease inhibitory mechanism despite its different target. This strongly supports our hypothesis that SQAPI evolved from an ancestral cystatin.

  7. An efficient and versatile synthesis of GlcNAcstatins—potent and selective O-GlcNAcase inhibitors built on the tetrahydroimidazo[1,2-a]pyridine scaffold

    PubMed Central

    Borodkin, Vladimir S.; van Aalten, Daan M.F.

    2010-01-01

    We report a novel approach to the synthesis of GlcNAcstatins—members of an emerging family of potent and selective inhibitors of peptidyl O-GlcNAc hydrolase build upon tetrahydroimidazo[1,2-a]pyridine scaffold. Making use of a streamlined synthetic sequence featuring de novo synthesis of imidazoles from glyoxal, ammonia and aldehydes, a properly functionalised linear GlcNAcstatin precursor has been efficiently prepared starting from methyl 3,4-O-(2′,3′-dimethoxybutane-2′,3′-diyl)-α-d-mannopyranoside. Subsequent ring closure of the linear precursor in an intramolecular SN2 process furnished the key fused d-mannose-imidazole GlcNAcstatin precursor in excellent yield. Finally, a sequence of transformations of this key intermediate granted expeditious access to a variety of the target compounds bearing a C(2)-phenethyl group and a range of N(8) acyl substituents. The versatility of the new approach stems from an appropriate choice of a set of acid labile permanent protecting groups on the monosaccharide starting material. Application was demonstrated by the synthesis of GlcNAcstatins containing polyunsaturated and thiol-containing amido substituents. PMID:20976183

  8. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  9. Towards inhibitors of glycosyltransferases: A novel approach to the synthesis of 3-acetamido-3-deoxy-D-psicofuranose derivatives

    PubMed Central

    Koóš, Miroslav; Lin, Chun-Hung

    2015-01-01

    Summary A novel synthetic strategy leading to 3-acetamido-3-deoxy-D-psicofuranose 9 is presented. The latter compound, after some manipulations, was transformed into fully protected 3-acetamido-3-deoxy-D-psicofuranose 11 as a potential substrate for the synthesis of N-acetylglucosaminyltransferase inhibitors designed by computational methods. After the attempted thioglycosylation of 11 with EtSH in the presence of BF3·OEt2, 2-methyloxazoline derivatives 13 and 14 were isolated. PMID:26425214

  10. Synthesis and crystal structures of the potential tyrosinase inhibitors N-(4-acetylphenyl)-2-chloroacetamide and 2-(4-acetylanilino)-2-oxoethyl cinnamate.

    PubMed

    Ashraf, Zaman; Kim, Daeyoung; Seo, Sung-Yum; Kang, Sung Kwon

    2016-02-01

    Substituted benzoic acid and cinnamic acid esters are of interest as tyrosinase inhibitors and the development of such inhibitors may help in diminishing many dermatological disorders. The tyrosinase enzyme has also been linked to Parkinson's disease. In view of hydroxylated compounds having ester and amide functionalities to potentially inhibit tyrosinase, we herein report the synthesis and crystal structures of two amide-based derivatives, namely N-(4-acetylphenyl)-2-chloroacetamide, C10H10ClNO2, (I), and 2-(4-acetylanilino)-2-oxoethyl cinnamate, C19H17NO4, (II). In compound (I), the acetylphenyl ring and the N-(C=O)-C unit of the acetamide group are almost coplanar, with a dihedral angle of 7.39 (18)°. Instead of esterification, a cheaper and more efficient synthetic method has been developed for the preparation of compound (II). The molecular geometry of compound (II) is a V-shape. The acetamide and cinnamate groups are almost planar, with mean deviations of 0.088 and 0.046 Å, respectively; the dihedral angle between these groups is 77.39 (7)°. The carbonyl O atoms are positioned syn and anti to the amide carbonyl O atom. In the crystals of (I) and (II), N-H...O, C-H...O and C-H...π interactions link the molecules into a three-dimensional network. PMID:26846491

  11. Baker's Yeast Deficient in Storage Lipid Synthesis Uses cis-Vaccenic Acid to Reduce Unsaturated Fatty Acid Toxicity.

    PubMed

    Sec, Peter; Garaiova, Martina; Gajdos, Peter; Certik, Milan; Griac, Peter; Hapala, Ivan; Holic, Roman

    2015-07-01

    The role of cis-vaccenic acid (18:1n-7) in the reduction of unsaturated fatty acids toxicity was investigated in baker's yeast Saccharomyces cerevisiae. The quadruple mutant (QM, dga1Δ lro1Δ are1Δ are2Δ) deficient in enzymes responsible for triacylglycerol and steryl ester synthesis has been previously shown to be highly sensitive to exogenous unsaturated fatty acids. We have found that cis-vaccenic acid accumulated during cultivation in the QM cells but not in the corresponding wild type strain. This accumulation was accompanied by a reduction in palmitoleic acid (16:1n-7) content in the QM cells that is consistent with the proposed formation of cis-vaccenic acid by elongation of palmitoleic acid. Fatty acid analysis of individual lipid classes from the QM strain revealed that cis-vaccenic acid was highly enriched in the free fatty acid pool. Furthermore, production of cis-vaccenic acid was arrested if the mechanism of fatty acids release to the medium was activated. We also showed that exogenous cis-vaccenic acid did not affect viability of the QM strain at concentrations toxic for palmitoleic or oleic acids. Moreover, addition of cis-vaccenic acid to the growth medium provided partial protection against the lipotoxic effects of exogenous oleic acid. Transformation of palmitoleic acid to cis-vaccenic acid is thus a rescue mechanism enabling S. cerevisiae cells to survive in the absence of triacylglycerol synthesis as the major mechanism for unsaturated fatty acid detoxification.

  12. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life.

  13. Inhibition of Pig Phosphoenolpyruvate Carboxykinase Isoenzymes by 3-Mercaptopicolinic Acid and Novel Inhibitors.

    PubMed

    Hidalgo, Jorge; Latorre, Pedro; Carrodeguas, José Alberto; Velázquez-Campoy, Adrián; Sancho, Javier; López-Buesa, Pascual

    2016-01-01

    There exist two isoforms of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) in pig populations that differ in a single amino acid (Met139Leu). The isoenzymes have different kinetic properties, affecting more strongly the Km and Vmax of nucleotides. They are associated to different phenotypes modifying traits of considerable economic interest. In this work we use inhibitors of phosphoenolpyruvate carboxykinase activity to search for further differences between these isoenzymes. On the one hand we have used the well-known inhibitor 3-mercaptopicolinic acid. Its inhibition patterns were the same for both isoenzymes: a three-fold decrease of the Ki values for GTP in 139Met and 139Leu (273 and 873 μM, respectively). On the other hand, through screening of a chemical library we have found two novel compounds with inhibitory effects of a similar magnitude to that of 3-mercaptopicolinic acid but with less solubility and specificity. One of these novel compounds, (N'1-({5-[1-methyl-5-(trifluoromethyl)-1H-pyrazol-3-yl]-2-thienyl}methylidene)-2,4-dichlorobenzene-1-carbohydrazide), exhibited significantly different inhibitory effects on either isoenzyme: it enhanced threefold the apparent Km value for GTP in 139Met, whereas in 139Leu, it reduced it from 99 to 69 μM. The finding of those significant differences in the binding of GTP reinforces the hypothesis that the Met139Leu substitution affects strongly the nucleotide binding site of PEPCK-C.

  14. Inhibition of Pig Phosphoenolpyruvate Carboxykinase Isoenzymes by 3-Mercaptopicolinic Acid and Novel Inhibitors

    PubMed Central

    Hidalgo, Jorge; Latorre, Pedro; Carrodeguas, José Alberto; Velázquez-Campoy, Adrián; Sancho, Javier; López-Buesa, Pascual

    2016-01-01

    There exist two isoforms of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) in pig populations that differ in a single amino acid (Met139Leu). The isoenzymes have different kinetic properties, affecting more strongly the Km and Vmax of nucleotides. They are associated to different phenotypes modifying traits of considerable economic interest. In this work we use inhibitors of phosphoenolpyruvate carboxykinase activity to search for further differences between these isoenzymes. On the one hand we have used the well-known inhibitor 3-mercaptopicolinic acid. Its inhibition patterns were the same for both isoenzymes: a three-fold decrease of the Ki values for GTP in 139Met and 139Leu (273 and 873 μM, respectively). On the other hand, through screening of a chemical library we have found two novel compounds with inhibitory effects of a similar magnitude to that of 3-mercaptopicolinic acid but with less solubility and specificity. One of these novel compounds, (N'1-({5-[1-methyl-5-(trifluoromethyl)-1H-pyrazol-3-yl]-2-thienyl}methylidene)-2,4-dichlorobenzene-1-carbohydrazide), exhibited significantly different inhibitory effects on either isoenzyme: it enhanced threefold the apparent Km value for GTP in 139Met, whereas in 139Leu, it reduced it from 99 to 69 μM. The finding of those significant differences in the binding of GTP reinforces the hypothesis that the Met139Leu substitution affects strongly the nucleotide binding site of PEPCK-C. PMID:27391465

  15. Inhibition of Pig Phosphoenolpyruvate Carboxykinase Isoenzymes by 3-Mercaptopicolinic Acid and Novel Inhibitors.

    PubMed

    Hidalgo, Jorge; Latorre, Pedro; Carrodeguas, José Alberto; Velázquez-Campoy, Adrián; Sancho, Javier; López-Buesa, Pascual

    2016-01-01

    There exist two isoforms of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) in pig populations that differ in a single amino acid (Met139Leu). The isoenzymes have different kinetic properties, affecting more strongly the Km and Vmax of nucleotides. They are associated to different phenotypes modifying traits of considerable economic interest. In this work we use inhibitors of phosphoenolpyruvate carboxykinase activity to search for further differences between these isoenzymes. On the one hand we have used the well-known inhibitor 3-mercaptopicolinic acid. Its inhibition patterns were the same for both isoenzymes: a three-fold decrease of the Ki values for GTP in 139Met and 139Leu (273 and 873 μM, respectively). On the other hand, through screening of a chemical library we have found two novel compounds with inhibitory effects of a similar magnitude to that of 3-mercaptopicolinic acid but with less solubility and specificity. One of these novel compounds, (N'1-({5-[1-methyl-5-(trifluoromethyl)-1H-pyrazol-3-yl]-2-thienyl}methylidene)-2,4-dichlorobenzene-1-carbohydrazide), exhibited significantly different inhibitory effects on either isoenzyme: it enhanced threefold the apparent Km value for GTP in 139Met, whereas in 139Leu, it reduced it from 99 to 69 μM. The finding of those significant differences in the binding of GTP reinforces the hypothesis that the Met139Leu substitution affects strongly the nucleotide binding site of PEPCK-C. PMID:27391465

  16. Activity of cefazolin and two beta-lactamase inhibitors, clavulanic acid and sulbactam, against Bacteroides fragilis.

    PubMed Central

    Fekete, T; McGowen, J; Cundy, K R

    1987-01-01

    One hundred clinical isolates of the Bacteroides fragilis group of bacteria were tested by agar dilution for susceptibility to cefazolin alone or in combination with clavulanic acid or sulbactam. For cefazolin, the MIC for 50% of the isolates (MIC50) was 32 micrograms/ml, the breakpoint for susceptibility. With the addition of 0.5 micrograms of clavulanic acid per ml, the MIC for 90% of the isolates (MIC90) was 8 micrograms/ml, well within the achievable range of concentrations in serum or tissue. Similarly, with the addition of 0.5 micrograms of sulbactam per ml, the MIC90 was 16 micrograms/ml. The addition of a higher concentration (4.0 micrograms/ml) of clavulanic acid or sulbactam resulted in MIC90S which were fourfold lower than those with 0.5 micrograms/ml. A fixed ratio of cefazolin-beta-lactamase inhibitor of 4:1 resulted in an MIC50 and MIC90 which were intermediate between the 0.5- and 4.0-micrograms/ml fixed concentration of beta-lactamase inhibitor. PMID:3032097

  17. Pyridopyrimidine derivatives as inhibitors of cyclic nucleotide synthesis: Application for treatment of diarrhea.

    PubMed

    Kots, Alexander Y; Choi, Byung-Kwon; Estrella-Jimenez, Maria E; Warren, Cirle A; Gilbertson, Scott R; Guerrant, Richard L; Murad, Ferid

    2008-06-17

    Acute secretory diarrhea induced by infection with enterotoxigenic strains of Escherichia coli involves binding of stable toxin (STa) to its receptor on the intestinal brush border, guanylyl cyclase type C (GC-C). Intracellular cGMP is elevated, inducing increase in chloride efflux and subsequent accumulation of fluid in the intestinal lumen. We have screened a library of compounds and identified a pyridopyrimidine derivatives {5-(3-bromophenyl)-1,3-dimethyl-5,11-dihydro-1H-indeno[2',1':5,6]pyrido[2,3-d]pyrimidine-2,4,6-trione; BPIPP} as an inhibitor of GC-C that can suppress STa-stimulated cGMP accumulation by decreasing GC-C activation in intact T84 human colorectal carcinoma cells. BPIPP inhibited stimulation of guanylyl cyclases, including types A and B and soluble isoform in various cells. BPIPP suppressed stimulation of adenylyl cyclase and significantly decreased the activities of adenylyl cyclase toxin of Bordetella pertussis and edema toxin of Bacillus anthracis. The effects of BPIPP on cyclic nucleotide synthesis were observed only in intact cells. The mechanism of BPIPP-dependent inhibition appears to be complex and indirect, possibly associated with phospholipase C and tyrosine-specific phosphorylation. BPIPP inhibited chloride-ion transport stimulated by activation of guanylyl or adenylyl cyclases and suppressed STa-induced fluid accumulation in an in vivo rabbit intestinal loop model. Thus, BPIPP may be a promising lead compound for treatment of diarrhea and other diseases.

  18. Functionalized imidazolium and benzimidazolium salts as paraoxonase 1 inhibitors: Synthesis, characterization and molecular docking studies.

    PubMed

    Karataş, Mert Olgun; Uslu, Harun; Alıcı, Bülent; Gökçe, Başak; Gencer, Nahit; Arslan, Oktay; Arslan, N Burcu; Özdemir, Namık

    2016-03-15

    Paraoxonase (PON) is a key enzyme in metabolism of living organisms and decreased activity of PON1 was acknowledged as a risk for atherosclerosis and organophosphate toxicity. The present study describes the synthesis, characterization, PON1 inhibitory properties and molecular docking studies of functionalized imidazolium and benzimidazolium salts (1a-5g). The structures of all compounds were elucidated by IR, NMR, elemental analysis and structures of compounds 2b and 2c were characterized by single-crystal X-ray diffraction. Compound 1c, a coumarin substituted imidazolium salt showed the best inhibitory effect on the activity of PON1 with good IC50 value (6.37 μM). Kinetic investigation was evaluated for this compound and results showed that this compound is competitive inhibitor of PON1 with Ki value of 2.39 μM. Molecular docking studies were also performed for most active compound 1c and one of least active compound 2c in order to determine the probable binding model into active site of PON1 and validation of the experimental results. PMID:26879855

  19. Design, Synthesis, and Evaluation of Acrylamide Derivatives as Direct NLRP3 Inflammasome Inhibitors.

    PubMed

    Cocco, Mattia; Miglio, Gianluca; Giorgis, Marta; Garella, Davide; Marini, Elisabetta; Costale, Annalisa; Regazzoni, Luca; Vistoli, Giulio; Orioli, Marica; Massulaha-Ahmed, Raïhane; Détraz-Durieux, Isabelle; Groslambert, Marine; Py, Bénédicte F; Bertinaria, Massimo

    2016-08-19

    NLRP3 inflammasome plays a key role in the intracellular activation of caspase-1, processing of pro-inflammatory interleukin-1β (IL-1β), and pyroptotic cell death cascade. The overactivation of NLRP3 is implicated in the pathogenesis of autoinflammatory diseases, known as cryopyrin-associated periodic syndromes (CAPS), and in the progression of several diseases, such as atherosclerosis, type-2 diabetes, gout, and Alzheimer's disease. In this study, the synthesis of acrylamide derivatives and their pharmaco-toxicological evaluation as potential inhibitors of NLRP3-dependent events was undertaken. Five hits were identified and evaluated for their efficiency in inhibiting IL-1β release from different macrophage subtypes, including CAPS mutant macrophages. The most attractive hits were tested for their ability to inhibit NLRP3 ATPase activity on human recombinant NLRP3. This screening allowed the identification of 14, 2-(2-chlorobenzyl)-N-(4-sulfamoylphenethyl)acrylamide, which was able to concentration-dependently inhibit NLRP3 ATPase with an IC50 value of 74 μm. The putative binding pose of 14 in the ATPase domain of NLRP3 was also proposed. PMID:26990578

  20. Synthesis and Pharmacokinetic Evaluation of Siderophore Biosynthesis Inhibitors for Mycobacterium tuberculosis

    PubMed Central

    Nelson, Kathryn M.; Viswanathan, Kishore; Dawadi, Surendra; Duckworth, Benjamin P.; Boshoff, Helena I.; Barry, Clifton E.; Aldrich, Courtney C.

    2015-01-01

    MbtA catalyzes the first committed biosynthetic step of the mycobactins, which are important virulence factors associated with iron acquisition in Mycobacterium tuberculosis. MbtA is a validated therapeutic target for antitubercular drug development. 5′-O-[N-(salicyl)sulfamoyl]adenosine (1) is a bisubstrate inhibitor of MbtA and exhibits exceptionally potent biochemical and antitubercular activity. However, 1 suffers from sub-optimal drug disposition properties resulting in a short half-life (t1/2), low exposure (AUC), and low bioavailability (F). Four strategies were pursued to address these liabilities including the synthesis of prodrugs, increasing the pKa of the acyl-sulfonyl moiety, modulation of the lipophilicity, and strategic introduction of fluorine into 1. Complete pharmacokinetic (PK) analysis of all compounds was performed. The most successful modifications involved fluorination of the nucleoside that provided substantial improvements in t1/2 and AUC. Increasing the pKa of the acyl-sulfonyl linker yielded incremental enhancements while modulation of the lipophilicity and prodrug approaches led to substantially poorer PK parameters. PMID:26110337

  1. Synthesis and activity of benzimidazole-1,3-dioxide inhibitors of separase.

    PubMed

    Do, Ha T; Zhang, Nenggang; Pati, Debananda; Gilbertson, Scott R

    2016-09-15

    Due to the oncogenic activity of cohesin protease, separase in human cancer cells, modulation of separase enzymatic activity could constitute a new therapeutic strategy for targeting resistant, separase-overexpressing aneuploid tumors. Herein, we report the synthesis, structural information, and structure-activity relationship (SAR) of separase inhibitors based on modification of the lead molecule 2,2-dimethyl-5-nitro-2H-benzimidazole-1,3-dioxide, named Sepin-1, (1) identified from a high-throughput-screen. Replacement of -NO2 at C5 with other functional groups reduce the inhibitory activity in separase enzymatic assay. Substitution of the two methyl groups with other alkyl chains at the C2 moderately improves the effects on the inhibitory activity of those compounds. Modifications on 2H-benzimidazole-1,3-dioxide or the skeleton have variable effect on inhibition of separase enzymatic activity. Density-functional theory (DFT) calculations suggest there may be a correlation between the charges on the oxide moieties on these compounds and their activity in inhibiting separase enzyme. PMID:27530289

  2. Evaluation of Two Formulated Chitin Synthesis Inhibitors, Hexaflumuron and Lufenuron Against the Raisin Moth, Ephestia figulilella

    PubMed Central

    Khajepour, Simin; Izadi, Hamzeh; Asari, Mohammad Javad

    2012-01-01

    The raisin moth, Ephestia figulilella Gregson (Lepidoptera: Pyralidae), has a nearly cosmopolitan distribution, and causes severe quantitative and qualitative losses throughout the world. The larvae attack various drying and dried fruits, fallen figs, and damaged or moldy clusters of grapes on vines. Control of this pest in storage depends mostly on synthetic pesticides with several adverse side effects. To mitigate the adverse effects of these pesticides, investigations have focused on the development of compounds with more selectivity, and short residual life. In this research, insecticidal effects of two chitin synthesis inhibitors, hexaflumuron and lufenuron, were investigated against E. figulilella. Graded concentrations of each pesticide were prepared with distilled water. One-day-old fifth instar were sprayed by Potter's precision spray tower. Application of hexaflumuron and lufenuron on last instar larvae of E. figulilella caused not only mortality in larval stage, but also caused defects in pupal and adult stages. Larval mortality increased as concentration increased. The longevity of the fifth instars in both hexaflumuron and lufenuron treatments, in comparison with the controls, increased by more than 12 days. The longevity of adults decreased by about 10 days. Probit analysis data revealed that the sensitivity of the test insect to hexaflumuron (EC50 = 95.38 ppm) was greater than lufenuron (EC50= 379.21 ppm). PMID:23425138

  3. Evaluation of two formulated chitin synthesis inhibitors, hexaflumuron and lufenuron against the raisin moth, Ephestia figulilella.

    PubMed

    Khajepour, Simin; Izadi, Hamzeh; Asari, Mohammad Javad

    2012-01-01

    The raisin moth, Ephestia figulilella Gregson (Lepidoptera: Pyralidae), has a nearly cosmopolitan distribution, and causes severe quantitative and qualitative losses throughout the world. The larvae attack various drying and dried fruits, fallen figs, and damaged or moldy clusters of grapes on vines. Control of this pest in storage depends mostly on synthetic pesticides with several adverse side effects. To mitigate the adverse effects of these pesticides, investigations have focused on the development of compounds with more selectivity, and short residual life. In this research, insecticidal effects of two chitin synthesis inhibitors, hexaflumuron and lufenuron, were investigated against E. figulilella. Graded concentrations of each pesticide were prepared with distilled water. One-day-old fifth instar were sprayed by Potter's precision spray tower. Application of hexaflumuron and lufenuron on last instar larvae of E. figulilella caused not only mortality in larval stage, but also caused defects in pupal and adult stages. Larval mortality increased as concentration increased. The longevity of the fifth instars in both hexaflumuron and lufenuron treatments, in comparison with the controls, increased by more than 12 days. The longevity of adults decreased by about 10 days. Probit analysis data revealed that the sensitivity of the test insect to hexaflumuron (EC(50) = 95.38 ppm) was greater than lufenuron (EC(50)= 379.21 ppm). PMID:23425138

  4. Disruption of reproductive activity of Coptotermes formosanus (Isoptera: Rhinotermitidae) primary reproductives by three chitin synthesis inhibitors.

    PubMed

    Rojas, M Guadalupe; Morales-Ramos, Juan A

    2004-12-01

    Effects of the chitin synthesis inhibitors (CSIs) diflubenzuron, hexaflumuron, and lufenuron on the Formosan subterranean termite, Coptotermes formosanus Shiraki, primary reproductives were studied in the laboratory. Incipient colonies were established by collecting and pairing C. formosanus alates and placing them in dishes containing an artificial diet. Three groups of 56 colonies each were fed with a diet containing 10 ppm of one of each of the CSIs and were compared with a control group fed with an untreated diet. All eggs oviposited by treated young queens failed to hatch at the end of 6 mo. Estimated queen fecundity was significantly lower in the lufenuron treatment compared with the control group. Fecundity of hexaflumuron-treated queens did not differ significantly from that of queens from the control group and the other treatments. Adult mortality was significantly higher in the diflubenzuron and lufenuron treatments than in the control group at the end of 6 mo., but not in the hexaflumuron treatment. All the pairs died within 8 mo. in the diflubenzuron and lufenuron treatments, even after treatment was suspended at the end of 6 mo. Mortality in the hexaflumuron treatment was significantly higher than in the control group by the end of 9 mo. The three CSIs tested eliminated reproduction in C. formosanus by preventing egg hatching and induced adult mortality. Possible mechanisms by which CSIs induce termite adult death are discussed. PMID:15666759

  5. Regioselective Synthesis of a Family of β‐Lactams Bearing a Triazole Moiety as Potential Apoptosis Inhibitors

    PubMed Central

    Garrido, Maria; Corredor, Miriam; Orzáez, Mar; Alfonso, Ignacio

    2016-01-01

    Abstract Apoptosis is a biological process important to several human diseases; it is strongly regulated through protein–protein interactions and complex formation. We previously reported the synthesis of apoptosis inhibitors bearing an exocyclic triazole amide isoster by using an Ugi four‐component coupling reaction (Ugi‐4CC), followed by a base‐promoted intramolecular cyclization. Depending on the substitution patterns and the reaction conditions, this cyclization forms the six‐ or four‐membered ring. Two compounds bearing the β‐lactam scaffold turned out to be the most potent inhibitors. This encouraged us to optimize the modulation of the cyclization, and prepare a library of 15 β‐lactams with total regioselectivity. Moreover, we aimed to improve the bioavailability of these compounds through the introduction of diversity at different substitution positions. The activity of these compounds as apoptosis inhibitors in cellular extracts has been evaluated, showing an increase in their potency. PMID:27777842

  6. Serum albumin and α-1 acid glycoprotein impede the killing of Schistosoma mansoni by the tyrosine kinase inhibitor Imatinib

    PubMed Central

    Beckmann, Svenja; Long, Thavy; Scheld, Christina; Geyer, Rudolf; Caffrey, Conor R.; Grevelding, Christoph G.

    2014-01-01

    In the search for new drugs and drug targets to treat the flatworm disease schistosomiasis, protein kinases (PKs) have come under particular scrutiny because of their essential roles in developmental and physiological processes in schistosome parasites. In this context the application of the anti-cancer Abl tyrosine kinase (TK) inhibitor Imatinib (Gleevec/Glivec; STI-571) to adult Schistosoma mansoni in vitro has indicated negative effects on diverse physiological processes including survival. Motivated by these in vitro findings, we performed in vivo experiments in rodent models of S. mansoni infection. Unexpectedly, Imatinib had no effect on worm burden or egg-production. We found that the blood components serum albumin (SA) and alpha-1 acid glycoprotein (AGP or orosomucoid) negated Imatinib’s deleterious effects on adult S. mansoni and schistosomula (post-infective larvae) in vitro. This negative effect was partially reversed by erythromycin. AGP synthesis can increase as a consequence of inflammatory processes or infection; in addition upon infection AGP levels are 6–8 times higher in mice compared to humans. Therefore, mice and probably other rodents are poor infection models for measuring the effects of Imatinib in vivo. Accordingly, we suggest the routine evaluation of the ability of AGP and SA to block in vitro anti-schistosomal effects of small molecules like Imatinib prior to laborious and expensive animal experiments. PMID:25516839

  7. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  8. Screening of plants used by Southern African traditional healers in the treatment of dysmenorrhoea for prostaglandin-synthesis inhibitors and uterine relaxing activity.

    PubMed

    Lindsey, K; Jäger, A K; Raidoo, D M; van Staden, J

    1999-01-01

    Plants used by Southern African traditional healers for the treatment of menstrual pains were screened for prostaglandin-synthesis inhibitors and the ability to reduce isolated uterine muscle contraction using the cyclooxygenase and in vitro uterine bioassays respectively. Prostaglandins are synthesized from arachidonic acid and the enzyme that drives this reaction is cyclooxygenase. The excessive production of prostaglandins by the myometrium and endometrium induces uterine contractions. Inhibition of cyclooxygenase and hence of the prostaglandin biosynthetic pathway may lead to relief of menstrual pain. Ten plants used by traditional healers for menstrual pains were assayed for cyclooxygenase inhibitory activity. Several plant extracts exhibited high inhibitory activity in the assay. The highest activities were obtained with ethanolic extracts of Siphonochilus aethiopicus, Cenchrus ciliaris and Solanum mauritianum. Generally ethanolic extracts gave higher activity than the aqueous extracts. None of the ethanolic plant extracts were able to relax or reduce the contractions of the precontracted guinea pig uterus. PMID:10075117

  9. Design, synthesis and evaluation of N-aryl-glyoxamide derivatives as structurally novel bacterial quorum sensing inhibitors.

    PubMed

    Nizalapur, Shashidhar; Kimyon, Önder; Biswas, Nripendra Nath; Gardner, Christopher R; Griffith, Renate; Rice, Scott A; Manefield, Mike; Willcox, Mark; Black, David StC; Kumar, Naresh

    2016-01-14

    Bacteria cooperatively regulate the expression of many phenotypes through a mechanism called quorum sensing (QS). Many Gram-negative bacteria use an N-acyl homoserine lactone (AHL)-mediated QS system to control biofilm formation and virulence factor production. In recent years, quorum sensing inhibitors (QSIs) have become attractive tools to overcome antimicrobial resistance exhibited by various pathogenic bacteria. In the present study, we report the design and synthesis of novel N-arylisatin-based glyoxamide derivatives via the ring-opening reaction of N-aryl isatins with cyclic and acylic amines, and amino acid esters. The QSI activity of the synthesized compounds was determined in the LasR-expressing Pseudomonas aeruginosa MH602 and LuxR-expressing Escherichia coli MT102 reporter strains. Compounds 31 and 32 exhibited the greatest QSI activity in P. aeruginosa MH602, with 48.7% and 42.7% reduction in QS activity at 250 μM, respectively, while compounds 31 and 34 showed 73.6% and 43.7% QSI activity in E. coli MT102. In addition, the ability of these compounds to inhibit the production of pyocyanin in P. aeruginosa (PA14) was also determined, with compound 28 showing 47% inhibition at 250 μM. Furthermore, computational docking studies were performed on the LasR receptor protein of P. aeruginosa, which showed that formation of a hydrogen bonding network played a major role in influencing the QS inhibitory activity. We envisage that these novel non-AHL glyoxamide derivatives could become a new tool for the study of QS and potentially for the treatment of bacterial infections.

  10. Structure-based Design of Potent HIV-1 Protease Inhibitors with Modified P1 - Biphenyl Ligands: Synthesis, Biological Evaluation, and Enzyme-inhibitor X-ray Structural studies

    PubMed Central

    Ghosh, Arun K.; Yu, Xufen; Osswald, Heather L.; Agniswamy, Johnson; Wang, Yuan-Fang; Amano, Masayuki; Weber, Irene T.; Mitsuya, Hiroaki

    2016-01-01

    We report the design, synthesis, X-ray structural studies, and biological evaluation of a novel series of HIV-1 protease inhibitors. We designed a variety of functionalized biphenyl derivatives to make enhanced van der Waals interactions in the S1 subsite of HIV-1 protease. These biphenyl derivatives were conveniently synthesized using a Suzuki-Miyaura cross-coupling reaction as the key step. We examined the potential of these functionalized biphenyl-derived P1 ligands in combination with 3-(S)-tetrahydrofuranyl urethane and bis-tetrahydrofuranyl urethane as the P2 ligands. Inhibitor 21e, with a 2-methoxy-1, 1’-biphenyl derivative as P1 ligand and bis-THF as the P2 ligand, displayed the most potent enzyme inhibitory and antiviral activity. This inhibitor also exhibited potent activity against a panel of multidrug-resistant HIV-1 variants. A high resolution X-ray crystal structure of related Boc-derivative 17a-bound HIV-1 protease provided important molecular insight into the ligand-binding site interactions of the biphenyl core in the S1 subsite of HIV-1 protease. PMID:26107245

  11. Benzimidazole as corrosion inhibitor for heat treated 6061 Al- SiCp composite in acetic acid

    NASA Astrophysics Data System (ADS)

    Chacko, Melby; Nayak, Jagannath

    2015-06-01

    6061 Al-SiCpcomposite was solutionizedat 350 °C for 30 minutes and water quenched. It was then underaged at 140 °C (T6 treatment). The aging behaviour of the composite was studied using Rockwell B hardness measurement. Corrosion behaviour of the underaged sample was studied in different concentrations of acetic acid and at different temperatures. Benzimidazole at different concentrations was used for the inhibition studies. Inhibition efficiency of benzimidazole was calculated for different experimental conditions. Thermodynamic parameters were found out which suggested benzimidazole is an efficient inhibitor and it adsorbed on to the surface of composite by mixed adsorption where chemisorption is predominant.

  12. Synthesis and optimization of thiadiazole derivatives as a novel class of substrate competitive c-Jun N-terminal kinase inhibitors

    PubMed Central

    De, Surya K.; Chen, Vida; Stebbins, John L.; Chen, Li-Hsing; Cellitti, Jason F.; Machleidt, Thomas; Barile, Elisa; Riel-Mehan, Megan; Dahl, Russell; Yang, Li; Emdadi, Aras; Murphy, Ria; Pellecchia, Maurizio

    2009-01-01

    A series of thiadiazole derivatives has been designed as potential allosteric, substrate competitive inhibitors of the protein kinase JNK. We report on the synthesis, characterization and evaluation of a series of compounds that resulted in the identification of potent and selective JNK inhibitors targeting its JIP-1 docking site. PMID:20045647

  13. Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria1[OPEN

    PubMed Central

    Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.

    2016-01-01

    Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016

  14. Post-session injections of a protein synthesis inhibitor, cycloheximide do not alter saccharin self-administration.

    PubMed

    Mierzejewski, Pawel; Korkosz, Agnieszka; Rogowski, Artur; Korkosz, Izabela; Kostowski, Wojciech; Scinska, Anna

    2009-03-17

    A large body of evidence indicates that reactivation of aversive memories leads to protein synthesis-dependent memory reconsolidation which can be disrupted by cycloheximide (CHX) and other protein synthesis inhibitors. The aim of the present study was to investigate whether CHX would alter maintenance of well-trained instrumental responding for 0.1% saccharin. Male Wistar rats were trained to lever press for saccharin. When lever pressing stabilized, experimental self-administration sessions with CHX (3 mg/kg, s.c.) started. The animals received four experimental sessions, with each session separated by 5 days. The protein synthesis inhibitor was injected immediately after the experimental sessions 1-3. Repeated post-session injections of CHX did not alter saccharin self-administration. A two-bottle choice test conducted after the last experimental session revealed that CHX had not induced any conditioned taste aversion to 0.1% saccharin. The present results suggest that well-consolidated long-term memory of an appetitive instrumental task does not depend on de novo protein synthesis.

  15. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  16. Synthesis of a 10,000-membered library of molecules resembling carpanone and discovery of vesicular traffic inhibitors.

    PubMed

    Goess, Brian C; Hannoush, Rami N; Chan, Lawrence K; Kirchhausen, Tomas; Shair, Matthew D

    2006-04-26

    Split-and-pool synthesis of a 10,000-membered library of molecules resembling the natural product carpanone has been achieved. The synthesis features development of solid-phase multicomponent reactions between nitrogen nucleophiles, enones, and hydroxylamines, and a solid-phase application of the Huisgen cycloaddition affording substituted triazoles. The synthesis was performed in high-capacity (500 microm) polystyrene beads using a one bead-one stock solution strategy that enabled phenotypic screens of the resulting library. Using whole-cell fluorescence imaging, we discovered a series of molecules from the carpanone-based library that inhibit exocytosis from the Golgi apparatus. The most potent member of this series has an IC(50) of 14 microM. We also report structure-activity relationships for the molecules exhibiting this interesting phenotype. These inhibitors of exocytosis may be useful reagents for the study of vesicular traffic. PMID:16620111

  17. Sterculic Acid and Its Analogues Are Potent Inhibitors of Toxoplasma gondii

    PubMed Central

    Hao, Pan; Alaraj, Intisar Q. M.; Dulayymi, Juma’a R. Al; Baird, Mark S.; Liu, Jing; Liu, Qun

    2016-01-01

    Toxoplasmosis is a serious disease caused by Toxoplasma gondii, one of the most widespread parasites in the world. Lipid metabolism is important in the intracellular stage of T. gondii. Stearoyl-CoA desaturase (SCD), a key enzyme for the synthesis of unsaturated fatty acid is predicted to exist in T. gondii. Sterculic acid has been shown to specifically inhibit SCD activity. Here, we examined whether sterculic acid and its methyl ester analogues exhibit anti-T. gondii effects in vitro. T. gondii-infected Vero cells were disintegrated at 36 hr because of the propagation and egress of intracellular tachyzoites. All test compounds inhibited tachyzoite propagation and egress, reducing the number of ruptured Vero cells by the parasites. Sterculic acid and the methyl esters also inhibited replication of intracellular tachyzoites in HFF cells. Among the test compounds, sterculic acid showed the most potent activity against T. gondii, with an EC50 value of 36.2 μM, compared with EC50 values of 248-428 μM for the methyl esters. Our study demonstrated that sterculic acid and its analogues are effective in inhibition of T. gondii growth in vitro, suggesting that these compounds or analogues targeting SCD could be effective agents for the treatment of toxoplasmosis. PMID:27180571

  18. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  19. New stabilized FastPrep-CLEAs for sialic acid synthesis.

    PubMed

    García-García, María Inmaculada; Sola-Carvajal, Agustín; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2011-05-01

    N-acetyl-D-neuraminic acid aldolase, a key enzyme in the biotechnological production of N-acetyl-D-neuraminic acid (sialic acid) from N-acetyl-D-mannosamine and pyruvate, was immobilized as cross-linked enzyme aggregates (CLEAs) by precipitation with 90% ammonium sulfate and crosslinking with 1% glutaraldehyde. Because dispersion in a reciprocating disruptor (FastPrep) was only able to recover 40% of the activity, improved CLEAs were then prepared by co-aggregation of the enzyme with 10mg/mL bovine serum albumin followed by a sodium borohydride treatment and final disruption by FastPrep (FastPrep-CLEAs). This produced a twofold increase in activity up to 86%, which is a 30% more than that reported for this aldolase in cross-linked inclusion bodies (CLIBs). In addition, these FastPrep-CLEAs presented remarkable biotechnological features for Neu5Ac synthesis, including, good activity and stability at alkaline pHs, a high K(M) for ManNAc (lower for pyruvate) and good operational stability. These results reinforce the practicability of using FastPrep-CLEAs in biocatalysis, thus reducing production costs and favoring reusability.

  20. Potent acetylcholinesterase inhibitors: Synthesis, biological assay and docking study of nitro acridone derivatives.

    PubMed

    Parveen, Mehtab; Aslam, Afroz; Nami, Shahab A A; Malla, Ali Mohammed; Alam, Mahboob; Lee, Dong-Ung; Rehman, Sumbul; Silva, P S Pereira; Silva, M Ramos

    2016-08-01

    The reaction of o-halobenzoic acid with aniline derivatives and their subsequent cyclization reaction yielded the acridone derivatives. The series of nitro acridone derivatives were prepared by Ullmann condensation in presence of copper as catalyst and were characterized by FTIR, (1)H, (13)C NMR and mass spectra. The structure of 5-nitro-(2-phenyl amino) benzoic acid (4) was confirmed by X-ray crystallography and was found to crystallize in P21/c space group. The in vitro efficacy of the compounds for their acetylcholinesterase (AChE) and antimicrobial inhibitory activities have been evaluated against the standard drugs Ampicillin and Gentamicin against Gram positive and Gram negative bacteria. 1,7-Dinitroacridone was found to be the most potent AChE inhibitor (IC50=0.22μM). Moreover, the compounds have been screened for their antioxidant activity using the DPPH assay. Also, docking study results were found to be in good agreement with the results obtained through in vitro experiments. The docking study further predicted possible binding conformation. PMID:27295412