Science.gov

Sample records for acid synthesis inhibitor

  1. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  2. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  3. Total synthesis of the squalene synthase inhibitor zaragozic acid C.

    PubMed

    Nakamura, Seiichi

    2005-01-01

    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219

  4. [The clinical evaluation of the hypocholesterolemic effects of an inhibitor of cholesterol synthesis: mevalonic acid].

    PubMed

    Del Nero, E; Aloe, N; Augeri, C; Avola, F; Carta, G; Cavagnaro, A; De Grandi, R; Gianfreda, M; Magro, G P; Mazzarello, G P

    1992-07-01

    Twenty eight patients with heterozygous familial hypercholesterolemia were treated with mevalonic acid (an inhibitor of cholesterol synthesis) for 45 days. Patients received a daily dose of 750 to 1500 mg mevalonic acid depending on plasma cholesterol levels. Results showed a significant reduction in cholesterol values whereas no significant difference was observed in HDL cholesterol and triglyceride levels. PMID:1505176

  5. Synthesis of potent inhibitors of anthrax toxin based on poly-L-glutamic acid.

    PubMed

    Joshi, Amit; Saraph, Arundhati; Poon, Vincent; Mogridge, Jeremy; Kane, Ravi S

    2006-01-01

    We report the synthesis of biodegradable polyvalent inhibitors of anthrax toxin based on poly-L-glutamic acid (PLGA). These biocompatible polyvalent inhibitors are at least 4 orders of magnitude more potent than the corresponding monovalent peptides in vitro and are comparable in potency to polyacrylamide-based inhibitors of anthrax toxin assembly. We have elucidated the influence of peptide density on inhibitory potency and demonstrated that these inhibitory potencies are limited by kinetics, with even higher activities seen when the inhibitors are preincubated with the heptameric receptor-binding subunit of anthrax toxin prior to exposure to cells. These polyvalent inhibitors are also effective at neutralizing anthrax toxin in vivo and represent attractive leads for designing biocompatible anthrax therapeutics. PMID:16984137

  6. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  7. Synthesis of 4-substituted nipecotic acid derivatives and their evaluation as potential GABA uptake inhibitors.

    PubMed

    Hellenbrand, Tim; Höfner, Georg; Wein, Thomas; Wanner, Klaus T

    2016-05-01

    In this study, we disclose the design and synthesis of novel 4-susbtituted nipecotic acid derivatives as inhibitors of the GABA transporter mGAT1. Based on molecular modeling studies the compounds are assumed to adopt a binding pose similar to that of the potent mGAT1 inhibitor nipecotic acid. As substitution in 4-position should not cause an energetically unfavorable orientation of nipecotic acid as it is the case for N-substituted derivatives this is expected to lead to highly potent binders. For the synthesis of novel 4-substituted nipecotic acid derivatives a linear synthetic strategy was employed. As a key step, palladium catalyzed cross coupling reactions were used to attach the required biaryl moieties to the ω-position of the alkenyl- or alkynyl spacers of varying length in the 4-position of the nipecotic acid scaffold. The resulting amino acids were characterized with respect to their binding affinities and inhibitory potencies at mGAT1. Though the biological activities found were generally insignificant to poor, two compounds, one of which possesses a reasonable binding affinity for mGAT1, rac-57, the other a notable inhibitory potency at mGAT4, rac-84, both displaying a slight subtype selectivity for the individual transporters, could be identified. PMID:27039250

  8. Synthesis and characterization of phosphocitric acid, a potent inhibitor of hydroxylapatite crystal growth.

    PubMed

    Tew, W P; Mahle, C; Benavides, J; Howard, J E; Lehninger, A L

    1980-04-29

    Human urine and extracts of rat liver mitochondria contain apparently identical agents capable of inhibiting the precipitation or crystallization of calcium phosphate. Its general properties, as well as 1H NMR and mass spectra, have suggested that the agent is phosphocitric acid. This paper reports the synthesis of phosphocitric acid via the phosphorylation of triethyl citrate with o-phenylene phosphochloridate, hydrogenolysis of the product to yield triethyl phosphocitrate, hydrolytic removal of the blocking ethyl groups and also chromatographic purification. An enzymatic assay of phosphocitrate is described. Synthetic phosphocitrate was found to be an exceedingly potent inhibitor of the growth of hydroxylapatite seed crystals in a medium supersaturated with respect to Ca2+ and phosphate. Comparative assays showed phosphocitrate to be much more potent than the most active precipitation-crystallization inhibitors previously reported, which include pyrophosphate and ATP. 14C-Labeled phosphocitrate was bound very tightly to hydroxylapatite crystals. Such binding appeared to be essential for its inhibitory activity on crystal growth. Citrate added before but not after, phosphocitrate greatly enhanced the inhibitory potency of the latter. This enhancement effect was not given by other tricarboxylic acids. The monoethyl ester of phosphocitrate had no inhibitory effect on hydroxylapatite crystal growth. PMID:7378389

  9. Synthesis and biological evaluation of enantiomerically pure glyceric acid derivatives as LpxC inhibitors.

    PubMed

    Tangherlini, Giovanni; Torregrossa, Tullio; Agoglitta, Oriana; Köhler, Jens; Melesina, Jelena; Sippl, Wolfgang; Holl, Ralph

    2016-03-01

    Inhibitors of the UDP-3-O-[(R)-3-hydroxymyristoyl]-N-acetylglucosamine deacetylase (LpxC) represent a promising class of novel antibiotics, selectively combating Gram-negative bacteria. In order to elucidate the impact of the hydroxymethyl groups of diol (S,S)-4 on the inhibitory activity against LpxC, glyceric acid ethers (R)-7a, (S)-7a, (R)-7b, and (S)-7b, lacking the hydroxymethyl group in benzylic position, were synthesized. The compounds were obtained in enantiomerically pure form by a chiral pool synthesis and a lipase-catalyzed enantioselective desymmetrization, respectively. The enantiomeric hydroxamic acids (R)-7b (Ki=230nM) and (S)-7b (Ki=390nM) show promising enzyme inhibition. However, their inhibitory activities do not substantially differ from each other leading to a low eudismic ratio. Generally, the synthesized glyceric acid derivatives 7 show antibacterial activities against two Escherichia coli strains exceeding the ones of their respective regioisomes 6. PMID:26827141

  10. Synthesis, docking, and biological studies of phenanthrene β-diketo acids as novel HIV-1 integrase inhibitors

    PubMed Central

    Sharma, Horrick; Sanchez, Tino W.; Neamati, Nouri; Detorio, Mervi; Schinazi, Raymond F.; Cheng, Xiaolin; Buolamwini, John K.

    2013-01-01

    In the present study we report the synthesis of halogen-substituted phenanthrene β-diketo acids as new HIV-1 integrase inhibitors. The target phenanthrenes were obtained using both standard thermal- and microwave-assisted synthesis. 4-(6-Chlorophenanthren-2-yl)-2,4-dioxobutanoic acid (18) was the most active compound of the series that inhibited both 3′-end processing (3′-P) and strand transfer (ST) with IC50 values of 5 and 1.3 μM, respectively. Docking studies revealed two predominant binding modes that were distinct from the binding modes of raltegravir and elvitegravir, and suggest a novel binding region in the IN active site. Moreover, these compounds do not interact significantly with some of the key amino acids (Q148 and N155) implicated in viral resistance. Therefore, this series of compounds can further be investigated for a possible chemotype to circumvent resistance to clinical HIV-1 IN inhibitors. PMID:24091080

  11. Synthesis of all stereoisomers of 3-hydroxypipecolic acid and 3-hydroxy-4,5-dehydropipecolic acid and their evaluation as glycosidase inhibitors.

    PubMed

    Ohara, Chiaki; Takahashi, Ryouko; Miyagawa, Tatsunori; Yoshimura, Yuichi; Kato, Atsushi; Adachi, Isao; Takahata, Hiroki

    2008-03-15

    A highly practicable synthesis of both enantiomers of 3-hydroxypipecolic acid derivatives 1, 2, 3, 4 is described. Screening of these molecules for glycosidase inhibition has been examined. Compound 3 was shown to be a potent inhibitor of beta-N-acetylglucosaminidase as well as Escherichia coli beta-glucuronidase. PMID:18296050

  12. Induction of α-Amylase Inhibitor Synthesis in Barley Embryos and Young Seedlings by Abscisic Acid and Dehydration Stress 1

    PubMed Central

    Robertson, Masumi; Walker-Simmons, M.; Munro, Doug; Hill, Robert D.

    1989-01-01

    An endogenous α-amylase inhibitor was found to be synthesized in embryos of developing barley grain (Hordeum vulgare cv Bonanza). Accumulation of this protein occurred late in development (stage IV), at the same time that endogenous abscisic acid (ABA) showed a large increase. The inhibitor could be induced up to 23-fold in isolated immature embryos (stage III) by culture in ABA. Precocious germination was also blocked in stage III embryos by ABA. Dehydration stress on the isolated immature embryos also induced higher levels of the inhibitor and ABA. An even greater response to dehydration stress was observed in young seedlings, where inhibitor content increased 20-fold and ABA increased 80-fold during water stress. The high degree of correlation between ABA and inhibitor contents in in situ embryos, dehydrated embryos and young seedlings, as well as the increase in inhibitor caused by exogenously applied ABA to isolated embryos, suggests that increased α-amylase inhibitor synthesis in response to dehydration stress is mediated by ABA. PMID:16667035

  13. Self-consistent synthesis of the squalene synthase inhibitor zaragozic acid C via controlled oligomerization.

    PubMed

    Nicewicz, David A; Satterfield, Andrew D; Schmitt, Daniel C; Johnson, Jeffrey S

    2008-12-24

    Despite the prevalence of repeating subunits in chiral natural products, stereocontrolled oligomerization is a largely unexplored strategy for construction of carbon skeletal frameworks. This report describes the use of silyl glyoxylates as dipolar glycolic acid synthons in a controlled oligomerization reaction for the efficient construction of the squalene synthase inhibitor zaragozic acid C. This new methodology allows rapid, stereocontrolled formation of the carbon skeleton with a desirable protecting group scheme while minimizing functional group repair and oxidation state manipulations. PMID:19053214

  14. Benzoxazolone Carboxamides as Potent Acid Ceramidase Inhibitors: Synthesis and Structure-Activity Relationship (SAR) Studies.

    PubMed

    Bach, Anders; Pizzirani, Daniela; Realini, Natalia; Vozella, Valentina; Russo, Debora; Penna, Ilaria; Melzig, Laurin; Scarpelli, Rita; Piomelli, Daniele

    2015-12-10

    Ceramides are lipid-derived intracellular messengers involved in the control of senescence, inflammation, and apoptosis. The cysteine amidase, acid ceramidase (AC), hydrolyzes these substances into sphingosine and fatty acid and, by doing so, regulates their signaling activity. AC inhibitors may be useful in the treatment of pathological conditions, such as cancer, in which ceramide levels are abnormally reduced. Here, we present a systematic SAR investigation of the benzoxazolone carboxamides, a recently described class of AC inhibitors that display high potency and systemic activity in mice. We examined a diverse series of substitutions on both benzoxazolone ring and carboxamide side chain. Several modifications enhanced potency and stability, and one key compound with a balanced activity-stability profile (14) was found to inhibit AC activity in mouse lungs and cerebral cortex after systemic administration. The results expand our arsenal of AC inhibitors, thereby facilitating the use of these compounds as pharmacological tools and their potential development as drug leads. PMID:26560855

  15. Design and synthesis of inhibitors incorporating beta -amino acids of metalloendopeptidase EC 3.4.24.15.

    PubMed

    Steer, D L; Lew, R A; Perlmutter, P; Smith, A I; Aguilar, M I

    2000-09-01

    Endopeptidase EC 3.4.24.15 (EP 24.15) is a thermolysin-like metalloendopeptidase which is expressed widely throughout the body, with the highest concentrations in the brain, pituitary and testis. While the precise role of EP 24.15 remains unknown, it is thought to participate in the regulated metabolism of a number of specific neuropeptides. Of the limited number of inhibitors described for EP 24.15, N-[1-(R,S)-carboxy-3-phenylpropyl]-Ala-Ala-Tyr-p-amino benzoate (CFP) is the most widely studied. CFP is a potent and specific inhibitor, but is unstable in vivo due to its cleavage between the alanine and tyrosine residues by the enzyme neprilysin (EP 24.11). The cpp-Ala-Ala N-terminal product of this cleavage is a potent inhibitor of angiotensin converting enzyme, which further limits the use of CFP in vivo. To generate specific inhibitors of EP 24.15 that are resistant to in vivo proteolysis by EP 24.11, beta-amino acids have been incorporated into the structure of CFP. We have prepared racemic mixtures of beta-amino acids containing proteogenic side chains, which are 9-fluorenylmethoxycarbonyl (Fmoc)-protected, and several analogues of CFP containing beta-amino acids have been synthesized by solid phase peptide synthesis. The results of stability and inhibitory studies of these new analogues show that the incorporation of beta-amino acids adjacent to the scissile bond can indeed stabilize the peptides against cleavage by EP 24.11 and still inhibit EP 24.15. The results obtained in these studies demonstrate the potential of these amino acids in the synthesis of peptidomimetics and in the design of new stable and specific therapeutics. PMID:11016884

  16. How polyamine synthesis inhibitors and cinnamic acid affect tropane alkaloid production.

    PubMed

    Marconi, Patricia L; Alvarez, María A; Pitta-Alvarez, Sandra I

    2007-01-01

    Hairy roots of Brugmansia candida produce the tropane alkaloids scopolamine and hyoscyamine. In an attempt to divert the carbon flux from competing pathways and thus enhance productivity, the polyamine biosynthesis inhibitors cyclohexylamine (CHA) and methylglyoxal-bis-guanylhydrazone (MGBG) and the phenylalanine-ammonia-lyase inhibitor cinnamic acid were used. CHA decreased the specific productivity of both alkaloids but increased significantly the release of scopolamine (approx 500%) when it was added in the mid-exponential phase. However, when CHA was added for only 48 h during the exponential phase, the specific productivity of both alkaloids increased (approx 200%), favoring scopolamine. Treatment with MGBG was detrimental to growth but promoted release into the medium of both alkaloids. However, when it was added for 48 h during the exponential phase, MGBG increased the specific productivity (approx 200%) and release (250- 1800%) of both alkaloids. Cinnamic acid alone also favored release but not specific productivity. When a combination of CHA or MGBG with cinnamic acid was used, the results obtained were approximately the same as with each polyamine biosynthesis inhibitor alone, although to a lesser extent. Regarding root morphology, CHA inhibited growth of primary roots and ramification. However, it had a positive effect on elongation of lateral roots. PMID:17416978

  17. Novel 2-oxoimidazolidine-4-carboxylic acid derivatives as Hepatitis C virus NS3-4A serine protease inhibitors: synthesis, activity, and X-ray crystal structure of an enzyme inhibitor complex

    SciTech Connect

    Arasappan, Ashok; Njoroge, F. George; Parekh, Tejal N.; Yang, Xiaozheng; Pichardo, John; Butkiewicz, Nancy; Prongay, Andrew; Yao, Nanhua; Girijavallabhan, Viyyoor

    2008-06-30

    Synthesis and HCV NS3 serine protease inhibitory activity of some novel 2-oxoimidazolidine-4-carboxylic acid derivatives are reported. Inhibitors derived from this new P2 core exhibited activity in the low {micro}M range. X-ray structure of an inhibitor, 15c bound to the protease is presented.

  18. Search for novel histone deacetylase inhibitors. Part II: design and synthesis of novel isoferulic acid derivatives.

    PubMed

    Lu, Wen; Wang, Fang; Zhang, Tao; Dong, Jinyun; Gao, Hongping; Su, Ping; Shi, Yaling; Zhang, Jie

    2014-05-01

    Previously, we described the discovery of potent ferulic acid-based histone deacetylase inhibitors (HDACIs) with halogeno-acetanilide as novel surface recognition moiety (SRM). In order to improve the affinity and activity of these HDACIs, twenty seven isoferulic acid derivatives were described herein. The majority of title compounds displayed potent HDAC inhibitory activity. In particular, IF5 and IF6 exhibited significant enzymatic inhibitory activities, with IC50 values of 0.73 ± 0.08 and 0.57 ± 0.16 μM, respectively. Furthermore, these compounds showed moderate antiproliferative activity against human cancer cells. Especially, IF6 displayed promising profile as an antitumor candidate with IC50 value of 3.91 ± 0.97 μM against HeLa cells. The results indicated that these isoferulic acid derivatives could serve as promising lead compounds for further optimization. PMID:24702857

  19. Benzoylurea Chitin Synthesis Inhibitors.

    PubMed

    Sun, Ranfeng; Liu, Chunjuan; Zhang, Hao; Wang, Qingmin

    2015-08-12

    Benzoylurea chitin synthesis inhibitors are widely used in integrated pest management (IPM) and insecticide resistance management (IRM) programs due to their low toxicity to mammals and predatory insects. In the past decades, a large number of benzoylurea derivatives have been synthesized, and 15 benzoylurea chitin synthesis inhibitors have been commercialized. This review focuses on the history of commercial benzolyphenylureas (BPUs), synthetic methods, structure-activity relationships (SAR), action mechanism research, environmental behaviors, and ecotoxicology. Furthermore, their disadvantages of high risk to aquatic invertebrates and crustaceans are pointed out. Finally, we propose that the para-substituents at anilide of benzoylphenylureas should be the functional groups, and bipartite model BPU analogues are discussed in an attempt to provide new insight for future development of BPUs. PMID:26168369

  20. Synthesis of water soluble glycosides of pentacyclic dihydroxytriterpene carboxylic acids as inhibitors of α-glucosidase.

    PubMed

    Xu, Jiancong; Nie, Xuliang; Hong, Yanping; Jiang, Yan; Wu, Guoqiang; Yin, Xiaoli; Wang, Chunrong; Wang, Xiaoqiang

    2016-04-01

    A series of compounds were synthesized by glycosylation of maslinic acid (MA) and corosolic acid (CA) with monosaccharides and disaccharides, and the structures of the derivatives were elucidated by standard spectroscopic methods including (1)H NMR, (13)C NMR and HRMS. The α-glucosidase inhibitory activities of all the novel compounds were evaluated in vitro. The solubility and inhibitory activity of α-glucosidase assays showed that the bis-disaccharide glycosides of triterpene acids possessed higher water solubility and α-glucosidase inhibitory activities than the bis-monosaccharide glycosides. Among these compounds, maslinic acid bis-lactoside (8e, IC50 = 684 µM) and corosolic acid bis-lactoside (9e, IC50 = 428 µM) had the best water solubility, and 9e exhibited a better inhibitory activity than acarbose (IC50 = 478 µM). However, most of glycosylated derivatives possessed lower inhibitory activities than the parent compounds, although their water solubility was enhanced obviously. Moreover, the kinetic inhibition studies indicated that 9e was a non-competitive inhibitor, and structure-activity relationships of the derivatives are also discussed. PMID:26974355

  1. Design, synthesis and evaluation of semi-synthetic triazole-containing caffeic acid analogues as 5-lipoxygenase inhibitors.

    PubMed

    De Lucia, Daniela; Lucio, Oscar Méndez; Musio, Biagia; Bender, Andreas; Listing, Monika; Dennhardt, Sophie; Koeberle, Andreas; Garscha, Ulrike; Rizzo, Roberta; Manfredini, Stefano; Werz, Oliver; Ley, Steven V

    2015-08-28

    In this work the synthesis, structure-activity relationship (SAR) and biological evaluation of a novel series of triazole-containing 5-lipoxygenase (5-LO) inhibitors are described. The use of structure-guided drug design techniques provided compounds that demonstrated excellent 5-LO inhibition with IC50 of 0.2 and 3.2 μm in cell-based and cell-free assays, respectively. Optimization of binding and functional potencies resulted in the identification of compound 13d, which showed an enhanced activity compared to the parent bioactive compound caffeic acid 5 and the clinically approved zileuton 3. Compounds 15 and 16 were identified as lead compounds in inhibiting 5-LO products formation in neutrophils. Their interference with other targets on the arachidonic acid pathway was also assessed. Cytotoxicity tests were performed to exclude a relationship between cytotoxicity and the increased activity observed after structure optimization. PMID:26197161

  2. Design, synthesis, crystal structures and antimicrobial activity of sulfonamide boronic acids as β-lactamase inhibitors

    PubMed Central

    Eidam, Oliv; Romagnoli, Chiara; Caselli, Emilia; Babaoglu, Kerim; Pohlhaus, Denise Teotico; Karpiak, Joel; Bonnet, Richard; Shoichet, Brian K.; Prati, Fabio

    2010-01-01

    We investigated a series of sulfonamide boronic acids that resulted from the merging of two unrelated AmpC β-lactamase inhibitor series. The new boronic acids differed in the replacement of the canonical carboxamide, found in all penicillin and cephalosporin antibiotics, with a sulfonamide. Surprisingly, these sulfonamides had a highly distinct structure-activity relationship from the previously explored carboxamides, high ligand efficiencies (up to 0.91), Ki values down to 25 nM and up to 23 times better for smaller analogs. Conversely, Ki values were 10 to 20 times worse for larger molecules than in the carboxamide congener series. X-ray crystal structures (1.6–1.8 Å) of AmpC with three of the new sulfonamides suggest that this altered structure-activity relationship results from the different geometry and polarity of the sulfonamide versus the carboxamide. The most potent inhibitor reversed β-lactamase-mediated resistance to third generation cephalosporins, lowering their minimum inhibitory concentrations up to 32-fold in cell culture. PMID:20945905

  3. Development of Highly Potent GAT1 Inhibitors: Synthesis of Nipecotic Acid Derivatives by Suzuki-Miyaura Cross-Coupling Reactions.

    PubMed

    Petrera, Marilena; Wein, Thomas; Allmendinger, Lars; Sindelar, Miriam; Pabel, Jörg; Höfner, Georg; Wanner, Klaus T

    2016-03-01

    A new series of potent and selective mGAT1 inhibitors has been identified, featuring a nipecotic acid residue and an N-butenyl linker with a 2-biphenyl residue at the ω-position. Docking, combined with MD calculations, revealed a binding mode for the new compounds similar to that of tiagabine, the only mGAT1 inhibitor currently approved as antiepileptic drug. For the synthesis, a Suzuki-Miyaura cross-coupling reaction was used as a key step by which variously substituted biaryl subunits were assembled. Biological evaluation revealed several compounds that possess binding affinities and inhibitory potencies toward mGAT1, together with subtype selectivities against mGAT2-mGAT4 that were similar to or even higher than those for tiagabine. A derivative carrying the 2',4'-dichloro-2-biphenyl moiety attached to N-but-3-enylnipecotic acid at the terminal position of the linker chain was found to be the most potent binder, with the racemic form of the compound displaying a binding affinity of 8.05±0.13 (pKi ), while the R enantiomer exhibited an affinity value of 8.33±0.06 (pKi ). PMID:26683881

  4. Design, synthesis and SAR studies of GABA uptake inhibitors derived from 2-substituted pyrrolidine-2-yl-acetic acids.

    PubMed

    Steffan, Tobias; Renukappa-Gutke, Thejavathi; Höfner, Georg; Wanner, Klaus T

    2015-03-15

    In this paper, we disclose the design and synthesis of a series of 2-substituted pyrrolidine-2-yl-acetic acid as core structures and the N-arylalkyl derivatives thereof as potential GABA transport inhibitors. The 2-position in the side chain of pyrrolidine-2-yl-acetic acid derivatives was substituted with alkyl, hydroxy and amino groups to modulate the activity and selectivity to mGAT1 and mGAT4 proteins. SAR studies of the compounds performed for the four mouse GABA transporter proteins (mGAT1-mGAT4) implied significant potencies and subtype selectivities for 2-hydroxy-2-pyrrolidine-2-yl-acetic acid derivatives. The racemate rac-(u)-13c exhibited the highest potency (pIC50 5.67) at and selectivity for mGAT1 in GABA uptake assays. In fact, the potency of rac-(u)-13c at hGAT-1 (pIC50 6.14) was even higher than its potency at mGAT1. These uptake results for rac-(u)-13c are in line with the binding affinities to the aforesaid proteins mGAT1 (pKi 6.99) and hGAT-1 (pKi 7.18) determined by MS Binding Assay based on NO711 as marker quantified by LC-ESI-MS-MS analysis. Interestingly, the 2-hydroxy-2-pyrrolidine-2-yl-acetic acid rac-(u)-13d containing 2-{[tris(4-methoxyphenyl)]methoxy} ethyl group at the nitrogen atom of the pyrrolidine ring showed high potency at mGAT4 and a comparatively better selectivity for this protein (>15 against mGAT3) than the well known mGAT4 uptake inhibitor (S)-SNAP-5114. PMID:25698617

  5. A lysophosphatidic acid analogue is revealed as a potent inhibitor of phosphatidylcholine synthesis, inducing apoptosis.

    PubMed Central

    Gueguen, Geneviéve; Granci, Virginie; Rogalle, Pierre; Briand-Mésange, Fabienne; Wilson, Michéle; Klaébé, Alain; Tercé, François; Chap, Hugues; Salles, Jean-Pierre; Simon, Marie-Françoise; Gaits, Frédérique

    2002-01-01

    A previous study demonstrated that cross-desensitization experiments performed with the lysophosphatidic acid (LPA) analogues (R)- and (S)-N-palmitoyl-norleucinol 1-phosphate (PNPAs) inhibited LPA-induced platelet aggregation without any stereospecificity. Here we report opposite biological effects of the two enantiomers on mitogenesis of IMR-90 fibroblasts in relation to their respective metabolism. (R)PNPA was proliferative, while (S)PNPA induced apoptosis by specifically inhibiting phosphatidylcholine biosynthesis at the last step of the CDP-choline pathway controlled by cholinephosphotransferase. This effect was not direct but required dephosphorylation of PNPAs by ecto-lipid phosphate phosphatase before cellular uptake of the generated N-palmitoyl-norleucinols (PNOHs). Inhibition of cholinephosphotransferase by the derivative (S)PNOH was confirmed by an in vitro assay. (S)PNPA proapoptotic effects led us to clarify the mechanism linking cholinephosphotransferase inhibition to apoptosis. Three proapoptotic responses were observed: the activation of caspase-3, the production of ceramides from newly synthesized pools (as demonstrated by the inhibitor Fumonisin B1) and finally the activation of stress-activated protein kinase, p38 and c-Jun N-terminal kinases 1/2, as a result of ceramide increase. Thus our data demonstrate that synthetic analogues of LPA might display stereospecific effects leading to apoptosis independently of classical LPA-activated pathways. PMID:12197836

  6. Synthesis of novel beta-lactone inhibitors of fatty acid synthase.

    PubMed

    Richardson, Robyn D; Ma, Gil; Oyola, Yatsandra; Zancanella, Manuel; Knowles, Lynn M; Cieplak, Piotr; Romo, Daniel; Smith, Jeffrey W

    2008-09-11

    Fatty acid synthase (FAS) is necessary for growth and survival of tumor cells and is a promising drug target for oncology. Here, we report on the syntheses and activity of novel inhibitors of the thioesterase domain of FAS. Using the structure of orlistat as a starting point, which contains a beta-lactone as the central pharmacophore, 28 novel congeners were synthesized and examined. Structural features such as the length of the alpha- and beta-alkyl chains, their chemical composition, and amino ester substitutions were altered and the resulting compounds explored for inhibitory activity toward the thioesterase domain of FAS. Nineteen congeners show improved potency for FAS in biochemical assays relative to orlistat. Three of that subset, including the natural product valilactone, also display an increased potency in inducing tumor cell death and improved solubility compared to orlistat. These findings support the idea that an orlistat congener can be optimized for use in a preclinical drug design and for clinical drug development. PMID:18710210

  7. Synthesis of Novel β-Lactone Inhibitors of Fatty Acid Synthase

    PubMed Central

    Richardson, Robyn D.; Ma, Gil; Oyola, Yatsandra; Zancanella, Manuel; Knowles, Lynn M.; Cieplak, Piotr; Romo, Daniel; Smith, Jeffrey W.

    2011-01-01

    Fatty acid synthase (FAS) is necessary for growth and survival of tumor cells and is a promising drug target for oncology. Here, we report on the syntheses and activity of novel inhibitors of the thioesterase domain of FAS. Using the structure of orlistat as a starting point, which contains a β-lactone as the central pharmacophore, 28 novel congeners were synthesized and examined. Structural features such as the length of the α- and β-alkyl chains, their chemical composition, and amino ester substitutions were altered and the resulting compounds explored for inhibitory activity toward the thioesterase domain of FAS. Nineteen congeners show improved potency for FAS in biochemical assays relative to orlistat. Three of that subset, including the natural product valilactone, also display an increased potency in inducing tumor cell death and improved solubility compared to orlistat. These findings support the idea that an orlistat congener can be optimized for use in a preclinical drug design and for clinical drug development. PMID:18710210

  8. Synthesis of Lysine Methyltransferase Inhibitors

    NASA Astrophysics Data System (ADS)

    Ye, Tao; Hui, Chunngai

    2015-07-01

    Lysine methyltransferase which catalyze methylation of histone and nonhistone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting Lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery.

  9. Statins and the squalene synthase inhibitor zaragozic acid stimulate the non-amyloidogenic pathway of amyloid-beta protein precursor processing by suppression of cholesterol synthesis.

    PubMed

    Kojro, Elzbieta; Füger, Petra; Prinzen, Claudia; Kanarek, Anna Maria; Rat, Dorothea; Endres, Kristina; Fahrenholz, Falk; Postina, Rolf

    2010-01-01

    Cholesterol-lowering drugs such as statins influence the proteolytic processing of the amyloid-beta protein precursor (AbetaPP) and are reported to stimulate the activity of alpha-secretase, the major preventive secretase of Alzheimer's disease. Statins can increase the alpha-secretase activity by their cholesterol-lowering properties as well as by impairment of isoprenoids synthesis. In the present study, we elucidate the contribution of these pathways in alpha-secretase activation. We demonstrate that zaragozic acid, a potent inhibitor of squalene synthase which blocks cholesterol synthesis but allows synthesis of isoprenoids, also stimulates alpha-secretase activity. Treatment of human neuroblastoma cells with 50 microM zaragozic acid resulted in a approximately 3 fold increase of alpha-secretase activity and reduced cellular cholesterol by approximately 30%. These effects were comparable to results obtained from cells treated with a low lovastatin concentration (2 microM). Zaragozic acid-stimulated secretion of alpha-secretase-cleaved soluble AbetaPP was dose dependent and saturable. Lovastatin- or zaragozic acid-stimulated increase of alpha-secretase activity was completely abolished by a selective ADAM10 inhibitor. By targeting the alpha-secretase ADAM10 to lipid raft domains via a glycosylphosphatidylinositol anchor, we demonstrate that ADAM10 is unable to cleave AbetaPP in a cholesterol-rich environment. Our results indicate that inhibition of cholesterol biosynthesis by a low lovastatin concentration is sufficient for alpha-secretase activation. PMID:20413873

  10. N-Benzyl-indolo carboxylic acids: Design and synthesis of potent and selective adipocyte fatty-acid binding protein (A-FABP) inhibitors.

    PubMed

    Barf, Tjeerd; Lehmann, Fredrik; Hammer, Kristin; Haile, Saba; Axen, Eva; Medina, Carmen; Uppenberg, Jonas; Svensson, Stefan; Rondahl, Lena; Lundbäck, Thomas

    2009-03-15

    Small molecule inhibitors of adipocyte fatty-acid binding protein (A-FABP) have gained renewed interest following the recent publication of pharmacologically beneficial effects of such inhibitors. Despite the potential utility of selective A-FABP inhibitors within the fields of metabolic disease, inflammation and atherosclerosis, there are few examples of useful A-FABP inhibitors in the public domain. Herein, we describe the optimization of N-benzyl-tetrahydrocarbazole derivatives through the use of co-crystal structure guided medicinal chemistry efforts. This led to the identification of a potent and selective class of A-FABP inhibitors as illustrated by N-benzyl-hexahydrocyclohepta[b]indole 30. PMID:19217286

  11. Synthesis of B- and C-ring-modified lithocholic acid analogues as potential sialyltransferase inhibitors.

    PubMed

    Abdu-Allah, Hajjaj H M; Chang, Tzu Ting; Li, Wen-Shan

    2016-08-01

    In order to identify structural features of lithocholic acid (LCA) critical for inhibition of the enzyme sialyltransferase (ST) novel analogues with modifications of the skeleton (7-9, 16-18 and 20) were designed and synthesized. Methyl 3α-acetoxy-7-oxo-cholanate (1), methyl 3α-acetoxy-12-oxo-cholanate (2) and methyl 3α,7α-diacetoxy-12-oxo-cholanate (3) were subjected to Baeyer-Villiger oxidation to provide homolactones (7-9) or to the Beckmann rearrangement of the corresponding oximes to give homolactams (16-18). Both reactions proceed regio- and stereoselectively. Ring B homolog of lithocholic acid (20) was efficiently synthesized. Among these compounds, 7, 9 and 16 were found to have the significant activity, with IC50 values ⩽3μM against α-2,6-(N)-ST selectively, which are 5-fold lower than that of Lith-O-Asp. Given the reality that LCA and its analogue, Lith-O-Asp, have been revealed to improve inhibitory efficacy of ST and to have a wide range of antimetastatic activities in different human cancer cells, the up-to-date findings have noteworthy pharmacological significance as they open a promising path to the improvement of a prospective molecular targeted application of modified LCA analogues as agents for the treatment of cancer metastasis. PMID:27154753

  12. Synthesis, Biological Evaluation, and Computer-Aided Drug Designing of New Derivatives of Hyperactive Suberoylanilide Hydroxamic Acid Histone Deacetylase Inhibitors.

    PubMed

    Zhang, Song; Huang, Weibin; Li, Xiaonan; Yang, Zhicheng; Feng, Binghong

    2015-10-01

    The synthesis and biological evaluation of a novel series of compounds based on suberoylanilide hydroxamic acid (SAHA) had been designed as potential histone deacetylase inhibitors (HDACis). Molecular docking studies indicated that our derivatives had better fitting in the binding sites of HDAC8 than SAHA. Compounds 1-5 were synthesized through the synthetic routes. In biological test, compounds also showed good inhibitory activity in HDAC enzyme assay and more potent growth inhibition in human glioma cell lines (MGR2, U251, and U373). A representative compound, N3F, exhibited better inhibitory effect (HDAC, IC50  = 0.1187 μm; U251, IC50  = 0.8949 μm) and lower toxicity for human normal cells (LO2, IC50  = 172.5 μm and MRC5, IC50  = 213.6 μm) compared with SAHA (HDAC, IC50  = 0.8717 μm; U251, IC50  = 8.938 μm; LO2, IC50  = 86.52 μm and MRC5, IC50  = 81.02 μm). In addition, N3F obviously increased Beclin-1 and Caspase-3 and 9 as well as inhibited Bcl-2 in U251 cells. All of our results indicated that these SAHA cap derivatives could serve as potential lead compounds for further optimization. In addition, N3F and N2E both displayed promising profile as antitumor candidates for the treatment of human glioma. PMID:25763653

  13. Synthesis and Biological Evaluation of Phosphate Prodrugs of 4-Phospho-d -erythronohydroxamic Acid, an Inhibitor of 6-Phosphogluconate Dehydrogenase

    PubMed Central

    Ruda, Gian Filippo; Alibu, Vincent P; Mitsos, Christos; Bidet, Olivier; Kaiser, Marcel; Brun, Reto; Barrett, Michael P; Gilbert, Ian H

    2007-01-01

    We have previously reported the discovery of potent and selective inhibitors of 6-phosphogluconate dehydrogenase, the third enzyme of the phosphate pentose pathway, from Trypanosoma brucei, the causative organism of human African trypanosomiasis. These inhibitors were charged phosphate derivatives with restricted capacity to enter cells. Herein, we report the synthesis of five different classes of prodrugs: phosphoramidate; bis-S-acyl thioethyl esters (bis-SATE); bis-pivaloxymethyl (bis-POM); CycloSaligenyl; and phenyl, S-acyl thioethyl mixed phosphate esters (mix-SATE). Prodrugs were studied for stability and activity against the intact parasites. Most prodrugs caused inhibition of the growth of the parasites. The activity of the prodrugs against the parasites appeared to be related to their stability in aqueous buffer. PMID:17615587

  14. Synthesis of lysine methyltransferase inhibitors

    PubMed Central

    Hui, Chunngai; Ye, Tao

    2015-01-01

    Lysine methyltransferase which catalyze methylation of histone and non-histone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery. PMID:26258118

  15. Novel Bifunctional Quinolonyl Diketo Acid Derivatives as HIV-1 Integrase Inhibitors: Design, Synthesis, Biological Activities and Mechanism of Action

    PubMed Central

    Di Santo, Roberto; Costi, Roberta; Roux, Alessandra; Artico, Marino; Lavecchia, Antonio; Marinelli, Luciana; Novellino, Ettore; Palmisano, Lucia; Andreotti, Mauro; Amici, Roberta; Galluzzo, Clementina Maria; Nencioni, Lucia; Palamara, Anna Teresa; Pommier, Yves; Marchand, Christophe

    2008-01-01

    The virally encoded integrase protein is an essential enzyme in the life cycle of the HIV-1 virus and represents an attractive and validated target in the development of therapeutics against HIV infection. Drugs that selectively inhibit this enzyme, when used in combination with inhibitors of reverse transcriptase and protease, are believed to be highly effective in suppressing the viral replication. Among the HIV-1 integrase inhibitors, the β-diketo acids (DKAs) represent a major lead for anti-HIV-1drug development. In this study, novel bifunctional quinolonyl diketo acid derivatives were designed, synthesized and tested for their inhibitory ability against HIV-1 integrase. The compounds are potent inhibitors of integrase activity. Particularly, derivative 8 is a potent IN inhibitor for both steps of the reaction (3′-processing and strand transfer) and exhibits both high antiviral activity against HIV-1 infected cells and low cytotoxicity. Molecular modeling studies provide a plausible mechanism of action, which is consistent with ligand SARs and enzyme photo-crosslinking experiments. PMID:16539381

  16. Synthesis of 1,2,3-triazol-1-yl-methaneboronic acids via click chemistry: an easy access to a new potential scaffold for protease inhibitors

    PubMed Central

    Romagnoli, Chiara; Caselli, Emilia; Prati, Fabio

    2015-01-01

    Stereoselective synthesis of previously unreported 1,2,3-triazol-1-yl-methaneboronic acids has been achieved from azidomethaneboronates by Copper-catalyzed Azide-Alkyne Cycloaddition (CuAAC). The proximity of the cycloaddition reaction center to the boronic group is not detrimental for the stability of the sp3-carbon-boron bond nor to the stereoisomeric composition, further expanding the field of application of click chemistry to new boronate substrates and offering a new potential scaffold for protease inhibitors. PMID:26257579

  17. Synthesis and QSAR of Fatty Acid Amide Hydrolase Inhibitors: Modulation at the N-Portion of Biphenyl-3-yl Alkylcarbamates

    PubMed Central

    Mor, Marco; Lodola, Alessio; Rivara, Silvia; Vacondio, Federica; Duranti, Andrea; Tontini, Andrea; Sanchini, Silvano; Piersanti, Giovanni; Clapper, Jason R.; King, Alvin R.; Tarzia, Giorgio; Piomelli, Daniele

    2013-01-01

    Alkylcarbamic acid biphenyl-3-yl esters are a class of fatty acid amide hydrolase (FAAH) inhibitors that comprises cyclohexylcarbamic acid 3′-carbamoylbiphenyl-3-yl ester (URB597), a compound with analgesic, anxiolytic-like and antidepressant-like properties in rat and mouse models. Here, we extended the structure-activity relationships (SARs) for this class of compounds by replacing the cyclohexyl ring of the parent compound cyclohexylcarbamic acid biphenyl-3-yl ester (URB524) (IC50, for FAAH = 63 nM) with a selected set of substituents of different size, shape, flexibility and lipophilicity. Docking experiments and Linear Interaction Energy (LIE) calculations indicated that the N-terminal group of O-arylcarbamates fits within the lipophilic region of the substrate-binding site, mimicking the arachidonoyl chain of anandamide. Significant potency improvements were observed for the β-naphthylmethyl derivative 4q (IC50 = 5.3 nM) and its 3′-carbamoylbiphenyl-3-yl ester 4z (URB880, IC50 = 0.63 nM), indicating that shape complementarity and hydrogen bonds are crucial to obtain highly potent inhibitors. PMID:18507372

  18. Novel 5alpha-reductase inhibitors: synthesis, structure-activity studies, and pharmacokinetic profile of phenoxybenzoylphenyl acetic acids.

    PubMed

    Salem, Ola I A; Frotscher, Martin; Scherer, Christiane; Neugebauer, Alexander; Biemel, Klaus; Streiber, Martina; Maas, Ruth; Hartmann, Rolf W

    2006-01-26

    Novel substituted benzoyl benzoic acids and phenylacetic acids 1-14 have been synthesized and evaluated for inhibition of rat and human steroid 5alpha-reductase isozymes 1 and 2. The compounds turned out to be potent and selective human type 2 enzyme inhibitors, exhibiting IC(50) values in the nanomolar range. The phenylacetic acid derivatives were more potent than the analogous benzoic acids. Bromination in the 4-position of the phenoxy moiety led to the strongest inhibitor in this class (12; IC(50) = 5 nM), which was equipotent to finasteride. Since oral absorption is essential for a potential drug, 12 was further examined. In the parallel artificial membrane permeation assay (PAMPA) it turned out to be a good permeator, whereas it was a medium permeator in Caco2 cells. After oral administration (40 mg/kg) to rats a high bioavailability and a biological half-life of 5.5 h were observed, making it a promising candidate for clinical evaluation. PMID:16420060

  19. A new dioxime corrosion inhibitor for the protection and conservation of copper: synthesis, characterization and evaluation in acidic chloride solution

    NASA Astrophysics Data System (ADS)

    Abu-Baker, Ahmad N.; Al-Qudah, Mahmoud A.

    2016-08-01

    This study aimed to investigate a new dioxime compound as a corrosion inhibitor for copper. The compound (4,6-dihydroxy benzene-1,3-dicarbaldehyde dioxime) was synthesized and characterized by nuclear magnetic resonance spectroscopy. Electrochemical impedance spectroscopy and potentiodynamic polarization measurements were used to compare the dioxime compound with benzotriazole for their effectiveness as corrosion inhibitors for copper in 0.1 M HCl solution. Fourier transform infrared (FTIR) spectroscopy and scanning electron microscopy (SEM) were used to investigate the bonding mechanisms and morphological changes of the two inhibitors on the copper surface. The electrochemical techniques showed that the new dioxime compound was more effective than benzotriazole in inhibiting copper corrosion in the acidic chloride medium. The FTIR and SEM results indicated that the dioxime compound was able to coordinate with copper ions and formed a protective film on the copper surface. It was concluded that the new dioxime compound proved effectiveness to be used as a corrosion inhibitor for the protection and conservation of copper.

  20. Potent α-amino-β-lactam carbamic acid ester as NAAA inhibitors. Synthesis and structure-activity relationship (SAR) studies.

    PubMed

    Nuzzi, Andrea; Fiasella, Annalisa; Ortega, Jose Antonio; Pagliuca, Chiara; Ponzano, Stefano; Pizzirani, Daniela; Bertozzi, Sine Mandrup; Ottonello, Giuliana; Tarozzo, Glauco; Reggiani, Angelo; Bandiera, Tiziano; Bertozzi, Fabio; Piomelli, Daniele

    2016-03-23

    4-Cyclohexylbutyl-N-[(S)-2-oxoazetidin-3-yl]carbamate (3b) is a potent, selective and systemically active inhibitor of intracellular NAAA activity, which produces profound anti-inflammatory effects in animal models. In the present work, we describe structure-activity relationship (SAR) studies on 3-aminoazetidin-2-one derivatives, which have led to the identification of 3b, and expand these studies to elucidate the principal structural and stereochemical features needed to achieve effective NAAA inhibition. Investigations on the influence of the substitution at the β-position of the 2-oxo-3-azetidinyl ring as well as on the effect of size and shape of the carbamic acid ester side chain led to the discovery of 3ak, a novel inhibitor of human NAAA that shows an improved physicochemical and drug-like profile relative to 3b. This favourable profile, along with the structural diversity of the carbamic acid chain of 3b, identify this compound as a promising new tool to investigate the potential of NAAA inhibitors as therapeutic agents for the treatment of pain and inflammation. PMID:26866968

  1. Design, synthesis, and biological activity of a potent inhibitor of the neuropeptidase N-acetylated alpha-linked acidic dipeptidase.

    PubMed

    Jackson, P F; Cole, D C; Slusher, B S; Stetz, S L; Ross, L E; Donzanti, B A; Trainor, D A

    1996-01-19

    A series of substituted phosphonate derivatives were designed and synthesized in order to study the ability of these compounds to inhibit the neuropeptidase N-acetylated alpha-linked acidic dipeptidase (NAALADase). The molecules were shown to act as inhibitors of the enzyme, with the most potent (compound 3) having a Ki of 0.275 nM. The potency of this compound is more than 1000 times greater than that of previously reported inhibitors of the enzyme. NAALADase is responsible for the catabolism of the abundant neuropeptide N-acetyl-aspartylglutamate (NAAG) into N-acetylaspartate and glutamate. NAAG has been proposed to be a neurotransmitter at a subpopulation of glutamate receptors; alternatively, NAAG has been suggested to act as a storage form of synaptic glutamate. As a result, inhibition of NAALADase may show utility as a therapeutic intervention in diseases in which altered levels of glutamate are thought to be involved. PMID:8558536

  2. [The synthesis of specific enzyme inhibitors].

    PubMed

    Iakovleva, G M

    1987-04-01

    The review deals with directed synthesis of specific enzyme inhibitors. They are classified within the framework of the mechanistic approach, namely, stable analogues of substrates, which form enzyme complexes mimicking the Michaelis complex or those which influence the chemical stages of enzyme catalysis; conformational inhibitors; substrate analogues participating in enzyme reactions and producing modified products; suicide inhibitors; stage inhibitors (inhibitors influencing certain stages of enzyme reaction); transition state analogues; multisubstrate analogues and collected substrates. Types of chemical modification used in synthesis of the specific inhibitors are discussed. Some possibilities of the quantity structure-activity relationship methods, computer modelling and molecular graphics in designing the optimal structure of inhibitors are mentioned. PMID:3300658

  3. The DNA gyrase inhibitors, nalidixic acid and oxolinic acid, prevent iron-mediated repression of catechol siderophore synthesis in Azotobacter vinelandii.

    PubMed

    Page, W J; Patrick, J

    1988-01-01

    Low concentrations of nalidixic acid and oxolinic acid that were just inhibitory to Azotobacter vinelandii growth promoted the production of the catechol siderophores azotochelin and aminochelin, in the presence of normally repressive concentrations of Fe3+. There was a limited effect on the pyoverdin siderophore, azotobactin, where low concentrations of Fe3+ were rendered less repressive, but the repression by higher concentrations of Fe3+ was normal. These drugs did not induce high-molecular-mass iron-repressible outer-membrane proteins and similar effects on the regulation of catechol siderophore synthesis were not produced by novobiocin, coumermycin, or ethidium bromide. The timing of nalidixic acid and Fe3+ addition to iron-limited cells was critical. Nalidixic acid had to be added before iron-repression of catechol siderophore synthesis and before the onset of iron-sufficient growth. Continued production of the catechol siderophores, however, was not due to interference with normal iron uptake. These data indicated that nalidixic acid prevented normal iron-repression of catechol siderophore synthesis but could not reverse iron repression once it had occurred. The possible roles of DNA gyrase activity in the regulation of catechol siderophore synthesis is discussed. PMID:2856355

  4. Synthesis and bioevaluation of 2-phenyl-4-methyl-1,3-selenazole-5-carboxylic acids as potent xanthine oxidase inhibitors.

    PubMed

    Guan, Qi; Cheng, Zengjin; Ma, Xiaoxue; Wang, Lijie; Feng, Dongjie; Cui, Yuanhang; Bao, Kai; Wu, Lan; Zhang, Weige

    2014-10-01

    A series of 2-phenyl-4-methyl-1,3-selenazole-5-carboxylic acid derivatives (8a-f, 9a-m) were synthesized and evaluated for inhibitory activity against xanthine oxidase in vitro. Structure-activity relationship analyses have also been presented. Most of the target compounds exhibited potency levels in the nanomolar range. Compound 9e emerged as the most potent xanthine oxidase inhibitor (IC50 = 5.5 nM) in comparison to febuxostat (IC50 = 18.6 nM). Steady-state kinetics measurements with the bovine milk enzyme indicated a mixed type inhibition with Ki and Ki' values of 0.9 and 2.3 nM, respectively. A molecular modeling study on compounds 9e was performed to gain an insight into its binding mode with xanthine oxidase, and to provide the basis for further structure-guided design of new non-purine xanthine oxidase inhibitors related with 2-phenyl-4-methyl-1,3-selenazole-5-carboxylic acid scaffold. PMID:25113879

  5. Synthesis and In Vitro Evaluation of Aspartate Transcarbamoylase Inhibitors

    PubMed Central

    Coudray, Laëtitia; Pennebaker, Anne F.; Montchamp, Jean-Luc

    2009-01-01

    The design, synthesis, and evaluation of a series of novel inhibitors of aspartate transcarbamoylase (ATCase) are reported. Several submicromolar phosphorus-containing inhibitors are described, but all-carboxylate compounds are inactive. Compounds were synthesized to probe the postulated cyclic transition-state of the enzyme-catalyzed reaction. In addition, the associated role of the protonation state at the phosphorus acid moiety was evaluated using phosphinic and carboxylic acids. Although none of the synthesized inhibitors is more potent than N-phosphonacetyl-L-aspartate (PALA), the compounds provide useful mechanistic information, as well as the basis for the design of future inhibitors and/or prodrugs. PMID:19828320

  6. Design, synthesis and pharmacological characterization of coumarin-based fluorescent analogs of excitatory amino acid transporter subtype 1 selective inhibitors, UCPH-101 and UCPH-102.

    PubMed

    Huynh, Tri H V; Abrahamsen, Bjarke; Madsen, Karsten K; Gonzalez-Franquesa, Alba; Jensen, Anders A; Bunch, Lennart

    2012-12-01

    The excitatory amino acid transporters (EAATs) play a pivotal role in regulating the synaptic concentration of glutamate in the mammalian central nervous system. To date, five different subtypes have been identified, named EAAT15 in humans (and GLAST, GLT-1, EAAC1, EAAT4, and EAAT5, respectively, in rodents). Recently, we have published and presented a structure-activity relationship (SAR) study of a novel class of selective inhibitors of EAAT1 (and GLAST), with the analogs UCPH-101 (IC(50)=0.66μM) and UCPH-102 (IC(50)=0.43μM) being the most potent inhibitors in the series. In this paper, we present the design, synthesis and pharmacological evaluation of six coumarin-based fluorescent analogs of UCPH-101/102 as subtype-selective inhibitors at EAAT1. Analogs 1114 failed to inhibit EAAT1 function (IC(50) values >300μM), whereas analogs 15 and UCPH-102F inhibited EAAT1 with IC(50) values in the medium micromolar range (17μM and 14μM, respectively). Under physiological pH no fluorescence was observed for analog 15, while a bright blue fluorescence emission was observed for analog UCPH-102F. Regrettably, under confocal laser scanning microscopy selective visualization of expression of EAAT1 over EAAT3 was not possible due to nonspecific binding of UCPH-102F. PMID:23072958

  7. Multicomponent Synthesis and Evaluation of New 1,2,3-Triazole Derivatives of Dihydropyrimidinones as Acidic Corrosion Inhibitors for Steel.

    PubMed

    González-Olvera, Rodrigo; Román-Rodríguez, Viridiana; Negrón-Silva, Guillermo E; Espinoza-Vázquez, Araceli; Rodríguez-Gómez, Francisco Javier; Santillan, Rosa

    2016-01-01

    An efficient one-pot synthesis of 1,2,3-triazole derivatives of dihydropyrimidinones has been developed using two multicomponent reactions. The aldehyde-1,2,3-triazoles were obtained in good yields from in situ-generated organic azides and O-propargylbenzaldehyde. The target heterocycles were synthesized through the Biginelli reaction in which the aldehyde-1,2,3-triazoles reacted with ethyl acetoacetate and urea in the presence of Ce(OTf)₃ as the catalyst. The corrosion inhibition of steel grade API 5 L X52 in 1 M HCl by the synthesized compounds was investigated using the electrochemical impedance spectroscopy technique. The measurements revealed that these heterocycles are promising candidates to inhibit acidic corrosion of steel. PMID:26907242

  8. Synthesis and biological evaluation of piperic acid amides as free radical scavengers and α-glucosidase inhibitors.

    PubMed

    Takao, Koichi; Miyashiro, Takaki; Sugita, Yoshiaki

    2015-01-01

    A series of piperic acid amides (4-24, 29, 30) were synthesized and their 1,1-diphenyl-2-picrylhydrazyl (DPPH) free radical scavenging and α-glucosidase inhibitory activities were evaluated. Among the synthesized compounds, the amides 11, 13 and 15, which contain o-methoxyphenol, catechol or 5-hydroxyindole moieties, showed potent DPPH free radical scavenging activity (11: EC50 140 µM; 13: EC50 28 µM; 15: EC50 20 µM). The amides 10, 18 and 23 showed higher inhibitory activity of α-glucosidase (10: IC50 21 µM; 18: IC50 21 µM; 23: IC50 12 µM). These data suggest that the hydrophobicity of the conjugated amines is an important determinant of α-glucosidase inhibitory activity. In addition, the amides 13 and 15 showed both potent DPPH free radical scavenging activity and α-glucosidase inhibitory activity (13: IC50 46 µM; 15: IC50 46 µM). This is the first report identifying the DPPH free radical scavenging and α-glucosidase inhibitory activities of piperic acid amides and suggests that these amides may serve as lead compounds for the development of novel α-glucosidase inhibitors with antioxidant activity. PMID:25948326

  9. Rational Design, Synthesis, and Preliminary Structure-Activity Relationships of α-Substituted-2-Phenylcyclopropane Carboxylic Acids as Inhibitors of Salmonella typhimurium O-Acetylserine Sulfhydrylase.

    PubMed

    Pieroni, Marco; Annunziato, Giannamaria; Beato, Claudia; Wouters, Randy; Benoni, Roberto; Campanini, Barbara; Pertinhez, Thelma A; Bettati, Stefano; Mozzarelli, Andrea; Costantino, Gabriele

    2016-03-24

    Cysteine is a building block for several biomolecules that are crucial for living organisms. The last step of cysteine biosynthesis is catalyzed by O-acetylserine sulfydrylase (OASS), a highly conserved pyridoxal 5'-phosphate (PLP)-dependent enzyme, present in different isoforms in bacteria, plants, and nematodes, but absent in mammals. Beside the biosynthesis of cysteine, OASS exerts a series of "moonlighting" activities in bacteria, such as transcriptional regulation, contact-dependent growth inhibition, swarming motility, and induction of antibiotic resistance. Therefore, the discovery of molecules capable of inhibiting OASS would be a valuable tool to unravel how this protein affects the physiology of unicellular organisms. As a continuation of our efforts toward the synthesis of OASS inhibitors, in this work we have used a combination of computational and spectroscopic approaches to rationally design, synthesize, and test a series of substituted 2-phenylcyclopropane carboxylic acids that bind to the two S. typhymurium OASS isoforms at nanomolar concentrations. PMID:26894308

  10. Isozyme-nonselective N-substituted bipiperidylcarboxamide acetyl-CoA carboxylase inhibitors reduce tissue malonyl-CoA concentrations, inhibit fatty acid synthesis, and increase fatty acid oxidation in cultured cells and in experimental animals.

    PubMed

    Harwood, H James; Petras, Stephen F; Shelly, Lorraine D; Zaccaro, Lawrence M; Perry, David A; Makowski, Michael R; Hargrove, Diane M; Martin, Kelly A; Tracey, W Ross; Chapman, Justin G; Magee, William P; Dalvie, Deepak K; Soliman, Victor F; Martin, William H; Mularski, Christian J; Eisenbeis, Shane A

    2003-09-26

    Inhibition of acetyl-CoA carboxylase (ACC), with its resultant inhibition of fatty acid synthesis and stimulation of fatty acid oxidation, has the potential to favorably affect the multitude of cardiovascular risk factors associated with the metabolic syndrome. To achieve maximal effectiveness, an ACC inhibitor should inhibit both the lipogenic tissue isozyme (ACC1) and the oxidative tissue isozyme (ACC2). Herein, we describe the biochemical and acute physiological properties of CP-610431, an isozyme-nonselective ACC inhibitor identified through high throughput inhibition screening, and CP-640186, an analog with improved metabolic stability. CP-610431 inhibited ACC1 and ACC2 with IC50s of approximately 50 nm. Inhibition was reversible, uncompetitive with respect to ATP, and non-competitive with respect to bicarbonate, acetyl-CoA, and citrate, indicating interaction with the enzymatic carboxyl transfer reaction. CP-610431 also inhibited fatty acid synthesis, triglyceride (TG) synthesis, TG secretion, and apolipoprotein B secretion in HepG2 cells (ACC1) with EC50s of 1.6, 1.8, 3.0, and 5.7 microm, without affecting either cholesterol synthesis or apolipoprotein CIII secretion. CP-640186, also inhibited both isozymes with IC50sof approximately 55 nm but was 2-3 times more potent than CP-610431 in inhibiting HepG2 cell fatty acid and TG synthesis. CP-640186 also stimulated fatty acid oxidation in C2C12 cells (ACC2) and in rat epitrochlearis muscle strips with EC50s of 57 nm and 1.3 microm. In rats, CP-640186 lowered hepatic, soleus muscle, quadriceps muscle, and cardiac muscle malonyl-CoA with ED50s of 55, 6, 15, and 8 mg/kg. Consequently, CP-640186 inhibited fatty acid synthesis in rats, CD1 mice, and ob/ob mice with ED50s of 13, 11, and 4 mg/kg, and stimulated rat whole body fatty acid oxidation with an ED50 of approximately 30 mg/kg. Taken together, These observations indicate that isozyme-nonselective ACC inhibition has the potential to favorably affect risk

  11. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  12. Acid Mediated Ring Closing Metathesis: A Powerful Synthetic Tool Enabling the Synthesis of Clinical Stage Kinase Inhibitors.

    PubMed

    William, Anthony D; Lee, Angeline C-H

    2015-01-01

    The powerful olefin metathesis reaction was employed for the construction of late-phase clinical agents SB1317 and SB1518. In both cases RCM seems to proceed only in the presence of an acid and to predominantly furnish trans isomers. In case of SB1518 it proceeded in the presence of acid HCl, while for SB1317, it mainly proceeds in the presence of TFA (trifluroacetic acid). PMID:26507218

  13. Design, Synthesis and Biological Evaluation of N4-Sulfonamido-Succinamic, Phthalamic, Acrylic and Benzoyl Acetic Acid Derivatives as Potential DPP IV Inhibitors

    PubMed Central

    Khalaf, Reema Abu; Sheikha, Ghassan Abu; Al-Sha'er, Mahmoud; Taha, Mutasem

    2013-01-01

    As incidence rate of type II diabetes mellitus continues to rise, there is a growing need to identify novel therapeutic agents with improved efficacy and reduced side effects. Dipeptidyl peptidase IV (DPP IV) is a multifunctional protein involved in many physiological processes. It deactivates the natural hypoglycemic incretin hormone effect. Inhibition of this enzyme increases endogenous incretin level, incretin activity and should restore glucose homeostasis in type II diabetic patients making it an attractive target for the development of new antidiabetic drugs. One of the interesting reported anti- DPP IV hits is Gemifloxacin which is used as a lead compound for the development of new DPP IV inhibitors. In the current work, design and synthesis of a series of N4-sulfonamido-succinamic, phthalamic, acrylic and benzoyl acetic acid derivatives was carried out. The synthesized compounds were evaluated for their in vitro anti-DPP IV activity. Some of them have shown reasonable bioactivity, where the most active one 17 was found to have an IC50 of 33.5 μM. PMID:24358058

  14. Natural Product Total Synthesis in the Organic Laboratory: Total Synthesis of Caffeic Acid Phenethyl Ester (CAPE), a Potent 5-Lipoxygenase Inhibitor from Honeybee Hives

    ERIC Educational Resources Information Center

    Touaibia, Mohamed; Guay, Michel

    2011-01-01

    Natural products play a critical role in modern organic synthesis and learning synthetic techniques is an important component of the organic laboratory experience. In addition to traditional one-step organic synthesis laboratories, a multistep natural product synthesis is an interesting experiment to challenge students. The proposed three-step…

  15. Synthesis of new sulfonamides as lipoxygenase inhibitors.

    PubMed

    Mustafa, Ghulam; Khan, Islam Ullah; Ashraf, Muhammad; Afzal, Iftikhar; Shahzad, Sohail Anjum; Shafiq, Muhammad

    2012-04-15

    The present study describes a convenient method for the synthesis of new lipoxygenase inhibitors, 4-(toluene-4-sulfonylamino)-benzoic acids from p-amino benzoic acid. Reaction of p-amino benzoic acid with p-toluenesulfonyl chloride provided thirteen N- and O-alkylation products 4a-4m in moderate to good yields. Lipoxygenase inhibition of newly formed sulfonamide derivatives was investigated and some of these compounds 4m, 4g, 4e, 4f and 4j showed good lipoxygenase inhibitory activities with IC(50) values ranged between 15.8 ± 0.57 and 91.7 ± 0.61 μmol whilst all other compounds exhibited mild anti-lipoxygenase activities with IC(50) values ranged between 139.2 ± 0.75 and 232.1 ± 0.78 μmol. N-alkylated products were more active against the enzyme than O-alkylated or both N- and O-alkylated ones. All synthesized sulfonamides were recrystallized in chloroform to give these title compounds which were characterized using FTIR, (1)H NMR, (13)C NMR, elemental analysis and single crystal X-ray diffraction techniques. PMID:22436389

  16. Studies on bacterial cell wall inhibitors. VI. Screening method for the specific inhibitors of peptidoglycan synthesis.

    PubMed

    Omura, S; Tanaka, H; Oiwa, R; Nagai, T; Koyama, Y; Takahashi, Y

    1979-10-01

    A screening method was established for selecting new specific inhibitors of bacterial cell wall peptidoglycan synthesis. In the primary test, culture broths of soil isolates were selected based on relative microbial activity. A culture, to be retained, must be active against Bacillus subtilis and lack activities against Acholeplasma laidawii. In the secondary test, inhibitors of bacterial cell wall synthesis were identified by their ability to prevent the incorporation of meso-[3H]diaminopimelic acid but not to prevent the incorporation of L-[4C]leucine into the acid-insoluble macromolecular fraction of growing cells of Bacillus sp. ATCC 21206 (Dpm-). As the tertiary test, inhibitors with molecular weights under 1,000 were selected by passage through a Diaflo UM-2 membrane. By this screening procedure, six known antibiotics and one new one were picked out from ten thousand soil isolates. PMID:528376

  17. Synthesis/biological evaluation of hydroxamic acids and their prodrugs as inhibitors for Botulinum neurotoxin A light chain

    PubMed Central

    Seki, Hajime; Pellett, Sabine; Šilhár, Peter; Stowe, G. Neil; Blanco, Beatriz; Lardy, Matthew; Johnson, Eric A.; Janda, Kim D.

    2014-01-01

    Botulinum neurotoxin A (BoNT/A) is the most potent toxin known. Unfortunately, it is also a potential bioweapon in terrorism, which is without an approved therapeutic treatment once cellular intoxication takes place. Previously, we reported how hydroxamic acid prodrug carbamates increased cellular uptake, which translated to successful inhibition of this neurotoxin. Building upon this research, we detail BoNT/A protease molecular modeling studies accompanied by the construction of small library of hydroxamic acids based on 2,4-dichlorocinnamic hydroxamic acid scaffold and their carbamate prodrug derivatization along with the evaluation of these molecules in both enzymatic and cellular models. PMID:24360826

  18. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei

    2009-01-01

    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  19. Synthesis and structure-activity relationship studies of O-biphenyl-3-yl carbamates as peripherally restricted fatty acid amide hydrolase inhibitors.

    PubMed

    Moreno-Sanz, Guillermo; Duranti, Andrea; Melzig, Laurin; Fiorelli, Claudio; Ruda, Gian Filippo; Colombano, Giampiero; Mestichelli, Paola; Sanchini, Silvano; Tontini, Andrea; Mor, Marco; Bandiera, Tiziano; Scarpelli, Rita; Tarzia, Giorgio; Piomelli, Daniele

    2013-07-25

    The peripherally restricted fatty acid amide hydrolase (FAAH) inhibitor URB937 (3, cyclohexylcarbamic acid 3'-carbamoyl-6-hydroxybiphenyl-3-yl ester) is extruded from the brain and spinal cord by the Abcg2 efflux transporter. Despite its inability to enter the central nervous system (CNS), 3 exerts profound antinociceptive effects in mice and rats, which result from the inhibition of FAAH in peripheral tissues and the consequent enhancement of anandamide signaling at CB1 cannabinoid receptors localized on sensory nerve endings. In the present study, we examined the structure-activity relationships (SAR) for the biphenyl region of compound 3, focusing on the carbamoyl and hydroxyl groups in the distal and proximal phenyl rings. Our SAR studies generated a new series of peripherally restricted FAAH inhibitors and identified compound 35 (cyclohexylcarbamic acid 3'-carbamoyl-5-hydroxybiphenyl-3-yl ester) as the most potent brain-impermeant FAAH inhibitor disclosed to date. PMID:23822179

  20. Synthesis and Evaluation of a Series of Oleanolic Acid Saponins as α-Glucosidase and α-Amylase Inhibitors.

    PubMed

    Guo, Tiantian; Wu, Shaoping; Guo, Sen; Bai, Lu; Liu, Qingchao; Bai, Naisheng

    2015-09-01

    Sixteen naturally occurring oleanolic acid saponins and their derivatives were synthesized in an efficient and practical strategy, and their inhibitory activities against α-glucosidase and α-amylase were evaluated in vitro. Among all the compounds, 28-O-monoglucoside 8 exhibited remarkably potent inhibitory activity against α-glucosidase with an IC50 value of 87.3 µM, which was fivefold stronger than that of the antidiabetic acarbose. Based on the preliminary structure-activity relationships, for 28-O-monoglucosides, the presence of a terminal α-l-rhamnopyranosyl residue enhanced the α-glucosidase and α-amylase inhibitory activities. Furthermore, for 3,28-O-bidesmosides, sugar-substituted moieties attached to the C-3 and C-28 positions of the oleanolic acid scaffold are helpful to increase the inhibitory activities against α-amylase and α-glucosidase. PMID:26207761

  1. Synthesis and evaluation of bibenzyl glycosides as potent tyrosinase inhibitors.

    PubMed

    Tajima, Reiko; Oozeki, Hiromi; Muraoka, Seiichi; Tanaka, Saori; Motegi, Yukari; Nihei, Hiroyuki; Yamada, Yoichi; Masuoka, Noriyoshi; Nihei, Ken-ichi

    2011-04-01

    Bibenzyl glycosides 1-6 were synthesized from 2,4-dihydoxybenzaldehyde and xylose, glucose, cellobiose or maltose. The key steps in the synthesis were the Wittig reaction and trichloroacetimidate glycosylation. Tests for tyrosinase inhibitory activity showed that all were significantly active, indicating that they are unique hydrophilic tyrosinase inhibitors. Bibenzyl xyloside 2 is a particularly potent inhibitor (IC(50) = 0.43 μM, 17 times higher than that of kojic acid). These results suggest that the hydrophilic cavity of tyrosinase might accommodate the bulky carbohydrate on the bibenzyl scaffold. PMID:21334791

  2. Chlorolissoclimides: New inhibitors of eukaryotic protein synthesis

    PubMed Central

    Robert, Francis; Gao, Hong Qing; Donia, Marwa; Merrick, William C.; Hamann, Mark T.; Pelletier, Jerry

    2006-01-01

    Lissoclimides are cytotoxic compounds produced by shell-less molluscs through chemical secretions to deter predators. Chlorinated lissoclimides were identified as the active component of a marine extract from Pleurobranchus forskalii found during a high-throughput screening campaign to characterize new protein synthesis inhibitors. It was demonstrated that these compounds inhibit protein synthesis in vitro, in extracts prepared from mammalian and plant cells, as well as in vivo against mammalian cells. Our results suggest that they block translation elongation by inhibiting translocation, leading to an accumulation of ribosomes on mRNA. These data provide a rationale for the cytotoxic nature of this class of small molecule natural products. PMID:16540697

  3. Heterocyclics as corrosion inhibitors for acid media

    SciTech Connect

    Ajmal, M.; Khan, M.A.W.; Ahmad, S.; Quraishi, M.A.

    1996-12-01

    The available literature on the use of heterocyclic compounds as corrosion inhibitors in acid media has been reviewed. It has been noted that the workers in this field have either used sulfur or nitrogen containing heterocyclic compounds for studying inhibition action. The authors have synthesized compounds containing sulfur and nitrogen both in the same ring and studied their inhibition action in acid media. These compounds were found to be better inhibitors than those containing either atoms alone.

  4. 3D-QSAR-aided design, synthesis, in vitro and in vivo evaluation of dipeptidyl boronic acid proteasome inhibitors and mechanism studies.

    PubMed

    Lei, Meng; Feng, Huayun; Wang, Cheng; Li, Hailing; Shi, Jingmiao; Wang, Jia; Liu, Zhaogang; Chen, Shanshan; Hu, Shihe; Zhu, Yongqiang

    2016-06-01

    Proteasome had been clinically validated as an effective target for the treatment of cancers. Up to now, many structurally diverse proteasome inhibitors were discovered. And two of them were launched to treat multiple myeloma (MM) and mantle cell lymphoma (MCL). Based on our previous biological results of dipeptidyl boronic acid proteasome inhibitors, robust 3D-QSAR models were developed and structure-activity relationship (SAR) was summarized. Several structurally novel compounds were designed based on the theoretical models and finally synthesized. Biological results showed that compound 12e was as active as the standard bortezomib in enzymatic and cellular activities. In vivo pharmacokinetic profiles suggested compound 12e showed a long half-life, which indicated that it could be administered intravenously. Cell cycle analysis indicated that compound 12e inhibited cell cycle progression at the G2M stage. PMID:27117691

  5. 5'-azido-N-1-naphthylphthalamic acid, a photolabile analog of the auxin transport inhibitor, N-1-naphthylphthalamic acid: synthesis and binding properties

    SciTech Connect

    Voet, J.G.; Howley, K.; Shumsky, J.S.

    1987-05-01

    The polar transport of the plant growth regulator, auxin (indole-3-acetic acid, IAAH), is thought to involve the participation of several proteins in the plasma membrane, including a specific, saturable, voltage independent H/sup +//IAA/sup -/ efflux carrier located preferentially at the basal end of each cell. Auxin transport is specifically inhibited by the herbicide, N-1-naphthylphthalamic acid (NPA), which binds specifically to a protein in the plasma membrane, thought to be either the IAA/sup -/ efflux carrier or an allosteric effector protein. They have synthesized and characterized a photolabile analog of NPA, 5'-azido-N-1-naphthylphthalamic acid (Az-NPA). This potential photoaffinity label for the NPA binding protein competes with /sup 3/H-NPA for binding sites on Curcurbita pepo L. (zucchini) stem cell membranes with K/sub j/ = 1.5 x 10/sup -7/ M. The K/sub i/ for NPA under these conditions is 2 x 10/sup -8/M, indicating that the affinity of Az-NPA for the membranes is only 7.5 fold lower than NPA. While the binding of 4.6 x 10/sup -6/ M Az-NPA to NPA binding sites is reversible in the dark, exposure to light results in a 30% loss in /sup 3/H-NPA binding ability. Pretreatment with 10/sup -4/ M NPA protects the membranes against photodestruction of /sup 3/H-NPA binding sites by Az-NPA, supporting the conclusion that Az-NPA destroys these sites by specific covalent attachment.

  6. Synthesis and Structure–Activity Relationships of N-(2-Oxo-3-oxetanyl)amides as N-Acylethanolamine-hydrolyzing Acid Amidase Inhibitors

    PubMed Central

    Solorzano, Carlos; Antonietti, Francesca; Duranti, Andrea; Tontini, Andrea; Rivara, Silvia; Lodola, Alessio; Vacondio, Federica; Tarzia, Giorgio; Piomelli, Daniele; Mor, Marco

    2010-01-01

    The fatty acid ethanolamides (FAEs) are a family of bioactive lipid mediators that include the endogenous agonist of peroxisome proliferator-activated receptor-α, palmitoylethanolamide (PEA). FAEs are hydrolyzed intracellularly by either fatty acid amide hydrolase or N-acylethanolamine-hydrolyzing acid amidase (NAAA). Selective inhibition of NAAA by (S)-N-(2-oxo-3-oxetanyl)-3-phenylpropionamide [(S)-OOPP, 7a] prevents PEA degradation in mouse leukocytes and attenuates responses to proinflammatory stimuli. Starting from the structure of 7a a series of β-lactones was prepared and tested on recombinant rat NAAA to explore structure-activity relationships (SARs) for this class of inhibitors and improve their in vitro potency. Following the hypothesis that these compounds inhibit NAAA by acylation of the catalytic cysteine, we identified several requirements for recognition at the active site and obtained new potent inhibitors. In particular, (S)-N-(2-oxo-3-oxetanyl)biphenyl-4-carboxamide (7h) was more potent than 7a at inhibiting recombinant rat NAAA activity (7a, IC50 = 420 nM; 7h, IC50 = 115 nM) in vitro and at reducing carrageenan-induced leukocyte infiltration in vivo. PMID:20604568

  7. Rational design and synthesis of topoisomerase I and II inhibitors based on oleanolic acid moiety for new anti-cancer drugs.

    PubMed

    Ashour, Ahmed; El-Sharkawy, Saleh; Amer, Mohamed; Abdel Bar, Fatma; Katakura, Yoshinori; Miyamoto, Tomofumi; Toyota, Nozomi; Bang, Tran Hai; Kondo, Ryuichiro; Shimizu, Kuniyoshi

    2014-01-01

    Semisynthetic reactions were conducted on oleanolic acid, a common plant-derived oleanane-type triterpene. Ten rationally designed derivatives of oleanolic acid were synthesized based on docking studies and tested for their topoisomerase I and IIα inhibitory activity. Semisynthetic reactions targeted C-3, C-12, C-13, and C-17. Nine of the synthesized compounds were identified as new compounds. The structures of these compounds were confirmed by spectroscopic methods (1D, 2D NMR and MS). Five oleanolic acid analogues (S2, S3, S5, S7 and S9) showed higher activity than camptothecin (CPT) in the topoisomerase I DNA relaxation assay. Four oleanolic acid analogues (S2, S3, S5 and S6) showed higher activity than etoposide in a topoisomerase II assay. The results indicated that the C12-C13 double bond of the oleanolic acid skeleton is important for the inhibitory activity against both types of topoisomerases, while insertion of a longer chain at either position 3 or 17 increases the activity against topoisomerases by various degrees. Some of the synthesized compounds act as dual inhibitors for both topoisomerase I and IIα. PMID:24326278

  8. Design, Synthesis and Crystal Structures of 6-Alkylidene-2’-Substituted Penicillanic Acid Sulfones as Potent Inhibitors of Acinetobacter baumannii OXA-24 Carbapenemase

    PubMed Central

    Bou, German; Santillana, Elena; Sheri, Anjaneyulu; Beceiro, Alejandro; Sampson, Jared; Kalp, Matthew; Bethel, Christopher R.; Distler, Anne M.; Drawz, Sarah M.; Pagadala, Sundar Ram Reddy; van den Akker, Focco; Bonomo, Robert A.; Romero, Antonio; Buynak, John D.

    2010-01-01

    Class D β-lactamases represent a growing and diverse class of penicillin inactivating enzymes that are usually resistant to commercial β-lactamase inhibitors. As many such enzymes are found in multi-drug resistant (MDR) Acinetobacter baumannii and Pseudomonas aeruginosa, novel β-lactamase inhibitors are urgently needed. Five unique 6-alkylidene-2’-substituted penicillanic acid sulfones (1, 2, 3, 4, and 5) were synthesized and tested against OXA-24, a clinically important β-lactamase that inactivates carbapenems and found in A. baumannii. Based upon the roles Tyr112 and Met223 play in the OXA-24 β-lactamase, we also engineered two variants (Tyr112Ala and Tyr112Ala,Met223Ala) to test the hypothesis that the hydrophobic tunnel formed by these residues influences inhibitor recognition. IC50 values, against OXA-24, and two OXA-24 β-lactamase variants ranged from 10 ± 1 (4 vs. WT) to 338 ± 20 nM (5 vs. Tyr112Ala, Met223Ala). Compound 4 possessed the lowest Ki (500 ± 80 nM vs. WT) and 1 possessed the highest inactivation efficiency (kinact/Ki = 0.21 ± 0.02 μM-1s-1). Electrospray ionization mass spectrometry revealed a single covalent adduct, suggesting the formation of an acyl-enzyme intermediate. X-ray structures of OXA-24 complexed to four inhibitors (2.0-2.6 Å) reveal there is formation of stable bicyclic aromatic intermediates with their carbonyl oxygen in the oxyanion hole. These data provide the first structural evidence that 6-alkylidene-2’-substituted penicillin sulfones are effective mechanism-based inactivators of class D β-lactamases. Their unique chemistry makes them developmental candidates. Mechanisms for class D hydrolysis and inhibition are discussed, and a pathway for the evolution of the BlaR1 sensor of Staphylococcus aureus to the class D β-lactamases is proposed. PMID:20822105

  9. Protein synthesis inhibitor from potato tuber

    SciTech Connect

    Romaen, R. )

    1989-04-01

    A protein fraction capable of inhibit in vitro protein synthesis was found in potato tubers in fresh and wounded tissue. Inhibitor activity from fresh tissue decays with wounding. Inhibition activity was detected absorbed to ribsomal fraction and cytosol of potato tuber tissue by a partially reconstituted in vitro system from potato tuber and wheat germ. Adsorbed ribosomal fraction was more suitable of purification. This fraction was washed from ribosomes with 0.3M KCl, concentrated with ammonium sulfate precipitation and purified through sephadex G100 and sephadex G-75 columns chromatography. After 61 fold purification adsorbed protein fraction can inhibit germination of maize, wheat and sesame seeds, as well as {sup 3}H-leucine incorporation into protein by imbibed maize embryos. Inhibition activity was lost by temperature, alkali and protease-K hydrolysis. Preliminar analysis could not show presence of reductor sugars. Physiological role of this inhibitor in relation to rest and active tissue remains to be studied.

  10. Tools for Characterizing Bacterial Protein Synthesis Inhibitors

    PubMed Central

    Orelle, Cédric; Carlson, Skylar; Kaushal, Bindiya; Almutairi, Mashal M.; Liu, Haipeng; Ochabowicz, Anna; Quan, Selwyn; Pham, Van Cuong; Squires, Catherine L.; Murphy, Brian T.

    2013-01-01

    Many antibiotics inhibit the growth of sensitive bacteria by interfering with ribosome function. However, discovery of new protein synthesis inhibitors is curbed by the lack of facile techniques capable of readily identifying antibiotic target sites and modes of action. Furthermore, the frequent rediscovery of known antibiotic scaffolds, especially in natural product extracts, is time-consuming and expensive and diverts resources that could be used toward the isolation of novel lead molecules. In order to avoid these pitfalls and improve the process of dereplication of chemically complex extracts, we designed a two-pronged approach for the characterization of inhibitors of protein synthesis (ChIPS) that is suitable for the rapid identification of the site and mode of action on the bacterial ribosome. First, we engineered antibiotic-hypersensitive Escherichia coli strains that contain only one rRNA operon. These strains are used for the rapid isolation of resistance mutants in which rRNA mutations identify the site of the antibiotic action. Second, we show that patterns of drug-induced ribosome stalling on mRNA, monitored by primer extension, can be used to elucidate the mode of antibiotic action. These analyses can be performed within a few days and provide a rapid and efficient approach for identifying the site and mode of action of translation inhibitors targeting the bacterial ribosome. Both techniques were validated using a bacterial strain whose culture extract, composed of unknown metabolites, exhibited protein synthesis inhibitory activity; we were able to rapidly detect the presence of the antibiotic chloramphenicol. PMID:24041905

  11. Discovery of potent wall teichoic acid early stage inhibitors.

    PubMed

    Labroli, Marc A; Caldwell, John P; Yang, Christine; Lee, Sang Ho; Wang, Hao; Koseoglu, Sandra; Mann, Paul; Yang, Shu-Wei; Xiao, Jing; Garlisi, Charles G; Tan, Christopher; Roemer, Terry; Su, Jing

    2016-08-15

    The widespread emergence of methicillin-resistant Staphylococcus aureus (MRSA) has dramatically eroded the efficacy of current β-lactam antibiotics and created an urgent need for novel treatment options. Using an S. aureus phenotypic screening strategy, we have identified small molecule early stage wall teichoic acid (WTA) pathway-specific inhibitors predicted to be chemically synergistic with β-lactams. These previously disclosed inhibitors, termed tarocins, demonstrate by genetic and biochemical means inhibition of TarO, the first step in WTA biosynthesis. Tarocins demonstrate potent bactericidal synergy in combination with broad spectrum β-lactam antibiotics across diverse clinical isolates of methicillin-resistant Staphylococci. The synthesis and structure-activity relationships (SAR) of a tarocin series will be detailed. Tarocins and other WTA inhibitors may provide a rational strategy to develop Gram-positive bactericidal β-lactam combination agents active against methicillin-resistant Staphylococci. PMID:27436582

  12. Design, synthesis and biological evaluation of novel L-ascorbic acid-conjugated pentacyclic triterpene derivatives as potential influenza virus entry inhibitors.

    PubMed

    Wang, Han; Xu, Renyang; Shi, Yongying; Si, Longlong; Jiao, Pingxuan; Fan, Zibo; Han, Xu; Wu, Xingyu; Zhou, Xiaoshu; Yu, Fei; Zhang, Yongmin; Zhang, Liangren; Zhang, Lihe; Zhou, Demin; Xiao, Sulong

    2016-03-01

    Since the influenza viruses can rapidly evolve, it is urgently required to develop novel anti-influenza agents possessing a novel mechanism of action. In our previous study, two pentacyclic triterpene derivatives (Q8 and Y3) have been found to have anti-influenza virus entry activities. Keeping the potential synergy of biological activity of pentacyclic triterpenes and l-ascorbic acid in mind, we synthesized a series of novel l-ascorbic acid-conjugated pentacyclic triterpene derivatives (18-26, 29-31, 35-40 and 42-43). Moreover, we evaluated these novel compounds for their anti-influenza activities against A/WSN/33 virus in MDCK cells. Among all evaluated compounds, the 2,3-O,O-dibenzyl-6-deoxy-l-ascorbic acid-betulinic acid conjugate (30) showed the most significant anti-influenza activity with an EC50 of 8.7 μM, and no cytotoxic effects on MDCK cells were observed. Time-of-addition assay indicated that compound 30 acted at an early stage of the influenza life cycle. Further analyses revealed that influenza virus-induced hemagglutination of chicken red blood cells was inhibited by treatment of compound 30, and the interaction between the influenza hemagglutinin (HA) and compound 30 was determined by surface plasmon resonance (SPR) with a dissociation constant of KD = 3.76 μM. Finally, silico docking studies indicated that compound 30 and its derivative 31 were able to occupy the binding pocket of HA for sialic acid receptor. Collectively, these results suggested that l-ascorbic acid-conjugated pentacyclic triterpenes were promising anti-influenza entry inhibitors, and HA protein associated with viral entry was a promising drug target. PMID:26866456

  13. Intentional synthesis of corrosion inhibitors based on secondary products of sugar cane processing

    SciTech Connect

    Ledovskykh, V.M.

    1988-07-01

    Secondary products of sugar cane processing (mosto, wax, furfurol) were studied as starting raw materials for creating inhibitors for different purposes and temporary means of protecting metals from corrosion. In order to protect metals in different corrosive media the following inhibitors have been developed: an inhibitor for acid solutions (pickling metals, acid washing of the equipment) based on high-tonnage water-soluble waste mosto and combined synergistic inhibitors based on mixtures of it with cation- and anion-active surfactants, including nitrogen- and sulfur-containing substances obtained by intentional synthesis of another secondary product, furfurol; inhibitors for two-phase media (oil recovery and refining) of the carbonic acid amide and 2-alkylimidazoline classes from sugar cane wax; and inhibitors comprised of Li-, Na-, Ca-, and Al-plastic greases from sugar cane wax for atmospheric conditions.

  14. Microwave assisted synthesis of naphthopyrans catalysed by silica supported fluoroboric acid as a new class of non purine xanthine oxidase inhibitors.

    PubMed

    Sharma, Sahil; Sharma, Kirti; Ojha, Ritu; Kumar, Dinesh; Singh, Gagandip; Nepali, Kunal; Bedi, P M S

    2014-01-15

    A series of naphthopyrans was synthesized employing silica supported fluoroboric acid under solvent free conditions in a microwave reactor. The catalytic influence of HBF4-SiO2 was investigated in detail to optimize the reaction conditions. The synthesised compounds were evaluated for in vitro xanthine oxidase inhibitory activity for the first time. Structure-activity relationship analyses have also been presented. Among the synthesised compounds, NP-17, NP-19, NP-20, NP-23, NP-24, NP-25 and NP-26 were the active inhibitors with an IC50 ranging from 4 to 17 μM. Compound NP-19 with a thiophenyl ring at position 1 emerged as the most potent xanthine oxidase inhibitor (IC50=4 μM) in comparison to allopurinol (IC50=11.10 μM) and febuxostat (IC50=0.025 μM). The basis of significant inhibition of xanthine oxidase by NP-19 was rationalized by its molecular docking at MTE binding site of xanthine oxidase. PMID:24388807

  15. Synthesis and biological activities of novel 5-substituted-1,3,4-oxadiazole Mannich bases and bis-Mannich bases as ketol-acid reductoisomerase inhibitors.

    PubMed

    Zhang, Yan; Liu, Xing-Hai; Zhan, Yi-Zhou; Zhang, Li-Yuan; Li, Zheng-Ming; Li, Yong-Hong; Zhang, Xiao; Wang, Bao-Lei

    2016-10-01

    A series of novel 5-substituted-1,3,4-oxadiazole Mannich bases and bis-Mannich bases have been conveniently synthesized in good yields. Their structures were characterized by IR, (1)H NMR, (13)C NMR and elemental analysis. The preliminary bioassay results indicated that some of the compounds showed promising in vitro fungicidal activities towards several test plant fungi; some of them exhibited significant herbicidal activities against Brassica campestris and excellent in vitro inhibitory activities against rice ketol-acid reductoisomerase (KARI). Among 14 novel compounds, 8c, 8d and 8m showed potent KARI inhibitory activities with Ki value of (0.96±0.42), (3.86±0.49) and (3.10±0.71) μmol/L, respectively, and were comparable with IpOHA. These compounds could be novel KARI inhibitors for further investigation. The density functional theory (DFT) calculations and molecular docking were carried out to study the structure-activity relationship (SAR) of the active inhibitors in this Letter. PMID:27575481

  16. Hypolipidemic drugs are inhibitors of phosphatidylcholine synthesis.

    PubMed Central

    Parthasarathy, S; Kritchevsky, D; Baumann, W J

    1982-01-01

    Clofibric acid (CPIB) and several other systemic hypolipidemic drugs are shown to block phosphatidylcholine synthesis by inhibiting cholinephosphotransferase (ChoPTase; CDPcholine:1,2-diacylglycerol cholinephosphotransferase, EC 2.7.8.2) and particularly lysolecithin acyltransferase (LLAcylTase; acyl-CoA:1-acylglycero-3-phosphocholine O-acyltransferase, EC 2.3.1.23) of rat liver microsomes. Whereas millimolar drug concentrations are required to affect de novo lecithin synthesis catalyzed by ChoPTase, reacylation of lysolecithin by LLAcylTase is inhibited at micromolar levels. Increasing effectiveness in ChoPTase inhibition is observed in the series CPIB, SaH-42-348, tibric acid, S-321328, WY-14643, S-8527, and DH-990, with IC50 ranging from 22 mM (CPIB) to 0.3 mM (DH-990). LLAcylTase inhibition by the hypolipidemic drugs follows the same general pattern, but IC50 concentrations range from 9 mM (CPIB) to 40 microM (DH-990). The agents inhibit ChoPTase (Ki, 25-0.25 mM) and LLAcylTase (Ki, 10-0.025 mM) noncompetitively. The data suggest that inhibition of phosphatidylcholine synthesis, particularly by the LLAcylTase pathway, may be related to a drug's effectiveness in decreasing serum triglyceride and cholesterol levels by blocking lipoprotein synthesis. PMID:6294663

  17. Design, synthesis, and in vitro and biological evaluation of potent amino acid-derived thiol inhibitors of the metallo-β-lactamase IMP-1.

    PubMed

    Arjomandi, Omid Khalili; Hussein, Waleed M; Vella, Peter; Yusof, Yusralina; Sidjabat, Hanna E; Schenk, Gerhard; McGeary, Ross P

    2016-05-23

    There are currently no clinically available inhibitors of metallo-β-lactamases (MBLs). These enzymes confer resistance to bacteria against a broad range of commonly used β-lactam antibiotics, and are produced by an increasing number of bacterial pathogens. In this study, several thiol derivatives of l-amino acids were designed and synthesized, and their inhibitory effects against the metallo-β-lactamase IMP-1 (subclass B1) were investigated. The most potent compound, derived from l-tyrosine, exhibited competitive inhibition, with a Ki of 86 nM. The ability of this compound to render MBL-expressing bacteria susceptible to imipenem was examined. Reductions in MIC values up to 5.2-fold were observed. PMID:27017264

  18. Design, Synthesis, and Crystal Structures of 6-Alkylidene-2 -Substituted Penicillanic Acid Sulfones as Potent Inhibitors of Acinetobacter baumannii OXA-24 Carbapenemase

    SciTech Connect

    Bou, G.; Santillana, E; Sheri, A; Beceiro, A; Sampson, J; Kalp, M; Bethel, C; Distler, A; Drawz, S; et. al.

    2010-01-01

    Class D {beta}-lactamases represent a growing and diverse class of penicillin-inactivating enzymes that are usually resistant to commercial {beta}-lactamase inhibitors. As many such enzymes are found in multi-drug resistant (MDR) Acinetobacter baumannii and Pseudomonas aeruginosa, novel {beta}-lactamase inhibitors are urgently needed. Five unique 6-alkylidene-2{prime}-substituted penicillanic acid sulfones (1-5) were synthesized and tested against OXA-24, a clinically important {beta}-lactamase that inactivates carbapenems and is found in A. baumannii. Based upon the roles Tyr112 and Met223 play in the OXA-24 {beta}-lactamase, we also engineered two variants (Tyr112Ala and Tyr112Ala,Met223Ala) to test the hypothesis that the hydrophobic tunnel formed by these residues influences inhibitor recognition. IC{sub 50} values against OXA-24 and two OXA-24 {beta}-lactamase variants ranged from 10 {+-} 1 (4 vs WT) to 338 {+-} 20 nM (5 vs Tyr112Ala, Met223Ala). Compound 4 possessed the lowest K{sub i} (500 {+-} 80 nM vs WT), and 1 possessed the highest inactivation efficiency (k{sub inact}/K{sub i} = 0.21 {+-} 0.02 {micro}M{sup -1}s{sup -1}). Electrospray ionization mass spectrometry revealed a single covalent adduct, suggesting the formation of an acyl-enzyme intermediate. X-ray structures of OXA-24 complexed to four inhibitors (2.0-2.6 {angstrom}) reveal the formation of stable bicyclic aromatic intermediates with their carbonyl oxygen in the oxyanion hole. These data provide the first structural evidence that 6-alkylidene-2{prime}-substituted penicillin sulfones are effective mechanism-based inactivators of class D {beta}-lactamases. Their unique chemistry makes them developmental candidates. Mechanisms for class D hydrolysis and inhibition are discussed, and a pathway for the evolution of the BlaR1 sensor of Staphylococcus aureus to the class D {beta}-lactamases is proposed.

  19. Synthesis and evaluation of 1-hydroxy/methoxy-4-methyl-2-phenyl-1H-imidazole-5-carboxylic acid derivatives as non-purine xanthine oxidase inhibitors.

    PubMed

    Chen, Shaolei; Zhang, Tingjian; Wang, Jian; Wang, Fangyang; Niu, Handong; Wu, Chunfu; Wang, Shaojie

    2015-10-20

    Xanthine oxidase is a key enzyme that catalyses hypoxanthine and xanthine to uric acid, whose overproduction leads to the gout-causing hyperuricemia. In this study, a series of 1-hydroxy/methoxy-4-methyl-2-phenyl-1H-imidazole-5-carboxylic acid derivatives (4a-4k and 6a-6k) was synthesized and evaluated for their inhibitory potency against xanthine oxidase. The 1-hydroxyl substituted derivatives 4a-4k showed excellent inhibitory potency with IC50 values ranging from 0.003 μM to 1.2 μM, with compounds 4d (IC₅₀ = 0.003 μM), 4e (IC₅₀ = 0.003 μM), and 4f (IC₅₀ = 0.006 μM) manifesting the most potent xanthine oxidase inhibitory potency that were comparable with that of Febuxostat (IC₅₀ = 0.01 μM). Lineweaver-Burk plot analysis revealed that representative compound 4f acted as a mixed-type inhibitor for xanthine oxidase. The basis of significant inhibition of xanthine oxidase by 4f was rationalized by its molecular docking into the active site of xanthine dehydrogenase. PMID:26363870

  20. Synthesis, molecular modeling and biological evaluation of novel 2-allyl amino 4-methyl sulfanyl butyric acid as α-amylase and α-glucosidase inhibitor

    NASA Astrophysics Data System (ADS)

    Balan, Kannan; Perumal, Perumal; Sundarabaalaji, Narayanan; Palvannan, Thayumanavan

    2015-02-01

    In the present study 2-allyl amino 4-methyl sulfanyl butyric acid (AMSB) was synthesized in good yield. AMSB was characterized by Fourier transforms infrared spectroscopy (FTIR), Nuclear magnetic resonance (NMR) (1H and 13C) and Liquid chromatography mass spectrometry (LCMS). The radical scavenging activity and reducing power assay of AMSB was assessed using 1-1-diphenyl 2-picryl hydrazyl (DPPH), 2,2‧-azino-bis (3-ethyl benzothiazoline-6-sulfonic acid) (ABTS) and ferric ion reducing antioxidant power assay (FRAP) and was found to be 44.1, 34.71 and 41.7 μg/ml respectively. The compound showed effective inhibition against α-amylase and α-glucosidase. AMSB was identified to be a reversible mixed noncompetitive inhibitor of α-amylase and α-glucosidase. The molecular docking study was carried out to evaluate the specific groove binding properties and affords valuable information of AMSB binding mode in the active site of α-glucosidase the study may lead to the which leads to the rational design of new class of antidiabetic drugs targeting α-glucosidase based on AMSB in near future.

  1. Synthesis, structure-activity, and structure-stability relationships of 2-substituted-N-(4-oxo-3-oxetanyl) N-acylethanolamine acid amidase (NAAA) inhibitors.

    PubMed

    Vitale, Romina; Ottonello, Giuliana; Petracca, Rita; Bertozzi, Sine Mandrup; Ponzano, Stefano; Armirotti, Andrea; Berteotti, Anna; Dionisi, Mauro; Cavalli, Andrea; Piomelli, Daniele; Bandiera, Tiziano; Bertozzi, Fabio

    2014-02-01

    N-Acylethanolamine acid amidase (NAAA) is a cysteine amidase that preferentially hydrolyzes saturated or monounsaturated fatty acid ethanolamides (FAEs), such as palmitoylethanolamide (PEA) and oleoylethanolamide (OEA), which are endogenous agonists of nuclear peroxisome proliferator-activated receptor-α (PPAR-α). Compounds that feature an α-amino-β-lactone ring have been identified as potent and selective NAAA inhibitors and have been shown to exert marked anti-inflammatory effects that are mediated through FAE-dependent activation of PPAR-α. We synthesized and tested a series of racemic, diastereomerically pure β-substituted α-amino-β-lactones, as either carbamate or amide derivatives, investigating the structure-activity and structure-stability relationships (SAR and SSR) following changes in β-substituent size, relative stereochemistry at the α- and β-positions, and α-amino functionality. Substituted carbamate derivatives emerged as more active and stable than amide analogues, with the cis configuration being generally preferred for stability. Increased steric bulk at the β-position negatively affected NAAA inhibitory potency, while improving both chemical and plasma stability. PMID:24403170

  2. EFFECT OF ANTIBIOTICS AND INHIBITORS ON M PROTEIN SYNTHESIS

    PubMed Central

    Brock, Thomas D.

    1963-01-01

    Brock, Thomas D. (Western Reserve University, Cleveland, Ohio). Effect of antibiotics and inhibitors on M protein synthesis. J. Bacteriol. 85:527–531. 1963.—This work extends the observations of Fox and Krampitz on M protein synthesis in nongrowing cells of streptococci. A survey of a large number of antibiotics and other potential inhibitors was made. Some substances bring about inhibition of fermentation and inhibit M protein synthesis because they deprive the cell of the energy needed for this process. A second group of substances inhibit growth at concentrations tenfold or more lower than they inhibit M protein synthesis. These are the antibiotics which inhibit synthesis of cell wall or other structures in growing cells, but do not affect protein synthesis. A third group of substances inhibit growth and M protein synthesis at the same concentration. These substances probably inhibit growth because they inhibit general protein synthesis, and are therefore specific inhibitors of protein synthesis. In this class are chloramphenicol, erythromycin, and the tetracyclines. Several other antibiotics of previously unknown mode of action are in this class. A fourth group of substances had no effect on M protein synthesis. No substances were found which inhibited M protein synthesis at a lower concentration than that which inhibited growth. M protein synthesis in nongrowing cells may be a useful model system for obtaining a detailed understanding of protein synthesis. PMID:14042928

  3. Enantioselective Synthesis of Dioxatriquinane Structural Motifs for HIV-1 Protease Inhibitors Using a Cascade Radical Cyclization†

    PubMed Central

    Ghosh, Arun K.; Xu, Chun-Xiao; Osswald, Heather L.

    2015-01-01

    Synthesis of novel HIV-1 protease inhibitors incorporating dioxatriquinane-derived P2-ligands is described. The tricyclic ligand alcohol contains five contiguous chiral centers. The ligand alcohols were prepared in optically active form by an enzymatic asymmetrization of mesodiacetate, cascade radical cyclization, and Lewis acid catalyzed reduction as the key steps. Inhibitors with dioxatriquinane-derived P2-ligands exhibited low nanomolar HIV-1 protease activity. PMID:26185337

  4. Probing for improved potency and in vivo bioavailability of excitatory amino acid transporter subtype 1 inhibitors UCPH-101 and UCPH-102: design, synthesis and pharmacological evaluation of substituted 7-biphenyl analogs.

    PubMed

    Erichsen, Mette N; Hansen, Jeanette; Ruiz, Josep A; Demmer, Charles S; Abrahamsen, Bjarke; Bastlund, Jesper F; Bundgaard, Christoffer; Jensen, Anders A; Bunch, Lennart

    2014-10-01

    Uptake of the major excitatory neurotransmitter in the CNS, (S)-glutamate, is mediated by a family of excitatory amino acid transporters (EAAT). Previously we have explored the structure-activity relationship (SAR) of a series of EAAT1 selective inhibitors, leading to the development of the potent inhibitors UCPH-101 and UCPH-102. In the present study, we set out to improve the solubility properties of these EAAT1 inhibitors with the objective to develop analogs more suited as pharmacological tools for in vivo studies of EAAT1 in terms of their bioavailability. A total of 23 novel UCPH-101/102 analogs were designed, synthesized and characterized pharmacologically at EAAT1-3 in a [(3)H]-D-aspartate uptake assay. Most notably, the potent EAAT1 inhibition displayed of UCPH-101 and UCPH-102 was retained in analog 1d in which the napht-1-yl group in the 7-position of UCPH-102 has been replaced by an o-biphenyl moiety. In contrast, EAAT1 activity was dramatically compromised in analogs 1e and 1f comprising m- and p-biphenyl groups as 7-substituents, respectively. Analog 1d displayed low bioavailability after oral administration in rats, and this problem was addressed by the synthesis of a series of analogs with different chloro, fluoro, methoxy, triflouromethyl and carboxy substitution patterns at the o-biphenyl group of 1d (1h-1s) and m- and p-pyridine analogs of 1d (1t and 1v). Unfortunately, all of the modifications resulted in substantial decreased EAAT1 inhibitory activity, which supports the notion of a very lipophilic binding pocket in EAAT1 for the aromatic 7-substituent in these ligands. In conclusion, while we have not succeeded in developing UCPH-101/102 analogs possessing improved bioavailability properties, this study does offer interesting SAR information about this inhibitor class, and analog 1d seems to be an interesting lead for future SAR studies with focus on the development of more potent EAAT1 inhibitors. PMID:24682739

  5. Soraphen A, an inhibitor of acetyl CoA carboxylase activity, interferes with fatty acid elongation

    PubMed Central

    Jump, Donald B.; Torres-Gonzalez, Moises; Olson, L. Karl

    2010-01-01

    Acetyl CoA carboxylase (ACC1 & ACC2) generates malonyl CoA, a substrate for de novo lipogenesis (DNL) and an inhibitor of mitochondrial fatty acid β-oxidation (FAO). Malonyl CoA is also a substrate for microsomal fatty acid elongation, an important pathway for saturated (SFA), mono- (MUFA) and polyunsaturated fatty acid (PUFA) synthesis. Despite the interest in ACC as a target for obesity and cancer therapy, little attention has been given to the role ACC plays in long chain fatty acid synthesis. This report examines the effect of pharmacological inhibition of ACC on DNL & palmitate (16:0) and linoleate (18:2,n-6) metabolism in HepG2 and LnCap cells. The ACC inhibitor, soraphen A, lowers cellular malonyl CoA, attenuates DNL and the formation of fatty acid elongation products derived from exogenous fatty acids, i.e., 16:0 & 18:2,n-6; IC50 ~ 5 nM. Elevated expression of fatty acid elongases (Elovl5, Elovl6) or desaturases (FADS1, FADS2) failed to override the soraphen A effect on SFA, MUFA or PUFA synthesis. Inhibition of fatty acid elongation leads to the accumulation of 16- and 18-carbon unsaturated fatty acids derived from 16:0 and 18:2,n-6, respectively. Pharmacological inhibition of ACC activity will not only attenuate DNL and induce FAO, but will also attenuate the synthesis of very long chain saturated, mono- and polyunsaturated fatty acids. PMID:21184748

  6. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  7. Synthesis and biological evaluation of neutrophilic inflammation inhibitors.

    PubMed

    Bruno, Olga; Brullo, Chiara; Arduino, Nicoletta; Schenone, Silvia; Ranise, Angelo; Bondavalli, Francesco; Ottonello, Luciano; Dapino, Patrizia; Dallegri, Franco

    2004-03-01

    In several non-infectious human diseases, such as ulcerous colitis, rheumatoid arthritis, chronic obstructive pulmonary disease (COPD), the extravasal recruitment of neutrophils plays a crucial role in the development of tissue damage, which, when persistent, can lead to the irreversible organ dysfunction. The neutrophil activation is controlled by a number of intracellular pathways, particularly by a cAMP-dependent protein kinase A (PKA) which also acts on phosphodiesterase IV (PDE4) gene stimulating the synthesis of this enzyme, able to transform cAMP to inactive AMP. PDE4 inhibitors enhance intracellular cAMP and decrease inflammatory cell activation. Several 3-cyclopentyloxy-4-methoxybenzaldehyde and 3-cyclopentyloxy-4-methoxybenzoic acid derivatives were synthesized and studied by us to evaluate their ability to inhibit the superoxide anion production in human neutrophils. These compounds were found able to inhibit the neutrophil activation and some of them increased the cAMP level on tumor necrosis factor-alpha-stimulated neutrophils. Moreover, they also inhibited selectively the human PDE4 enzyme, although they are less potent than the reference compound Rolipram. We report here synthesis, biological studies and some SAR considerations concerning the above mentioned compounds. PMID:14987986

  8. Plasmin inhibitors with hydrophobic amino acid-based linker between hydantoin moiety and benzimidazole scaffold enhance inhibitory activity.

    PubMed

    Teno, Naoki; Gohda, Keigo; Yamashita, Yukiko; Otsubo, Tadamune; Yamaguchi, Masafumi; Wanaka, Keiko; Tsuda, Yuko

    2016-05-01

    In this letter we report the design and synthesis of a series of plasmin inhibitors, which share the amino acid-based linker with limited free rotation between the hydantoin moiety and the benzimidazole scaffold. Our studies led to potent plasmin inhibitors and yielded important new insights into their structure-activity relationship for binding to the active site of plasmin. PMID:27009905

  9. 2-Aminoimidazole Amino Acids as Inhibitors of the Binuclear Manganese Metalloenzyme Human Arginase I

    SciTech Connect

    Ilies, M.; Di Costanzo, L; North, M; Scott, J; Christianson, D

    2010-01-01

    Arginase, a key metalloenzyme of the urea cycle that converts L-arginine into L-ornithine and urea, is presently considered a pharmaceutical target for the management of diseases associated with aberrant L-arginine homeostasis, such as asthma, cardiovascular diseases, and erectile dysfunction. We now report the design, synthesis, and evaluation of a series of 2-aminoimidazole amino acid inhibitors in which the 2-aminoimidazole moiety serves as a guanidine mimetic. These compounds represent a new class of arginase inhibitors. The most potent inhibitor identified in this study, 2-(S)-amino-5-(2-aminoimidazol-1-yl)pentanoic acid (A1P, 10), binds to human arginase I with K{sub d} = 2 {micro}M and significantly attenuates airways hyperresponsiveness in a murine model of allergic airways inflammation. These findings suggest that 2-aminoimidazole amino acids represent new leads for the development of arginase inhibitors with promising pharmacological profiles.

  10. 2-Aminoimidazole Amino Acids as Inhibitors of the Binuclear Manganese Metalloenzyme Human Arginase I

    PubMed Central

    Ilies, Monica; Di Costanzo, Luigi; North, Michelle L.; Scott, Jeremy A.; Christianson, David W.

    2010-01-01

    Arginase, a key metalloenzyme of the urea cycle that converts L-arginine into L-ornithine and urea, is presently considered a pharmaceutical target for the management of diseases associated with aberrant L-arginine homeostasis, such as asthma, cardiovascular diseases, and erectile dysfunction. We now report the design, synthesis, and evaluation of a series of 2-aminoimidazole amino acids inhibitors in which the 2-aminoimidazole moiety serves as a guanidine mimetic. These compounds represent a new class of arginase inhibitors. The most potent inhibitor identified in this study, 2-(S)-amino-5-(2-aminoimidazol-1-yl)-pentanoic acid (A1P, 10), binds to human arginase I with Kd = 2 μM and significantly attenuates airways hyperresponsiveness in a murine model of allergic airways inflammation. These findings suggest that 2-aminoimidazole amino acids represent new leads for the development of arginase inhibitors with promising pharmacological profiles. PMID:20441173

  11. Synthesis and biological evaluation of ring A and/or C expansion and opening echinocystic acid derivatives for anti-HCV entry inhibitors.

    PubMed

    Wang, Han; Yu, Fei; Peng, Yiyun; Wang, Qi; Han, Xu; Xu, Renyang; Zhou, Xiaoshu; Wan, Chuanxing; Fan, Zibo; Jiao, Pingxuan; Zhang, Yongmin; Zhang, Lihe; Zhou, Demin; Xiao, Sulong

    2015-09-18

    Echinocystic acid (EA), a naturally occurring oleanane-type triterpene isolated from Dipsacus asperoides, was found to have anti-HCV entry activity in our previous study. Expansion of triterpene structural diversity, including the ring A and/or C expansion and opening, was performed. To elucidate the pharmacophore of EA, seven lactones (8, 16, 17, 24, 26, 35 and 41), three 3,28-dioic acids (9, 36 and 42) and two pentols (10 and 27) were synthesized. The anti-HCV entry activities of those derivatives, along with their parental compound EA and analogs α,β-unsaturated ketone (18), were evaluated. All the products showed no improvement but detrimental effect on potency of EA. The results demonstrated that ring A and C of EA are highly conserved, indicating the steric effects of the rigid skeleton have a profound effect on the potency. PMID:26318066

  12. Zaragozic acids: a family of fungal metabolites that are picomolar competitive inhibitors of squalene synthase.

    PubMed

    Bergstrom, J D; Kurtz, M M; Rew, D J; Amend, A M; Karkas, J D; Bostedor, R G; Bansal, V S; Dufresne, C; VanMiddlesworth, F L; Hensens, O D

    1993-01-01

    Three closely related fungal metabolites, zaragozic acids A, B, and C, that are potent inhibitors of squalene synthase have been isolated and characterized. Zaragozic acids A, B, and C were produced from an unidentified sterile fungal culture, Sporormiella intermedia, and Leptodontium elatius, respectively. The structures of the zaragozic acids and their trimethyl esters were determined by a combination of physical and chemical techniques. The zaragozic acids are characterized by a novel 2,8-dioxobicyclo[3.2.1]octane-4,6,7- trihydroxyl-3,4,5-tricarboxylic acid core and differ from each other in the structures of the 6-acyl and 1-alkyl side chains. They were found to be potent competitive inhibitors of rat liver squalene synthase with apparent Ki values of 78 pM, 29 pM, and 45 pM, respectively. They inhibited cholesterol synthesis in Hep G2 cells, and zaragozic acid A was an inhibitor of acute hepatic cholesterol synthesis in the mouse (50% inhibitory dose of 200 micrograms/kg of body weight). Inhibition of squalene synthase in cells and in vivo was accompanied by an accumulation of label from [3H]mevalonate into farnesyl diphosphate, farnesol, and organic acids. These data indicate that the zaragozic acids are a previously unreported class of therapeutic agents with potential for the treatment of hypercholesterolemia. PMID:8419946

  13. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  14. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  15. Hydroxamic acids in asymmetric synthesis.

    PubMed

    Li, Zhi; Yamamoto, Hisashi

    2013-02-19

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  16. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  17. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  18. Synthesis of amino heterocycle aspartyl protease inhibitors.

    PubMed

    Chambers, Rachel K; Khan, Tanweer A; Olsen, David B; Sleebs, Brad E

    2016-06-14

    Aspartyl proteases are important pharmacological targets. Historically aspartyl proteases have been commonly targeted with transition state derived peptidomimetics. The strategy to develop aspartyl protease inhibitors has undertaken a dramatic paradigm shift in the last 10 years. The pharmaceutical industry in 2005 disclosed several scaffolds or "head groups" that prompted the field to move beyond peptidomimetic derived inhibitors. Since the discovery of the first amino heterocycle aspartyl protease inhibitor, the amino hydantoin, industry and academia have positioned themselves for a foothold on the new molecular space, designing a variety of related "head groups". Both the design and synthetic efforts involved in constructing these scaffolds are varied and complex. Here we highlight the synthetic strategies used to access these amino heterocycle scaffolds. PMID:27143279

  19. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  20. Eukaryotic protein synthesis inhibitors identified by comparison of cytotoxicity profiles

    PubMed Central

    CHAN, JENNY; KHAN, SHAKILA N.; HARVEY, ISABELLE; MERRICK, WILLIAM; PELLETIER, JERRY

    2004-01-01

    The National Cancer Institute (NCI) Human Tumor Cell Line Anti-Cancer Drug Screen has evaluated the cytotoxicity profiles of a large number of synthetic compounds, natural products, and plant extracts on 60 different cell lines. The data for each compound/extract can be assessed for similarity of cytotoxicity pattern, relative to a given test compound, using an algorithm called COMPARE. In applying a chemical biology approach to better understand the mechanism of eukaryotic protein synthesis, we used these resources to search for novel inhibitors of translation. The cytotoxicity profiles of 31 known protein synthesis inhibitors were used to identify compounds from the NCI database with similar activity profiles. Using this approach, two natural products, phyllanthoside and nagilactone C, were identified and characterized as novel protein synthesis inhibitors. Both compounds are specific for the eukaryotic translation apparatus, function in vivo and in vitro, and interfere with translation elongation. Our results demonstrate the feasibility of utilizing cytotoxicity profiles to identify new inhibitors of translation. PMID:14970397

  1. Pyridoxine hydroxamic acids as novel HIV-integrase inhibitors.

    PubMed

    Stranix, Brent R; Wu, Jinzi J; Milot, Guy; Beaulieu, Françis; Bouchard, Jean-Emanuel; Gouveia, Kristine; Forte, André; Garde, Seema; Wang, Zhigang; Mouscadet, Jean-François; Delelis, Olivier; Xiao, Yong

    2016-02-15

    A series of pyridoxine hydroxamic acid analog bearing a 5-aryl-spacers were synthesized. Evaluation of these novel HIV integrase complex inhibitors revealed compounds with high potency against wild-type HIV virus. PMID:26826732

  2. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  3. Natural fatty acid synthase inhibitors as potent therapeutic agents for cancers: A review.

    PubMed

    Zhang, Jia-Sui; Lei, Jie-Ping; Wei, Guo-Qing; Chen, Hui; Ma, Chao-Ying; Jiang, He-Zhong

    2016-09-01

    Context Fatty acid synthase (FAS) is the only mammalian enzyme to catalyse the synthesis of fatty acid. The expression level of FAS is related to cancer progression, aggressiveness and metastasis. In recent years, research on natural FAS inhibitors with significant bioactivities and low side effects has increasingly become a new trend. Herein, we present recent research progress on natural fatty acid synthase inhibitors as potent therapeutic agents. Objective This paper is a mini overview of the typical natural FAS inhibitors and their possible mechanism of action in the past 10 years (2004-2014). Method The information was collected and compiled through major databases including Web of Science, PubMed, and CNKI. Results Many natural products induce cancer cells apoptosis by inhibiting FAS expression, with fewer side effects than synthetic inhibitors. Conclusion Natural FAS inhibitors are widely distributed in plants (especially in herbs and foods). Some natural products (mainly phenolics) possessing potent biological activities and stable structures are available as lead compounds to synthesise promising FAS inhibitors. PMID:26864638

  4. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  5. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.

    PubMed

    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu

    2015-10-20

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  6. Bis(aminomethyl)phosphinic Acid, a Highly Promising Scaffold for the Development of Bacterial Urease Inhibitors

    PubMed Central

    2014-01-01

    Inhibitors of bacterial ureases are considered to be promising compounds in the treatment of infections caused by Helicobacter pylori in the gastric tract and/or by urealytic bacteria (e.g., Proteus species) in the urinary tract. A new, extended transition state scaffold, bis(aminomethyl)phosphinic acid, was successfully explored for the construction of effective enzyme inhibitors. A reliable methodology for the synthesis of phosphinate analogues in a three-component Mannich-type reaction was elaborated. The obtained molecules were assayed against ureases purified from Sporosarcina pasteurii and Proteus mirabilis, and aminomethyl(N-n-hexylaminomethyl)phosphinic acid was found to be the most potent inhibitor, with a Ki = 108 nM against the S. pasteurii enzyme. PMID:25699141

  7. Bis(aminomethyl)phosphinic Acid, a Highly Promising Scaffold for the Development of Bacterial Urease Inhibitors.

    PubMed

    Macegoniuk, Katarzyna; Dziełak, Anna; Mucha, Artur; Berlicki, Łukasz

    2015-02-12

    Inhibitors of bacterial ureases are considered to be promising compounds in the treatment of infections caused by Helicobacter pylori in the gastric tract and/or by urealytic bacteria (e.g., Proteus species) in the urinary tract. A new, extended transition state scaffold, bis(aminomethyl)phosphinic acid, was successfully explored for the construction of effective enzyme inhibitors. A reliable methodology for the synthesis of phosphinate analogues in a three-component Mannich-type reaction was elaborated. The obtained molecules were assayed against ureases purified from Sporosarcina pasteurii and Proteus mirabilis, and aminomethyl(N-n-hexylaminomethyl)phosphinic acid was found to be the most potent inhibitor, with a K i = 108 nM against the S. pasteurii enzyme. PMID:25699141

  8. Synthesis of the Pitstop family of clathrin inhibitors.

    PubMed

    Robertson, Mark J; Deane, Fiona M; Stahlschmidt, Wiebke; von Kleist, Lisa; Haucke, Volker; Robinson, Phillip J; McCluskey, Adam

    2014-07-01

    This protocol describes the synthesis of two classes of clathrin inhibitors, Pitstop 1 and Pitstop 2, along with two inactive analogs that can be used as negative controls (Pitstop inactive controls, Pitnot-2 and Pitnot-2-100). Pitstop-induced inhibition of clathrin TD function acutely interferes with clathrin-mediated endocytosis (CME), synaptic vesicle recycling and cellular entry of HIV, whereas clathrin-independent internalization pathways and secretory traffic proceed unperturbed; these reagents can, therefore, be used to investigate clathrin function, and they have potential pharmacological applications. Pitstop 1 is synthesized in two steps: sulfonation of 1,8-naphthalic anhydride and subsequent reaction with 4-amino(methyl)aniline. Pitnot-1 results from the reaction of 4-amino(methyl)aniline with commercially available 4-sulfo-1,8-naphthalic anhydride potassium salt. Reaction of 1-naphthalene sulfonyl chloride with pseudothiohydantoin followed by condensation with 4-bromobenzaldehyde yields Pitstop 2. The synthesis of the inactive control commences with the condensation of 4-bromobenzaldehyde with the rhodanine core. Thioketone methylation and displacement with 1-napthylamine affords the target compound. Although Pitstop 1-series compounds are not cell permeable, they can be used in biochemical assays or be introduced into cells via microinjection. The Pitstop 2-series compounds are cell permeable. The synthesis of these compounds does not require specialist equipment and can be completed in 3-4 d. Microwave irradiation can be used to reduce the synthesis time. The synthesis of the Pitstop 2 family is easily adaptable to enable the synthesis of related compounds such as Pitstop 2-100 and Pitnot-2-100. The procedures are also simple, efficient and amenable to scale-up, enabling cost-effective in-house synthesis for users of these inhibitor classes. PMID:24922269

  9. Synthesis of new polysialic acid derivatives.

    PubMed

    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke

    2010-09-01

    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  10. New peptide deformylase inhibitors design, synthesis and pharmacokinetic assessment.

    PubMed

    Lv, Fengping; Chen, Chen; Tang, Yang; Wei, Jianhai; Zhu, Tong; Hu, Wenhao

    2016-08-01

    The docking approach for the screening of designed small molecule ligands, led to the identification of a critical arginine residue in peptide deformylase for spiro cyclopropyl PDF inhibitor's extra hydrophobic binding, providing us a useful tool for searching more efficient PDF inhibitors to fight for horrifying antibiotics resistance. Further synthetic modification was undertaken to optimize the potency of amide compounds. To lower metabolic susceptibility and in turn reduce unwanted metabolic toxicity that was observed clinically, while retaining desired antibacterial activity, the use of azoles as amide bioisosteres had also been investigated. After the completion of chemical synthesis, all the compounds were evaluated through in vitro antibacterial activity assay, some of which were further subject to in vivo rat pharmacokinetic assessment. Those findings in this letter showed that spiro cyclopropyl proline N-formyl hydroxylamines, and especially the bioisosteric azoles, can represent a promising class of PDF inhibitors. PMID:27293070

  11. Synthesis and evaluation of transthyretin amyloidosis inhibitors containing carborane pharmacophores

    PubMed Central

    Julius, Richard L.; Farha, Omar K.; Chiang, Janet; Perry, L. Jeanne; Hawthorne, M. Frederick

    2007-01-01

    Carboranes represent a potentially rich but underutilized class of inorganic and catabolism-inert pharmacophores. The regioselectivity and ease of derivatization of carboranes allows for facile syntheses of a wide variety of novel structures. The steric bulk, rigidity, and ease of B- and C-derivatization and lack of π-interactions associated with hydrophobic carboranes may be exploited to enhance the selectivity of previously identified bioactive molecules. Transthyretin (TTR) is a thyroxine-transport protein found in the blood that has been implicated in a variety of amyloid related diseases. Previous investigations have identified a variety of nonsteroidal antiinflammatory drugs (NSAIDs) and structurally related derivatives that imbue kinetic stabilization to TTR, thus inhibiting its dissociative fragmentation and subsequent aggregation to form putative toxic amyloid fibrils. However, the cyclooxygenase (COX) activity associated with these pharmaceuticals may limit their potential as long-term therapeutic agents for TTR amyloid diseases. Here, we report the synthesis and evaluation of carborane-containing analogs of the promising NSAID pharmaceuticals previously identified. The replacement of a phenyl ring in the NSAIDs with a carborane moiety greatly decreases their COX activity with the retention of similar efficacy as an inhibitor of TTR dissociation. The most promising of these compounds, 1-carboxylic acid-7-[3-fluorophenyl]-1,7-dicarba-closo-dodecaborane, showed effectively no COX-1 or COX-2 inhibition at a concentration more than an order of magnitude larger than the concentration at which TTR dissociation is nearly completely inhibited. This specificity is indicative of the potential for the exploitation of the unique properties of carboranes as potent and selective pharmacophores. PMID:17360344

  12. Design, synthesis, molecular docking studies and in vitro screening of ethyl 4-(3-benzoylthioureido) benzoates as urease inhibitors.

    PubMed

    Saeed, Aamer; Khan, Muhammad Siraj; Rafique, Hummera; Shahid, Mohammad; Iqbal, Jamshed

    2014-02-01

    Thioureas are exceptionally versatile building blocks towards the synthesis of wide variety of heterocyclic systems, which also possess extensive range of pharmacological activities. The substituted benzoic acids were converted into corresponding acid chlorides, these acid chlorides were then treated with potassium thiocyanate in acetone and then the reaction mixture was refluxed for 1-2h afford ethyl 4-(3-benzoylthioureido)benzoates thioureas in good yields. All the newly synthesized compounds were evaluated for their urease inhibitory activities and were found to be potent inhibitors of urease enzyme. Compounds 1f and 1g were identified as the most potent urease inhibitors (IC50 0.21 and 0.13 μM, respectively), and was 100-fold more potent than the standard inhibitors. Further molecular docking studies were carried out using the crystal structure of urease to find out the binding mode of the inhibitors with the enzyme. PMID:24269986

  13. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  14. Discovery, biosynthesis, and mechanism of action of the zaragozic acids: potent inhibitors of squalene synthase.

    PubMed

    Bergstrom, J D; Dufresne, C; Bills, G F; Nallin-Omstead, M; Byrne, K

    1995-01-01

    The zaragozic acids (ZAs), a family of fungal metabolites containing a novel 4,6,7-trihydroxy-2,8-dioxobicyclo[3.2.1]octane-3,4,5-tricarboxylic acid core, were discovered independently by two separate groups screening natural product sources to discover inhibitors of squalene synthase. This family of compounds all contain the same core but differ in their 1-alkyl and their 6-acyl side chains. Production of the ZAs is distributed over an extensive taxonomic range of Ascomycotina or their anamorphic states. The zaragozic acids are very potent inhibitors of squalene synthase that inhibit cholesterol synthesis and lower plasma cholesterol levels in primates. They also inhibit fungal ergosterol synthesis and are potent fungicidal compounds. The biosynthesis of the zaragozic acids appears to proceed through alkyl citrate intermediates and new members of the family have been produced through directed biosynthesis. These potent natural product based inhibitors of squalene synthase have potential to be developed either as cholesterol lowering agents and/or as antifungal agents. PMID:8561474

  15. [The action of catecholamine-synthesis inhibitors and of spiperone on sea urchin and mouse embryos].

    PubMed

    Markova, L N; Sakharova, N Iu; Bezuglov, V V

    2000-01-01

    We studied the effects of three inhibitors of catecholamine synthesis on the development of sea urchins Sphaerechinus granularis and Paracentrotus lividus. These drugs affected the early embryogenesis, which was expressed in inhibition of the cleavage divisions, appearance of abnormal embryos, and developmental arrest. The addition of arachidonic acid amide and dopamine to the incubation medium weakened the effects of the inhibitors. Spiperone induced developmental defects in preimplantation mouse embryos and sea urchin embryos. Arachidonic acid amide with dopamine exerted a protective effect against spiperone when introduced to sea urchin embryos at the blastula or late gastrula stages, rather than after fertilization. In murine embryos, this amide induced developmental defects and arrest itself and its effect was reversible. Possible mechanisms underlying the effects of these drugs are discussed. PMID:10732361

  16. Microwave-Assisted Synthesis of a MK2 Inhibitor by Suzuki-Miyaura Coupling for Study in Werner Syndrome Cells

    PubMed Central

    Bagley, Mark C.; Baashen, Mohammed; Chuckowree, Irina; Dwyer, Jessica E.; Kipling, David; Davis, Terence

    2015-01-01

    Microwave-assisted Suzuki-Miyaura cross-coupling reactions have been employed towards the synthesis of three different MAPKAPK2 (MK2) inhibitors to study accelerated aging in Werner syndrome (WS) cells, including the cross-coupling of a 2-chloroquinoline with a 3-pyridinylboronic acid, the coupling of an aryl bromide with an indolylboronic acid and the reaction of a 3-amino-4-bromopyrazole with 4-carbamoylphenylboronic acid. In all of these processes, the Suzuki-Miyaura reaction was fast and relatively efficient using a palladium catalyst under microwave irradiation. The process was incorporated into a rapid 3-step microwave-assisted method for the synthesis of a MK2 inhibitor involving 3-aminopyrazole formation, pyrazole C-4 bromination using N-bromosuccinimide (NBS), and Suzuki-Miyaura cross-coupling of the pyrazolyl bromide with 4-carbamoylphenylboronic acid to give the target 4-arylpyrazole in 35% overall yield, suitable for study in WS cells. PMID:26046488

  17. Binding of [alpha, alpha]-Disubstituted Amino Acids to Arginase Suggests New Avenues for Inhibitor Design

    SciTech Connect

    Ilies, Monica; Di Costanzo, Luigi; Dowling, Daniel P.; Thorn, Katherine J.; Christianson, David W.

    2011-10-21

    Arginase is a binuclear manganese metalloenzyme that hydrolyzes L-arginine to form L-ornithine and urea, and aberrant arginase activity is implicated in various diseases such as erectile dysfunction, asthma, atherosclerosis, and cerebral malaria. Accordingly, arginase inhibitors may be therapeutically useful. Continuing our efforts to expand the chemical space of arginase inhibitor design and inspired by the binding of 2-(difluoromethyl)-L-ornithine to human arginase I, we now report the first study of the binding of {alpha},{alpha}-disubstituted amino acids to arginase. Specifically, we report the design, synthesis, and assay of racemic 2-amino-6-borono-2-methylhexanoic acid and racemic 2-amino-6-borono-2-(difluoromethyl)hexanoic acid. X-ray crystal structures of human arginase I and Plasmodium falciparum arginase complexed with these inhibitors reveal the exclusive binding of the L-stereoisomer; the additional {alpha}-substituent of each inhibitor is readily accommodated and makes new intermolecular interactions in the outer active site of each enzyme. Therefore, this work highlights a new region of the protein surface that can be targeted for additional affinity interactions, as well as the first comparative structural insights on inhibitor discrimination between a human and a parasitic arginase.

  18. Synthesis and metabolism of inhibitors of ribonucleotide reductase

    SciTech Connect

    Smith, F.T.

    1985-01-01

    In an effort to prepare more effective inhibitors of ribo-nucleotide reductase a series of 2-substituted-4,6-dihydroxypyrimidines was prepared via the appropriately substituted benzamidine. None of the compounds exhibited in vivo activity against L1210 leukemia. No further testing was performed. In order to investigate the metabolism of 3,4-dihydroxybenzohydroxamic acid, a known inhibitor of ribonucleotide reductase, radiolabeled 3,4-dihydroxybenzohydroxamic acid was synthesized by a modification of the procedure of Pichat and Tostain. /sup 14/C-3,4-Dihydroxybenzoic acid was converted to the methyl ester and subsequently reacted with hydroxylamine to give the hydroxamic acid. /sup 14/C-3,4-Dihydroxybenzohydroxamic acid was given i.p. to Sprague-Dawley rats. Excretion occurred mainly (72%) via the urine. HPLC coupled with GC/MS analyses showed that the compound was excreted mainly unchanged. The compound was metabolized to 3,4-dihydroxybenzamide, 4-methoxy-3-hydroxybenzohydroxamic acid, and 4-hydroxy-3-methoxybenzohydroxamic acid. HPLC analysis also showed the lack of formation of any glucuronide or sulfate conjugates through either the hydroxamic acid or catechol functionalities.

  19. Total synthesis of (+)-zaragozic acid C.

    PubMed

    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G

    2000-10-20

    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  20. Converting maslinic acid into an effective inhibitor of acylcholinesterases.

    PubMed

    Schwarz, Stefan; Loesche, Anne; Lucas, Susana Dias; Sommerwerk, Sven; Serbian, Immo; Siewert, Bianka; Pianowski, Elke; Csuk, René

    2015-10-20

    During the last decade, maslinic acid has been evaluated for many biological properties, e.g. as an anti-tumor or an anti-viral agent but also as a nutraceutical. The potential of maslinic acid and related derivatives to act as inhibitors of acetyl- or butyryl-cholinesterase was examined in this communication in more detail. Cholinesterases do still represent an interesting group of target enzymes with respect to the investigation and treatment of the Alzheimer's disease and other dementia illnesses as well. Although other triterpenoic acids have successfully been tested for their ability to act as inhibitors of cholinesterases, up to now maslinic acid has not been part of such studies. For this reason, three series of maslinic acid derivatives possessing modifications at different centers were synthesized and subjected to Ellman's assay to determine their inhibitory strength and type of inhibitory action. While parent compound maslinic acid was no inhibitor in these assays, some of the compounds exhibited an inhibition of acetylcholinesterase in the single-digit micro-molar range. Two compounds were identified as inhibitors of butyrylcholinesterase showing inhibition constants comparable to those of galantamine, a drug often used in the treatment of Alzheimer's disease. Furthermore, additional selectivity as well as cytotoxicity studies were performed underlining the potential of several derivatives and qualifying them for further investigations. Docking studies revealed that the different kinetic behavior within the same compound series may be explained by the ability of the compounds to enter the active site gorge of AChE. PMID:26383128

  1. Hydrogenase synthesis in Bradyrhizobium japonicum Hupc mutants is altered in sensitivity to DNA gyrase inhibitors.

    PubMed Central

    Novak, P D; Maier, R J

    1989-01-01

    In the Hupc mutants of Bradyrhizobium japonicum SR, regulation of expression of hydrogenase is altered; the mutants synthesize hydrogenase constitutively in the presence of atmospheric levels of oxygen. The DNA gyrase inhibitors nalidixic acid, novobiocin, and coumermycin were used to inhibit growth of wild-type and mutant cells. For each inhibitor tested, growth of mutant and wild-type strains was equally sensitive. However, in contrast to the wild type, the Hupc mutants synthesized hydrogenase in the presence of high levels of any inhibitor. Cells were incubated with the drugs and simultaneously labeled with 14C-labeled amino acids, and hydrogenase was immunoprecipitated with antibody to the large subunit of the enzyme. Fluorograms of antibody blots then were scanned to determine the relative amount of hydrogenase (large subunit) synthesized in the presence or absence of the gyrase inhibitors. The amount of hydrogenase synthesized by the Hupc mutants in the presence of 300 micrograms of nalidixic acid per ml was near the level of enzyme synthesized in the absence of the inhibitor. No hydrogenase was detected in antibody blots of wild-type cultures which were derepressed for hydrogenase in the presence of 100 micrograms of coumermycin or novobiocin per ml. In contrast, hydrogenase was synthesized by the Hupc mutants in the presence of 100 micrograms of either drug per ml. The amount synthesized ranged from 5 to 32% and 20 to 49%, respectively, of that in the absence of those inhibitors, but nevertheless, hydrogenase synthesis was detected in all of the mutants examined.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:2547335

  2. A PHGDH inhibitor reveals coordination of serine synthesis and one-carbon unit fate.

    PubMed

    Pacold, Michael E; Brimacombe, Kyle R; Chan, Sze Ham; Rohde, Jason M; Lewis, Caroline A; Swier, Lotteke J Y M; Possemato, Richard; Chen, Walter W; Sullivan, Lucas B; Fiske, Brian P; Cho, Steve; Freinkman, Elizaveta; Birsoy, Kıvanç; Abu-Remaileh, Monther; Shaul, Yoav D; Liu, Chieh Min; Zhou, Minerva; Koh, Min Jung; Chung, Haeyoon; Davidson, Shawn M; Luengo, Alba; Wang, Amy Q; Xu, Xin; Yasgar, Adam; Liu, Li; Rai, Ganesha; Westover, Kenneth D; Vander Heiden, Matthew G; Shen, Min; Gray, Nathanael S; Boxer, Matthew B; Sabatini, David M

    2016-06-01

    Serine is both a proteinogenic amino acid and the source of one-carbon units essential for de novo purine and deoxythymidine synthesis. In the canonical pathway of glucose-derived serine synthesis, Homo sapiens phosphoglycerate dehydrogenase (PHGDH) catalyzes the first, rate-limiting step. Genetic loss of PHGDH is toxic toward PHGDH-overexpressing breast cancer cell lines even in the presence of exogenous serine. Here, we used a quantitative high-throughput screen to identify small-molecule PHGDH inhibitors. These compounds reduce the production of glucose-derived serine in cells and suppress the growth of PHGDH-dependent cancer cells in culture and in orthotopic xenograft tumors. Surprisingly, PHGDH inhibition reduced the incorporation into nucleotides of one-carbon units from glucose-derived and exogenous serine. We conclude that glycolytic serine synthesis coordinates the use of one-carbon units from endogenous and exogenous serine in nucleotide synthesis, and we suggest that one-carbon unit wasting thus may contribute to the efficacy of PHGDH inhibitors in vitro and in vivo. PMID:27110680

  3. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  4. Prostaglandin synthesis inhibitors block alcohol-induced fetal hypoplasia.

    PubMed

    Pennington, S; Allen, Z; Runion, J; Farmer, P; Rowland, L; Kalmus, G

    1985-01-01

    Alcohol-induced growth retardation is a fetal effect consistently associated with maternal ethanol consumption. In humans, those infants whose mothers consume even a limited amount of ethanol during pregnancy have a significant incidence of growth inhibition. The molecular mechanism responsible for this growth deficiency is unknown, and prevention depends on maternal abstinence during pregnancy. The data reported here suggest that ethanol-mediated increases in tissue prostaglandin (PG) E levels (PGE1 plus PGE2) are correlated with the growth retardation. Further, simultaneous administration of PG synthesis inhibitors with the alcohol blocks the rise in tissue PG levels and protects against the alcohol-induced hypoplasia. PMID:3904508

  5. X-ray crystallographic analysis of IMP-1 metallo-β-lactamase complexed with a 3-aminophthalic acid derivative, structure-based drug design, and synthesis of 3,6-disubstituted phthalic acid derivative inhibitors.

    PubMed

    Hiraiwa, Yukiko; Saito, Jun; Watanabe, Takashi; Yamada, Mototsugu; Morinaka, Akihiro; Fukushima, Takayoshi; Kudo, Toshiaki

    2014-10-15

    3-(4-Hydroxypiperidine-1-yl) phthalic acid 1 shows potent inhibitory activity against metallo-β-lactamase, which is known to inactivate β-lactam antibiotics such as carbapenems. Here, the structure of co-crystals of the metallo-β-lactamase IMP-1 and 1 was first analyzed by X-ray crystallography, and then used for structure-based drug design. Four novel compounds bearing substituents at the 6-position were synthesized to produce 3,6-disubstituted phthalic acid derivatives, and their IMP-1 inhibitory activity and synergistic effect with the carbapenem biapenem (BIPM) were evaluated. 3,6-Disubstituted phthalic acid derivatives showed potent IMP-1 inhibitory activity. In particular, compound 13 showed 10-fold higher IMP-1 inhibitory activity as compared with the parent derivative 1. PMID:25246278

  6. Synthesis and characterization of constrained peptidomimetic dipeptidyl peptidase IV inhibitors: amino-lactam boroalanines.

    PubMed

    Lai, Jack H; Wu, Wengen; Zhou, Yuhong; Maw, Hlaing H; Liu, Yuxin; Milo, Lawrence J; Poplawski, Sarah E; Henry, Gillian D; Sudmeier, James L; Sanford, David G; Bachovchin, William W

    2007-05-17

    We describe here the epimerization-free synthesis and characterization of a new class of conformationally constrained lactam aminoboronic acid inhibitors of dipeptidyl peptidase IV (DPP IV; E.C. 3.4.14.5). These compounds have the advantage that they cannot undergo the pH-dependent cyclization prevalent in most dipeptidyl boronic acids that attenuates their potency at physiological pH. For example, D-3-amino-1-[L-1-boronic-ethyl]-pyrrolidine-2-one (amino-D-lactam-L-boroAla), one of the best lactam inhibitors of DPP IV, is several orders of magnitude less potent than L-Ala-L-boroPro, as measured by Ki values (2.3 nM vs 30 pM, respectively). At physiological pH, however, it is actually more potent than L-Ala-L-boroPro, as measured by IC50 values (4.2 nM vs 1400 nM), owing to the absence of the potency-attenuating cyclization. In an interesting and at first sight surprising reversal of the relationship between stereochemistry and potency observed with the conformationally unrestrained Xaa-boroPro class of inhibitors, the L-L diastereomers of the lactams are orders of magnitude less effective than the D-L lactams. However, this interesting reversal and the unexpected potency of the D-L lactams as DPP IV inhibitors can be understood in structural terms, which is explained and discussed here. PMID:17458948

  7. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  8. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  9. Penta- and hexadienoic acid derivatives: a novel series of 5-lipoxygenase inhibitors.

    PubMed

    Malleron, J L; Roussel, G; Gueremy, G; Ponsinet, G; Robin, J L; Terlain, B; Tissieres, J M

    1990-10-01

    The synthesis of a series of pentadienoic and hexadienoic acid derivatives is reported. These compounds were tested as inhibitors of 5-lipoxygenase (5 LO) and cyclooxygenase (CO) in vitro and as inhibitors of arachidonic acid (AA) induced ear edema in mice in vivo. Their potency is compared with that of the standard inhibitors nafazatrom, BW 755C, NDGA, KME4, quercetine, and L 652,243. The most potent compound in vivo, diethyl 2-hydroxy-5-(ethylthio)-2(Z),4(Z)-hexadienedioate (20) inhibited AA-induced ear edema when administered topically or orally, with an ED50 value of 0.01 mg/ear and 20 mg/kg, respectively. Among the standard compounds tested, L 652,243 was the most active compound in this test with an ED50 value of 0.01 mg/ear and 1 mg/kg po, but unlike this compound, 20 is a selective inhibitor of 5-LO (IC50 = 2 microM) without any significant activity against CO (IC50 greater than 50 microM). Most of the other compounds in this series are also selective 5-LO inhibitors. PMID:2213827

  10. A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site.

    PubMed

    Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A

    2014-09-01

    Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor. PMID:25086508

  11. Direct Synthesis of 5-Aryl Barbituric Acids by Rhodium(II)-Catalyzed Reactions of Arenes with Diazo Compounds**

    PubMed Central

    Best, Daniel; Burns, David J; Lam, Hon Wai

    2015-01-01

    A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544

  12. Discovery of a novel acyl-CoA: cholesterol acyltransferase inhibitor: the synthesis, biological evaluation, and reduced adrenal toxicity of (4-phenylcoumarin)acetanilide derivatives with a carboxylic acid moiety.

    PubMed

    Ogino, Masaki; Nakada, Yoshihisa; Negoro, Nobuyuki; Itokawa, Shigekazu; Nishimura, Satoshi; Sanada, Tsukasa; Satomi, Tomoko; Kita, Shunbun; Kubo, Kazuki; Marui, Shogo

    2011-01-01

    As a part of our research for novel potent and orally available acyl-CoA: cholesterol acyltransferase (ACAT) inhibitors that can be used as anti-atherosclerotic agents, we recently reported the discovery of the (4-phenylcoumarine)acetanilide derivative 1. However, compound 1 showed adrenal toxicity in animal models. In order to search for safer ACAT inhibitors that do not have adrenal toxicity, we examined the inhibitory activity of ACAT in human macrophage and adrenal cells. The introduction of a carboxylic acid moiety on the pendant phenyl ring and the adjustment of the lipophilicity led to the discovery of (2E)-3-[7-chloro-3-[2-[[4-fluoro-2-(trifluoromethyl)phenyl]amino]-2-oxoethyl]-6-methyl-2-oxo-2H-chromen-4-yl]phenyl]acrylic acid (21e), which showed potent ACAT inhibitory activity in macrophages and a selectivity of around 30-fold over adrenal cells. In addition, compound 21e showed high adrenal safety in guinea pigs. PMID:22041073

  13. Design, synthesis, and biological evaluation of benzofuran- and 2,3-dihydrobenzofuran-2-carboxylic acid N-(substituted)phenylamide derivatives as anticancer agents and inhibitors of NF-κB.

    PubMed

    Choi, Minho; Jo, Hyeju; Park, Hyun-Jung; Sateesh Kumar, Arepalli; Lee, Joonkwang; Yun, Jieun; Kim, Youngsoo; Han, Sang-Bae; Jung, Jae-Kyung; Cho, Jungsook; Lee, Kiho; Kwak, Jae-Hwan; Lee, Heesoon

    2015-06-15

    With the aim of developing novel scaffolds as anticancer agents and inhibitors of NF-κB activity, 60 novel benzofuran- and 2,3-dihydrobenzofuran-2-carboxylic acid N-(substituted)phenylamide derivatives (1a-s, 2a-k, 3a-s, and 4a-k) were designed and synthesized from the reference lead compound KL-1156, which is an inhibitor of NF-κB translocation to the nucleus in LPS-stimulated RAW 264.7 macrophage cells. The novel benzofuran- and 2,3-dihydrobenzofuran-2-carboxamide derivatives exhibited potent cytotoxic activities (measured by the sulforhodamine B assay) at low micromolar concentrations against six human cancer cell lines: ACHN (renal), HCT15 (colon), MM231 (breast), NUGC-3 (gastric), NCI-H23 (lung), and PC-3 (prostate). In addition, these compounds also inhibited LPS-induced NF-κB transcriptional activity. The +M effect and hydrophobic groups on the N-phenyl ring potentiated the anticancer activity and NF-κB inhibitory activity, respectively. However, according to the results of structure-activity relationship studies, only benzofuran-2-carboxylic acid N-(4'-hydroxy)phenylamide (3m) was the lead scaffold with both an outstanding anticancer activity and NF-κB inhibitory activity. This novel lead scaffold may be helpful for investigation of new anticancer agents that act through inactivation of NF-κB. PMID:25953156

  14. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  15. Enantioselective Total Synthesis of Secalonic Acid E.

    PubMed

    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F

    2015-11-16

    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  16. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  17. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  18. Interaction of silicic acid with sulfurous acid scale inhibitor

    SciTech Connect

    Gallup, D.L.

    1997-12-31

    The solubility of amorphous silica and the inhibition of silica polymerization in the presence of sulfurous acid and sulfite salts has been investigated to 260{degrees}C. Investigations of inhibition of silica scaling from geothermal brines by sulfurous acid have produced unusual results. Bisulfite/sulfite increases amorphous silica solubility by {open_quotes}salting in{close_quotes} effects resulting from apparent complexation. Silica-sulfite complexes are postulated to form via hydrogen bonding, and appear to be much stronger than silica-sulfate complexes. Treatment of brines with sulfurous acid inhibits silica scaling by (1) retarding the kinetics of silicic acid polymerization, and (2) forming soluble sulfito-silicate complexes. Sulfurous acid offers several advantages over sulfuric acid in controlling scale deposition-reduced corrosion potential, reduced by-product scale formation potential, oxygen scavenging and inhibition of certain metal silicate scales.

  19. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  20. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  1. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  2. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  3. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H

    1988-01-01

    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  4. Action of Inhibitors of RNA and Protein Synthesis on Cell Enlargement 1

    PubMed Central

    Noodén, Larry D.; Thimann, Kenneth V.

    1966-01-01

    Further studies with inhibitors of protein synthesis are presented to support the conclusion, drawn from work with chloramphenicol, that protein synthesis is a critical limiting factor in auxin-induced cell expansion. The indoleacetic acid-induced elongation of oat coleoptile sections was strongly inhibited by dl-p-fluorophenylalanine, and the inhibition is antagonized by phenylalanine. Puromycin at 10−4 m very strongly inhibited the indoleacetic acid-induced growth of oat coleoptile and artichoke tuber sections and exerted a less powerful effect on pea stem sections. As found earlier with chloramphenicol, concentrations of puromycin effective in inhibiting the growth of coleoptile sections had quantitatively similar effects on protein synthesis, as measured by the incorporation of C14-leucine into protein of the coleoptile tissue. Several analogues of RNA bases were also tested, but while 8-azaguanine very strongly inhibited growth of artichoke tuber disks, 6-azauracil was the only one of this group clearly inhibitory to growth in coleoptile or pea stem sections. Actinomycin D actively inhibited both elongation and the incorporation of C14-leucine into protein in oat coleoptile sections. Inhibition of the 2 processes went closely parallel. Actinomycin D also powerfully inhibited growth of artichoke tuber disks. All the compounds effective in inhibiting growth generally inhibited the uptake of leucine as well. The possibility that auxin causes cell enlargement in plants by inducing the synthesis of a messenger RNA and of one or more new but unstable enzymes, is discussed. Possible but less favored alternative explanations are: A) that auxin induces synthesis of a wall protein, or B) that the continued synthesis of some other unstable protein (by a process independent of auxin) may be a prerequisite for cell enlargement. PMID:5904588

  5. Polyamines are Inhibitors of Gastric Acid Secretion

    NASA Astrophysics Data System (ADS)

    Ray, Tushar K.; Nandi, Jyotirmoy; Pidhorodeckyj, Nykolai; Meng-Ai, Zhou

    1982-03-01

    The naturally occurring organic polycations such as spermine and spermidine inhibit histamine-stimulated gastric acid secretion by bullfrog gastric mucosa in vitro; spermine is much more potent than spermidine. Unlike the H2 receptor antagonists, the polyamines are completely ineffective from the nutrient side and are effective only from the secretory side of the chambered mucosa. The polyamine effects could be reversed by increasing K+ concentration in the secretory solution. Studies with isolated gastric microsomal vesicles demonstrate that the polyamines do not inhibit the gastric H+,K+-ATPase but greatly decrease the ATPase-mediated uptake of H+ under appropriate conditions. For the latter effects the presence of polyamine within the vesicle interior was found to be essential. Our data strongly suggest an uncoupling of the gastric H+,K+-ATPase system by the polyamines. The therapeutic potential of these and similar compounds in the treatment of hyperacidity and peptic ulcer is discussed.

  6. Structure-based Design and In-Parallel Synthesis of Inhibitors of AmpC b-lactamase

    SciTech Connect

    Tondi, D.; Powers, R.A.; Negri, M.C.; Caselli, M.C.; Blazquez, J.; Costi, M.P.; Shoichet, B.K.

    2010-03-08

    Group I {beta}-lactamases are a major cause of antibiotic resistance to {beta}-lactams such as penicillins and cephalosporins. These enzymes are only modestly affected by classic {beta}-lactam-based inhibitors, such as clavulanic acid. Conversely, small arylboronic acids inhibit these enzymes at sub-micromolar concentrations. Structural studies suggest these inhibitors bind to a well-defined cleft in the group I {beta}-lactamase AmpC; this cleft binds the ubiquitous R1 side chain of {beta}-lactams. Intriguingly, much of this cleft is left unoccupied by the small arylboronic acids. To investigate if larger boronic acids might take advantage of this cleft, structure-guided in-parallel synthesis was used to explore new inhibitors of AmpC. Twenty-eight derivatives of the lead compound, 3-aminophenylboronic acid, led to an inhibitor with 80-fold better binding (2; K{sub i} 83 nM). Molecular docking suggested orientations for this compound in the R1 cleft. Based on the docking results, 12 derivatives of 2 were synthesized, leading to inhibitors with K{sub i} values of 60 nM and with improved solubility. Several of these inhibitors reversed the resistance of nosocomial Gram-positive bacteria, though they showed little activity against Gram-negative bacteria. The X-ray crystal structure of compound 2 in complex with AmpC was subsequently determined to 2.1 {angstrom} resolution. The placement of the proximal two-thirds of the inhibitor in the experimental structure corresponds with the docked structure, but a bond rotation leads to a distinctly different placement of the distal part of the inhibitor. In the experimental structure, the inhibitor interacts with conserved residues in the R1 cleft whose role in recognition has not been previously explored. Combining structure-based design with in-parallel synthesis allowed for the rapid exploration of inhibitor functionality in the R1 cleft of AmpC. The resulting inhibitors differ considerably from {beta}-lactams but

  7. Chiral Proton Catalysis of Secondary Nitroalkane Additions to Azomethine: Synthesis of a Potent GlyT1 Inhibitor

    PubMed Central

    Davis, Tyler A.; Danneman, Michael W.; Johnston, Jeffrey N.

    2014-01-01

    The first enantioselective synthesis of a potent GlyT1 inhibitor is described. A 3-nitroazetidine donor is used in an enantioselective aza-Henry reaction catalyzed by a bis(amidine)-triflic acid salt organocatalyst, delivering the key intermediate with 92% ee. This adduct is reductively denitrated and converted to the target through a short sequence, thereby allowing assignment of the absolute configuration of the more potent enantiomer. PMID:22543734

  8. Rational Design Synthesis and Evaluation of New Selective Inhibitors of Microbial Class II (Zinc Dependent) Fructose Bis-phosphate Aldolases

    SciTech Connect

    R Daher; M Coincon; M Fonvielle; P Gest; M Guerin; M Jackson; J Sygusch; M Therisod

    2011-12-31

    We report the synthesis and biochemical evaluation of several selective inhibitors of class II (zinc dependent) fructose bis-phosphate aldolases (Fba). The products were designed as transition-state analogues of the catalyzed reaction, structurally related to the substrate fructose bis-phosphate (or sedoheptulose bis-phosphate) and based on an N-substituted hydroxamic acid, as a chelator of the zinc ion present in active site. The compounds synthesized were tested on class II Fbas from various pathogenic microorganisms and, by comparison, on a mammalian class I Fba. The best inhibitor shows Ki against class II Fbas from various pathogens in the nM range, with very high selectivity (up to 105). Structural analyses of inhibitors in complex with aldolases rationalize and corroborate the enzymatic kinetics results. These inhibitors represent lead compounds for the preparation of new synthetic antibiotics, notably for tuberculosis prophylaxis.

  9. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  10. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  11. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  12. Design and synthesis of novel selective anaplastic lymphoma kinase inhibitors.

    PubMed

    Michellys, Pierre-Yves; Chen, Bei; Jiang, Tao; Jin, Yunho; Lu, Wenshuo; Marsilje, Thomas H; Pei, Wei; Uno, Tetsuo; Zhu, Xuefeng; Wu, Baogen; Nguyen, Truc Ngoc; Bursulaya, Badry; Lee, Christian; Li, Nanxin; Kim, Sungjoon; Tuntland, Tove; Liu, Bo; Sun, Frank; Steffy, Auzon; Hood, Tami

    2016-02-01

    Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase belonging to the insulin receptor superfamily. Expression of ALK in normal human tissues is only found in a subset of neural cells, however it is involved in the genesis of several cancers through genetic aberrations involving translocation of the kinase domain with multiple fusion partners (e.g., NPM-ALK in anaplastic large cell lymphoma ALCL or EML4-ALK in non-small cell lung cancer) or activating mutations in the full-length receptor resulting in ligand-independent constitutive activation (e.g., neuroblastoma). Here we are reporting the discovery of novel and selective anaplastic lymphoma kinase inhibitors from specific modifications of the 2,4-diaminopyridine core present in TAE684 and LDK378. Synthesis, structure activity relationships (SAR), absorption, distribution, metabolism, and excretion (ADME) profile, and in vivo efficacy in a mouse xenograft model of anaplastic large cell lymphoma are described. PMID:26750252

  13. Synthesis of carbon-13-labeled tetradecanoic acids.

    PubMed

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  14. Tanzawaic Acids, a Chemically Novel Set of Bacterial Conjugation Inhibitors

    PubMed Central

    Getino, María; Fernández-López, Raúl; Palencia-Gándara, Carolina; Campos-Gómez, Javier; Sánchez-López, Jose M.; Martínez, Marta; Fernández, Antonio; de la Cruz, Fernando

    2016-01-01

    Bacterial conjugation is the main mechanism for the dissemination of multiple antibiotic resistance in human pathogens. This dissemination could be controlled by molecules that interfere with the conjugation process. A search for conjugation inhibitors among a collection of 1,632 natural compounds, identified tanzawaic acids A and B as best hits. They specially inhibited IncW and IncFII conjugative systems, including plasmids mobilized by them. Plasmids belonging to IncFI, IncI, IncL/M, IncX and IncH incompatibility groups were targeted to a lesser extent, whereas IncN and IncP plasmids were unaffected. Tanzawaic acids showed reduced toxicity in bacterial, fungal or human cells, when compared to synthetic conjugation inhibitors, opening the possibility of their deployment in complex environments, including natural settings relevant for antibiotic resistance dissemination. PMID:26812051

  15. Potent inhibitors of HCV-NS3 protease derived from boronic acids

    SciTech Connect

    Venkatraman, Srikanth; Wu, Wanli; Prongay, Andrew; Girijavallabhan, Viyyoor; Njoroge, F. George

    2009-07-23

    Chronic hepatitis C infection is the leading causes for cirrhosis of the liver and hepatocellular carcinoma, leading to liver failure and liver transplantation. The etiological agent, HCV virus produces a single positive strand of RNA that is processed with the help of serine protease NS3 to produce mature virus. Inhibition of NS3 protease can be potentially used to develop effective drugs for HCV infections. Numerous efforts are now underway to develop potent inhibitors of HCV protease that contain ketoamides as serine traps. Herein we report the synthesis of a series of potent inhibitors that contain a boronic acid as a serine trap. The activity of these compounds were optimized to 200 pM. X-ray structure of compound 17 bound to NS3 protease is also discussed.

  16. Synthesis and evaluation of colletoic acid core derivatives.

    PubMed

    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima

    2016-03-01

    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  17. Inhibitors to Polyhydroxyalkanoate (PHA) Synthases: Synthesis, Molecular Docking, and Implications

    PubMed Central

    Cao, Ruikai; Maurmann, Leila; Li, Ping

    2015-01-01

    Polyhydroxyalkanoate (PHA) synthases (PhaCs) catalyze the formation of biodegradable PHAs that are considered as an ideal alternative to nonbiodegradable synthetic plastics. However, study of PhaC has been challenging because the rate of PHA chain elongation is much faster than that of initiation. This difficulty along with lack of a structure has become the main hurdle to understand and engineer PhaCs for economical PHA production. Here we reported the synthesis of two carbadethia CoA analogs, sT-CH2-CoA 26a and sTet-CH2-CoA 26b as well as sT-aldehyde 29 as new PhaC inhibitors. Study of these analogs with PhaECAv revealed that 26a/b and 29 are competitive and mixed inhibitors, respectively. It was observed that CoA moiety and PHA chain extension can increase binding affinity, which is consistent with the docking study. Estimation from Kic of 26a/b predicts that a CoA analog attached with an octameric-HB chain may facilitate the formation of a kinetically well-behaved synthase. PMID:25394180

  18. Inhibitors of polyhydroxyalkanoate (PHA) synthases: synthesis, molecular docking, and implications.

    PubMed

    Zhang, Wei; Chen, Chao; Cao, Ruikai; Maurmann, Leila; Li, Ping

    2015-01-01

    Polyhydroxyalkanoate (PHA) synthases (PhaCs) catalyze the formation of biodegradable PHAs that are considered to be ideal alternatives to non-biodegradable synthetic plastics. However, study of PhaCs has been challenging because the rate of PHA chain elongation is much faster than that of initiation. This difficulty, along with lack of a crystal structure, has become the main hurdle to understanding and engineering PhaCs for economical PHA production. Here we report the synthesis of two carbadethia CoA analogues--sT-CH2-CoA (26 a) and sTet-CH2-CoA (26 b)--as well as sT-aldehyde (saturated trimer aldehyde, 29), as new PhaC inhibitors. Study of these analogues with PhaECAv revealed that 26 a/b and 29 are competitive and mixed inhibitors, respectively. Both the CoA moiety and extension of PHA chain will increase binding affinity; this is consistent with our docking study. Estimation of the Kic values of 26 a and 26 b predicts that a CoA analogue incorporating an octameric hydroxybutanoate (HB) chain might facilitate the formation of a kinetically well-behaved synthase. PMID:25394180

  19. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  20. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  1. Design and synthesis of phosphonoacetic acid (PPA) ester and amide bioisosters of ribofuranosylnucleoside diphosphates as potential ribonucleotide reductase inhibitors and evaluation of their enzyme inhibitory, cytostatic and antiviral activity.

    PubMed

    Manfredini, Stefano; Solaroli, Nicola; Angusti, Angela; Nalin, Federico; Durini, Elisa; Vertuani, Silvia; Pricl, Sabrina; Ferrone, Marco; Spadari, Silvio; Focher, Federico; Verri, Annalisa; De Clercq, Erik; Balzarini, Jan

    2003-07-01

    Continuing our investigations on inhibitors of ribonucleotide reductase (RNR), the crucial enzyme that catalyses the reduction of ribonucleotides to deoxyribonucleotides, we have now prepared and evaluated 5'-phosphonoacetic acid, amide and ester analogues of adenosine, uridine and cytidine with the aim to verify both substrate specificity and contribution to biological activity of diphosphate mimic moieties. A molecular modelling study has been conducted on the RNR R1 subunit, in order to verify the possible interaction of the proposed bioisosteric moieties. The study compounds were finally tested on the recombinant murine RNR showing a degree of inhibition that ranged from 350 microM for the UDP analogue 5'-deoxy-5'-N-(phosphon-acetyl)uridine sodium salt (amide) to 600 microM for the CDP analogue 5'-O-[(diethyl-phosphon)acetyl]cytidine (ester). None of the tested compounds displayed noteworthy cytostatic activity at 100-500 microM concentrations, whereas ADP analogue 5'-N-[(diethyl-phosphon) acetyl]adenosine (amide) and 5'-deoxy-5'-N-(phosphon-acetyl)adenosine sodium salt (amide) showed a moderate inhibitory activity (EC50: 48 microM) against HSV-2 and a modest inhibitory activity (EC50: 110 microM) against HIV-1, respectively. PMID:14582847

  2. Large-scale asymmetric synthesis of a cathepsin S inhibitor.

    PubMed

    Lorenz, Jon C; Busacca, Carl A; Feng, XuWu; Grinberg, Nelu; Haddad, Nizar; Johnson, Joe; Kapadia, Suresh; Lee, Heewon; Saha, Anjan; Sarvestani, Max; Spinelli, Earl M; Varsolona, Rich; Wei, Xudong; Zeng, Xingzhong; Senanayake, Chris H

    2010-02-19

    A potent reversible inhibitor of the cysteine protease cathepsin-S was prepared on large scale using a convergent synthetic route, free of chromatography and cryogenics. Late-stage peptide coupling of a chiral urea acid fragment with a functionalized aminonitrile was employed to prepare the target, using 2-hydroxypyridine as a robust, nonexplosive replacement for HOBT. The two key intermediates were prepared using a modified Strecker reaction for the aminonitrile and a phosphonation-olefination-rhodium-catalyzed asymmetric hydrogenation sequence for the urea. A palladium-catalyzed vinyl transfer coupled with a Claisen reaction was used to produce the aldehyde required for the side chain. Key scale up issues, safety calorimetry, and optimization of all steps for multikilogram production are discussed. PMID:20102230

  3. Design and synthesis of potent and multifunctional aldose reductase inhibitors based on quinoxalinones.

    PubMed

    Qin, Xiangyu; Hao, Xin; Han, Hui; Zhu, Shaojuan; Yang, Yanchun; Wu, Bobin; Hussain, Saghir; Parveen, Shagufta; Jing, Chaojun; Ma, Bing; Zhu, Changjin

    2015-02-12

    Quinoxalin-2(1H)-one based design and synthesis produced several series of aldose reductase (ALR2) inhibitor candidates. In particular, phenolic structure was installed in the compounds for the combination of antioxidant activity and strengthening the ability to fight against diabetic complications. Most of the series 6 showed potent and selective effects on ALR2 inhibition with IC50 values in the range of 0.032-0.468 μM, and 2-(3-(2,4-dihydroxyphenyl)-7-fluoro-2-oxoquinoxalin-1(2H)-yl)acetic acid (6e) was the most active. More significantly, most of the series 8 revealed not only good activity in the ALR2 inhibition but also potent antioxidant activity, and 2-(3-(3-methoxy-4-hydroxystyryl)-2-oxoquinoxalin-1(2H)-yl)acetic acid (8d) was even as strong as the well-known antioxidant Trolox at a concentration of 100 μM, verifying the C3 p-hydroxystyryl side chain as the key structure for alleviating oxidative stress. These results therefore suggest an achievement of multifunctional ALR2 inhibitors having both potency for ALR2 inhibition and as antioxidants. PMID:25602762

  4. Synthesis and biological evaluation of novel FK228 analogues as potential isoform selective HDAC inhibitors.

    PubMed

    Narita, Koichi; Matsuhara, Keisuke; Itoh, Jun; Akiyama, Yui; Dan, Singo; Yamori, Takao; Ito, Akihiro; Yoshida, Minoru; Katoh, Tadashi

    2016-10-01

    Novel C4- and C7-modified FK228 analogues were efficiently synthesized in a highly convergent and unified manner. This synthesis features the amide condensation of glycine-d-cysteine-containing segments with d-valine-containing segments for the direct assembly of the corresponding seco-acids, which are key precursors of macrolactones. The HDAC inhibition assay and cell-growth inhibition analysis of the synthesized analogues revealed novel aspects of their structure-activity relationship. This study demonstrated that simple modification at the C4 and C7 side chains in FK228 is effective for improving both HDAC inhibitory activity and isoform selectivity; moreover, potent and highly isoform-selective class I HDAC1 inhibitors were identified. PMID:27318982

  5. Nitroaromatic amino acids as inhibitors of neuronal nitric oxide synthase.

    PubMed

    Cowart, M; Kowaluk, E A; Daanen, J F; Kohlhaas, K L; Alexander, K M; Wagenaar, F L; Kerwin, J F

    1998-07-01

    Nitric oxide (NO.) is an important biomodulator of many physiological processes. The inhibition of inappropriate production of NO. by the isoforms of nitric oxide synthase (NOS) has been proposed as a therapeutic approach for the treatment of stroke, inflammation, and other processes. In this study, certain 2-nitroaryl-substituted amino acid analogues were discovered to inhibit NOS. Analogues bearing a 5-methyl substituent on the aromatic ring demonstrated maximal inhibitory potency. For two selected inhibitors, investigation of the kinetics of the enzyme showed the inhibition to be competitive with l-arginine. Additionally, functional NOS inhibition in tissue preparations was demonstrated. PMID:9651169

  6. Mechanisms of corrosion inhibitors used in acidizing wells

    SciTech Connect

    Frenier, W.W.; Growcock, F.B.; Lopp, V.R. )

    1988-11-01

    Two model compounds, n-dodecylpyridinium bromide (n-DDPB) and 1-octyn-3-ol, were tested in HCL acid as inhibitors for J55 oilfield steel. This paper describes the kinetic and chemical analyses conducted to arrive at inhibition mechanisms for these model compounds. These studies show that the pyridinium forms a weak bond with the chloride-covered surface and is sensitive to temperature and (HCl). Octynol, however, chemisorbs and produces a film that contains a reaction product of the acetylenic alcohol. This film is quite insensitive to changes in temperature and (HCl).

  7. Inhibitors of fatty acid biosynthesis in sunflower seeds.

    PubMed

    Pleite, Rafael; Martínez-Force, Enrique; Garcés, Rafael

    2006-09-01

    During de novo fatty acid synthesis in sunflower seeds, saturated fatty acid production is influenced by the competition between the enzymes of the principal pathways and the saturated acyl-ACP thioesterases. Genetic backgrounds with more efficient saturated acyl-ACP thioesterase alleles only express their phenotypic effects when the alleles for the enzymes in the main pathway are less efficient. For this reason, we studied the incorporation of [2-(14)C]acetate into the lipids of developing sunflower seeds (Helianthus annuus L.) from several mutant lines in vivo. The labelling of different triacylglycerol fatty acids in different oilseed mutants reflects the fatty acid composition of the seed and supports the channelling theory of fatty acid biosynthesis. Incubation with methyl viologen diminished the conversion of stearoyl-ACP to oleoyl-ACP in vivo through a decrease in the available reductant power. In turn, this led to the accumulation of stearoyl-ACP to the levels detected in seeds from high stearic acid mutants. The concomitant reduction of oleoyl-ACP content inside the plastid allowed us to study the activity of acyl-ACP thioesterases on saturated fatty acids. In these mutants, we verified that the accumulation of saturated fatty acids requires efficient thioesterase activity on saturated-ACPs. By studying the effects of cerulenin on the in vivo incorporation of [2-(14)C]acetate into lipids and on the in vitro activity of beta-ketoacyl-ACP synthase II, we found that elongation to very long chain fatty acids can occur both inside and outside of the plastid in sunflower seeds. PMID:16500723

  8. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  9. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  10. Combined kinetic studies and computational analysis on kojic acid analogous as tyrosinase inhibitors.

    PubMed

    Lima, Carlyle Ribeiro; Silva, José Rogério A; de Tássia Carvalho Cardoso, Erica; Silva, Edilene O; Lameira, Jerônimo; do Nascimento, José Luiz Martins; do Socorro Barros Brasil, Davi; Alves, Cláudio N

    2014-01-01

    Tyrosinase is a key enzyme in melanin synthesis and widely distributed in plants and animals tissues. In mammals, this enzyme is related to pigment production, involved in wound healing, primary immune response and it can also contribute to catecholamines synthesis in the brain. Consequently, tyrosinase enzyme represents an attractive and selective target in the field of the medicine, cosmetics and bio-insecticides. In this paper, experimental kinetics and computational analysis were used to study the inhibition of tyrosinase by analogous of Kojic acid. The main interactions occurring between inhibitors-tyrosinase complexes and the influence of divalent cation (Cu2+) in enzymatic inhibition were investigated by using molecular docking, molecular dynamic simulations and electrostatic binding free energy by using the Linear Interaction Energy (LIE) method. The results showed that the electrostatic binding free energy are correlated with values of constant inhibition (r2 = 0.97).Thus, the model obtained here could contribute to future studies of this important system and, therefore, eventually facilitate development of tyrosinase inhibitors. PMID:25004069

  11. Practical Synthesis of PC190723, An Inhibitor of the Bacterial Cell Division Protein FtsZ

    PubMed Central

    Sorto, Nohemy A.; Olmstead, Marilyn M.; Shaw, Jared T.

    2010-01-01

    A high-yielding and practical synthesis of the bacterial cell division inhibitor PC190723 is described. The synthesis is completed in a longest linear sequence of five steps from commercially available starting materials and can be readily executed on a multi-gram scale. PMID:21033691

  12. Binding of α,α-Disubstituted Amino Acids to Arginase Suggests New Avenues for Inhibitor Design1

    PubMed Central

    Ilies, Monica; Di Costanzo, Luigi; Dowling, Daniel P.; Thorn, Katherine J.; Christianson, David W.

    2011-01-01

    Arginase is a binuclear manganese metalloenzyme that hydrolyzes L-arginine to form L-ornithine and urea, and aberrant arginase activity is implicated in various diseases such as erectile dysfunction, asthma, atherosclerosis, and cerebral malaria. Accordingly, arginase inhibitors may be therapeutically useful. Continuing our efforts to expand the chemical space of arginase inhibitor design, and inspired by the binding of 2-(difluoromethyl)-L-ornithine to human arginase I, we now report the first study of the binding of α,α-disubstituted amino acids to arginase. Specifically, we report the design, synthesis, and assay of racemic 2-amino-6-borono-2- methylhexanoic acid and racemic 2-amino-6-borono-2-(difluoromethyl)hexanoic acid. X-ray crystal structures of human arginase I and Plasmodium falciparum arginase complexed with these inhibitors reveal the exclusive binding of the L-stereoisomer; the additional α-substituent of each inhibitor is readily accommodated and makes new intermolecular interactions in the outer active site of each enzyme. Therefore, this work highlights a new region of the protein surface that can be targeted for additional affinity interactions, as well as the first comparative structural insights on inhibitor discrimination between a human and a parasitic arginase. PMID:21728378

  13. Amino derivatives of glycyrrhetinic acid as potential inhibitors of cholinesterases.

    PubMed

    Schwarz, Stefan; Lucas, Susana Dias; Sommerwerk, Sven; Csuk, René

    2014-07-01

    The development of remedies against the Alzheimer's disease (AD) is one of the biggest challenges in medicinal chemistry nowadays. Although not completely understood, there are several strategies fighting this disease or at least bringing some relief. During the progress of AD, the level of acetylcholine (ACh) decreases; hence, a therapy using inhibitors should be of some benefit to the patients. Drugs presently used for the treatment of AD inhibit the two ACh controlling enzymes, acetylcholinesterase as well as butyrylcholinesterase; hence, the design of selective inhibitors is called for. Glycyrrhetinic acid seems to be an interesting starting point for the development of selective inhibitors. Although its glycon, glycyrrhetinic acid is known for being an AChE activator, several derivatives, altered in position C-3 and C-30, exhibited remarkable inhibition constants in micro-molar range. Furthermore, five representative compounds were subjected to three more enzyme assays (on carbonic anhydrase II, papain and the lipase from Candida antarctica) to gain information about the selectivity of the compounds in comparison to other enzymes. In addition, photometric sulforhodamine B assays using murine embryonic fibroblasts (NiH 3T3) were performed to study the cytotoxicity of these compounds. Two derivatives, bearing either a 1,3-diaminopropyl or a 1H-benzotriazolyl residue, showed a BChE selective inhibition in the single-digit micro-molar range without being cytotoxic up to 30μM. In silico molecular docking studies on the active sites of AChE and BChE were performed to gain a molecular insight into the mode of action of these compounds and to explain the pronounced selectivity for BChE. PMID:24853320

  14. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  15. Hyaluronic acid lipoate: synthesis and physicochemical properties.

    PubMed

    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco

    2013-03-01

    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  16. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  17. cis-Cinnamic acid selective suppressors distinct from auxin inhibitors.

    PubMed

    Okuda, Katsuhiro; Nishikawa, Keisuke; Fukuda, Hiroshi; Fujii, Yoshiharu; Shindo, Mitsuru

    2014-01-01

    The activity of cis-cinnamic acid (cis-CA), one of the allelochemicals, in plants is very similar to that of indole-3-acetic acid (IAA), a natural auxin, and thus cis-CA has long been believed to be an analog of auxin. We have reported some structure-activity relationships studies by synthesizing over 250 cis-CA derivatives and estimating their inhibitory activities on root growth inhibition in lettuce. In this study, the compounds that showed low- or no-activity on root growth inhibition were recruited as candidates suppressors against cis-CA and/or auxin and tested for their activity. In the presence of cis-CA, lettuce root growth was inhibited; however, the addition of some cis-CA derivatives restored control-level root growth. Four compounds, (Z)-3-(4-isopropylphenyl)acrylic acid, (Z)-3-(3-butoxyphenyl)acrylic acid, (Z)-3-[3-(pentyloxy)phenyl]acrylic acid, and (Z)-3-(naphthalen-1-yl)acrylic acid were selected as candidates for a cis-CA selective suppressor they allowed the recovery of root growth from inhibition by cis-CA treatment without any effects on the IAA-induced effect or elongating activity by themselves. Three candidates significantly ameliorated the root shortening by the potent inhibitor derived from cis-CA. In brief, we have found some cis-CA selective suppressors which have never been reported from inactive cis-CA derivatives for root growth inhibition. cis-CA selective suppressors will play an important role in elucidating the mechanism of plant growth regulation. PMID:24881667

  18. Stereocontrolled Synthesis of a Potential Transition-State Inhibitor of the Salicylate Synthase MbtI from Mycobacterium tuberculosis

    PubMed Central

    Liu, Zheng; Liu, Feng; Aldrich, Courtney C.

    2015-01-01

    Mycobactins are small-molecule iron chelators (siderophores) produced by Mycobacterium tuberculosis (Mtb) for iron mobilization. The bifunctional salicylate synthase MbtI catalyzes the first step of mycobactin biosynthesis through the conversion of the primary metabolite chorismate into salicylic acid via isochorismate. We report the design, synthesis and biochemical evaluation of an inhibitor based on the putative transition-state (TS) for the isochorismatase partial reaction of MbtI. The inhibitor mimics the hypothesized charge build-up at C-4 of chorismate in the TS as well as C-O bond-formation at C-6. Another important design element of the inhibitor is replacement of the labile pyruvate side-chain in chorismate with a stable C-linked propionate isostere. We developed a stereocontrolled synthesis of the highly functionalized cyclohexene inhibitor that features an asymmetric aldol reaction using a titanium enolate, diastereoselective Grignard addition to a tert-butanesulfinyl aldimine, and ring closing olefin metathesis as key steps. PMID:26035083

  19. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  20. Synthesis and anti-HIV activity of some [Nucleoside Reverse Transcriptase Inhibitor]-C5'-linker-[Integrase Inhibitor] heterodimers as inhibitors of HIV replication.

    PubMed

    Sugeac, Elena; Fossey, Christine; Ladurée, Daniel; Schmidt, Sylvie; Laumond, Geraldine; Aubertin, Anne-Marie

    2004-12-01

    Selected for their expected ability to inhibit HIV replication, a series of eight heterodimers containing a Nucleoside Reverse Transcriptase Inhibitor (NRTI) and an Integrase Inhibitor (INI), bound by a linker, were designed and synthesized. For the NRTIs, d4U, d2U and d4T were chosen. For the INIs, 4-[1-(4-fluorobenzyl)-1H-pyrrol-2-yl]-2,4-dioxobutyric acid (6) and 4-(3,5-dibenzyloxyphenyl)-2,4-dioxobutyric acid (9) (belonging to the beta-diketo acids class) were chosen. The conjugation of the two different inhibitors (NRTI and INI) was performed using an amino acid (glycine or beta-alanine) as a cleavable linker. PMID:15662954

  1. Integrase Inhibitor Prodrugs: Approaches to Enhancing the Anti-HIV Activity of β-Diketo Acids.

    PubMed

    Nair, Vasu; Okello, Maurice

    2015-01-01

    HIV integrase, encoded at the 3'-end of the HIV pol gene, is essential for HIV replication. This enzyme catalyzes the incorporation of HIV DNA into human DNA, which represents the point of "no-return" in HIV infection. Integrase is a significant target in anti-HIV drug discovery. This review article focuses largely on the design of integrase inhibitors that are β-diketo acids constructed on pyridinone scaffolds. Methodologies for synthesis of these compounds are discussed. Integrase inhibition data for the strand transfer (ST) step are compared with in vitro anti-HIV data. The review also examines the issue of the lack of correlation between the ST enzymology data and anti-HIV assay results. Because this disconnect appeared to be a problem associated with permeability, prodrugs of these inhibitors were designed and synthesized. Prodrugs dramatically improved the anti-HIV activity data. For example, for compound, 96, the anti-HIV activity (EC50) improved from 500 nM for this diketo acid to 9 nM for its prodrug 116. In addition, there was excellent correlation between the IC50 and IC90 ST enzymology data for 96 (6 nM and 97 nM, respectively) and the EC50 and EC90 anti-HIV data for its prodrug 116 (9 nM and 94 nM, respectively). Finally, it was confirmed that the prodrug 116 was rapidly hydrolyzed in cells to the active compound 96. PMID:26184144

  2. Design, Synthesis, and Biological Evaluation of 14-Substituted Aromathecins as Topoisomerase I Inhibitors

    PubMed Central

    Cinelli, Maris A.; Morrell, Andrew; Dexheimer, Thomas S.; Scher, Evan S.; Pommier, Yves; Cushman, Mark

    2008-01-01

    The aromathecin or “rosettacin” class of topoisomerase I (top1) inhibitors is effectively a “composite” of the natural products camptothecin and luotonin A and the synthetic indenoisoquinolines. The aromathecins have aroused considerable interest following the isolation and total synthesis of 22-hydroxyacuminatine, a rare cytotoxic natural product containing the 12H-5,11a-diazadibenzo[b,h]fluoren-11-one system. We have developed two novel syntheses of this system and prepared a series of 14-substituted aromathecins as novel antiproliferative topoisomerase I poisons. These inhibitors are proposed to act via an intercalation and “poisoning” mechanism identical to camptothecin and the indenoisoquinolines. Many of these compounds possess greater antiproliferative activity and anti-top1 activity than the parent unsubstituted compound (rosettacin) and previously synthesized aromathecins, as well as greater top1 inhibitory activity than 22-hydroxyacuminatine. In addition to potentially aiding solubility and localization to the DNA–enzyme complex, nitrogenous substituents located at the 14-position of the aromathecin system have been proposed to project into the major groove of the top1–DNA complex and hydrogen bond to major-groove amino acids, thereby stabilizing the ternary complex. PMID:18630891

  3. Rapid synthesis of the 7-deoxy zaragozic acid core.

    PubMed

    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J

    2002-01-24

    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  4. First total synthesis of prasinic acid and its anticancer activity.

    PubMed

    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt

    2012-11-01

    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  5. Molecular assembly for high-performance bivalent nucleic acid inhibitor.

    PubMed

    Kim, Youngmi; Cao, Zehui; Tan, Weihong

    2008-04-15

    It is theorized that multivalent interaction can result in better affinity and selectivity than monovalent interaction in the design of high-performance ligands. Accordingly, biomolecular engineers are increasingly taking advantage of multivalent interactions to fabricate novel molecular assemblies, resulting in new functions for ligands or enhanced performance of existing ligands. Substantial efforts have been expended in using small molecules or epitopes of antibodies for designing multifunctional or better-performing ligands. However, few attempts to use nucleic acid aptamers as functional domains have been reported. In this study, we explore the design of bivalent nucleic acid ligands by using thrombin and its aptamers as the model by which to evaluate its functions. By assembling two thrombin-binding aptamers with optimized design parameters, this assembly has resulted in the successful development of a nucleic acid-based high-performance bivalent protein inhibitor. Our experimentation proved (i) that the simultaneous binding of two aptamers after linkage achieved 16.6-fold better inhibition efficiency than binding of the monovalent ligand and (ii) that such an improvement originated from changes in the kinetics of the binding interactions, with a k(off) rate approximately 1/50 as fast. In addition, the newly generated aptamer assembly is an excellent anticoagulant reagent when tested with different samples. Because this optimized ligand design offers a simple and noninvasive means of accomplishing higher performance from known functional aptamers, it holds promise as a potent antithrombin agent in the treatment of various diseases related to abnormal thrombin activities. PMID:18398007

  6. Identification of Bidentate Salicylic Acid Inhibitors of PTP1B.

    PubMed

    Haftchenary, Sina; Jouk, Andriana O; Aubry, Isabelle; Lewis, Andrew M; Landry, Melissa; Ball, Daniel P; Shouksmith, Andrew E; Collins, Catherine V; Tremblay, Michel L; Gunning, Patrick T

    2015-09-10

    PTP1B is a master regulator in the insulin and leptin metabolic pathways. Hyper-activated PTP1B results in insulin resistance and is viewed as a key factor in the onset of type II diabetes and obesity. Moreover, inhibition of PTP1B expression in cancer cells dramatically inhibits cell growth in vitro and in vivo. Herein, we report the computationally guided optimization of a salicylic acid-based PTP1B inhibitor 6, identifying new and more potent bidentate PTP1B inhibitors, such as 20h, which exhibited a > 4-fold improvement in activity. In CHO-IR cells, 20f, 20h, and 20j suppressed PTP1B activity and restored insulin receptor phosphorylation levels. Notably, 20f, which displayed a 5-fold selectivity for PTP1B over the closely related PTPσ protein, showed no inhibition of PTP-LAR, PRL2 A/S, MKPX, or papain. Finally, 20i and 20j displayed nanomolar inhibition of PTPσ, representing interesting lead compounds for further investigation. PMID:26396684

  7. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  8. Sulfonyl fluoride inhibitors of fatty acid amide hydrolase.

    PubMed

    Alapafuja, Shakiru O; Nikas, Spyros P; Bharathan, Indu T; Shukla, Vidyanand G; Nasr, Mahmoud L; Bowman, Anna L; Zvonok, Nikolai; Li, Jing; Shi, Xiaomeng; Engen, John R; Makriyannis, Alexandros

    2012-11-26

    Sulfonyl fluorides are known to inhibit esterases. Early work from our laboratory has identified hexadecyl sulfonylfluoride (AM374) as a potent in vitro and in vivo inhibitor of fatty acid amide hydrolase (FAAH). We now report on later generation sulfonyl fluoride analogs that exhibit potent and selective inhibition of FAAH. Using recombinant rat and human FAAH, we show that 5-(4-hydroxyphenyl)pentanesulfonyl fluoride (AM3506) has similar inhibitory activity for both the rat and the human enzyme, while rapid dilution assays and mass spectrometry analysis suggest that the compound is a covalent modifier for FAAH and inhibits its action in an irreversible manner. Our SAR results are highlighted by molecular docking of key analogs. PMID:23083016

  9. Total synthesis of amiclenomycin, an inhibitor of biotin biosynthesis.

    PubMed

    Mann, Stéphane; Carillon, Sophie; Breyne, Olivier; Marquet, Andrée

    2002-01-18

    We describe the first synthesis of amiclenomycin, a natural product that has been found to inhibit biotin biosynthesis and, as a consequence, to exhibit antibiotic properties. Structure 1, with a trans relationship between the ring substituents. had previously been proposed for amiclenomycin on the basis of its 1H NMR spectrum. We have prepared the trans and cis isomers 1 and 2 by unequivocal routes and we conclude that the natural product is in fact the cis isomer 2. The properly substituted cyclohexadienyl rings were constructed first. A cycloaddition reaction between 1,2-di(phenylsulfonyl)ethylene and the N-allyloxycarbonyl diene 13, followed by reductive elimination of the phenylsulfinyl groups, gave the cis isomer 15. To obtain the trans isomer, the O-trimethylsilyl diene was used to give the cis hydroxylated Diels-Alder adduct 33, which was transformed into the corresponding trans amino derivative by means of a Mitsunobu reaction. The L-alpha-amino acid functionality was introduced by means of a Strecker reaction on the aldehydes 16 and 42, followed by enzymatic hydrolysis with immobilised pronase. PMID:11843156

  10. 4,5-Diarylisoxazol-3-carboxylic acids: A new class of leukotriene biosynthesis inhibitors potentially targeting 5-lipoxygenase-activating protein (FLAP).

    PubMed

    Banoglu, Erden; Çelikoğlu, Erşan; Völker, Susanna; Olgaç, Abdurrahman; Gerstmeier, Jana; Garscha, Ulrike; Çalışkan, Burcu; Schubert, Ulrich S; Carotti, Andrea; Macchiarulo, Antonio; Werz, Oliver

    2016-05-01

    In this article, we report novel leukotriene (LT) biosynthesis inhibitors that may target 5-lipoxygenase-activating protein (FLAP) based on the previously identified isoxazole derivative (8). The design and synthesis was directed towards a subset of 4,5-diaryl-isoxazole-3-carboxylic acid derivatives as LT biosynthesis inhibitors. Biological evaluation disclosed a new skeleton of potential anti-inflammatory agents, exemplified by 39 and 40, which potently inhibit cellular 5-LO product synthesis (IC50 = 0.24 μM, each) seemingly by targeting FLAP with weak inhibition on 5-LO (IC50 ≥ 8 μM). Docking studies and molecular dynamic simulations with 5-LO and FLAP provide valuable insights into potential binding modes of the inhibitors. Together, these diaryl-isoxazol-3-carboxylic acids may possess potential as leads for development of effective anti-inflammatory drugs through inhibition of LT biosynthesis. PMID:26922224

  11. Synthesis and anti-HIV evaluation of hybrid-type prodrugs conjugating HIV integrase inhibitors with d4t by self-cleavable spacers containing an amino acid residue.

    PubMed

    Fossey, Christine; Huynh, Ngoc-Trinh; Vu, Anh-Hoang; Vidu, Anamaria; Zarafu, Irina; Laduree, Daniel; Schmidt, Sylvie; Laumond, Geraldine; Aubertin, Anne-Marie

    2007-10-01

    In an attempt to combine the anti-HIV inhibitory capacity of reverse transcriptase (RT) inhibitors (NRTIs) and integrase (IN) inhibitors (INIs), several heterodimer analogues of the previously reported [d4T]-PABC-[INI] and [d4T]-OABC-[INI] prototypes have been prepared. In these novel series, we wished to extend our results to conjugates which incorporated an enzymatically labile aminoacid unit (L-alanine) connected to d4T through a self-immolative para- or ortho-aminobenzyl carbonate (PABC or OABC) spacer. Among the novel heterodimers, several derivatives show a potent anti-HIV-1 activity, which proved comparable to that of the [L-708,906]-PABC-[d4T] Heterodimer A prototype. However, although the compounds proved inhibitory to HIV-1, they were less potent than the parent compounds from which they were derived. PMID:18035829

  12. The Synthesis of α,α-Disubstituted α-Amino Acids via Ichikawa Rearrangement.

    PubMed

    Szcześniak, Piotr; Pieczykolan, Michał; Stecko, Sebastian

    2016-02-01

    An approach to α,α-disubstituted α-amino acids is reported. The key step is allyl cyanate-to-isocyanate rearrangement. As demonstrated, the resultant allyl isocyanates can be directly trapped with various nucleophiles, for instance, alcohols, amines, and organometallic reagents, to provide a broad range of N-functionalized allylamines. The developed method has been successfully applied in the synthesis of two bioactive peptides: 2-aminoadamantane-2-carboxylic acid derived P2X7-evoked glutamate release inhibitor and 4-amino-tetrahydropyranyl-4-carboxylic acid derived dipeptide GSK-2793660, which is currently in clinical trials as cathepsin C inhibitor for the treatment of cystic fibrosis, noncystic fibrosis bronchiectasis, ANCA-associated vasculitis and bronchiectasis. PMID:26726732

  13. Complestatin exerts antibacterial activity by the inhibition of fatty acid synthesis.

    PubMed

    Kwon, Yun-Ju; Kim, Hyun-Ju; Kim, Won-Gon

    2015-01-01

    Bacterial enoyl-acyl carrier protein (ACP) reductase has been confirmed as a novel target for antibacterial drug development. In the screening of inhibitors of Staphylococcus aureus enoyl-ACP reductase (FabI), complestatin was isolated as a potent inhibitor of S. aureus FabI together with neuroprotectin A and chloropeptin I from Streptomyces chartreusis AN1542. Complestatin and related compounds inhibited S. aureus FabI with IC₅₀ of 0.3-0.6 µM. They also prevented the growth of S. aureus as well as methicillin-resistance S. aureus (MRSA) and quinolone-resistant S. aureus (QRSA), with minimum inhibitory concentrations (MICs) of 2-4 µg/mL. Consistent with its FabI-inhibition, complestatin selectively inhibited the intracellular fatty acid synthesis in S. aureus, whereas it did not affect the macromolecular biosynthesis of other cellular components, such as DNA, RNA, proteins, and the cell wall. Additionally, supplementation with exogenous fatty acids reversed the antibacterial effect of complestatin, demonstrating that it targets fatty acid synthesis. In this study, we reported that complestatin and related compounds showed potent antibacterial activity via inhibiting fatty acid synthesis. PMID:25947917

  14. Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

    PubMed Central

    Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

    2009-01-01

    In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

  15. Identification of novel functional inhibitors of acid sphingomyelinase.

    PubMed

    Kornhuber, Johannes; Muehlbacher, Markus; Trapp, Stefan; Pechmann, Stefanie; Friedl, Astrid; Reichel, Martin; Mühle, Christiane; Terfloth, Lothar; Groemer, Teja W; Spitzer, Gudrun M; Liedl, Klaus R; Gulbins, Erich; Tripal, Philipp

    2011-01-01

    We describe a hitherto unknown feature for 27 small drug-like molecules, namely functional inhibition of acid sphingomyelinase (ASM). These entities named FIASMAs (Functional Inhibitors of Acid SphingoMyelinAse), therefore, can be potentially used to treat diseases associated with enhanced activity of ASM, such as Alzheimer's disease, major depression, radiation- and chemotherapy-induced apoptosis and endotoxic shock syndrome. Residual activity of ASM measured in the presence of 10 µM drug concentration shows a bimodal distribution; thus the tested drugs can be classified into two groups with lower and higher inhibitory activity. All FIASMAs share distinct physicochemical properties in showing lipophilic and weakly basic properties. Hierarchical clustering of Tanimoto coefficients revealed that FIASMAs occur among drugs of various chemical scaffolds. Moreover, FIASMAs more frequently violate Lipinski's Rule-of-Five than compounds without effect on ASM. Inhibition of ASM appears to be associated with good permeability across the blood-brain barrier. In the present investigation, we developed a novel structure-property-activity relationship by using a random forest-based binary classification learner. Virtual screening revealed that only six out of 768 (0.78%) compounds of natural products functionally inhibit ASM, whereas this inhibitory activity occurs in 135 out of 2028 (6.66%) drugs licensed for medical use in humans. PMID:21909365

  16. Identification of Novel Functional Inhibitors of Acid Sphingomyelinase

    PubMed Central

    Trapp, Stefan; Pechmann, Stefanie; Friedl, Astrid; Reichel, Martin; Mühle, Christiane; Terfloth, Lothar; Groemer, Teja W.; Spitzer, Gudrun M.; Liedl, Klaus R.; Gulbins, Erich; Tripal, Philipp

    2011-01-01

    We describe a hitherto unknown feature for 27 small drug-like molecules, namely functional inhibition of acid sphingomyelinase (ASM). These entities named FIASMAs (Functional Inhibitors of Acid SphingoMyelinAse), therefore, can be potentially used to treat diseases associated with enhanced activity of ASM, such as Alzheimer's disease, major depression, radiation- and chemotherapy-induced apoptosis and endotoxic shock syndrome. Residual activity of ASM measured in the presence of 10 µM drug concentration shows a bimodal distribution; thus the tested drugs can be classified into two groups with lower and higher inhibitory activity. All FIASMAs share distinct physicochemical properties in showing lipophilic and weakly basic properties. Hierarchical clustering of Tanimoto coefficients revealed that FIASMAs occur among drugs of various chemical scaffolds. Moreover, FIASMAs more frequently violate Lipinski's Rule-of-Five than compounds without effect on ASM. Inhibition of ASM appears to be associated with good permeability across the blood-brain barrier. In the present investigation, we developed a novel structure-property-activity relationship by using a random forest-based binary classification learner. Virtual screening revealed that only six out of 768 (0.78%) compounds of natural products functionally inhibit ASM, whereas this inhibitory activity occurs in 135 out of 2028 (6.66%) drugs licensed for medical use in humans. PMID:21909365

  17. Effects of norflurazon, an inhibitor of carotenogenesis, on abscisic acid and xanthoxin in the caps of gravistimulated maize roots

    NASA Technical Reports Server (NTRS)

    Feldman, L. J.; Sun, P. S.

    1986-01-01

    Maize seeds were germinated in the dark in the presence of the carotenoid synthesis inhibitor norflurazon and the levels of abscisic acid, xanthoxin and total carotenoids were measured in the root cap and in the adjacent 1.5 mm segment. In norflurazon-treated roots abscisic acid levels were markedly reduced, but an increase occurred in the levels of xanthoxin, a compound structurally and physiologically similar to abscisic acid. In the cultivar of maize (Zea mays L. cv. Merit) used for this work, brief illumination of the root is required for gravitropic curving. Following illumination both control and norflurazon-treated roots showed normal gravitropic curvature; however, the rate of curvature was delayed in norflurazon-treated roots. Our data from norflurazon-treated roots are consistent with a role for xanthoxin in maize root gravitropism. The increase in xanthoxin in the presence of an inhibitor of carotenoid synthesis suggests that xanthoxin and abscisic acid originate, at least in part, via different metabolic pathways.

  18. Cyclopentanedi- and tricarboxylic acids as squalene synthase inhibitors: syntheses and evaluation.

    PubMed

    Shen, W; Garvey, D S; Cohen, J; Stein, H; Rosenberg, S H

    1998-04-21

    Based on earlier lead squalene synthase inhibitor A-87049 (3) and zaragozic acids, a series of cyclopentanedi- and tricarboxylic acids were synthesized and evaluated against the enzyme. Some exhibited good potency and SAR revealed the importance of conformation and substitution pattern of these synthetic inhibitors. PMID:9871507

  19. Development and testing of a low toxicity acid corrosion inhibitor for industrial cleaning applications

    SciTech Connect

    Frenier, W.W.

    1997-02-01

    A low toxicity corrosion inhibitor used in hydrochloric acid cleaning formulations has been developed. This formulation does not contain formaldehyde. It contains cinnamaldehyde, quaternary nitrogen salts, and a nonionic surfactant, none of which are currently known or suspected to be carcinogens. In laboratory tests, corrosion protection values were equivalent to those provided by current commercial acid inhibitors. Field tests using the low toxicity inhibitor were conducted.

  20. Increased fatty acid synthesis inhibits nitrogen starvation-induced autophagy in lipid droplet-deficient yeast.

    PubMed

    Régnacq, Matthieu; Voisin, Pierre; Sere, Yves Y; Wan, Bin; Soeroso, Venty M S; Bernard, Marianne; Camougrand, Nadine; Bernard, François-Xavier; Barrault, Christine; Bergès, Thierry

    2016-08-12

    Macroautophagy is a degradative pathway whereby cells encapsulate and degrade cytoplasmic material within endogenously-built membranes. Previous studies have suggested that autophagosome membranes originate from lipid droplets. However, it was recently shown that rapamycin could induce autophagy in cells lacking these organelles. Here we show that lipid droplet-deprived cells are unable to perform autophagy in response to nitrogen-starvation because of an accelerated lipid synthesis that is not observed with rapamycin. Using cerulenin, a potent inhibitor of fatty acid synthase, and exogenous addition of palmitic acid we could restore nitrogen-starvation induced autophagy in the absence of lipid droplets. PMID:27270031

  1. Design and synthesis of hepatoselective, pyrrole-based HMG-CoA reductase inhibitors.

    PubMed

    Pfefferkorn, Jeffrey A; Song, Yuntao; Sun, Kuai-Lin; Miller, Steven R; Trivedi, Bharat K; Choi, Chulho; Sorenson, Roderick J; Bratton, Larry D; Unangst, Paul C; Larsen, Scott D; Poel, Toni-Jo; Cheng, Xue-Min; Lee, Chitase; Erasga, Noe; Auerbach, Bruce; Askew, Valerie; Dillon, Lisa; Hanselman, Jeffrey C; Lin, Zhiwu; Lu, Gina; Robertson, Andrew; Olsen, Karl; Mertz, Thomas; Sekerke, Catherine; Pavlovsky, Alexander; Harris, Melissa S; Bainbridge, Graeme; Caspers, Nicole; Chen, Huifen; Eberstadt, Matthias

    2007-08-15

    This manuscript describes the design and synthesis of a series of pyrrole-based inhibitors of HMG-CoA reductase for the treatment of hypercholesterolemia. Analogs were optimized using structure-based design and physical property considerations resulting in the identification of 44, a hepatoselective HMG-CoA reductase inhibitor with excellent acute and chronic efficacy in a pre-clinical animal models. PMID:17574412

  2. Synthesis and structure–activity relationships of tyrosine-based inhibitors of autotaxin (ATX)

    PubMed Central

    East, James E.; Kennedy, Andrew J.; Tomsig, Jose L.; De Leon, Alexandra R.; Lynch, Kevin R.; Macdonald, Timothy L.

    2010-01-01

    Autotaxin (ATX) is a secreted soluble enzyme that generates lysophosphatidic acid (LPA) through its lysophospholipase D activity. Because of LPA’s role in neoplastic diseases, ATX is an attractive therapeutic target due to its involvement in LPA biosynthesis. Here we describe the SAR of ATX inhibitor, VPC8a202, and apply this SAR knowledge towards developing a high potency inhibitor. We found that electron density in the pyridine region greatly influences activity of our inhibitors at ATX. PMID:20951039

  3. Design and Synthesis of Potent, Selective Inhibitors of Matriptase

    PubMed Central

    2012-01-01

    Matriptase is a member of the type II transmembrane serine protease family. Several studies have reported deregulated matriptase expression in several types of epithelial cancers, suggesting that matriptase constitutes a potential target for cancer therapy. We report herein a new series of slow, tight-binding inhibitors of matriptase, which mimic the P1–P4 substrate recognition sequence of the enzyme. Preliminary structure–activity relationships indicate that this benzothiazole-containing RQAR-peptidomimetic is a very potent inhibitor and possesses a good selectivity for matriptase versus other serine proteases. A molecular model was generated to elucidate the key contacts between inhibitor 1 and matriptase. PMID:24900505

  4. Synthesis of Chromone, Quinolone, and Benzoxazinone Sulfonamide Nucleosides as Conformationally Constrained Inhibitors of Adenylating Enzymes Required for Siderophore Biosynthesis

    PubMed Central

    Engelhart, Curtis A.; Aldrich, Courtney C.

    2013-01-01

    MbtA catalyzes the first committed step of mycobactin biosynthesis in Mycobacterium tuberculosis (Mtb) and is responsible for the incorporation of salicylic acid into the mycobactin siderophores. 5′-O-[N-(Salicyl)sulfamoyl]adenosine (Sal-AMS) is an extremely potent nucleoside inhibitor of MbtA that possesses excellent activity against whole-cell Mtb, but suffers from poor bioavailability. In an effort to improve the bioavailability, we have designed four conformationally constrained analogues of Sal-AMS that remove two rotatable bonds and the ionized sulfamate group based on computational and structural studies. Herein we describe the synthesis, biochemical, and microbiological evaluation of chromone-, quinolone-, and benzoxazinone-3-sulfonamide derivatives of Sal-AMS. We developed new chemistry to assemble these three heterocycles from common β-ketosulfonamide intermediates. The synthesis of the chromone- and quinolone-3-sulfonamide intermediates features formylation of a β-ketosulfonamide employing dimethylformamide dimethyl acetal to afford an enaminone that can react intramolecularly with a phenol or intermolecularly with a primary amine via addition-elimination reaction(s). The benzoxazinone-3-sulfonamide was prepared by nitrosation of a β-ketosulfonamide followed by intramolecular nucleophilic aromatic substitution. Mitsunobu coupling of these bicyclic sulfonamides with a protected adenosine derivative followed by global deprotection provides a concise synthesis of the respective inhibitors. PMID:23805993

  5. Design and synthesis of potent, isoxazole-containing renin inhibitors.

    PubMed

    Fournier, Pierre-André; Arbour, Mélissa; Cauchon, Elizabeth; Chen, Austin; Chefson, Amandine; Ducharme, Yves; Falgueyret, Jean-Pierre; Gagné, Sébastien; Grimm, Erich; Han, Yongxin; Houle, Robert; Lacombe, Patrick; Lévesque, Jean-François; MacDonald, Dwight; Mackay, Bruce; McKay, Dan; Percival, M David; Ramtohul, Yeeman; St-Jacques, René; Toulmond, Sylvie

    2012-04-15

    The design and optimization of a novel isoxazole S(1) linker for renin inhibitor is described herein. This effort culminated in the identification of compound 18, an orally bioavailable, sub-nanomolar renin inhibitor even in the presence of human plasma. When compound 18 was found to inhibit CYP3A4 in a time dependent manner, two strategies were pursued that successfully delivered equipotent compounds with minimal TDI potential. PMID:22450130

  6. Possible involvement of phospholipase C and protein kinase C in stimulatory actions of L-leucine and its keto acid, alpha-ketoisocaproic acid, on protein synthesis in RLC-16 hepatocytes.

    PubMed

    Yagasaki, Kazumi; Morisaki-Tsuji, Naoko; Miura, Atsuhito; Funabiki, Ryuhei

    2002-11-01

    Effects of leucine and related compounds on protein synthesis were studied in RLC-16 hepatocytes. The incorporation of [(3)H] tyrosine into cellular protein was measured as an indexof protein synthesis. In leucine-depleted RLC-16 cells, L-leucineand its keto acid, alpha-ketoisocaproic acid (KIC), stimulated protein synthesis, while D-leucine did not. Mepacrine, an inhibitor of both phospholipase A(2) and C canceled stimulatory actions of L-leucine and KIC on protein synthesis, suggesting a possible involvement of either arachidonic acid metabolism by phospholipase A(2), cyclooxygenase or lipoxygenase, or phosphatidylinositol degradation by phospholipase C in the stimulatory actions of L-leucine and KIC.Neither indomethacin, an inhibitor of cyclooxygenase, nor caffeic acid, an inhibitor of lipoxygenase, diminished their stimulatory actions, suggesting no involvement of arachidonic acid metabolism. Conversely, 1-O-hexadecyl-2-O-methylglycerol, an inhibitor of protein kinase C, significantly canceled the stimulatory actions of L-leucine and KIC on protein synthesis, suggesting an involvement of phosphatidylinositol degradation and activation of protein kinase C. These results strongly suggest that both L-leucine and KIC stimulate protein synthesis in RLC-16 cells via activation of phospholipase C and production of diacylglycerol and inositol triphosphate from phosphatidylinositol, which in turn activate protein kinase C. PMID:19003115

  7. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  8. Total synthesis and complete stereostructure of gambieric acid A.

    PubMed

    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto

    2012-07-25

    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  9. Synthesis of fatty acids in the perused mouse liver.

    PubMed

    Salmon, D M; Bowen, N L; Hems, D A

    1974-09-01

    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  10. Synthesis and Evaluation of Macrocyclic Peptide Aldehydes as Potent and Selective Inhibitors of the 20S Proteasome.

    PubMed

    Wilson, David L; Meininger, Isabel; Strater, Zack; Steiner, Stephanie; Tomlin, Frederick; Wu, Julia; Jamali, Haya; Krappmann, Daniel; Götz, Marion G

    2016-03-10

    This research explores the first design and synthesis of macrocyclic peptide aldehydes as potent inhibitors of the 20S proteasome. Two novel macrocyclic peptide aldehydes based on the ring-size of the macrocyclic natural product TMC-95 were prepared and evaluated as inhibitors of the 20S proteasome. Both compounds inhibited in the low nanomolar range and proved to be selective for the proteasome over other serine and cysteine proteases, particularly when compared to linear analogues with similar amino acid sequences. In HeLa cells, both macrocycles efficiently inhibited activation of nuclear factor-κB (NF-κB) transcription factor by blocking proteasomal degradation of the inhibitor protein IκBα after cytokine stimulation. Due to their covalent mechanism of binding these compounds represent a 1000-fold increase in inhibitory potency over previously reported noncovalently binding TMC-95 analogues. Molecular modeling of the macrocyclic peptides confirms the preference of the large S3 pocket for large, hydrophobic residues and the ability to exploit this to improve selectivity of proteasome inhibitors. PMID:26985310

  11. Synthesis and preliminary evaluation of 5,7-dimethyl-2-aryl-3H-pyrrolizin-3-ones as angiogenesis inhibitors.

    PubMed

    Kirk, Nicholas S; Bezos, Anna; Willis, Anthony C; Sudta, Pichit; Suksamrarn, Sunit; Parish, Christopher R; Ranson, Marie; Kelso, Michael J

    2016-04-01

    Sunitinib (Sutent®) is a receptor tyrosine kinase (RTK) and angiogenesis inhibitor approved for the treatment of renal cell carcinomas, gastrointestinal stromal tumours and pancreatic neuroendocrine tumours. A key structural motif retained throughout medicinal chemistry efforts during sunitinib's development was the indoline-2-one group. In the search for new anti-angiogenic scaffolds, we previously reported that non-indoline-2-one-based derivatives of semaxanib (SU5416, a structurally simpler sunitinib predecessor that underwent Phase III trials) are active as angiogenesis inhibitors, indicating that the group is not essential for activity. This Letter describes the synthesis and structure-activity relationships of another class of non-indoline-2-one angiogenesis inhibitors related to sunitinib/semaxanib; the 5,7-dimethyl-2-aryl-3H-pyrrolizin-3-ones. A focussed library of 19 analogues was prepared using a simple novel process, wherein commercially available substituted arylacetic acids activated with an amide coupling reagent (HBTU) were reacted with the potassium salt of 3,5-dimethyl-1H-pyrrole-2-carbaldehyde in one-pot. Screening of the library using a cell-based endothelial tube formation assay identified 6 compounds with anti-angiogenesis activity. Two of the compounds were advanced to the more physiologically relevant rat aortic ring assay, where they showed similar inhibitory effects to semaxanib at 10μg/mL, confirming that 5,7-dimethyl-2-aryl-3H-pyrrolizin-3-ones represent a new class of angiogenesis inhibitors. PMID:26912111

  12. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  13. Synthesis and optimization of N-heterocyclic pyridinones as catechol-O-methyltransferase (COMT) inhibitors.

    PubMed

    Zhao, Zhijian; Harrison, Scott T; Schubert, Jeffrey W; Sanders, John M; Polsky-Fisher, Stacey; Zhang, Nanyan Rena; McLoughlin, Debra; Gibson, Christopher R; Robinson, Ronald G; Sachs, Nancy A; Kandebo, Monika; Yao, Lihang; Smith, Sean M; Hutson, Pete H; Wolkenberg, Scott E; Barrow, James C

    2016-06-15

    A series of N-heterocyclic pyridinone catechol-O-methyltransferase (COMT) inhibitors were synthesized. Physicochemical properties, including ligand lipophilic efficiency (LLE) and clogP, were used to guide compound design and attempt to improve inhibitor pharmacokinetics. Incorporation of heterocyclic central rings provided improvements in physicochemical parameters but did not significantly reduce in vitro or in vivo clearance. Nevertheless, compound 11 was identified as a potent inhibitor with sufficient in vivo exposure to significantly affect the dopamine metabolites homovanillic acid (HVA) and dihydroxyphenylacetic acid (DOPAC), and indicate central COMT inhibition. PMID:27133481

  14. A symmetry-based formal synthesis of zaragozic acid A.

    PubMed

    Freeman-Cook, K D; Halcomb, R L

    2000-09-22

    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  15. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.

    PubMed

    Papadopoulos, Giorgos N; Kokotos, Christoforos G

    2016-05-10

    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  16. Design and synthesis of novel, conformationally restricted HMG-CoA reductase inhibitors.

    PubMed

    Pfefferkorn, Jeffrey A; Choi, Chulho; Song, Yuntao; Trivedi, Bharat K; Larsen, Scott D; Askew, Valerie; Dillon, Lisa; Hanselman, Jeffrey C; Lin, Zhiwu; Lu, Gina; Robertson, Andrew; Sekerke, Catherine; Auerbach, Bruce; Pavlovsky, Alexander; Harris, Melissa S; Bainbridge, Graeme; Caspers, Nicole

    2007-08-15

    Using structure-based design, a novel series of conformationally restricted, pyrrole-based inhibitors of HMG-CoA reductase were discovered. Leading analogs demonstrated potent inhibition of cholesterol synthesis in both in vitro and in vivo models and may be useful for the treatment of hypercholesterolemia and related lipid disorders. PMID:17574411

  17. Bait matrix for delivery of chitin synthesis inhibitors to the formosan subterranean termite (Isoptera: Rhinotermitidae).

    PubMed

    Rojas, M G; Morales-Ramos, J A

    2001-04-01

    The efficacy of three chitin synthesis inhibitors, diflubenzuron, hexaflumuron, and chlorfluazuron, incorporated into a novel bait matrix to kill the Formosan subterranean termite, Coptotermes formosanus Shiraki, was evaluated in the laboratory. The bait matrix was significantly preferred by C. formosanus over southern yellow pine wood in a two-choice feeding test. Bait formulations containing 250 ppm of the three chitin synthesis inhibitors were presented to termite nests with 2,500 individuals (80% workers and 20% soldiers) in the presence of alternative food sources consisting of cardboard and southern yellow pine, Pinus taeda L., wood. None of the bait formulations were significantly repellent or feeding deterrent to the termite workers evidenced by the lack of full consumption of alternative food sources. All nests presented with the bait formulations died within 9 wk, whereas the control nests (bait with no chitin synthesis inhibitors) remained alive 6 mo after the end of the study. No significant differences in consumption were observed among the chitin synthesis inhibitor treatments. Importance of this study for the improvement of current bait technology is discussed. PMID:11332846

  18. Design, synthesis and biological evaluation of potent FAAH inhibitors.

    PubMed

    Tuo, Wei; Leleu-Chavain, Natascha; Barczyk, Amélie; Renault, Nicolas; Lemaire, Lucas; Chavatte, Philippe; Millet, Régis

    2016-06-01

    A new series of 3-carboxamido-5-aryl-isoxazoles was designed, synthesized and evaluated for their biological activity. Different pharmacomodulations have been explored and the lipophilicity of these compounds was assessed. Investigation of the in vitro biological activity led to the identification of 5 compounds as potent FAAH inhibitors, their good FAAH inhibition capacity is probably correlated with their suitable lipophilicity. Specifically, compound 25 showed similar inhibition potency against FAAH in comparison with URB597, one of the most potent FAAH inhibitor known to date. PMID:27117424

  19. Design, Synthesis, and Biological Evaluation of PKD Inhibitors

    PubMed Central

    George, Kara M.; Frantz, Marie-Céline; Bravo-Altamirano, Karla; LaValle, Courtney R.; Tandon, Manuj; Leimgruber, Stephanie; Sharlow, Elizabeth R.; Lazo, John S.; Wang, Q. Jane; Wipf, Peter

    2011-01-01

    Protein kinase D (PKD) belongs to a family of serine/threonine kinases that play an important role in basic cellular processes and are implicated in the pathogenesis of several diseases. Progress in our understanding of the biological functions of PKD has been limited due to the lack of a PKD-specific inhibitor. The benzoxoloazepinolone CID755673 was recently reported as the first potent and kinase-selective inhibitor for this enzyme. For structure-activity analysis purposes, a series of analogs was prepared and their in vitro inhibitory potency evaluated. PMID:22267986

  20. [Neurochemical study of effects of the new anxiolytic drugs afobazol and ladasten on the synthesis and metabolism of monoamines and their metabolites in the brain structures of Wistar rat on the model of monoamine synthesis blockade induced by aromatic amino acid decarboxylase inhibitor NSD-1015].

    PubMed

    Davydova, A I; Klodt, P M; Kudrin, V S; Kuznetsova, E A; Narkevich, V B

    2010-03-01

    Results of a neurochemical study of the effects of the new anxiolytic drugs afobazole and ladasten on the synthesis and metabolism of monoamines and their metabolites determined by HPLC on the model of monoamine synthesis blockade induced by NSD-1015 (aromatic L-amino acid decarboxylase) in the brain structures of Wistar rats are reported. A decrease in the levels of DOPAC in hypothalamus and HVA in striatum after afobazole injection may be evidence of an inhibitory action of this drug on the activity of monoamine oxidase (MAO-A), which is the main enzyme involved in dopamine biodegradation. Afobazole was also found to increase the content of serotonin (5-HT) as well as its precursor (5-OTP) and its main metabolite (5-HIAA) in hypothalamus by up to 50, 60 and 50%, respectively, which confirms a hypothesis that this anxiolytic drug can modulate the activity of tryptophan hydroxylase (5-OTP synthesis enzyme). In contrast to afobazole, ladasten demonstrated the ability to increase the level of L-DOPA (a dopamine precursor) in virtually all functional structures of the brain (except for hippocamp), which may support the hypothesis suggestion concerning a predominant action of this drug on the activity of tyrosine hydroxylase. Ladasten exhibited selectivity with respect to the dopaminergic system and affected only parameters of the dopamine metabolism, in particular, by increasing the HVA content in nucleus accumbens and decreasing it in the hypothalamus. The drug also affected the dopamine turnover parameters, producing an increase in both HVA/dopamine ratio in nucleus accumbens and DOPAC/dopamine ratio in hippocamp. PMID:20408420

  1. Pentapeptide Boronic Acid Inhibitors of Mycobacterium tuberculosis MycP1 Protease

    PubMed Central

    Frasinyuk, Mykhaylo S.; Kwiatkowski, Stefan; Wagner, Jonathan M.; Evans, Timothy J.; Reed, Robert W.; Korotkov, Konstantin V.; Watt, David S.

    2014-01-01

    Mycosin protease-1 (MycP1) cleaves ESX secretion-associated protein B (EspB) that is a virulence factor of Mycobacterium tuberculosis, and accommodates an octapeptide, AVKAASLG, as a short peptide substrate. Because peptidoboronic acids are known inhibitors of serine proteases, the synthesis and binding of a boronic acid analog of the pentapeptide cleavage product, AVKAA, was studied using MycP1 variants from M. thermoresistible (MycP1mth), M. smegmatis (MycP1msm) and M. tuberculosis (MycP1mtu). We synthesized the boropentapeptide, HAlaValLysAlaAlaB(OH)2 (1) and the analogous pinanediol PD-protected HAlaValLysAlaAlaBO2(PD) (2) using an Fmoc/Boc peptide strategy. The pinanediol boropentapeptide 2 displayed IC50 values 121.6±25.3 μM for MycP1mth, 93.2±37.3 μM for MycP1msm and 37.9±5.2 μM for MycP1mtu. Such relatively strong binding creates a chance for crystalizing the complex with 2 and finding the structure of the unknown MycP1 catalytic site that would potentially facilitate the development of new anti-tuberculosis drugs. PMID:24915878

  2. Novel route to chaetomellic acid A and analogues: serendipitous discovery of a more competent FTase inhibitor.

    PubMed

    Bellesia, Franco; Choi, Seoung-ryoung; Felluga, Fulvia; Fiscaletti, Giuliano; Ghelfi, Franco; Menziani, Maria Cristina; Parsons, Andrew F; Poulter, C Dale; Roncaglia, Fabrizio; Sabbatini, Massimo; Spinelli, Domenico

    2013-01-01

    A new practical route to chaetomellic acid A (ACA), based on the copper catalysed radical cyclization (RC) of (Z)-3-(2,2-dichloropropanoyl)-2-pentadecylidene-1,3-thiazinane, is described. Remarkably, the process entailed: (i) a one-pot preparation of the intermediate N-α-perchloroacyl-2-(Z)-alkyliden-1,3-thiazinanes starting from N-(3-hydroxypropyl)palmitamide, (ii) a two step smooth transformation of the RC products into ACA and (iii) only one intermediate chromatographic purification step. The method offers a versatile approach to the preparation of ACA analogues, through the synthesis of an intermediate maleic anhydride with a vinylic group at the end of the aliphatic tail, a function that can be transformed through a thiol-ene coupling. Serendipitously, the disodium salt of 2-(9-(butylthio)nonyl)-3-methylmaleic acid, that we prepared as a representative sulfurated ACA analogue, was a more competent FTase inhibitor than ACA. This behaviour was analysed by a molecular docking study. PMID:23182215

  3. Novel route to chaetomellic acid A and analogues: serendipitous discovery of a more competent FTase inhibitor

    PubMed Central

    Bellesia, Franco; Choi, Seoung-ryoung; Felluga, Fulvia; Fiscaletti, Giuliano; Ghelfi, Franco; Menziani, Maria Cristina; Parsons, Andrew F.; Poulter, C. Dale; Roncaglia, Fabrizio; Sabbatini, Massimo; Spinelli, Domenico

    2013-01-01

    A new practical route to chaetomellic acid A (ACA), based on the copper catalysed radical cyclization (RC) of (Z)-3-(2,2-dichloropropanoyl)-2-pentadecylidene-1,3-thiazinane, is described. Remarkably, the process entailed: i) a one-pot preparation of the intermediate N-α-perchloroacyl-2-(Z)-alkyliden-1,3-thiazinanes starting from N-(3-hydroxypropyl)palmitamide, ii) a two step smooth transformation of the RC products into ACA and iii) only one intermediate chromatographic purification step. The method offers a versatile approach to the preparation of ACA analogues, through the synthesis of an intermediate maleic anhydride with a vinylic group at the end of the aliphatic tail, a function that can be transformed through a thiol-ene coupling. Serendipitously, the disodium salt of 2-(9-(butylthio)nonyl)-3-methylmaleic acid, that we prepared as a representative sulfurated ACA analogue, was a more competent FTase inhibitor than ACA. This behaviour was analysed by a molecular docking study. PMID:23182215

  4. Design, Synthesis and Inhibitory Activity of Photoswitchable RET Kinase Inhibitors

    NASA Astrophysics Data System (ADS)

    Ferreira, Rubén; Nilsson, Jesper R.; Solano, Carlos; Andréasson, Joakim; Grøtli, Morten

    2015-05-01

    REarranged during Transfection (RET) is a transmembrane receptor tyrosine kinase required for normal development and maintenance of neurons of the central and peripheral nervous systems. Deregulation of RET and hyperactivity of the RET kinase is intimately connected to several types of human cancers, most notably thyroid cancers, making it an attractive therapeutic target for small-molecule kinase inhibitors. Novel approaches, allowing external control of the activity of RET, would be key additions to the signal transduction toolbox. In this work, photoswitchable RET kinase inhibitors based on azo-functionalized pyrazolopyrimidines were developed, enabling photonic control of RET activity. The most promising compound displays excellent switching properties and stability with good inhibitory effect towards RET in cell-free as well as live-cell assays and a significant difference in inhibitory activity between its two photoisomeric forms. As the first reported photoswitchable small-molecule kinase inhibitor, we consider the herein presented effector to be a significant step forward in the development of tools for kinase signal transduction studies with spatiotemporal control over inhibitor concentration in situ.

  5. Design, Synthesis and Inhibitory Activity of Photoswitchable RET Kinase Inhibitors

    PubMed Central

    Ferreira, Rubén; Nilsson, Jesper R.; Solano, Carlos; Andréasson, Joakim; Grøtli, Morten

    2015-01-01

    REarranged during Transfection (RET) is a transmembrane receptor tyrosine kinase required for normal development and maintenance of neurons of the central and peripheral nervous systems. Deregulation of RET and hyperactivity of the RET kinase is intimately connected to several types of human cancers, most notably thyroid cancers, making it an attractive therapeutic target for small-molecule kinase inhibitors. Novel approaches, allowing external control of the activity of RET, would be key additions to the signal transduction toolbox. In this work, photoswitchable RET kinase inhibitors based on azo-functionalized pyrazolopyrimidines were developed, enabling photonic control of RET activity. The most promising compound displays excellent switching properties and stability with good inhibitory effect towards RET in cell-free as well as live-cell assays and a significant difference in inhibitory activity between its two photoisomeric forms. As the first reported photoswitchable small-molecule kinase inhibitor, we consider the herein presented effector to be a significant step forward in the development of tools for kinase signal transduction studies with spatiotemporal control over inhibitor concentration in situ. PMID:25944708

  6. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  7. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  8. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

    PubMed

    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

    2016-01-01

    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  9. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases. PMID:25282359

  10. Synthesis and biological evaluation of salicylic acid and N-acetyl-2-carboxybenzenesulfonamide regioisomers possessing a N-difluoromethyl-1,2-dihydropyrid-2-one pharmacophore: dual inhibitors of cyclooxygenases and 5-lipoxygenase with anti-inflammatory activity.

    PubMed

    Chowdhury, Morshed A; Abdellatif, Khaled R A; Dong, Ying; Das, Dipankar; Yu, Gang; Velázquez, Carlos A; Suresh, Mavanur R; Knaus, Edward E

    2009-12-15

    A novel class of salicylic acid and N-acetyl-2-carboxybenzenesulfonamide regioisomers possessing a N-difluoromethyl-1,2-dihydropyrid-2-one pharmacophore attached to its C-4 or C-5 position was designed for evaluation as anti-inflammatory (AI) agents. Replacement of the 2,4-difluorophenyl ring in diflunisal by the N-difluoromethyl-1,2-dihydropyrid-2-one moiety provided compounds showing dual selective cyclooxygenase-2 (COX-2)/5-lipoxygenase (5-LOX) inhibitory activities. AI structure-activity studies showed that the C-4 (14a) and C-5 (14b) salicylate regioisomers were 1.4- and 1.6-fold more potent than aspirin, and the C-5 N-acetyl-2-carboxybenzenesulfonamide regioisomer (22b) was 1.3- and 2.8-fold more potent than ibuprofen and aspirin, respectively. In vivo ulcer index (UI) studies showed that the 4- and 5-(N-difluoromethyl-1,2-dihydropyrid-2-one-4-yl)salicylic acids (14a and 14b) were completely non-ulcerogenic since no gastric lesions were present (UI=0) relative to aspirin (UI=57) at an equivalent mumol/kg oral dose. The N-difluoromethyl-1,2-dihydropyridin-2-one moiety provides a novel 5-LOX pharmacophore for the design of cyclic hydroxamic mimetics for exploitation in the development of dual COX-2/5-LOX inhibitory AI drugs. PMID:19884005

  11. Protein synthesis inhibitors prevent both spontaneous and hormone-dependent maturation of isolated mouse oocytes

    SciTech Connect

    Downs, S.M. )

    1990-11-01

    The present study was carried out to examine the role of protein synthesis in mouse oocyte maturation in vitro. In the first part of this study, the effects of cycloheximide (CX) were tested on spontaneous meiotic maturation when oocytes were cultured in inhibitor-free medium. CX reversibly suppressed maturation of oocytes as long as maturation was either initially prevented by the phosphodiesterase inhibitor, 3-isobutyl-1-methyl-xanthine (IBMX), or delayed by follicle-stimulating hormone (FSH). In the second part of this study, the actions of protein synthesis inhibitors were tested on hormone-induced maturation. CEO were maintained in meiotic arrest for 21-22 h with hypoxanthine, and germinal vesicle breakdown (GVB) was induced with follicle-stimulating hormone (FSH). Three different protein synthesis inhibitors (CX, emetine (EM), and puromycin (PUR)) each prevented the stimulatory action of FSH on GVB in a dose-dependent fashion. This was accompanied by a dose-dependent suppression of 3H-leucine incorporation by oocyte-cumulus cell complexes. The action of these inhibitors on FSH- and epidermal growth factor (EGF)-induced GVB was next compared. All three drugs lowered the frequency of GVB in the FSH-treated groups, below even that of the controls (drug + hypoxanthine); the drugs maintained meiotic arrest at the control frequencies in the EGF-treated groups. Puromycin aminonucleoside, an analog of PUR with no inhibitory action on protein synthesis, had no effect. The three inhibitors also suppressed the stimulatory action of FSH on oocyte maturation when meiotic arrest was maintained with the cAMP analog, dbcAMP.

  12. Isolation and partial characterization of a protein synthesis inhibitor from brine shrimp embryos.

    PubMed

    Warner, A H; Shridhar, V; Finamore, F J

    1977-09-01

    Encysted embryos of the brine shrimp, Artemia salina, contain an inhibitor of protein synthesis that appears to be important in translational control. In cyst homogenates, the inhibitor appears to be partitioned almost equally between the cytosol and ribosome fractions and it has been purified from both fractions to near homogeneity. In a cell-free protein-synthesizing system derived from Artemia cysts, with poly(U) as messenger, the protein inhibits polyphenylalanine synthesis proportional to inhibitor concentration up to about 75% inhibition, and the primary site of action appears to be at the elongation step. The inhibitor activity is not altered by 50-150 mM KCl in the reaction mixture, but it is slightly more effective at 5 mM MgCl2 than at 10 mM MgCl2. The inhibitor is a heat-labile protein of 130000 molecular weight and is devoid of hydrolase activity. Our data indicate that the inhibitor is not elongation factor EF-1 or EF-2, but we are studying the possibility that it may be a modified form of elongation factor EF-2. PMID:907902

  13. Inhibition of PAF synthesis by stimulated human polymorphonuclear leucocytes with cloricromene, an inhibitor of phospholipase A2 activation.

    PubMed Central

    Ribaldi, E.; Mezzasoma, A. M.; Francescangeli, E.; Prosdocimi, M.; Nenci, G. G.; Goracci, G.; Gresele, P.

    1996-01-01

    1. A phospholipase A2 (PLA2) represents the key enzyme in the remodelling pathway of platelet-activating factor (PAF) synthesis in human polymorphonuclear (PMN) leucocytes. 2. PLA2 activation is also the rate-limiting step for the release of the arachidonic acid utilized for the synthesis of leukotrienes in stimulated leucocytes; however, it is unknown whether the PLA2s involved in the two biosynthetic pathways are identical. 3. Cloricromene (8-monochloro-3-beta-diethylaminoethyl-4-methyl-7-ethoxy- carbonylmethoxy coumarin) is an antithrombotic coumarin derivative which inhibits platelet and leucocyte function and suppresses arachidonic acid liberation by interfering with PLA2 activation. 4. The aim of the present study was to assess whether chloricromene inhibits PAF synthesis by stimulated human polymorphonuclear leucocytes (PMNs). 5. Cloricromene (50-500 microM) inhibited in a concentration-dependent manner the release of PAF, as measured by h.p.l.c. bioassay, from A23187-stimulated PMNs. Significant inhibition (45%) of PAF-release was obtained with 50 microM cloricromene and the IC50 was 85 microM. Mepacrine (500 microM), a non-specific PLA2 inhibitor, strikingly reduced PAF release. 6. The incorporation of [3H]-acetate into [3H]-PAF induced by serum-treated zymosan in human PMNs was also inhibited concentration-dependently by cloricromene, with an IC50 of 105 microM. Mepacrine also suppressed [3H]-acetate incorporation into [3H]-PAF. 7. Cloricromene did not affect the activities of the enzymes involved in PAF-synthesis acetyltransferase or phosphocholine transferase. 8. Our data demonstrate that cloricromene, an inhibitor of PLA2-activation in human leucocytes, reduces the synthesis of PAF by stimulated PMNs. This finding has a twofold implication: the PLA2s (or the mechanisms that regulate their activation) involved in PAF synthesis and arachidonate release in human leucocytes are either identical or else indistinguishable by their sensitivity to cloricromene

  14. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors. PMID:26134042

  15. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  16. Feeding the nitric oxide synthase inhibitor L-N(omega)nitroarginine elevates serum very low density lipoprotein and hepatic triglyceride synthesis in rats.

    PubMed

    Goto, T; Ohnomi, S; Khedara, A; Kato, N; Ogawa, H; Yanagita, T

    1999-05-01

    This study was conducted to study the influence of dietary L-N(omega)nitroarginine (L-NNA), a nitric oxide (NO) synthase inhibitor, on serum lipids and lipoproteins and on the activities of enzymes related to lipid metabolism in rats. Feeding rats a diet containing 0.2 g/kg L-NNA for 5 weeks elevated serum concentrations of triglyceride, cholesterol, phospholipid, and free fatty acid and reduced serum nitrate (an oxidation product of NO). The elevation in serum triglyceride was mainly due to the elevation in very low density lipoprotein (VLDL) triglyceride. Contents of cholesterol and phospholipid in the VLDL fraction also were elevated by L-NNA. L-NNA treatment caused significantly higher activity of hepatic microsomal phosphatidate phosphohydrolase (the rate-limiting enzyme in triglyceride synthesis) and lower activity of hepatic carnitine palmitoyltransferase (the rate-limiting enzyme in fatty acid oxidation). Activities of hepatic enzymes responsible for fatty acid synthesis such as glucose-6-phosphate dehydrogenase, malic enzyme, and fatty acid synthase were unaffected by L-NNA. The activity of hepatic microsomal phosphocholine cytidyltransferase (the rate-limiting enzyme in phosphatidylcholine synthesis) was reduced significantly by L-NNA. Our results suggest that lower NO production caused the elevations in hepatic triglyceride synthesis by higher esterification of fatty acid and lower fatty acid oxidation, leading to an enrichment of VLDL triglyceride. PMID:15539300

  17. Purification, characterization, and complete amino acid sequence of a trypsin inhibitor from amaranth (Amaranthus hypochondriacus) seeds.

    PubMed Central

    Valdes-Rodriguez, S; Segura-Nieto, M; Chagolla-Lopez, A; Verver y Vargas-Cortina, A; Martinez-Gallardo, N; Blanco-Labra, A

    1993-01-01

    A protein proteinase inhibitor was purified from a seed extract of amaranth (Amaranthus hypochondriacus) by precipitation with (NH4)2SO4, gel-filtration chromatography, ion-exchange chromatography, and reverse-phase high-performance liquid chromatography. It is a 69-amino acid protein with a high content of valine, arginine, and glutamic acid, but lacking in methionine. The inhibitor has a relative molecular weight of 7400 and an isoelectric point of 7.5. It is a serine proteinase inhibitor that recognizes chymotrypsin, trypsin, and trypsin-like proteinase activities extracted from larvae of the insect Prostephanus truncatus. This inhibitor belongs to the potato-I inhibitor family, showing the closest homology (59.5%) with the Lycopersicum peruvianum trypsin inhibitor, and (51%) with the proteinase inhibitor 5 extracted from the seeds of Cucurbita maxima. The position of the lysine-aspartic acid residues present in the active site of the amaranth inhibitor are found in almost the same relative position as in the inhibitor from C. maxima. PMID:8290633

  18. Synthesis and Biochemical Evaluation of Thiochromanone Thiosemicarbazone Analogues as Inhibitors of Cathepsin L

    PubMed Central

    2012-01-01

    A series of 36 thiosemicarbazone analogues containing the thiochromanone molecular scaffold functionalized primarily at the C-6 position were prepared by chemical synthesis and evaluated as inhibitors of cathepsins L and B. The most promising inhibitors from this group are selective for cathepsin L and demonstrate IC50 values in the low nanomolar range. In nearly all cases, the thiochromanone sulfide analogues show superior inhibition of cathepsin L as compared to their corresponding thiochromanone sulfone derivatives. Without exception, the compounds evaluated were inactive (IC50 > 10000 nM) against cathepsin B. The most potent inhibitor (IC50 = 46 nM) of cathepsin L proved to be the 6,7-difluoro analogue 4. This small library of compounds significantly expands the structure–activity relationship known for small molecule, nonpeptidic inhibitors of cathepsin L. PMID:24900494

  19. Carborane-containing urea-based inhibitors of glutamate carboxypeptidase II: Synthesis and structural characterization.

    PubMed

    Youn, Sihyun; Kim, Kyung Im; Ptacek, Jakub; Ok, Kiwon; Novakova, Zora; Kim, YunHye; Koo, JaeHyung; Barinka, Cyril; Byun, Youngjoo

    2015-11-15

    Glutamate carboxypeptidase II (GCPII) is a zinc metalloprotease on the surface of astrocytes which cleaves N-acetylaspartylglutamate to release N-acetylaspartate and glutamate. GCPII inhibitors can decrease glutamate concentration and play a protective role against apoptosis or degradation of brain neurons. Herein, we report the synthesis and structural analysis of novel carborane-based GCPII inhibitors. We determined the X-ray crystal structure of GCPII in complex with a carborane-containing inhibitor at 1.79Å resolution. The X-ray analysis revealed that the bulky closo-carborane cluster is located in the spacious entrance funnel region of GCPII, indicating that the carborane cluster can be further structurally modified to identify promising lead structures of novel GCPII inhibitors. PMID:26459214

  20. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  1. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  2. S-Farnesyl-Thiopropionic Acid Triazoles as Potent Inhibitors of Isoprenylcysteine Carboxyl Methyltransferase

    PubMed Central

    2011-01-01

    We report the design and synthesis of novel FTPA-triazole compounds as potent inhibitors of isoprenylcysteine carboxyl methyltransferase (Icmt), through a focus on thioether and isoprenoid mimetics. These mimetics were coupled utilizing a copper-assisted cycloaddition to assemble the potential inhibitors. Using the resulting triazole from the coupling as an isoprenyl mimetic resulted in the biphenyl-substituted FTPA triazole 10n. This lipid-modified analogue is a potent inhibitor of Icmt (IC50 = 0.8 ± 0.1 μM; calculated Ki = 0.4 μM). PMID:22754607

  3. A Novel Selective Prostaglandin E2 Synthesis Inhibitor Relieves Pyrexia and Chronic Inflammation in Rats.

    PubMed

    Sugita, Ryusuke; Kuwabara, Harumi; Sugimoto, Kotaro; Kubota, Kazufumi; Imamura, Yuichiro; Kiho, Toshihiro; Tengeiji, Atsushi; Kawakami, Katsuhiro; Shimada, Kohei

    2016-04-01

    Prostaglandin E2 (PGE2) is a terminal prostaglandin in the cyclooxygenase (COX) pathway. Inhibition of PGE2 production may relieve inflammatory symptoms such as fever, arthritis, and inflammatory pain. We report here the profile of a novel selective PGE2 synthesis inhibitor, compound A [N-[(1S,3S)-3-carbamoylcyclohexyl]-1-(6-methyl-3-phenylquinolin-2-yl)piperidine-4-carboxamide], in animal models of pyrexia and inflammation. The compound selectively suppressed the synthesis of PGE2 in human alveolar adenocarcinoma cell line A549 cells and rat macrophages. In the lipopolysaccharide-induced pyrexia model, this compound selectively reduced PGE2 production in cerebrospinal fluid and showed an anti-pyretic effect. In the adjuvant-induced arthritis model, compound A therapeutically decreased foot swelling in the established arthritis. Our data demonstrates that selective suppression of PGE2 synthesis shows anti-pyretic and anti-inflammatory effects, suggesting that selective PGE2 synthesis inhibitors can be applied as an alternative treatment to nonsteroidal, anti-inflammatory drugs (NSAIDs) or COX-2-selective inhibitors. PMID:26923147

  4. Synthesis and Biological Evaluation of Resveratrol Derivatives as Melanogenesis Inhibitors.

    PubMed

    Liu, Qing; Kim, CheongTaek; Jo, Yang Hee; Kim, Seon Beom; Hwang, Bang Yeon; Lee, Mi Kyeong

    2015-01-01

    Resveratrol (1), a naturally occurring stilbene compound, has been suggested as a potential whitening agent with strong inhibitory activity on melanin synthesis. However, the use of resveratrol in cosmetics has been limited due to its chemical instability and poor bioavailability. Therefore, resveratrol derivatives were prepared to improve bioavailability and anti-melanogenesis activity. Nine resveratrol derivatives including five alkyl ether derivatives with C₂H₅, C₄H₉, C₅H11, C₆H13, and C₈H17 (2a-2e) and four ester derivatives with CH₃, CH=C(CH₃)₂, CH(C₂H₅)C₄H₉, C₇H15 (3a-3d) were newly synthesized and their effect on melanin synthesis were assessed. All the synthetic derivatives efficiently reduced the melanin content in α-MSH stimulated B16F10 melanoma cells. Further investigation showed that the inhibitory effect of 2a on melanin synthesis was achieved not by the inhibition of tyrosinase activity but by the inhibition of melanogenic enzyme expressions such as tyrosinase and tyrosinase-related protein (TRP)-1. Our synthetic resveratrol derivatives have more lipophilic properties than resveratrol by the addition of alkyl or acyl chains to free hydroxyl moiety of resveratrol; thus, they are expected to show better bioavailability in skin application. Therefore, we suggest that our synthetic resveratrol derivatives might be promising candidates for better practical application to skin-whitening cosmetics. PMID:26393543

  5. Amidation inhibitors 4-phenyl-3-butenoic acid and 5-(acetylamino)-4-oxo-6-phenyl-2-hexenoic acid methyl ester are novel HDAC inhibitors with anti-tumorigenic properties.

    PubMed

    Ali, Amna; Burns, Timothy J; Lucrezi, Jacob D; May, Sheldon W; Green, George R; Matesic, Diane F

    2015-08-01

    4-Phenyl-3-butenoic acid (PBA) is an inhibitor of peptidylglycine alpha-amidating monooxygenase with anti-inflammatory properties that has been shown to inhibit the growth of ras-mutated epithelial and human lung carcinoma cells. In this report, we show that PBA also increases the acetylation levels of selected histone subtypes in a dose and time dependent manner, an effect that is attributable to the inhibition of histone deacetylase (HDAC) enzymes. Comparison studies with the known HDAC inhibitor suberoylanilide hydroxamic acid (SAHA) using high resolution two-dimensional polyacrylamide gels and Western analysis provide evidence that PBA acts as an HDAC inhibitor within cells. PBA and a more potent amidation inhibitor, 5-(acetylamino)-4-oxo-6-phenyl-2-hexenoic acid methyl ester (AOPHA-Me), inhibit HDAC enzymes in vitro at micromolar concentrations, with IC50 values approximately 30 fold lower for AOPHA-Me than PBA for selected HDAC isoforms. Overall, these results indicate that PBA and AOPHA-Me are novel anti-tumorigenic HDAC inhibitors. PMID:26065689

  6. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  7. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.

    PubMed

    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D

    2016-05-01

    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  8. Peptides inhibitors of acid-sensing ion channels.

    PubMed

    Diochot, S; Salinas, M; Baron, A; Escoubas, P; Lazdunski, M

    2007-02-01

    Acid-sensing ion channels (ASICs) channels are proton-gated cationic channels mainly expressed in central and peripheric nervous system and related to the epithelial amiloride-sensitive Na(+) channels and to the degenerin family of ion channels. ASICs comprise four proteins forming functional channel subunits (ASIC1a, ASIC1b, ASIC2a, and ASIC3) and two proteins (ASIC2b and ASIC4) without yet known activators. Functional channels are activated by external pH variations ranging from pH(0.5) 6.8 to 4.0 and currents are characterized by either rapid kinetics of inactivation (ASIC1a, ASIC1b, ASIC3) or slow kinetics of inactivation (ASIC2a) and sometimes the presence of a plateau phase (ASIC3). ASIC1a and ASIC3, which are expressed in nociceptive neurons, have been implicated in inflammation and knockout mice studies support the role of ASIC3 in various pain processes. ASIC1a seems more related to synaptic plasticity, memory, learning and fear conditioning in the CNS. ASIC2a contributes to hearing in the cochlea, sour taste sensation, and visual transduction in the retina. The pharmacology of ASICs is limited to rather nonselective drugs such as amiloride, nonsteroid anti-inflammatory drugs, and neuropeptides. Recently, two peptides, PcTx1 and APETx2, isolated from a spider and a sea anemone, have been characterized as selective and high-affinity inhibitors for ASIC1a and ASIC3 channels, respectively. PcTx1 inhibits ASIC1a homomers with an affinity of 0.7 nM (IC(50)) without any effect on ASIC1a containing heteromers and thus helped to characterize ASIC1a homomeric channels in peripheric and central neurons. PcTx1 acts as a gating modifier since it shifts the channel from the resting to an inactivated state by increasing its affinity for H(+). APETx2 is less selective since it inhibits several ASIC3-containing channels (IC(50) from 63 nM to 2 microM) and to date its mode of action is unknown. Nevertheless, APETx2 structure is related to other sea anemone peptides, which

  9. [Effect of proteolysis inhibitors on the incorporation of labelled amino acids into proteins].

    PubMed

    Konikova, A S; Korotkina, R N

    1975-01-01

    Role of peptide bond breaks in the incorporation of amino acids into proteins in a "protein--amino acid" system is investigated. For this purpose the incorporation of labelled amino acids into trypsin under the inhibition of its autolysis by a specific inhibitor from soybean and epsilon-amino-caproic acid is studied. The trypsin inhibitor from soybean is found to suppress considerably the incorporation of 14C-glycine, 14C-lysine and 14C-methionine into crystal trypsin and not to affect the incorporation of labelled amino acids into chomotrypsin, papain and carboxypeptidase. Epsilon-Aminocaproic acid inhibited 14C-glycine incorporation into crystal trypsin by 40% and did not change its incorporation level into serum albumin. The dependency of amino acid incorporation level into trypsin on the activity of autolysis in the "protein--amino acid" system is demonstrated. PMID:1212456

  10. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  11. Synthesis of benzopentathiepin analogs and their evaluation as inhibitors of the phosphatase STEP

    PubMed Central

    Baguley, Tyler D.; Nairn, Angus C.; Lombroso, Paul J.; Ellman, Jonathan A.

    2015-01-01

    Striatal-enriched protein tyrosine phosphatase (STEP) is a brain specific protein tyrosine phosphatase that has been implicated in many neurodegenerative diseases, such as Alzheimer’s disease. We recently reported the benzopentathiepin TC-2153 as a potent inhibitor of STEP in vitro, cells and animals. Herein, we report the synthesis and evaluation of TC-2153 analogs in order to define what structural features are important for inhibition and to identify positions tolerant of substitution for further study. The trifluoromethyl substitution is beneficial for inhibitor potency, and the amine is tolerant of acylation, and thus provides a convenient handle for introducing additional functionality such as reporter groups. PMID:25666825

  12. Arylsulfonamide inhibitors of aggrecanases as potential therapeutic agents for osteoarthritis: synthesis and biological evaluation.

    PubMed

    Nuti, Elisa; Santamaria, Salvatore; Casalini, Francesca; Yamamoto, Kazuhiro; Marinelli, Luciana; La Pietra, Valeria; Novellino, Ettore; Orlandini, Elisabetta; Nencetti, Susanna; Marini, Anna Maria; Salerno, Silvia; Taliani, Sabrina; Da Settimo, Federico; Nagase, Hideaki; Rossello, Armando

    2013-04-01

    Aggrecanases, in particular aggrecanase-2 (ADAMTS-5), are considered the principal proteases responsible for aggrecan degradation in osteoarthritis. For this reason, considerable effort has been put on the discovery and development of aggrecanase inhibitors able to slow down or halt the progression of osteoarthritis. We report herein the synthesis and biological evaluation of a series of arylsulfonamido-based hydroxamates as aggrecanase inhibitors. Compound 18 was found to have a nanomolar activity for ADAMTS-5, ADAMTS-4 and MMP-13 and high selectivity over MMP-1 and MMP-14. Furthermore, this compound proved to be effective in blocking ex vivo cartilage degradation without having effect on cell cytotoxicity. PMID:23376997

  13. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  14. Synthesis and Biological Evaluation of Botulinum Neurotoxin A Protease Inhibitors

    PubMed Central

    Li, Bing; Pai, Ramdas; Cardinale, Steven C.; Butler, Michelle M.; Peet, Norton P.; Moir, Donald T.; Bavari, Sina; Bowlin, Terry L.

    2010-01-01

    NSC 240898 was previously identified as a botulinum neurotoxin A light chain (BoNT/A LC) endopeptidase inhibitor by screening the National Cancer Institute Open Repository diversity set. Two types of analogs have been synthesized and shown to inhibit BoNT/A LC in a FRET-based enzyme assay, with confirmation in an HPLC-based assay. These two series of compounds have also been evaluated for inhibition of anthrax lethal factor (LF), an unrelated metalloprotease, to examine enzyme specificity of the BoNT/A LC inhibition. The most potent inhibitor against BoNT/A LC in these two series is compound 12 (IC50 = 2.5 µM, FRET assay), which is 4.4-fold more potent than the lead structure, and 11.2-fold more selective for BoNT/A LC versus the anthrax LF metalloproteinase. Structure-activity relationship studies have revealed structural features important to potency and enzyme specificity. PMID:20155918

  15. Comparative acid tolerances and inhibitor sensitivities of isolated F-ATPases of oral lactic acid bacteria.

    PubMed Central

    Sturr, M G; Marquis, R E

    1992-01-01

    pH activity profiles and inhibitor sensitivities were compared for membrane ATPases isolated from three oral lactic acid bacteria, Lactobacillus casei ATCC 4646, Streptococcus mutans GS-5, and Streptococcus sanguis NCTC 10904, with, respectively, high, moderate, and low levels of acid tolerance. Membranes containing F1F0 ATPases were isolated by means of salt lysis of cells treated with muralytic enzymes. Membrane-free F1F0 complexes were then isolated from membranes by detergent extraction with Triton X-100 or octylglucoside. Finally, F1 complexes free of the proton-conducting F0 sector were obtained by washing membranes with buffers of low ionic strength. The pH activity profiles of the membrane-associated enzymes reflected the general acid tolerances of the organisms from which they were isolated; for example, pH optima were approximately 5.5, 6.0, and 7.0, respectively, for enzymes from L. casei, S. mutans, and S. sanguis. Roughly similar profiles were found for membrane-free F1F0 complexes, which were stabilized by phospholipids against loss of activity during storage. However, profiles for F1 enzymes were distinctly narrower, indicating that association with F0 and possibly other membrane components enhanced tolerance to both acid and alkaline media. All of the enzymes were found to have similar sensitivities to Al-F complexes, but only F1F0 enzymes were highly sensitive to dicyclohexylcarbodiimide. The procedures described for isolation of membrane-free F1F0 forms of the enzymes from oral lactic acid bacteria will be of use in future studies of the characteristics of the enzymes, especially in studies with liposomes. PMID:1386211

  16. One-pot green synthesis of 1,3,5-triarylpentane-1,5-dione and triarylmethane derivatives as a new class of tyrosinase inhibitors.

    PubMed

    Zheng, Zong-Ping; Zhang, Yi-Nan; Zhang, Shuang; Chen, Jie

    2016-02-01

    A new method was developed for one-pot green synthesis 1,3,5-triarylpentane-1,5-dione, triarylmethane, and flavonoid derivatives from the reaction between 2,4-dihydroxybenzaldehyde and hydroxyacetophenones via Aldol, Michael, and Friedel-Crafts additions using boric acid as catalyst in polyethylene glycol 400. The synthetic compounds demonstrated significant tyrosinase inhibitory activities much stronger than that of kojic acid. More important, 1,3,5-triarylpentane-1,5-dione and triarylmethane derivatives were found to be a new class of tyrosinase inhibitors. PMID:26754613

  17. Efficient synthesis of Empagliflozin, an inhibitor of SGLT-2, utilizing an AlCl3-promoted silane reduction of a β-glycopyranoside.

    PubMed

    Wang, Xiao-jun; Zhang, Li; Byrne, Denis; Nummy, Larry; Weber, Dirk; Krishnamurthy, Dhileep; Yee, Nathan; Senanayake, Chris H

    2014-08-15

    An efficient production synthesis of the SGLT-2 inhibitor Empagliflozin (5) from acid 1 is described. The key tactical stage involves I/Mg exchange of aryl iodide 2 followed by addition to glucono lactone 3 in THF. Subsequent in situ treatment of the resulting lactol with HCl in MeOH produces β-anomeric methyl glycopyranoside 4 which is, without isolation, directly reduced with Et3SiH mediated by AlCl3 as a Lewis acid in CH2Cl2/MeCN to afford 5 in 50% overall yield. The process was implemented for production on a metric ton scale for commercial launch. PMID:25061799

  18. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  19. Concise Asymmetric Synthesis and Pharmacological Characterization of All Stereoisomers of Glutamate Transporter Inhibitor TFB-TBOA and Synthesis of EAAT Photoaffinity Probes.

    PubMed

    Leuenberger, Michele; Ritler, Andreas; Simonin, Alexandre; Hediger, Matthias A; Lochner, Martin

    2016-05-18

    Glutamate is the major excitatory neurotransmitter in the mammalian brain. Its rapid clearance after the release into the synaptic cleft is vital in order to avoid toxic effects and is ensured by several transmembrane transport proteins, so-called excitatory amino acid transporters (EAATs). Impairment of glutamate removal has been linked to several neurodegenerative diseases and EAATs have therefore received increased attention as therapeutic targets. O-Benzylated l-threo-β-hydroxyaspartate derivatives have been developed previously as highly potent inhibitors of EAATs with TFB-TBOA ((2S,3S)-2-amino-3-((3-(4-(trifluoromethyl)benzamido)benzyl)oxy)succinic acid) standing out as low-nanomolar inhibitor. We report the stereoselective synthesis of all four stereoisomers of TFB-TBOA in less than a fifth of synthetic steps than the published route. For the first time, the inhibitory activity and isoform selectivity of these TFB-TBOA enantio- and diastereomers were assessed on human glutamate transporters EAAT1-3. Furthermore, we synthesized potent photoaffinity probes based on TFB-TBOA using our novel synthetic strategy. PMID:26918289

  20. The synthesis of 19-norandrostenedione from dehydroepiandrosterone in equine placenta is inhibited by aromatase inhibitors 4-hydroxyandrostenedione and fadrozole.

    PubMed

    Moslemi, S; Silberzahn, P; Gaillard, J L

    1995-12-01

    19-Norandrostenedione was synthesized in vitro from dehydroepiandrosterone by explants of equine full-term placenta. The synthesis of 19-norandrostenedione was inhibited by two specific aromatase inhibitors, 4-hydroxyandrostenedione and fadrozole. PMID:8590376

  1. Total synthesis of legionaminic acid as basis for serological studies.

    PubMed

    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H

    2015-03-01

    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  2. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  3. Ovicidal activity of chitin synthesis inhibitors when fed to adult German cockroaches (Dictyoptera: Blattellidae).

    PubMed

    DeMark, J J; Bennett, G W

    1990-07-01

    Ovicidal activity was observed in four adult groups (virgin males; virgin females; newly gravid females; and inseminated, reproducing females) of the German cockroach, Blattella germanica (L.), fed the chitin synthesis inhibitors triflumuron, chlorfluazuron, hexafluron, and UC 84572 (structure not disclosed) at the LC50's and LC95's determined from fifth-stage nymphs. All compounds were active only when fed to reproducing females (including the feeding period in which the ootheca is developing). Hexafluron and triflumuron at the LC50 caused 100% inhibition of hatch in reproducing females. Chlorfluazuron and UC 84572 at the LC50 had similar ovicidal activity (45.8 and 50.0% hatch, respectively). Female German cockroaches fed the chitin synthesis inhibitors before mating and after the ootheca had protruded from the abdomen were not affected. Reproductive capabilities of males were not affected, and males did not effectively transfer the compounds to untreated females during mating. PMID:2388230

  4. [Current conservative treatment of renal colic: value of prostaglandin synthesis inhibitors].

    PubMed

    Zwergel, U; Felgner, J; Rombach, H; Zwergel, T

    1998-04-20

    Prostaglandin synthesis inhibitors and parasympatholytic drugs are often used as analgetics in the case of renal colic. This paper analyzes how and whether these drug effects are important for the analgetic therapy. In an animal and in a human model with acutely obstructed kidneys we found that intravenous application of Indometacine and dipyrone significantly reduces renal pelvic pressure. The parasympatholytic drug hyoscine butylbromide did not produce any change of upper urinary tract dynamics. Inhibitors of prostaglandin synthesis thus effect pressure reduction in the renal pelvis, which is necessary for analgetic therapy. In contrast, hyoscine butylbromide does not have any influence on the acute upper urinary tract obstruction; consequently its usefulness in the treatment of renal colic is rather doubtful. PMID:12799978

  5. Fidaxomicin Is an Inhibitor of the Initiation of Bacterial RNA Synthesis

    PubMed Central

    Artsimovitch, Irina; Seddon, Jaime; Sears, Pamela

    2012-01-01

    Fidaxomicin was recently approved for the treatment of Clostridium difficile infection. It inhibits transcription by bacterial RNA polymerase. Because transcription is a multistep process, experiments were conducted in which fidaxomicin was added at different stages of transcriptional initiation to identify the blocked step. DNA footprinting experiments were also conducted to further elucidate the stage inhibited. Fidaxomicin blocks initiation only if added before the formation of the “open promoter complex,” in which the template DNA strands have separated but RNA synthesis has not yet begun. Binding of fidaxomicin precludes the initial separation of DNA strands that is prerequisite to RNA synthesis. These studies show that it has a mechanism distinct from that of elongation inhibitors, such as streptolydigin, and from the transcription initiation inhibitors myxopyronin and the rifamycins. PMID:22752861

  6. Inhibitors of Fatty Acid Amide Hydrolase and Monoacylglycerol Lipase: New Targets for Future Antidepressants.

    PubMed

    Ogawa, Shintaro; Kunugi, Hiroshi

    2015-01-01

    Cannabis and analogs of Δ9-tetrahydrocannabinol have been used for therapeutic purposes, but their therapeutic use remains limited because of various adverse effects. Endogenous cannabinoids have been discovered, and dysregulation of endocannabinoid signaling is implicated in the pathophysiology of major depressive disorder (MDD). Recently, endocannabinoid hydrolytic enzymes such as fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL) have become new therapeutic targets in the treatment of MDD. Several FAAH or MAGL inhibitors are reported to have no cannabimimetic side effects and, therefore, are new potential therapeutic options for patients with MDD who are resistant to first-line antidepressants (selective serotonin and serotonin-norepinephrine reuptake inhibitors). In this review, we focus on the possible relationships between MDD and the endocannabinoid system as well as the inhibitors' therapeutic potential. MAGL inhibitors may reduce inflammatory responses through activation of cannabinoid receptor type 2. In the hypothalamic-pituitary-adrenal axis, repeated FAAH inhibitor administration may be beneficial for reducing circulating glucocorticoid levels. Both FAAH and MAGL inhibitors may contribute to dopaminergic system regulation. Recently, several new inhibitors have been developed with strong potency and selectivity. FAAH inhibitor, MAGL inhibitor, or dual blocker use would be promising new treatments for MDD. Further pre-clinical studies and clinical trials using these inhibitors are warranted. PMID:26630956

  7. Amino Compounds as Inhibitors of De Novo Synthesis of Chlorobenzenes.

    PubMed

    Wang, Si-Jia; He, Pin-Jing; Lu, Wen-Tao; Shao, Li-Ming; Zhang, Hua

    2016-01-01

    The inhibitory effects of four amino compounds on the formation of chlorobenzenes (CBzs) - dioxin precursors and indicators, and the inhibitory mechanisms were explored. The results show NH4H2PO4 can decrease the total yields of CBzs (1,2di-CBz, 1,3di-CBz, 1,4di-CBz, penta-CBz and hexa-CBz) by 98.1%±1.6% and 96.1%±0.7% under air and nitrogen flow. The inhibitory effects indicated by the total yields of CBzs follow the order NH4H2PO4 > NH4HF2 > (NH4)2SO4 > NH4Br under air flow and NH4H2PO4 ≈ (NH4)2SO4 ≈ NH4HF2 >NH4Br under nitrogen flow. The inhibition mechanism revealed by thermal analysis that CuCl2 was converted to CuPO3 by reacting with NH4H2PO4 below 200 °C, which can block the transfer of chlorine and formation of C-Cl bonds at 350 °C. The effects of the other three inhibitors were weaker because their reactions with CuCl2, which form other copper compounds, and the reaction of CuCl2 with carbon, which forms C-Cl bonds, were almost simultaneous and competitive. Oxygen influenced the yield of CBzs obviously, and the total yield of five CBzs sharply increased with oxygen. Because of their high efficiency, low environmental impact, low cost, and availability, amino compounds - especially NH4H2PO4 - can be utilized as inhibitors of CBzs during incineration. PMID:27034259

  8. Amino Compounds as Inhibitors of De Novo Synthesis of Chlorobenzenes

    NASA Astrophysics Data System (ADS)

    Wang, Si-Jia; He, Pin-Jing; Lu, Wen-Tao; Shao, Li-Ming; Zhang, Hua

    2016-04-01

    The inhibitory effects of four amino compounds on the formation of chlorobenzenes (CBzs) - dioxin precursors and indicators, and the inhibitory mechanisms were explored. The results show NH4H2PO4 can decrease the total yields of CBzs (1,2di-CBz, 1,3di-CBz, 1,4di-CBz, penta-CBz and hexa-CBz) by 98.1%±1.6% and 96.1%±0.7% under air and nitrogen flow. The inhibitory effects indicated by the total yields of CBzs follow the order NH4H2PO4 > NH4HF2 > (NH4)2SO4 > NH4Br under air flow and NH4H2PO4 ≈ (NH4)2SO4 ≈ NH4HF2 >NH4Br under nitrogen flow. The inhibition mechanism revealed by thermal analysis that CuCl2 was converted to CuPO3 by reacting with NH4H2PO4 below 200 °C, which can block the transfer of chlorine and formation of C–Cl bonds at 350 °C. The effects of the other three inhibitors were weaker because their reactions with CuCl2, which form other copper compounds, and the reaction of CuCl2 with carbon, which forms C–Cl bonds, were almost simultaneous and competitive. Oxygen influenced the yield of CBzs obviously, and the total yield of five CBzs sharply increased with oxygen. Because of their high efficiency, low environmental impact, low cost, and availability, amino compounds - especially NH4H2PO4 - can be utilized as inhibitors of CBzs during incineration.

  9. Amino Compounds as Inhibitors of De Novo Synthesis of Chlorobenzenes

    PubMed Central

    Wang, Si-Jia; He, Pin-Jing; Lu, Wen-Tao; Shao, Li-Ming; Zhang, Hua

    2016-01-01

    The inhibitory effects of four amino compounds on the formation of chlorobenzenes (CBzs) - dioxin precursors and indicators, and the inhibitory mechanisms were explored. The results show NH4H2PO4 can decrease the total yields of CBzs (1,2di-CBz, 1,3di-CBz, 1,4di-CBz, penta-CBz and hexa-CBz) by 98.1%±1.6% and 96.1%±0.7% under air and nitrogen flow. The inhibitory effects indicated by the total yields of CBzs follow the order NH4H2PO4 > NH4HF2 > (NH4)2SO4 > NH4Br under air flow and NH4H2PO4 ≈ (NH4)2SO4 ≈ NH4HF2 >NH4Br under nitrogen flow. The inhibition mechanism revealed by thermal analysis that CuCl2 was converted to CuPO3 by reacting with NH4H2PO4 below 200 °C, which can block the transfer of chlorine and formation of C–Cl bonds at 350 °C. The effects of the other three inhibitors were weaker because their reactions with CuCl2, which form other copper compounds, and the reaction of CuCl2 with carbon, which forms C–Cl bonds, were almost simultaneous and competitive. Oxygen influenced the yield of CBzs obviously, and the total yield of five CBzs sharply increased with oxygen. Because of their high efficiency, low environmental impact, low cost, and availability, amino compounds - especially NH4H2PO4 - can be utilized as inhibitors of CBzs during incineration. PMID:27034259

  10. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  11. The effect of chitin synthesis inhibitors on the development of Brugia malayi in Aedes aegypti.

    PubMed

    Mohapatra, R; Ranjit, M R; Dash, A P

    1996-09-01

    Two chitin synthesis inhibitors (CSIs) viz., triflumuron and hexaflumuron interfere++ with the development of Brugia malayi in Aedes aegypti (a black-eyed Liverpool strain). The development of B. malayi was slow in both the treated populations and the infection rate, infectivity rate and L3 load per mosquito decreased significantly (P < 0.001) in comparison with untreated controls. Hexaflumuron was found to be more inhibiting than triflumuron. PMID:8984113

  12. Synthesis and biological evaluation of analogues of the kinase inhibitor nilotinib as Abl and Kit inhibitors

    PubMed Central

    Duveau, Damien Y.; Hu, Xin; Walsh, Martin J.; Shukla, Suneet; Skoumbourdis, Amanda P.; Boxer, Matthew B.; Ambudkar, Suresh V.; Shen, Min; Thomas, Craig J.

    2013-01-01

    The importance of the trifluoromethyl group in the polypharmacological profile of nilotinib was investigated. Molecular editing of nilotinib led to the design, synthesis and biological evaluation of analogues where the trifluoromethyl group was replaced by a proton, fluorine and a methyl group. While these analogues were less active than nilotinib toward Abl, their activity toward Kit was comparable, with the monofluorinated analogue being the most active. Docking of nilotinib and of analogues 2a–c to the binding pocket of Abl and of Kit showed that the lack of shape complementarity in Kit is compensated by the stabilizing effect from its juxtamembrane region. PMID:23273517

  13. Synthesis and characterization of potent bivalent amyloidosis inhibitors that bind prior to transthyretin tetramerization.

    PubMed

    Green, Nora S; Palaninathan, Satheesh K; Sacchettini, James C; Kelly, Jeffery W

    2003-11-01

    The misfolding of transthyretin (TTR), including rate-limiting tetramer dissociation and partial monomer denaturation, is sufficient for TTR misassembly into amyloid and other abnormal quaternary structures associated with senile systemic amyloidosis, familial amyloid polyneuropathy, and familial amyloid cardiomyopathy. Monovalent small molecules that bind to one or both of the unoccupied thyroid hormone binding sites at the TTR quaternary structure interface stabilize the native state, raising the kinetic barrier for tetramer dissociation sufficiently that the rate of dissociation, and therefore amyloidosis, becomes slow. Bivalent amyloid inhibitors that bind to both binding sites simultaneously are reported herein. The candidate bivalent inhibitors are generally unable to bind to the native TTR tetramer and typically do not engage in monovalent binding owing to a strong inhibitor orientation preference. However, the TTR quaternary structure can assemble around several of the bivalent inhibitors if the inhibitor intercepts the protein before assembly occurs. Some of the wild-type TTR.bivalent inhibitor complexes prepared in this fashion retain a tetrameric structure when subjected to substantial denaturation stresses (8 M urea, 120 h). The best bivalent inhibitor reduced acid-mediated TTR (3.6 microM) amyloid fibril formation to 6% of that exhibited by TTR in the absence of inhibitor, a significant improvement over the approximately 30% observed for the best monovalent inhibitors (3.6 microM, 72 h). The apparent dissociation rate of the best bivalent inhibitor is effectively zero, consistent with the idea that TTR tetramer dissociation and inhibitor dissociation are linked-as a result of the inhibitor-templating tetramer assembly. X-ray cocrystal structures of two of the complexes demonstrate that the bivalent inhibitors simultaneously occupy both sites in TTR, consistent with the 1:1 binding stoichiometry derived from HPLC analysis. The purpose of this study was

  14. Total Synthesis of 4,5-Didehydroguadiscine: A Potent Melanogenesis Inhibitor from the Brazilian Medicinal Herb, Hornschuchia obliqua.

    PubMed

    Tanabe, Genzoh; Sugano, Youta; Shirato, Miki; Sonoda, Naoki; Tsutsui, Nozomi; Morikawa, Toshio; Ninomiya, Kiyofumi; Yoshikawa, Masayuki; Muraoka, Osamu

    2015-07-24

    The first total synthesis of the 7,7-dimethylaporphinoid, 4,5-didehydroguadiscine (6), originally isolated from the stems and roots of Hornschuchia oblique (Annonaceae), was achieved by the condensation of homopiperonylamine (7) with an α,α-dimethylphenylacetic acid derivative (8) and subsequent Pschorr reaction of the resulting benzylisoquinoline intermediate (22). The reported (13)C NMR data were partially revised on the basis of the analysis of HMBC spectra measured under different conditions. The melanogenesis inhibitory activity (IC50 = 4.7 μM) of 6 was 40 times stronger than that of arbutin (174 μM), which was used as reference standard. Furthermore, 6 was the most potent natural melanogenesis inhibitor within this class of compounds. PMID:26135746

  15. Induction of DNA synthesis in isolated nuclei by cytoplasmic factors: inhibition by protease inhibitors.

    PubMed Central

    Wong, R L; Gutowski, J K; Katz, M; Goldfarb, R H; Cohen, S

    1987-01-01

    Cytoplasmic extracts from spontaneously proliferating and mitogen-activated lymphoid cells contain a protein factor called ADR (activator of DNA replication) that induces DNA synthesis in isolated quiescent nuclei. ADR-containing preparations have proteolytic activity, as indicated by their ability to degrade fibrin in a plasminogen-independent and plasminogen-dependent manner. In addition, aprotinin, a nonspecific protease inhibitor, abrogates ADR-induced DNA synthesis in a dose-dependent fashion. Preincubation studies demonstrated that the effect of aprotinin is not due to its suppressive effects on the nuclei themselves. Other protease inhibitors such as leupeptin, p-aminobenzamidine, and N-alpha-tosyllysine chloromethyl ketone are also inhibitory, but soybean trypsin inhibitor is without effect. ADR activity can be removed from active extracts by adsorption with aprotinin-conjugated agarose beads and can be recovered by elution with an acetate buffer (pH 5). These findings are consistent with the interpretation that the initiation of DNA synthesis in resting nuclei may be protease dependent and, further, that the cytoplasmic stimulatory factor we have called ADR may be a protease itself. PMID:3540956

  16. A New alpha-Glucosidase Inhibitor, 10-Hydroxy-8(E)-Octadecenoic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In our continuous effort to screen natural products for their anti-microbial and enzyme inhibitor activities, we found that 10-Hydroxy-8(E)-Octadecenoic acid (HOD) exhibited strong anti- a-glucosidase (EC 3.2.1.20) activity. HOD is an intermediate in the bioconversion of oleic acid to 7,10-dihydrox...

  17. COMPARATIVE PATHOGENESIS OF HALOACETIC ACID AND PROTEIN KINASE INHIBITOR EMBRYOTOXICITY IN MOUSE WHOLE EMBRYO CULTURE

    EPA Science Inventory

    Comparative pathogenesis of haloacetic acid and protein kinase inhibitor embryotoxicity in mouse whole embryo culture.

    Ward KW, Rogers EH, Hunter ES 3rd.

    Curriculum in Toxicology, University of North Carolina at Chapel Hill, 27599-7270, USA.

    Haloacetic acids ...

  18. Effects of chitin synthesis inhibitors on incorporation of nucleosides into DNA and RNA in a cell line from Manduca sexta (L).

    PubMed

    Klitschka, G E; Mayer, R T; Droleskey, R E; Norman, J O; Chen, A C

    1986-06-01

    Five putative chitin synthesis inhibitors (CSI) were tested to determine if they inhibited nucleoside incorporation into acid precipitable material in a cell line from Manduca sexta (L.). The results varied. Diflubenzuron (DFB) (100 micron) inhibited cytidine incorporation by 38%; EL-494 (100 micron) inhibited adenosine incorporation by 43%; Bay Sir 8514 (100 micron) inhibited uridine incorporation by 24%. Superdiflubenzuron (100 micron) was the worst inhibitor overall (18-22%) for the benzoylphenyl urea CSI. The triazine CSI, CGA 19255, was the best inhibitor tested with 60% inhibition for cytidine and 49% for adenosine incorporation into DNA and RNA. Examination of cells incubated with diflubenzuron by scanning electron microscopy revealed distinct external morphological changes. Transmission electron microscopy showed that crystalline structures accumulated in the cytoplasm of cells treated with DFB. The crystalline structures were assumed to be diflubenzuron and they persisted even after diflubenzuron was removed from the medium. PMID:2422789

  19. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  20. Synthesis of urea-based inhibitors as active site probes of glutamate carboxypeptidase II: efficacy as analgesic agents.

    PubMed

    Kozikowski, Alan P; Zhang, Jiazhong; Nan, Fajun; Petukhov, Pavel A; Grajkowska, Ewa; Wroblewski, Jarda T; Yamamoto, Tatsuo; Bzdega, Tomasz; Wroblewska, Barbara; Neale, Joseph H

    2004-03-25

    The neuropeptidase glutamate carboxypeptidase II (GCPII) hydrolyzes N-acetyl-L-aspartyl-L-glutamate (NAAG) to liberate N-acetylaspartate and glutamate. GCPII was originally cloned as PSMA, an M(r) 100,000 type II transmembrane glycoprotein highly expressed in prostate tissues. PSMA/GCPII is located on the short arm of chromosome 11 and functions as both a folate hydrolase and a neuropeptidase. Inhibition of brain GCPII may have therapeutic potential in the treatment of certain disease states arising from pathologically overactivated glutamate receptors. Recently, we reported that certain urea-based structures act as potent inhibitors of GCPII (J. Med. Chem. 2001, 44, 298). However, many of the potent GCPII inhibitors prepared to date are highly polar compounds and therefore do not readily penetrate the blood-brain barrier. Herein, we elaborate on the synthesis of a series of potent, urea-based GCPII inhibitors from the lead compound 3 and provide assay data for these ligands against human GCPII. Moreover, we provide data revealing the ability of one of these compounds, namely, 8d, to reduce the perception of inflammatory pain. Within the present series, the gamma-tetrazole bearing glutamate isostere 7d is the most potent inhibitor with a K(i) of 0.9 nM. The biological evaluation of these compounds revealed that the active site of GCPII likely comprises two regions, namely, the pharmacophore subpocket and the nonpharmacophore subpocket. The pharmacophore subpocket is very sensitive to structural changes, and thus, it appears important to keep one of the glutamic acid moieties intact to maintain the potency of the GCPII inhibitors. The site encompassing the nonpharmacophore subpocket that binds to glutamate's alpha-carboxyl group is sensitive to structural change, as shown by compounds 6b and 7b. However, the other region of the nonpharmacophore subpocket can accommodate both hydrophobic and hydrophilic groups. Thus, an aromatic ring can be introduced to the

  1. Snake venoms. The amino-acid sequence of trypsin inhibitor E of Dendroaspis polylepis polylepis (Black Mamba) venom.

    PubMed

    Joubert, F J; Strydom, D J

    1978-06-01

    Trypsin inhibitor E from black mamba venom comprises 59 amino acid residues in a single polypeptide chain, cross-linked by three intrachain disulphide bridges. The complete primary structure of inhibitor E was elucidated. The sequence is homologous with trypsin inhibitors from different sources. Unique among this homologous series of proteinase inhibitors, inhibitor E has an affinity for transition metal ions, exemplified here by Cu2 and Co2+. PMID:668688

  2. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.

    1982-05-01

    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  3. Inhibitors of Fatty Acid Amide Hydrolase and Monoacylglycerol Lipase: New Targets for Future Antidepressants

    PubMed Central

    Ogawa, Shintaro; Kunugi, Hiroshi

    2015-01-01

    Cannabis and analogs of Δ9-tetrahydrocannabinol have been used for therapeutic purposes, but their therapeutic use remains limited because of various adverse effects. Endogenous cannabinoids have been discovered, and dysregulation of endocannabinoid signaling is implicated in the pathophysiology of major depressive disorder (MDD). Recently, endocannabinoid hydrolytic enzymes such as fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL) have become new therapeutic targets in the treatment of MDD. Several FAAH or MAGL inhibitors are reported to have no cannabimimetic side effects and, therefore, are new potential therapeutic options for patients with MDD who are resistant to first-line antidepressants (selective serotonin and serotonin-norepinephrine reuptake inhibitors). In this review, we focus on the possible relationships between MDD and the endocannabinoid system as well as the inhibitors’ therapeutic potential. MAGL inhibitors may reduce inflammatory responses through activation of cannabinoid receptor type 2. In the hypothalamic–pituitary–adrenal axis, repeated FAAH inhibitor administration may be beneficial for reducing circulating glucocorticoid levels. Both FAAH and MAGL inhibitors may contribute to dopaminergic system regulation. Recently, several new inhibitors have been developed with strong potency and selectivity. FAAH inhibitor, MAGL inhibitor, or dual blocker use would be promising new treatments for MDD. Further pre-clinical studies and clinical trials using these inhibitors are warranted. PMID:26630956

  4. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  5. Metabolic effects of inhibitors of two enzymes of the branched-chain amino acid pathway in Salmonella typhimurium.

    PubMed Central

    Epelbaum, S; Chipman, D M; Barak, Z

    1996-01-01

    The metabolic effects of inhibitors of two enzymes in the pathway for biosynthesis of branched-chain amino acids were examined in Salmonella typhimurium mutant strain TV105, expressing a single isozyme of acetohydroxy acid synthase (AHAS), AHAS isozyme II. One inhibitor was the sulfonylurea herbicide sulfometuron methyl (SMM), which inhibits this isozyme and AHAS of other organisms, and the other was N-isopropyl oxalylhydroxamate (IpOHA), which inhibits ketol-acid reductoisomerase (KARI). The effects of the inhibitors on growth, levels of several enzymes of the pathway, and levels of intermediates of the pathway were measured. The intracellular concentration of the AHAS substrate 2-ketobutyrate increased on addition of SMM, but a lack of correlation between increased ketobutyrate and growth inhibition suggests that the former is not the immediate cause of the latter. The levels of the keto acid precursor of valine, but not of the precursor of isoleucine, were drastically decreased by SMM, and valine, but not isoleucine, partially overcame SMM inhibition. This apparent stronger effect of SMM on the flux into the valine arm, as opposed to the isoleucine arm, of the branched-chain amino acid pathway is explained by the kinetics of the AHAS reaction, as well as by the different roles of pyruvate, ketobutyrate, and the valine precursor in metabolism. The organization of the pathway thus potentiates the inhibitory effect of SMM. IpOHA has strong initial effects at lower concentrations than does SMM and leads to increases both in the acetohydroxy acid substrates of KARI and, surprisingly, in ketobutyrate. Valine completely protected strain TV105 from IpOHA at the MIC. A number of explanations for this effect can be ruled out, so that some unknown arrangement of the enzymes involved must be suggested. IpOHA led to initial cessation of growth, with partial recovery after a time whose duration increased with the inhibitor concentration. The recovery is apparently due to

  6. Metabolic effects of inhibitors of two enzymes of the branched-chain amino acid pathway in Salmonella typhimurium.

    PubMed

    Epelbaum, S; Chipman, D M; Barak, Z

    1996-02-01

    The metabolic effects of inhibitors of two enzymes in the pathway for biosynthesis of branched-chain amino acids were examined in Salmonella typhimurium mutant strain TV105, expressing a single isozyme of acetohydroxy acid synthase (AHAS), AHAS isozyme II. One inhibitor was the sulfonylurea herbicide sulfometuron methyl (SMM), which inhibits this isozyme and AHAS of other organisms, and the other was N-isopropyl oxalylhydroxamate (IpOHA), which inhibits ketol-acid reductoisomerase (KARI). The effects of the inhibitors on growth, levels of several enzymes of the pathway, and levels of intermediates of the pathway were measured. The intracellular concentration of the AHAS substrate 2-ketobutyrate increased on addition of SMM, but a lack of correlation between increased ketobutyrate and growth inhibition suggests that the former is not the immediate cause of the latter. The levels of the keto acid precursor of valine, but not of the precursor of isoleucine, were drastically decreased by SMM, and valine, but not isoleucine, partially overcame SMM inhibition. This apparent stronger effect of SMM on the flux into the valine arm, as opposed to the isoleucine arm, of the branched-chain amino acid pathway is explained by the kinetics of the AHAS reaction, as well as by the different roles of pyruvate, ketobutyrate, and the valine precursor in metabolism. The organization of the pathway thus potentiates the inhibitory effect of SMM. IpOHA has strong initial effects at lower concentrations than does SMM and leads to increases both in the acetohydroxy acid substrates of KARI and, surprisingly, in ketobutyrate. Valine completely protected strain TV105 from IpOHA at the MIC. A number of explanations for this effect can be ruled out, so that some unknown arrangement of the enzymes involved must be suggested. IpOHA led to initial cessation of growth, with partial recovery after a time whose duration increased with the inhibitor concentration. The recovery is apparently due to

  7. Design and Synthesis of Phenylpyrrolidine Phenylglycinamides As Highly Potent and Selective TF-FVIIa Inhibitors

    PubMed Central

    2013-01-01

    Inhibitors of the Tissue Factor/Factor VIIa (TF-FVIIa) complex are promising novel anticoagulants that show excellent efficacy and minimal bleeding in preclinical models. On the basis of a zwitterionic phenylglycine acylsulfonamide 1, a phenylglycine benzylamide 2 was shown to possess improved permeability and oral bioavailability. Optimization of the benzylamide, guided by X-ray crystallography, led to a potent TF-FVIIa inhibitor 18i with promising oral bioavailability, but promiscuous activity in an in vitro safety panel of receptors and enzymes. Introducing an acid on the pyrrolidine ring, guided by molecular modeling, resulted in highly potent, selective, and efficacious TF-FVIIa inhibitors with clean in vitro safety profile. The pyrrolidine acid 20 showed a moderate clearance, low volume of distribution, and a short t1/2 in dog PK studies. PMID:24900796

  8. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  9. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  10. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  11. Inhibitor of DNA synthesis is present in normal chicken serum

    SciTech Connect

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-03-05

    The authors have found that heat-inactivated serum (57/sup 0/C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in /sup 3/H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of /sup 3/H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both /sup 3/H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines.

  12. Chitosan as a green inhibitor for copper corrosion in acidic medium.

    PubMed

    El-Haddad, Mahmoud N

    2013-04-01

    The behavior of copper in 0.5 M HCl acid containing different concentrations of chitosan has been studied by weight loss, potentiodynamic polarization, electrochemical impedance spectroscopy (EIS) and electrochemical frequency modulation (EFM) measurements. Potentiodynamic polarization measurements show that the chitosan acts essentially as a mixed-type inhibitor. EFM can be used as a rapid and non destructive technique for corrosion rate measurements without prior knowledge of Tafel constants. The results of EIS indicate that the value of CPEs tends to decrease and both charge transfer resistance and inhibition efficiency tend to increase by increasing the inhibitor concentration. The investigated inhibitor has shown good inhibition efficiency in 0.5 M HCl. The adsorption of inhibitor on the copper surface obeys Langmuir's isotherm. Metal surface characterization was performed using scanning electron microscope (SEM) and Fourier transform infrared spectroscopy (FT-IR). Also, the relationship between quantum chemical calculations and experimental inhibition efficiency of the inhibitor was discussed. PMID:23298849

  13. Chemoenzymatic synthesis of sialosides containing C7-modified sialic acids and their application in sialidase substrate specificity studies

    PubMed Central

    Khedri, Zahra; Li, Yanhong; Muthana, Saddam; Muthana, Musleh M.; Hsiao, Ching-Wen; Yu, Hai; Chen, Xi

    2014-01-01

    Modification at the glycerol side chain of sialic acid in sialosides modulate their recognition by sialic acid-binding proteins and sialidases. However, limited work has been focused on the synthesis and functional studies of sialosides with C7-modified sialic acids. Here we report chemical synthesis of C4-modified ManNAc and mannose and their application as sialic acid precursors in a highly efficient one-pot three-enzyme system for chemoenzymatic synthesis of α2–3- and α2–6-linked sialyl para-nitrophenyl galactosides in which the C7-hydroxyl group in sialic acid (N-acetylneuraminic acid, Neu5Ac, or 2-keto-3-deoxynonulosonic acid, Kdn) was systematically substituted by -F, -OMe, -H, and -N3 groups. Substrate specificity study of bacterial and human sialidases using the obtained sialoside library containing C7-modified sialic acids showed that sialosides containing C7-deoxy Neu5Ac were selective substrates for all bacterial sialidases tested but not for human NEU2. The information obtained from sialidase substrate specificity can be used to guide the design of new inhibitors that are selective against bacterial sialidases. PMID:24680514

  14. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  15. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  16. Enantioselective synthesis of isotopically labeled homocitric acid lactone.

    PubMed

    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T

    2013-11-15

    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  17. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  18. Pyrazole phenylcyclohexylcarbamates as inhibitors of human fatty acid amide hydrolases (FAAH).

    PubMed

    Aghazadeh Tabrizi, Mojgan; Baraldi, Pier Giovanni; Ruggiero, Emanuela; Saponaro, Giulia; Baraldi, Stefania; Romagnoli, Romeo; Martinelli, Adriano; Tuccinardi, Tiziano

    2015-06-01

    Fatty acid amide hydrolase (FAAH) inhibitors have gained attention as potential therapeutic targets in the management of neuropathic pain. Here, we report a series of pyrazole phenylcyclohexylcarbamate derivatives standing on the known carbamoyl FAAH inhibitor URB597. Structural modifications led to the recognition of compound 22 that inhibited human recombinant FAAH (hrFAAH) in the low nanomolar range (IC50 = 11 nM). The most active compounds of this series showed significant selectivity toward monoacylglycerol lipase (MAGL) enzyme. In addition, molecular modeling and reversibility behavior of the new class of FAAH inhibitors are presented in this article. PMID:26002335

  19. Cholesterol synthesis inhibitors protect against platelet-activating factor-induced neuronal damage

    PubMed Central

    Bate, Clive; Rumbold, Louis; Williams, Alun

    2007-01-01

    Background Platelet-activating factor (PAF) is implicated in the neuronal damage that accompanies ischemia, prion disease and Alzheimer's disease (AD). Since some epidemiological studies demonstrate that statins, drugs that reduce cholesterol synthesis, have a beneficial effect on mild AD, we examined the effects of two cholesterol synthesis inhibitors on neuronal responses to PAF. Methods Primary cortical neurons were treated with cholesterol synthesis inhibitors (simvastatin or squalestatin) prior to incubation with different neurotoxins. The effects of these drugs on neuronal cholesterol levels and neuronal survival were measured. Immunoblots were used to determine the effects of simvastatin or squalestatin on the distribution of the PAF receptor and an enzyme linked immunoassay was used to quantify the amounts of PAF receptor. Results PAF killed primary neurons in a dose-dependent manner. Pre-treatment with simvastatin or squalestatin reduced neuronal cholesterol and increased the survival of PAF-treated neurons. Neuronal survival was increased 50% by 100 nM simvastatin, or 20 nM squalestatin. The addition of mevalonate restored cholesterol levels, and reversed the protective effect of simvastatin. Simvastatin or squalestatin did not affect the amounts of the PAF receptor but did cause it to disperse from within lipid rafts. Conclusion Treatment of neurons with cholesterol synthesis inhibitors including simvastatin and squalestatin protected neurons against PAF. Treatment caused a percentage of the PAF receptors to disperse from cholesterol-sensitive domains. These results raise the possibility that the effects of statins on neurodegenerative disease are, at least in part, due to desensitisation of neurons to PAF. PMID:17233902

  20. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk

    2008-10-01

    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  1. Ferulic acid in combination with PARP inhibitor sensitizes breast cancer cells as chemotherapeutic strategy.

    PubMed

    Choi, Young Eun; Park, Eunmi

    2015-03-13

    Homologous-recombination (HR)-dependent repair defective cells are hypersensitive to poly (ADP-ribose) polymerase (PARP) inhibitors. Combinations of defective HR pathway and PARP inhibitors have been an effective chemotherapeutic modality. We previously showed that knockdown of the WD40-repeat containing protein, Uaf1, causes an HR repair defect in mouse embryo fibroblast cells and therefore, increases sensitivity to PARP inhibitor, ABT-888. Similarly, here, we show that ferulic acid reduces HR repair, inhibits RAD 51 foci formation, and accumulates γ-H2AX in breast cancer cells. Moreover, ferulic acid, when combined with ABT-888, renders breast cancer cells become hypersensitive to ABT-888. Our study indicates that ferulic acid in combination with ABT-888 treatment may serve as an effective combination chemotherapeutic agent as a natural bioactive compound. PMID:25677620

  2. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  3. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  4. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  5. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  6. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.

    2012-01-01

    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  7. Optimization of amino acid thioesters as inhibitors of metallo-β-lactamase L1.

    PubMed

    Liu, Xiao-Long; Yang, Ke-Wu; Zhang, Yue-Juan; Ge, Ying; Xiang, Yang; Chang, Ya-Nan; Oelschlaeger, Peter

    2016-10-01

    The emergence of antibiotic resistance caused by metallo-β-lactamases (MβLs) is a global public health problem. Recently, we found amino acid thioesters to be a highly promising scaffold for inhibitors of the MβL L1. In order to optimize this series of inhibitors, nine new amino acid thioesters were developed by modifying the substituents on the N-terminus of the thioesters and the groups representing the amino acid side chain. Biological activity assays indicate that all of them are very potent inhibitors of L1 with an IC50 value range of 20-600nM, lower than those of most of the previously reported inhibitors of this scaffold. Analysis of structure-activity relationship reveals that big hydrophobic substituents on the N-terminus and a methionine amino acid side chain improves inhibitory activity of the thioesters. All these inhibitors are able to restore antibacterial activity of a β-lactam antibiotic against Escherichia coli BL21(DE3) cells producing L1 to that against E. coli cells lacking a β-lactamase. Docking studies reveal that a large N-terminal hydrophobic group results in a slightly different binding mode than smaller hydrophobic groups at the same position. PMID:27595424

  8. Suppression of IL-12p40-related regulatory cytokines by suberoylanilide hydroxamic acid an inhibitor of histone deacetylases.

    PubMed

    Dobreva, Zlatka Georgieva; Grigorov, Boncho Grigorov; Stanilova, Spaska Angelova

    2016-08-01

    Small molecule inhibitors of histone deacetylases (HDACs) are a new class drugs used in clinical trials for the treatment of various malignancies. Emerging evidence suggest that HDAC inhibitors may also have anti-inflammatory properties, although the molecular mechanisms remain poorly defined. Our study investigates the effect of the HDACs inhibitor suberoylanilide hydroxamic acid (SAHA) on the expression of IL-12p40-related cytokines. For this purpose, human peripheral blood mononuclear cells (PBMC) were stimulated with LPS and C3bgp with or without SAHA. IL-12p40, IL-12p35 and IL-23p19 mRNA was determined at 6 h by qRT-PCR. Cytokine levels were determined in culture supernatants at 6 and 24 h, by ELISA. SAHA significantly inhibited IL-12p40 and IL-23p19 mRNA synthesis and did not change IL-12p35 mRNA transcription. Early at 6 h, we detected significantly decreased IL-12p40 and IL-23, but not IL-12p70 protein production in cultures treated with SAHA. Results also showed that the suppression of IL-12p40-related cytokines was clearly defined at 24 h. However, this suppression was less pronounced regarding IL-12p70. The present study showed that SAHA suppressed the gene expression of IL-23p19 stronger than the expression of IL-12p35, as well as the synthesis of IL-23 compared to that of IL-12p70. We suggest that this inhibitory effect of SAHA may be beneficial during treatment of inflammatory and autoimmune diseases mediated by Th17 immune response. PMID:27240992

  9. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.

    1981-01-01

    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  10. Lipoxygenase inhibitors suppress IL-2 synthesis: relationship with rise of [Ca++]i and the events dependent on protein kinase C activation.

    PubMed

    Dornand, J; Sekkat, C; Mani, J C; Gerber, M

    1987-11-01

    The present study was performed in an attempt to understand the mechanism involved in the inhibition of interleukin 2 (IL-2) synthesis by lipoxygenase (LO) pathway inhibitors. Using the two IL-2-producing lymphoid cell lines, (Jurkat and EL4 cells), we showed first that the inhibitory effect of the phenolic compounds tested (NDGA, BHA and caffeic acid) acted on lymphoid cells themselves and not on eventual monocytic or granulocytic contaminant cells. Secondly, these inhibitors were demonstrated as exerting their effect on two levels: they affected the events controlled by both second messengers implicated in T cell activation, namely rise of intracellular free calcium concentration [( Ca++]i) and protein kinase C (PKC) activation. For this purpose, LO inhibitor effects have been compared: (a) on IL-2 production by the two different lines: Jurkat cells, which need both signals, and EL4 cells, which require only PKC activation for the induction of this production; and (b) on the events induced by the different ways of Jurkat cell activation: PHA (or anti-CD3 monoclonal antibody) versus calcium ionophore. These results are discussed with respect to an eventual involvement of arachidonic acid [AA] derivatives in IL-2 synthesis. PMID:3123378

  11. A Two-Step Synthesis of Virstatin, a Virulence Inhibitor of "Vibrio cholerae"

    ERIC Educational Resources Information Center

    McDonald, Chriss E.

    2009-01-01

    Virstatin, an "N"-butanoic acid substituted naphthalimide, inhibits the ability of "Vibrio cholerae" to cause disease. A three-week experiment involving synthesis, purification, and spectral characterization of this compound is described. This experiment is appropriate for organic chemistry. It has been performed with three lab sections of about…

  12. LP99: Discovery and Synthesis of the First Selective BRD7/9 Bromodomain Inhibitor**

    PubMed Central

    Clark, Peter G K; Vieira, Lucas C C; Tallant, Cynthia; Fedorov, Oleg; Singleton, Dean C; Rogers, Catherine M; Monteiro, Octovia P; Bennett, James M; Baronio, Roberta; Müller, Susanne; Daniels, Danette L; Méndez, Jacqui; Knapp, Stefan; Brennan, Paul E; Dixon, Darren J

    2015-01-01

    The bromodomain-containing proteins BRD9 and BRD7 are part of the human SWI/SNF chromatin-remodeling complexes BAF and PBAF. To date, no selective inhibitor for BRD7/9 has been reported despite its potential value as a biological tool or as a lead for future therapeutics. The quinolone-fused lactam LP99 is now reported as the first potent and selective inhibitor of the BRD7 and BRD9 bromodomains. Development of LP99 from a fragment hit was expedited through balancing structure-based inhibitor design and biophysical characterization against tractable chemical synthesis: Complexity-building nitro-Mannich/lactamization cascade processes allowed for early structure–activity relationship studies whereas an enantioselective organocatalytic nitro-Mannich reaction enabled the synthesis of the lead scaffold in enantioenriched form and on scale. This epigenetic probe was shown to inhibit the association of BRD7 and BRD9 to acetylated histones in vitro and in cells. Moreover, LP99 was used to demonstrate that BRD7/9 plays a role in regulating pro-inflammatory cytokine secretion. PMID:25864491

  13. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  14. Inhibitors

    MedlinePlus

    ... Community Counts Blood Safety Inhibitors Articles & Key Findings Free Materials Videos Starting the Conversation Playing it Safe A Look at Hemophilia Joint Range of Motion My Story Links to Other Websites ...

  15. Complete amino acid sequence of the lentil trypsin-chymotrypsin inhibitor LCI-1.7 and a discussion of atypical binding sites of Bowman-Birk inhibitors.

    PubMed

    Weder, Jürgen K P; Hinkers, Sabine C

    2004-06-30

    The complete primary structure of the lentil (Lens culinaris) trypsin-chymotrypsin inhibitor LCI-1.7 was determined by conventional methods in order to find relationships between partial sequences and the difference in action against human and bovine chymotrypsin. As other Bowman-Birk type inhibitors, LCI-1.7 contained 68 amino acid residues, seven disulfide bridges, and two reactive sites, Arg16-Ser17 for trypsin and Tyr42-Ser43 for chymotrypsin. Evaluation of sequence homologies showed that it belonged to the group III Bowman-Birk inhibitors. The atypical additional binding site of LCI-1.7 for human chymotrypsin was discussed and compared with such binding sites of two other Bowman-Birk inhibitors, the Bowman-Birk soybean proteinase inhibitor BBI, and the lima bean proteinase inhibitor LBI I, for human and bovine trypsin and chymotrypsin. A concept to reduce the action of these inhibitors against human enzymes by genetic engineering was proposed. PMID:15212472

  16. Scoparic acid A, a beta-glucuronidase inhibitor from Scoparia dulcis.

    PubMed

    Hayashi, T; Kawasaki, M; Okamura, K; Tamada, Y; Morita, N; Tezuka, Y; Kikuchi, T; Miwa, Y; Taga, T

    1992-12-01

    The 70% EtOH extract of Scoparia dulcis showed inhibitory activity against beta-glucuronidase from bovine liver. Bioassay-directed fractionation of the active extract led to the isolation of three labdane-type diterpene acids, scoparic acid A [1] [6-benzoyl-12-hydroxy-labda-8(17), 13-dien-18-oic acid], scoparic acid B [2] [6-benzoyl-14,15-dinor-13-oxo-8(17)-labden-18-oic acid], and scoparic acid C [3] [6-benzoyl-15-nor-14-oxo-8(17)-labden-18-oic acid], the structures of which were established by spectral means, including X-ray analysis. Scoparic acid A was found to be a potent beta-glucuronidase inhibitor. PMID:1294695

  17. Design and synthesis of a series of serine derivatives as small molecule inhibitors of the SARS coronavirus 3CL protease.

    PubMed

    Konno, Hiroyuki; Wakabayashi, Masaki; Takanuma, Daiki; Saito, Yota; Akaji, Kenichi

    2016-03-15

    Synthesis of serine derivatives having the essential functional groups for the inhibitor of SARS 3CL protease and evaluation of their inhibitory activities using SARS 3CL R188I mutant protease are described. The lead compounds, functionalized serine derivatives, were designed based on the tetrapeptide aldehyde and Bai's cinnamoly inhibitor, and additionally performed with simulation on GOLD softwear. Structure activity relationship studies of the candidate compounds were given reasonable inhibitors ent-3 and ent-7k against SARS 3CL R188I mutant protease. These inhibitors showed protease selectivity and no cytotoxicity. PMID:26879854

  18. Synthesis of the proteinase inhibitor LEKTI domain 6 by the fragment condensation method and regioselective disulfide bond formation.

    PubMed

    Vasileiou, Zoe; Barlos, Kostas K; Gatos, Dimitrios; Adermann, Knut; Deraison, Celine; Barlos, Kleomenis

    2010-01-01

    Proteinase inhibitors are of high pharmaceutical interest and are drug candidates for a variety of indications. Specific kallikrein inhibitors are important for their antitumor activity and their potential application to the treatment of skin diseases. In this study we describe the synthesis of domain 6 of the kallikrein inhibitor Lympho-Epithilial Kazal-Type Inhibitor (LEKTI) by the fragment condensation method and site-directed cystine bridge formation. To obtain the linear LEKTI precursor, the condensation was best performed in solution, coupling the protected fragment 1-22 to 23-68. This method yielded LEKTI domain 6 of high purity and equipotent to the recombinantly produced peptide. PMID:20069636

  19. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  20. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.

    1971-01-01

    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  1. Advances in the discovery of N-acylethanolamine acid amidase inhibitors.

    PubMed

    Bandiera, Tiziano; Ponzano, Stefano; Piomelli, Daniele

    2014-08-01

    N-Acylethanolamine acid amidase (NAAA) is a cysteine amidase that hydrolyzes saturated or monounsaturated fatty acid ethanolamides, such as palmitoylethanolamide (PEA) and oleoylethanolamide (OEA). PEA has been shown to exert analgesic and anti-inflammatory effects by engaging peroxisome proliferator-activated receptor-α. Like other fatty acid ethanolamides, PEA is not stored in cells, but produced on demand from cell membrane precursors, and its actions are terminated by intracellular hydrolysis by either fatty acid amide hydrolase or NAAA. Endogenous levels of PEA and OEA have been shown to decrease during inflammation. Modulation of the tissue levels of PEA by inhibition of enzymes responsible for the breakdown of this lipid mediator may represent therefore a new therapeutic strategy for the treatment of pain and inflammation. While a large number of inhibitors of fatty acid amide hydrolase have been discovered, few compounds have been reported to inhibit NAAA activity. Here, we describe the most representative NAAA inhibitors and briefly highlight their pharmacological profile. A recent study has shown that a NAAA inhibitor attenuated heat hyperalgesia and mechanical allodynia caused by local inflammation or nerve damage in animal models of pain and inflammation. This finding encourages further exploration of the pharmacology of NAAA inhibitors. PMID:24798679

  2. The juxtamembrane sequence of the Hepatitis C virus polymerase can affect RNA synthesis and inhibition by allosteric polymerase inhibitors.

    PubMed

    Wen, Y; Lin, X; Fan, B; Ranjith-Kumar, C T; Kao, C C

    2015-08-01

    The Hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp), nonstructural protein 5B (NS5B), is anchored in the membrane through a C-terminal helix. A sequence of ca. 12 residues that connects the catalytically competent portion of the RdRp and the C-terminal helix, the juxtamembrane sequence (JMS), has a poorly defined role in RdRp function in a large part since it is translated from a cis-acting RNA element (CRE) that is essential for HCV replication. Using a HCV replicon that transposed a second copy of CRE to the 3' UTR of the HCV replicon, we demonstrate that amino acid substitutions in the JMS were detrimental for HCV replicon replication. Substitutions in the JMS also resulted in a defect in de novo-initiated RNAs synthesis in vitro and in a cell-based reporter assay. A nonnucleoside inhibitor of the NS5B that binds to the catalytic pocket was less potent in inhibiting NS5B in the presence of JMS mutations. The JMS mutants exhibit reduced stability in thermodenaturation assays, suggesting that the JMS helps confer a more stable conformation to NS5B that could impact RNA synthesis. PMID:25895103

  3. Impacts of lignocellulose-derived inhibitors on L-lactic acid fermentation by Rhizopus oryzae.

    PubMed

    Zhang, Li; Li, Xin; Yong, Qiang; Yang, Shang-Tian; Ouyang, Jia; Yu, Shiyuan

    2016-03-01

    Inhibitors generated in the pretreatment and hydrolysis of corn stover and corn cob were identified. In general, they inhibited cell growth, lactate dehydrogenase, and lactic acid production but with less or no adverse effect on alcohol dehydrogenase and ethanol production in batch fermentation by Rhizopus oryzae. Furfural and 5-hydroxymethyl furfural (HMF) were highly toxic at 0.5-1 g L(-1), while formic and acetic acids at less than 4 g L(-1) and levulinic acid at 10 g L(-1) were not toxic. Among the phenolic compounds at 1 g L(-1), trans-cinnamic acid and syringaldehyde had the highest toxicity while syringic, ferulic and p-coumaric acids were not toxic. Although these inhibitors were present at concentrations much lower than their separately identified toxic levels, lactic acid fermentation with the hydrolysates showed much inferior performance compared to the control without inhibitor, suggesting synergistic or compounded effects of the lignocellulose-degraded compounds on inhibiting lactic acid fermentation. PMID:26724548

  4. Structural Requirements of Histone Deacetylase Inhibitors: SAHA Analogs Modified on the Hydroxamic Acid.

    PubMed

    Bieliauskas, Anton V; Weerasinghe, Sujith V W; Negmeldin, Ahmed T; Pflum, Mary Kay H

    2016-05-01

    Histone deacetylase (HDAC) proteins have emerged as targets for anti-cancer therapeutics, with several inhibitors used in the clinic, including suberoylanilide hydroxamic acid (SAHA, vorinostat). Because SAHA and many other inhibitors target all or most of the 11 human HDAC proteins, the creation of selective inhibitors has been studied intensely. Recently, inhibitors selective for HDAC1 and HDAC2 were reported where selectivity was attributed to interactions between substituents on the metal binding moiety of the inhibitor and residues in the 14-Å internal cavity of the HDAC enzyme structure. Based on this earlier work, we synthesized and tested SAHA analogs with substituents on the hydroxamic acid metal binding moiety. The N-substituted SAHA analogs displayed reduced potency and solubility, but greater selectivity, compared to SAHA. Docking studies suggested that the N-substituent accesses the 14-Å internal cavity to impart preferential inhibition of HDAC1. These studies with N-substituted SAHA analogs are consistent with the strategy exploiting the 14-Å internal cavity of HDAC proteins to create HDAC1/2 selective inhibitors. PMID:27062198

  5. Massive production of farnesol-derived dicarboxylic acids in mice treated with the squalene synthase inhibitor zaragozic acid A.

    PubMed

    Vaidya, S; Bostedor, R; Kurtz, M M; Bergstrom, J D; Bansal, V S

    1998-07-01

    The zaragozic acids are potent inhibitors of squalene synthase. In vivo studies in mice confirmed our earlier observations that inhibition of squalene synthase by zaragozic acid A was accompanied by an increase in the incorporation of label from [3H]mevalonate into farnesyl-diphosphate (FPP)-derived isoprenoic acids (J. D. Bergstrom et al., 1993, Proc. Natl. Acad. Sci. USA 90, 80-84). Farnesyl-diphosphate-derived metabolites appear transiently in the liver. We were unable to detect any farnesol formation in the zaragozic acid-treated animals which indicates that FPP is readily converted to farnesoic acid and dicarboxylic acids in the liver. These metabolites were found to be produced only in the liver and not in the kidney. trans-3,7-Dimethyl-2-octaen-1,8-dioic acid and 3, 7-dimethyloctan-1,8-dioic acid were identified as the major end products of farnesyl-diphosphate metabolism in the urine of mice treated with zaragozic acid A. Quantitative analysis of these FPP-derived dicarboxylic acids by gas-liquid chromatography revealed that approximately 11 mg of total dicarboxylic acids is excreted per day into the urine of a mouse after 3 days of treatment with zaragozic acid A. PMID:9647670

  6. Synthesis and characterization of potent inhibitors of Trypanosoma cruzi dihydrofolate reductase

    SciTech Connect

    Schormann, Norbert; Velu, Sadanandan E.; Murugesan, Srinivasan; Senkovich, Olga; Walker, Kiera; Chenna, Bala C.; Shinkre, Bidhan; Desai, Amar; Chattopadhyay, Debasish

    2010-09-17

    Dihydrofolate reductase (DHFR) of the parasite Trypanosoma cruzi (T. cruzi) is a potential target for developing drugs to treat Chagas disease. We have undertaken a detailed structure-activity study of this enzyme. We report here synthesis and characterization of six potent inhibitors of the parasitic enzyme. Inhibitory activity of each compound was determined against T. cruzi and human DHFR. One of these compounds, ethyl 4-(5-[(2,4-diamino-6-quinazolinyl)methyl]amino-2-methoxyphenoxy)butanoate (6b) was co-crystallized with the bifunctional dihydrofolate reductase-thymidylate synthase enzyme of T. cruzi and the crystal structure of the ternary enzyme:cofactor:inhibitor complex was determined. Molecular docking was used to analyze the potential interactions of all inhibitors with T. cruzi DHFR and human DHFR. Inhibitory activities of these compounds are discussed in the light of enzyme-ligand interactions. Binding affinities of each inhibitor for the respective enzymes were calculated based on the experimental or docked binding mode. An estimated 60-70% of the total binding energy is contributed by the 2,4-diaminoquinazoline scaffold.

  7. New selective carbonic anhydrase IX inhibitors: synthesis and pharmacological evaluation of diarylpyrazole-benzenesulfonamides.

    PubMed

    Rogez-Florent, Tiphaine; Meignan, Samuel; Foulon, Catherine; Six, Perrine; Gros, Abigaëlle; Bal-Mahieu, Christine; Supuran, Claudiu T; Scozzafava, Andrea; Frédérick, Raphaël; Masereel, Bernard; Depreux, Patrick; Lansiaux, Amélie; Goossens, Jean-François; Gluszok, Sébastien; Goossens, Laurence

    2013-03-15

    Carbonic anhydrase (CA) IX expression is increased upon hypoxia and has been proposed as a therapeutic target since it has been associated with poor prognosis, tumor progression and pH regulation. We report the synthesis and the pharmacological evaluation of a new class of human carbonic anhydrase (hCA) inhibitors, 4-(5-aryl-2-hydroxymethyl-pyrazol-1-yl)-benzenesulfonamides. A molecular modeling study was conducted in order to simulate the binding mode of this new family of enzyme inhibitors within the active site of hCA IX. Pharmacological studies revealed high hCA IX inhibitory potency in the parameters nanomolar range. This study showed that the position of sulfonamide group in meta of the 1-phenylpyrazole increase a selectivity hCA IX versus hCA II of our compounds. An in vitro antiproliferative screening has been performed on the breast cancer MDA-MB-231 cell using doxorubicin as cytotoxic agent and in presence of selected CA IX inhibitor. The results shown that the cytotoxic efficiency of doxorubicin in an hypoxic environment, expressed in IC50 value, is restored at 20% level with 1μM CA IX inhibitor. PMID:23168081

  8. Synthesis of Novel Tricyclic Chromenone-Based Inhibitors of IRE-1 RNase Activity

    PubMed Central

    2015-01-01

    Inositol-requiring enzyme 1 (IRE-1) is a kinase/RNase ER stress sensor that is activated in response to excessive accumulation of unfolded proteins, hypoxic conditions, calcium imbalance, and other stress stimuli. Activation of IRE-1 RNase function exerts a cytoprotective effect and has been implicated in the progression of cancer via increased expression of the transcription factor XBP-1s. Here, we describe the synthesis and biological evaluation of novel chromenone-based covalent inhibitors of IRE-1. Preparation of a family of 8-formyltetrahydrochromeno[3,4-c]pyridines was achieved via a Duff formylation that is attended by an unusual cyclization reaction. Biological evaluation in vitro and in whole cells led to the identification of 30 as a potent inhibitor of IRE-1 RNase activity and XBP-1s expression in wild type B cells and human mantle cell lymphoma cell lines. PMID:24749861

  9. Solanocapsine derivatives as potential inhibitors of acetylcholinesterase: Synthesis, molecular docking and biological studies.

    PubMed

    García, Manuela E; Borioni, José L; Cavallaro, Valeria; Puiatti, Marcelo; Pierini, Adriana B; Murray, Ana P; Peñéñory, Alicia B

    2015-12-01

    The investigation of natural products in medicinal chemistry is essential today. In this context, acetylcholinesterase (AChE) inhibitors comprise one type of the compounds most actively studied in the search for an effective treatment of symptoms of Alzheimer's disease. This work describes the isolation of a natural compound, solanocapsine, the preparation of its chemical derivatives, the evaluation of AChE inhibitory activity, and the structure-activity analysis of relevant cases. The influence of structural variations on the inhibitory potency was carefully investigated by modifying different reactive parts of the parent molecule. A theoretical study was also carried out into the binding mode of representative compounds to the enzyme through molecular modeling. The biological properties of the series were investigated. Through this study valuable information was obtained of steroidal alkaloid-type compounds as a starting point for the synthesis of AChE inhibitors. PMID:26362598

  10. Inhibitors of the Hydrolytic Enzyme Dimethylarginine Dimethylaminohydrolase (DDAH): Discovery, Synthesis and Development.

    PubMed

    Murphy, Rhys B; Tommasi, Sara; Lewis, Benjamin C; Mangoni, Arduino A

    2016-01-01

    Dimethylarginine dimethylaminohydrolase (DDAH) is a highly conserved hydrolytic enzyme found in numerous species, including bacteria, rodents, and humans. In humans, the DDAH-1 isoform is known to metabolize endogenous asymmetric dimethylarginine (ADMA) and monomethyl arginine (l-NMMA), with ADMA proposed to be a putative marker of cardiovascular disease. Current literature reports identify the DDAH family of enzymes as a potential therapeutic target in the regulation of nitric oxide (NO) production, mediated via its biochemical interaction with the nitric oxide synthase (NOS) family of enzymes. Increased DDAH expression and NO production have been linked to multiple pathological conditions, specifically, cancer, neurodegenerative disorders, and septic shock. As such, the discovery, chemical synthesis, and development of DDAH inhibitors as potential drug candidates represent a growing field of interest. This review article summarizes the current knowledge on DDAH inhibition and the derived pharmacokinetic parameters of the main DDAH inhibitors reported in the literature. Furthermore, current methods of development and chemical synthetic pathways are discussed. PMID:27187323

  11. Design and synthesis of a new class of cryptophycins based tubulin inhibitors.

    PubMed

    Kumar, Arvind; Kumar, Manjeet; Sharma, Simmi; Guru, Santosh Kumar; Bhushan, Shashi; Shah, Bhahwal Ali

    2015-03-26

    Tubulin binding compounds represent one of the most attractive targets for anticancer drug development. They broadly fall into two categories viz., tubulin polymerization inhibitors, which block microtubule growth and destabilize microtubules like vinca alkaloids and cryptophycins, and the others, which polymerize microtubules into hyperstable forms represented by family of taxanes. In this context, we aimed at design and synthesis of cryptophycins based macrocyclic depsipeptides, which are synthetically more accessible, however have the basic information to target tubulins and establish structure activity relationship (SAR). Thus, a new class of cryptophycins based marocyclic depsipeptides with a truncated epoxide chain were synthesized as potential tubulin inhibitors. The resultant lead analogues 15a and 16a exhibited good anti-cancer activity, induced apoptosis, caused block/delay in cell cycle as well as significantly reduced the expression of α- and β-tubulins. Molecular modelling studies show that 15a and 16a bind in the same domain as that of cryptophycins. PMID:25647428

  12. Phenotypic Screening Identifies Protein Synthesis Inhibitors as H-Ras-Nanocluster-Increasing Tumor Growth Inducers.

    PubMed

    Najumudeen, Arafath K; Posada, Itziar M D; Lectez, Benoit; Zhou, Yong; Landor, Sebastian K-J; Fallarero, Adyary; Vuorela, Pia; Hancock, John; Abankwa, Daniel

    2015-12-15

    Ras isoforms H-, N-, and K-ras are each mutated in specific cancer types at varying frequencies and have different activities in cell fate control. On the plasma membrane, Ras proteins are laterally segregated into isoform-specific nanoscale signaling hubs, termed nanoclusters. As Ras nanoclusters are required for Ras signaling, chemical modulators of nanoclusters represent ideal candidates for the specific modulation of Ras activity in cancer drug development. We therefore conducted a chemical screen with commercial and in-house natural product libraries using a cell-based H-ras-nanoclustering FRET assay. Next to established Ras inhibitors, such as a statin and farnesyl-transferase inhibitor, we surprisingly identified five protein synthesis inhibitors as positive regulators. Using commonly employed cycloheximide as a representative compound, we show that protein synthesis inhibition increased nanoclustering and effector recruitment specifically of active H-ras but not of K-ras. Consistent with these data, cycloheximide treatment activated both Erk and Akt kinases and specifically promoted H-rasG12V-induced, but not K-rasG12V-induced, PC12 cell differentiation. Intriguingly, cycloheximide increased the number of mammospheres, which are enriched for cancer stem cells. Depletion of H-ras in combination with cycloheximide significantly reduced mammosphere formation, suggesting an exquisite synthetic lethality. The potential of cycloheximide to promote tumor cell growth was also reflected in its ability to increase breast cancer cell tumors grown in ovo. These results illustrate the possibility of identifying Ras-isoform-specific modulators using nanocluster-directed screening. They also suggest an unexpected feedback from protein synthesis inhibition to Ras signaling, which might present a vulnerability in certain tumor cell types. PMID:26568031

  13. Rational Design, Synthesis and Evaluation of Coumarin Derivatives as Protein-protein Interaction Inhibitors.

    PubMed

    De Luca, Laura; Agharbaoui, Fatima E; Gitto, Rosaria; Buemi, Maria Rosa; Christ, Frauke; Debyser, Zeger; Ferro, Stefania

    2016-09-01

    Herein we describe the design and synthesis of a new series of coumarin derivatives searching for novel HIV-1 integrase (IN) allosteric inhibitors. All new obtained compounds were tested in order to evaluate their ability to inhibit the interaction between the HIV-1 IN enzyme and the nuclear protein lens epithelium growth factor LEDGF/p75. A combined approach of docking and molecular dynamic simulations has been applied to clarify the activity of the new compounds. Specifically, the binding free energies by using the method of molecular mechanics-generalized Born surface area (MM-GBSA) was calculated, whereas hydrogen bond occupancies were monitored throughout simulations methods. PMID:27546050

  14. Synthesis of novel, peptidic kinase inhibitors with cytostatic/cytotoxic activity.

    PubMed

    Szymanski, Wiktor; Zwolinska, Magdalena; Klossowski, Szymon; Młynarczuk-Biały, Izabela; Biały, Lukasz; Issat, Tadeusz; Malejczyk, Jacek; Ostaszewski, Ryszard

    2014-03-01

    The utility of a novel, chemoenzymatic procedure for the stereocontrolled synthesis of small peptides is presented in the preparation and structure optimisation of dipeptides with cytostatic/cytotoxic activity. The method uses Passerini multicomponent reaction for the preparation of racemic scaffold which is then enantioselectively hydrolysed by hydrolytic enzymes. Products of these transformations are further functionalised towards title compounds. Both activity and selectivity towards tumor cells is optimised. Final compound is shown to be an inhibitor of the protein kinase signaling pathway. PMID:24507826

  15. A Synthesis of a Spirocyclic Macrocyclic Protease Inhibitor for the Treatment of Hepatitis C.

    PubMed

    Chung, Cheol K; Cleator, Ed; Dumas, Aaron M; Hicks, Jacqueline D; Humphrey, Guy R; Maligres, Peter E; Nolting, Andrew F; Rivera, Nelo; Ruck, Rebecca T; Shevlin, Michael

    2016-03-18

    The development of a convergent and highly stereoselective synthesis of an HCV NS3/4a protease inhibitor possessing a unique spirocyclic and macrocyclic architecture is described. A late-stage spirocyclization strategy both enabled rapid structure-activity relationship studies in the drug discovery phase and simultaneously served as the basis for the large scale drug candidate preparation for clinical use. Also reported is the discovery of a novel InCl3-catalyzed carbonyl reduction with household aluminum foil or zinc powder as the terminal reductant. PMID:26950496

  16. Synthesis and evaluation of novel benzylphthalazine derivatives as hedgehog signaling pathway inhibitors.

    PubMed

    Bao, Xiaolong; Peng, Yuanqiu; Lu, Xiuhong; Yang, Jun; Zhao, Weili; Tan, Wenfu; Dong, Xiaochun

    2016-07-01

    We report herein the design and synthesis of a series of novel benzylphthalazine derivatives as hedgehog signaling pathway inhibitors. Gli-luciferase assay demonstrated that changing piperazine ring of Anta XV to different four, five or six-membered heterocyclic building blocks afforded significant influences on Hh pathway inhibition. In particular, compound 10e with piperidin-4-amine moiety was found to possess 12-fold higher Hh inhibitory activities comparing to the lead compound in vitro. In vivo efficacy of 10e in a ptch(+/-)p53(-/-) mouse medulloblastoma allograft model also indicated encouraging results. PMID:27180012

  17. Enantioselective Synthesis and Profiling of Two Novel Diazabicyclooctanone β-Lactamase Inhibitors

    PubMed Central

    2014-01-01

    The enantioselective synthesis of two novel cyclopropane-fused diazabicyclooctanones is reported here. Starting from butadiene monoxide, the key enone intermediate 7 was prepared in six steps. Subsequent stereoselective introduction of the cyclopropane group and further transformation led to compounds 1a and 1b as their corresponding sodium salt. The great disparity regarding their hydrolytic stability was rationalized by the steric interaction between the cyclopropyl methylene and urea carbonyl. These two novel β-lactamase inhibitors were active against class A, C, and D enzymes. PMID:25313328

  18. Growth inhibition of human prostate cells in vitro by novel inhibitors of androgen synthesis.

    PubMed

    Klus, G T; Nakamura, J; Li, J S; Ling, Y Z; Son, C; Kemppainen, J A; Wilson, E M; Brodie, A M

    1996-11-01

    The long-standing strategy for the treatment of metastatic prostate cancer has been to reduce androgenic stimulation of tumor growth by removal of the testes, the primary site of testosterone synthesis. However, a low level of androgenic stimulation may continue, even after castration, by the conversion of adrenal androgens to 5alpha-dihydrotestosterone (DHT) in the prostate tumor cells. Two important enzymes of the androgen biosynthetic pathway are 17alpha-hydroxylase/C17,20-lyase, which regulates an early step in the synthesis of testosterone and other androgens in both the testes and adrenal glands, and 5alpha-reductase, which converts testosterone to the more potent androgen, DHT, in the prostate. We have identified new inhibitors of these enzymes that may be of use in achieving a more complete ablation of androgens in the treatment of metastatic prostate cancer. Three derivatives of androstene were shown to inhibit 17alpha-hydroxylase/C17,20-lyase with potencies 2-20-fold greater than that of ketoconazole, a previously established inhibitor of this enzyme. Derivatives of pregnane and pregnene displayed activities against 5alpha-reductase that were comparable to that of N-(1,1-dimethyl-ethyl)-3-oxo-4-aza-5alpha-androst-1-ene-17beta-car boxamide. All of the 5alpha-reductase inhibitors were able to at least partially inhibit the mitogenic effect of testosterone in either histocultures of human benign prostatic hypertrophic tissue or in cultures of the LNCaP human prostatic tumor cell line. For these compounds, it appears that this inhibition can be attributed to a reduction of DHT synthesis in these cultures, because no inhibitory effect was observed in DHT-treated cultures, and none of the compounds had a cytotoxic effect. Surprisingly, one of the inhibitors of 17alpha-hydroxylase/C17,20-lyase, 17beta-(4-imidazolyl)-5-pregnen-3beta-ol, was also able to inhibit the mitogenic effect of testosterone in both the histoculture and cell culture assays and had an effect

  19. Curcumin Derivatives as Green Corrosion Inhibitors for α-Brass in Nitric Acid Solution

    NASA Astrophysics Data System (ADS)

    Fouda, A. S.; Elattar, K. M.

    2012-11-01

    1,7- Bis-(4-hydroxy-3-methoxy-phenyl)-hepta-1,6-diene-4-arylazo-3,5-dione I-V have been investigated as corrosion inhibitors for α-brass in 2 M nitric acid solution using weight-loss and galvanostatic polarization techniques. The efficiency of the inhibitors increases with the increase in the inhibitor concentration but decreases with a rise in temperature. The conjoint effect of the curcumin derivatives and KSCN has also been studied. The apparent activation energy ( E a*) and other thermodynamic parameters for the corrosion process have also been calculated. The galvanostatic polarization data indicated that the inhibitors were of mixed-type, but the cathode is more polarized than the anode. The slopes of the cathodic and anodic Tafel lines ( b c and b a) are maintained approximately equal for various inhibitor concentrations. However, the value of the Tafel slopes increases together as inhibitor concentration increases. The adsorption of these compounds on α-brass surface has been found to obey the Frumkin's adsorption isotherm. The mechanism of inhibition was discussed in the light of the chemical structure of the undertaken inhibitors.

  20. Action of Protein Synthesis Inhibitors in Blocking Electrogenic H+ Efflux from Corn Roots 12

    PubMed Central

    Chastain, Chris J.; Lafayette, Peter R.; Hanson, John B.

    1981-01-01

    The block in the electrogenic H+ efflux produced by protein synthesis inhibitors in corn root tissue can be released or by-passed by addition of fusicoccin or nigericin. The inhibition also lowers cell potential, and the release repolarizes. Associated with the inhibition of H+ efflux is inhibition of K+ influx and the growth of the root tip; fusicoccin partially relieves these inhibitions, but nigericin does not. The inhibition of H+ efflux which arises from blocking the proton channel of the ATPase by oligomycin or N,N′-dicyclohexylcarbodiimide can also be partially relieved by fusicoccin, but not by nigericin; the inhibition produced by diethylstilbestrol is not relieved by fusicoccin. The results are discussed in terms of the presumed mode of action of fusicoccin on the plasmalemma ATPase. Inhibition of protein synthesis appears to inactivate the proton channel of the ATPase, possibly as the indirect result of disrupted metabolism. Fusicoccin reactivates or bypasses the blocked channel. PMID:16661763

  1. Synthesis and biological evaluation of C(5)-substituted derivatives of leukotriene biosynthesis inhibitor BRP-7.

    PubMed

    Levent, Serkan; Gerstmeier, Jana; Olgaç, Abdurrahman; Nikels, Felix; Garscha, Ulrike; Carotti, Andrea; Macchiarulo, Antonio; Werz, Oliver; Banoglu, Erden; Çalışkan, Burcu

    2016-10-21

    Pharmacological intervention with 5-lipoxygenase (5-LO) pathway leading to suppression of leukotriene (LT) biosynthesis is a clinically validated strategy for treatment of respiratory and cardiovascular diseases such as asthma and atherosclerosis. Here we describe the synthesis of a series of C(5)-substituted analogues of the previously described 5-LO-activating protein (FLAP) inhibitor BRP-7 (IC50 = 0.31 μM) to explore the effects of substitution at the C(5)-benzimidazole (BI) ring as a strategy to increase the potency against FLAP-mediated 5-LO product formation. Incorporation of polar substituents on the C(5) position of the BI core, exemplified by compound 11 with a C(5)-nitrile substituent, significantly enhances the potency for suppression of 5-LO product synthesis in human neutrophils (IC50 = 0.07 μM) and monocytes (IC50 = 0.026 μM). PMID:27423639

  2. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  3. Novel Transthyretin Amyloid Fibril Formation Inhibitors: Synthesis, Biological Evaluation, and X-Ray Structural Analysis

    PubMed Central

    Orlandini, Elisabetta; Ortore, Gabriella; Nencetti, Susanna; Lapucci, Annalina; Rossello, Armando; Freundlich, Joel S.; Sacchettini, James C.

    2009-01-01

    Transthyretin (TTR) is one of thirty non-homologous proteins whose misfolding, dissociation, aggregation, and deposition is linked to human amyloid diseases. Previous studies have identified that TTR amyloidogenesis can be inhibited through stabilization of the native tetramer state by small molecule binding to the thyroid hormone sites of TTR. We have evaluated a new series of β-aminoxypropionic acids (compounds 5–21), with a single aromatic moiety (aryl or fluorenyl) linked through a flexible oxime tether to a carboxylic acid. These compounds are structurally distinct from the native ligand thyroxine and typical halogenated biaryl NSAID-like inhibitors to avoid off-target hormonal or anti-inflammatory activity. Based on an in vitro fibril formation assay, five of these compounds showed significant inhibition of TTR amyloidogenesis, with two fluorenyl compounds displaying inhibitor efficacy comparable to the well-known TTR inhibitor diflunisal. Fluorenyl 15 is the most potent compound in this series and importantly does not show off-target anti-inflammatory activity. Crystal structures of the TTR∶inhibitor complexes, in agreement with molecular docking studies, revealed that the aromatic moiety, linked to the sp2-hybridized oxime carbon, specifically directed the ligand in either a forward or reverse binding mode. Compared to the aryl family members, the bulkier fluorenyl analogs achieved more extensive interactions with the binding pockets of TTR and demonstrated better inhibitory activity in the fibril formation assay. Preliminary optimization efforts are described that focused on replacement of the C-terminal acid in both the aryl and fluorenyl series (compounds 22–32). The compounds presented here constitute a new class of TTR inhibitors that may hold promise in treating amyloid diseases associated with TTR misfolding. PMID:19621084

  4. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  5. Beyond gastric acid reduction: Proton pump inhibitors induce heme oxygenase-1 in gastric and endothelial cells

    SciTech Connect

    Becker, Jan C. . E-mail: beckeja@uni-muenster.de; Grosser, Nina; Waltke, Christian; Schulz, Stephanie; Erdmann, Kati; Domschke, Wolfram; Schroeder, Henning; Pohle, Thorsten

    2006-07-07

    Proton pump inhibitors (PPIs) have been demonstrated to prevent gastric mucosal injury by mechanisms independent of acid inhibition. Here we demonstrate that both omeprazole and lansoprazole protect human gastric epithelial and endothelial cells against oxidative stress. This effect was abrogated in the presence of the heme oxygenase-1 (HO-1) inhibitor ZnBG. Exposure to either PPI resulted in a strong induction of HO-1 expression on mRNA and protein level, and led to an increased activity of this enzyme. Expression of cyclooxygenase isoforms 1 and 2 remained unaffected, and COX-inhibitors did not antagonize HO-1 induction by PPIs. Our results suggest that the antioxidant defense protein HO-1 is a target of PPIs in both endothelial and gastric epithelial cells. HO-1 induction might account for the gastroprotective effects of PPIs independently of acid inhibition, especially in NSAID gastropathy. Moreover, our findings provide additional perspectives for a possible but yet unexplored use of PPIs in vasoprotection.

  6. Trypsin inhibitors from ridged gourd (Luffa acutangula Linn.) seeds: purification, properties, and amino acid sequences.

    PubMed

    Haldar, U C; Saha, S K; Beavis, R C; Sinha, N K

    1996-02-01

    Two trypsin inhibitors, LA-1 and LA-2, have been isolated from ridged gourd (Luffa acutangula Linn.) seeds and purified to homogeneity by gel filtration followed by ion-exchange chromatography. The isoelectric point is at pH 4.55 for LA-1 and at pH 5.85 for LA-2. The Stokes radius of each inhibitor is 11.4 A. The fluorescence emission spectrum of each inhibitor is similar to that of the free tyrosine. The biomolecular rate constant of acrylamide quenching is 1.0 x 10(9) M-1 sec-1 for LA-1 and 0.8 x 10(9) M-1 sec-1 for LA-2 and that of K2HPO4 quenching is 1.6 x 10(11) M-1 sec-1 for LA-1 and 1.2 x 10(11) M-1 sec-1 for LA-2. Analysis of the circular dichroic spectra yields 40% alpha-helix and 60% beta-turn for La-1 and 45% alpha-helix and 55% beta-turn for LA-2. Inhibitors LA-1 and LA-2 consist of 28 and 29 amino acid residues, respectively. They lack threonine, alanine, valine, and tryptophan. Both inhibitors strongly inhibit trypsin by forming enzyme-inhibitor complexes at a molar ratio of unity. A chemical modification study suggests the involvement of arginine of LA-1 and lysine of LA-2 in their reactive sites. The inhibitors are very similar in their amino acid sequences, and show sequence homology with other squash family inhibitors. PMID:8924202

  7. Transinhibition of C1 inhibitor synthesis in type I hereditary angioneurotic edema.

    PubMed Central

    Kramer, J; Rosen, F S; Colten, H R; Rajczy, K; Strunk, R C

    1993-01-01

    To ascertain the mechanism for decreased synthesis of C1 inhibitor (C1 INH) in certain patients with the autosomal dominant disorder hereditary angioneurotic edema, we studied expression of C1 INH in fibroblasts in which the mutant and wild type mRNA and protein could be distinguished because of deletion of exon 7 (delta Ex7). In the HANE delta Ex7 cells, the amount of wild type mRNA (2.1 kb) was expressed at 52 +/- 2% (n = 5) of normal, whereas the mutant mRNA was 17 +/- 1% (n = 5) of normal. Rates of synthesis of both wild type and mutant proteins (11 +/- 3 and 3 +/- 1% of normal, respectively) were lower than predicted from the mRNA levels. There was no evidence of increased C1 INH protein catabolism. These data indicate that there are multiple levels of control of C1 INH synthesis in type I hereditary angioneurotic edema. Pretranslational regulation results in < 50% of the mutant truncated 1.9-kb mRNA. In addition, translational regulation results in decreased synthesis of both wild type and mutatn C1 INH proteins. These data suggest a transinhibition of wild type C1 INH translation by mutant mRNA and/or protein. Images PMID:8450054

  8. Synthesis of N-hydroxycinnamides capped with a naturally occurring moiety as inhibitors of histone deacetylase.

    PubMed

    Huang, Wei-Jan; Chen, Ching-Chow; Chao, Shi-Wei; Lee, Shoei-Sheng; Hsu, Fen-Lin; Lu, Yeh-Lin; Hung, Ming-Fang; Chang, Chung-I

    2010-04-01

    Histone deacetylase (HDAC) inhibitors are regarded as promising therapeutics for the treatment of cancer. All reported HDAC inhibitors contain three pharmacophoric features: a zinc-chelating group, a hydrophobic linker, and a hydrophobic cap for surface recognition. In this study we investigated the effectiveness of osthole, a hydrophobic Chinese herbal compound, as the surface recognition cap in hydroxamate-based compounds as inhibitors of HDAC. Nine novel osthole-based N-hydroxycinnamides were synthesized and screened for enzyme inhibition activity. Compounds 9 d, 9 e, 9 g exhibited inhibitory activities (IC(50)=24.5, 20.0, 19.6 nM) against nuclear HDACs in HeLa cells comparable to that of suberoylanilide hydroxamic acid (SAHA; IC(50)=24.5 nM), a potent inhibitor clinically used for the treatment of cutaneous T-cell lymphoma (CTCL). While compounds 9 d and 9 e showed SAHA-like activity towards HDAC1 and HDAC6, compound 9 g was more selective for HDAC1. Compound 9 d exhibited the best cellular effect, which was comparable to that of SAHA, of enhancing acetylation of either alpha-tubulin or histone H3. Molecular docking analysis showed that the osthole moiety of compound 9 d may interact with the same hydrophobic surface pocket exploited by SAHA and it may be modified to provide class-specific selectivity. These results suggest that osthole is an effective hydrophobic cap when incorporated into N-hydroxycinnamide-derived HDAC inhibitors. PMID:20209563

  9. Synergism of antifungal activity between mitochondrial respiration inhibitors and kojic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Co-application of certain types of compounds with conventional antimicrobial drugs results in the enhancement of efficacy of drugs through a mechanism termed chemosensitization. We show that kojic acid (KA), a natural product, is a potent chemosensitizer to complex III inhibitors of mitochondrial re...

  10. The identification and optimization of 2,4-diketobutyric acids as flap endonuclease 1 inhibitors.

    PubMed

    Tumey, L Nathan; Huck, Bayard; Gleason, Elizabeth; Wang, Jianmin; Silver, Daniel; Brunden, Kurt; Boozer, Sherry; Rundlett, Stephen; Sherf, Bruce; Murphy, Steven; Bailey, Andrew; Dent, Tom; Leventhal, Christina; Harrington, John; Bennani, Youssef L

    2004-10-01

    There have been several recent reports of chemopotentiation via inhibition of DNA repair processes. Flap endonuclease 1 (FEN1) is a key enzyme involved in base excision repair (BER), a primary pathway utilized by mammalian cells to repair DNA damage. In this report, we describe the identification and SAR of a series of 2,4-diketobutyric acid FEN1 inhibitors. PMID:15341951

  11. HALOACETIC ACIDS AND KINASE INHIBITORS PERTURB MOUSE NEURAL CREST CELLS IN VITRO

    EPA Science Inventory

    HUNTER, E.S.1, J. SMITH2, J. ANDREWS1. 1 Reproductive Toxicology Division, NHEERL, US EPA, Research Triangle Park and 2 Department of Cell and Developmental Biology, UNC-CH, Chapel Hill, North Carolina. Haloacetic acids and kinase inhibitors perturb mouse neural crest cells in vi...

  12. Hydroxyindole Carboxylic Acid-Based Inhibitors for Receptor-Type Protein Tyrosine Protein Phosphatase Beta

    PubMed Central

    Zeng, Li-Fan; Zhang, Ruo-Yu; Bai, Yunpeng; Wu, Li; Gunawan, Andrea M.

    2014-01-01

    Abstract Aims: Protein tyrosine phosphatases (PTPs) play an important role in regulating a wide range of cellular processes. Understanding the role of PTPs within these processes has been hampered by a lack of potent and selective PTP inhibitors. Generating potent and selective probes for PTPs remains a significant challenge because of the highly conserved and positively charged PTP active site that also harbors a redox-sensitive Cys residue. Results: We describe a facile method that uses an appropriate hydroxyindole carboxylic acid to anchor the inhibitor to the PTP active site and relies on the secondary binding elements introduced through an amide-focused library to enhance binding affinity for the target PTP and to impart selectivity against off-target phosphatases. Here, we disclose a novel series of hydroxyindole carboxylic acid-based inhibitors for receptor-type tyrosine protein phosphatase beta (RPTPβ), a potential target that is implicated in blood vessel development. The representative RPTPβ inhibitor 8b-1 (L87B44) has an IC50 of 0.38 μM and at least 14-fold selectivity for RPTPβ over a large panel of PTPs. Moreover, 8b-1 also exhibits excellent cellular activity and augments growth factor signaling in HEK293, MDA-MB-468, and human umbilical vein endothelial cells. Innovation: The bicyclic salicylic acid pharmacophore-based focused library approach may provide a potential solution to overcome the bioavailability issue that has plagued the PTP drug discovery field for many years. Conclusion: A novel method is described for the development of bioavailable PTP inhibitors that utilizes bicyclic salicylic acid to anchor the inhibitors to the active site and peripheral site interactions to enhance binding affinity and selectivity. Antioxid. Redox Signal. 20, 2130–2140. PMID:24180557

  13. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  14. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  15. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  16. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  17. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  18. Fatty acid amide hydrolase inhibitors confer anti-invasive and antimetastatic effects on lung cancer cells

    PubMed Central

    Winkler, Katrin; Ramer, Robert; Dithmer, Sophie; Ivanov, Igor; Merkord, Jutta; Hinz, Burkhard

    2016-01-01

    Inhibition of endocannabinoid degradation has been suggested as tool for activation of endogenous tumor defense. One of these strategies lies in blockade of fatty acid amide hydrolase (FAAH) which catalyzes the degradation of endocannabinoids (anandamide [AEA], 2-arachidonoylglycerol [2-AG]) and endocannabinoid-like substances (N-oleoylethanolamine [OEA], N-palmitoylethanolamine [PEA]). This study addressed the impact of two FAAH inhibitors (arachidonoyl serotonin [AA-5HT], URB597) on A549 lung cancer cell metastasis and invasion. LC-MS analyses revealed increased levels of FAAH substrates (AEA, 2-AG, OEA, PEA) in cells incubated with either FAAH inhibitor. In athymic nude mice FAAH inhibitors were shown to elicit a dose-dependent antimetastatic action yielding a 67% and 62% inhibition of metastatic lung nodules following repeated administration of 15 mg/kg AA-5HT and 5 mg/kg URB597, respectively. In vitro, a concentration-dependent anti-invasive action of either FAAH inhibitor was demonstrated, accompanied with upregulation of tissue inhibitor of matrix metalloproteinases-1 (TIMP-1). Using siRNA approaches, a causal link between the TIMP-1-upregulating and anti-invasive action of FAAH inhibitors was confirmed. Moreover, knockdown of FAAH by siRNA was shown to confer decreased cancer cell invasiveness and increased TIMP-1 expression. Inhibitor experiments point toward a role of CB2 and transient receptor potential vanilloid 1 in conferring anti-invasive effects of FAAH inhibitors and FAAH siRNA. Finally, antimetastatic and anti-invasive effects were confirmed for all FAAH substrates with AEA and OEA causing a TIMP-1-dependent anti-invasive action. Collectively, the present study provides first-time proof for an antimetastatic action of FAAH inhibitors. As mechanism of its anti-invasive properties an upregulation of TIMP-1 was identified. PMID:26930716

  19. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.

    PubMed

    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei

    2010-06-01

    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  20. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  1. Strategies for the Total Synthesis of Clavicipitic Acid.

    PubMed

    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori

    2016-04-11

    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  2. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.

    2015-01-01

    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  3. Synthesis and docking studies of 2,4,6-trihydroxy-3-geranylacetophenone analogs as potential lipoxygenase inhibitor.

    PubMed

    Ng, Chean Hui; Rullah, Kamal; Aluwi, Mohd Fadhlizil Fasihi Mohd; Abas, Faridah; Lam, Kok Wai; Ismail, Intan Safinar; Narayanaswamy, Radhakrishnan; Jamaludin, Fadzureena; Shaari, Khozirah

    2014-01-01

    The natural product molecule 2,4,6-trihydroxy-3-geranyl-acetophenone (tHGA) isolated from the medicinal plant Melicope ptelefolia was shown to exhibit potent lipoxygenase (LOX) inhibitory activity. It is known that LOX plays an important role in inflammatory response as it catalyzes the oxidation of unsaturated fatty acids, such as linoleic acid to form hydroperoxides. The search for selective LOX inhibitors may provide new therapeutic approach for inflammatory diseases. Herein, we report the synthesis of tHGA analogs using simple Friedel-Craft acylation and alkylation reactions with the aim of obtaining a better insight into the structure-activity relationships of the compounds. All the synthesized analogs showed potent soybean 15-LOX inhibitory activity in a dose-dependent manner (IC50 = 10.31-27.61 μM) where compound 3e was two-fold more active than tHGA. Molecular docking was then applied to reveal the important binding interactions of compound 3e in soybean 15-LOX binding site. The findings suggest that the presence of longer acyl bearing aliphatic chain (5Cs) and aromatic groups could significantly affect the enzymatic activity. PMID:25100256

  4. Phospholipase C inhibitors and prostaglandins differentially regulate phosphatidylcholine synthesis in rat renal papilla. Evidence of compartmental regulation of CTP:phosphocholine cytidylyltransferase and CDP-choline:1,2-diacylglycerol cholinephosphotransferase.

    PubMed

    Fernández-Tomé, María del Carmen; Speziale, Emir H S; Sterin-Speziale, Norma B

    2002-07-11

    Phosphatidylcholine (PC) is the most abundant phospholipid in mammalian cell membranes. Several lines of evidence support that PC homeostasis is preserved by the equilibrium between PC biosynthetic enzymes and phospholipases catabolic activities. We have previously shown that papillary synthesis of PC depends on prostaglandins (PGs) that modulate biosynthetic enzymes. In papillary tissue, under bradikynin stimulus, arachidonic acid (AA) mobilization (the substrate for PG synthesis) requires a previous phospholipase C (PLC) activation. Thus, in the present work, we study the possible involvement of PLC in PC biosynthesis and its relationship with PG biosynthetic pathway on the maintenance of phospholipid renewal in papillary membranes; we also evaluated the relevance of CDP-choline pathway enzymes compartmentalization. To this end, neomycin, U-73122 and dibutiryl cyclic AMP, reported as PLC inhibitors, were used to study PC synthesis in rat renal papilla. All the PLC inhibitors assayed impaired PC synthesis. PG synthesis was also blocked by PLC inhibitors without affecting cyclooxygenase activity, indicating a metabolic connection between both pathways. However, we found that PC biosynthesis decrease in the presence of PLC inhibitors was not a consequence of PG decreased synthesis, suggesting that basal PLC activity and PGs exert their effect on different targets of PC biosynthetic pathway. The study of PC biosynthetic enzymes showed that PLC inhibitors affect CTP:phosphocholine cytidylyltransferase (CCT) activity while PGD(2) operates on CDP-choline:1,2-diacylglycerol cholinephosphotransferase (CPT), both activities associated to papillary enriched-nuclei fraction. The present results suggest that renal papillary PC synthesis is a highly regulated process under basal conditions. Such regulation might occur at least at two different levels of the CDP-choline pathway: on the one hand, PLC operates on CCT activity; on the other, while PGs regulate CPT activity. PMID

  5. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  6. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  7. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  8. Purification, characterization and biological activity of tulipin, a novel inhibitor of DNA synthesis of plant origin.

    PubMed

    Gasperi-Campani, A; Lorenzoni, E; Abbondanza, A; Perocco, P; Falasca, A I

    1987-01-01

    A DNA synthesis-inhibiting protein (for which the term tulipin is proposed) was isolated from the bulbs of Tulipa sp. The yield ranged from 3.4 to 4.1 per cent of total protein content of the crude extract. Mr, isoelectric point, neutral and amino sugar and amino acid composition were determined. Inhibition of DNA synthesis varied in intact cells according to the cellular types studied, with a minimum ID 50% (concentration giving 50% inhibition) of 400 ng/ml in neuroblastoma cells. The effect was reversible. No effect was obtained in cell-lysate. RNA and protein synthesis were unaffected. The acute toxicity, evaluated in Swiss mice, gave an LD of 6.1 mg/kg body wt. Results of electron microscopy are also given. A second protein, called tulipin 2, has been isolated and partially characterized. PMID:3592627

  9. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John

    2002-01-01

    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  10. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  11. Synthesis and Evaluation of 5-Lipoxygenase Translocation Inhibitors from Acylnitroso Hetero-Diels-Alder Cycloadducts†

    PubMed Central

    Bolger, Joshua K.; Tian, Wen; Wolter, William R.; Cho, Wonhwa; Suckow, Mark A.

    2012-01-01

    Acylnitroso cycloadducts have proven to be valuable intermediates in the syntheses of a plethora of biologically active molecules. Recently, organometallic reagents were shown to open bicyclic acylnitroso cycloadducts and, more interestingly, the prospect of highly regioselective openings was raised. This transformation was employed in the synthesis of a compound with excellent inhibitory activity against 5-lipoxygenase ((±)-4a, IC50 51 nM), an important mediator of inflammation intimately involved in a number of disease states including asthma and cancer. Optimization of the copper-mediated organometallic ring opening reaction was accomplished allowing the further exploration of the biological activity. Synthesis of a number of derivatives with varying affinity for metal binding as well as pendant groups in a range of sizes was accomplished. Analogues were tested in a whole cell assay which revealed a subset of the compounds to be inhibitors of enzyme translocation, a mode of action not previously known and, potentially, extremely important for better understanding of the enzyme and inhibitor development. Additionally, the lead compound was tested in vivo in an established colon cancer model and showed very encouraging anti-tumorogenic properties. PMID:21365098

  12. Laboratory evaluation of five chitin synthesis inhibitors against the colorado potato beetle, Leptinotarsa decemlineata.

    PubMed

    Karimzadeh, R; Hejazi, M J; Rahimzadeh Khoei, F; Moghaddam, M

    2007-01-01

    Results of laboratory experiments are reported that tested the effects of five chitin synthesis inhibitors, diflubenzuron, cyromazine, lufenuron, hexaflumuron and triflumuron. on second instars of the Colorado potato beetle, Leptinotarsa decemlineata (Say) (Coleoptera: Crysomelidae), originally collected from potato fields of Bostanabaad, a town 66 km southeast of Tabriz, Iran. In bioassays, the larvae were fed potato leaves dipped in aqueous solutions containing chitin synthesis inhibitors. The mortalities and abnormalities of the treated larvae were recorded 72 hours after treatments. LC(50) values were 58.6, 69.6, 27.3, 0.79 and 81.4 mg ai/ L for diflubenzuron, cyromazine, lufenuron, hexaflumuron and triflumuron, respectively. Compared with phosalone, which is one of the common insecticides used for controlling this pest in Iran, lufenuron and hexaflumuron seem to be much more potent, and if they perform equally well in the field, they would be suitable candidates to be considered as reduced risk insecticides in management programs for L. decemlineata due to much wider margin of safety for mammals and considerably fewer undesirable environmental side effects. PMID:20345285

  13. Laboratory Evaluation of Five Chitin Synthesis Inhibitors Against the Colorado Potato Beetle, Leptinotarsa decemlineata

    PubMed Central

    Karimzadeh, R.; Hejazi, M. J.; Rahimzadeh Khoei, F.; Moghaddam, M.

    2007-01-01

    Results of laboratory experiments are reported that tested the effects of five chitin synthesis inhibitors, diflubenzuron, cyromazine, lufenuron, hexaflumuron and triflumuron. on second instars of the Colorado potato beetle, Leptinotarsa decemlineata (Say) (Coleoptera: Crysomelidae), originally collected from potato fields of Bostanabaad, a town 66 km southeast of Tabriz, Iran. In bioassays, the larvae were fed potato leaves dipped in aqueous solutions containing chitin synthesis inhibitors. The mortalities and abnormalities of the treated larvae were recorded 72 hours after treatments. LC50 values were 58.6, 69.6, 27.3, 0.79 and 81.4 mg ai/ L for diflubenzuron, cyromazine, lufenuron, hexaflumuron and triflumuron, respectively. Compared with phosalone, which is one of the common insecticides used for controlling this pest in Iran, lufenuron and hexaflumuron seem to be much more potent, and if they perform equally well in the field, they would be suitable candidates to be considered as reduced risk insecticides in management programs for L. decemlineata due to much wider margin of safety for mammals and considerably fewer undesirable environmental side effects. PMID:20345285

  14. Protein synthesis inhibitors attenuate water flow in vasopressin-stimulated toad urinary bladder

    SciTech Connect

    Hoch, B.S.; Ast, M.B.; Fusco, M.J.; Jacoby, M.; Levine, S.D. )

    1988-01-01

    Vasopressin stimulates the introduction of aggregated particles, which may represent pathways for water flow, into the luminal membrane of toad urinary bladder. It is not known whether water transport pathways are degraded on removal from membrane or whether they are recycled. The authors examined the effect of the protein synthesis inhibitors cycloheximide and puromycin using repeated 30-min cycles of vasopressin followed by washout of vasopressin, all in the presence of an osmotic gradient, a protocol that maximizes aggregate turnover. High dose cycloheximide inhibited flow immediately. Low dose cycloheximide did not affect initial flow. In the absence of vasopressin, inhibition did not develop. Despite the inhibition of flow in vasopressin-treated tissues, the cAMP-dependent protein kinase ratio was elevated in cycloheximide-treated tissues, suggesting modulation at a distal site in the stimulatory cascade. ({sup 14}C)urea permeability was not inhibited by cycloheximide. Puromycin also inhibited water flow by the fourth challenge with vasopressin. The data suggest that protein synthesis inhibitors attenuate flow at a site that is distal to cAMP-dependent protein kinase. However, the reversal of inhibition in MIX-treated tissues suggests that the water pathway can be fully manifested given suitable stimulation. They conclude that either large stores of the transport system are available or that the transport system is extensively recycled on retrieval from the membrane.

  15. Structure-Based Design of Non-Natural Amino Acid Inhibitors of Amyloid Fibrillation

    PubMed Central

    Sievers, Stuart A.; Karanicolas, John; Chang, Howard W.; Zhao, Anni; Jiang, Lin; Zirafi, Onofrio; Stevens, Jason T.; Münch, Jan; Baker, David; Eisenberg, David

    2014-01-01

    Many globular and natively disordered proteins can convert into amyloid fibers. These fibers are associated with numerous pathologies1 as well as with normal cellular functions2,3, and frequently form during protein denaturation4,5. Inhibitors of pathological amyloid fibers could serve as leads for therapeutics, provided the inhibitors were specific enough to avoid interfering with normal processes. Here we show that computer-aided, structure-based design can yield highly specific peptide inhibitors of amyloid formation. Using known atomic structures of segments of amyloid fibers as templates, we have designed and characterized an all D-amino acid inhibitor of fibrillation of the tau protein found in Alzheimer’s disease, and a non-natural L-amino acid inhibitor of an amyloid fiber that enhances sexual transmission of HIV. Our results indicate that peptides from structure-based designs can disrupt the fibrillation of full-length proteins, including those like tau that lack fully ordered native structures. PMID:21677644

  16. Structure-based design of non-natural amino-acid inhibitors of amyloid fibril formation

    SciTech Connect

    Sievers, Stuart A.; Karanicolas, John; Chang, Howard W.; Zhao, Anni; Jiang, Lin; Zirafi, Onofrio; Stevens, Jason T.; Münch, Jan; Baker, David; Eisenberg, David

    2011-09-20

    Many globular and natively disordered proteins can convert into amyloid fibrils. These fibrils are associated with numerous pathologies as well as with normal cellular functions, and frequently form during protein denaturation. Inhibitors of pathological amyloid fibril formation could be useful in the development of therapeutics, provided that the inhibitors were specific enough to avoid interfering with normal processes. Here we show that computer-aided, structure-based design can yield highly specific peptide inhibitors of amyloid formation. Using known atomic structures of segments of amyloid fibrils as templates, we have designed and characterized an all-D-amino-acid inhibitor of the fibril formation of the tau protein associated with Alzheimer's disease, and a non-natural L-amino-acid inhibitor of an amyloid fibril that enhances sexual transmission of human immunodeficiency virus. Our results indicate that peptides from structure-based designs can disrupt the fibril formation of full-length proteins, including those, such as tau protein, that lack fully ordered native structures. Because the inhibiting peptides have been designed on structures of dual-{beta}-sheet 'steric zippers', the successful inhibition of amyloid fibril formation strengthens the hypothesis that amyloid spines contain steric zippers.

  17. Peroxisomal fatty acid oxidation and inhibitors of the mitochondrial carnitine palmitoyltransferase I in isolated rat hepatocytes.

    PubMed Central

    Skorin, C; Necochea, C; Johow, V; Soto, U; Grau, A M; Bremer, J; Leighton, F

    1992-01-01

    Fatty acid oxidation was studied in the presence of inhibitors of carnitine palmitoyltransferase I (CPT I), in normal and in peroxisome-proliferated rat hepatocytes. The oxidation decreased in mitochondria, as expected, but in peroxisomes it increased. These two effects were seen, in variable proportions, with (+)-decanoylcarnitine, 2-tetradecylglycidic acid (TDGA) and etomoxir. The decrease in mitochondrial oxidation (ketogenesis) affected saturated fatty acids with 12 or more carbon atoms, whereas the increase in peroxisomal oxidation (H2O2 production) affected saturated fatty acids with 8 or more carbon atoms. The peroxisomal increase was sensitive to chlorpromazine, a peroxisomal inhibitor. To study possible mechanisms, palmitoyl-, octanoyl- and acetyl-carnitine acyltransferase activities were measured, in homogenates and in subcellular fractions from control and TDGA-treated cells. The palmitoylcarnitine acyltransferase was inhibited, as expected, but the octanoyltransferase activity also decreased. The CoA derivative of TDGA was synthesized and tentatively identified as being responsible for inhibition of the octanoylcarnitine acyltransferase. These results show that inhibitors of the mitochondrial CPT I may also inhibit the peroxisomal octanoyl transferase; they also support the hypothesis that the octanoyltransferase has the capacity to control or regulate peroxisomal fatty acid oxidation. PMID:1736904

  18. Fatty Acid Synthase Inhibitor C75 Ameliorates Experimental Colitis

    PubMed Central

    Matsuo, Shingo; Yang, Weng-Lang; Aziz, Monowar; Kameoka, Shingo; Wang, Ping

    2014-01-01

    Abnormalities of lipid metabolism through overexpression of fatty acid synthase (FASN), which catalyzes the formation of long-chain fatty acids, are associated with the development of inflammatory bowel disease (IBD). C75 is a synthetic α-methylene-γ-butyrolactone compound that inhibits FASN activity. We hypothesized that C75 treatment could effectively reduce the severity of experimental colitis. Male C57BL/6 mice were fed 4% dextran sodium sulfate (DSS) for 7 d. C75 (5 mg/kg body weight) or dimethyl sulfoxide (DMSO) (vehicle) was administered intraperitoneally from d 2 to 6. Clinical parameters were monitored daily. Mice were euthanized on d 8 for histological evaluation and measurements of colon length, chemokine, cytokine and inflammatory mediator expression. C75 significantly reduced body weight loss from 23% to 15% on d 8, compared with the vehicle group. The fecal bleeding, diarrhea and colon histological damage scores in the C75-treated group were significantly lower than scores in the vehicle animals. Colon shortening was significantly improved after C75 treatment. C75 protected colon tissues from DSS-induced apoptosis by inhibiting caspase-3 activity. Macrophage inflammatory protein 2, keratinocyte-derived chemokine, myeloperoxidase activity and proinflammatory cytokines (tumor necrosis factor-α, interleukin [IL]-1β and IL-6) in the colon were significantly downregulated in the C75-treated group, compared with the vehicle group. Treatment with C75 in colitis mice inhibited the elevation of FASN, cyclooxygenase-2 and inducible nitric oxide synthase expression as well as IκB degradation in colon tissues. C75 administration alleviates the severity of colon damage and inhibits the activation of inflammatory pathways in DSS-induced colitis. Thus, inhibition of FASN may represent an attractive therapeutic potential for treating IBD. PMID:24306512

  19. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.

    PubMed

    Lem, N W; Stumpf, P K

    1984-01-01

    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  20. Discovery and molecular basis of potent noncovalent inhibitors of fatty acid amide hydrolase (FAAH)

    PubMed Central

    Min, Xiaoshan; Thibault, Stephen T.; Porter, Amy C.; Gustin, Darin J.; Carlson, Timothy J.; Xu, Haoda; Lindstrom, Michelle; Xu, Guifen; Uyeda, Craig; Ma, Zhihua; Li, Yihong; Kayser, Frank; Walker, Nigel P. C.; Wang, Zhulun

    2011-01-01

    Fatty acid amide hydrolase (FAAH), an amidase-signature family member, is an integral membrane enzyme that degrades lipid amides including the endogenous cannabinoid anandamide and the sleep-inducing molecule oleamide. Both genetic knock out and pharmacological administration of FAAH inhibitors in rodent models result in analgesic, anxiolytic, and antiinflammatory phenotypes. Targeting FAAH activity, therefore, presents a promising new therapeutic strategy for the treatment of pain and other neurological-related or inflammatory disorders. Nearly all FAAH inhibitors known to date attain their binding potency through a reversible or irreversible covalent modification of the nucleophile Ser241 in the unusual Ser-Ser-Lys catalytic triad. Here, we report the discovery and mechanism of action of a series of ketobenzimidazoles as unique and potent noncovalent FAAH inhibitors. Compound 2, a representative of these ketobenzimidazoles, was designed from a series of ureas that were identified from high-throughput screening. While urea compound 1 is characterized as an irreversible covalent inhibitor, the cocrystal structure of FAAH complexed with compound 2 reveals that these ketobenzimidazoles, though containing a carbonyl moiety, do not covalently modify Ser241. These inhibitors achieve potent inhibition of FAAH activity primarily from shape complementarity to the active site and through numerous hydrophobic interactions. These noncovalent compounds exhibit excellent selectivity and good pharmacokinetic properties. The discovery of this distinctive class of inhibitors opens a new avenue for modulating FAAH activity through nonmechanism-based inhibition. PMID:21502526

  1. Structure–Activity Relationships of α-Keto Oxazole Inhibitors of Fatty Acid Amide Hydrolase

    PubMed Central

    Hardouin, Christophe; Kelso, Michael J.; Romero, F. Anthony; Rayl, Thomas J.; Leung, Donmienne; Hwang, Inkyu; Cravatt, Benjamin F.; Boger, Dale L.

    2008-01-01

    A systematic study of the structure–activity relationships (SAR) of 2b (OL-135), a potent inhibitor of fatty acid amide hydrolase (FAAH), is detailed targeting the C2 acyl side chain. A series of aryl replacements or substituents for the terminal phenyl group provided effective inhibitors (e.g., 5c, aryl = 1-napthyl, Ki = 2.6 nM) with 5hh (aryl = 3-Cl-Ph, Ki = 900 pM) being 5-fold more potent than 2b. Conformationally-restricted C2 side chains were examined and many provided exceptionally potent inhibitors of which 11j (ethylbiphenyl side chain) was established to be a 750 pM inhibitor. A systematic series of heteroatoms (O, NMe, S), electron-withdrawing groups (SO, SO2), and amides positioned within and hydroxyl substitutions on the linking side chain were investigated which typically led to a loss in potency. The most tolerant positions provided effective inhibitors (12p, 6-position S, Ki = 3 nM or 13d, 2-position OH, Ki = 8 nM) comparable in potency to 2b. Proteomic-wide screening of selected inhibitors from the systematic series of >100 candidates prepared revealed that they are selective for FAAH over all other mammalian serine proteases. PMID:17559203

  2. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2014-05-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  3. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2008-09-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  4. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  5. Cathepsin D-mediated yolk protein degradation is blocked by acid phosphatase inhibitors.

    PubMed

    Fialho, Eliane; Nakamura, Angelica; Juliano, Luiz; Masuda, Hatisaburo; Silva-Neto, Mário A C

    2005-04-15

    Vitellin (VT) is a lipoglycophosphoprotein stored inside the eggs of every oviparous organism during oogenesis. In the blood-sucking bug Rhodnius prolixus, VT is deposited inside growing oocytes together with two acid hydrolases: acid phosphatase (AP) and cathepsin D (CD). Egg fertilization triggers AP activity and VT proteolysis in vivo [Insect Biochem. Mol. Biol. 2002 (32) 847]. Here, we show that CD is the main protease targeting VT proteolysis during egg development. CD activity in total egg homogenates is blocked by the classical aspartyl protease inhibitor, pepstatin A. Surprisingly, AP inhibitors such as NaF, Na+/K+ tartrate, and inorganic phosphate also block VT proteolysis, whereas this effect is not observed when tyrosine phosphatase inhibitors such as vanadate and phenylarsine oxide or an inhibitor of alkaline phosphatases such as levamisole are used in a VT proteolysis assay. NaF concentrations that block isolated AP activity do not affect the activity of partially purified CD. Therefore, a specific repressor of VT proteolysis must be dephosphorylated by AP in vivo. In conclusion, these results demonstrate for the first time that acid hydrolases act cooperatively to promote yolk degradation during egg development in arthropods. PMID:15797237

  6. Synthesis of novel fluorocarbocyclic nucleosides and nucleotides as potential inhibitors of human immunodeficiency virus

    SciTech Connect

    Hilpert, H.

    1989-01-01

    3[prime]-Azido-3[prime]-deoxythymidine (AZT) and 2[prime], 3[prime]-dideoxycytidine (DDC) are potent in vivo inhibitors of human immunodeficiency virus. Due to their short half-life in the body and undesired side-effects compounds with improved bioavailability were designed. A feature of these analogues was the replacement of the heterocyclic oxygen atom by an isosteric CHF-group thus stabilizing the labile glycosidic bond against metabolic breakdown. A versatile and short synthesis, starting from ketone, serves to construct the highly functionalized and protected key intermediates. These ([alpha]- and [beta]-fluoro epimeric) intermediates were elaborated to eight fluorocarbocyclic nucleoside analogues linked with a thymine base, an adenine base, and a guanine base. An attempt was made to prepare analogues of the potent HIV inhibitor carbovir c. The unexpected oxidation of the double bond of compound d, instead of the desired Baeyer-Villiger ring-expansion, meant that the synthetic scheme was redundant. A second total synthesis involves the preparation of the three fluorocarbocyclic phosphonates. These analogues possess additionally a P-C linkage which should markedly enhance the stability of the side chain. To perform enzyme inhibition tests, three analogues were chemically activated to the biologically active triphosphates. Inhibition tests on HIV associated reverse transcriptase confirmed the high activity of one of the AZT triphosphates. The fluorocarbocyclic counterpart was two orders of magnitude less active. A fluorocarbocyclic phosphonate was twice as active as the AZT triphosphate. Neither the eight nucleoside analogues nor the three phosphonates displayed significant activity against HIV infected cells. Crystallographic data of two fluorocarbocyclic nucleosides, two potent HIV inhibitors, and some 20 examples of 2[prime]-deoxyribonucleosides have been compared.

  7. In vivo protection against soman toxicity by known inhibitors of acetylcholine synthesis in vitro.

    PubMed

    Sterling, G H; Doukas, P H; Sheldon, R J; O'Neill, J J

    1988-02-01

    Soman inhibits the enzyme acetylcholinesterase, essentially irreversibly, producing an accumulation of acetylcholine (ACh) which is responsible for many of its toxic effects. Current approaches to treatment include: (1) atropine, a muscarinic receptor blocker; (2) pyridine-2-aldoxime methylchloride (2-PAM), an enzyme reactivator; and (3) carbamate protection of the enzyme. However, no fully satisfactory regimen has been found, primarily because of the rapid aging process. In this study, compounds known to inhibit ACh synthesis in vitro were evaluated in combination with atropine and 2-PAM so as to assess their potential utility in protection against soman toxicity in rats. Acetylsecohemicholinium (100 micrograms/kg, i.c.v.t., 30 min prior to soman), an inhibitor of high affinity choline uptake (HAChU) and cholineacetyltransferase (ChAT) activity in vitro, enhanced the protective effects of atropine and 2-PAM, reducing the mortality within the first 2 hr following soman. N-Hydroxyethylnaphthylvinylpyridine (NHENVP), a quaternary ChAT inhibitor (1.7 mumol/kg, i.m.), significantly reduced the overall percent mortality due to soman from 80% to 20%. The compound was most effective when administered 2-3 min prior to soman and was effective only by the intramuscular route. N-Allyl-3-quinuclidinol, a potent HAChU inhibitor (1 mumol/kg, i.m.) was the most effective quinuclidine analog evaluated, also reducing the percent mortality for a 24-hr period. Unlike NHENVP, it was most effective when given 30-60 min prior to soman. It is suggested from the data that compounds that disrupt presynaptic ACh synthesis in vitro may prove effective in treating organophosphate poisoning. The results demonstrate interesting differences among the compounds studied and provide insight for the design of protectants against soman toxicity. These findings further underscore the need to examine the structure activity and pharmacokinetic properties of these compounds, i.e. comparison of routes of

  8. Design, Synthesis, and Protein Crystallography of Biaryltriazoles as Potent Tautomerase Inhibitors of Macrophage Migration Inhibitory Factor

    PubMed Central

    Dziedzic, Pawel; Cisneros, José A.; Robertson, Michael J.; Hare, Alissa A.; Danford, Nadia E.; Baxter, Richard H. G.; Jorgensen, William L.

    2015-01-01

    Optimization is reported for biaryltriazoles as inhibitors of the tautomerase activity of human macrophage migration inhibitory factor (MIF), a proinflammatory cytokine associated with numerous inflammatory diseases and cancer. A combined approach was taken featuring organic synthesis, enzymatic assaying, crystallography, and modeling including free-energy perturbation (FEP) calculations. X-ray crystal structures for 3a and 3b bound to MIF are reported and provided a basis for the modeling efforts. The accommodation of the inhibitors in the binding site is striking with multiple hydrogen bonds and aryl–aryl interactions. Additional modeling encouraged pursuit of 5-phenoxyquinolinyl analogues, which led to the very potent compound 3s. Activity was further enhanced by addition of a fluorine atom adjacent to the phenolic hydroxyl group as in 3w, 3z, 3aa, and 3bb to strengthen a key hydrogen bond. It is also shown that physical properties of the compounds can be modulated by variation of solvent-exposed substituents. Several of the compounds are likely the most potent known MIF tautomerase inhibitors; the most active ones are more than 1000-fold more active than the well-studied (R)-ISO-1 and more than 200-fold more active than the chromen-4-one Orita-13. PMID:25697265

  9. A review on ROCK-II inhibitors: From molecular modelling to synthesis.

    PubMed

    Shah, Surmil; Savjani, Jignasa

    2016-05-15

    Rho kinase enzyme expressed in different disease conditions and involved in mediating vasoconstriction and vascular remodeling in the pathogenesis. There are two isoforms of Rho kinases, namely ROCK I and ROCK II, responsible for different physiological function due to difference in distribution, but almost similar in structure. The Rho kinase 2 belongs to AGC family and is widely distributed in brain, heart and muscles. It is responsible for contraction of vascular smooth muscles by calcium sensitization. Its defective and unwanted expression can lead to many medical conditions like multiple sclerosis, myocardial ischemia, inflammatory responses, etc. Many Rho kinase 1 and 2 inhibitors have been designed for Rho/Rho kinase pathway by use of molecular modeling studies. Most of the designed compounds have been modeled based on ROCK 1 enzyme. This article is focused on Rho kinase 2 inhibitors as there are many ways to improvise by use of Computer aided drug designing as very less quantum of research work carried out. Herein, the article highlights different stages of designing like docking, SAR and synthesis of ROCK inhibitors and recent advances. It also highlights future prospective to improve the activity. PMID:27080184

  10. In silico design, synthesis, and screening of novel deoxyhypusine synthase inhibitors targeting HIV-1 replication.

    PubMed

    Schroeder, Marcus; Kolodzik, Adrian; Pfaff, Katharina; Priyadarshini, Poornima; Krepstakies, Marcel; Hauber, Joachim; Rarey, Matthias; Meier, Chris

    2014-05-01

    The human enzyme deoxyhypusine synthase (DHS) is an important host cell factor that participates in the post-translational hypusine modification of eukaryotic initiation factor 5A (eIF-5A). Hypusine-modified eIF-5A plays a role in a number of diseases, including HIV infection/AIDS. Thus, DHS represents a novel and attractive drug target. So far, four crystal structures are available, and various substances have been tested for inhibition of human DHS. Among these inhibitors, N-1-guanyl-1,7-diaminoheptane (GC7) has been co-crystallized in the active site of DHS. However, despite its potency, GC7 is not selective enough to be used in drug applications. Therefore, new compounds that target DHS are needed. Herein we report the in silico design, chemical synthesis, and biological evaluation of new DHS inhibitors. One of these inhibitors showed dose-dependent inhibition of DHS in vitro, as well as suppression of HIV replication in cell cultures. Furthermore, the compound exhibited no cytotoxic effects at active concentrations. Thus, this designed compound demonstrated proof of principle and represents a promising starting point for the development of new drug candidates to specifically interfere with DHS activity. PMID:24616161

  11. The Design, Synthesis and Structure-Activity Relationship of Mixed Serotonin, Norepinephrine and Dopamine Uptake Inhibitors

    NASA Astrophysics Data System (ADS)

    Chen, Zhengming; Yang, Ji; Skolnick, Phil

    The evolution of antidepressants over the past four decades has involved the replacement of drugs with a multiplicity of effects (e.g., TCAs) by those with selective actions (i.e., SSRIs). This strategy was employed to reduce the adverse effects of TCAs, largely by eliminating interactions with certain neurotransmitters or receptors. Although these more selective compounds may be better tolerated by patients, selective drugs, specifically SSRIs, are not superior to older drugs in treating depressed patients as measured by response and remission rates. It may be an advantage to increase synaptic levels of both serotonin and norepinephrine, as in the case of dual uptake inhibitors like duloxetine and venlafaxine. An important recent development has been the emergence of the triple-uptake inhibitors (TUIs/SNDRIs), which inhibit the uptake of the three neurotransmitters most closely linked to depression: serotonin, norepinephrine, and dopamine. Preclinical studies and clinical trials indicate that a drug inhibiting the reuptake of all three of these neurotransmitters could produce more rapid onset of action and greater efficacy than traditional antidepressants. This review will detail the medicinal chemistry involved in the design, synthesis and discovery of mixed serotonin, norepinephrine and dopamine transporter uptake inhibitors.

  12. Identification of new quinic acid derivatives as histone deacetylase inhibitors by fluorescence-based cellular assay.

    PubMed

    Son, Dohyun; Kim, Chung Sub; Lee, Kang Ro; Park, Hyun-Ju

    2016-05-01

    A fluorescence-based cellular assay system was established to identify potential epigenetic modulator ligands. This assay method is to detect the de-repression of an EGFP reporter in cancer cells by the treatment of HDAC (histone deacetylase) or DNMT (DNA methyltransferase) inhibitor. Using this system, we conducted a preliminary screening of in-house natural product library containing extracts and pure compounds, and identified several active compounds. Among them, novel quinic acid derivatives were recognized as excellent HDAC inhibitors by both enzymatic and cell-based HDAC assays. PMID:26996372

  13. Triacontanol negatively modulates the jasmonic acid-stimulated proteinase inhibitors in tomato (Lycopersicon esculentum).

    PubMed

    Ramanarayan, Krishnamurthy; Swamy, Gangadharamurthy Sivakumar

    2004-04-01

    Triacontanol (TRIA), a long chain aliphatic alcohol (C30H61OH) reverses the effect of jasmonic acid (JA) in inducing proteinase inhibitors (PIs) in tomato leaves. Porcine pancreas trypsin and Spodoptera litura gut proteinases were inhibited in the presence of leaf proteins treated with JA, and TRIA partially reverses this effect. Spodoptera litura larvae fed with tomato leaves treated with JA were reduced in body weight and TRIA is able to partially reverse this JA-induced effect. These results reflect the partial reversal effect of TRIA in down regulating the JA-induced production of proteinase inhibitors. PMID:15128037

  14. 3-Cyano-3-aza-β-amino Acid Derivatives as Inhibitors of Human Cysteine Cathepsins

    PubMed Central

    2014-01-01

    Nitrile-type inhibitors are known to interact with cysteine proteases in a covalent-reversible manner. The chemotype of 3-cyano-3-aza-β-amino acid derivatives was designed in which the N-cyano group is centrally arranged in the molecule to allow for interactions with the nonprimed and primed binding regions of the target enzymes. These compounds were evaluated as inhibitors of the human cysteine cathepsins K, S, B, and L. They exhibited slow-binding behavior and were found to be exceptionally potent, in particular toward cathepsin K, with second-order rate constants up to 52 900 × 103 M–1 s–1. PMID:25313316

  15. Ascorbic acid intake and oxalate synthesis.

    PubMed

    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P

    2016-08-01

    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  16. Resistance of horse alpha 1-proteinase inhibitor to perchloric acid denaturation and a simplified purification procedure resulting therefrom.

    PubMed

    Pellegrini, A; Hägeli, G; von Fellenberg, R

    1986-11-21

    Addition of perchloric acid (6.4% w/v final concentration) to horse alpha 1-proteinase inhibitor or to horse plasma neither precipitated nor inactivated alpha 1-proteinase inhibitor. None of the isoinhibitors of alpha 1-proteinase inhibitor was altered by dilute perchloric acid. This unexpected behavior led to a simplified procedure for the purification of horse alpha 1-proteinase inhibitor, consisting of removal of the bulk of plasma proteins, by perchloric acid precipitation and by gel filtration on Sephadex G-75 and G-200. The resulting preparations of alpha 1-proteinase inhibitor were immunogenically pure. The simplified purification procedure permitted the immunochemical comparison of the isoinhibitors of alpha 1-proteinase inhibitor, which proved to be immunologically identical. PMID:3022814

  17. Interference of L-α-aminoocy-β-phenylpropionic acid with cold-induced sphagnorubin synthesis in Sphagnum magellanicum BRID.

    PubMed

    Tutschek, R

    1982-08-01

    The ability of the phenylalanine ammonia-lyase (PAL)-inhibitor L-α-aminooxy-β-phenyl-propionic acid (AOPP) to suppress the synthesis of the main reddish-violet wall pigment of Sphagnum magellanicum (sphagnorubin) was investigated. Fifty percent inhibition is achieved with 14 μM AOPP in mosses stimulated to intensive coloring by sugar feeding. AOPP does not affect the content of free amino acids, except for phenylalanine, during cold-induced sphagnorubin synthesis. AOPP dramatically amplifies the increase in extractable PAL activity in response to cold treatment. Phenylalanine applied in vivo causes an eminent increase in PAL activity, above the level of the cold-treated mosses. The results from the feeding experiments are discussed in connection with a possible end-product repression in PAL activity with sphagnorubin-synthesizing mosses. These results are correspond best to the theory that the enzyme level is regulated independently from a mechanism of feedback repression. PMID:24271864

  18. Thiadiazole Carbamates: Potent Inhibitors of Lysosomal Acid Lipase and Potential Niemann-Pick Type C Disease Therapeuticsa

    PubMed Central

    Rosenbaum, Anton I.; Cosner, Casey C.; Mariani, Christopher J.; Maxfield, Frederick R.; Wiest, Olaf; Helquist, Paul

    2010-01-01

    Niemann-Pick type C (NPC) disease is a lysosomal storage disorder characterized at the cellular level by abnormal accumulation of cholesterol and other lipids in lysosomal storage organelles. Lysosomal acid lipase (LAL) has been recently identified as a potential therapeutic target for NPC. LAL can be specifically inhibited by a variety of 3,4-disubstituted thiadiazole carbamates. An efficient synthesis of the C(3) oxygenated/C(4) aminated analogues has been developed that furnishes the products in high yields and high degrees of purity. Common intermediates can also be used for the synthesis of the C(3) carbon substituted derivatives. Herein we tested various thiadiazole carbamates, amides, esters, and ketones for inhibition of LAL. In addition, we tested a diverse selection of commercially available non-thiadiazole carbamates. Our studies show that, among the compounds examined herein, only thiadiazole carbamates are effective inhibitors of LAL. We present a mechanism for LAL inhibition by these compounds whereby LAL transiently carbamoylates the enzyme similarly to previously described inhibition of acetylcholinesterase by rivastigmine and other carbamates as well as acylation of various lipases by orlistat. PMID:20557099

  19. A dual inhibitor of cyclooxygenase and 5-lipoxygenase protects against kainic acid-induced brain injury.

    PubMed

    Minutoli, Letteria; Marini, Herbert; Rinaldi, Mariagrazia; Bitto, Alessandra; Irrera, Natasha; Pizzino, Gabriele; Pallio, Giovanni; Calò, Margherita; Adamo, Elena Bianca; Trichilo, Vincenzo; Interdonato, Monica; Galfo, Federica; Squadrito, Francesco; Altavilla, Domenica

    2015-06-01

    Systemic administration of kainic acid causes inflammation and apoptosis in the brain, resulting in neuronal loss. Dual cyclooxygenase/5-lipoxygenase (COX/5-LOX) inhibitors could represent a possible neuroprotective approach in preventing glutamate excitotoxicity. Consequently, we investigated the effects of a dual inhibitor of COX/5-LOX following intraperitoneal administration of kainic acid (KA, 10 mg/kg) in rats. Animals were randomized to receive either the dual inhibitor of COX/5-LOX (flavocoxid, 20 mg/kg i.p.) or its vehicle (1 ml/kg i.p.) 30 min after KA administration. Sham brain injury rats were used as controls. We evaluated protein expression of phosphorylated extracellular signal-regulated kinase (p-ERK1/2) and tumor necrosis factor alpha (TNF-α) as well as levels of malondialdehyde (MDA), prostaglandin E2 (PGE2) and leukotriene B4 (LTB4) in the hippocampus. Animals were also observed for monitoring behavioral changes according to Racine Scale. Finally, histological analysis and brain edema evaluation were carried out. Treatment with the dual inhibitor of COX/5-LOX decreased protein expression of p-ERK1/2 and TNF-α in hippocampus, markedly reduced MDA, LTB4 and PGE2 hippocampal levels, and also ameliorated brain edema. Histological analysis showed a reduction in cell damage in rats treated with the dual inhibitor of COX/5-LOX, particularly in hippocampal subregion CA3c. Moreover, flavocoxid significantly improved behavioral signs following kainic acid administration. Our results suggest that dual inhibition of COX/5-LOX by flavocoxid has neuroprotective effects during kainic acid-induced excitotoxicity. PMID:25893744

  20. Formation of 10-Formylfolic Acid, a Potent Inhibitor of Dihydrofolate Reductase, in Rat Liver Slices Incubated with Folic Acid

    PubMed Central

    d'Urso-Scott, M.; Uhoch, J.; Bertino, J. R.

    1974-01-01

    During investigation of folate polyglutamate biosynthesis in rat liver slices utilizing [2-14C]folic acid, a folate compound that behaved like a polyglutamate form in the Sephadex G-15 gel filtration system was found to accumulate. Subsequent chromatographic, spectral, chemical, and enzymic studies have indicated that the compound formed in liver slices incubated with [14C]folic acid with and without methotrexate was 10-formyl folate. This folate is of interest in that it is the most potent natural inhibitor of dihydrofolate reductase known and may be capable of serving a regulatory function within the cell. PMID:4527808

  1. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  2. Design, synthesis, and biological evaluation of pyrazinones containing novel P1 needles as inhibitors of TF/VIIa.

    PubMed

    Trujillo, John I; Huang, Horng-Chih; Neumann, William L; Mahoney, Matthew W; Long, Scott; Huang, Wei; Garland, Danny J; Kusturin, Carrie; Abbas, Zaheer; South, Michael S; Reitz, David B

    2007-08-15

    Herein is described the design, synthesis, and enzymatic activity of a series of substituted pyrazinones as inhibitors of the TF/VIIa complex. These inhibitors were designed to explore replacement and variation of the P1 amidine described previously [J. Med. Chem.2003, 46, 4050]. The P1 needle replacements were selected based upon their reduced basicity compared to the parent phenyl amidine (pKa approximately 12). A contributing factor towards the oral bioavailability of a compound is the ionization state of the compound in the intestinal tract. The desired outcome of the study was to identify an orally bioavailable TF-VIIa inhibitor. PMID:17566736

  3. Circadian control of bile acid synthesis by a KLF15-Fgf15 axis

    PubMed Central

    Han, Sean (Shuxin); Zhang, Rongli; Jain, Rajan; Shi, Hong; Zhang, Lilei; Zhou, Guangjin; Sangwung, Panjamaporn; Tugal, Derin; Atkins, G. Brandon; Prosdocimo, Domenick A.; Lu, Yuan; Han, Xiaonan; Tso, Patrick; Liao, Xudong; Epstein, Jonathan A.; Jain, Mukesh K.

    2015-01-01

    Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15 signalling axis that regulates circadian BA production. Systemic Klf15 deficiency disrupted circadian expression of key BA synthetic enzymes, tissue BA levels and triglyceride/cholesterol absorption. Studies in liver-specific Klf15-knockout mice suggested a non-hepatic basis for regulation of BA production. Ileal Fgf15 is a potent inhibitor of BA synthesis. Using a combination of biochemical, molecular and functional assays (including ileectomy and bile duct catheterization), we identify KLF15 as the first endogenous negative regulator of circadian Fgf15 expression. Elucidation of this novel pathway controlling circadian BA production has important implications for physiologic control of nutrient availability and metabolic homeostasis. PMID:26040986

  4. Identification of ellagic acid as potent inhibitor of protein kinase CK2: a successful example of a virtual screening application.

    PubMed

    Cozza, Giorgio; Bonvini, Paolo; Zorzi, Elisa; Poletto, Giorgia; Pagano, Mario A; Sarno, Stefania; Donella-Deana, Arianna; Zagotto, Giuseppe; Rosolen, Angelo; Pinna, Lorenzo A; Meggio, Flavio; Moro, Stefano

    2006-04-20

    Casein kinase 2 (CK2) is a ubiquitous, essential, and highly pleiotropic protein kinase whose abnormally high constitutive activity is suspected to underlie its pathogenic potential in neoplasia and other diseases. Using a virtual screening approach, we have identified the ellagic acid, a naturally occurring tannic acid derivative, as a novel potent CK2 inhibitor. At present, ellagic acid represents the most potent known CK2 inhibitor (K(i) = 20 nM). PMID:16610779

  5. Antitumor effects of tyropeptin-boronic acid derivatives: New proteasome inhibitors

    PubMed Central

    Momose, Isao; Abe, Hikaru; Watanabe, Takumi; Ohba, Shun-ichi; Yamazaki, Kanami; Dan, Shingo; Yamori, Takao; Masuda, Tohru; Nomoto, Akio

    2014-01-01

    The proteasome degrades numerous regulatory proteins that are critical for tumor growth. Thus, proteasome inhibitors are promising antitumor agents. New proteasome inhibitors, such as tyropeptins and tyropeptin-boronic acid derivatives, have a potent inhibitory activity. Here we report the antitumor effects of two new tyropeptin-boronic acid derivatives, AS-06 and AS-29. AS-06 and AS-29 significantly suppress the degradation of the proteasome-sensitive fluorescent proteins in HEK293PS cells, and induce the accumulation of ubiquitinated proteins in human multiple myeloma cells. We show that these derivatives also suppress the degradation of the NF-κB inhibitor IκB-α and the nuclear translocation of NF-κB p65 in multiple myeloma cells, resulting in the inhibition of NF-κB activation. Furthermore, we demonstrate that AS-06 and AS-29 induce apoptosis through the caspase-8 and caspase-9 cascades. In a xenograft mouse model, i.v. administration of tyropeptin-boronic acid derivatives inhibits proteasome in tumors and clearly suppresses tumor growth in mice bearing human multiple myeloma. Our results indicate that tyropeptin-boronic acid derivatives could be lead therapeutic agents against human multiple myeloma. PMID:25251038

  6. Synthesis and bioactivity of 2',3'-benzoabscisic acid analogs.

    PubMed

    Han, Xiaoqiang; Wan, Chuan; Li, Xiuyun; Li, Hong; Yang, Dongyan; Du, Shijie; Xiao, Yumei; Qin, Zhaohai

    2015-06-01

    2',3'-Benzoabscisic acid 4a is significantly more active than (±)-ABA and can be potentially used as a plant growth regulator for agriculture. In this study, six 4a analogs were designed and synthesized. Bioassay showed that 4a displayed greater activity than (±)-ABA and the six analogs produced less inhibition than 4a itself. Specially, some analogs displayed markedly different activities to different physiological and biochemical process, which were largely different from ABA and 4a. Compared to (±)-ABA, 4b and 4c were more effective germination inhibitors for lettuce, but less effective inhibitors for rice elongation. Five-membered analog 5 was higher or slightly weaker in inhibiting Arabidopsis seed germination and rice elongation, respectively, but at least 10 times less effective than (±)-ABA in lettuce seed germination. Dual acid 6 and alkyne acid 20 nearly produced no inhibitory activity for Arabidopsis seed germination, but displayed excellent activity in inhibiting rice seedling growth. The preference of the analogs to different physiology process indicated that they might provide a strategy to develop novel ABA agonists or antagonist and be used as probe to investigate the function of different ABA receptors. PMID:25913114

  7. Androgen synthesis inhibitors in the treatment of castration-resistant prostate cancer

    PubMed Central

    Stein, Mark N; Patel, Neal; Bershadskiy, Alexander; Sokoloff, Alisa; Singer, Eric A

    2014-01-01

    Suppression of gonadal testosterone synthesis represents the standard first line therapy for treatment of metastatic prostate cancer. However, in the majority of patients who develop castration-resistant prostate cancer (CRPC), it is possible to detect persistent activation of the androgen receptor (AR) through androgens produced in the adrenal gland or within the tumor itself. Abiraterone acetate was developed as an irreversible inhibitor of the dual functional cytochrome P450 enzyme CYP17 with activity as a 17α-hydroxylase and 17,20-lyase. CYP17 is necessary for production of nongonadal androgens from cholesterol. Regulatory approval of abiraterone in 2011, based on a phase III trial showing a significant improvement in overall survival (OS) with abiraterone and prednisone versus prednisone, represented proof of principle that targeting AR is essential for improving outcomes in men with CRPC. Inhibition of 17α-hydroxylase by abiraterone results in accumulation of upstream mineralocorticoids due to loss of cortisol-mediated suppression of pituitary adrenocorticotropic hormone (ACTH), providing a rationale for development of CYP17 inhibitors with increased specificity for 17,20-lyase (orteronel, galeterone and VT-464) that can potentially be administered without exogenous corticosteroids. In this article, we review the development of abiraterone and other CYP17 inhibitors; recent studies with abiraterone that inform our understanding of clinical parameters such as drug effects on quality-of-life, potential early predictors of response, and optimal sequencing of abiraterone with respect to other agents; and results of translational studies providing insights into resistance mechanisms to CYP17 inhibitors leading to clinical trials with drug combinations designed to prolong abiraterone benefit or restore abiraterone activity. PMID:24759590

  8. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  9. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.

    PubMed

    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A

    2015-10-01

    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  10. Design and synthesis of orally bioavailable serum and glucocorticoid-regulated kinase 1 (SGK1) inhibitors

    SciTech Connect

    Hammond, Marlys; Washburn, David G.; Hoang, Tram H.; Manns, Sharada; Frazee, James S.; Nakamura, Hiroko; Patterson, Jaclyn R.; Trizna, Walter; Wu, Charlene; Azzarano, Leonard M.; Nagilla, Rakesh; Nord, Melanie; Trejo, Rebecca; Head, Martha S.; Zhao, Baoguang; Smallwood, Angela M.; Hightower, Kendra; Laping, Nicholas J.; Schnackenberg, Christine G.; Thompson, Scott K.

    2010-09-27

    The lead serum and glucocorticoid-related kinase 1 (SGK1) inhibitors 4-(5-phenyl-1H-pyrrolo[2,3-b]pyridin-3-yl)benzoic acid (1) and {l_brace}4-[5-(2-naphthalenyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]phenyl{r_brace}acetic acid (2) suffer from low DNAUC values in rat, due in part to formation and excretion of glucuronic acid conjugates. These PK/glucuronidation issues were addressed either by incorporating a substituent on the 3-phenyl ring ortho to the key carboxylate functionality of 1 or by substituting on the group in between the carboxylate and phenyl ring of 2. Three of these analogs have been identified as having good SGK1 inhibition potency and have DNAUC values suitable for in vivo testing.

  11. Green Synthesis and Urease Inhibitory Activity of Spiro-Pyrimidinethiones/Spiro-Pyrimidinones-Barbituric Acid Derivatives.

    PubMed

    Mohammadi Ziarani, Ghodsi; Asadi, Shima; Faramarzi, Sakineh; Amanlou, Massoud

    2015-01-01

    Sulfonic acid functionalized SBA-15 (SBA-Pr-SO3H) with pore size 6 nm as an efficient heterogeneous nanoporous solid acid catalyst exhibited good catalytic activity in the Biginelli-like reaction in the synthesis of spiroheterobicyclic rings with good yield and good recyclability. Spiro-pyrimidinethiones/spiro-pyrimidinones-barbituric acid derivatives were synthesized in a simple and efficient method using the one-pot three-component reaction of a cyclic 1,3- dicarbonyl compounds (barbituric acid), an aromatic aldehyde and urea or thiourea in the presence of nanoporous silica SBA-Pr-SO3H under solvent free conditions. Urease inhibitory activity of spiro compounds were tested against Jack bean urease using Berthelot alkaline phenol-hypochlorite method. Five of 13 compounds were inhibitor and two of them were enzyme activators. Analysis of the docking results showed that, in most of the spiro molecules, one of the carbonyl groups is coordinated with both nickel atoms, while the other one is involved in the formation of hydrogen bonds with important active-site residues. The effect of inserting two methyl groups on N atoms of barbiturate ring, S substituted, ortho, meta and para substituted compounds were investigated too. PMID:26664377

  12. Green Synthesis and Urease Inhibitory Activity of Spiro-Pyrimidinethiones/Spiro-Pyrimidinones-Barbituric Acid Derivatives

    PubMed Central

    Mohammadi Ziarani, Ghodsi; Asadi, Shima; Faramarzi, Sakineh; Amanlou, Massoud

    2015-01-01

    Sulfonic acid functionalized SBA-15 (SBA-Pr-SO3H) with pore size 6 nm as an efficient heterogeneous nanoporous solid acid catalyst exhibited good catalytic activity in the Biginelli-like reaction in the synthesis of spiroheterobicyclic rings with good yield and good recyclability. Spiro-pyrimidinethiones/spiro-pyrimidinones-barbituric acid derivatives were synthesized in a simple and efficient method using the one-pot three-component reaction of a cyclic 1,3- dicarbonyl compounds (barbituric acid), an aromatic aldehyde and urea or thiourea in the presence of nanoporous silica SBA-Pr-SO3H under solvent free conditions. Urease inhibitory activity of spiro compounds were tested against Jack bean urease using Berthelot alkaline phenol–hypochlorite method. Five of 13 compounds were inhibitor and two of them were enzyme activators. Analysis of the docking results showed that, in most of the spiro molecules, one of the carbonyl groups is coordinated with both nickel atoms, while the other one is involved in the formation of hydrogen bonds with important active-site residues. The effect of inserting two methyl groups on N atoms of barbiturate ring, S substituted, ortho, meta and para substituted compounds were investigated too. PMID:26664377

  13. S-(−)-10,11-Dihydroxyfarnesoic Acid Methyl Ester Inhibits Melanin Synthesis in Murine Melanocyte Cells

    PubMed Central

    Baek, Seung-Hwa; Ahn, Jun-Won; Nam, Sung-Hee; Yoon, Cheol-Sik; Shin, Jae-Cheon; Lee, Sang-Han

    2014-01-01

    The development of antimelanogenic agents is important for the prevention of serious aesthetic problems such as melasmas, freckles, age spots, and chloasmas. In the course of screening for melanin synthesis inhibitors, we found that the culture broth from an insect morphopathogenic fungus, Beauveria bassiana CS1029, exhibits potent antimelanogenic activity. We isolated and purified an active metabolite and identified it as S-(−)-10,11-dihydroxyfarnesoic acid methyl ester (dhFAME), an insect juvenile hormone. To address whether dhFAME inhibits melanin synthesis, we first measured the size of the melanin biosynthesis inhibition zone caused by dhFAME. dhFAME also showed inhibitory activity against mushroom tyrosinase in Melan-a cells. Intracellular, dose-dependent tyrosinase inhibition activity was also confirmed by zymography. In addition, we showed that dhFAME strongly inhibits melanin synthesis in Melan-a cells. Furthermore, we compared levels of TYR, TRP-1, TRP-2, MITF, and MC1R mRNA expression by reverse-transcription polymerase chain reaction and showed that treatment of Melan-a cells with 35 μM dhFAME led to an 11-fold decrease in TYR expression, a 6-fold decrease in TRP-2 expression, and a 5-fold decrease in MITF expression. Together, these results indicate that dhFAME is a potent inhibitor of melanin synthesis that can potentially be used for cosmetic biomaterial(s). PMID:25046747

  14. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W

    1993-01-01

    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  15. Design and Synthesis of Activity-Based Probes and Inhibitors for Bleomycin Hydrolase.

    PubMed

    van der Linden, Wouter A; Segal, Ehud; Child, Matthew A; Byzia, Anna; Drąg, Marcin; Bogyo, Matthew

    2015-08-20

    Bleomycin hydrolase (BLMH) is a neutral cysteine aminopeptidase that has been ascribed roles in many physiological and pathological processes, yet its primary biological function remains enigmatic. In this work, we describe the results of screening of a library of fluorogenic substrates to identify non-natural amino acids that are optimally recognized by BLMH. This screen identified several substrates with kcat/KM values that are substantially improved over the previously reported fluorogenic substrates for this enzyme. The substrate sequences were used to design activity-based probes that showed potent labeling of recombinant BLMH as well as endogenously expressed BLMH in cell extracts, and in intact cells. Importantly, we identify potent BLMH inhibitors that are able to fully inhibit endogenous BLMH activity in intact cells. These probes and inhibitors will be valuable new reagents to study BLMH function in cellular and animal models of human diseases where BLMH is likely to be involved. PMID:26256478

  16. Bioisosterism of urea-based GCPII inhibitors. Synthesis and structure activity relationship studies

    SciTech Connect

    Wang, Haofan; Byun, Youngjoo; Barinka, Cyril; Pullambhatla, Mrudula; Bhang, Hyo-eun C; Fox, James J; Lubkowski, Jacek; Mease, Ronnie C; Pomper, Martin G

    2010-10-28

    We report a strategy based on bioisosterism to improve the physicochemical properties of existing hydrophilic, urea-based GCPII inhibitors. Comprehensive structure-activity relationship studies of the P1prime site of ZJ-43- and DCIBzL-based compounds identified several glutamate-free inhibitors with Ki values below 20 nM. Among them, compound 32d (Ki = 11 nM) exhibited selective uptake in GCPII-expressing tumors by SPECT-CT imaging in mice. A novel conformational change of amino acids in the S1prime pharmacophore pocket was observed in the X-ray crystal structure of GCPII complexed with 32d.

  17. Synthesis of p-O-Alkyl Salicylanilide Derivatives as Novel EGFR Inhibitors.

    PubMed

    Zhang, Li; Hou, Lin; Sun, Wenyan; Yu, Zidong; Wang, Jibo; Gao, Hua; Yang, Guiming

    2016-02-01

    Preclinical Research Epidermal growth factor receptor (EGFR), a validated target for anticancer drugs, plays a critical role in tumorigenesis and tumor development. A series of p-O-alkyl salicylanilide derivatives were designed and synthesized as novel EGFR inhibitors using a salicylic acid scaffold. A simulated six-membered ring strategy formed through intramolecular hydrogen bonds was employed to mimic the planar quinazoline of the EGFR antagonist, gefitinib. The derived compounds with hydroxyl at the ortho position were more potent than ones with methoxyl group. In particular, compounds 5d and 5b displayed significant EGFR inhibitory (IC50 values = 0.30 and 0.45 μM, respectively) activity as well as potent antiproliferative activity in A431 and HCT-116 tumor cells. These salicylanilides could be considered as promising lead compounds for developing novel EGFR inhibitors. PMID:26763193

  18. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  19. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco

    1972-01-01

    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  20. Lichen secondary metabolite evernic acid as potential quorum sensing inhibitor against Pseudomonas aeruginosa.

    PubMed

    Gökalsın, Barış; Sesal, Nüzhet Cenk

    2016-09-01

    Cystic Fibrosis is a genetic disease and it affects the respiratory and digestive systems. Pseudomonas aeruginosa infections in Cystic Fibrosis are presented as the main cause for high mortality and morbidity rates. Pseudomonas aeruginosa populations can regulate their virulence gene expressions via the bacterial communication system: quorum sensing. Inhibition of quorum sensing by employing quorum sensing inhibitors can leave the bacteria vulnerable. Therefore, determining natural sources to obtain potential quorum sensing inhibitors is essential. Lichens have ethnobotanical value for their medicinal properties and it is possible that their secondary metabolites have quorum sensing inhibitor properties. This study aims to investigate an alternative treatment approach by utilizing lichen secondary metabolite evernic acid to reduce the expressions of Pseudomonas aeruginosa virulence factors by inhibiting quorum sensing. For this purpose, fluorescent monitor strains were utilized for quorum sensing inhibitor screens and quantitative reverse-transcriptase PCR analyses were conducted for comparison. Results indicate that evernic acid is capable of inhibiting Pseudomonas aeruginosa quorum sensing systems. PMID:27465850

  1. Structure-activity relationship analysis of the peptide deformylase inhibitor 5-bromo-1H-indole-3-acetohydroxamic acid.

    PubMed

    Petit, Sylvain; Duroc, Yann; Larue, Valéry; Giglione, Carmela; Léon, Carole; Soulama, Coralie; Denis, Alexis; Dardel, Frédéric; Meinnel, Thierry; Artaud, Isabelle

    2009-02-01

    The lead compound 5-bromoindolyl-3-acetohydroxamic acid (10) was recently identified as a potent inhibitor of bacterial peptide deformylases (PDFs). The synthesis and associated activities of new variants were investigated at position 5 to optimize the fit at the S1' subsite and at position 1 to improve both potency and antibacterial activity. A morphomimetic series, termed "reverse-indole" was synthesized. The indole derivatives remain selective in vitro inhibitors of PDF2 over PDF1. Bromide is the best group at position 5 and cannot be replaced by bulkier substituents. In this series, an N-benzyl group at position 1 in 19 e improves the potency relative to 10. In the case of PDF1, and unlike PDF2, potency is increased as the alkyl chain becomes longer and more ramified. These data support the results of NMR footprinting experiments that were performed with (15)N-labeled Ni-PDF and the corresponding 3-acetic acid derivatives. Most of the compounds have antibacterial activities toward B. subtilis, but are inefficient toward E. coli owing to active removal by the major efflux pumps. Among the reverse-indole derivatives, 23 c, which is the exact mirror image of 19 e, shows strong potency in vitro against PDF2, but little against PDF1, although this compound displays significant antibacterial activity toward an efflux-minus mutant of E. coli. All the compounds were assessed with major pathogenic bacteria, but most of them are inefficient antibacterial agents. The reverse-indole compounds 23 a and 23 c have potency against S. pneumoniae that is similar to that of actinonin. PMID:19053131

  2. Chloropropionyl-CoA: a mechanism-based inhibitor of HMG-CoA synthase and fatty acid synthase

    SciTech Connect

    Miziorko, H.M.; Ahmad, F.; Behnke, C.E.

    1986-05-01

    Recent work on the mechanisms of inactivation of HMG-CoA synthase and fatty acid synthase by chloropropionyl-CoA (Cl-prop-CoA) suggests that this analog is a mechanism-based (suicide) inhibitor; the acyl group is enzymatically converted to an acrylyl derivative prior to alkylation of the target proteins. When Cl-(/sup 3/H)prop-CoA is incubated with the target enzymes, /sup 3/H/sub 2/O is produced concomitantly with enzyme inactivation; this suggests that deprotonation and chloride elimination to form an acrylyl moiety occurs. Difficulty in cleanly synthesizing acrylyl-CoA complicates direct demonstration of the intermediacy of this species. However, synthesis of a functionally equivalent reactive substrate analog, S-acrylyl-N-acetylcysteamine has been accomplished. This analog irreversibly inhibits both HMG-CoA synthase and fatty acid synthase in a site directed fashion. Concentrations required for effective inhibition (K/sub i/ values of 1.9 mM and 3.6 mM, respectively) are much higher than observed with Cl-prop-CoA. Maximal rates of inactivation (as vertical bar ..-->.. infinity) are comparable to those measured with Cl-prop-CoA, indicating that an acrylyl derivative is kinetically competent to function as an intermediate, as required if Cl-prop-CoA is a mechanism-based inhibitor. S-acrylyl-N-acetylcysteamine also inactivates HMG-CoA lyase. In this case, kinetic studies indicate that a bimolecular process is involved (k/sub 2/ = 86.7M/sup -1/min/sup -1/ at 30/sup 0/, pH 7.0).

  3. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  4. Isolation of 4,5-O-Dicaffeoylquinic Acid as a Pigmentation Inhibitor Occurring in Artemisia capillaris Thunberg and Its Validation In Vivo.

    PubMed

    Tabassum, Nadia; Lee, Ji-Hyung; Yim, Soon-Ho; Batkhuu, Galzad Javzan; Jung, Da-Woon; Williams, Darren R

    2016-01-01

    There is a continual need to develop novel and effective melanogenesis inhibitors for the prevention of hyperpigmentation disorders. The plant Artemisia capillaris Thunberg (Oriental Wormwood) was screened for antipigmentation activity using murine cultured cells (B16-F10 malignant melanocytes). Activity-based fractionation using HPLC and NMR analyses identified the compound 4,5-O-dicaffeoylquinic acid as an active component in this plant. 4,5-O-Dicaffeoylquinic acid significantly reduced melanin synthesis and tyrosinase activity in a dose-dependent manner in the melanocytes. In addition, 4,5-O-dicaffeoylquinic acid treatment reduced the expression of tyrosinase-related protein-1. Significantly, we could validate the antipigmentation activity of this compound in vivo, using a zebrafish model. Moreover, 4,5-O-dicaffeoylquinic acid did not show toxicity in this animal model. Our discovery of 4,5-O-dicaffeoylquinic acid as an inhibitor of pigmentation that is active in vivo shows that this compound can be developed as an active component for formulations to treat pigmentation disorders. PMID:27528883

  5. Isolation of 4,5-O-Dicaffeoylquinic Acid as a Pigmentation Inhibitor Occurring in Artemisia capillaris Thunberg and Its Validation In Vivo

    PubMed Central

    Tabassum, Nadia; Lee, Ji-Hyung; Yim, Soon-Ho; Batkhuu, Galzad Javzan

    2016-01-01

    There is a continual need to develop novel and effective melanogenesis inhibitors for the prevention of hyperpigmentation disorders. The plant Artemisia capillaris Thunberg (Oriental Wormwood) was screened for antipigmentation activity using murine cultured cells (B16-F10 malignant melanocytes). Activity-based fractionation using HPLC and NMR analyses identified the compound 4,5-O-dicaffeoylquinic acid as an active component in this plant. 4,5-O-Dicaffeoylquinic acid significantly reduced melanin synthesis and tyrosinase activity in a dose-dependent manner in the melanocytes. In addition, 4,5-O-dicaffeoylquinic acid treatment reduced the expression of tyrosinase-related protein-1. Significantly, we could validate the antipigmentation activity of this compound in vivo, using a zebrafish model. Moreover, 4,5-O-dicaffeoylquinic acid did not show toxicity in this animal model. Our discovery of 4,5-O-dicaffeoylquinic acid as an inhibitor of pigmentation that is active in vivo shows that this compound can be developed as an active component for formulations to treat pigmentation disorders. PMID:27528883

  6. Design and Synthesis of New Benzimidazole and Pyrimidine Derivatives as α-glucosidase Inhibitor

    PubMed Central

    Mobinikhaledi, Akbar; Asghari, Behvar; Jabbarpour, Mahsa

    2015-01-01

    In an endeavor to find a novel series of antihyperglycemic agents, new benzimidazole and pyrimidine derivatives were successfully synthesized efficiently in high yield with high purity, starting from amino acids in the presence of phosphorus oxychloride (POCl3). The synthesized compounds were identified by 1H-NMR, 13C-NMR, FT-IR spectroscopic techniques and elemental analysis. All products were assayed for their inhibitory effects on yeast and rat intestinal α-glucosidases. The results revealed that compounds with aromatic amino acids moiety showed significant inhibition activity on the tested enzymes. Among the benzimidazole derivatives 4c and 4d exhibited the best activity against both of the tested enzymes. Also, among the pyrimidine derivatives 5c and 5d possessed significant inhibition action on the enzymes. The IC50 values for the most potent benzimidazole yeast and intestinal α-glucosidases inhibitor (4d) were found to be 9.1 and 36.7 µM, respectively. The IC50 values for the inhibition of yeast and intestinal α-glucosidases by the most active pyrimidine compound (5d) were calculated to be 8.3 and 21.8 µM, respectively. Overall, this study proved that benzimidazole and pyrimidine derivatives with aromatic amino acids moieties can represent novel promising α-glucosidase inhibitors. PMID:26330860

  7. Lipid phosphate phosphatases regulate lysophosphatidic acid production and signaling in platelets: studies using chemical inhibitors of lipid phosphate phosphatase activity.

    PubMed

    Smyth, Susan S; Sciorra, Vicki A; Sigal, Yury J; Pamuklar, Zehra; Wang, Zuncai; Xu, Yong; Prestwich, Glenn D; Morris, Andrew J

    2003-10-31

    Blood platelets play an essential role in ischemic heart disease and stroke contributing to acute thrombotic events by release of potent inflammatory agents within the vasculature. Lysophosphatidic acid (LPA) is a bioactive lipid mediator produced by platelets and found in the blood and atherosclerotic plaques. LPA receptors on platelets, leukocytes, endothelial cells, and smooth muscle cells regulate growth, differentiation, survival, motility, and contractile activity. Definition of the opposing pathways of synthesis and degradation that control extracellular LPA levels is critical to understanding how LPA bioactivity is regulated. We show that intact platelets and platelet membranes actively dephosphorylate LPA and identify the major enzyme responsible as lipid phosphate phosphatase 1 (LPP1). Localization of LPP1 to the platelet surface is increased by exposure to LPA. A novel receptor-inactive sn-3-substituted difluoromethylenephosphonate analog of phosphatidic acid that is a potent competitive inhibitor of LPP1 activity potentiates platelet aggregation and shape change responses to LPA and amplifies LPA production by agonist-stimulated platelets. Our results identify LPP1 as a pivotal regulator of LPA signaling in the cardiovascular system. These findings are consistent with genetic and cell biological evidence implicating LPPs as negative regulators of lysophospholipid signaling and suggest that the mechanisms involve both attenuation of lysophospholipid actions at cell surface receptors and opposition of lysophospholipid production. PMID:12909631

  8. HDAC inhibitor valproic acid upregulates CAR in vitro and in vivo

    PubMed Central

    Segura-Pacheco, Blanca; Avalos, Berenice; Rangel, Edgar; Velazquez, Dora; Cabrera, Gustavo

    2007-01-01

    Background The presence of CAR in diverse tumor types is heterogeneous with implications in tumor transduction efficiency in the context of adenoviral mediated cancer gene therapy. Preliminary studies suggest that CAR transcriptional regulation is modulated through histone acetylation and not through promoter methylation. Furthermore, it has been documented that the pharmacological induction of CAR using histone deacetylase inhibitor (iHDAC) compounds is a viable strategy to enhance adenoviral mediated gene delivery to cancer cells in vitro. The incorporation of HDAC drugs into the overall scheme in adenoviral based cancer gene therapy clinical trials seems rational. However, reports using compounds with iHDAC properties utilized routinely in the clinic are pending. Valproic acid, a short chained fatty acid extensively used in the clinic for the treatment of epilepsy and bipolar disorder has been recently described as an effective HDAC inhibitor at therapeutic concentrations. Methods We studied the effect of valproic acid on histone H3 and H4 acetylation, CAR mRNA upregulation was studied using semiquantitative PCR and adenoviral transduction on HeLa cervical cancer cells, on MCF-7 breast cancer cells, on T24 transitional cell carcinoma of the bladder cells. CAR mRNA was studied using semiquantitative PCR on tumor tissue extracted from patients diagnosed with cervical cancer treated with valproic acid. Results CAR upregulation through HDAC inhibition was observed in the three cancer cell lines with enhancement of adenoviral transduction. CAR upregulation was also observed in tumor samples obtained from patients with cervical cancer treated with therapeutic doses of valproic acid. These results support the addition of the HDAC inhibitor valproic acid to adenoviral mediated cancer gene therapy clinical trials to enhance adenoviral mediated gene delivery to the tumor cells. PMID:17892546

  9. Products of the Black Sea alga Phyllophora nervosa as corrosion inhibitor for steel in acids

    SciTech Connect

    Popelyukh, G.M.; Andrianov, A.M.; Burtnenko, L.M.; Gazha, P.A.; Talavira, L.I.

    1986-05-01

    The authors have investigated the inhibiting properties of the processing products of the Black Sea red seaweed Phyllophora nervosa on specimens of steel St3 in phosphoric and hydrochloric acids of various concentrations at temperatures in the range from 30 to 95 /sup 0/C. They have studied how the concentrations of urotropin, sodium chloride, and Fe/sup 3 +/ ions influence the protective properties of the seaweed inhibitor. They have made preliminary investigations of the mechanisms of the protective action.

  10. The gyrase inhibitor albicidin consists of p-aminobenzoic acids and cyanoalanine.

    PubMed

    Cociancich, Stéphane; Pesic, Alexander; Petras, Daniel; Uhlmann, Stefanie; Kretz, Julian; Schubert, Vivien; Vieweg, Laura; Duplan, Sandrine; Marguerettaz, Mélanie; Noëll, Julie; Pieretti, Isabelle; Hügelland, Manuela; Kemper, Sebastian; Mainz, Andi; Rott, Philippe; Royer, Monique; Süssmuth, Roderich D

    2015-03-01

    Albicidin is a potent DNA gyrase inhibitor produced by the sugarcane pathogenic bacterium Xanthomonas albilineans. Here we report the elucidation of the hitherto unknown structure of albicidin, revealing a unique polyaromatic oligopeptide mainly composed of p-aminobenzoic acids. In vitro studies provide further insights into the biosynthetic machinery of albicidin. These findings will enable structural investigations on the inhibition mechanism of albicidin and its assessment as a highly effective antibacterial drug. PMID:25599532

  11. Benzoic acid derivatives with improved antifungal activity: Design, synthesis, structure-activity relationship (SAR) and CYP53 docking studies.

    PubMed

    Berne, Sabina; Kovačič, Lidija; Sova, Matej; Kraševec, Nada; Gobec, Stanislav; Križaj, Igor; Komel, Radovan

    2015-08-01

    Previously, we identified CYP53 as a fungal-specific target of natural phenolic antifungal compounds and discovered several inhibitors with antifungal properties. In this study, we performed similarity-based virtual screening and synthesis to obtain benzoic acid-derived compounds and assessed their antifungal activity against Cochliobolus lunatus, Aspergillus niger and Pleurotus ostreatus. In addition, we generated structural models of CYP53 enzyme and used them in docking trials with 40 selected compounds. Finally, we explored CYP53-ligand interactions and identified structural elements conferring increased antifungal activity to facilitate the development of potential new antifungal agents that specifically target CYP53 enzymes of animal and plant pathogenic fungi. PMID:26154240

  12. Corrosion damage of the surface of high-speed tool steel in acid-inhibitor pickling

    SciTech Connect

    Mindyuk, A.K.; Sholok, V.I.; Shvets, V.V. Gural', V.M.

    1988-01-01

    Profilograms were recorded of the surface of 20-mm-diameter 1.5-mm-thick specimens prepared from hardened and tempered R6M5 high-speed tool steel (62 HRC) and also of similar specimens subjected to the action of pure hydrochloric acid etching solution and of the same solutions with additions of KhOSP-10, KhOSP-10D, and urotropin inhibitors at 30, 60, and 90/sup 0/C for 4.0, 2.0, and 0.5 h, respectively. The analysis of corrosion damage and determination of the surface finish of the steel made it possible to develop the optimum method of acid-inhibitor pickling specifying the addition to the acid of 1.5 g/liter KhOSP-10 inhibitor and a temperature of 30/sup 0/C. This suppressed the corrosion rate, hydrogen impregnation and embrittlement, decarburization of the steel, and sensitivity to crack formation, and reduced the number of scrapped parts.

  13. Larvicidal Activity of Novaluron, a Chitin Synthesis Inhibitor, Against the Housefly, Musca domestica

    PubMed Central

    Cetin, Huseyin; Erler, Fedai; Yanikoglu, Atila

    2006-01-01

    A chitin synthesis inhibitor, novaluron, was evaluated under laboratory conditions for its larvicidal activity against a field population of the housefly, Musca domestica L. (Diptera: Muscidae), by feeding and dipping methods. The concentrations used were 1, 2.5, 5, 10 and 20 mg a.i./kg in both methods. The product caused >80% larval mortality at 10 and 20 mg a.i./kg. Of the two methods, feeding was more effective for larvicidal activity at doses above 2.5 mg a.i./kg. After 72 hours, the LC50 and LC90 values were 1.66 and 8.25 mg a.i./kg, respectively, with the feeding method; and 2.72 and 17.88 mg a.i./kg, respectively, using the dipping method. The results showed that the product provided good control of housefly larvae and would greatly reduce adult emergence.

  14. The first synthesis of substituted azepanes mimicking monosaccharides: a new class of potent glycosidase inhibitors.

    PubMed

    Li, Hongqing; Blériot, Yves; Chantereau, Caroline; Mallet, Jean-Maurice; Sollogoub, Matthieu; Zhang, Yongmin; Rodríguez-García, Eliazar; Vogel, Pierre; Jiménez-Barbero, Jesús; Sinaÿ, Pierre

    2004-05-21

    The synthesis of the first examples of seven-membered ring iminoalditols, molecules displaying an extra hydroxymethyl substituent on their seven-membered ring compared to the previously reported polyhydroxylated azepanes, has been achieved from d-arabinose in 10 steps using RCM of a protected N-allyl-aminohexenitol as a key step. While the (2R,3R,4R)-2-hydroxymethyl-3,4-dihydroxy-azepane 10, a seven-membered ring analogue of fagomine, is a weak inhibitor of glycosidases, the (2R,3R,4R,5S,6S)-2-hydroxymethyl-3,4,5,6-tetrahydroxy-azepane 9 selectively inhibits green coffee bean alpha-galactosidase in the low micromolar range (Ki = 2.2 muM) despite a D-gluco relative configuration. PMID:15136805

  15. Design, synthesis and biological evaluation of 6-pyridylmethylaminopurines as CDK inhibitors.

    PubMed

    Wilson, Stuart C; Atrash, Butrus; Barlow, Clare; Eccles, Susan; Fischer, Peter M; Hayes, Angela; Kelland, Lloyd; Jackson, Wayne; Jarman, Michael; Mirza, Amin; Moreno, Javier; Nutley, Bernard P; Raynaud, Florence I; Sheldrake, Peter; Walton, Mike; Westwood, Robert; Whittaker, Steven; Workman, Paul; McDonald, Edward

    2011-11-15

    The cyclin-dependent kinase (CDK) inhibitor seliciclib (1, CYC202) is in phase II clinical development for the treatment of cancer. Here we describe the synthesis of novel purines with greater solubility, lower metabolic clearance, and enhanced potency versus CDKs. These compounds exhibit novel selectivity profiles versus CDK isoforms. Compound αSβR-21 inhibits CDK2/cyclin E with IC(50)=30 nM, CDK7-cyclin H with IC(50)=1.3 μM, and CDK9-cyclinT with IC(50)=0.11 μM; it (CCT68127) inhibits growth of HCT116 colon cancer cells in vitro with GI(50)=0.7 μM; and shows antitumour activity when dosed p.o. at 50mg/kg to mice bearing HCT116 solid human tumour xenografts. PMID:21982796

  16. Isolation and Synthesis of a Bacterially Produced Inhibitor of Rosette Development in Choanoflagellates.

    PubMed

    Cantley, Alexandra M; Woznica, Arielle; Beemelmanns, Christine; King, Nicole; Clardy, Jon

    2016-04-01

    The choanoflagellate Salpingoeca rosetta is a microbial marine eukaryote that can switch between unicellular and multicellular states. As one of the closest living relatives of animals, this organism has become a model for understanding how multicellularity evolved in the animal lineage. Previously our laboratories isolated and synthesized a bacterially produced sulfonolipid that induces S. rosetta to form multicellular "rosettes." In this study, we report the identification of a bacterially produced inhibitor of rosettes (IOR-1) as well as the total synthesis of this molecule and all of its stereoisomers. Our results confirm the previously noted specificity and potency of rosette-modulating molecules, expand our understanding of the complex chemical ecology between choanoflagellates and rosette-inducing bacteria, and provide a synthetic probe template for conducting further mechanistic studies on the emergence of multicellularity. PMID:26998963

  17. Isolation and Synthesis of a Bacterially Produced Inhibitor of Rosette Development in Choanoflagellates

    PubMed Central

    2016-01-01

    The choanoflagellate Salpingoeca rosetta is a microbial marine eukaryote that can switch between unicellular and multicellular states. As one of the closest living relatives of animals, this organism has become a model for understanding how multicellularity evolved in the animal lineage. Previously our laboratories isolated and synthesized a bacterially produced sulfonolipid that induces S. rosetta to form multicellular “rosettes.” In this study, we report the identification of a bacterially produced inhibitor of rosettes (IOR-1) as well as the total synthesis of this molecule and all of its stereoisomers. Our results confirm the previously noted specificity and potency of rosette-modulating molecules, expand our understanding of the complex chemical ecology between choanoflagellates and rosette-inducing bacteria, and provide a synthetic probe template for conducting further mechanistic studies on the emergence of multicellularity. PMID:26998963

  18. An inhibitor of chondroitin sulfate proteoglycan synthesis promotes central nervous system remyelination.

    PubMed

    Keough, Michael B; Rogers, James A; Zhang, Ping; Jensen, Samuel K; Stephenson, Erin L; Chen, Tieyu; Hurlbert, Mitchel G; Lau, Lorraine W; Rawji, Khalil S; Plemel, Jason R; Koch, Marcus; Ling, Chang-Chun; Yong, V Wee

    2016-01-01

    Remyelination is the generation of new myelin sheaths after injury facilitated by processes of differentiating oligodendrocyte precursor cells (OPCs). Although this repair phenomenon occurs in lesions of multiple sclerosis patients, many lesions fail to completely remyelinate. A number of factors have been identified that contribute to remyelination failure, including the upregulated chondroitin sulfate proteoglycans (CSPGs) that comprise part of the astrogliotic scar. We show that in vitro, OPCs have dramatically reduced process outgrowth in the presence of CSPGs, and a medication library that includes a number of recently reported OPC differentiation drugs failed to rescue this inhibitory phenotype on CSPGs. We introduce a novel CSPG synthesis inhibitor to reduce CSPG content and find rescued process outgrowth from OPCs in vitro and accelerated remyelination following focal demyelination in mice. Preventing CSPG deposition into the lesion microenvironment may be a useful strategy to promote repair in multiple sclerosis and other neurological disorders. PMID:27115988

  19. Laboratory Evaluation of Flurox, a Chitin Synthesis Inhibitor, on the Termite, Microcerotermes diversus

    PubMed Central

    Habibpour, Behzad

    2010-01-01

    Microcerotermes diversus (Silvestri) (Isoptera: Termitidae) is the most economically destructive termite in structures in southwest Iran. One sustainable control strategy that usually helps to reduce subterranean termite damage in buildings, is the use of insect growth regualtors in a suitable bait matrix that are safe to the user and the environment. In the laboratory assays described here, the delayed toxicity of Flurox, a chitin synthesis inhibitor, to M. diversus was evaluated under force-feeding and choice trials. Flurox induced worker and nymph mortality and incomplete ecdysis in nymphs of M. diversus under no-choice and two-choice feeding tests. These adverse effects may cause disruption of the caste balance in M. diversus, leading to the collapse of the colony. These assays determined concentrations of Flurox that can be used in bait formulations. PMID:20569123

  20. An inhibitor of chondroitin sulfate proteoglycan synthesis promotes central nervous system remyelination

    PubMed Central

    Keough, Michael B.; Rogers, James A.; Zhang, Ping; Jensen, Samuel K.; Stephenson, Erin L.; Chen, Tieyu; Hurlbert, Mitchel G.; Lau, Lorraine W.; Rawji, Khalil S.; Plemel, Jason R.; Koch, Marcus; Ling, Chang-Chun; Yong, V. Wee

    2016-01-01

    Remyelination is the generation of new myelin sheaths after injury facilitated by processes of differentiating oligodendrocyte precursor cells (OPCs). Although this repair phenomenon occurs in lesions of multiple sclerosis patients, many lesions fail to completely remyelinate. A number of factors have been identified that contribute to remyelination failure, including the upregulated chondroitin sulfate proteoglycans (CSPGs) that comprise part of the astrogliotic scar. We show that in vitro, OPCs have dramatically reduced process outgrowth in the presence of CSPGs, and a medication library that includes a number of recently reported OPC differentiation drugs failed to rescue this inhibitory phenotype on CSPGs. We introduce a novel CSPG synthesis inhibitor to reduce CSPG content and find rescued process outgrowth from OPCs in vitro and accelerated remyelination following focal demyelination in mice. Preventing CSPG deposition into the lesion microenvironment may be a useful strategy to promote repair in multiple sclerosis and other neurological disorders. PMID:27115988

  1. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  2. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids. PMID:25796392

  3. Effects of inhibitors of eicosanoid synthesis in the uterus of ovariectomized rats and rats in natural oestrus: relation with calcium.

    PubMed

    Cantabrana, B; Baamonde, A; Andres-Trelles, F; Hidalgo, A

    1990-01-01

    1. The effects of 4 inhibitors of eicosanoid synthesis (ESIs)--mepacrine (MEP, 10(-5) - 3 x 10(-4) M), nordihydroguaiaretic acid (NDHGA, 10(-6) - 2 x 10(-5) M), indomethacin (IND, 2 x 10(-6) M and 2 x 10(-5) M) and imidazole (IMI, 10(-5) M and 10(-4) M)--on the motility induced by oxytocin (OT, 0.5 and 4 mU/ml) in uterus of rats in natural oestrus and of ovariectomized rats have been studied. 2. MEP, NDHGA and IND, but not IMI, inhibited the motility induced by both concentrations of OT in natural oestrus. Ovariectomy enhanced the effects of all ESIs, except the one of MEP. 3. MEP and NDHGA, but not IND or IMI, inhibited the contractions induced by methacholine (10(-5) M) and prostaglandin F2a (10(-6) M) and relaxed in a dose-dependent way the tonic component of the contractile response to KCl 60 mM (DI50: 6.14 +/- 0.38 and 1.38 +/- 0.29 x 10(-5) M, respectively). 4. CaCl2 (0.1-10 mM) reverted the relaxation of KCl contractions produced by MEP but not by NDHGA. PMID:2298392

  4. Discovery of a potent inhibitor of the antiapoptotic protein Bcl-xL from NMR and parallel synthesis.

    PubMed

    Petros, Andrew M; Dinges, Jurgen; Augeri, David J; Baumeister, Steven A; Betebenner, David A; Bures, Mark G; Elmore, Steven W; Hajduk, Philip J; Joseph, Mary K; Landis, Shelley K; Nettesheim, David G; Rosenberg, Saul H; Shen, Wang; Thomas, Sheela; Wang, Xilu; Zanze, Irini; Zhang, Haichao; Fesik, Stephen W

    2006-01-26

    The antiapoptotic proteins Bcl-x(L) and Bcl-2 play key roles in the maintenance of normal cellular homeostasis. However, their overexpression can lead to oncogenic transformation and is responsible for drug resistance in certain types of cancer. This makes Bcl-x(L) and Bcl-2 attractive targets for the development of potential anticancer agents. Here we describe the structure-based discovery of a potent Bcl-x(L) inhibitor directed at a hydrophobic groove on the surface of the protein. This groove represents the binding site for BH3 peptides from proapoptotic Bcl-2 family members such as Bak and Bad. Application of NMR-based screening yielded an initial biaryl acid with an affinity (K(d)) of approximately 300 microM for the protein. Following the classical "SAR by NMR" approach, a second-site ligand was identified that bound proximal to the first-site ligand in the hydrophobic groove. From NMR-based structural studies and parallel synthesis, a potent ligand was obtained, which binds to Bcl-x(L) with an inhibition constant (K(i)) of 36 +/- 2 nM. PMID:16420051

  5. Diastereoselective solution and multipin-based combinatorial array synthesis of a novel class of potent phosphinic metalloprotease inhibitors.

    PubMed

    Makaritis, Anastasios; Georgiadis, Dimitris; Dive, Vincent; Yiotakis, Athanasios

    2003-05-01

    The solution-phase synthesis and resolution of new phosphinopeptidic building blocks containing a triple bond was realized in high yields and optical purities (units 3 a-d). The absolute configuration of the target compounds was unambiguously established by NMR studies. A post-assembly diversification strategy of these blocks was developed through 1,3-dipolar cycloaddition of a variety of in situ prepared nitrile oxides. This strategy led to the rapid and efficient diastereoselective preparation of a novel class of isoxazole-containing phosphinic peptides (peptides 5 a-i). Solid-phase version of this strategy was efficiently achieved on multipin solid technology, by developing a new protocol for the coupling of P-unprotected dipeptidic blocks with solid supported amino acids in a quantitative and diastereoselective manner. Optimization of dipolar cycloadditions onto pin-embodied phosphinic peptides allowed the convenient preparation of this new class of pseudopeptides. The crude phosphinic peptides (9 a-k) were obtained in high yields and purity as determined by RP-HPLC. Inhibition assays of some of these peptides revealed that they behave as very potent inhibitors of MMPs, outmatching previously reported phosphinic peptides, in terms of potency (K(i) in the range of few nM). PMID:12740857

  6. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  7. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  8. Anti-amyloidogenic effects of glycosphingolipid synthesis inhibitors occur independently of ganglioside alterations.

    PubMed

    Noel, Anastasia; Ingrand, Sabrina; Barrier, Laurence

    2016-09-01

    Evidence has suggested that ganglioside abnormalities may be linked to the proteolytic processing of amyloid precursor protein (APP) in Alzheimer's disease (AD) and that pharmacological inhibition of ganglioside synthesis may reduce amyloid β-peptide (Aβ) production. In this study, we assessed the usefulness of two well-established glycosphingolipid (GSL) synthesis inhibitors, the synthetic ceramide analog D-PDMP (1-phenyl 2-decanoylamino-3-morpholino-1-propanol) and the iminosugar N-butyldeoxynojirimycin (NB-DNJ or miglustat), as anti-amyloidogenic drugs in a human cellular model of AD. We found that both GSL inhibitors were able to markedly inhibit Aβ production, although affecting differently the APP cleavage. Surprisingly, the L-enantiomer of PDMP, which promotes ganglioside accumulation, acted similarly to D-PDMP to inhibit Aβ production. Concurrently, both D- and L-PDMP strongly and equally reduced the levels of long-chain ceramides. Altogether, our data suggested that the anti-amyloidogenic effects of PDMP agents are independent of the altered cellular ganglioside composition, but may result, at least in part, from their ability to reduce ceramide levels. Moreover, our current study established for the first time that NB-DNJ, a drug already used as a therapeutic for Gaucher disease (a lysosomal storage disorder), was also able to reduce Aβ production in our cellular model. Therefore, our study provides novel information regarding the possibilities to target amyloidogenic processing of APP through modulation of sphingolipid metabolism and emphasizes the potential of the iminosugar NB-DNJ as a disease modifying therapy for AD. PMID:27373967

  9. Synthesis of all nineteen appropriately protected chiral alpha-hydroxy acid equivalents of the alpha-amino acids for Boc solid-phase depsi-peptide synthesis.

    PubMed

    Deechongkit, Songpon; You, Shu-Li; Kelly, Jeffery W

    2004-02-19

    [reaction: see text] The preparation of depsi-peptides, amide-to-ester-substituted peptides used to probe the role of hydrogen bonding in protein folding energetics, is accomplished by replacing specific l-alpha-amino acid residues by their alpha-hydroxy acid counterparts in a solid-phase synthesis employing a t-Boc strategy. Herein we describe the efficient stereoselective synthesis of all 19 appropriately protected alpha-hydroxy acid equivalents of the l-alpha-amino acids, employing commercially available materials, expanding the number of available alpha-hydroxy acids from 9 to 19. PMID:14961607

  10. Stimulators and inhibitors of lymphocyte DNA synthesis in supernatants from human lymphoid cell lines.

    PubMed

    Vesole, D H; Goust, J M; Fett, J W; Fudenberg, H H

    1979-09-01

    Some T and B lymphoid cell lines (LCL) were found to secrete into their supernatants a substance able to stimulate lymphocyte proliferation. This substance produced an increase in [3H]thymidine uptake by mononuclear cells when added to unstimulated cultures (mitogenic effect) or when added to cultures stimulated with phytohemagglutinin (PHA) or pokeweed mitogen (PWM) (potentiating effect). When complete supernatants were used, the potentiating effect was sometimes masked by an inhibitor of DNA synthesis. Fractionation on Sephadex G-100 separated these two activities. The stimulatory substance eluted at a m.w. range of 15,000 to 30,000, and the inhibitor eluted with the albumin peak. B cells with or without monocytes were the most sensitive to the mitogenic effect, whereas T cells were unaffected. Responses to PHA and PWM were potentiated when T cells were present, but the maximum effect was observed when the proportion of T cells was less than 50%. The stimulatory material may be similar to lymphocyte mitogenic factor and may function as a T cell-replacing factor in B cell stimulation. PMID:313950

  11. Synthesis and biological activities of vitamin D-like inhibitors of CYP24 hydroxylase

    PubMed Central

    Chiellini, Grazia; Rapposelli, Simona; Zhu, Jinge; Massarelli, Ilaria; Saraceno, Marilena; Bianucci, Anna Maria; Plum, Lori A.; Clagett-Dame, Margaret; DeLuca, Hector F.

    2012-01-01

    Selective inhibitors of CYP24A1 represent an important synthetic target in a search for novel vitamin D compounds of therapeutic value. In the present work, we show the synthesis and biological properties of two novel side chain modified 2-methylene-19-nor-1,25(OH)2D3 analogs, the 22-imidazole-1-yl derivative 2 (VIMI) and the 25-N-cyclopropylamine compound 3 (CPA1), which were efficiently prepared in convergent syntheses utilizing the Lythgoe type Horner–Wittig olefination reaction. When tested in a cell-free assay, both compounds were found to be potent competitive inhibitors of CYP24A1, with the cyclopropylamine analog 3 exhibiting an 80–1 selective inhibition of CYP24A1 over CYP27B1. Addition of 3 to a mouse osteoblast culture sustained the level of 1,25(OH)2D3, further demonstrating its effectiveness in CYP24A1 inhibition. Importantly, the in vitro effects on human promyeloid leukemia (HL-60) cell differentiation by 3 were nearly identical to those of 1,25(OH)2D3 and in vivo the compound showed low calcemic activity. Finally, the results of preliminary theoretical studies provide useful insights to rationalize the ability of analog 3 to selectively inhibit the cytochrome P450 isoform CYP24A1. PMID:22133546

  12. Synthesis of a Poly-hydroxypyrolidine-Based inhibitor of Mycobacterium tuberculosis GlgE

    PubMed Central

    2015-01-01

    Long treatment times, poor drug compliance, and natural selection during treatment of Mycobacterium tuberculosis (Mtb) have given rise to extensively drug-resistant tuberculosis (XDR-TB). As a result, there is a need to identify new antituberculosis drug targets. Mtb GlgE is a maltosyl transferase involved in α-glucan biosynthesis. Mutation of GlgE in Mtb increases the concentration of maltose-1-phosphate (M1P), one substrate for GlgE, causing rapid cell death. We have designed 2,5-dideoxy-3-O-α-d-glucopyranosyl-2,5-imino-d-mannitol (9) to act as an inhibitor of GlgE. Compound 9 was synthesized using a convergent synthesis by coupling thioglycosyl donor 14 and 5-azido-3-O-benzyl-5-deoxy-1,2-O-isopropylidene-β-d-fructopyranose (23) to form disaccharide 24. A reduction and intramolecular reductive amination transformed the intermediate disaccharide 24 to the desired pyrolidine 9. Compound 9 inhibited both Mtb GlgE and a variant of Streptomyces coelicolor (Sco) GlgEI with Ki = 237 ± 27 μM and Ki = 102 ± 7.52 μM, respectively. The results confirm that a Sco GlgE-V279S variant can be used as a model for Mtb GlgE. In conclusion, we designed a lead transition state inhibitor of GlgE, which will be instrumental in further elucidation of the enzymatic mechanism of Mtb GlgE. PMID:25137149

  13. The DNA methylation inhibitor 5-azacytidine decreases melanin synthesis by inhibiting CREB phosphorylation.

    PubMed

    Shin, Jun Seob; Jeong, Hyo-Soon; Kim, Myo-Kyoung; Yun, Hye-Young; Baek, Kwang Jin; Kwon, Nyoun Soo; Kim, Dong-Seok

    2015-10-01

    Here we examined the effects of a DNA methylation inhibitor, 5-azacytidine, on melanogenesis in Mel-Ab cells. We found that 5-azacytidine decreased the melanin content and tyrosinase activity in these cells in a dose-dependent manner; importantly, 5-azacytidine was not cytotoxic at the concentrations used in these experiments. On the other hand, 5-azacytidine did not affect tyrosinase activity in a cell-free system, indicating that 5-azacytidine is not a direct tyrosinase inhibitor. Instead, 5-azacytidine decreased the protein levels of microphthalmia-associated transcription factor (MITF) and tyrosinase. Thus, we investigated the effects of 5-azacytidine on signal transduction pathways related to melanogenesis. However, 5-azacytidine did not have any effect on either Akt or glycogen synthase kinase 3β (GSK3β) phosphorylation. The phosphorylation of cAMP response element-binding protein (CREB) is well known to regulate MITF expression, thereby also regulating tyrosinase expression. We found that 5-azacytidine decreased the phosphorylation of CREB. Therefore, we propose that 5-azacytidine may decrease melanin synthesis by downregulating MITF and tyrosinase via CREB inactivation. PMID:26601420

  14. New MKLP-2 inhibitors in the paprotrain series: Design, synthesis and biological evaluations.

    PubMed

    Labrière, Christophe; Talapatra, Sandeep K; Thoret, Sylviane; Bougeret, Cécile; Kozielski, Frank; Guillou, Catherine

    2016-02-15

    Members of the kinesin superfamily are involved in key functions during intracellular transport and cell division. Their involvement in cell division makes certain kinesins potential targets for drug development in cancer chemotherapy. The two most advanced kinesin targets are Eg5 and CENP-E with inhibitors in clinical trials. Other mitotic kinesins are also being investigated for their potential as prospective drug targets. One recently identified novel potential cancer therapeutic target is the Mitotic kinesin-like protein 2 (MKLP-2), a member of the kinesin-6 family, which plays an essential role during cytokinesis. Previous studies have shown that inhibition of MKLP-2 leads to binucleated cells due to failure of cytokinesis. We have previously identified compound 1 (paprotrain) as the first selective inhibitor of MKLP-2. Herein we describe the synthesis and biological evaluation of new analogs of 1. Our structure-activity relationship (SAR) study reveals the key chemical elements in the paprotrain family necessary for MKLP-2 inhibition. We have successfully identified one MKLP-2 inhibitor 9a that is more potent than paprotrain. In addition, in vitro analysis of a panel of kinesins revealed that this compound is selective for MKLP-2 compared to other kinesins tested and also does not have an effect on microtubule dynamics. Upon testing in different cancer cell lines, we find that the more potent paprotrain analog is also more active than paprotrain in 10 different cancer cell lines. Increased selectivity and higher potency is therefore a step forward toward establishing MKLP-2 as a potential cancer drug target. PMID:26778612

  15. Synthesis of herpes simplex virus, vaccinia virus, and adenovirus DNA in isolated HeLa cell nuclei. I. Effect of viral-specific antisera and phosphonoacetic acid.

    PubMed Central

    Bolden, A; Aucker, J; Weissbach, A

    1975-01-01

    Purified nuclei, isolated from appropriately infected HeLa cells, are shown to synthesize large amounts of either herpes simplex virus (HSV) or vaccinia virus DNA in vitro. The rate of synthesis of DNA by nuclei from infected cells is up to 30 times higher than the synthesis of host DNA in vitro by nuclei isolated from uninfected HeLa cells. Thus HSV nuclei obtained from HSV-infected cells make DNA in vitro at a rate comparable to that seen in the intact, infected cell. Molecular hybridization studies showed that 80% of the DNA sequences synthesized in vitro by nuclei from herpesvirus-infected cells are herpesvirus specific. Vaccinia virus nuclei from vaccinia virus-infected cells, also produce comparable percentages of vaccinia virus-specific DNA sequences. Adenovirus nuclei from adenovirus 2-infected HeLa cells, which also synthesize viral DNA in vitro, have been included in this study. Synthesis of DNA by HSV or vaccinia virus nuclei is markedly inhibited by the corresponding viral-specific antisera. These antisera inhibit in a similar fashion the purified herpesvirus-induced or vaccinia virus-induced DNA polymerase isolated from infected cells. Phosphonoacetic acid, reported to be a specific inhibitor of herpesvirus formation and the herpesvirus-induced DNA polymerase, is equally effective as an inhibitor of HSV DNA synthesis in isolated nuclei in vitro. However, we also find phosphonoacetic acid to be an effective inhibitor of vaccinia virus nuclear DNA synthesis and the purified vaccinia virus-induced DNA polymerase. In addition, this compound shows significant inhibition of DNA synthesis in isolated nuclei obtained from adenovirus-infected or uninfected cells and is a potent inhibitor of HeLa cell DNA polymerase alpha. PMID:172658

  16. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc. PMID:19441565

  17. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  18. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  19. The NADPH oxidase inhibitor apocynin induces nitric oxide synthesis via oxidative stress

    SciTech Connect

    Riganti, Chiara

    2008-05-01

    We have recently shown that apocynin elicits an oxidative stress in N11 mouse glial cells and other cell types. Here we report that apocynin increased the accumulation of nitrite, the stable derivative of nitric oxide (NO), in the extracellular medium of N11 cell cultures, and the NO synthase (NOS) activity in cell lysates. The increased synthesis of NO was associated with increased expression of inducible NOS (iNOS) mRNA, increased nuclear translocation of the redox-sensitive transcription factor NF-{kappa}B and decreased intracellular level of its inhibitor IkB{alpha}. These effects, accompanied by increased production of H{sub 2}O{sub 2}, were very similar to those observed after incubation with bacterial lipopolysaccharide (LPS) and were inhibited by catalase. These results suggest that apocynin, similarly to LPS, induces increased NO synthesis by eliciting a generation of reactive oxygen species (ROS), which in turn causes NF-{kappa}B activation and increased expression of iNOS. Therefore, the increased bioavailability of NO reported in the literature after in vivo or in vitro treatments with apocynin might depend, at least partly, on the drug-elicited induction of iNOS, and not only on the inhibition of NADPH oxidase and the subsequent decreased scavenging of NO by oxidase-derived ROS, as it is often supposed.

  20. The synthesis of lysylfluoromethanes and their properties as inhibitors of trypsin, plasmin and cathepsin B.

    PubMed Central

    Angliker, H; Wikstrom, P; Rauber, P; Shaw, E

    1987-01-01

    The synthesis of two lysylfluoromethanes is described by an extension of the synthesis method of Rauber, Angliker, Walker & Shaw [(1986) Biochem. J. 239, 633-640]. Ala-Phe-Lys-CH2F was found to be an active-centre-directed inhibitor of plasmin and trypsin, as is the corresponding chloromethane. However, the rate of covalent-bond formation is about an order of magnitude lower at 25 degrees C for the fluoro derivative. It was, in addition, an extremely effective inactivator of cathepsin B at pH 5.4 and 6.4. The chemical reactivity of fluoromethanes was compared with that of chloromethanes as alkylators of GSH. At pH 7.4 and 37 degrees C, a fluoromethane has 1/500th the reactivity of a chloromethane. A comparison of the rates of reaction of the fluoromethane with cathepsin B and with GSH at pH 6.4 revealed an enhancement of 10(8)-fold for the alkylation of the enzyme, ascribable largely to a proximity effect. PMID:2954536

  1. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.

    1987-01-01

    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  2. Optimization of the Central Heterocycle of α-Ketoheterocycle Inhibitors of Fatty Acid Amide Hydrolase

    PubMed Central

    Garfunkle, Joie; Ezzili, Cyrine; Rayl, Thomas J.; Hochstatter, Dustin G.; Hwang, Inkyu; Boger, Dale L.

    2008-01-01

    The synthesis and evaluation of a refined series of α-ketoheterocycles based on the oxazole 2 (OL-135) incorporating systematic changes in the central heterocycle bearing a key set of added substituents are described. The nature of the central heterocycle, even within the systematic and minor perturbations explored herein, significantly influenced the inhibitor activity: 1,3,4-oxadiazoles and 1,2,4-oxadiazoles 9 > tetrazoles, the isomeric 1,2,4-oxadiazoles 10, 1,3,4-thiadiazoles > oxazoles including 2 > 1,2-diazines > thiazoles > 1,3,4-triazoles. Most evident in these trends is the observation that introduction of an additional heteroatom at position 4 (oxazole numbering, N > O > CH) substantially increases activity that may be attributed to a reduced destabilizing steric interaction at the FAAH active site. Added heterocycle substituents displaying well defined trends may be utilized to enhance the inhibitor potency and, more significantly, to enhance the inhibitor selectivity. These trends, exemplified herein, emerge from both enhancements in the FAAH activity and simultaneous disruption of binding affinity for competitive off-target enzymes. PMID:18630870

  3. Suppression of asymmetric acid efflux and gravitropism in maize roots treated with auxin transport inhibitors of sodium orthovanadate

    NASA Technical Reports Server (NTRS)

    Mulkey, T. J.; Evans, M. L.

    1982-01-01

    In gravitropically stimulated roots of maize (Zea mays L., hybrid WF9 x 38MS), there is more acid efflux on the rapidly growing upper side than on the slowly growing lower side. In light of the Cholodny/Went hypothesis of gravitropism which states that gravitropic curvature results from lateral redistribution of auxin, the effects of auxin transport inhibitors on the development of acid efflux asymmetry and curvature in gravistimulated roots were examined. All the transport inhibitors tested prevented both gravitropism and the development of asymmetric acid efflux in gravistimulated roots. The results indicate that auxin redistribution may cause the asymmetry of acid efflux, a finding consistent with the Cholodny/Went hypothesis of gravitropism. As further evidence that auxin-induced acid efflux asymmetry may mediate gravitropic curvature, sodium orthovanadate, an inhibitor of auxin-induced H+ efflux was found to prevent both gravitropism and the development of asymmetric acid efflux in gravistimulated roots.

  4. Discovery of novel, non-acidic mPGES-1 inhibitors by virtual screening with a multistep protocol

    PubMed Central

    Noha, Stefan M.; Fischer, Katrin; Koeberle, Andreas; Garscha, Ulrike; Werz, Oliver; Schuster, Daniela

    2015-01-01

    Microsomal prostaglandin E2 synthase-1 (mPGES-1) inhibitors are considered as potential therapeutic agents for the treatment of inflammatory pain and certain types of cancer. So far, several series of acidic as well as non-acidic inhibitors of mPGES-1 have been discovered. Acidic inhibitors, however, may have issues, such as loss of potency in human whole blood and in vivo, stressing the importance of the design and identification of novel, non-acidic chemical scaffolds of mPGES-1 inhibitors. Using a multistep virtual screening protocol, the Vitas-M compound library (∼1.3 million entries) was filtered and 16 predicted compounds were experimentally evaluated in a biological assay in vitro. This approach yielded two molecules active in the low micromolar range (IC50 values: 4.5 and 3.8 μM, respectively). PMID:26088337

  5. Effects of VMAT2 inhibitors lobeline and GZ-793A on methamphetamine-induced changes in dopamine release, metabolism and synthesis in vivo.

    PubMed

    Meyer, Andrew C; Neugebauer, Nichole M; Zheng, Guangrong; Crooks, Peter A; Dwoskin, Linda P; Bardo, Michael T

    2013-10-01

    Vesicular monoamine transporter-2 (VMAT2) inhibitors reduce methamphetamine (METH) reward in rats. The current study determined the effects of VMAT2 inhibitors lobeline (LOB; 1 or 3 mg/kg) and N-(1,2R-dihydroxylpropyl)-2,6-cis-di(4-methoxyphenethyl)piperidine hydrochloride (GZ-793A; 15 or 30 mg/kg) on METH-induced (0.5 mg/kg, SC) changes in extracellular dopamine (DA) and its metabolite dihydroxyphenylacetic acid (DOPAC) in the reward-relevant nucleus accumbens (NAc) shell using in vivo microdialysis. The effect of GZ-793A (15 mg/kg) on DA synthesis in tissue also was investigated in NAc, striatum, medial prefrontal cortex and orbitofrontal cortex. In NAc shell, METH produced a time-dependent increase in extracellular DA and decrease in DOPAC. Neither LOB nor GZ-793A alone altered extracellular DA; however, both drugs increased extracellular DOPAC. In combination with METH, LOB did not alter the effects of METH on DA; however, GZ-793A, which has greater selectivity than LOB for inhibiting VMAT2, reduced the duration of the METH-induced increase in extracellular DA. Both LOB and GZ-793A enhanced the duration of the METH-induced decrease in extracellular DOPAC. METH also increased tissue DA synthesis in NAc and striatum, whereas GZ-793A decreased synthesis; no effect of METH or GZ-793A on DA synthesis was found in medial prefrontal cortex or orbitofrontal cortex. These results suggest that selective inhibition of VMAT2 produces a time-dependent decrease in DA release in NAc shell as a result of alterations in tyrosine hydroxylase activity, which may play a role in the ability of GZ-793A to decrease METH reward. PMID:23875705

  6. Modulation of the equilibrative nucleoside transporter by inhibitors of DNA synthesis.

    PubMed Central

    Pressacco, J.; Wiley, J. S.; Jamieson, G. P.; Erlichman, C.; Hedley, D. W.

    1995-01-01

    Expression of the equilibrative, S-(p-nitrobenzyl)-6-thioinosine (NBMPR)-sensitive nucleoside transporter (es), a component of the nucleoside salvage pathway, was measured during unperturbed growth and following exposure to various antimetabolites at growth-inhibitory concentrations. The probe 5-(SAENTA-x8)-fluorescein is a highly modified form of adenosine incorporating a fluorescein molecule. It binds. with high affinity and specificity to the (es) nucleoside transporter at a 1:1 stoichiometry, allowing reliable estimates of es expression by flow cytometry. Using a dual labelling technique which combined the vital DNA dye Hoechst-33342 and 5-(SAENTA-x8)-fluorescein, we found that surface expression of es approximately doubled between G1 and G2 + M phases of the cell cycle. To address the question of whether es expression could be modulated in cells exposed to drugs which inhibit de novo synthesis of nucleotides, cells were exposed to antimetabolite drugs having different modes of action. Hydroxyurea and 5-fluorouracil (5-FU), which inhibit the de novo synthesis of DNA precursors, produced increases in the expression of es. In contrast, cytosine arabinoside (ara-C) and aphidicolin, which directly inhibit DNA synthesis, produced no significant increase in es expression. Thymidine (TdR), which is an allosteric inhibitor of ribonucleotide reductase that depletes dATP, dCTP and dGTP pools while repleting the dTTP pool, had no significant effect on es expression. These data suggest that surface expression of the es nucleoside transporter is regulated by a mechanism which is sensitive to the supply of deoxynucleotides. Because 5-FU (which specifically depletes dTTP pools) causes a large increase in expression whereas TdR (which depletes all precursors except dTTP) does not, this mechanism might be particularly sensitive to dTTP pools. PMID:7547244

  7. Acquisition of a Potent and Selective TC-PTP Inhibitor via a Stepwise Fluorophoretagged Combinatorial Synthesis and Screening Strategy

    PubMed Central

    Zhang, Sheng; Chen, Lan; Luo, Yong; Gunawan, Andrea; Lawrence, David S.; Zhang, Zhong-Yin

    2009-01-01

    Protein tyrosine phosphatases (PTPs) regulate a broad range of cellular processes including proliferation, differentiation, migration, apoptosis, and the immune responses. Dysfunction of PTP activity is associated with cancers, metabolic syndromes, and autoimmune disorders. Consequently, small molecule PTP inhibitors should not only serve as powerful tools to delineate the physiological roles of these enzymes in vivo, but also as lead compounds for therapeutic development. We describe a novel stepwise fluorophore-tagged combinatorial library synthesis and competitive fluorescence polarization screening approach that transforms a weak and general PTP inhibitor into an extremely potent and selective TC-PTP inhibitor with highly efficacious cellular activity. The result serves as a proof-of-concept in PTP inhibitor development, as it demonstrates the feasibility of acquiring potent, yet highly selective, cell permeable PTP inhibitory agents. Given the general nature of the approach, this strategy should be applicable to other PTP targets. PMID:19737019

  8. Regulatory Mechanisms in Anthocyanin Biosynthesis in First Internodes of Sorghum vulgare: Effect of Presumed Inhibitors of Protein Synthesis 1

    PubMed Central

    Stafford, Helen A.

    1966-01-01

    There was a 6 to 24-hour lag in the production of anthocyanins in the light after excision of 4-day-old etiolated internodes of Sorghum vulgare variety Wheatland milo. In internodes infiltrated with water, apigeninidin was formed first at 12 to 24 hours and continued to be produced slowly. Luteolinidin was formed slightly later, but its formation rapidly exceeded that of apigeninidin. Cyanidin was the last type to be produced, but equaled the amounts of luteolinidin by 4 days. In noninfiltrated internodes, the production of cyanidin was greatly accelerated, beginning at about 6 hours. Data from experiments with inhibitors that presumably affect protein synthesis at different loci indicated that protein synthesis was necessary for maximum production of all 3 anthocyanins, but that different steps were rate limiting. Light independent synthesis of apigeninidin and luteolinidin was inhibited by chloramphenicol and l-ethionine but not by actinomycin D and 8-azaguanine. However, the synthesis of these 2 anthocyanins was not inhibited by puromycin, but was sometimes stimulated. The light-induced synthesis of cyanidin was inhibited by actinomycin, azaguanine, chloramphenicol and ethionine. Actinomycin no longer was inhibitory if added after incubation for 6 hours in air. All inhibitors were capable of inhibiting to various degrees either the incorporation of 14C-uracil into RNA or 14C-leucine into protein. The inhibitor data suggest that the light insensitive synthesis of apigeninidin and luteolinidin may be controlled by enzyme synthesis at the level of ribosomes via stable mRNA, while the light-induced production of cyanidin is dependent initially on the production of mRNA. The latter hypothesis is similar to that recently proposed by Lange and Mohr for a cyanidin produced in Sinapis seedlings. PMID:16656361

  9. AMINO ACIDS AUGMENT MUSCLE PROTEIN SYNTHESIS IN NEONATAL PIGS DURING ENDOTOXEMIA BY MODULATING TRANSLATION INITIATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In adults, sepsis reduces protein synthesis in skeletal muscle by restraining translation. The effect of sepsis on amino acid-stimulated muscle protein synthesis has not been determined in neonates, a population who is highly anabolic and whose muscle protein synthesis rates are uniquely sensitive ...

  10. Liver-specific mono-unsaturated fatty acid synthase-1 inhibitor for anti-hepatitis C treatment.

    PubMed

    Nio, Yasunori; Hasegawa, Hikari; Okamura, Hitomi; Miyayama, Yohei; Akahori, Yuichi; Hijikata, Makoto

    2016-08-01

    Recently, direct antiviral agents against hepatitis C virus (HCV) infection have been developed as highly effective anti-HCV drugs. However, the appearance of resistant viruses against direct anti-viral agents is an unsolved problem. One of the strategies considered to suppress the emergence of the drug-resistant viruses is to use drugs inhibiting the host factor, which contributes to HCV proliferation, in combination with direct anti-viral agents. The replication complex was reported to be present in the membranous compartment in the cells. Thus, lipid metabolism modulators are good candidates to regulate virus assembly and HCV replication. Recent studies have shown that stearoyl-CoA desaturase (SCD), an enzyme for long-chain mono-unsaturated fatty acid (LCMUFA) synthesis, is a key factor that defines HCV replication efficiency. Systemic exposure to SCD-1 inhibor induces some side effects in the eyes and skin. Thus, systemic SCD-1 inhibitors are considered inappropriate for HCV therapy. To avoid the side effects of systemic SCD-1 inhibitors, the liver-specific SCD-1 inhibitor, MK8245, was synthesized; it showed antidiabetic effects in diabetic model mice with no side effects. In the phase 1 clinical study on measurement of MK8245 tolerability, no significant side effects were reported (ClinicalTrials.gov Identifier: NCT00790556). Therefore, we thought liver-specific SCD-1 inhibitors would be suitable agents for HCV-infected patients. MK8245 was evaluated using recombinant HCV culture systems. Considering current HCV treatments, to avoid the emergence of direct anti-viral agents-resistant viruses, combination therapy with direct anti-viral agents and host-targeted agents would be optimal. With this viewpoint, we confirmed MK8245's additive or synergistic anti-HCV effects on current direct anti-viral agents and interferon-alpha therapy. The results suggest that MK8245 is an option for anti-HCV multi-drug therapy with a low risk of emergence of drug-resistant HCV

  11. Characterization of inhibitory effects of the potential therapeutic inhibitors, benzoic acid and pyridine derivatives, on the monophenolase and diphenolase activities of tyrosinase

    PubMed Central

    Gheibi, Nematollah; Taherkhani, Negar; Ahmadi, Abolfazl; Haghbeen, Kamahldin; Ilghari, Dariush

    2015-01-01

    Objective(s): Involvement of tyrosinase in the synthesis of melanin and cell signaling pathway has made it an attractive target in the search for therapeutic inhibitors for treatment of different skin hyperpigmentation disorders and melanoma cancers. Materials and Methods: In the present study, we conducted a comprehensive kinetic analysis to understand the mechanisms of inhibition imposed by 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid on the monophenolase and diphenolase activities of the mushroom tyrosinase, and then MTT assay was exploited to evaluate their toxicity on the melanoma cells. Results: Kinetic analysis revealed that nicotinic acid and picolinic acid competitively restricted the monophenolase activity with inhibition constants (Ki) of 1.21 mM and 1.97 mM and the diphenolase activity with Kis of 2.4 mM and 2.93 mM, respectively. 2-aminobenzoic acid and 4-aminobenzoic acid inhibited the monophenolase activity in a non-competitive fashion with Kis of 5.15 µM and 3.8 µM and the diphenolase activity with Kis of 4.72 µM and 20 µM, respectively. Conclusion: Our cell-based data revealed that only the pyridine derivatives imposed cytotoxicity in melanoma cells. Importantly, the concentrations of the inhibitors leading to 50% decrease in the cell density (IC50) were comparable to those causing 50% drop in the enzyme activity, implying that the observed cytotoxicity is highly likely due to the tyrosinase inhibition. Moreover, our cell-based data exhibited that the pyridine derivatives acted as anti-proliferative agents, perhaps inducing cytotoxicity in the melanoma cells through inhibition of the tyrosinase activities. PMID:25810885

  12. Chemical Genetics Uncovers Novel Inhibitors of Lignification, Including p-Iodobenzoic Acid Targeting CINNAMATE-4-HYDROXYLASE.

    PubMed

    Van de Wouwer, Dorien; Vanholme, Ruben; Decou, Raphaël; Goeminne, Geert; Audenaert, Dominique; Nguyen, Long; Höfer, René; Pesquet, Edouard; Vanholme, Bartel; Boerjan, Wout

    2016-09-01

    Plant secondary-thickened cell walls are characterized by the presence of lignin, a recalcitrant and hydrophobic polymer that provides mechanical strength and ensures long-distance water transport. Exactly the recalcitrance and hydrophobicity of lignin put a burden on the industrial processing efficiency of lignocellulosic biomass. Both forward and reverse genetic strategies have been used intensively to unravel the molecular mechanism of lignin deposition. As an alternative strategy, we introduce here a forward chemical genetic approach to find candidate inhibitors of lignification. A high-throughput assay to assess lignification in Arabidopsis (Arabidopsis thaliana) seedlings was developed and used to screen a 10-k library of structurally diverse, synthetic molecules. Of the 73 compounds that reduced lignin deposition, 39 that had a major impact were retained and classified into five clusters based on the shift they induced in the phenolic profile of Arabidopsis seedlings. One representative compound of each cluster was selected for further lignin-specific assays, leading to the identification of an aromatic compound that is processed in the plant into two fragments, both having inhibitory activity against lignification. One fragment, p-iodobenzoic acid, was further characterized as a new inhibitor of CINNAMATE 4-HYDROXYLASE, a key enzyme of the phenylpropanoid pathway synthesizing the building blocks of the lignin polymer. As such, we provide proof of concept of this chemical biology approach to screen for inhibitors of lignification and present a broad array of putative inhibitors of lignin deposition for further characterization. PMID:27485881

  13. Inhibition of protein synthesis may explain the bactericidal properties of hypochlorous acid produced by phagocytic cells

    SciTech Connect

    McKenna, S.M.; Davies, K.J.A.

    1986-05-01

    The authors find that hypochlorous acid (HOCl) and hydrogen peroxide (H/sub 2/O/sub 2/) inhibit protein synthesis in E. coli: HOCl is similarly ordered 10x more efficient than H/sub 2/O/sub 2/. This result may underlie the mechanism of bacterial killing by phagocytes, which use H/sub 2/O/sub 2/ and myeloperoxidase (MPO) to oxidize Cl/sup -/ to HOCl. Protein synthesis (/sup 3/H-leu incorporation) was completely inhibited by 50..mu..M HOCl, whereas 50..mu..M H/sub 2/O/sub 2/ only gave similarly ordered 10% inhibition. Complete inhibition by H/sub 2/O/sub 2/ was only observed at concentrations < 0.5 mM. HOCl was also a more potent inhibitor of cell growth (cultured in M9 medium + glucose) than was H/sub 2/O/sub 2/. No growth occurred at 50..mu..M HOCl: in contrast 0.5 mM H/sub 2/O/sub 2/ was required for similar results. During time-course experiments it was found that the inhibition of cell growth by both HOCl and H/sub 2/O/sub 2/ reached a maximum within 30 min (at any concentration used). HOCl reacts avidly with amino groups to form N-chloroamines but H/sub 2/O/sub 2/ is unreactive. Amino acids (ala, lys, met, trp) or taurine (all at 10 mM) prevented the effects of HOCl but did not affect H/sub 2/O/sub 2/ results. There was an excellent correlation between decreased protein synthesis and diminished cell growth. Inhibition of cell growth was not explained by proteolysis (release of acid-soluble counts), or by loss of membrane integrity. They propose that inhibition of protein synthesis may be a fundamental aspect of the bactericidal functions of phagocytes, and that the production of HOCl by MPO represents a quantitative advantage over H/sub 2/O/sub 2/.

  14. Synthesis and scavenging role of furan fatty acids

    PubMed Central

    Lemke, Rachelle A. S.; Peterson, Amelia C.; Ziegelhoffer, Eva C.; Westphall, Michael S.; Tjellström, Henrik; Coon, Joshua J.; Donohue, Timothy J.

    2014-01-01

    Fatty acids play important functional and protective roles in living systems. This paper reports on the synthesis of a previously unidentified 19 carbon furan-containing fatty acid, 10,13-epoxy-11-methyl-octadecadienoate (9-(3-methyl-5-pentylfuran-2-yl)nonanoic acid) (19Fu-FA), in phospholipids from Rhodobacter sphaeroides. We show that 19Fu-FA accumulation is increased in cells containing mutations that increase the transcriptional response of this bacterium to singlet oxygen (1O2), a reactive oxygen species generated by energy transfer from one or more light-excited donors to molecular oxygen. We identify a previously undescribed class of S-adenosylmethionine-dependent methylases that convert a phospholipid 18 carbon cis unsaturated fatty acyl chain to a 19 carbon methylated trans unsaturated fatty acyl chain (19M-UFA). We also identify genes required for the O2-dependent conversion of this 19M-UFA to 19Fu-FA. Finally, we show that the presence of 1O2 leads to turnover of 19Fu-Fa in vivo. We propose that furan-containing fatty acids like 19Fu-FA can act as a membrane-bound scavenger of 1O2, which is naturally produced by integral membrane enzymes of the R. sphaeroides photosynthetic apparatus. PMID:25092314

  15. Effect of carbonyl inhibitors and their H₂O₂ detoxification on lactic acid fermentation.

    PubMed

    Li, Jing; Zhu, Caiqing; Tu, Maobing; Han, Pingping; Wu, Yonnie

    2015-04-01

    Biomass degradation compounds significantly inhibit biochemical conversion of biomass prehydrolysates to biofuels and chemicals, such as lactic acid. To characterize the structure-activity relationship of carbonyl inhibition on lactic acid fermentation, we examined effects of eight carbonyl compounds (furfural, 5-hydroxymethyl furfural, vanillin, syringaldehyde, 4-hydroxybenzaldehyde, phthalaldehyde, benzoic acid, and pyrogallol aldehyde) and creosol on lactic acid production by Lactobacillus delbrueckii. Pyrogallol aldehyde reduced the cell growth rate by 35 % at 1.0 mM and inhibited lactic acid production completely at 2.0 mM. By correlating the molecular descriptors to the inhibition constants in lactic acid fermentation, we found a good relationship between the hydrophobicity (Log P) of aldehydes and their inhibition constants in fermentation. The inhibitory effect of carbonyl inhibitors appeared to correlate with their thiol reactivity as well. In addition, we found that H2O2 detoxified pyrogallol aldehyde and phthalaldehyde inhibitory activity. H2O2 detoxification was applied to real biomass prehydrolysates in lactic acid fermentation. PMID:25666370

  16. Select microtubule inhibitors increase lysosome acidity and promote lysosomal disruption in acute myeloid leukemia (AML) cells.

    PubMed

    Bernard, Dannie; Gebbia, Marinella; Prabha, Swayam; Gronda, Marcela; MacLean, Neil; Wang, Xiaoming; Hurren, Rose; Sukhai, Mahadeo A; Cho, Eunice E; Manolson, Morris F; Datti, Alessandro; Wrana, Jeffrey; Minden, Mark D; Al-Awar, Rima; Aman, Ahmed; Nislow, Corey; Giaever, Guri; Schimmer, Aaron D

    2015-07-01

    To identify new biological vulnerabilities in acute myeloid leukemia, we screened a library of natural products for compounds cytotoxic to TEX leukemia cells. This screen identified the novel small molecule Deoxysappanone B 7,4' dimethyl ether (Deox B 7,4), which possessed nanomolar anti-leukemic activity. To determine the anti-leukemic mechanism of action of Deox B 7,4, we conducted a genome-wide screen in Saccharomyces cerevisiae and identified enrichment of genes related to mitotic cell cycle as well as vacuolar acidification, therefore pointing to microtubules and vacuolar (V)-ATPase as potential drug targets. Further investigations into the mechanisms of action of Deox B 7,4 and a related analogue revealed that these compounds were reversible microtubule inhibitors that bound near the colchicine site. In addition, Deox B 7,4 and its analogue increased lysosomal V-ATPase activity and lysosome acidity. The effects on microtubules and lysosomes were functionally important for the anti-leukemic effects of these drugs. The lysosomal effects were characteristic of select microtubule inhibitors as only the Deox compounds and nocodazole, but not colchicine, vinca alkaloids or paclitaxel, altered lysosome acidity and induced lysosomal disruption. Thus, our data highlight a new mechanism of action of select microtubule inhibitors on lysosomal function. PMID:25832785

  17. N-substituted aminomethanephosphonic and aminomethane-P-methylphosphinic acids as inhibitors of ureases.

    PubMed

    Berlicki, Lukasz; Bochno, Marta; Grabowiecka, Agnieszka; Białas, Arkadiusz; Kosikowska, Paulina; Kafarski, Paweł

    2012-05-01

    Small unextended molecules based on the diamidophosphate structure with a covalent carbon-to-phosphorus bond to improve hydrolytic stability were developed as a novel group of inhibitors to control microbial urea decomposition. Applying a structure-based inhibitor design approach using available crystal structures of bacterial urease, N-substituted derivatives of aminomethylphosphonic and P-methyl-aminomethylphosphinic acids were designed and synthesized. In inhibition studies using urease from Bacillus pasteurii and Canavalia ensiformis, the N,N-dimethyl derivatives of both lead structures were most effective with dissociation constants in the low micromolar range (Ki=13±0.8 and 0.62±0.09 μM, respectively). Whole-cell studies on a ureolytic strain of Proteus mirabilis showed the high efficiency of N,N-dimethyl and N-methyl derivatives of aminomethane-P-methylphosphinic acids for urease inhibition in pathogenic bacteria. The high hydrolytic stability of selected inhibitors was confirmed over a period of 30 days using NMR technique. PMID:21559954

  18. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. PMID:27012633

  19. The novel azole R126638 is a selective inhibitor of ergosterol synthesis in Candida albicans, Trichophyton spp., and Microsporum canis.

    PubMed

    Vanden Bossche, Hugo; Ausma, Jannie; Bohets, Hilde; Vermuyten, Karen; Willemsens, Gustaaf; Marichal, Patrick; Meerpoel, Lieven; Odds, Frank; Borgers, Marcel

    2004-09-01

    R126638 is a novel triazole with in vitro activity similar to that of itraconazole against dermatophytes, Candida spp., and Malassezia spp. In animal models of dermatophyte infections, R126638 showed superior antifungal activity. R126638 inhibits ergosterol synthesis in Candida albicans, Trichophyton mentagrophytes, Trichophyton rubrum, and Microsporum canis at nanomolar concentrations, with 50% inhibitory concentrations (IC(50)s) similar to those of itraconazole. The decreased synthesis of ergosterol and the concomitant accumulation of 14 alpha-methylsterols provide indirect evidence that R126638 inhibits the activity of CYP51 that catalyzes the oxidative removal of the 14 alpha-methyl group of lanosterol or eburicol. The IC(50)s for cholesterol synthesis from acetate in human hepatoma cells were 1.4 microM for itraconazole and 3.1 microM for R126638. Compared to itraconazole (IC(50) = 3.5 microM), R126638 is a poor inhibitor of the 1 alpha-hydroxylation of 25-hydroxyvitamin D(3) (IC(50) > 10 microM). Micromolar concentrations of R126638 and itraconazole inhibited the 24-hydroxylation of 25-hydroxyvitamin D(3) and the conversion of 1,25-dihydroxyvitamin D(3) into polar metabolites. At concentrations up to 10 microM, R126638 had almost no effect on cholesterol side chain cleavage (CYP11A1), 11 beta-hydroxylase (CYP11B1), 17-hydroxylase and 17,20-lyase (CYP17), aromatase (CYP19), or 4-hydroxylation of all-trans retinoic acid (CYP26). At 10 microM, R126638 did not show clear inhibition of CYP1A2, CYP2A6, CYP2D6, CYP2C8, CYP2C9, CYP2C10, CYP2C19, or CYP2E1. Compared to itraconazole, R126638 had a lower interaction potential with testosterone 6 beta hydroxylation and cyclosporine hydroxylation, both of which are catalyzed by CYP3A4, whereas both antifungals inhibited the CYP3A4-catalyzed hydroxylation of midazolam similarly. The results suggest that R126638 has promising properties and merits further in vivo investigations for the treatment of dermatophyte and yeast

  20. Synthesis and biological activities of tricyclic conformationally restricted tetrahydropyrido annulated furo[2,3-d]pyrimidines as inhibitors of dihydrofolate reductases.

    PubMed

    Gangjee, A; Elzein, E; Queener, S F; McGuire, J J

    1998-04-23

    The synthesis of seven 2,4-diamino-5,6,7,8-tetrahydro-7-substituted pyrido[4',3':4,5]furo[2,3-d]pyrimidines 1-6 are reported as nonclassical antifolate inhibitors of dihydrofolate reductase (DHFR) and compound 7 as a classical antifolate inhibitor of tumor cells in culture. The compounds were designed as conformationally restricted analogues of trimetrexate. The synthesis was accomplished from the cyclocondensation of 3-bromo-4-piperidone with 2, 4-diamino-6-hydroxypyrimidine to afford regiospecifically 2, 4-diamino-5,6,7,8-tetrahydropyrido[4',3':4,5]furo[2, 3-d]pyrimidine-7-hydrobromide (16). This in turn was alkylated with the appropriate benzyl halide to afford the target compounds 1-6. The classical antifolate 7 utilized 4-(chloromethyl)benzoyl-l-glutamic acid diethyl ester (17) instead of the benzyl halide for alkylation, followed by saponification to afford 7. Compounds 1-6 showed moderate inhibitory potency against DHFR from Pneumocystis carinii, Toxoplasma gondii, Mycobacterium avium, and rat liver. The classical analogue 7 was 88-fold more potent against M. avium DHFR than against rat liver DHFR. The classical analogue was also inhibitory against the growth of tumor cells, CCRF-CEM, and FaDu, in culture. PMID:9554874

  1. Design and synthesis of thiourea derivatives with sulfur-containing heterocyclic scaffolds as potential tyrosinase inhibitors.

    PubMed

    Liu, Pingping; Shu, Chen; Liu, Lujie; Huang, Qingchun; Peng, Yanqing

    2016-04-15

    Tyrosinase is a key enzyme during the production of melanins in plants and animals. A class of novel N-aryl-N'-substituted phenylthiourea derivatives (3a-i, 6a-k) were designed, synthesized and their inhibitory effects on the diphenolase activity of mushroom tyrosinase were evaluated. The results showed some 4,5,6,7-tetrahydro-2-[[(phenylamino)thioxomethyl]amino]-benzo[b]thiophene-3-carboxylic acid derivatives (3a-i) exhibited moderate inhibitory potency on diphenolase activity of tyrosinase. When the scaffold of 4,5,6,7-tetrahydrobenzo[b]thiophene-3-carboxylic acid was replaced with 2-(1,3,4-thiadiazol-2-yl)thio acetic acid, the inhibitory activity of compounds (6a-k) against tyrosinase was improved obviously; especially, the inhibitory activity of compound 6h (IC50=6.13 μM) is significantly higher than kojic acid (IC50=33.3 μM). Moreover, the analysis on inhibition mechanism revealed that compound 6h might plays the role as a noncompetitive inhibitor. PMID:26972919

  2. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  3. Development of novel ferulic acid derivatives as potent histone deacetylase inhibitors.

    PubMed

    Wang, Fang; Lu, Wen; Zhang, Tao; Dong, Jinyun; Gao, Hongping; Li, Pengfei; Wang, Sicen; Zhang, Jie

    2013-11-15

    Histone deacetylase inhibitors (HDACIs) offer a promising strategy for cancer therapy. The discovery of potent ferulic acid-based HDACIs with hydroxamic acid or 2-aminobenzamide group as zinc binding group was reported. The halogeno-acetanilide was introduced as novel surface recognition moiety (SRM). The majority of title compounds displayed potent HDAC inhibitory activity. In particular, FA6 and FA16 exhibited significant enzymatic inhibitory activities, with IC50 values of 3.94 and 2.82 μM, respectively. Furthermore, these compounds showed moderate antiproliferative activity against a panel of human cancer cells. FA17 displayed promising profile as an antitumor candidate. The results indicated that these ferulic acid derivatives could serve as promising lead compounds for further optimization. PMID:24095016

  4. Discovery of arjunolic acid as a novel non-zinc binding carbonic anhydrase II inhibitor.

    PubMed

    Kalyanavenkataraman, Subhalakshmi; Nanjan, Pandurangan; Banerji, Asoke; Nair, Bipin G; Kumar, Geetha B

    2016-06-01

    Elevated levels of carbonic anhydrase II (CA II) have been shown to be associated with cardiac hypertrophy and heart failure. Although arjunolic acid (AA) has a diverse range of therapeutic applications including cardio-protection, there have been no reports on the effect of AA on CA II. The present study describes for the first time, the novel zinc independent inhibition of CA II by AA. The molecular docking studies of AA indicated that the hydroxyl group at C2 of the A-ring, which hydrogen bonds with the catalytic site residues (His64, Asn62 and Asn67), along with the gem-dimethyl group at C20 of the E-ring, greatly influences the inhibitory activity, independent of the catalytic zinc, unlike the inhibition observed with most CA II inhibitors. Among the triterpenoids tested viz. arjunolic acid, arjunic acid, asiatic acid, oleanolic acid and ursolic acid, AA was the most potent in inhibiting CA II in vitro with an IC50 of 9μM. It was interesting to note, that in spite of exhibiting very little differences in their structures, these triterpenoids exhibited vast differences in their inhibitory activities, with IC50 values ranging from 9μM to as high as 333μM. Furthermore, AA also inhibited the cytosolic activity of CA in H9c2 cardiomyocytes, as reflected by the decrease in acidification of the intracellular pH (pHi). The decreased acidification reduced the intracellular calcium levels, which further prevented the mitochondrial membrane depolarization. Thus, these studies provide a better understanding for establishing the novel molecular mechanism involved in CA II inhibition by the non-zinc binding inhibitor AA. PMID:27038848

  5. Novel CYP17 inhibitors: synthesis, biological evaluation, structure-activity relationships and modelling of methoxy- and hydroxy-substituted methyleneimidazolyl biphenyls.

    PubMed

    Hille, Ulrike E; Hu, Qingzhong; Vock, Carsten; Negri, Matthias; Bartels, Marc; Müller-Vieira, Ursula; Lauterbach, Thomas; Hartmann, Rolf W

    2009-07-01

    Recently, the steroidal CYP17 inhibitor Abiraterone entered phase II clinical trial for the treatment of androgen-dependent prostate cancer. As 17alpha-hydroxylase-17,20-lyase (CYP17) catalyzes the last step in androgen biosynthesis, inhibition of this target should affect not only testicular but also adrenal androgen formation. Therefore CYP17 inhibitors should be advantageous over existing therapies, for example with GnRH analogues. However, steroidal drugs are known for side effects which are due to affinities for steroid receptors. Therefore we decided to synthesize non-steroidal compounds mimicking the natural CYP17 substrates pregnenolone and progesterone. The synthesis and biological evaluation of a series of 15 novel and highly active non-steroidal CYP17 inhibitors are reported. The compounds were prepared via Suzuki-cross-coupling, Grignard reaction and CDI-assisted S(N)t-reaction with imidazole and their inhibitory activity was examined with recombinant human CYP17 expressed in Escherichia coli. Promising compounds were further tested for their selectivity against the hepatic enzyme CYP3A4 and the glucocorticoid-forming enzyme CYP11B1. All compounds turned out to be potent CYP17 inhibitors. The most active compounds 7 and 8 were much more active than Ketoconazole showing activity comparable to Abiraterone (IC(50) values of 90 and 52nM vs. 72nM). Most compounds also showed higher selectivities than Ketoconazole, but turned out to be less selective than Abiraterone. Docking studies using our CYP17 protein model were performed with selected compounds to study the interactions between the inhibitors and the amino acid residues of the active site. PMID:19211174

  6. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved. PMID:17511507

  7. Design and synthesis of a novel, orally active, brain penetrant, tri-substituted thiophene based JNK inhibitor

    SciTech Connect

    Bowers, Simeon; Truong, Anh P.; Neitz, R. Jeffrey; Neitzel, Martin; Probst, Gary D.; Hom, Roy K.; Peterson, Brian; Galemmo, Jr., Robert A.; Konradi, Andrei W.; Sham, Hing L.; Tóth, Gergley; Pan, Hu; Yao, Nanhua; Artis, Dean R.; Brigham, Elizabeth F.; Quinn, Kevin P.; Sauer, John-Michael; Powell, Kyle; Ruslim, Lany; Ren, Zhao; Bard, Frédérique; Yednock, Ted A.; Griswold-Prenner, Irene

    2012-02-28

    The SAR of a series of tri-substituted thiophene JNK3 inhibitors is described. By optimizing both the N-aryl acetamide region of the inhibitor and the 4-position of the thiophene we obtained single digit nanomolar compounds, such as 47, which demonstrated an in vivo effect on JNK activity when dosed orally in our kainic acid mouse model as measured by phospho-c-jun reduction.

  8. Protein synthesis in isolated rabbit forelimb muscles. The possible role of metabolites of arachidonic acid in the response to intermittent stretching.

    PubMed Central

    Smith, R H; Palmer, R M; Reeds, P J

    1983-01-01

    Protein synthesis was measured in isolated intact rabbit muscles by the incorporation of [3H]phenylalanine added at a high concentration (2.5 mM) to the incubation medium. Intermittent mechanical stretching substantially increased the rate of protein synthesis relative to that in control muscles incubated under a constant tension. Indomethacin and meclofenamic acid, inhibitors of the enzyme cyclo-oxygenase, which converts free arachidonic acid into the prostaglandins, prostacyclins and thromboxanes, decreased the rate of protein synthesis in intermittently stretched muscles, but had no effect on synthesis rates in the unstimulated controls. Arachidonic acid at concentrations of 0.2 and 1.0 microM gave a highly significant increase in the rate of protein synthesis in muscles incubated under a constant tension. The ability of arachidonic acid to increase protein-synthesis rates was abolished by the addition of indomethacin. Activation of protein synthesis by intermittent stretching persisted for 10-20 min after the stretch stimulation had ceased. Indomethacin, added either during the initial incubation with intermittent stretching or during the subsequent period when protein synthesis was measured after stimulation had ceased, decreased protein-synthesis rates. This decrease was similar whether indomethacin was present during the initial, final or entire incubation period. In experiments analogous with those in (4) above, when Ca2+ was withheld and EGTA added for the entire incubation, rates of protein synthesis were again decreased. The rates of protein synthesis observed when Ca2+ was present during either an initial stimulation phase or a final, unstimulated, measurement phase were similar, and were intermediate between control rates and those in muscles incubated without Ca2+ for the whole experiment. Two prostaglandins, F2 alpha (2.8 microM) and A1 (28 microM), increased rates of protein synthesis in unstimulated muscles, but prostaglandins E2 and D2 and the

  9. Synthesis of HCV replicase inhibitors: base-catalyzed synthesis of protected α-hydrazino esters and selective aerobic oxidation with catalytic Pt/Bi/C for synthesis of imidazole-4,5-dicarbaldehyde.

    PubMed

    Bowman, Roy K; Brown, Andrew D; Cobb, Jannine H; Eaddy, John F; Hatcher, Mark A; Leivers, Martin R; Miller, John F; Mitchell, Mark B; Patterson, Daniel E; Toczko, Matthew A; Xie, Shiping

    2013-12-01

    A robust convergent synthesis of the prodrugs of HCV replicase inhibitors 1-5 is described. The central 5H-imidazo[4,5-d]pyridazine core was formed from acid-catalyzed cyclocondensation of an imidazole-4,5-dicarbaldehyde (20) and a α-hydrazino ester, generated in situ from the bis-BOC-protected precursors 25 and 33. The acidic conditions not only released the otherwise unstable α-hydrazino esters but also were the key to avoid facile decarboxylation to the parent drugs from the carboxylic ester prodrugs 1-5. The bis-BOC α-hydrazino esters 25 and 33 were prepared by addition of ester enolates (from 23 and 32) to di-tert-butyl azodicarboxylate via catalysis with mild inorganic bases, such as Li2CO3. A selective aerobic oxidation with catalytic 5% Pt-Bi/C in aqueous KOH was developed to provide the dicarbaldehyde 20 from the diol 27. PMID:24171666

  10. Synthesis and structure-activity relationship of piperidine-derived non-urea soluble epoxide hydrolase inhibitors

    SciTech Connect

    Pecic, Stevan; Pakhomova, Svetlana; Newcomer, Marcia E.; Morisseau, Christophe; Hammock, Bruce D.; Zhu, Zhengxiang; Rinderspacher, Alison; Deng, Shi-Xian

    2013-09-27

    A series of potent amide non-urea inhibitors of soluble epoxide hydrolase (sEH) is disclosed. The inhibition of soluble epoxide hydrolase leads to elevated levels of epoxyeicosatrienoic acids (EETs), and thus inhibitors of sEH represent one of a novel approach to the development of vasodilatory and anti-inflammatory drugs. Structure–activities studies guided optimization of a lead compound, identified through high-throughput screening, gave rise to sub-nanomolar inhibitors of human sEH with stability in human liver microsomal assay suitable for preclinical development.

  11. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  12. Inhibition of Pig Phosphoenolpyruvate Carboxykinase Isoenzymes by 3-Mercaptopicolinic Acid and Novel Inhibitors.

    PubMed

    Hidalgo, Jorge; Latorre, Pedro; Carrodeguas, José Alberto; Velázquez-Campoy, Adrián; Sancho, Javier; López-Buesa, Pascual

    2016-01-01

    There exist two isoforms of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) in pig populations that differ in a single amino acid (Met139Leu). The isoenzymes have different kinetic properties, affecting more strongly the Km and Vmax of nucleotides. They are associated to different phenotypes modifying traits of considerable economic interest. In this work we use inhibitors of phosphoenolpyruvate carboxykinase activity to search for further differences between these isoenzymes. On the one hand we have used the well-known inhibitor 3-mercaptopicolinic acid. Its inhibition patterns were the same for both isoenzymes: a three-fold decrease of the Ki values for GTP in 139Met and 139Leu (273 and 873 μM, respectively). On the other hand, through screening of a chemical library we have found two novel compounds with inhibitory effects of a similar magnitude to that of 3-mercaptopicolinic acid but with less solubility and specificity. One of these novel compounds, (N'1-({5-[1-methyl-5-(trifluoromethyl)-1H-pyrazol-3-yl]-2-thienyl}methylidene)-2,4-dichlorobenzene-1-carbohydrazide), exhibited significantly different inhibitory effects on either isoenzyme: it enhanced threefold the apparent Km value for GTP in 139Met, whereas in 139Leu, it reduced it from 99 to 69 μM. The finding of those significant differences in the binding of GTP reinforces the hypothesis that the Met139Leu substitution affects strongly the nucleotide binding site of PEPCK-C. PMID:27391465

  13. Inhibition of Pig Phosphoenolpyruvate Carboxykinase Isoenzymes by 3-Mercaptopicolinic Acid and Novel Inhibitors

    PubMed Central

    Hidalgo, Jorge; Latorre, Pedro; Carrodeguas, José Alberto; Velázquez-Campoy, Adrián; Sancho, Javier; López-Buesa, Pascual

    2016-01-01

    There exist two isoforms of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) in pig populations that differ in a single amino acid (Met139Leu). The isoenzymes have different kinetic properties, affecting more strongly the Km and Vmax of nucleotides. They are associated to different phenotypes modifying traits of considerable economic interest. In this work we use inhibitors of phosphoenolpyruvate carboxykinase activity to search for further differences between these isoenzymes. On the one hand we have used the well-known inhibitor 3-mercaptopicolinic acid. Its inhibition patterns were the same for both isoenzymes: a three-fold decrease of the Ki values for GTP in 139Met and 139Leu (273 and 873 μM, respectively). On the other hand, through screening of a chemical library we have found two novel compounds with inhibitory effects of a similar magnitude to that of 3-mercaptopicolinic acid but with less solubility and specificity. One of these novel compounds, (N'1-({5-[1-methyl-5-(trifluoromethyl)-1H-pyrazol-3-yl]-2-thienyl}methylidene)-2,4-dichlorobenzene-1-carbohydrazide), exhibited significantly different inhibitory effects on either isoenzyme: it enhanced threefold the apparent Km value for GTP in 139Met, whereas in 139Leu, it reduced it from 99 to 69 μM. The finding of those significant differences in the binding of GTP reinforces the hypothesis that the Met139Leu substitution affects strongly the nucleotide binding site of PEPCK-C. PMID:27391465

  14. Serum albumin and α-1 acid glycoprotein impede the killing of Schistosoma mansoni by the tyrosine kinase inhibitor Imatinib.

    PubMed

    Beckmann, Svenja; Long, Thavy; Scheld, Christina; Geyer, Rudolf; Caffrey, Conor R; Grevelding, Christoph G

    2014-12-01

    In the search for new drugs and drug targets to treat the flatworm disease schistosomiasis, protein kinases (PKs) have come under particular scrutiny because of their essential roles in developmental and physiological processes in schistosome parasites. In this context the application of the anti-cancer Abl tyrosine kinase (TK) inhibitor Imatinib (Gleevec/Glivec; STI-571) to adult Schistosoma mansoni in vitro has indicated negative effects on diverse physiological processes including survival. Motivated by these in vitro findings, we performed in vivo experiments in rodent models of S. mansoni infection. Unexpectedly, Imatinib had no effect on worm burden or egg-production. We found that the blood components serum albumin (SA) and alpha-1 acid glycoprotein (AGP or orosomucoid) negated Imatinib's deleterious effects on adult S. mansoni and schistosomula (post-infective larvae) in vitro. This negative effect was partially reversed by erythromycin. AGP synthesis can increase as a consequence of inflammatory processes or infection; in addition upon infection AGP levels are 6-8 times higher in mice compared to humans. Therefore, mice and probably other rodents are poor infection models for measuring the effects of Imatinib in vivo. Accordingly, we suggest the routine evaluation of the ability of AGP and SA to block in vitro anti-schistosomal effects of small molecules like Imatinib prior to laborious and expensive animal experiments. PMID:25516839

  15. Serum albumin and α-1 acid glycoprotein impede the killing of Schistosoma mansoni by the tyrosine kinase inhibitor Imatinib

    PubMed Central

    Beckmann, Svenja; Long, Thavy; Scheld, Christina; Geyer, Rudolf; Caffrey, Conor R.; Grevelding, Christoph G.

    2014-01-01

    In the search for new drugs and drug targets to treat the flatworm disease schistosomiasis, protein kinases (PKs) have come under particular scrutiny because of their essential roles in developmental and physiological processes in schistosome parasites. In this context the application of the anti-cancer Abl tyrosine kinase (TK) inhibitor Imatinib (Gleevec/Glivec; STI-571) to adult Schistosoma mansoni in vitro has indicated negative effects on diverse physiological processes including survival. Motivated by these in vitro findings, we performed in vivo experiments in rodent models of S. mansoni infection. Unexpectedly, Imatinib had no effect on worm burden or egg-production. We found that the blood components serum albumin (SA) and alpha-1 acid glycoprotein (AGP or orosomucoid) negated Imatinib’s deleterious effects on adult S. mansoni and schistosomula (post-infective larvae) in vitro. This negative effect was partially reversed by erythromycin. AGP synthesis can increase as a consequence of inflammatory processes or infection; in addition upon infection AGP levels are 6–8 times higher in mice compared to humans. Therefore, mice and probably other rodents are poor infection models for measuring the effects of Imatinib in vivo. Accordingly, we suggest the routine evaluation of the ability of AGP and SA to block in vitro anti-schistosomal effects of small molecules like Imatinib prior to laborious and expensive animal experiments. PMID:25516839

  16. Design, Synthesis, and Evaluation of Donepezil-Like Compounds as AChE and BACE-1 Inhibitors.

    PubMed

    Costanzo, Paola; Cariati, Luca; Desiderio, Doriana; Sgammato, Roberta; Lamberti, Anna; Arcone, Rosaria; Salerno, Raffaele; Nardi, Monica; Masullo, Mariorosario; Oliverio, Manuela

    2016-05-12

    An ecofriendly synthetic pathway for the synthesis of donepezil precursors is described. Alternative energy sources were used for the total synthesis in order to improve yields, regioselectively, and rate of each synthetic step and to reduce the coproduction of waste at the same time. For all products, characterized by an improved structural rigidity respect to donepezil, the inhibitor activity on AChE, the selectivity vs BuChE, the side-activity on BACE-1, and the effect on SHSY-5Y neuroblastoma cells viability were tested. Two potential new lead compounds for a dual therapeutic strategy against Alzheimer's disease were envisaged. PMID:27190595

  17. Synthesis and biological evaluation of several dephosphonated analogues of CMP-Neu5Ac as inhibitors of GM3-synthase.

    PubMed

    Rota, Paola; Cirillo, Federica; Piccoli, Marco; Gregorio, Antonio; Tettamanti, Guido; Allevi, Pietro; Anastasia, Luigi

    2015-10-01

    Previous studies demonstrated that reducing the GM3 content in myoblasts increased the cell resistance to hypoxic stress, suggesting that a pharmacological inhibition of the GM3 synthesis could be instrumental for the development of new treatments for ischemic diseases. Herein, the synthesis of several dephosphonated CMP-Neu5Ac congeners and their anti-GM3-synthase activity is reported. Biological activity testes revealed that some inhibitors almost completely blocked the GM3-synthase activity in vitro and reduced the GM3 content in living embryonic kidney 293A cells, eventually activating the epidermal growth factor receptor (EGFR) signaling cascade. PMID:26397189

  18. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  19. Design and synthesis of 2,3-dihydro- and 5-chloro-2,3-dihydro-naphtho-[1,2-b]furan-2-carboxylic acid N-(substitutedphenyl)amide analogs and their biological activities as inhibitors of NF-κB activity and anticancer agents.

    PubMed

    Choi, Minho; Jo, Hyeju; Kim, Dayoung; Yun, Jieun; Kang, Jong-Soon; Kim, Youngsoo; Jung, Jae-Kyung; Hong, Jin Tae; Cho, Jungsook; Kwak, Jae-Hwan; Lee, Heesoon

    2016-05-01

    A series of 2,3-dihydro- and 5-chloro-2,3-dihydro-naphtho-[1,2-b]furan-2-carboxylic acid N-(substitutedphenyl)amide analogs (1a-k and 2a-i) were designed and synthesized for developing novel naphthofuran scaffolds as anticancer agents and inhibitors of NF-κB activity. Compound 1d, which had a 4'-chloro group on the N-phenyl ring, exhibited inhibitory activity of NF-κB. Compound 2g, which had a 5'-chloro group on the naphthofuran ring and a 3',5'-bistrifluoromethane group on the N-phenyl ring, had the best NF-κB inhibitory activity. In addition, the novel analogs exhibited potent cytotoxicity at low concentrations against HCT-116, NCI-H23, and PC-3 cell lines. The two electron-withdrawing groups, especially at the 3',5'-position on the N-phenyl ring, increased anticancer activity and NF-κB inhibitory activity. However, only 5-chloro-2,3-dihydronaphtho[1,2-b]furan-2-carboxylic N-(3',5'-bis(trifluoromethyl)phenyl)amide (2g) exhibited both outstanding cytotoxicity and NF-κB inhibitory activities. This novel lead scaffold may be helpful for investigation of new anticancer agents by inactivation of NF-κB. PMID:27021311

  20. C-3 benzoic acid derivatives of C-3 deoxybetulinic acid and deoxybetulin as HIV-1 maturation inhibitors.

    PubMed

    Liu, Zheng; Swidorski, Jacob J; Nowicka-Sans, Beata; Terry, Brian; Protack, Tricia; Lin, Zeyu; Samanta, Himadri; Zhang, Sharon; Li, Zhufang; Parker, Dawn D; Rahematpura, Sandhya; Jenkins, Susan; Beno, Brett R; Krystal, Mark; Meanwell, Nicholas A; Dicker, Ira B; Regueiro-Ren, Alicia

    2016-04-15

    A series of C-3 phenyl- and heterocycle-substituted derivatives of C-3 deoxybetulinic acid and C-3 deoxybetulin was designed and synthesized as HIV-1 maturation inhibitors (MIs) and evaluated for their antiviral activity and cytotoxicity in cell culture. A 4-subsituted benzoic acid moiety was identified as an advantageous replacement for the 3'3'-dimethylsuccinate moiety present in previously disclosed MIs that illuminates new aspects of the topography of the pharmacophore. The new analogs exhibit excellent in vitro antiviral activity against wild-type (wt) virus and a lower serum shift when compared with the prototypical HIV-1 MI bevirimat (1, BVM), the first MI to be evaluated in clinical studies. Compound 9a exhibits comparable cell culture potency toward wt virus as 1 (WT EC50=16nM for 9a compared to 10nM for 1). However, the potency of 9a is less affected by the presence of human serum, while the compound displays a similar pharmacokinetic profile in rats to 1. Hence 9a, the 4-benzoic acid derivative of deoxybetulinic acid, represents a new starting point from which to explore the design of a 2nd generation MI. PMID:26968652