Science.gov

Sample records for acid synthesis inhibitor

  1. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  2. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  3. The use of ascorbate as an oxidation inhibitor in prebiotic amino acid synthesis: a cautionary note.

    PubMed

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO(2)-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO(2) was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO(2)-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO(2)-rich atmosphere under the conditions studied.

  4. Synthesis of quaternary α-amino acid-based arginase inhibitors via the Ugi reaction.

    PubMed

    Golebiowski, Adam; Whitehouse, Darren; Beckett, R Paul; Van Zandt, Michael; Ji, Min Koo; Ryder, Todd R; Jagdmann, Erik; Andreoli, Monica; Lee, Yung; Sheeler, Ryan; Conway, Bruce; Olczak, Jacek; Mazur, Marzena; Czestkowski, Wojciech; Piotrowska, Wieslawa; Cousido-Siah, Alexandra; Ruiz, Francesc X; Mitschler, Andre; Podjarny, Alberto; Schroeter, Hagen

    2013-09-01

    The Ugi reaction has been successfully applied to the synthesis of novel arginase inhibitors. In an effort to decrease conformational flexibility of the previously reported series of 2-amino-6-boronohexanoic acid (ABH) analogs 1, we designed and synthesized a series of compounds, 2, in which a piperidine ring is linked directly to a quaternary amino acid center. Further improvement of in vitro activity was achieved by adding two carbon bridge in the piperidine ring, that is, tropane analogs 11. These improvements in activity are rationalized by X-ray crystallography analysis, which show that the tropane ring nitrogen atom moves into direct contact with Asp202 (arginase II numbering). The synthetic routes described here enabled the design of novel arginase inhibitors with improved potency and markedly different physico-chemical properties compared to ABH. Compound 11c represents the most in vitro active arginase inhibitor reported to date.

  5. Synthesis of 11-Thialinoleic Acid and 14-Thialinoleic Acid, Inhibitors of Soybean and Human Lipoxygenases

    PubMed Central

    Jacquot, Cyril; McGinley, Chris M.; Plata, Erik; Holman, Theodore R.

    2010-01-01

    Lipoxygenases catalyse the oxidation of polyunsaturated fatty acids and have been invoked in many diseases including cancer, atherosclerosis and Alzheimer’s disease. Currently, no X-ray structures are available with substrate or substrate analogues bound in a productive conformation. Such structures would be very useful for examining interactions between substrate and active site residues. Reported here are the syntheses of linoleic acid analogues containing a sulphur atom at the 11 or 14 positions. The key steps in the syntheses were the incorporation of sulphur using nucleophilic attack of metallated alkynes on electrophilic sulphur compounds and the subsequent stereospecific tantalum-mediated reduction of the alkynylsulphide to the cis-alkenylsulphide. Kinetic assays performed with soybean lipoxygenase-1 showed that both 11-thialinoleic acid and 14-thialinoleic acid were competitive inhibitors with respect to linoleic acid with Ki values of 22 and 35 µM, respectively. On the other hand, 11-thialinoleic acid was a noncompetitive inhibitor with respect to arachidonic acid with Kis and Kii values of 48 and 36 µM, respectively. 11-Thialinoleic acid was also a noncompetitive inhibitor of human 15-lipoxygenase-1 with arachidonic acid (Kis = 11.4 µM, Kii = 18.1 µM) or linoleic acid as substrate (Kis = 20.1 µM, Kii = 20.0 µM), and a competitive inhibitor of human 12-lipoxygenase with arachidonic acid as substrate (Ki = 2.5 µM). The presence of inhibitor did not change the regioselectivity of soybean lipoxygenase-1, human 12- or 15-lipoxygenase-1. PMID:18972057

  6. Synthesis and characterization of phosphocitric acid, a potent inhibitor of hydroxylapatite crystal growth.

    PubMed

    Tew, W P; Mahle, C; Benavides, J; Howard, J E; Lehninger, A L

    1980-04-29

    Human urine and extracts of rat liver mitochondria contain apparently identical agents capable of inhibiting the precipitation or crystallization of calcium phosphate. Its general properties, as well as 1H NMR and mass spectra, have suggested that the agent is phosphocitric acid. This paper reports the synthesis of phosphocitric acid via the phosphorylation of triethyl citrate with o-phenylene phosphochloridate, hydrogenolysis of the product to yield triethyl phosphocitrate, hydrolytic removal of the blocking ethyl groups and also chromatographic purification. An enzymatic assay of phosphocitrate is described. Synthetic phosphocitrate was found to be an exceedingly potent inhibitor of the growth of hydroxylapatite seed crystals in a medium supersaturated with respect to Ca2+ and phosphate. Comparative assays showed phosphocitrate to be much more potent than the most active precipitation-crystallization inhibitors previously reported, which include pyrophosphate and ATP. 14C-Labeled phosphocitrate was bound very tightly to hydroxylapatite crystals. Such binding appeared to be essential for its inhibitory activity on crystal growth. Citrate added before but not after, phosphocitrate greatly enhanced the inhibitory potency of the latter. This enhancement effect was not given by other tricarboxylic acids. The monoethyl ester of phosphocitrate had no inhibitory effect on hydroxylapatite crystal growth.

  7. Treatment with the hyaluronic Acid synthesis inhibitor 4-methylumbelliferone suppresses LPS-induced lung inflammation.

    PubMed

    McKallip, Robert J; Ban, Hao; Uchakina, Olga N

    2015-01-01

    Exposure to bacterial endotoxins, such as lipopolysaccharide (LPS), can lead to the induction of acute lung injury/acute respiratory distress syndrome (ALI/ARDS). To date, there are no known effective treatments for LPS-induced inflammation. In the current study, we investigated the potential use of the hyaluronic acid (HA) synthesis inhibitor 4-methylumbelliferone (4-MU) on LPS-induced acute lung inflammation. Culturing LPS-activated immune cells with 4-MU led to reduced proliferation, reduced cytokine production, and an increase in apoptosis when compared to untreated cells. Treatment of mice with 4-MU led to protection from LPS-induced lung injury. Specifically, 4-MU treatment led to a reduction in LPS-induced hyaluronic acid synthase (HAS) messenger RNA (mRNA) levels, reduction in lung permeability, and reduction in proinflammatory cytokine production. Taken together, these results suggest that use of 4-MU to target HA production may be an effective treatment for the inflammatory response following exposure to LPS.

  8. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  9. ANTITUMOR ACTIVITY OF HYALURONIC ACID SYNTHESIS INHIBITOR 4-METHYLUMBELLIFERONE IN PROSTATE CANCER CELLS

    PubMed Central

    Lokeshwar, Vinata B.; Lopez, Luis E.; Munoz, Daniel; Chi, Andrew; Shirodkar, Samir P.; Lokeshwar, Soum D.; Escudero, Diogo O.; Dhir, Neetika; Altman, Norman

    2010-01-01

    4-methylumbelliferone (4-MU) is a hyaluronic acid (HA) synthesis inhibitor with anticancer properties; the mechanism of its anticancer effects is unknown. We evaluated the effects of 4-MU on prostate cancer cells. 4-MU inhibited proliferation, motility and invasion of DU145, PC3-ML, LNCaP, C4-2B and/or LAPC-4 cells. At IC50 for HA synthesis (0.4 mM), 4-MU induced > 3-fold apoptosis in prostate cancer cells, which could be prevented by HA addition. 4-MU induced caspase-8, -9 and -3 activation, PARP cleavage, up-regulation of Fas-L, Fas, FADD and DR4 and down regulation of bcl-2, phospho-bad, bcl-XL, phospho-Akt, phospho-IKB, phospho-ErbB2 and phospho-EGFR. At IC50, 4-MU also caused > 90% inhibition of NFkB reporter activity which was prevented partially by HA addition. With the exception of caveolin-1, HA prevented the 4-MU induced down regulation of HA receptors (CD44, RHAMM), matrix-degrading enzymes (MMP-2, MMP-9), IL-8, and chemokine receptors (CXCR1, CXCR4, CXCR7) at protein and mRNA levels. Expression of myristoylated-Akt rescued 4-MU induced apoptosis and inhibition of cell growth and IL-8, RHAMM, HAS2, CD44 and MMP-9 expression. Oral administration of 4-MU significantly decreased PC3-ML tumor growth (> 3-fold), when treatment was started either on the day of tumor cell injection or after the tumors became palpable, without organ toxicity, changes in serum chemistry or body weight. Tumors from 4-MU treated animals showed reduced microvessel density (~ 3-fold) and HA expression but increased TUNEL positive cells and expression of apoptosis-related molecules. Therefore, anticancer effects of 4-MU, an orally bioavailable and relatively non-toxic agent, are primarily mediated by inhibition of HA signaling. PMID:20332231

  10. Potential New H1N1 Neuraminidase Inhibitors from Ferulic Acid and Vanillin: Molecular Modelling, Synthesis and in Vitro Assay

    PubMed Central

    Hariono, Maywan; Abdullah, Nurshariza; Damodaran, K.V.; Kamarulzaman, Ezatul E.; Mohamed, Nornisah; Hassan, Sharifah Syed; Shamsuddin, Shaharum; Wahab, Habibah A.

    2016-01-01

    We report the computational and experimental efforts in the design and synthesis of novel neuraminidase (NA) inhibitors from ferulic acid and vanillin. Two proposed ferulic acid analogues, MY7 and MY8 were predicted to inhibit H1N1 NA using molecular docking. From these two analogues, we designed, synthesised and evaluated the biological activities of a series of ferulic acid and vanillin derivatives. The enzymatic H1N1 NA inhibition assay showed MY21 (a vanillin derivative) has the lowest IC50 of 50 μM. In contrast, the virus inhibition assay showed MY15, a ferulic acid derivative has the best activity with the EC50 of ~0.95 μM. Modelling studies further suggest that these predicted activities might be due to the interactions with conserved and essential residues of NA with ΔGbind values comparable to those of oseltamivir and zanamivir, the two commercial NA inhibitors. PMID:27995961

  11. Potential New H1N1 Neuraminidase Inhibitors from Ferulic Acid and Vanillin: Molecular Modelling, Synthesis and in Vitro Assay.

    PubMed

    Hariono, Maywan; Abdullah, Nurshariza; Damodaran, K V; Kamarulzaman, Ezatul E; Mohamed, Nornisah; Hassan, Sharifah Syed; Shamsuddin, Shaharum; Wahab, Habibah A

    2016-12-20

    We report the computational and experimental efforts in the design and synthesis of novel neuraminidase (NA) inhibitors from ferulic acid and vanillin. Two proposed ferulic acid analogues, MY7 and MY8 were predicted to inhibit H1N1 NA using molecular docking. From these two analogues, we designed, synthesised and evaluated the biological activities of a series of ferulic acid and vanillin derivatives. The enzymatic H1N1 NA inhibition assay showed MY21 (a vanillin derivative) has the lowest IC50 of 50 μM. In contrast, the virus inhibition assay showed MY15, a ferulic acid derivative has the best activity with the EC50 of ~0.95 μM. Modelling studies further suggest that these predicted activities might be due to the interactions with conserved and essential residues of NA with ΔGbind values comparable to those of oseltamivir and zanamivir, the two commercial NA inhibitors.

  12. Potential New H1N1 Neuraminidase Inhibitors from Ferulic Acid and Vanillin: Molecular Modelling, Synthesis and in Vitro Assay

    NASA Astrophysics Data System (ADS)

    Hariono, Maywan; Abdullah, Nurshariza; Damodaran, K. V.; Kamarulzaman, Ezatul E.; Mohamed, Nornisah; Hassan, Sharifah Syed; Shamsuddin, Shaharum; Wahab, Habibah A.

    2016-12-01

    We report the computational and experimental efforts in the design and synthesis of novel neuraminidase (NA) inhibitors from ferulic acid and vanillin. Two proposed ferulic acid analogues, MY7 and MY8 were predicted to inhibit H1N1 NA using molecular docking. From these two analogues, we designed, synthesised and evaluated the biological activities of a series of ferulic acid and vanillin derivatives. The enzymatic H1N1 NA inhibition assay showed MY21 (a vanillin derivative) has the lowest IC50 of 50 μM. In contrast, the virus inhibition assay showed MY15, a ferulic acid derivative has the best activity with the EC50 of ~0.95 μM. Modelling studies further suggest that these predicted activities might be due to the interactions with conserved and essential residues of NA with ΔGbind values comparable to those of oseltamivir and zanamivir, the two commercial NA inhibitors.

  13. Recent advances in inhibitors of bacterial fatty acid synthesis type II (FASII) system enzymes as potential antibacterial agents.

    PubMed

    Wang, Yi; Ma, Shutao

    2013-10-01

    Bacterial infections are a constant and serious threat to human health. With the increase of multidrug resistance of clinically pathogenic bacteria, common antibiotic therapies have been less effective. Fatty acid synthesis type II (FASII) system enzymes are essential for bacterial membrane lipid biosynthesis and represent increasingly promising targets for the discovery of antibacterial agents with new mechanisms of action. This review highlights recent advances in inhibitors of bacterial FASII as potential antibacterial agents, paying special attention to the activities, mechanisms, and structure-activity relationships of those inhibitors that mainly target β-ketoacyl-ACP synthase, β-ketoacyl-ACP reductase, β-hydroxyacyl-ACP dehydratase, and enoyl-ACP reductase. Although inhibitors with low nanomolar and selective activity against various bacterial FASII have entered clinical trials, further research is needed to expand upon both available and yet unknown scaffolds to identify new FASII inhibitors that may have antibacterial potential, particularly against resistant bacterial strains.

  14. Design and synthesis of lactam-thiophene carboxylic acids as potent hepatitis C virus polymerase inhibitors.

    PubMed

    Barnes-Seeman, David; Boiselle, Carri; Capacci-Daniel, Christina; Chopra, Rajiv; Hoffmaster, Keith; Jones, Christopher T; Kato, Mitsunori; Lin, Kai; Ma, Sue; Pan, Guoyu; Shu, Lei; Wang, Jianling; Whiteman, Leah; Xu, Mei; Zheng, Rui; Fu, Jiping

    2014-08-15

    Herein we report the successful incorporation of a lactam as an amide replacement in the design of hepatitis C virus NS5B Site II thiophene carboxylic acid inhibitors. Optimizing potency in a replicon assay and minimizing potential risk for CYP3A4 induction led to the discovery of inhibitor 22a. This lead compound has a favorable pharmacokinetic profile in rats and dogs.

  15. Design, synthesis and biological evaluation of novel non-peptide boronic acid derivatives as proteasome inhibitors.

    PubMed

    Ge, Ying; Li, Aibo; Wu, Jianwei; Feng, Haiwei; Wang, Letian; Liu, Hongwu; Xu, Yungen; Xu, Qingxiang; Zhao, Li; Li, Yuyan

    2017-03-10

    A novel series of non-peptide proteasome inhibitors bearing the 1, 4-naphthoquinone scaffold and boronic acid warhead was developed. In the biological evaluation on the chymotrypsin-like activity of human 20S proteasome, five compounds showed IC50 values in the nanomolar range. Docking experiments into the yeast 20S proteasome rationalized their biological activities and allowed further optimization of this interesting class of inhibitors. Within the cellular proliferation inhibition assay and western blot analysis, compound 3e demonstrated excellent anti-proliferative activity against solid tumor cells and clear accumulation of ubiquitinated cellular proteins. Furthermore, in the microsomal stability assay compound 3e demonstrated much improved metabolic stability compared to bortezomib, emerging as a promising lead compound for further design of non-peptide proteasome inhibitors.

  16. The synthesis of ethacrynic acid thiazole derivatives as glutathione S-transferase pi inhibitors.

    PubMed

    Li, Ting; Liu, Guyue; Li, Hongcai; Yang, Xinmei; Jing, Yongkui; Zhao, Guisen

    2012-04-01

    Glutathione S-transferase pi (GSTpi) is a phase II enzyme which protects cells from death and detoxifies chemotherapeutic agents in cancer cells. Ethacrynic acid (EA) is a weak GSTpi inhibitor. Structure modifications were done to improve the ability of EA to inhibit GSTpi activity. Eighteen EA thiazole derivatives were designed and synthesized. Compounds 9a, 9b and 9c with a replacement of carboxyl group of EA by a heterocyclic thiazole exhibited improvement over EA to inhibit GSTpi activity.

  17. The synthesis and SAR of 2-arylsulfanylphenyl-1-oxyalkylamino acids as GlyT-1 inhibitors.

    PubMed

    Smith, Garrick; Mikkelsen, Gitte; Eskildsen, Jørgen; Bundgaard, Christoffer

    2006-08-01

    Elevation of glycine levels by inhibition of the glycine transporter-1 (GlyT-1) and activation of the NMDA receptor is a potential strategy for the treatment of schizophrenia. A novel series of 2-arylsulfanylphenyl-1-oxyalkyl amino acids have been identified. The most prominent member of this series S-1-{2-[3-(3-fluoro-phenylsulfanyl)biphenyl-4-yloxy]ethyl}pyrrolidine-2-carboxylic acid (38) is a potent GlyT-1 inhibitor (IC50=59 nM). In vitro and in vivo assessment of CNS exposure indicates this compound is a likely substrate for active efflux transporters.

  18. [Design, synthesis and evaluation of malonic acid-based PTP1B inhibitors].

    PubMed

    Du, Xin; Zhang, Shu-En; Liu, Jun-Zheng; Nie, Fei-Lin; Ye, Fei; Tian, Jin-Ying; Xiao, Zhi-Yan

    2012-03-01

    Protein tyrosine phosphatase (PTP) 1B is a potential target for the treatment of diabetes and obesity. Phosphotyrosine (pTyr) is the substrate for PTP1B dephosphorylation. Malonic acid moiety was used herein as a mimic of the phosphate group in pTyr, and novel malonic acid derivatives 1-7 were designed, synthesized and evaluated as PTP1B inhibitors. Results from enzymatic assays indicated that compounds 3 and 4 exhibited potent inhibition against human recombinant PTP1B with IC50 values of 7.66 and 1.88 micromol x L(-1), respectively.

  19. Novel 2-oxoimidazolidine-4-carboxylic acid derivatives as Hepatitis C virus NS3-4A serine protease inhibitors: synthesis, activity, and X-ray crystal structure of an enzyme inhibitor complex

    SciTech Connect

    Arasappan, Ashok; Njoroge, F. George; Parekh, Tejal N.; Yang, Xiaozheng; Pichardo, John; Butkiewicz, Nancy; Prongay, Andrew; Yao, Nanhua; Girijavallabhan, Viyyoor

    2008-06-30

    Synthesis and HCV NS3 serine protease inhibitory activity of some novel 2-oxoimidazolidine-4-carboxylic acid derivatives are reported. Inhibitors derived from this new P2 core exhibited activity in the low {micro}M range. X-ray structure of an inhibitor, 15c bound to the protease is presented.

  20. Synthesis of ST7612AA1, a Novel Oral HDAC Inhibitor, via Radical 
Thioacetic Acid Addition

    PubMed Central

    Battistuzzi, Gianfranco; Giannini, Giuseppe

    2016-01-01

    Abstract: Background In the expanding field of anticancer drugs, HDAC inhibitors are playing an increasingly important role. To date, four/five HDAC inhibitors have been approved by FDA. All these compounds fit the widely accepted HDAC inhibitors pharmacophore model characterized by a cap group, a linker chain and a zinc binding group (ZBG), able to bind the Zn2+ ion in a pocket of the HDAC active site. Romidepsin, a natural compound, is the only thiol derivative. We have selected a new class of synthetic HDAC inhibitors, the thio-ω(lactam-carboxamide) derivatives, with ST7612AA1 as drug candidate, pan-inhibitor active in the range of single- to two-digit nanomolar concentrations. Preliminary results of a synthetic optimization attempt towards a fast scale-up process are here proposed. Methods In the four steps of synthesis, from unsaturated amino acid intermediate to the final product, we explored different synthetic conditions in order to have a transferable process for a scale-up synthetic laboratory. Results In the first step, isobutyl chloroformate was used and, after a simple work up with 1M HCl, 2 (96% yield) was obtained as a white solid, which was used directly in the next step. For thioacetic acid addition to the double bond of intermediate 2, two different routes were possible, with addition reaction in the first (D’) or last step (D). Reactions of 2 to give 5 or of 4 to give ST7612AA1 were both performed in dioxane. Reactions were fast and did not need the usually advised radical quenching with cyclohexene. The corresponding products were obtained in good yields (step D’, 89%; step D, 81%) after a flash chromatography. Conclusion: ST7612AA1 , a thiol derivative prodrug of ST7464AA1, is the first of a new generation of HDAC inhibitors, very potent, orally administered, and well tolerated. Here, we have identified a synthetic route, competitive, versatile and easily transferable to industrial processes. PMID:27917100

  1. Design, synthesis, and biological evaluation of α-hydroxyacyl-AMS inhibitors of amino acid adenylation enzymes.

    PubMed

    Davis, Tony D; Mohandas, Poornima; Chiriac, Maria I; Bythrow, Glennon V; Quadri, Luis E N; Tan, Derek S

    2016-11-01

    Biosynthesis of bacterial natural-product virulence factors is emerging as a promising antibiotic target. Many such natural products are produced by nonribosomal peptide synthetases (NRPS) from amino acid precursors. To develop selective inhibitors of these pathways, we have previously described aminoacyl-AMS (sulfamoyladenosine) macrocycles that inhibit NRPS amino acid adenylation domains but not mechanistically-related aminoacyl-tRNA synthetases. To improve the cell permeability of these inhibitors, we explore herein replacement of the α-amino group with an α-hydroxy group. In both macrocycles and corresponding linear congeners, this leads to decreased biochemical inhibition of the cysteine adenylation domain of the Yersina pestis siderophore synthetase HMWP2, which we attribute to loss of an electrostatic interaction with a conserved active-site aspartate. However, inhibitory activity can be regained by installing a cognate β-thiol moiety in the linear series. This provides a path forward to develop selective, cell-penetrant inhibitors of the biosynthesis of virulence factors to probe their biological functions and potential as therapeutic targets.

  2. Synthesis of new sulfonylamido-penicillanic acid sulfones inhibitors of beta-lactamases.

    PubMed

    Vanwetswinkel, S; Fastrez, J; Marchand-Brynaert, J

    1994-09-01

    Three new sulfonylamido-penicillanic acid sulfones have been prepared by reaction of 6-aminopenicillanic esters with the monoester or monoamide derivatives obtained in nucleophilic substitution reactions by alcohol or aniline on the carboxyl chloride function of sulfoacetic dichloride followed by oxidation. These penicillin sulfones are converted to beta-lactamases suicide inhibitors by removal of the C3 ester protecting group. This synthetic strategy can give access to sulfonamidopenam sulfones bearing a variety of 6-amino side chain. These inhibitors inactivate the RTEM beta-lactamase rapidly. The kinetics of inactivation are consistent with the partitioning of an acylenzyme intermediate between two main pathways: regeneration of free enzyme and irreversible inactivation, little transient inactivation is observed. A slow inhibition by the product of enzymatic hydrolysis of the sulfones is also observed.

  3. Design, synthesis and biological evaluation of 2-(substituted phenyl)thiazolidine-4-carboxylic acid derivatives as novel tyrosinase inhibitors.

    PubMed

    Ha, Young Mi; Park, Yun Jung; Lee, Ji Yeon; Park, Daeui; Choi, Yeon Ja; Lee, Eun Kyeong; Kim, Ji Min; Kim, Jin-Ah; Park, Ji Young; Lee, Hye Jin; Moon, Hyung Ryong; Chung, Hae Young

    2012-02-01

    Herein we describe the design, synthesis and biological activities of 2-(substituted phenyl)thiazolidine-4-carboxylic acid derivatives as novel tyrosinase inhibitors. The target compounds 2a-2j were designed and synthesized from the structural characteristics of N-phenylthiourea, tyrosinase inhibitor and tyrosine, and l-DOPA, the natural substrates of tyrosinase. Among them, (2R/S,4R)-2-(2,4-dimethoxyphenyl)thiazolidine-4-carboxylic acid (2g) caused the greatest inhibition 66.47% at 20 μM of l-DOPA oxidase activity of mushroom tyrosinase. Kinetic analysis of tyrosinase inhibition revealed that 2g is a competitive inhibitor. We predicted the tertiary structure of tyrosinase, and simulated the docking of mushroom tyrosinase with 2g. These results suggest that the binding affinity of 2g with tyrosinase is high. Also, 2g effectively inhibited tyrosinase activity and reduced melanin levels in B16 cells treated with α-MSH. These data strongly suggest that 2g can suppress the production of melanin via the inhibition of tyrosinase activity.

  4. Synthesis of water soluble glycosides of pentacyclic dihydroxytriterpene carboxylic acids as inhibitors of α-glucosidase.

    PubMed

    Xu, Jiancong; Nie, Xuliang; Hong, Yanping; Jiang, Yan; Wu, Guoqiang; Yin, Xiaoli; Wang, Chunrong; Wang, Xiaoqiang

    2016-04-07

    A series of compounds were synthesized by glycosylation of maslinic acid (MA) and corosolic acid (CA) with monosaccharides and disaccharides, and the structures of the derivatives were elucidated by standard spectroscopic methods including (1)H NMR, (13)C NMR and HRMS. The α-glucosidase inhibitory activities of all the novel compounds were evaluated in vitro. The solubility and inhibitory activity of α-glucosidase assays showed that the bis-disaccharide glycosides of triterpene acids possessed higher water solubility and α-glucosidase inhibitory activities than the bis-monosaccharide glycosides. Among these compounds, maslinic acid bis-lactoside (8e, IC50 = 684 µM) and corosolic acid bis-lactoside (9e, IC50 = 428 µM) had the best water solubility, and 9e exhibited a better inhibitory activity than acarbose (IC50 = 478 µM). However, most of glycosylated derivatives possessed lower inhibitory activities than the parent compounds, although their water solubility was enhanced obviously. Moreover, the kinetic inhibition studies indicated that 9e was a non-competitive inhibitor, and structure-activity relationships of the derivatives are also discussed.

  5. Design, synthesis and evaluation of semi-synthetic triazole-containing caffeic acid analogues as 5-lipoxygenase inhibitors.

    PubMed

    De Lucia, Daniela; Lucio, Oscar Méndez; Musio, Biagia; Bender, Andreas; Listing, Monika; Dennhardt, Sophie; Koeberle, Andreas; Garscha, Ulrike; Rizzo, Roberta; Manfredini, Stefano; Werz, Oliver; Ley, Steven V

    2015-08-28

    In this work the synthesis, structure-activity relationship (SAR) and biological evaluation of a novel series of triazole-containing 5-lipoxygenase (5-LO) inhibitors are described. The use of structure-guided drug design techniques provided compounds that demonstrated excellent 5-LO inhibition with IC50 of 0.2 and 3.2 μm in cell-based and cell-free assays, respectively. Optimization of binding and functional potencies resulted in the identification of compound 13d, which showed an enhanced activity compared to the parent bioactive compound caffeic acid 5 and the clinically approved zileuton 3. Compounds 15 and 16 were identified as lead compounds in inhibiting 5-LO products formation in neutrophils. Their interference with other targets on the arachidonic acid pathway was also assessed. Cytotoxicity tests were performed to exclude a relationship between cytotoxicity and the increased activity observed after structure optimization.

  6. Synthesis and biological evaluation of novel ursolic acid analogues as potential α-glucosidase inhibitors

    PubMed Central

    Wu, Pan-Pan; Zhang, Bing-Jie; Cui, Xi-Ping; Yang, Yang; Jiang, Zheng-Yun; Zhou, Zhi-Hong; Zhong, Ying-Ying; Mai, Yu-Ying; Ouyang, Zhong; Chen, Hui-Sheng; Zheng, Jie; Zhao, Su-Qing; Zhang, Kun

    2017-01-01

    Ursolic acid (UA) is a major pentacyclic triterpenoid in plants, vegetables and fruits, which has been reported to have a potential anti-diabetic activity. Despite various semi-synthetic ursolic acid derivatives already described, new derivatives still need to be designed and synthesized to further improve the anti-diabetic activity. In the present study, two series of novel UA derivatives, were synthesized and their structures were confirmed. The enzyme inhibition activities of semi-synthesized analogues against α-glucosidase were screened in vitro. The results indicated that most of UA derivatives showed a significant inhibitory activity, especially analogues UA-O-i with the IC50 values of 0.71 ± 0.27 μM, which was more potential than other analogues and the positive control. Furthermore, molecular docking studies were also investigated to verify the in vitro study. Structure modification at the C-3 and C-2 positions of UA was an effective approach to obtain the desired ligand from UA, whose structure was in accordance with the active pocket. Besides, suitable hydrophobic group at the position of C-2 might play an important role for the docking selectivity and binding affinity between the ligand and the homology modelling protein. These results could be helpful for designing more potential α-glucosidase inhibitors from UA in the future. PMID:28358057

  7. Treatment with the hyaluronic acid synthesis inhibitor 4-methylumbelliferone suppresses SEB-induced lung inflammation.

    PubMed

    McKallip, Robert J; Hagele, Harriet F; Uchakina, Olga N

    2013-10-17

    Exposure to bacterial superantigens, such as staphylococcal enterotoxin B (SEB), can lead to the induction of acute lung injury/acute respiratory distress syndrome (ALI/ARDS). To date, there are no known effective treatments for SEB-induced inflammation. In the current study we investigated the potential use of the hyaluronic acid synthase inhibitor 4-methylumbelliferone (4-MU) on staphylococcal enterotoxin B (SEB) induced acute lung inflammation. Culturing SEB-activated immune cells with 4-MU led to reduced proliferation, reduced cytokine production as well as an increase in apoptosis when compared to untreated cells. Treatment of mice with 4-MU led to protection from SEB-induced lung injury. Specifically, 4-MU treatment led to a reduction in SEB-induced HA levels, reduction in lung permeability, and reduced pro-inflammatory cytokine production. Taken together, these results suggest that use of 4-MU to target hyaluronic acid production may be an effective treatment for the inflammatory response following exposure to SEB.

  8. Treatment with the Hyaluronic Acid Synthesis Inhibitor 4-Methylumbelliferone Suppresses SEB-Induced Lung Inflammation

    PubMed Central

    McKallip, Robert J.; Hagele, Harriet F.; Uchakina, Olga N.

    2013-01-01

    Exposure to bacterial superantigens, such as staphylococcal enterotoxin B (SEB), can lead to the induction of acute lung injury/acute respiratory distress syndrome (ALI/ARDS). To date, there are no known effective treatments for SEB-induced inflammation. In the current study we investigated the potential use of the hyaluronic acid synthase inhibitor 4-methylumbelliferone (4-MU) on staphylococcal enterotoxin B (SEB) induced acute lung inflammation. Culturing SEB-activated immune cells with 4-MU led to reduced proliferation, reduced cytokine production as well as an increase in apoptosis when compared to untreated cells. Treatment of mice with 4-MU led to protection from SEB-induced lung injury. Specifically, 4-MU treatment led to a reduction in SEB-induced HA levels, reduction in lung permeability, and reduced pro-inflammatory cytokine production. Taken together, these results suggest that use of 4-MU to target hyaluronic acid production may be an effective treatment for the inflammatory response following exposure to SEB. PMID:24141285

  9. Synthesis and biological evaluation of novel ursolic acid analogues as potential α-glucosidase inhibitors.

    PubMed

    Wu, Pan-Pan; Zhang, Bing-Jie; Cui, Xi-Ping; Yang, Yang; Jiang, Zheng-Yun; Zhou, Zhi-Hong; Zhong, Ying-Ying; Mai, Yu-Ying; Ouyang, Zhong; Chen, Hui-Sheng; Zheng, Jie; Zhao, Su-Qing; Zhang, Kun

    2017-03-30

    Ursolic acid (UA) is a major pentacyclic triterpenoid in plants, vegetables and fruits, which has been reported to have a potential anti-diabetic activity. Despite various semi-synthetic ursolic acid derivatives already described, new derivatives still need to be designed and synthesized to further improve the anti-diabetic activity. In the present study, two series of novel UA derivatives, were synthesized and their structures were confirmed. The enzyme inhibition activities of semi-synthesized analogues against α-glucosidase were screened in vitro. The results indicated that most of UA derivatives showed a significant inhibitory activity, especially analogues UA-O-i with the IC50 values of 0.71 ± 0.27 μM, which was more potential than other analogues and the positive control. Furthermore, molecular docking studies were also investigated to verify the in vitro study. Structure modification at the C-3 and C-2 positions of UA was an effective approach to obtain the desired ligand from UA, whose structure was in accordance with the active pocket. Besides, suitable hydrophobic group at the position of C-2 might play an important role for the docking selectivity and binding affinity between the ligand and the homology modelling protein. These results could be helpful for designing more potential α-glucosidase inhibitors from UA in the future.

  10. Design, synthesis and SAR studies of GABA uptake inhibitors derived from 2-substituted pyrrolidine-2-yl-acetic acids.

    PubMed

    Steffan, Tobias; Renukappa-Gutke, Thejavathi; Höfner, Georg; Wanner, Klaus T

    2015-03-15

    In this paper, we disclose the design and synthesis of a series of 2-substituted pyrrolidine-2-yl-acetic acid as core structures and the N-arylalkyl derivatives thereof as potential GABA transport inhibitors. The 2-position in the side chain of pyrrolidine-2-yl-acetic acid derivatives was substituted with alkyl, hydroxy and amino groups to modulate the activity and selectivity to mGAT1 and mGAT4 proteins. SAR studies of the compounds performed for the four mouse GABA transporter proteins (mGAT1-mGAT4) implied significant potencies and subtype selectivities for 2-hydroxy-2-pyrrolidine-2-yl-acetic acid derivatives. The racemate rac-(u)-13c exhibited the highest potency (pIC50 5.67) at and selectivity for mGAT1 in GABA uptake assays. In fact, the potency of rac-(u)-13c at hGAT-1 (pIC50 6.14) was even higher than its potency at mGAT1. These uptake results for rac-(u)-13c are in line with the binding affinities to the aforesaid proteins mGAT1 (pKi 6.99) and hGAT-1 (pKi 7.18) determined by MS Binding Assay based on NO711 as marker quantified by LC-ESI-MS-MS analysis. Interestingly, the 2-hydroxy-2-pyrrolidine-2-yl-acetic acid rac-(u)-13d containing 2-{[tris(4-methoxyphenyl)]methoxy} ethyl group at the nitrogen atom of the pyrrolidine ring showed high potency at mGAT4 and a comparatively better selectivity for this protein (>15 against mGAT3) than the well known mGAT4 uptake inhibitor (S)-SNAP-5114.

  11. Design, synthesis, and biological evaluation of chicoric acid analogs as inhibitors of HIV-1 integrase.

    PubMed

    Charvat, Trevor T; Lee, Deborah J; Robinson, W Edward; Chamberlin, A Richard

    2006-07-01

    A series of analogs of the potent HIV-1 integrase (HIV IN) inhibitor chicoric acid (CA) was designed with the intention of ameliorating some of the parent natural product's undesirable properties, in particular its toxicity, instability, and poor membrane permeability. More than 70 analogs were synthesized and assayed for three types of activity: (1) the ability to inhibit 3'-end processing and strand transfer reactions using recombinant HIV IN in vitro, (2) toxicity against the CD4+ lymphoblastoid cell line, MT2, and (3) anti-HIV activity against HIV(LAI). CA analogs lacking one of the carboxyl groups of CA and with 3,4,5-trihydroxycinnamoyl sidechains in place of the caffeoyl group of CA exhibited the most potent inhibition of HIV replication and end-processing activity. Galloyl-substituted derivatives also displayed very potent in vitro and in vivo activities, in most cases exceeding the inhibitory effects of CA itself. Conversely, analogous monocarboxy caffeoyl analogs exhibited only modest inhibition, while the corresponding 3,4-dihydroxybenzoyl-substituted compounds were devoid of activity.

  12. Design, synthesis and evaluation of 3-quinoline carboxylic acids as new inhibitors of protein kinase CK2.

    PubMed

    Syniugin, Anatolii R; Ostrynska, Olga V; Chekanov, Maksym O; Volynets, Galyna P; Starosyla, Sergiy A; Bdzhola, Volodymyr G; Yarmoluk, Sergiy M

    2016-01-01

    In this article, the derivatives of 3-quinoline carboxylic acid were studied as inhibitors of protein kinase CK2. Forty-three new compounds were synthesized. Among them 22 compounds inhibiting CK2 with IC50 in the range from 0.65 to 18.2 μM were identified. The most active inhibitors were found among tetrazolo-quinoline-4-carboxylic acid and 2-aminoquinoline-3-carboxylic acid derivatives.

  13. Synthesis of Lysine Methyltransferase Inhibitors

    NASA Astrophysics Data System (ADS)

    Ye, Tao; Hui, Chunngai

    2015-07-01

    Lysine methyltransferase which catalyze methylation of histone and nonhistone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting Lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery.

  14. Design and synthesis of N-benzoyl amino acid derivatives as DNA methylation inhibitors.

    PubMed

    Garella, Davide; Atlante, Sandra; Borretto, Emily; Cocco, Mattia; Giorgis, Marta; Costale, Annalisa; Stevanato, Livio; Miglio, Gianluca; Cencioni, Chiara; Fernández-de Gortari, Eli; Medina-Franco, José L; Spallotta, Francesco; Gaetano, Carlo; Bertinaria, Massimo

    2016-11-01

    The inhibition of human DNA Methyl Transferases (DNMT) is a novel promising approach to address the epigenetic dysregulation of gene expression in different diseases. Inspired by the validated virtual screening hit NSC137546, a series of N-benzoyl amino acid analogues was synthesized and obtained compounds were assessed for their ability to inhibit DNMT-dependent DNA methylation in vitro. The biological screening allowed the definition of a set of preliminary structure-activity relationships and the identification of compounds promising for further development. Among the synthesized compounds, L-glutamic acid derivatives 22, 23, and 24 showed the highest ability to prevent DNA methylation in a total cell lysate. Compound 22 inhibited DNMT1 and DNMT3A activity in a concentration-dependent manner in the micromolar range. In addition, compound 22 proved to be stable in human serum and it was thus selected as a starting point for further biological studies.

  15. Synthesis and evaluation of quinazoline amino acid derivatives as mono amine oxidase (MAO) inhibitors.

    PubMed

    Khattab, Sherine Nabil; Haiba, Nesreen Saied; Asal, Ahmed Mosaad; Bekhit, Adnan A; Amer, Adel; Abdel-Rahman, Hamdy M; El-Faham, Ayman

    2015-07-01

    A series of quinazolinone amino acid ester and quinazolinone amino acid hydrazides were prepared under microwave irradiation as well as conventional condition. The microwave irradiation afforded the product in less reaction time, higher yield and purity. The structures of the synthesized compounds were confirmed by IR, NMR, and elemental analysis. The new synthesized compounds were studied for their monoamine oxidase inhibitory activity. They showed more selective inhibitory activity toward MAO-A than MAO-B. Compounds 7, 10, and 15 showed MAO-A inhibition activity (IC50=3.6×10(-9), 2.8×10(-9), 2.1×10(-9) M, respectively) comparable to that of the standard clorgyline (IC50=2.9×10(-9)M). 2-(2-(Benzo[d][1,3]dioxol-5-yl)-4-oxo-1,2-dihydroquinazolin-3(4H)-yl)acetohydrazide 15 showed selective MAO-A inhibition activity (SI=39524) superior to that of the standard clorgyline (SI=33793). The acute toxicity of the synthesized compounds was determined. In addition, computer-assisted simulated docking experiments were performed to rationalize the biological activity.

  16. Quinic acid derivatives as sialyl Lewis(x)-mimicking selectin inhibitors: design, synthesis, and crystal structure in complex with E-selectin.

    PubMed

    Kaila, Neelu; Somers, William S; Thomas, Bert E; Thakker, Paresh; Janz, Kristin; DeBernardo, Silvano; Tam, Steve; Moore, William J; Yang, Ruiyang; Wrona, Wojciech; Bedard, Patricia W; Crommie, Deidre; Keith, James C; Tsao, Desiree H H; Alvarez, Juan C; Ni, Heyu; Marchese, Erik; Patton, John T; Magnani, John L; Camphausen, Raymond T

    2005-06-30

    A search for noncarbohydrate sLe(x) mimics led to the development of quinic acid derivatives as selectin inhibitors. At Wyeth we solved the first cocrystal structure of a small molecule, quinic acid, with E-selectin. In the cocomplex two hydroxyls of quinic acid mimic the calcium-bound fucose of the tetrasaccharide sLe(x). The X-ray structure, together with structure based computational methods, was used to design quinic acid based libraries that were synthesized and evaluated for their ability to block the interaction of sLex with P-selectin. A large number of analogues were prepared using solution-phase parallel synthesis. Selected compounds showed decrease in leukocyte rolling in the IVM mouse model. Compound 2 inhibited neutrophil influx in the murine TIP model and demonstrated good plasma exposure.

  17. Design, synthesis and docking studies of novel dipeptidyl boronic acid proteasome inhibitors constructed from αα- and αβ-amino acids.

    PubMed

    Shi, Jingmiao; Lei, Meng; Wu, Wenkui; Feng, Huayun; Wang, Jia; Chen, Shanshan; Zhu, Yongqiang; Hu, Shihe; Liu, Zhaogang; Jiang, Cheng

    2016-04-15

    A series of novel dipeptidyl boronic acid proteasome inhibitors constructed from αα- and αβ-amino acids were designed and synthesized. Their structures were elucidated by (1)H NMR, (13)C NMR, LC-MS and HRMS. These compounds were evaluated for their β5 subunit inhibitory activities of human proteasome. The results showed that dipeptidyl boronic acid inhibitors composed of αα-amino acids were as active as bortezomib. Interestingly, the activities of those derived from αβ-amino acids lost completely. Of all the inhibitors, compound 22 (IC50=4.82 nM) was the most potent for the inhibition of proteasome activity. Compound 22 was also the most active against three MM cell lines with IC50 values less than 5 nM in inhibiting cell growth assays. Molecular docking studies displayed that 22 fitted very well in the β5 subunit active pocket of proteasome.

  18. Discovery, synthesis, and pharmacological evaluation of spiropiperidine hydroxamic acid based derivatives as structurally novel histone deacetylase (HDAC) inhibitors.

    PubMed

    Varasi, Mario; Thaler, Florian; Abate, Agnese; Bigogno, Chiara; Boggio, Roberto; Carenzi, Giacomo; Cataudella, Tiziana; Dal Zuffo, Roberto; Fulco, Maria Carmela; Rozio, Marco Giulio; Mai, Antonello; Dondio, Giulio; Minucci, Saverio; Mercurio, Ciro

    2011-04-28

    New spiro[chromane-2,4'-piperidine] and spiro[benzofuran-2,4'-piperidine] hydroxamic acid derivatives as HDAC inhibitors have been identified by combining privileged structures with a hydroxamic acid moiety as zinc binding group. The compounds were evaluated for their ability to inhibit nuclear extract HDACs and for their in vitro antiproliferative activity on different tumor cell lines. This work resulted in the discovery of spirocycle 30d that shows good oral bioavailability and tumor growth inhibition in an HCT-116 murine xenograft model.

  19. Synthesis and QSAR of Fatty Acid Amide Hydrolase Inhibitors: Modulation at the N-Portion of Biphenyl-3-yl Alkylcarbamates

    PubMed Central

    Mor, Marco; Lodola, Alessio; Rivara, Silvia; Vacondio, Federica; Duranti, Andrea; Tontini, Andrea; Sanchini, Silvano; Piersanti, Giovanni; Clapper, Jason R.; King, Alvin R.; Tarzia, Giorgio; Piomelli, Daniele

    2013-01-01

    Alkylcarbamic acid biphenyl-3-yl esters are a class of fatty acid amide hydrolase (FAAH) inhibitors that comprises cyclohexylcarbamic acid 3′-carbamoylbiphenyl-3-yl ester (URB597), a compound with analgesic, anxiolytic-like and antidepressant-like properties in rat and mouse models. Here, we extended the structure-activity relationships (SARs) for this class of compounds by replacing the cyclohexyl ring of the parent compound cyclohexylcarbamic acid biphenyl-3-yl ester (URB524) (IC50, for FAAH = 63 nM) with a selected set of substituents of different size, shape, flexibility and lipophilicity. Docking experiments and Linear Interaction Energy (LIE) calculations indicated that the N-terminal group of O-arylcarbamates fits within the lipophilic region of the substrate-binding site, mimicking the arachidonoyl chain of anandamide. Significant potency improvements were observed for the β-naphthylmethyl derivative 4q (IC50 = 5.3 nM) and its 3′-carbamoylbiphenyl-3-yl ester 4z (URB880, IC50 = 0.63 nM), indicating that shape complementarity and hydrogen bonds are crucial to obtain highly potent inhibitors. PMID:18507372

  20. A new dioxime corrosion inhibitor for the protection and conservation of copper: synthesis, characterization and evaluation in acidic chloride solution

    NASA Astrophysics Data System (ADS)

    Abu-Baker, Ahmad N.; Al-Qudah, Mahmoud A.

    2016-08-01

    This study aimed to investigate a new dioxime compound as a corrosion inhibitor for copper. The compound (4,6-dihydroxy benzene-1,3-dicarbaldehyde dioxime) was synthesized and characterized by nuclear magnetic resonance spectroscopy. Electrochemical impedance spectroscopy and potentiodynamic polarization measurements were used to compare the dioxime compound with benzotriazole for their effectiveness as corrosion inhibitors for copper in 0.1 M HCl solution. Fourier transform infrared (FTIR) spectroscopy and scanning electron microscopy (SEM) were used to investigate the bonding mechanisms and morphological changes of the two inhibitors on the copper surface. The electrochemical techniques showed that the new dioxime compound was more effective than benzotriazole in inhibiting copper corrosion in the acidic chloride medium. The FTIR and SEM results indicated that the dioxime compound was able to coordinate with copper ions and formed a protective film on the copper surface. It was concluded that the new dioxime compound proved effectiveness to be used as a corrosion inhibitor for the protection and conservation of copper.

  1. The synthesis and SAR of 2-arylsulfanyl-phenyl piperazinyl acetic acids as glyT-1 inhibitors.

    PubMed

    Smith, Garrick; Ruhland, Thomas; Mikkelsen, Gitte; Andersen, Kim; Christoffersen, Claus Tornby; Alifrangis, Lene Hjorth; Mørk, Arne; Wren, Stephen P; Harris, Neil; Wyman, Barry M; Brandt, Guillaume

    2004-08-02

    Elevation of glycine levels and activation of the NMDA receptor by inhibition of the glycine transporter 1 (GlyT-1) is a potential strategy for the treatment of schizophrenia. A novel series of GlyT-1 inhibitors have been identified containing the 2-arylsulfanyl-phenylpiperazine motif. The most prominent member of this series, (R)-4-[5-chloro-2-(4-methoxy-phenylsulfanyl)-phenyl]-2-methyl-piperazin-1-yl-acetic acid (31) is a potent glycine transporter-1 inhibitor (IC(50)=150 nM), which elevated glycine levels in rat ventral hippocampus as measured by microdialysis in vivo at doses of 1.2-4.6 mg/kg s.c.

  2. Synthesis and bioevaluation of 2-phenyl-4-methyl-1,3-selenazole-5-carboxylic acids as potent xanthine oxidase inhibitors.

    PubMed

    Guan, Qi; Cheng, Zengjin; Ma, Xiaoxue; Wang, Lijie; Feng, Dongjie; Cui, Yuanhang; Bao, Kai; Wu, Lan; Zhang, Weige

    2014-10-06

    A series of 2-phenyl-4-methyl-1,3-selenazole-5-carboxylic acid derivatives (8a-f, 9a-m) were synthesized and evaluated for inhibitory activity against xanthine oxidase in vitro. Structure-activity relationship analyses have also been presented. Most of the target compounds exhibited potency levels in the nanomolar range. Compound 9e emerged as the most potent xanthine oxidase inhibitor (IC50 = 5.5 nM) in comparison to febuxostat (IC50 = 18.6 nM). Steady-state kinetics measurements with the bovine milk enzyme indicated a mixed type inhibition with Ki and Ki' values of 0.9 and 2.3 nM, respectively. A molecular modeling study on compounds 9e was performed to gain an insight into its binding mode with xanthine oxidase, and to provide the basis for further structure-guided design of new non-purine xanthine oxidase inhibitors related with 2-phenyl-4-methyl-1,3-selenazole-5-carboxylic acid scaffold.

  3. Synthesis of new glycyrrhetinic acid derived ring A azepanone, 29-urea and 29-hydroxamic acid derivatives as selective 11β-hydroxysteroid dehydrogenase 2 inhibitors.

    PubMed

    Gaware, Rawindra; Khunt, Rupesh; Czollner, Laszlo; Stanetty, Christian; Da Cunha, Thierry; Kratschmar, Denise V; Odermatt, Alex; Kosma, Paul; Jordis, Ulrich; Classen-Houben, Dirk

    2011-03-15

    Glycyrrhetinic acid, the metabolite of the natural product glycyrrhizin, is a well known nonselective inhibitor of 11β-hydroxysteroid dehydrogenase (11β-HSD) type 1 and type 2. Whereas inhibition of 11β-HSD1 is currently under consideration for treatment of metabolic diseases, such as obesity and diabetes, 11β-HSD2 inhibitors may find therapeutic applications in chronic inflammatory diseases and certain forms of cancer. Recently, we published a series of hydroxamic acid derivatives of glycyrrhetinic acid showing high selectivity for 11β-HSD2. The most potent and selective compound is active against human 11β-HSD2 in the low nanomolar range with a 350-fold selectivity over human 11β-HSD1. Starting from the lead compounds glycyrrhetinic acid and the hydroxamic acid derivatives, novel triterpene type derivatives were synthesized and analyzed for their biological activity against overexpressed human 11β-HSD1 and 11β-HSD2 in cell lysates. Here we describe novel 29-urea- and 29-hydroxamic acid derivatives of glycyrrhetinic acid as well as derivatives with the Beckman rearrangement of the 3-oxime to a seven-membered ring, and the rearrangement of the C-ring from 11-keto-12-ene to 12-keto-9(11)-ene. The combination of modifications on different positions led to compounds comprising further improved selective inhibition of 11β-HSD2 in the lower nanomolar range with up to 3600-fold selectivity.

  4. Multicomponent Synthesis and Evaluation of New 1,2,3-Triazole Derivatives of Dihydropyrimidinones as Acidic Corrosion Inhibitors for Steel.

    PubMed

    González-Olvera, Rodrigo; Román-Rodríguez, Viridiana; Negrón-Silva, Guillermo E; Espinoza-Vázquez, Araceli; Rodríguez-Gómez, Francisco Javier; Santillan, Rosa

    2016-02-22

    An efficient one-pot synthesis of 1,2,3-triazole derivatives of dihydropyrimidinones has been developed using two multicomponent reactions. The aldehyde-1,2,3-triazoles were obtained in good yields from in situ-generated organic azides and O-propargylbenzaldehyde. The target heterocycles were synthesized through the Biginelli reaction in which the aldehyde-1,2,3-triazoles reacted with ethyl acetoacetate and urea in the presence of Ce(OTf)₃ as the catalyst. The corrosion inhibition of steel grade API 5 L X52 in 1 M HCl by the synthesized compounds was investigated using the electrochemical impedance spectroscopy technique. The measurements revealed that these heterocycles are promising candidates to inhibit acidic corrosion of steel.

  5. Practical synthesis of a p38 MAP kinase inhibitor.

    PubMed

    Achmatowicz, Michał; Thiel, Oliver R; Wheeler, Philip; Bernard, Charles; Huang, Jinkun; Larsen, Robert D; Faul, Margaret M

    2009-01-16

    p38 MAP kinase inhibitors have attracted considerable interest as potential agents for the treatment of inflammatory diseases. Herein, we describe a concise and efficient synthesis of inhibitor 1 that is based on a phthalazine scaffold. Highlights of our approach include a practical synthesis of a 1,6-disubstituted phthalazine building block 24 as well as the one-pot formation of boronic acid 27. Significant synthetic work to understand the reactivity principles of the intermediates helped in selection of the final synthetic route. Subsequent optimization of the individual steps of the final sequence led to a practical synthesis of 1.

  6. Synthesis of novel 3-amino and 29-hydroxamic acid derivatives of glycyrrhetinic acid as selective 11β-hydroxysteroid dehydrogenase 2 inhibitors.

    PubMed

    Stanetty, Christian; Czollner, Laszlo; Koller, Iris; Shah, Priti; Gaware, Rawindra; Cunha, Thierry Da; Odermatt, Alex; Jordis, Ulrich; Kosma, Paul; Classen-Houben, Dirk

    2010-11-01

    Glycyrrhetinic acid, the metabolite of the natural product glycyrrhizin, is a well known nonselective inhibitor of 11β-hydroxysteroid dehydrogenase (11β-HSD) type 1 and type 2. Whereas inhibition of 11β-HSD1 is currently under consideration for treatment of metabolic diseases, such as obesity and diabetes, 11β-HSD2 inhibitors may find therapeutic applications in chronic inflammatory diseases and certain forms of cancer. So far, no selective 11β-HSD2 inhibitor has been developed and neither animal studies nor clinical trials have been reported based on 11β-HSD2 inhibition. Starting from the lead compound glycyrrhetinic acid, novel triterpene type derivatives were synthesized and analyzed for their biological activity against overexpressed human 11β-HSD1 and 11β-HSD2 in cell lysates. Several hydroxamic acid derivatives showed high selectivity for 11β-HSD2. The most potent and selective compound is active against human 11β-HSD2 in the low nanomolar range with a 350-fold selectivity over human 11β-HSD1.

  7. Design, synthesis and biological evaluation of thienopyrimidine hydroxamic acid based derivatives as structurally novel histone deacetylase (HDAC) inhibitors.

    PubMed

    Wang, Jiang; Su, Mingbo; Li, Tingting; Gao, Anhui; Yang, Wei; Sheng, Li; Zang, Yi; Li, Jia; Liu, Hong

    2017-03-10

    New thienopyrimidine hydroxamic acid derivatives as HDACs inhibitors were designed, synthesized and evaluated. All compounds were evaluated for their ability to inhibit recombinant human HDAC1, HDAC3, and HDAC6 isoforms and in vitro anti-proliferative activity on tumor cell lines RMPI 8226 and HCT 116. Most of these compounds displayed good to excellent inhibitory activities against HDACs. The IC50 values of compound 9m against HDAC1, HDAC3, and HDAC6 was 29.81 ± 0.52 nM, 24.71 ± 1.16 nM, and 21.29 ± 0.32 nM. Most of these compounds showed strong anti-proliferative activity against human cancer cell lines including RMPI 8226 and HCT 116. The IC50 values of compound 9m against RPMI 8226 and HCT 116 proliferation were 0.97 ± 0.072 μM and 1.01 ± 0.033 μM, respectively. In addition, compound 9m noticeably up-regulated the level of histone H3 acetylation at the low concentration of 0.3 μM.

  8. Synthesis of the (5Z)-5-Pentacosenoic and 5-Pentacosynoic Acids as Novel HIV-1 Reverse Transcriptase Inhibitors

    PubMed Central

    Moreira, Lizabeth Giménez; Orellano, Elsie A.; Rosado, Karolyna; Guido, Rafael V. C.; Andricopulo, Adriano D.; Soto, Gabriela O.; Rodríguez, José W.; Sanabria-Ríos, David J.; Carballeira, Néstor M.

    2016-01-01

    The natural fatty acids (5Z)-5-pentacosenoic and (9Z)-9-pentacosenoic acids were synthesized for the first time in eight steps starting from either 4-bromo-1-butanol or 8-bromo-1-butanol and in 20-58% overall yields, while the novel fatty acids 5-pentacosynoic and 9-pentacosynoic acids were also synthesized in six steps and in 34-43% overall yields. The Δ5 acids displayed the best IC50’s (24-38 µM) against the HIV-1 reverse transcriptase (RT) enzyme, comparable to nervonic acid (IC50 = 12 µM). The Δ9 acids were not as effective towards HIV-RT with the (9Z)-9-pentacosenoic acid displaying an IC50 = 54 µM. Fatty acid chain length and position of the unsaturation was critical for the observed inhibition. Molecular modeling studies indicated the structural determinants underlying the biological activity of the most potent compounds. These results provide new insights into the structural requirements that must be present in fatty acids so as to enhance their inhibitory potential towards HIV-RT. PMID:26345647

  9. Natural Product Total Synthesis in the Organic Laboratory: Total Synthesis of Caffeic Acid Phenethyl Ester (CAPE), a Potent 5-Lipoxygenase Inhibitor from Honeybee Hives

    ERIC Educational Resources Information Center

    Touaibia, Mohamed; Guay, Michel

    2011-01-01

    Natural products play a critical role in modern organic synthesis and learning synthetic techniques is an important component of the organic laboratory experience. In addition to traditional one-step organic synthesis laboratories, a multistep natural product synthesis is an interesting experiment to challenge students. The proposed three-step…

  10. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  11. Design, synthesis and in vitro evaluation of potent, novel, small molecule inhibitors of plasminogen activator inhibitor-1.

    PubMed

    Folkes, Adrian; Brown, S David; Canne, Lynne E; Chan, Jocelyn; Engelhardt, Erin; Epshteyn, Sergey; Faint, Richard; Golec, Julian; Hanel, Art; Kearney, Patrick; Leahy, James W; Mac, Morrison; Matthews, David; Prisbylla, Michael P; Sanderson, Jason; Simon, Reyna J; Tesfai, Zerom; Vicker, Nigel; Wang, Shouming; Webb, Robert R; Charlton, Peter

    2002-04-08

    We have synthesized and evaluated a series of tetramic acid-based and hydroxyquinolinone-based inhibitors of plasminogen activator inhibitor-1 (PAI-1). These studies resulted in the identification of several compounds which showed excellent potency against PAI-1. The design, synthesis and SAR of these compounds are described.

  12. Synthesis and Evaluation of a Series of Oleanolic Acid Saponins as α-Glucosidase and α-Amylase Inhibitors.

    PubMed

    Guo, Tiantian; Wu, Shaoping; Guo, Sen; Bai, Lu; Liu, Qingchao; Bai, Naisheng

    2015-09-01

    Sixteen naturally occurring oleanolic acid saponins and their derivatives were synthesized in an efficient and practical strategy, and their inhibitory activities against α-glucosidase and α-amylase were evaluated in vitro. Among all the compounds, 28-O-monoglucoside 8 exhibited remarkably potent inhibitory activity against α-glucosidase with an IC50 value of 87.3 µM, which was fivefold stronger than that of the antidiabetic acarbose. Based on the preliminary structure-activity relationships, for 28-O-monoglucosides, the presence of a terminal α-l-rhamnopyranosyl residue enhanced the α-glucosidase and α-amylase inhibitory activities. Furthermore, for 3,28-O-bidesmosides, sugar-substituted moieties attached to the C-3 and C-28 positions of the oleanolic acid scaffold are helpful to increase the inhibitory activities against α-amylase and α-glucosidase.

  13. Design, synthesis and biological evaluation of α-substituted isonipecotic acid benzothiazole analogues as potent bacterial type II topoisomerase inhibitors.

    PubMed

    Axford, Lorraine C; Agarwal, Piyush K; Anderson, Kelly H; Andrau, Laura N; Atherall, John; Barker, Stephanie; Bennett, James M; Blair, Michael; Collins, Ian; Czaplewski, Lloyd G; Davies, David T; Gannon, Carlie T; Kumar, Dushyant; Lancett, Paul; Logan, Alastair; Lunniss, Christopher J; Mitchell, Dale R; Offermann, Daniel A; Palmer, James T; Palmer, Nicholas; Pitt, Gary R W; Pommier, Stéphanie; Price, Daniel; Narasinga Rao, B; Saxena, Rashmi; Shukla, Tarun; Singh, Amit K; Singh, Mahipal; Srivastava, Anil; Steele, Christopher; Stokes, Neil R; Thomaides-Brears, Helena B; Tyndall, Edward M; Watson, David; Haydon, David J

    2013-12-15

    The discovery and optimisation of a new class of benzothiazole small molecules that inhibit bacterial DNA gyrase and topoisomerase IV are described. Antibacterial properties have been demonstrated by activity against DNA gyrase ATPase and potent activity against Staphylococcus aureus, Enterococcus faecalis, Streptococcus pyogenes and Haemophilus influenzae. Further refinements to the scaffold designed to enhance drug-likeness included analogues bearing an α-substituent to the carboxylic acid group, resulting in excellent solubility and favourable pharmacokinetic properties.

  14. Design, synthesis, and biological evaluation of 3-(1-Aryl-1H-indol-5-yl)propanoic acids as new indole-based cytosolic phospholipase A2α inhibitors.

    PubMed

    Tomoo, Toshiyuki; Nakatsuka, Takashi; Katayama, Toyoko; Hayashi, Yasuhiro; Fujieda, Yusuke; Terakawa, Maki; Nagahira, Kazuhiro

    2014-09-11

    This article describes the design, synthesis, and biological evaluation of new indole-based cytosolic phospholipase A2α (cPLA2α, a group IVA phospholipase A2) inhibitors. A screening-hit compound from our library, (E)-3-{4-[(4-chlorophenyl)thio]-3-nitrophenyl}acrylic acid (5), was used to design a class of 3-(1-aryl-1H-indol-5-yl)propanoic acids as new small molecule inhibitors. The resultant structure-activity relationships studied using the isolated enzyme and by cell-based assays revealed that the 1-(p-O-substituted)phenyl, 3-phenylethyl, and 5-propanoic acid groups on the indole core are essential for good inhibitory activity against cPLA2α. Optimization of the p-substituents on the N1 phenyl group led to the discovery of 56n (ASB14780), which was shown to be a potent inhibitor of cPLA2α via enzyme assay, cell-based assay, and guinea pig and human whole-blood assays. It displayed oral efficacy toward mice tetradecanoyl phorbol acetate-induced ear edema and guinea pig ovalbumin-induced asthma models.

  15. 5'-azido-N-1-naphthylphthalamic acid, a photolabile analog of the auxin transport inhibitor, N-1-naphthylphthalamic acid: synthesis and binding properties

    SciTech Connect

    Voet, J.G.; Howley, K.; Shumsky, J.S.

    1987-05-01

    The polar transport of the plant growth regulator, auxin (indole-3-acetic acid, IAAH), is thought to involve the participation of several proteins in the plasma membrane, including a specific, saturable, voltage independent H/sup +//IAA/sup -/ efflux carrier located preferentially at the basal end of each cell. Auxin transport is specifically inhibited by the herbicide, N-1-naphthylphthalamic acid (NPA), which binds specifically to a protein in the plasma membrane, thought to be either the IAA/sup -/ efflux carrier or an allosteric effector protein. They have synthesized and characterized a photolabile analog of NPA, 5'-azido-N-1-naphthylphthalamic acid (Az-NPA). This potential photoaffinity label for the NPA binding protein competes with /sup 3/H-NPA for binding sites on Curcurbita pepo L. (zucchini) stem cell membranes with K/sub j/ = 1.5 x 10/sup -7/ M. The K/sub i/ for NPA under these conditions is 2 x 10/sup -8/M, indicating that the affinity of Az-NPA for the membranes is only 7.5 fold lower than NPA. While the binding of 4.6 x 10/sup -6/ M Az-NPA to NPA binding sites is reversible in the dark, exposure to light results in a 30% loss in /sup 3/H-NPA binding ability. Pretreatment with 10/sup -4/ M NPA protects the membranes against photodestruction of /sup 3/H-NPA binding sites by Az-NPA, supporting the conclusion that Az-NPA destroys these sites by specific covalent attachment.

  16. Design, synthesis and biological evaluation of di-substituted cinnamic hydroxamic acids bearing urea/thiourea unit as potent histone deacetylase inhibitors.

    PubMed

    Ning, Chengqing; Bi, Yanjing; He, Yujun; Huang, WenYuan; Liu, Lifei; Li, Yi; Zhang, Sihan; Liu, Xiaoyu; Yu, Niefang

    2013-12-01

    A novel class of di-substituted cinnamic hydroxamic acid derivatives containing urea or thiourea unit was designed, synthesized and evaluated as HDAC inhibitors. All tested compounds demonstrated significant HDAC inhibitory activities and anti-proliferative effects against diverse human tumor cell lines. Among them, 7l exhibited most potent pan-HDAC inhibitory activity, with an IC50 value of 130 nM. It also showed strong cellular inhibition against diverse cell lines including HCT-116, MCF-7, MDB-MB-435 and NCI-460, with GI50 values of 0.35, 0.22, 0.51 and 0.48 μM, respectively.

  17. Protein synthesis inhibitor from potato tuber

    SciTech Connect

    Romaen, R. )

    1989-04-01

    A protein fraction capable of inhibit in vitro protein synthesis was found in potato tubers in fresh and wounded tissue. Inhibitor activity from fresh tissue decays with wounding. Inhibition activity was detected absorbed to ribsomal fraction and cytosol of potato tuber tissue by a partially reconstituted in vitro system from potato tuber and wheat germ. Adsorbed ribosomal fraction was more suitable of purification. This fraction was washed from ribosomes with 0.3M KCl, concentrated with ammonium sulfate precipitation and purified through sephadex G100 and sephadex G-75 columns chromatography. After 61 fold purification adsorbed protein fraction can inhibit germination of maize, wheat and sesame seeds, as well as {sup 3}H-leucine incorporation into protein by imbibed maize embryos. Inhibition activity was lost by temperature, alkali and protease-K hydrolysis. Preliminar analysis could not show presence of reductor sugars. Physiological role of this inhibitor in relation to rest and active tissue remains to be studied.

  18. Synthesis, biological evaluation, and structure-activity relationships of 2-[2-(benzoylamino)benzoylamino]benzoic acid analogues as inhibitors of adenovirus replication.

    PubMed

    Öberg, Christopher T; Strand, Mårten; Andersson, Emma K; Edlund, Karin; Tran, Nam Phuong Nguyen; Mei, Ya-Fang; Wadell, Göran; Elofsson, Mikael

    2012-04-12

    2-[2-Benzoylamino)benzoylamino]benzoic acid (1) was previously identified as a potent and nontoxic antiadenoviral compound (Antimicrob. Agents Chemother. 2010, 54, 3871). Here, the potency of 1 was improved over three generations of compounds. We found that the ortho, ortho substituent pattern and the presence of the carboxylic acid of 1 are favorable for this class of compounds and that the direction of the amide bonds (as in 1) is obligatory. Some variability in the N-terminal moiety was tolerated, but benzamides appear to be preferred. The substituents on the middle and C-terminal rings were varied, resulting in two potent inhibitors, 35g and 35j, with EC(50) = 0.6 μM and low cell toxicity.

  19. Tall oil fatty acid anhydrides as corrosion inhibitor intermediates

    SciTech Connect

    Fischer, E.R.; Parker, J.E. III

    1995-12-01

    Electrochemical corrosion of carbon steel tubulars in producing oil wells causes lost production and necessitates costly repairs. Corrosive environments exists where hydrocarbons and an aqueous phase are being extracted from producing wells. Tubing life has been extended four fold with the development of organic corrosion inhibitors and concentric configuration treatment. Anhydrides derived from tall oil fatty acids offer enhanced corrosion inhibition properties as compared to traditional dimer/trimer acids. The chemistry of this intermediate and its use in corrosion inhibition for down hole applications, as well as the synthesis of novel oil and water-soluble derivatives will be discussed.

  20. Design, synthesis and biological evaluation of novel L-ascorbic acid-conjugated pentacyclic triterpene derivatives as potential influenza virus entry inhibitors.

    PubMed

    Wang, Han; Xu, Renyang; Shi, Yongying; Si, Longlong; Jiao, Pingxuan; Fan, Zibo; Han, Xu; Wu, Xingyu; Zhou, Xiaoshu; Yu, Fei; Zhang, Yongmin; Zhang, Liangren; Zhang, Lihe; Zhou, Demin; Xiao, Sulong

    2016-03-03

    Since the influenza viruses can rapidly evolve, it is urgently required to develop novel anti-influenza agents possessing a novel mechanism of action. In our previous study, two pentacyclic triterpene derivatives (Q8 and Y3) have been found to have anti-influenza virus entry activities. Keeping the potential synergy of biological activity of pentacyclic triterpenes and l-ascorbic acid in mind, we synthesized a series of novel l-ascorbic acid-conjugated pentacyclic triterpene derivatives (18-26, 29-31, 35-40 and 42-43). Moreover, we evaluated these novel compounds for their anti-influenza activities against A/WSN/33 virus in MDCK cells. Among all evaluated compounds, the 2,3-O,O-dibenzyl-6-deoxy-l-ascorbic acid-betulinic acid conjugate (30) showed the most significant anti-influenza activity with an EC50 of 8.7 μM, and no cytotoxic effects on MDCK cells were observed. Time-of-addition assay indicated that compound 30 acted at an early stage of the influenza life cycle. Further analyses revealed that influenza virus-induced hemagglutination of chicken red blood cells was inhibited by treatment of compound 30, and the interaction between the influenza hemagglutinin (HA) and compound 30 was determined by surface plasmon resonance (SPR) with a dissociation constant of KD = 3.76 μM. Finally, silico docking studies indicated that compound 30 and its derivative 31 were able to occupy the binding pocket of HA for sialic acid receptor. Collectively, these results suggested that l-ascorbic acid-conjugated pentacyclic triterpenes were promising anti-influenza entry inhibitors, and HA protein associated with viral entry was a promising drug target.

  1. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  2. Design, synthesis and preliminary biological evaluation of indole-3-carboxylic acid-based skeleton of Bcl-2/Mcl-1 dual inhibitors.

    PubMed

    Liu, Tingting; Wan, Yichao; Liu, Renshuai; Ma, Lin; Li, Minyong; Fang, Hao

    2017-03-15

    The B-cell lymphoma-2 (Bcl-2) family proteins are attractive targets for cancer therapy. In our previous work, the structure-activity relationship of WL-276 was studied. According to the results, rhodanine derivatives show potent binding affinity for Bcl-2 and Mcl-1 protein and show weaker activity against Bcl-XL protein. Based on the previous results, a new class of indole-3-carboxylic acid-based derivatives were designed and synthesized as Bcl-2/Mcl-1 dual inhibitors. Among them, compound 17 has a Ki value of 0.26μM for Bcl-2 protein and is better than WL-276. Furthermore, it inhibits the myeloid cell leukemia sequence 1 (Mcl-1) protein with a Ki value of 72nM. Especially, compound 31 can selectively acting on Bcl-2 and Mcl-1 protein but not Bcl-XL protein, which has great significance for developing dual inhibitors targeting Bcl-2 and Mcl-1 protein, as well as specific antitumor abilities in cells.

  3. Design, Synthesis, and Crystal Structures of 6-Alkylidene-2 -Substituted Penicillanic Acid Sulfones as Potent Inhibitors of Acinetobacter baumannii OXA-24 Carbapenemase

    SciTech Connect

    Bou, G.; Santillana, E; Sheri, A; Beceiro, A; Sampson, J; Kalp, M; Bethel, C; Distler, A; Drawz, S; et. al.

    2010-01-01

    Class D {beta}-lactamases represent a growing and diverse class of penicillin-inactivating enzymes that are usually resistant to commercial {beta}-lactamase inhibitors. As many such enzymes are found in multi-drug resistant (MDR) Acinetobacter baumannii and Pseudomonas aeruginosa, novel {beta}-lactamase inhibitors are urgently needed. Five unique 6-alkylidene-2{prime}-substituted penicillanic acid sulfones (1-5) were synthesized and tested against OXA-24, a clinically important {beta}-lactamase that inactivates carbapenems and is found in A. baumannii. Based upon the roles Tyr112 and Met223 play in the OXA-24 {beta}-lactamase, we also engineered two variants (Tyr112Ala and Tyr112Ala,Met223Ala) to test the hypothesis that the hydrophobic tunnel formed by these residues influences inhibitor recognition. IC{sub 50} values against OXA-24 and two OXA-24 {beta}-lactamase variants ranged from 10 {+-} 1 (4 vs WT) to 338 {+-} 20 nM (5 vs Tyr112Ala, Met223Ala). Compound 4 possessed the lowest K{sub i} (500 {+-} 80 nM vs WT), and 1 possessed the highest inactivation efficiency (k{sub inact}/K{sub i} = 0.21 {+-} 0.02 {micro}M{sup -1}s{sup -1}). Electrospray ionization mass spectrometry revealed a single covalent adduct, suggesting the formation of an acyl-enzyme intermediate. X-ray structures of OXA-24 complexed to four inhibitors (2.0-2.6 {angstrom}) reveal the formation of stable bicyclic aromatic intermediates with their carbonyl oxygen in the oxyanion hole. These data provide the first structural evidence that 6-alkylidene-2{prime}-substituted penicillin sulfones are effective mechanism-based inactivators of class D {beta}-lactamases. Their unique chemistry makes them developmental candidates. Mechanisms for class D hydrolysis and inhibition are discussed, and a pathway for the evolution of the BlaR1 sensor of Staphylococcus aureus to the class D {beta}-lactamases is proposed.

  4. Synthesis, molecular modeling and biological evaluation of novel 2-allyl amino 4-methyl sulfanyl butyric acid as α-amylase and α-glucosidase inhibitor

    NASA Astrophysics Data System (ADS)

    Balan, Kannan; Perumal, Perumal; Sundarabaalaji, Narayanan; Palvannan, Thayumanavan

    2015-02-01

    In the present study 2-allyl amino 4-methyl sulfanyl butyric acid (AMSB) was synthesized in good yield. AMSB was characterized by Fourier transforms infrared spectroscopy (FTIR), Nuclear magnetic resonance (NMR) (1H and 13C) and Liquid chromatography mass spectrometry (LCMS). The radical scavenging activity and reducing power assay of AMSB was assessed using 1-1-diphenyl 2-picryl hydrazyl (DPPH), 2,2‧-azino-bis (3-ethyl benzothiazoline-6-sulfonic acid) (ABTS) and ferric ion reducing antioxidant power assay (FRAP) and was found to be 44.1, 34.71 and 41.7 μg/ml respectively. The compound showed effective inhibition against α-amylase and α-glucosidase. AMSB was identified to be a reversible mixed noncompetitive inhibitor of α-amylase and α-glucosidase. The molecular docking study was carried out to evaluate the specific groove binding properties and affords valuable information of AMSB binding mode in the active site of α-glucosidase the study may lead to the which leads to the rational design of new class of antidiabetic drugs targeting α-glucosidase based on AMSB in near future.

  5. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  6. Discovery of novel BTK inhibitors with carboxylic acids.

    PubMed

    Gao, Xiaolei; Wang, James; Liu, Jian; Guiadeen, Deodial; Krikorian, Arto; Boga, Sobhana Babu; Alhassan, Abdul-Basit; Selyutin, Oleg; Yu, Wensheng; Yu, Younong; Anand, Rajan; Liu, Shilan; Yang, Chundao; Wu, Hao; Cai, Jiaqiang; Cooper, Alan; Zhu, Hugh; Maloney, Kevin; Gao, Ying-Duo; Fischmann, Thierry O; Presland, Jeremy; Mansueto, My; Xu, Zangwei; Leccese, Erica; Zhang-Hoover, Jie; Knemeyer, Ian; Garlisi, Charles G; Bays, Nathan; Stivers, Peter; Brandish, Philip E; Hicks, Alexandra; Kim, Ronald; Kozlowski, Joeseph A

    2017-03-15

    We report the design and synthesis of a series of novel Bruton's Tyrosine Kinase (BTK) inhibitors with a carboxylic acid moiety in the ribose pocket. This series of compounds has demonstrated much improved off-target selectivities including adenosine uptake (AdU) inhibition compared to the piperidine amide series. Optimization of the initial lead compound 4 based on BTK enzyme inhibition, and human peripheral blood mononuclear cell (hPBMC) and human whole blood (hWB) activity led to the discovery of compound 40, with potent BTK inhibition, reduced off target activities, as well as favorable pharmacokinetic profile in both rat and dog.

  7. Cooperative Reinforcement of Ionic Liquid and Reactive Solvent on Enzymatic Synthesis of Caffeic Acid Phenethyl Ester as an In Vitro Inhibitor of Plant Pathogenic Bacteria.

    PubMed

    Xu, Yan; Sheng, Sheng; Liu, Xi; Wang, Chao; Xiao, Wei; Wang, Jun; Wu, Fu-An

    2017-01-02

    It is widely believed that lipases in ionic liquids (ILs) possess higher enzyme activity, stability and selectivity; however, reaction equilibrium is always limited by product inhibition, and the product is difficult to separate from non-volatile ILs using distillation. To solve this problem, using trialkylphosphine oxide (TOPO) as a complexing agent, a novel biphase of reactive solvent and IL was firstly reported for caffeic acid phenethyl ester (CAPE) production from methyl caffeate (MC) and 2-phenylethanol (PE) catalyzed by lipase via transesterification. The effects of the reaction parameters and their action mechanism were investigated, and the inhibition of CAPE against bacterial wilt pathogen Ralstonia solanacearum was firstly measured. The MC conversion of 98.83% ± 0.76% and CAPE yield of 96.29% ± 0.07% were obtained by response surface methodology in the 25 g/L TOPO-cyclohexane/[Bmim][Tf₂N] (1:1, v/v); the complex stoichiometry calculation and FTIR spectrum confirmed that the reversible hydrogen-bond complexation between TOPO and caffeates significantly enhances the cooperative effect of two phases on the lipase-catalyzed reaction. The temperature was reduced by 14 °C; the MC concentration increased by 3.33-fold; the ratio of catalyst to donor decreased by 4.5-fold; and Km decreased 1.08-fold. The EC50 of CAPE against R. solanacearum was 0.17-0.75 mg/mL, suggesting that CAPE is a potential in vitro inhibitor of plant pathogenic bacteria.

  8. Okadaic acid: the archetypal serine/threonine protein phosphatase inhibitor.

    PubMed

    Dounay, A B; Forsyth, C J

    2002-11-01

    As the first recognized member of the "okadaic acid class" of phosphatase inhibitors, the marine natural product okadaic acid is perhaps the most well-known member of a diverse array of secondary metabolites that have emerged as valuable probes for studying the roles of various cellular protein serine/threonine phosphatases. This review provides a historical perspective on the role that okadaic acid has played in stimulating a broad spectrum of modern scientific research as a result of the natural product's ability to bind to and inhibit important classes of protein serine / threonine phosphatases. The relationships between the structure and biological activities of okadaic acid are briefly reviewed, as well as the structural information regarding the particular cellular receptors protein phosphatases 1 (PP1) and 2A. Laboratory syntheses of okadaic acid and its analogs are thoroughly reviewed. Finally, an interpretation of the critical contacts observed between okadaic acid and PP1 by X-ray crystallography is provided, and specific molecular recognition hypotheses that are testable via the synthesis and assay of non-natural analogs of okadaic acid are suggested.

  9. Effects of tiaprofenic acid on plasminogen activators and inhibitors in human OA and RA synovium.

    PubMed

    Pelletier, J P; McCollum, R; Cloutier, J M; Martel-Pelletier, J

    1992-01-01

    The effect of therapeutic and pharmacological concentrations of tiaprofenic acid, a non-steroidal anti-inflammatory drug (NSAID), on the synthesis of the plasminogen activators, urokinase plasminogen activator (uPA) and tissue plasminogen activator (tPA), and the plasminogen activator inhibitors 1 and 2 (PAI-1 and PAI-2), by human synovial membranes isolated from osteoarthritis (OA) and rheumatoid arthritis (RA) sufferers was evaluated. Both forms of plasminogen activator (PA) and PA inhibitor (PAI) were synthesized by the arthritic synovium. PAI-1 and PAI-2 were both synthesized in greater amounts than the plasminogen activators. Tiaprofenic acid induced a dose-dependent decrease in uPA synthesis in both OA and RA, particularly in OA synovium, but had no true effect on tPA. Tiaprofenic acid also exerted a suppressive effect on the synthesis of PAI-1 in both OA and RA synovial membranes, and on the release of PAI-2 in RA synovium. The results of this study indicate that a decrease in uPA synthesis may be one of the mechanisms by which tiaprofenic acid could exert its effects on the arthritic process. The suppressive action of tiaprofenic acid on PAI is not likely to have a significant impact on the balance of plasminogen activators and plasminogen activator inhibitors, as plasminogen activator inhibitors are synthesized in greater amounts than plasminogen activators.

  10. Design, synthesis, and biological evaluation of novel hybrid dicaffeoyltartaric/diketo acid and tetrazole-substituted L-chicoric acid analogue inhibitors of human immunodeficiency virus type 1 integrase.

    PubMed

    Crosby, David C; Lei, Xiangyang; Gibbs, Charles G; McDougall, Brenda R; Robinson, W Edward; Reinecke, Manfred G

    2010-11-25

    Fourteen analogues of the anti-HIV-1 integrase (IN) inhibitor L-chicoric acid (L-CA) were prepared. Their IC(50) values for 3'-end processing and strand transfer against recombinant HIV-1 IN were determined in vitro, and their cell toxicities and EC(50) against HIV-1 were measured in cells (ex vivo). Compounds 1-6 are catechol/β-diketoacid hybrids, the majority of which exhibit submicromolar potency against 3'-end processing and strand transfer, though only with modest antiviral activities. Compounds 7-10 are L-CA/p-fluorobenzylpyrroloyl hybrids, several of which were more potent against strand transfer than 3'-end processing, a phenomenon previously attributed to the β-diketo acid pharmacophore. Compounds 11-14 are tetrazole bioisosteres of L-CA and its analogues, whose in vitro potencies were comparable to L-CA but with enhanced antiviral potency. The trihydroxyphenyl analogue 14 was 30-fold more potent than L-CA at relatively nontoxic concentrations. These data indicate that L-CA analogues are attractive candidates for development into clinically relevant inhibitors of HIV-1 IN.

  11. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  12. 2-Aminoimidazole Amino Acids as Inhibitors of the Binuclear Manganese Metalloenzyme Human Arginase I

    SciTech Connect

    Ilies, M.; Di Costanzo, L; North, M; Scott, J; Christianson, D

    2010-01-01

    Arginase, a key metalloenzyme of the urea cycle that converts L-arginine into L-ornithine and urea, is presently considered a pharmaceutical target for the management of diseases associated with aberrant L-arginine homeostasis, such as asthma, cardiovascular diseases, and erectile dysfunction. We now report the design, synthesis, and evaluation of a series of 2-aminoimidazole amino acid inhibitors in which the 2-aminoimidazole moiety serves as a guanidine mimetic. These compounds represent a new class of arginase inhibitors. The most potent inhibitor identified in this study, 2-(S)-amino-5-(2-aminoimidazol-1-yl)pentanoic acid (A1P, 10), binds to human arginase I with K{sub d} = 2 {micro}M and significantly attenuates airways hyperresponsiveness in a murine model of allergic airways inflammation. These findings suggest that 2-aminoimidazole amino acids represent new leads for the development of arginase inhibitors with promising pharmacological profiles.

  13. Inhibitors of abscisic acid 8'-hydroxylase.

    PubMed

    Cutler, A J; Rose, P A; Squires, T M; Loewen, M K; Shaw, A C; Quail, J W; Krochko, J E; Abrams, S R

    2000-11-07

    Structural analogues of the phytohormone (+)-abscisic acid (ABA) have been synthesized and tested as inhibitors of the catabolic enzyme (+)-ABA 8'-hydroxylase. Assays employed microsomes from suspension-cultured corn cells. Four of the analogues [(+)-8'-acetylene-ABA, (+)-9'-propargyl-ABA, (-)-9'-propargyl-ABA, and (+)-9'-allyl-ABA] proved to be suicide substrates of ABA 8'-hydroxylase. For each suicide substrate, inactivation required NADPH, increased with time, and was blocked by addition of the natural substrate, (+)-ABA. The most effective suicide substrate was (+)-9'-propargyl-ABA (K(I) = 0.27 microM). Several analogues were competitive inhibitors of ABA 8'-hydroxylase, of which the most effective was (+)-8'-propargyl-ABA (K(i) = 1.1 microM). Enzymes in the microsomal extracts also hydroxylated (-)-ABA at the 7'-position at a low rate. This activity was not inhibited by the suicide substrates, showing that the 7'-hydroxylation of (-)-ABA was catalyzed by a different enzyme from that which catalyzed 8'-hydroxylation of (+)-ABA. Based on the results described, a simple model for the positioning of substrates in the active site of ABA 8'-hydroxylase is proposed. In a representative physiological assay, inhibition of Arabidopsis thaliana seed germination, (+)-9'-propargyl-ABA and (+)-8'-acetylene-ABA exhibited substantially stronger hormonal activity than (+)-ABA itself.

  14. Development of Inhibitors of Salicylic Acid Signaling.

    PubMed

    Jiang, Kai; Kurimoto, Tetsuya; Seo, Eun-kyung; Miyazaki, Sho; Nakajima, Masatoshi; Nakamura, Hidemitsu; Asami, Tadao

    2015-08-19

    Salicylic acid (SA) plays important roles in the induction of systemic acquired resistance (SAR) in plants. Determining the mechanism of SAR will extend our understanding of plant defenses against pathogens. We recently reported that PAMD is an inhibitor of SA signaling, which suppresses the expression of the pathogenesis-related PR genes and is expected to facilitate the understanding of SA signaling. However, PAMD strongly inhibits plant growth. To minimize the side effects of PAMD, we synthesized a number of PAMD derivatives, and identified compound 4 that strongly suppresses the expression of the PR genes with fewer adverse effects on plant growth than PAMD. We further showed that the adverse effects on plant growth were partially caused the stabilization of DELLA, which is also related to the pathogen responses. These results indicate that compound 4 would facilitate our understanding of SA signaling and its cross talk with other plant hormones.

  15. In Situ Click Chemistry for the Identification of a Potent D-Amino Acid Oxidase Inhibitor.

    PubMed

    Toguchi, Shohei; Hirose, Tomoyasu; Yorita, Kazuko; Fukui, Kiyoshi; Sharpless, K Barry; Ōmura, Satoshi; Sunazuka, Toshiaki

    2016-07-01

    In situ click chemistry is a target-guided synthesis approach for discovering novel lead compounds by assembling organic azides and alkynes into triazoles inside the affinity site of target biogenic molecules such as proteins. We report in situ click chemistry screening with human D-amino acid oxidase (hDAO), which led to the identification of a more potent hDAO inhibitor. The hDAO inhibitors have chemotherapeutic potential as antipsychotic agents. The new inhibitor displayed competitive inhibition of hDAO and showed significantly increased inhibitory activity against hDAO compared with that of an anchor molecule of in situ click chemistry.

  16. Substituted thiobenzoic acid S-benzyl esters as potential inhibitors of a snake venom phospholipase A2: Synthesis, spectroscopic and computational studies

    NASA Astrophysics Data System (ADS)

    Henao Castañeda, I. C.; Pereañez, J. A.; Jios, J. L.

    2012-11-01

    4-Chlorothiobenzoic acid S-benzyl ester (I), 3-nitrothiobenzoic acid S-benzyl ester (II), 4-nitrothiobenzoic acid S-benzyl ester (III) and 4-methylthiobenzoic acid S-benzyl ester (IV) were prepared and characterized by 1H and 13C NMR, Mass spectrometry and IR spectroscopy. Quantum chemical calculations were performed with Gaussian 09 to calculate the geometric parameters and vibrational spectra. Phospholipase A2 (PLA2) was purified from Crotalus durissus cumanensis venom by molecular exclusion chromatography, followed by reverse phase-high performance liquid chromatography. Two studies of the inhibition of phospholipase A2 activity were performed using phosphatidilcholine and 4-nitro-3-octanoyloxybenzoic acid as substrates, in both cases compound II showed the best inhibitory ability, with 74.89% and 69.91% of inhibition, respectively. Average percentage of inhibition was 52.49%. Molecular docking was carried out with Autodock Vina using as ligands the minimized structures of compounds (I-IV) and as protein PLA2 (PDB code 2QOG). The results suggest that compounds I-IV could interact with His48 at the active site of PLA2. In addition, all compounds showed Van der Waals interactions with residues from hydrophobic channel of the enzyme. This interaction would impede normal catalysis cycle of the PLA2.

  17. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  18. Lunularic acid, a common endogenous growth inhibitor of liverworts.

    PubMed

    Pryce, R J

    1971-12-01

    By gas-liquid chromotography and thin layer chromatography, an endogenous growth inhibitor of Lunularia cruciata has been detected in seven other representatives of the class of liverworts. All liverworts so far examined have been found to contain lunularic acid. Evidence for the identity of the previously isolated, but unidentified, endogenous growth inhibitor of Marchantia polymorpha and lunularic acid is presented.

  19. Synthesis, biological characterization and molecular modeling insights of spirochromanes as potent HDAC inhibitors.

    PubMed

    Thaler, Florian; Moretti, Loris; Amici, Raffaella; Abate, Agnese; Colombo, Andrea; Carenzi, Giacomo; Fulco, Maria Carmela; Boggio, Roberto; Dondio, Giulio; Gagliardi, Stefania; Minucci, Saverio; Sartori, Luca; Varasi, Mario; Mercurio, Ciro

    2016-01-27

    In the last decades, inhibitors of histone deacetylases (HDAC) have become an important class of anti-cancer agents. In a previous study we described the synthesis of spiro[chromane-2,4'-piperidine]hydroxamic acid derivatives able to inhibit histone deacetylase enzymes. Herein, we present our exploration for new derivatives by replacing the piperidine moiety with various cycloamines. The goal was to obtain highly potent compounds with a good in vitro ADME profile. In addition, molecular modeling studies unravelled the binding mode of these inhibitors.

  20. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  1. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  2. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  3. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  4. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  5. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  6. Screening of Zulu medicinal plants for prostaglandin-synthesis inhibitors.

    PubMed

    Jäger, A K; Hutchings, A; van Staden, J

    1996-06-01

    Aqueous and ethanolic extracts of 39 plants used in traditional Zulu medicine to treat headache or inflammatory diseases were screened for prostaglandin-synthesis inhibitors. Extracts were tested in an in vitro assay for cyclooxygenase inhibitors. In general, ethanolic extracts caused higher inhibition than aqueous extracts. Two-thirds of the plants screened had high inhibitory activity. The highest inhibition was obtained with ethanolic extracts of Bidens pilosa, Eucomis autumnalis, Harpephyllum caffrum, Helichrysum nudifolium, Leonotis intermedia, L. leonorus, Ocotea bullata, Rumex saggitatus, Solanum mauritianum, Synadenium cupulare and Trichilia dregeana.

  7. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  8. Design and synthesis of a potent histone deacetylase inhibitor.

    PubMed

    Liu, Tao; Kapustin, Galina; Etzkorn, Felicia A

    2007-05-03

    Histone deacetylase (HDAC) inhibitors have potential for cancer therapy. An HDAC inhibitor based on a cyclic peptide mimic of known structure, linked by an aliphatic chain to a hydroxamic acid, was designed and synthesized. The chimeric compound showed potent competitive inhibition of nuclear HDACs, with an IC50 value of 46 nM and a Ki value of 13.7 nM. The designed inhibitor showed 4-fold selectivity for HDAC1 (57 nM) over HDAC8 (231 nM).

  9. Interfacial inhibitors of protein-nucleic acid interactions.

    PubMed

    Pommier, Yves; Marchand, Christophe

    2005-07-01

    This essay develops the paradigm of "Interfacial Inhibitors" (Pommier and Cherfils, TiPS, 2005, 28: 136) for inhibitory drugs beside orthosteric (competitive or non-competitive) and allosteric inhibitors. Interfacial inhibitors bind with high selectivity to a binding site involving two or more macromolecules within macromolecular complexes undergoing conformational changes. Interfacial binding traps (generally reversibly) a transition state of the complex, resulting in kinetic inactivation. The exemplary case of interfacial inhibitor of protein-DNA interface is camptothecin and its clinical derivatives. We will also provide examples generalizing the interfacial inhibitor concept to inhibitors of topoisomerase II (anthracyclines, ellipticines, epipodophyllotoxins), gyrase (quinolones, ciprofloxacin, norfloxacin), RNA polymerases (alpha-amanitin and actinomycin D), and ribosomes (antibiotics such as streptomycin, hygromycin B, tetracycline, kirromycin, fusidic acid, thiostrepton, and possibly cycloheximide). We discuss the implications of the interfacial inhibitor concept for drug discovery.

  10. Synthesis of Antidotes for Organophosphorus Acetylcholinesterase Inhibitors

    DTIC Science & Technology

    1991-08-30

    etal.ɟ> These compounds are imidazolium salts with one relatively complex nitrogen substituent and amido or methyl substituents at C-2. 11 TABLE...pyridinium p-toluenesulfonate (4.0 g, 10 mmol) and nicotinic acid hydrazide (1.52 g, 11 mmol) was refluxed in absolute ethanol (105 mL) for 2 h. The

  11. Synthesis of the Pitstop family of clathrin inhibitors.

    PubMed

    Robertson, Mark J; Deane, Fiona M; Stahlschmidt, Wiebke; von Kleist, Lisa; Haucke, Volker; Robinson, Phillip J; McCluskey, Adam

    2014-07-01

    This protocol describes the synthesis of two classes of clathrin inhibitors, Pitstop 1 and Pitstop 2, along with two inactive analogs that can be used as negative controls (Pitstop inactive controls, Pitnot-2 and Pitnot-2-100). Pitstop-induced inhibition of clathrin TD function acutely interferes with clathrin-mediated endocytosis (CME), synaptic vesicle recycling and cellular entry of HIV, whereas clathrin-independent internalization pathways and secretory traffic proceed unperturbed; these reagents can, therefore, be used to investigate clathrin function, and they have potential pharmacological applications. Pitstop 1 is synthesized in two steps: sulfonation of 1,8-naphthalic anhydride and subsequent reaction with 4-amino(methyl)aniline. Pitnot-1 results from the reaction of 4-amino(methyl)aniline with commercially available 4-sulfo-1,8-naphthalic anhydride potassium salt. Reaction of 1-naphthalene sulfonyl chloride with pseudothiohydantoin followed by condensation with 4-bromobenzaldehyde yields Pitstop 2. The synthesis of the inactive control commences with the condensation of 4-bromobenzaldehyde with the rhodanine core. Thioketone methylation and displacement with 1-napthylamine affords the target compound. Although Pitstop 1-series compounds are not cell permeable, they can be used in biochemical assays or be introduced into cells via microinjection. The Pitstop 2-series compounds are cell permeable. The synthesis of these compounds does not require specialist equipment and can be completed in 3-4 d. Microwave irradiation can be used to reduce the synthesis time. The synthesis of the Pitstop 2 family is easily adaptable to enable the synthesis of related compounds such as Pitstop 2-100 and Pitnot-2-100. The procedures are also simple, efficient and amenable to scale-up, enabling cost-effective in-house synthesis for users of these inhibitor classes.

  12. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  13. New peptide deformylase inhibitors design, synthesis and pharmacokinetic assessment.

    PubMed

    Lv, Fengping; Chen, Chen; Tang, Yang; Wei, Jianhai; Zhu, Tong; Hu, Wenhao

    2016-08-01

    The docking approach for the screening of designed small molecule ligands, led to the identification of a critical arginine residue in peptide deformylase for spiro cyclopropyl PDF inhibitor's extra hydrophobic binding, providing us a useful tool for searching more efficient PDF inhibitors to fight for horrifying antibiotics resistance. Further synthetic modification was undertaken to optimize the potency of amide compounds. To lower metabolic susceptibility and in turn reduce unwanted metabolic toxicity that was observed clinically, while retaining desired antibacterial activity, the use of azoles as amide bioisosteres had also been investigated. After the completion of chemical synthesis, all the compounds were evaluated through in vitro antibacterial activity assay, some of which were further subject to in vivo rat pharmacokinetic assessment. Those findings in this letter showed that spiro cyclopropyl proline N-formyl hydroxylamines, and especially the bioisosteric azoles, can represent a promising class of PDF inhibitors.

  14. Natural fatty acid synthase inhibitors as potent therapeutic agents for cancers: A review.

    PubMed

    Zhang, Jia-Sui; Lei, Jie-Ping; Wei, Guo-Qing; Chen, Hui; Ma, Chao-Ying; Jiang, He-Zhong

    2016-09-01

    Context Fatty acid synthase (FAS) is the only mammalian enzyme to catalyse the synthesis of fatty acid. The expression level of FAS is related to cancer progression, aggressiveness and metastasis. In recent years, research on natural FAS inhibitors with significant bioactivities and low side effects has increasingly become a new trend. Herein, we present recent research progress on natural fatty acid synthase inhibitors as potent therapeutic agents. Objective This paper is a mini overview of the typical natural FAS inhibitors and their possible mechanism of action in the past 10 years (2004-2014). Method The information was collected and compiled through major databases including Web of Science, PubMed, and CNKI. Results Many natural products induce cancer cells apoptosis by inhibiting FAS expression, with fewer side effects than synthetic inhibitors. Conclusion Natural FAS inhibitors are widely distributed in plants (especially in herbs and foods). Some natural products (mainly phenolics) possessing potent biological activities and stable structures are available as lead compounds to synthesise promising FAS inhibitors.

  15. Suppression of the biosynthesis of guanosine triphosphate by protein synthesis inhibitors

    SciTech Connect

    Volkin, E.; Boling, M.E.; Jones, M.H.; Lee, W.H.; Pike, L.M.

    1980-10-10

    In a prior report it was observed that CTP synthesis and concomitant incorporation of CMP into RNA and dCMP into DNA were markedly reduced in cells cultured in the presence of cycloheximide and puromycin. Experiments described here with Novikoff hepatoma cells reveal that the purine biosynthetic pathway is similarly affected. When the cells are subjected to cycloheximide (30 or 60 ..mu..g/ml) or puromycin (100 ..mu..g/ml), there is a substantial reduction in the bioconversion of hypoxanthine, adenosine, and deoxyadenosine into guanylate compared to untreated cultures. Whereas synthesis (counts per min/nmol) of pool ATP was 70 to 100% of controls, that of pool GTP was 20 to 35% of controls. Incorporation of AMP into RNA was 40 to 60% of controls, but that of GMP was only 10 to 25% of controls. Incorporation of dAMP into DNA averaged 10% of controls, but that of dGMP was only 4% of controls. Synthesis of guanylates from formate by the de novo pathway was similarly reduced, but incorporation of guanosine, which enters via kinase action alone, was not disproportionately lowered. These results suggest that protein synthesis inhibitors cause a severely reduced availability of newly synthesized GTP and CTP as well as their deoxy counterparts, dGTP and dCTP, the proximal precursors for the synthesis of RNA and DNA. However, the nanomolar levels of all nucleoside triphosphates remain high, probably as a result of recycling of nucleic acid breakdown products. Thus, reduced synthesis of these compounds may restrict nucleic acid synthesis only of some sort of compartmentation leads to a limitation of these precursors at the site(s) of nucleic acid synthesis.

  16. Bis(aminomethyl)phosphinic Acid, a Highly Promising Scaffold for the Development of Bacterial Urease Inhibitors

    PubMed Central

    2014-01-01

    Inhibitors of bacterial ureases are considered to be promising compounds in the treatment of infections caused by Helicobacter pylori in the gastric tract and/or by urealytic bacteria (e.g., Proteus species) in the urinary tract. A new, extended transition state scaffold, bis(aminomethyl)phosphinic acid, was successfully explored for the construction of effective enzyme inhibitors. A reliable methodology for the synthesis of phosphinate analogues in a three-component Mannich-type reaction was elaborated. The obtained molecules were assayed against ureases purified from Sporosarcina pasteurii and Proteus mirabilis, and aminomethyl(N-n-hexylaminomethyl)phosphinic acid was found to be the most potent inhibitor, with a Ki = 108 nM against the S. pasteurii enzyme. PMID:25699141

  17. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  18. Design, synthesis, molecular docking studies and in vitro screening of ethyl 4-(3-benzoylthioureido) benzoates as urease inhibitors.

    PubMed

    Saeed, Aamer; Khan, Muhammad Siraj; Rafique, Hummera; Shahid, Mohammad; Iqbal, Jamshed

    2014-02-01

    Thioureas are exceptionally versatile building blocks towards the synthesis of wide variety of heterocyclic systems, which also possess extensive range of pharmacological activities. The substituted benzoic acids were converted into corresponding acid chlorides, these acid chlorides were then treated with potassium thiocyanate in acetone and then the reaction mixture was refluxed for 1-2h afford ethyl 4-(3-benzoylthioureido)benzoates thioureas in good yields. All the newly synthesized compounds were evaluated for their urease inhibitory activities and were found to be potent inhibitors of urease enzyme. Compounds 1f and 1g were identified as the most potent urease inhibitors (IC50 0.21 and 0.13 μM, respectively), and was 100-fold more potent than the standard inhibitors. Further molecular docking studies were carried out using the crystal structure of urease to find out the binding mode of the inhibitors with the enzyme.

  19. Stereocontrolled Synthesis of a Potential Transition-State Inhibitor of the Salicylate Synthase MbtI from Mycobacterium tuberculosis.

    PubMed

    Liu, Zheng; Liu, Feng; Aldrich, Courtney C

    2015-07-02

    Mycobactins are small-molecule iron chelators (siderophores) produced by Mycobacterium tuberculosis (Mtb) for iron mobilization. The bifunctional salicylate synthase MbtI catalyzes the first step of mycobactin biosynthesis through the conversion of the primary metabolite chorismate into salicylic acid via isochorismate. We report the design, synthesis, and biochemical evaluation of an inhibitor based on the putative transition state (TS) for the isochorismatase partial reaction of MbtI. The inhibitor mimics the hypothesized charge buildup at C-4 of chorismate in the TS as well as C-O bond formation at C-6. Another important design element of the inhibitor is replacement of the labile pyruvate side chain in chorismate with a stable C-linked propionate isostere. We developed a stereocontrolled synthesis of the highly functionalized cyclohexene inhibitor that features an asymmetric aldol reaction using a titanium enolate, diastereoselective Grignard addition to a tert-butanesulfinyl aldimine, and ring closing olefin metathesis as key steps.

  20. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  1. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  2. Binding of [alpha, alpha]-Disubstituted Amino Acids to Arginase Suggests New Avenues for Inhibitor Design

    SciTech Connect

    Ilies, Monica; Di Costanzo, Luigi; Dowling, Daniel P.; Thorn, Katherine J.; Christianson, David W.

    2011-10-21

    Arginase is a binuclear manganese metalloenzyme that hydrolyzes L-arginine to form L-ornithine and urea, and aberrant arginase activity is implicated in various diseases such as erectile dysfunction, asthma, atherosclerosis, and cerebral malaria. Accordingly, arginase inhibitors may be therapeutically useful. Continuing our efforts to expand the chemical space of arginase inhibitor design and inspired by the binding of 2-(difluoromethyl)-L-ornithine to human arginase I, we now report the first study of the binding of {alpha},{alpha}-disubstituted amino acids to arginase. Specifically, we report the design, synthesis, and assay of racemic 2-amino-6-borono-2-methylhexanoic acid and racemic 2-amino-6-borono-2-(difluoromethyl)hexanoic acid. X-ray crystal structures of human arginase I and Plasmodium falciparum arginase complexed with these inhibitors reveal the exclusive binding of the L-stereoisomer; the additional {alpha}-substituent of each inhibitor is readily accommodated and makes new intermolecular interactions in the outer active site of each enzyme. Therefore, this work highlights a new region of the protein surface that can be targeted for additional affinity interactions, as well as the first comparative structural insights on inhibitor discrimination between a human and a parasitic arginase.

  3. Binding of α,α-disubstituted amino acids to arginase suggests new avenues for inhibitor design.

    PubMed

    Ilies, Monica; Di Costanzo, Luigi; Dowling, Daniel P; Thorn, Katherine J; Christianson, David W

    2011-08-11

    Arginase is a binuclear manganese metalloenzyme that hydrolyzes L-arginine to form L-ornithine and urea, and aberrant arginase activity is implicated in various diseases such as erectile dysfunction, asthma, atherosclerosis, and cerebral malaria. Accordingly, arginase inhibitors may be therapeutically useful. Continuing our efforts to expand the chemical space of arginase inhibitor design and inspired by the binding of 2-(difluoromethyl)-L-ornithine to human arginase I, we now report the first study of the binding of α,α-disubstituted amino acids to arginase. Specifically, we report the design, synthesis, and assay of racemic 2-amino-6-borono-2-methylhexanoic acid and racemic 2-amino-6-borono-2-(difluoromethyl)hexanoic acid. X-ray crystal structures of human arginase I and Plasmodium falciparum arginase complexed with these inhibitors reveal the exclusive binding of the L-stereoisomer; the additional α-substituent of each inhibitor is readily accommodated and makes new intermolecular interactions in the outer active site of each enzyme. Therefore, this work highlights a new region of the protein surface that can be targeted for additional affinity interactions, as well as the first comparative structural insights on inhibitor discrimination between a human and a parasitic arginase.

  4. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  5. Uric acid urolithiasis and crystallization inhibitors.

    PubMed

    Grases, F; Ramis, M; Villacampa, A I; Costa-Bauzá, A

    1999-01-01

    An in vitro study of the inhibitory effects that some substances occasionally present in urine can provoke on the crystallization of uric acid has been performed. The most remarkable crystallization inhibitory effects were produced by mucine at concentrations of >0.5 mg/l. Pentosan polysulfate and chondroitin sulfate also clearly increased the uric acid crystallization times at concentrations of >100 mg/l. Saponins, such as escin and glycyrrhizic acid, also produced a notable delay in uric acid crystallization times at concentrations of >10 mg/l. Similar effects were observed in the presence of a surfactant substance, lauryl sulfate. N-Acetyl-L-cysteine caused crystallization perturbations only when it was present at concentrations of >50 mg/l. Citric acid and phytic acid caused no effects on uric acid crystallization even at the highest concentrations assayed (1,000 and 5 mg/l, respectively). From the results obtained it can be deduced that mainly glycoproteins, glycosaminoglycans and surfactant substances can exert protective effects against uric acid crystallization.

  6. Imidazopyridine-Based Fatty Acid Synthase Inhibitors That Show Anti-HCV Activity and in Vivo Target Modulation

    PubMed Central

    2012-01-01

    Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo. PMID:24900571

  7. Inhibitors of Angiogenesis in Cancer Therapy - Synthesis and Biological Activity.

    PubMed

    Gensicka, Monika; Głowacka, Agnieszka; Dzierzbicka, Krystyna; Cholewinski, Grzegorz

    2015-01-01

    Angiogenesis is the process of formation of new capillaries from preexisting blood vessels. Angiogenesis is involved in normal physiological processes, and plays an important role in tumor invasion and development of metastases. Vascular endothelial growth factor (VEGF) plays a key role in angiogenesis. VEGF is a mitogen for vascular endothelial cells and stimulates their proliferation. By inhibiting the biological activity of VEGF, and then signal cascades with neutralizing VEGF antibodies and signal inhibitors, may negatively regulate the growth and metastasis. Anti-angiogenesis therapy is less toxic than chemotherapy. Angiogenesis is a multistep and multifactorial process, and therefore, can be blocked at different levels. In this review article, the authors present the synthesis of novel inhibitors of angiogenesis, together with the results of biological tests in vitro, and in some cases, state trials.

  8. Synthesis of antifungal glucan synthase inhibitors from enfumafungin.

    PubMed

    Zhong, Yong-Li; Gauthier, Donald R; Shi, Yao-Jun; McLaughlin, Mark; Chung, John Y L; Dagneau, Philippe; Marcune, Benjamin; Krska, Shane W; Ball, Richard G; Reamer, Robert A; Yasuda, Nobuyoshi

    2012-04-06

    An efficient, new, and scalable semisynthesis of glucan synthase inhibitors 1 and 2 from the fermentation product enfumafungin 3 is described. The highlights of the synthesis include a high-yielding ether bond-forming reaction between a bulky sulfamidate 17 and alcohol 4 and a remarkably chemoselective, improved palladium(II)-mediated Corey-Yu allylic oxidation at the highly congested C-12 position of the enfumafungin core. Multi-hundred gram quantities of the target drug candidates 1 and 2 were prepared, in 12 linear steps with 25% isolated yield and 13 linear steps with 22% isolated yield, respectively.

  9. A practical total synthesis of the microbial alkaline proteinase inhibitor (MAPI).

    PubMed

    Haebich, Dieter; Hillisch, Alexander; El Sheikh, Sherif

    2009-12-01

    Diverse serine and cysteine proteases as well as alkaline proteinases and elastases play a crucial role in numerous biological processes. Natural peptide aldehydes such as the "microbial alkaline proteinase inhibitor" (MAPI, 1) are valuable tools to characterize novel enzymes and to study their function in nature. Within a drug discovery program we wanted to design and explore non-natural MAPI congeners with novel biological profiles. To that end we devised a simple, practical, and scalable synthesis of MAPI 1 from readily available amino acid building blocks. The modular nature of our approach allows convenient structural modification of the MAPI backbone.

  10. Evaluation of benzoic acid derivatives as sirtuin inhibitors.

    PubMed

    Chen, Yi-Pei; Catbagan, Chad C; Bowler, Jeannette T; Gokey, Trevor; Goodwin, Natalie D M; Guliaev, Anton B; Wu, Weiming; Amagata, Taro

    2014-01-01

    Employing a genetically modified yeast strain as a screening tool, 4-dimethylaminobenzoic acid (5) was isolated from the marine sediment-derived Streptomyces sp. CP27-53 as a weak yeast sirtuin (Sir2p) inhibitor. Using this compound as a scaffold, a series of disubstituted benzene derivatives were evaluated to elucidate the structure activity relationships for Sir2p inhibition. The results suggested that 4-alkyl or 4-alkylaminobenzoic acid is the key structure motif for Sir2p inhibitory activity. The most potent Sir2p inhibitor, 4-tert-butylbenzoic acid (20), among the tested compounds in this study turned out to be a weak but selective SIRT1 inhibitor. The calculated binding free energies between the selected compounds and the catalytic domain of SIRT1 were well correlated to their measured SIRT1 inhibitory activities.

  11. Identification of sulfonic acids as efficient ecto-5'-nucleotidase inhibitors.

    PubMed

    Iqbal, Jamshed; Saeed, Aamer; Raza, Rabia; Matin, Abdul; Hameed, Abdul; Furtmann, Norbert; Lecka, Joanna; Sévigny, Jean; Bajorath, Jürgen

    2013-01-01

    Ecto-5'-nucleotidase (CD73) is well known for its implication in cancer. Inhibition of ecto-5'-nucleotidases is thought to provide an attractive approach to cancer therapy. This study identifies sulfonic acid compounds as efficient inhibitors of ecto-5'-nucleotidases. The compounds were tested against recombinant human and rat ecto-5'-nucleotidases. The most potent new sulfonic acid inhibitor 6-amino-4-hydroxynaphthalene-2-sulfonic acid (1) of ecto-5'-nucleotidase had an IC₅₀ of 1.32 ± 0.09 μM for the human and 10.4 ± 3.3 μM for the rat enzyme. Generally, all compounds were more active against the human enzyme. Plausible binding mode models were developed for this new class of inhibitors. Furthermore, several sulfonic acid inhibitors were efficient cytotoxic agents when tested on H157 cancer cell lines. Hence, new ecto-5'-nucleotidases inhibitors displayed significant potential for further development as compounds for anti-cancer therapy.

  12. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  13. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  14. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  15. Synthesis, chiral high performance liquid chromatographic resolution and enantiospecific activity of a potent new geranylgeranyl transferase inhibitor, 2-hydroxy-3-imidazo[1,2-a]pyridin-3-yl-2-phosphonopropionic acid.

    PubMed

    McKenna, Charles E; Kashemirov, Boris A; Błazewska, Katarzyna M; Mallard-Favier, Isabelle; Stewart, Charlotte A; Rojas, Javier; Lundy, Mark W; Ebetino, Frank H; Baron, Rudi A; Dunford, James E; Kirsten, Marie L; Seabra, Miguel C; Bala, Joy L; Marma, Mong S; Rogers, Michael J; Coxon, Fraser P

    2010-05-13

    3-(3-Pyridyl)-2-hydroxy-2-phosphonopropanoic acid (3-PEHPC, 1) is a phosphonocarboxylate (PC) analogue of 2-(3-pyridyl)-1-hydroxyethylidenebis(phosphonic acid) (risedronic acid, 2), an osteoporosis drug that decreases bone resorption by inhibiting farnesyl pyrophosphate synthase (FPPS) in osteoclasts, preventing protein prenylation. 1 has lower bone affinity than 2 and weakly inhibits Rab geranylgeranyl transferase (RGGT), selectively preventing prenylation of Rab GTPases. We report here the synthesis and biological studies of 2-hydroxy-3-imidazo[1,2-a]pyridin-3-yl-2-phosphonopropionic acid (3-IPEHPC, 3), the PC analogue of minodronic acid 4. Like 1, 3 selectively inhibited Rab11 vs. Rap 1A prenylation in J774 cells, and decreased cell viability, but was 33-60x more active in these assays. After resolving 3 by chiral HPLC (>98% ee), we found that (+)-3-E1 was much more potent than (-)-3-E2 in an isolated RGGT inhibition assay, approximately 17x more potent (LED 3 microM) than (-)-3-E2 in inhibiting Rab prenylation in J774 cells and >26x more active in the cell viability assay. The enantiomers of 1 exhibited a 4-fold or smaller potency difference in the RGGT and prenylation inhibition assays.

  16. Discovery of a novel acyl-CoA: cholesterol acyltransferase inhibitor: the synthesis, biological evaluation, and reduced adrenal toxicity of (4-phenylcoumarin)acetanilide derivatives with a carboxylic acid moiety.

    PubMed

    Ogino, Masaki; Nakada, Yoshihisa; Negoro, Nobuyuki; Itokawa, Shigekazu; Nishimura, Satoshi; Sanada, Tsukasa; Satomi, Tomoko; Kita, Shunbun; Kubo, Kazuki; Marui, Shogo

    2011-01-01

    As a part of our research for novel potent and orally available acyl-CoA: cholesterol acyltransferase (ACAT) inhibitors that can be used as anti-atherosclerotic agents, we recently reported the discovery of the (4-phenylcoumarine)acetanilide derivative 1. However, compound 1 showed adrenal toxicity in animal models. In order to search for safer ACAT inhibitors that do not have adrenal toxicity, we examined the inhibitory activity of ACAT in human macrophage and adrenal cells. The introduction of a carboxylic acid moiety on the pendant phenyl ring and the adjustment of the lipophilicity led to the discovery of (2E)-3-[7-chloro-3-[2-[[4-fluoro-2-(trifluoromethyl)phenyl]amino]-2-oxoethyl]-6-methyl-2-oxo-2H-chromen-4-yl]phenyl]acrylic acid (21e), which showed potent ACAT inhibitory activity in macrophages and a selectivity of around 30-fold over adrenal cells. In addition, compound 21e showed high adrenal safety in guinea pigs.

  17. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  18. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  19. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  20. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  1. Polyamines are Inhibitors of Gastric Acid Secretion

    NASA Astrophysics Data System (ADS)

    Ray, Tushar K.; Nandi, Jyotirmoy; Pidhorodeckyj, Nykolai; Meng-Ai, Zhou

    1982-03-01

    The naturally occurring organic polycations such as spermine and spermidine inhibit histamine-stimulated gastric acid secretion by bullfrog gastric mucosa in vitro; spermine is much more potent than spermidine. Unlike the H2 receptor antagonists, the polyamines are completely ineffective from the nutrient side and are effective only from the secretory side of the chambered mucosa. The polyamine effects could be reversed by increasing K+ concentration in the secretory solution. Studies with isolated gastric microsomal vesicles demonstrate that the polyamines do not inhibit the gastric H+,K+-ATPase but greatly decrease the ATPase-mediated uptake of H+ under appropriate conditions. For the latter effects the presence of polyamine within the vesicle interior was found to be essential. Our data strongly suggest an uncoupling of the gastric H+,K+-ATPase system by the polyamines. The therapeutic potential of these and similar compounds in the treatment of hyperacidity and peptic ulcer is discussed.

  2. Design, synthesis, and biological evaluation of novel (1-thioxo-1,2,3,4-tetrahydro-β-carbolin-9-yl)acetic acids as selective inhibitors for AKR1B1.

    PubMed

    Minehira, Daisuke; Takeda, Daisuke; Urata, Hirokazu; Kato, Atsushi; Adachi, Isao; Wang, Xu; Matsuya, Yuji; Sugimoto, Kenji; Takemura, Mayuko; Endo, Satoshi; Matsunaga, Toshiyuki; Hara, Akira; Koseki, Jun; Narukawa, Kayo; Hirono, Shuichi; Toyooka, Naoki

    2012-01-01

    New substituted (1-thioxo-1,2,3,4-tetrahydro-β-carbolin-9-yl)acetic acids were designed as the inhibitor of AKR1B1 based upon the structure of rhetsinine, a minor alkaloidal component of Evodia rutaecarpa, and twenty derivatives were synthesized and evaluated. The most active compound of the series was (2-benzyl-6-methoxy-1-thioxo-1,2,3,4-tetrahydro-β-carbolin-9-yl)acetic acid (7m), which showed comparable inhibitory activity for AKR1B1 (IC(50)=0.15μM) with clinically used epalrestat (IC(50)=0.1μM). In the view of activity and selectivity, the most potent compound was (2-benzyl-6-carboxy-1-thioxo-1,2,3,4-tetrahydro-β-carbolin-9-yl)acetic acid (7t), which showed strong inhibitory effect (IC(50)=0.17μM) and very high selectivity for AKR1B1 against AKR1A1 (311:1) and AKR1B10 (253:1) compared with epalrestat.

  3. Structure-based Design and In-Parallel Synthesis of Inhibitors of AmpC b-lactamase

    SciTech Connect

    Tondi, D.; Powers, R.A.; Negri, M.C.; Caselli, M.C.; Blazquez, J.; Costi, M.P.; Shoichet, B.K.

    2010-03-08

    Group I {beta}-lactamases are a major cause of antibiotic resistance to {beta}-lactams such as penicillins and cephalosporins. These enzymes are only modestly affected by classic {beta}-lactam-based inhibitors, such as clavulanic acid. Conversely, small arylboronic acids inhibit these enzymes at sub-micromolar concentrations. Structural studies suggest these inhibitors bind to a well-defined cleft in the group I {beta}-lactamase AmpC; this cleft binds the ubiquitous R1 side chain of {beta}-lactams. Intriguingly, much of this cleft is left unoccupied by the small arylboronic acids. To investigate if larger boronic acids might take advantage of this cleft, structure-guided in-parallel synthesis was used to explore new inhibitors of AmpC. Twenty-eight derivatives of the lead compound, 3-aminophenylboronic acid, led to an inhibitor with 80-fold better binding (2; K{sub i} 83 nM). Molecular docking suggested orientations for this compound in the R1 cleft. Based on the docking results, 12 derivatives of 2 were synthesized, leading to inhibitors with K{sub i} values of 60 nM and with improved solubility. Several of these inhibitors reversed the resistance of nosocomial Gram-positive bacteria, though they showed little activity against Gram-negative bacteria. The X-ray crystal structure of compound 2 in complex with AmpC was subsequently determined to 2.1 {angstrom} resolution. The placement of the proximal two-thirds of the inhibitor in the experimental structure corresponds with the docked structure, but a bond rotation leads to a distinctly different placement of the distal part of the inhibitor. In the experimental structure, the inhibitor interacts with conserved residues in the R1 cleft whose role in recognition has not been previously explored. Combining structure-based design with in-parallel synthesis allowed for the rapid exploration of inhibitor functionality in the R1 cleft of AmpC. The resulting inhibitors differ considerably from {beta}-lactams but

  4. CHR-2797: an antiproliferative aminopeptidase inhibitor that leads to amino acid deprivation in human leukemic cells.

    PubMed

    Krige, David; Needham, Lindsey A; Bawden, Lindsay J; Flores, Nicolas; Farmer, Hannah; Miles, Lauren E C; Stone, Erica; Callaghan, Juliana; Chandler, Stephen; Clark, Vanessa L; Kirwin-Jones, Patricia; Legris, Valérie; Owen, Jo; Patel, Thakor; Wood, Steve; Box, Gary; Laber, David; Odedra, Rajesh; Wright, Annette; Wood, L Michael; Eccles, Suzanne A; Bone, Elisabeth A; Ayscough, Andrew; Drummond, Alan H

    2008-08-15

    CHR-2797 is a novel metalloenzyme inhibitor that is converted into a pharmacologically active acid product (CHR-79888) inside cells. CHR-79888 is a potent inhibitor of a number of intracellular aminopeptidases, including leucine aminopeptidase. CHR-2797 exerts antiproliferative effects against a range of tumor cell lines in vitro and in vivo and shows selectivity for transformed over nontransformed cells. Its antiproliferative effects are at least 300 times more potent than the prototypical aminopeptidase inhibitor, bestatin. However, the mechanism by which inhibition of these enzymes leads to proliferative changes is not understood. Gene expression microarrays were used to profile changes in mRNA expression levels in the human promyelocytic leukemia cell line HL-60 treated with CHR-2797. This analysis showed that CHR-2797 treatment induced a transcriptional response indicative of amino acid depletion, the amino acid deprivation response, which involves up-regulation of amino acid synthetic genes, transporters, and tRNA synthetases. These changes were confirmed in other leukemic cell lines sensitive to the antiproliferative effects of CHR-2797. Furthermore, CHR-2797 treatment inhibited phosphorylation of mTOR substrates and reduced protein synthesis in HL-60 cells, both also indicative of amino acid depletion. Treatment with CHR-2797 led to an increase in the concentration of intracellular small peptides, the substrates of aminopeptidases. It is suggested that aminopeptidase inhibitors, such as CHR-2797 and bestatin, deplete sensitive tumor cells of amino acids by blocking protein recycling, and this generates an antiproliferative effect. CHR-2797 is orally bioavailable and currently undergoing phase II clinical investigation in the treatment of myeloid leukemia.

  5. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  6. Conservative and nonconservative inhibitors of gastric acid secretion

    SciTech Connect

    Ekblad, E.B.M.; Licko, V.

    1987-09-01

    Inhibitors of the initial step (H/sub 2/-antagonist) and of the final step (thiocyanate, SCN/sup -/; and nitrite, NO/sub 2//sup -/) were used to study the dynamics of acid secretion in isolated frog gastric mucosa. Tissues were mounted in flow-through chambers, and the acid secretion rate (SR) was recorded on a pH-stat microprocessor. Continuous presence of H/sub 2/-antagonist decreases the SR to a lower steady state, and on removal the SR returns to basal SR, causing a net loss of acid, the nonconservative effect. The amount of lost acid is a unique function of exposure, thus, independent of the patterns (pulses or steps) of inhibition. In contrast, continuous presence of SCN/sup -/ or NO/sub 2//sup -/ (below 3 mM) results in an undershoot in SR with a return to basal SR, whereas at higher concentrations there is not return. Removal of these inhibitors causes an overshoot in SR with return to basal SR. The rebound acid is equal to acid suppressed by NO/sub 2//sup -/ and low concentration of SCN/sup -/, resulting in no net loss of acid, the conservative effect, whereas at high concentrations of SCN/sup -/ there is an apparent loss of acid. In maximally secreting tissue the overshoot of SR is not observed. However, the acid is not lost, merely delayed. In resting tissue NO/sub 2//sup -/ also merely delays the exit of the acid produced in response to forskolin. The rebound acid is proposed to reside in a sequestered acid pool that is stable for at least 120 min. Results with NO/sub 2//sup -/ and SCN/sup -/ suggest an effect on a saturable exit enzyme, possibly the K/sup +/-H/sup +/-ATPase.

  7. Chiral Proton Catalysis of Secondary Nitroalkane Additions to Azomethine: Synthesis of a Potent GlyT1 Inhibitor

    PubMed Central

    Davis, Tyler A.; Danneman, Michael W.; Johnston, Jeffrey N.

    2014-01-01

    The first enantioselective synthesis of a potent GlyT1 inhibitor is described. A 3-nitroazetidine donor is used in an enantioselective aza-Henry reaction catalyzed by a bis(amidine)-triflic acid salt organocatalyst, delivering the key intermediate with 92% ee. This adduct is reductively denitrated and converted to the target through a short sequence, thereby allowing assignment of the absolute configuration of the more potent enantiomer. PMID:22543734

  8. Rational Design Synthesis and Evaluation of New Selective Inhibitors of Microbial Class II (Zinc Dependent) Fructose Bis-phosphate Aldolases

    SciTech Connect

    R Daher; M Coincon; M Fonvielle; P Gest; M Guerin; M Jackson; J Sygusch; M Therisod

    2011-12-31

    We report the synthesis and biochemical evaluation of several selective inhibitors of class II (zinc dependent) fructose bis-phosphate aldolases (Fba). The products were designed as transition-state analogues of the catalyzed reaction, structurally related to the substrate fructose bis-phosphate (or sedoheptulose bis-phosphate) and based on an N-substituted hydroxamic acid, as a chelator of the zinc ion present in active site. The compounds synthesized were tested on class II Fbas from various pathogenic microorganisms and, by comparison, on a mammalian class I Fba. The best inhibitor shows Ki against class II Fbas from various pathogens in the nM range, with very high selectivity (up to 105). Structural analyses of inhibitors in complex with aldolases rationalize and corroborate the enzymatic kinetics results. These inhibitors represent lead compounds for the preparation of new synthetic antibiotics, notably for tuberculosis prophylaxis.

  9. Synthesis and structural characterisation of selective non-carbohydrate-based inhibitors of bacterial sialidases.

    PubMed

    Brear, Paul; Telford, Judith; Taylor, Garry L; Westwood, Nicholas J

    2012-11-05

    The major human pathogen Streptococcus pneumoniae plays a key role in several disease states including septicaemia, meningitis and community-acquired pneumonia. Although vaccines against S. pneumoniae are available as prophylactics, there remains a need to identify and characterise novel chemical entities that can treat the diseases caused by this pathogen. S. pneumoniae expresses three sialidases, enzymes that cleave sialic acid from carbohydrate-based surface molecules. Two of these enzymes, NanA and NanB, have been implicated in the pathogenesis of S. pneumoniae and are considered to be validated drug targets. Here we report our studies on the synthesis and structural characterisation of novel NanB-selective inhibitors that are inspired by the β-amino-sulfonic acid family of buffers.

  10. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  11. Acetobixan, an inhibitor of cellulose synthesis identified by microbial bioprospecting.

    PubMed

    Xia, Ye; Lei, Lei; Brabham, Chad; Stork, Jozsef; Strickland, James; Ladak, Adam; Gu, Ying; Wallace, Ian; DeBolt, Seth

    2014-01-01

    In plants, cellulose biosynthesis is an essential process for anisotropic growth and therefore is an ideal target for inhibition. Based on the documented utility of small-molecule inhibitors to dissect complex cellular processes we identified a cellulose biosynthesis inhibitor (CBI), named acetobixan, by bio-prospecting among compounds secreted by endophytic microorganisms. Acetobixan was identified using a drug-gene interaction screen to sift through hundreds of endophytic microbial secretions for one that caused synergistic reduction in root expansion of the leaky AtcesA6prc1-1 mutant. We then mined this microbial secretion for compounds that were differentially abundant compared with Bacilli that failed to mimic CBI action to isolate a lead pharmacophore. Analogs of this lead compound were screened for CBI activity, and the most potent analog was named acetobixan. In living Arabidopsis cells visualized by confocal microscopy, acetobixan treatment caused CESA particles localized at the plasma membrane (PM) to rapidly re-localize to cytoplasmic vesicles. Acetobixan inhibited 14C-Glc uptake into crystalline cellulose. Moreover, cortical microtubule dynamics were not disrupted by acetobixan, suggesting specific activity towards cellulose synthesis. Previous CBI resistant mutants such as ixr1-2, ixr2-1 or aegeus were not cross resistant to acetobixan indicating that acetobixan targets a different aspect of cellulose biosynthesis.

  12. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  13. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  14. Synthesis and biological evaluation of geminal disulfones as HIV-1 integrase inhibitors.

    PubMed

    Meadows, D Christopher; Mathews, Timothy B; North, Thomas W; Hadd, Michael J; Kuo, Chih Lin; Neamati, Nouri; Gervay-Hague, Jacquelyn

    2005-07-14

    Integration of HIV-1 viral DNA into the host genome is carried out by HIV-integrase (IN) and is a critical step in viral replication. Although several classes of compounds have been reported to inhibit IN in enzymatic assays, inhibition is not always correlated with antiviral activity. Moreover, potent antiviral IN inhibitors such as the chicoric acids do not act upon the intended enzymatic target but behave as entry inhibitors instead. The charged nature of the chicoric acids contributes to poor cellular uptake, and these compounds are further plagued by rapid ester hydrolysis in vivo. To address these critical deficiencies, we designed neutral, nonhydrolyzable analogues of the chicoric acids. Herein, we report the synthesis, enzyme inhibition studies, and cellular antiviral data for a series of geminal disulfones. Of the 10 compounds evaluated, 8 showed moderate to high inhibition of IN in purified enzyme assays. The purified enzyme data correlated with antiviral assays for all but two compounds, suggesting alternative modes of inhibition. Time-of-addition studies were performed on these analogues, and the results indicate that they inhibit an early stage in the replication process, perhaps entry. In contrast, the most potent member of the correlative group shows behavior consistent with IN being the cellular target.

  15. Deoxycholic acid derivatives as inhibitors of P-glycoprotein-mediated multidrug efflux.

    PubMed

    Rocheblave, Luc; de Ravel, Marc Rolland; Monniot, Elodie; Tavenard, Jeremy; Cuilleron, Claude-Yves; Grenot, Catherine; Radix, Sylvie; Matera, Eva-Laure; Dumontet, Charles; Walchshofer, Nadia

    2016-12-01

    Deoxycholic acid derivatives were designed as P-glycoprotein (Pgp, ABCB1) inhibitors. Thus the synthesis and the biological activity of methyl deoxycholate derivatives 5-10 and their ether analogs 15-20 have been reported. The potency of these compounds to modulate Pgp-mediated MDR was evaluated through daunorubicin accumulation and potentiation of doxorubicin cytotoxicity in K562/R7 multidrug resistant cells overexpressing Pgp. In parallel, their intrinsic toxicity was appreciated on K562 sensitive cells. Methyl 12α-[(2R or 2S) tetrahydro-2H-pyran-2-yloxy]-3-oxo-5β-cholan-24-oate 9b has shown a good efficiency as a Pgp inhibitor and a low intrinsic toxicity. Therefore, this derivative constitutes a new lead compound which can be used as a starting point to improve the design of non-toxic Pgp modulators.

  16. Potent inhibitors of HCV-NS3 protease derived from boronic acids

    SciTech Connect

    Venkatraman, Srikanth; Wu, Wanli; Prongay, Andrew; Girijavallabhan, Viyyoor; Njoroge, F. George

    2009-07-23

    Chronic hepatitis C infection is the leading causes for cirrhosis of the liver and hepatocellular carcinoma, leading to liver failure and liver transplantation. The etiological agent, HCV virus produces a single positive strand of RNA that is processed with the help of serine protease NS3 to produce mature virus. Inhibition of NS3 protease can be potentially used to develop effective drugs for HCV infections. Numerous efforts are now underway to develop potent inhibitors of HCV protease that contain ketoamides as serine traps. Herein we report the synthesis of a series of potent inhibitors that contain a boronic acid as a serine trap. The activity of these compounds were optimized to 200 pM. X-ray structure of compound 17 bound to NS3 protease is also discussed.

  17. Amino Acid Derivatives as New Zinc Binding Groups for the Design of Selective Matrix Metalloproteinase Inhibitors

    PubMed Central

    Giustiniano, Mariateresa; Agamennone, Mariangela; Rossello, Armando; Gomez-Monterrey, Isabel; Novellino, Ettore; Campiglia, Pietro; Vernieri, Ermelinda; Bertamino, Alessia; Carotenuto, Alfonso

    2013-01-01

    A number of matrix metalloproteinases (MMPs) are important medicinal targets for conditions ranging from rheumatoid arthritis to cardiomyopathy, periodontal disease, liver cirrhosis, multiple sclerosis, and cancer invasion and metastasis, where they showed to have a dual role, inhibiting or promoting important processes involved in the pathology. MMPs contain a zinc (II) ion in the protein active site. Small-molecule inhibitors of these metalloproteins are designed to bind directly to the active site metal ions. In an effort to devise new approaches to selective inhibitors, in this paper, we describe the synthesis and preliminary biological evaluation of amino acid derivatives as new zinc binding groups (ZBGs). The incorporation of selected metal-binding functions in more complex biphenyl sulfonamide moieties allowed the identification of one compound able to interact selectively with different MMP enzymatic isoforms. PMID:23555050

  18. Tanzawaic Acids, a Chemically Novel Set of Bacterial Conjugation Inhibitors

    PubMed Central

    Getino, María; Fernández-López, Raúl; Palencia-Gándara, Carolina; Campos-Gómez, Javier; Sánchez-López, Jose M.; Martínez, Marta; Fernández, Antonio; de la Cruz, Fernando

    2016-01-01

    Bacterial conjugation is the main mechanism for the dissemination of multiple antibiotic resistance in human pathogens. This dissemination could be controlled by molecules that interfere with the conjugation process. A search for conjugation inhibitors among a collection of 1,632 natural compounds, identified tanzawaic acids A and B as best hits. They specially inhibited IncW and IncFII conjugative systems, including plasmids mobilized by them. Plasmids belonging to IncFI, IncI, IncL/M, IncX and IncH incompatibility groups were targeted to a lesser extent, whereas IncN and IncP plasmids were unaffected. Tanzawaic acids showed reduced toxicity in bacterial, fungal or human cells, when compared to synthetic conjugation inhibitors, opening the possibility of their deployment in complex environments, including natural settings relevant for antibiotic resistance dissemination. PMID:26812051

  19. Design, synthesis and biological evaluation of a phenyl butyric acid derivative, N-(4-chlorophenyl)-4-phenylbutanamide: A HDAC6 inhibitor with anti-proliferative activity on cervix cancer and leukemia cells.

    PubMed

    Alberto, Rodríguez-Fonseca Rolando; Yudibeth, Sixto-López; Jonathan, Fragoso-Vázquez M; Raúl, Flores-Mejía; Cristina, Cabrera-Pérez Laura; Ismael, Vázquez-Moctezuma; Cecilia, Rosales-Hernández Martha; Martiniano, Bello; Martínez-Archundia, M; Guadalupe, Trujillo-Ferrara José; Elvia, Becerra-Martínez; José, Correa-Basurto

    2017-01-02

    The epigenetic regulation of genes in cancer could be targeted by inhibiting Histone deacetylase 6 (HDAC6), an enzyme involved in several types of cancer such as lymphoma, leukemia, ovarian cancer, etc. Through in silico methods, a set of Phenyl butyric acid derivatives with possible HDAC6 inhibitory activity were designed, rendering monophenylamides and biphenylamides using tubacin (HDAC6 selective inhibitor) as reference. The target compounds were submitted to theoretical ADMET analyses and their binding properties on different HDAC6 conformers were evaluated through docking calculations. These in silico studies allowed us to identify a compound named B-R2B. In order to have more information about the B-R2B binding recognition properties on HDAC6, the B-R2B-HDAC6 complex was submitted through 100 ns-long Molecular Dynamics (MD) simulation coupled to MMGBSA approach, revealing that B-R2B is located at the entrance of HDAC6 active pocket, blocking the passage of the substrate without reaching the HDAC6 binding site. Based on these results, B-R2B was synthesized, characterized and biologically tested. The HDAC6 fluorometric drug discovery kit Fluor-de-Lys (ENZO Life Sciences Inc.) was used to determine the HDAC6 human inhibitory activity (IC50 value) of B-R2B compound. In addition, B-R2B show IC50 values on cancer cell lines (HeLa; IC50 = 72.6 µM), acute myeloid leukemia (THP-1; IC50 = 16.5 µM), human mast leukemia (HMC; IC50 = 79.29 µM) and chronic myelogenous leukemia (Kasumi; IC50 = 101 µM). In conclusion, these results show that B-R2B is a HDAC6 inhibitor, specifically a non-competitive type in a similar way that tubacin does, according to MD simulations.

  20. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  1. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  2. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  3. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  4. C-6 aryl substituted 4-quinolone-3-carboxylic acids as inhibitors of hepatitis C virus.

    PubMed

    Chen, Yue-Lei; Zacharias, Jeana; Vince, Robert; Geraghty, Robert J; Wang, Zhengqiang

    2012-08-01

    Quinolone-3-carboxylic acid represents a highly privileged chemotype in medicinal chemistry and has been extensively explored as antibiotics and antivirals targeting human immunodeficiency virus (HIV) integrase (IN). Herein we describe the synthesis and anti-hepatitis C virus (HCV) profile of a series of C-6 aryl substituted 4-quinlone-3-carboxylic acid analogues. Significant inhibition was observed with a few analogues at low micromolar range against HCV replicon in cell culture and a reduction in replicon RNA was confirmed through an RT-qPCR assay. Interestingly, evaluation of analogues as inhibitors of NS5B in a biochemical assay yielded only modest inhibitory activities, suggesting that a different mechanism of action could operate in cell culture.

  5. Design, synthesis and structure-activity relationships of substituted oxazole-benzamide antibacterial inhibitors of FtsZ.

    PubMed

    Stokes, Neil R; Baker, Nicola; Bennett, James M; Chauhan, Pramod K; Collins, Ian; Davies, David T; Gavade, Maruti; Kumar, Dushyant; Lancett, Paul; Macdonald, Rebecca; Macleod, Leanne; Mahajan, Anu; Mitchell, Jeffrey P; Nayal, Narendra; Nayal, Yashodanand Nandan; Pitt, Gary R W; Singh, Mahipal; Yadav, Anju; Srivastava, Anil; Czaplewski, Lloyd G; Haydon, David J

    2014-01-01

    The design, synthesis and structure-activity relationships of a series of oxazole-benzamide inhibitors of the essential bacterial cell division protein FtsZ are described. Compounds had potent anti-staphylococcal activity and inhibited the cytokinesis of the clinically-significant bacterial pathogen Staphylococcus aureus. Selected analogues possessing a 5-halo oxazole also inhibited a strain of S. aureus harbouring the glycine-to-alanine amino acid substitution at residue 196 of FtsZ which conferred resistance to previously reported inhibitors in the series. Substitutions to the pseudo-benzylic carbon of the scaffold improved the pharmacokinetic properties by increasing metabolic stability and provided a mechanism for creating pro-drugs. Combining multiple substitutions based on the findings reported in this study has provided small-molecule inhibitors of FtsZ with enhanced in vitro and in vivo antibacterial efficacy.

  6. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  7. Thermal copoly/amino acids/ as inhibitors of glyoxalase I

    NASA Technical Reports Server (NTRS)

    Fox, S. W.; Syren, R. M.; Windsor, C. R.

    1979-01-01

    A number of copoly(alpha-amino acids) have been prepared thermally; some have been found to function as inhibitors of glyoxalase I, an enzyme which occupies a central position in Szent-Gyorgyi's theory of tumour genesis. These polymers are also of interest in the search for synthetic peptides having carcinostatic activity, since many natural peptides are active. The way in which the inhibitory activity varies with composition of the synthetic polymers has been investigated. Various properties (hydrophobicity, molecular weight, UV absorption, kinetic type) have been examined in a search for correlates of inhibitory activity.

  8. Developing Inhibitors of Translesion DNA Synthesis as Therapeutic Agents against Lung Cancer

    DTIC Science & Technology

    2015-12-01

    AWARD NUMBER: W81XWH-13-1-0238 TITLE: Developing Inhibitors of Translesion DNA Synthesis as Therapeutic Agents against Lung Cancer PRINCIPAL...of Translesion DNA Synthesis as Therapeutic Agents against Lung Cancer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S...Oxygen-rich environments can create pro-mutagenic DNA lesions such as 8-oxoguanine (8-oxo-G) that can be misreplicated during translesion DNA synthesis

  9. Concise and Practical Asymmetric Synthesis of a Challenging Atropisomeric HIV Integrase Inhibitor.

    PubMed

    Fandrick, Keith R; Li, Wenjie; Zhang, Yongda; Tang, Wenjun; Gao, Joe; Rodriguez, Sonia; Patel, Nitinchandra D; Reeves, Diana C; Wu, Jiang-Ping; Sanyal, Sanjit; Gonnella, Nina; Qu, Bo; Haddad, Nizar; Lorenz, Jon C; Sidhu, Kanwar; Wang, June; Ma, Shengli; Grinberg, Nelu; Lee, Heewon; Tsantrizos, Youla; Poupart, Marc-André; Busacca, Carl A; Yee, Nathan K; Lu, Bruce Z; Senanayake, Chris H

    2015-06-08

    A practical and efficient synthesis of a complex chiral atropisomeric HIV integrase inhibitor has been accomplished. The combination of a copper-catalyzed acylation along with the implementation of the BI-DIME ligands for a ligand-controlled Suzuki cross-coupling and an unprecedented bis(trifluoromethane)sulfonamide-catalyzed tert-butylation renders the synthesis of this complex molecule robust, safe, and economical. Furthermore, the overall synthesis was conducted in an asymmetric and diastereoselective fashion with respect to the imbedded atropisomer.

  10. Chicoric acid analogues as HIV-1 integrase inhibitors.

    PubMed

    Lin, Z; Neamati, N; Zhao, H; Kiryu, Y; Turpin, J A; Aberham, C; Strebel, K; Kohn, K; Witvrouw, M; Pannecouque, C; Debyser, Z; De Clercq, E; Rice, W G; Pommier, Y; Burke, T R

    1999-04-22

    The present study was undertaken to examine structural features of L-chicoric acid (3) which are important for potency against purified HIV-1 integrase and for reported cytoprotective effects in cell-based systems. Through a progressive series of analogues, it was shown that enantiomeric D-chicoric acid (4) retains inhibitory potency against purified integrase equal to its L-counterpart and further that removal of either one or both carboxylic functionalities results in essentially no loss of inhibitory potency. Additionally, while two caffeoyl moieties are required, attachment of caffeoyl groups to the central linking structure can be achieved via amide or mixed amide/ester linkages. More remarkable is the finding that blockage of the catechol functionality through conversion to tetraacetate esters results in almost no loss of potency, contingent on the presence of at least one carboxyl group on the central linker. Taken as a whole, the work has resulted in the identification of new integrase inhibitors which may be regarded as bis-caffeoyl derivatives of glycidic acid and amino acids such as serine and beta-aminoalanine. The present study also examined the reported ability of chicoric acid to exert cytoprotective effects in HIV-infected cells. It was demonstrated in target and cell-based assays that the chicoric acids do not significantly inhibit other targets associated with HIV-1 replication, including reverse transcription, protease function, NCp7 zinc finger function, or replication of virus from latently infected cells. In CEM cells, for both the parent chicoric acid and selected analogues, antiviral activity was observable under specific assay conditions and with high dependence on the multiplicity of viral infection. However, against HIV-1- and HIV-2-infected MT-4 cells, the chicoric acids and their tetraacetylated esters exhibited antiviral activity (50% effective concentration (EC50) ranging from 1.7 to 20 microM and 50% inhibitory concentration (IC50

  11. Discovery of benzimidazole-diamide finger loop (Thumb Pocket I) allosteric inhibitors of HCV NS5B polymerase: Implementing parallel synthesis for rapid linker optimization.

    PubMed

    Goulet, Sylvie; Poupart, Marc-André; Gillard, James; Poirier, Martin; Kukolj, George; Beaulieu, Pierre L

    2010-01-01

    Previously described SAR of benzimidazole-based non-nucleoside finger loop (Thumb Pocket I) inhibitors of HCV NS5B polymerase was expanded. Prospecting studies using parallel synthesis techniques allowed the rapid identification of novel cinnamic acid right-hand sides that provide renewed opportunities for further optimization of these inhibitors. Novel diamide derivatives such as 44 exhibited comparable potency (enzymatic and cell-based HCV replicon) as previously described tryptophan-based inhibitors but physicochemical properties (e.g., aqueous solubility and lipophilicity) have been improved, resulting in molecules with reduced off-target liabilities (CYP inhibition) and increased metabolic stability.

  12. Binding of α,α-Disubstituted Amino Acids to Arginase Suggests New Avenues for Inhibitor Design1

    PubMed Central

    Ilies, Monica; Di Costanzo, Luigi; Dowling, Daniel P.; Thorn, Katherine J.; Christianson, David W.

    2011-01-01

    Arginase is a binuclear manganese metalloenzyme that hydrolyzes L-arginine to form L-ornithine and urea, and aberrant arginase activity is implicated in various diseases such as erectile dysfunction, asthma, atherosclerosis, and cerebral malaria. Accordingly, arginase inhibitors may be therapeutically useful. Continuing our efforts to expand the chemical space of arginase inhibitor design, and inspired by the binding of 2-(difluoromethyl)-L-ornithine to human arginase I, we now report the first study of the binding of α,α-disubstituted amino acids to arginase. Specifically, we report the design, synthesis, and assay of racemic 2-amino-6-borono-2- methylhexanoic acid and racemic 2-amino-6-borono-2-(difluoromethyl)hexanoic acid. X-ray crystal structures of human arginase I and Plasmodium falciparum arginase complexed with these inhibitors reveal the exclusive binding of the L-stereoisomer; the additional α-substituent of each inhibitor is readily accommodated and makes new intermolecular interactions in the outer active site of each enzyme. Therefore, this work highlights a new region of the protein surface that can be targeted for additional affinity interactions, as well as the first comparative structural insights on inhibitor discrimination between a human and a parasitic arginase. PMID:21728378

  13. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  14. Stereocontrolled Synthesis of a Potential Transition-State Inhibitor of the Salicylate Synthase MbtI from Mycobacterium tuberculosis

    PubMed Central

    Liu, Zheng; Liu, Feng; Aldrich, Courtney C.

    2015-01-01

    Mycobactins are small-molecule iron chelators (siderophores) produced by Mycobacterium tuberculosis (Mtb) for iron mobilization. The bifunctional salicylate synthase MbtI catalyzes the first step of mycobactin biosynthesis through the conversion of the primary metabolite chorismate into salicylic acid via isochorismate. We report the design, synthesis and biochemical evaluation of an inhibitor based on the putative transition-state (TS) for the isochorismatase partial reaction of MbtI. The inhibitor mimics the hypothesized charge build-up at C-4 of chorismate in the TS as well as C-O bond-formation at C-6. Another important design element of the inhibitor is replacement of the labile pyruvate side-chain in chorismate with a stable C-linked propionate isostere. We developed a stereocontrolled synthesis of the highly functionalized cyclohexene inhibitor that features an asymmetric aldol reaction using a titanium enolate, diastereoselective Grignard addition to a tert-butanesulfinyl aldimine, and ring closing olefin metathesis as key steps. PMID:26035083

  15. Discovery of Bacterial Fatty Acid Synthase Type II Inhibitors Using a Novel Cellular Bioluminescent Reporter Assay

    PubMed Central

    Wallace, Joselynn; Bowlin, Nicholas O.; Mills, Debra M.; Saenkham, Panatda; Kwasny, Steven M.; Opperman, Timothy J.; Williams, John D.; Rock, Charles O.; Bowlin, Terry L.

    2015-01-01

    Novel, cellular, gain-of-signal, bioluminescent reporter assays for fatty acid synthesis type II (FASII) inhibitors were constructed in an efflux-deficient strain of Pseudomonas aeruginosa and based on the discovery that FASII genes in P. aeruginosa are coordinately upregulated in response to pathway disruption. A screen of 115,000 compounds identified a series of sulfonamidobenzamide (SABA) analogs, which generated strong luminescent signals in two FASII reporter strains but not in four control reporter strains designed to respond to inhibitors of pathways other than FASII. The SABA analogs selectively inhibited lipid biosynthesis in P. aeruginosa and exhibited minimal cytotoxicity to mammalian cells (50% cytotoxic concentration [CC50] ≥ 80 μM). The most potent SABA analogs had MICs of 0.5 to 7.0 μM (0.2 to 3.0 μg/ml) against an efflux-deficient Escherichia coli (ΔtolC) strain but had no detectable MIC against efflux-proficient E. coli or against P. aeruginosa (efflux deficient or proficient). Genetic, molecular genetic, and biochemical studies revealed that SABA analogs target the enzyme (AccC) catalyzing the biotin carboxylase half-reaction of the acetyl coenzyme A (acetyl-CoA) carboxylase step in the initiation phase of FASII in E. coli and P. aeruginosa. These results validate the capability and the sensitivity of this novel bioluminescent reporter screen to identify inhibitors of E. coli and P. aeruginosa FASII. PMID:26169404

  16. Design and structure-activity relationships of potent and selective inhibitors of undecaprenyl pyrophosphate synthase (UPPS): tetramic, tetronic acids and dihydropyridin-2-ones.

    PubMed

    Peukert, Stefan; Sun, Yingchuan; Zhang, Rui; Hurley, Brian; Sabio, Mike; Shen, Xiaoyu; Gray, Christen; Dzink-Fox, JoAnn; Tao, Jianshi; Cebula, Regina; Wattanasin, Sompong

    2008-03-15

    Based on a pharmacophore hypothesis substituted tetramic and tetronic acid 3-carboxamides as well as dihydropyridin-2-one-3-carboxamides were investigated as inhibitors of undecaprenyl pyrophosphate synthase (UPPS) for use as novel antimicrobial agents. Synthesis and structure-activity relationship patterns for this class of compounds are discussed. Selectivity data and antibacterial activities for selected compounds are provided.

  17. Rational design of nitrofuran derivatives: Synthesis and valuation as inhibitors of Trypanosoma cruzi trypanothione reductase.

    PubMed

    Arias, D G; Herrera, F E; Garay, A S; Rodrigues, D; Forastieri, P S; Luna, L E; Bürgi, M D L M; Prieto, C; Iglesias, A A; Cravero, R M; Guerrero, S A

    2017-01-05

    The rational design and synthesis of a series of 5-nitro-2-furoic acid analogues are presented. The trypanocidal activity against epimastigote forms of Trypanosoma cruzi and the toxic effects on human HeLa cells were tested. Between all synthetic compounds, three of thirteen had an IC50 value in the range of Nfx, but compound 13 exhibited an improved effect with an IC50 of 1.0 ± 0.1 μM and a selective index of 70 in its toxicity against HeLa cells. We analyzed the activity of compounds 8, 12 and 13 to interfere in the central redox metabolic pathway in trypanosomatids, which is dependent of reduced trypanothione as the major pivotal thiol. The three compounds behaved as better inhibitors of trypanothione reductase than Nfx (Ki values of 118 μM, 61 μM and 68 μM for 8, 12 and 13, respectively, compared with 245 μM for Nfx), all following an uncompetitive enzyme inhibition pattern. Docking analysis predicted a binding of inhibitors to the enzyme-substrate complex with binding energy calculated in-silico that supports such molecular interaction.

  18. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  19. Resistance of lung fatty acid synthesis to inhibition by dietary fat in the meal-fed rat.

    PubMed

    Clarke, S D; Wilson, M D; Ibnoughazala, T

    1984-03-01

    One-half of the palmitate utilized by the lung for production of the surfactant phospholipid, dipalmitoyl phosphatidylcholine, originates from de novo palmitate synthesis in the lung. In this report the lung was examined for the influence of dietary fat on the lung de novo fatty acid synthesis pathway. Lung lipogenesis was reduced by fasting and accelerated by carbohydrate refeeding or insulin injection. However, in general lung fatty acid synthesis was unaffected by dietary fat. Supplementing one meal (high glucose diet) with as much as 36% additional fat kilocalories did not suppress lung fatty acid synthesis. An inhibition of fatty acid synthesis resulted from a fat supplement of +60 and +120% of meal kilocalories, but this inhibition was likely due to an attenuated rate of glucose absorption. Ingestion of a high carbohydrate diet supplemented with 10, 17, or 30% added kilocalories as safflower oil or palmitate had no effect on lipogenesis after 10 days. On the other hand, liver fatty acid synthesis and acetyl-CoA carboxylase were selectively suppressed by safflower oil, whereas dietary palmitate was ineffective as an inhibitor of lipogenesis. These data clearly demonstrate that the well-characterized preferential suppression of liver lipogenesis by dietary polyunsaturated fats does not extend to lung tissue, and, more importantly, the inhibition of liver lipogenesis is not secondary to an essential fatty acid deficiency. The marked resistance of lung fatty acid synthesis to inhibition by dietary fat might be a biological protective mechanism to ensure adequate palmitate for dipalmitoyl phosphatidylcholine synthesis.

  20. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  1. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  2. Integrase Inhibitor Prodrugs: Approaches to Enhancing the Anti-HIV Activity of β-Diketo Acids.

    PubMed

    Nair, Vasu; Okello, Maurice

    2015-07-13

    HIV integrase, encoded at the 3'-end of the HIV pol gene, is essential for HIV replication. This enzyme catalyzes the incorporation of HIV DNA into human DNA, which represents the point of "no-return" in HIV infection. Integrase is a significant target in anti-HIV drug discovery. This review article focuses largely on the design of integrase inhibitors that are β-diketo acids constructed on pyridinone scaffolds. Methodologies for synthesis of these compounds are discussed. Integrase inhibition data for the strand transfer (ST) step are compared with in vitro anti-HIV data. The review also examines the issue of the lack of correlation between the ST enzymology data and anti-HIV assay results. Because this disconnect appeared to be a problem associated with permeability, prodrugs of these inhibitors were designed and synthesized. Prodrugs dramatically improved the anti-HIV activity data. For example, for compound, 96, the anti-HIV activity (EC50) improved from 500 nM for this diketo acid to 9 nM for its prodrug 116. In addition, there was excellent correlation between the IC50 and IC90 ST enzymology data for 96 (6 nM and 97 nM, respectively) and the EC50 and EC90 anti-HIV data for its prodrug 116 (9 nM and 94 nM, respectively). Finally, it was confirmed that the prodrug 116 was rapidly hydrolyzed in cells to the active compound 96.

  3. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  4. Recycling and refurbishing old antitubercular drugs: the encouraging case of inhibitors of mycolic acid biosynthesis.

    PubMed

    Belardinelli, Juan M; Morbidoni, Héctor R

    2013-04-01

    One of the first approaches undertaken in the quest for antitubercular compounds was that of understanding the mechanism of action of old drugs and proposing chemical modifications or other strategies to improve their activity, generally lost to the mechanisms of resistance developed by Mycobacterium tuberculosis. A leading case was the work carried out on a set of compounds with proven activity on the essential pathway of the synthesis of mycolic acids. As a result, different solutions were presented, improving the activity of those inhibitors or producing novel compounds acting on the same molecular target(s), but avoiding the most common resistance strategies developed by the tubercle bacilli. This review focuses on the activity of those compounds, developed following the completion of the studies on several of the classic antitubercular drugs.

  5. Escherichia coli Unsaturated Fatty Acid Synthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.

    2009-01-01

    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA. PMID:19679654

  6. Design and synthesis of an Fmoc-SPPS-compatible amino acid building block mimicking the transition state of phosphohistidine phosphatase.

    PubMed

    Eerland, Martijn F; Hedberg, Christian

    2012-02-17

    The synthesis of a sulfonamide-based transition-state (TS) analogue of enzymatic phosphohistidine dephosphorylation as an amino acid building block is presented, together with the proof-of-concept of its incorporation into peptides. Key features include final global acidolytic protective group removal as well as full compatibility with standard Fmoc solid-phase peptide synthesis (SPPS). The peptides are designed as inhibitors of phosphohistidine phosphatase and as a pull-down probe for identification of phosphohistidine phosphatases, respectively.

  7. Synthesis and inhibitory activity of glycosidase inhibitors, glycosylamino-oxazolines.

    PubMed

    Uchida, C; Ogawa, S

    1996-02-01

    In connection with structural modification of the trehalase inhibitor trehazolin (1), as a new-type of glycohydrolase inhibitor, some glycosylamino-oxazolines were designed and synthesized. Among three oxazolines beta-galacto (3), beta-gluco (5) and alpha-manno-types (6) obtained in stable form, the latter 6 has been shown to possess a moderate inhibitory activity against alpha-mannosidase.

  8. Sulfonyl Fluoride Inhibitors of Fatty Acid Amide Hydrolase

    PubMed Central

    Alapafuja, Shakiru O.; Nikas, Spyros P.; Bharatan, Indu; Shukla, Vidyanand G.; Nasr, Mahmoud L.; Bowman, Anna L.; Zvonok, Nikolai; Li, Jing; Shi, Xiaomeng; Engen, John R.; Makriyannis, Alexandros

    2013-01-01

    Sulfonyl fluorides are known to inhibit esterases. Early work from our laboratory has identified hexadecyl sulfonylfluoride (AM374) as a potent in vitro and in vivo inhibitor of fatty acid amide hydrolase (FAAH). We now report on later generation sulfonyl fluoride analogs that exhibit potent and selective inhibition of FAAH. Using recombinant rat and human FAAH we show that 5-(4-hydroxyphenyl)pentanesulfonyl fluoride (AM3506) has similar inhibitory activity for both the rat and the human enzyme, while rapid dilution assays and mass spectrometry analysis suggest that the compound is a covalent modifier for FAAH and inhibits its action in an irreversible manner. Our SAR results are highlighted by molecular docking of key analogs. PMID:23083016

  9. cap alpha. -Alkenylphenones - A new class of acid corrosion inhibitors

    SciTech Connect

    Frenier, W.W.; Growcock, F.B.; Lopp, V.R. )

    1988-09-01

    In this paper, a new class of corrosion inhibitors for steel in strong HCI is described. When formulated with small amounts of surfactants, ..cap alpha..-Alkenylphenones provide excellent protection for oilfield steel in contact with strong HCI (up to 28%). The protection levels are similar to, and sometimes superior to, those provided by alkynols. In 15% HCI, benzylallyl alcohol (BAA) appears to be a common intermediate, i.e., in the acid after 24 h when any of the four different phenyl ketones are used. Poly(phenylvinyl ketone) (PPVK), which could form on the surface from reaction of absorbed BAA, was the major component of the thin surface film after corrosion tests with the four ketones.

  10. Synthesis and screening of 3-MA derivatives for autophagy inhibitors.

    PubMed

    Wu, Yanyang; Wang, Xin; Guo, Haijing; Zhang, Bo; Zhang, Xiao-Bo; Shi, Zhang-Jie; Yu, Li

    2013-04-01

    Autophagy is a conserved degradation process, which plays important pathophysiological roles. The lack of effective inhibitors of autophagy has been an obstacle in both basic research and understanding the physiological role of autophagy in disease manifestation. The most widely used inhibitor, 3-methyladenine (3-MA), is poorly soluble at room temperature and is effective only at high concentrations. In this study, we synthesized a library of small compounds by chemically modifying 3-MA and screened this library for autophagy inhibitors. Three 3-MA derivatives generated through this approach showed improved solubility and effectiveness in inhibiting autophagy. We demonstrated that chemical modification of an existing autophagy inhibitor is an effective method to generate improved autophagy inhibitors.

  11. Synthesis and evaluation of indazole based analog sensitive Akt inhibitors.

    PubMed

    Okuzumi, Tatsuya; Ducker, Gregory S; Zhang, Chao; Aizenstein, Brian; Hoffman, Randy; Shokat, Kevan M

    2010-08-01

    The kinase Akt is a key signaling node in regulating cellular growth and survival. It is implicated in cancer by mutation and its role in the downstream transmission of aberrant PI3K signaling. For these reasons, Akt has become an increasingly important target of drug development efforts and several inhibitors are now reaching clinical trials. Paradoxically it has been observed that active site kinase inhibitors of Akt lead to hyperphosphorylation of Akt itself. To investigate this phenomenon we here describe the application of a chemical genetics strategy that replaces native Akt with a mutant version containing an active site substitution that allows for the binding of an engineered inhibitor. This analog sensitive strategy allows for the selective inhibition of a single kinase. In order to create the inhibitor selective for the analog sensitive kinase, a diversity of synthetic approaches was required, finally resulting in the compound PrINZ, a 7-substituted version of the Abbott Labs Akt inhibitor A-443654.

  12. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  13. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  14. Scaffold oriented synthesis. Part 4: design, synthesis and biological evaluation of novel 5-substituted indazoles as potent and selective kinase inhibitors employing heterocycle forming and multicomponent reactions.

    PubMed

    Akritopoulou-Zanze, Irini; Wakefield, Brian D; Gasiecki, Alan; Kalvin, Douglas; Johnson, Eric F; Kovar, Peter; Djuric, Stevan W

    2011-03-01

    We report the synthesis and biological evaluation of 5-substituted indazoles as kinase inhibitors. The compounds were synthesized in a parallel synthesis fashion from readily available starting materials employing heterocycle forming and multicomponent reactions and were evaluated against a panel of kinase assays. Potent inhibitors were identified for Gsk3β, Rock2, and Egfr.

  15. Synthesis and biological evaluation of novel peptidomimetics as rhodesain inhibitors.

    PubMed

    Ettari, Roberta; Previti, Santo; Cosconati, Sandro; Kesselring, Jochen; Schirmeister, Tanja; Grasso, Silvana; Zappalà, Maria

    2016-12-01

    Novel rhodesain inhibitors were developed by combining an enantiomerically pure 3-bromoisoxazoline warhead with a 1,4-benzodiazepine scaffold as specific recognition moiety. All compounds were proven to inhibit rhodesain with Ki values in the low-micromolar range. Their activity towards rhodesain was found to be coupled to an in vitro antitrypanosomal activity, with IC50 values ranging from the mid-micromolar to a low-micromolar value for the most active rhodesain inhibitor (R,S,S)-3. All compounds showed a good selectivity against the target enzyme since all of them were proven to be poor inhibitors of human cathepsin L.

  16. Design, synthesis, and biological evaluation of novel histone deacetylase 1 inhibitors through click chemistry.

    PubMed

    Sun, Qiao; Yao, Yiwu; Liu, Chunping; Li, Hua; Yao, Hequan; Xue, Xiaowen; Liu, Jinsong; Tu, Zhengchao; Jiang, Sheng

    2013-06-01

    We report the design, synthesis, and biological evaluation of a new series of HDAC1 inhibitors using click chemistry. Compound 17 bearing a phenyl ring at meta-position was identified to show much better selectivity for HDAC1 over HDAC7 than SAHA. The compond 17 also showed better in vitro anticancer activities against several cancer cell lines than that of SAHA. This work could serve as a foundation for further exploration of selective HDAC inhibitors using the compound 17 molecular scaffold.

  17. Identification of Novel Functional Inhibitors of Acid Sphingomyelinase

    PubMed Central

    Trapp, Stefan; Pechmann, Stefanie; Friedl, Astrid; Reichel, Martin; Mühle, Christiane; Terfloth, Lothar; Groemer, Teja W.; Spitzer, Gudrun M.; Liedl, Klaus R.; Gulbins, Erich; Tripal, Philipp

    2011-01-01

    We describe a hitherto unknown feature for 27 small drug-like molecules, namely functional inhibition of acid sphingomyelinase (ASM). These entities named FIASMAs (Functional Inhibitors of Acid SphingoMyelinAse), therefore, can be potentially used to treat diseases associated with enhanced activity of ASM, such as Alzheimer's disease, major depression, radiation- and chemotherapy-induced apoptosis and endotoxic shock syndrome. Residual activity of ASM measured in the presence of 10 µM drug concentration shows a bimodal distribution; thus the tested drugs can be classified into two groups with lower and higher inhibitory activity. All FIASMAs share distinct physicochemical properties in showing lipophilic and weakly basic properties. Hierarchical clustering of Tanimoto coefficients revealed that FIASMAs occur among drugs of various chemical scaffolds. Moreover, FIASMAs more frequently violate Lipinski's Rule-of-Five than compounds without effect on ASM. Inhibition of ASM appears to be associated with good permeability across the blood-brain barrier. In the present investigation, we developed a novel structure-property-activity relationship by using a random forest-based binary classification learner. Virtual screening revealed that only six out of 768 (0.78%) compounds of natural products functionally inhibit ASM, whereas this inhibitory activity occurs in 135 out of 2028 (6.66%) drugs licensed for medical use in humans. PMID:21909365

  18. Pistagremic acid, a glucosidase inhibitor from Pistacia integerrima.

    PubMed

    Uddin, Ghias; Rauf, Abdur; Al-Othman, Abdulaziz M; Collina, Simona; Arfan, Muhammad; Ali, Gowhar; Khan, Inamullah

    2012-12-01

    Pistacia integerrima Stewart in traditionally used as folk remedy for various pathological conditions including diabetes. In order to identify the bioactive compound responsible for its folk use in diabetes, a phytochemical and biological study was conducted. Pistagremic acid (PA) was isolated from the dried galls extract of P. integerrima. Strong α-glucosidase inhibitory potential of PA was predicted using its molecular docking simulations against yeast α-glucosidase as a therapeutic target. Significant experimental α-glucosidase inhibitory activity of PA confirmed the computational predictions. PA showed potent enzyme inhibitory activity both against yeast (IC(50): 89.12±0.12μM) and rat intestinal (IC(50): 62.47±0.09μM) α-glucosidases. Interestingly, acarbose was found to be more than 12 times more potent an inhibitor against mammalian (rat intestinal) enzyme (having IC(50) value 62.47±0.09μM), as compared to the microbial (yeast) enzyme (with IC(50) value 780.21μM). Molecular binding mode was explored via molecular docking simulations, which revealed hydrogen bonding interactions between PA and important amino acid residues (Asp60, Arg69 and Asp 70 (3.11Å)), surrounding the catalytic site of the α-glucosidase. These interactions could be mainly responsible for their role in potent inhibitory activity of PA. PA has a strong potential to be further investigated as a new lead compound for better management of diabetes.

  19. Design, synthesis, and evaluation of aza inhibitors of chorismate mutase.

    PubMed

    Hediger, Mark E

    2004-09-15

    A series of aza inhibitors (4-9) of chorismate mutase (E.C. 5.4.99.5) was designed, prepared, and evaluated against the enzyme by monitoring the direct inhibition of the chorismate, 1, to prephenate, 2, conversion. None of these aza inhibitors displayed tighter binding to the enzyme than the native substrate chorismate or greater inhibitory action than the previously reported ether analogue, 3. Furthermore, no time-dependent loss of enzyme activity was observed in the presence of the two potentially reactive aza inhibitors (7 and 9). These results in conjunction with inhibition data from a broader series of chorismate mutase inhibitors allowed a novel proposal for the mechanistic role of chorismate mutase to be developed. This proposed mechanism was computationally verified and correlated with crystallographic studies of various chorismate mutases.

  20. Effects of norflurazon, an inhibitor of carotenogenesis, on abscisic acid and xanthoxin in the caps of gravistimulated maize roots

    NASA Technical Reports Server (NTRS)

    Feldman, L. J.; Sun, P. S.

    1986-01-01

    Maize seeds were germinated in the dark in the presence of the carotenoid synthesis inhibitor norflurazon and the levels of abscisic acid, xanthoxin and total carotenoids were measured in the root cap and in the adjacent 1.5 mm segment. In norflurazon-treated roots abscisic acid levels were markedly reduced, but an increase occurred in the levels of xanthoxin, a compound structurally and physiologically similar to abscisic acid. In the cultivar of maize (Zea mays L. cv. Merit) used for this work, brief illumination of the root is required for gravitropic curving. Following illumination both control and norflurazon-treated roots showed normal gravitropic curvature; however, the rate of curvature was delayed in norflurazon-treated roots. Our data from norflurazon-treated roots are consistent with a role for xanthoxin in maize root gravitropism. The increase in xanthoxin in the presence of an inhibitor of carotenoid synthesis suggests that xanthoxin and abscisic acid originate, at least in part, via different metabolic pathways.

  1. Nalidixic Acid and Macromolecular Metabolism in Tetrahymena pyriformis: Effects on Protein Synthesis

    PubMed Central

    de Castro, J. F.; Carvalho, J. F. O.; Moussatché, N.; de Castro, F. T.

    1975-01-01

    A study on the effect of nalidixic acid on macromolecular metabolism, particularly of protein, in Tetrahymena pyriformis was performed. It was shown that the compound is a potent inhibitor of deoxyribonucleic acid, ribonucleic acid, and protein synthesis for this organism. A conspicuous breakdown of polysomes, accompanied by the accumulation of 80S ribosomes, occurred in cells incubated for 10 min with the drug; polysome formation was prevented. The accumulating 80S particles were shown to be run-off ribosomal units. The incorporation of amino acids by a cell-free system is not affected by nalidixic acid. In nonproliferating cells the incorporation was also not prevented, unless the cells were previously incubated with the drug. These results are discussed in terms of the possible mechanism of action of nalidixic acid in T. pyriformis. PMID:807153

  2. Regulation of leukotriene and 5oxoETE synthesis and the effect of 5-lipoxygenase inhibitors: a mathematical modeling approach

    PubMed Central

    2012-01-01

    Background 5-lipoxygenase (5-LO) is a key enzyme in the synthesis of leukotrienes and 5-Oxo-6E,8Z,11Z,14Z-eicosatetraenoic acid (oxoETE). These inflammatory signaling molecules play a role in the pathology of asthma and so 5-LO inhibition is a promising target for asthma therapy. The 5-LO redox inhibitor zileuton (Zyflo IR/CR®) is currently marketed for the treatment of asthma in adults and children, but widespread use of zileuton is limited by its efficacy/safety profile, potentially related to its redox characteristics. Thus, a quantitative, mechanistic description of its functioning may be useful for development of improved anti-inflammatory targeting this mechanism. Results A mathematical model describing the operation of 5-LO, phospholipase A2, glutathione peroxidase and 5-hydroxyeicosanoid dehydrogenase was developed. The catalytic cycles of the enzymes were reconstructed and kinetic parameters estimated on the basis of available experimental data. The final model describes each stage of cys-leukotriene biosynthesis and the reactions involved in oxoETE production. Regulation of these processes by substrates (phospholipid concentration) and intracellular redox state (concentrations of reduced glutathione, glutathione (GSH), and lipid peroxide) were taken into account. The model enabled us to reveal differences between redox and non-redox 5-LO inhibitors under conditions of oxidative stress. Despite both redox and non-redox inhibitors suppressing leukotriene A4 (LTA4) synthesis, redox inhibitors are predicted to increase oxoETE production, thus compromising efficacy. This phenomena can be explained in terms of the pseudo-peroxidase activity of 5-LO and the ability of lipid peroxides to transform 5-LO into its active form even in the presence of redox inhibitors. Conclusions The mathematical model developed described quantitatively different mechanisms of 5-LO inhibition and simulations revealed differences between the potential therapeutic outcomes for these

  3. A strategy for the solution-phase parallel synthesis of N-(pyrrolidinylmethyl)hydroxamic acids.

    PubMed

    Takayanagi, M; Flessner, T; Wong, C H

    2000-06-16

    Both five- and six-membered iminocyclitols have proven to be useful transition-state analogue inhibitors of glycosidases. They also mimic the transition-state sugar moiety of the nucleoside phosphate sugar in glycosyltransferase-catalyzed reactions. Described here is the development of a general strategy toward the parallel synthesis of a five-membered iminocyclitol linked to a hydroxamic acid group designed to mimic the transition state of GDP-fucose complexed with Mn(II) in fucosyltransferase reactions. The iminocyclitol 8 containing a protected hydroxylamine unit was prepared from D-mannitol. The hydroxamic acid moiety was introduced via the reaction of 8 with various acid chlorides. The strategy is generally applicable to the construction of libraries for identification of glycosyltransferase inhibitors.

  4. A novel 18 beta-glycyrrhetinic acid analogue as a potent and selective inhibitor of 11 beta-hydroxysteroid dehydrogenase 2.

    PubMed

    Vicker, Nigel; Su, Xiangdong; Lawrence, Harshani; Cruttenden, Adrian; Purohit, Atul; Reed, Michael J; Potter, Barry V L

    2004-06-21

    Using 18beta-glycyrrhetinic acid as a template, the synthesis of a series of secondary amides at the 30-position is described and the effects of these modifications on the SAR of the 11beta-hydroxysteroid dehydrogenase isozymes type 1 and 2 from the rat are investigated. An isoform selective inhibitor has been discovered and compound 5, N-(2-hydroxyethyl)-3beta-hydroxy-11-oxo-18beta-olean-12-en-30-oic acid amide, is highlighted as a very potent and selective inhibitor of 11beta-hydroxysteroid dehydrogenase 2 with an IC(50)=4 pM.

  5. Virtual High-Throughput Screening Identifies Mycophenolic Acid as a Novel RNA Capping Inhibitor

    PubMed Central

    Tremblay-Létourneau, Maude; Despins, Simon; Bougie, Isabelle; Bisaillon, Martin

    2011-01-01

    The RNA guanylyltransferase (GTase) is involved in the synthesis of the m7Gppp-RNA cap structure found at the 5′ end of eukaryotic mRNAs. GTases are members of the covalent nucleotidyl transferase superfamily, which also includes DNA and RNA ligases. GTases catalyze a two-step reaction in which they initially utilize GTP as a substrate to form a covalent enzyme-GMP intermediate. The GMP moiety is then transferred to the diphosphate end of the RNA transcript in the second step of the reaction to form the Gppp-RNA structure. In the current study, we used a combination of virtual database screening, homology modeling, and biochemical assays to search for novel GTase inhibitors. Using this approach, we demonstrate that mycophenolic acid (MPA) can inhibit the GTase reaction by preventing the catalytic transfer of the GMP moiety onto an acceptor RNA. As such, MPA represents a novel type of inhibitor against RNA guanylyltransferases that inhibits the second step of the catalytic reaction. Moreover, we show that the addition of MPA to S. cerevisiae cells leads to a reduction of capped mRNAs. Finally, biochemical assays also demonstrate that MPA can inhibit DNA ligases through inhibition of the second step of the reaction. The biological implications of these findings for the MPA-mediated inhibition of members of the covalent nucleotidyl superfamily are discussed. PMID:21935470

  6. Catechol-substituted L-chicoric acid analogues as HIV integrase inhibitors.

    PubMed

    Lee, Jae Yeol; Yoon, Kwon Joong; Lee, Yong Sup

    2003-12-15

    HIV integrase catalyzes the integration of HIV DNA copy into the host cell DNA, which is essential for the production of progeny viruses. L-Chicoric acid and dicaffeoylquinic acids, isolated from plants, are well known potent inhibitors of HIV integrase. The common structural features of these inhibitors are caffeic acid derivatives connected to tartaric acid or quinic acid through ester bonds. In the present study, we have synthesized and tested the inhibitory activities of a new type of HIV IN inhibitors, which has catechol groups in place of caffeoyl groups in the structure of L-chicoric acid. Upon substitution of catechol groups at succinic acid, pyrrole-dicarboxylic acid, maleimide or maleic anhydride, the inhibitory activities (IC(50)=3.8-23.6 microM) were retained or remarkably increased when compared to parent compound L-chicoric acid (IC(50)=13.7 microM).

  7. Optimal use of proton pump inhibitors for treating acid peptic diseases in primary care.

    PubMed

    Tack, J; Louis, E; Persy, V; Urbain, D

    2013-12-01

    Heartburn, reflux and epigastric pain are frequently encountered symptoms in primary care medicine. Acid peptic diseases such as peptic ulcer and gastrointestinal reflux disease have a high prevalence, can have important impact on patient quality of life and represent a considerable health care cost. Proton pump inhibitors (PPIs) are the most potent pharmacological inhibitors of gastric acid secretion currently available and are the mainstay medical therapy for acid peptic diseases. This review summarizes current evidence on treatment of acid-peptic diseases with proton pump inhibitors and provides primary care clinicians with best practice guidelines for optimal use of these drugs.

  8. Synthesis and Evaluation of Macrocyclic Peptide Aldehydes as Potent and Selective Inhibitors of the 20S Proteasome

    PubMed Central

    2016-01-01

    This research explores the first design and synthesis of macrocyclic peptide aldehydes as potent inhibitors of the 20S proteasome. Two novel macrocyclic peptide aldehydes based on the ring-size of the macrocyclic natural product TMC-95 were prepared and evaluated as inhibitors of the 20S proteasome. Both compounds inhibited in the low nanomolar range and proved to be selective for the proteasome over other serine and cysteine proteases, particularly when compared to linear analogues with similar amino acid sequences. In HeLa cells, both macrocycles efficiently inhibited activation of nuclear factor-κB (NF-κB) transcription factor by blocking proteasomal degradation of the inhibitor protein IκBα after cytokine stimulation. Due to their covalent mechanism of binding these compounds represent a 1000-fold increase in inhibitory potency over previously reported noncovalently binding TMC-95 analogues. Molecular modeling of the macrocyclic peptides confirms the preference of the large S3 pocket for large, hydrophobic residues and the ability to exploit this to improve selectivity of proteasome inhibitors. PMID:26985310

  9. Design, Synthesis, and Biological Evaluation of PKD Inhibitors

    PubMed Central

    George, Kara M.; Frantz, Marie-Céline; Bravo-Altamirano, Karla; LaValle, Courtney R.; Tandon, Manuj; Leimgruber, Stephanie; Sharlow, Elizabeth R.; Lazo, John S.; Wang, Q. Jane; Wipf, Peter

    2011-01-01

    Protein kinase D (PKD) belongs to a family of serine/threonine kinases that play an important role in basic cellular processes and are implicated in the pathogenesis of several diseases. Progress in our understanding of the biological functions of PKD has been limited due to the lack of a PKD-specific inhibitor. The benzoxoloazepinolone CID755673 was recently reported as the first potent and kinase-selective inhibitor for this enzyme. For structure-activity analysis purposes, a series of analogs was prepared and their in vitro inhibitory potency evaluated. PMID:22267986

  10. Design, synthesis and biological evaluation of potent FAAH inhibitors.

    PubMed

    Tuo, Wei; Leleu-Chavain, Natascha; Barczyk, Amélie; Renault, Nicolas; Lemaire, Lucas; Chavatte, Philippe; Millet, Régis

    2016-06-01

    A new series of 3-carboxamido-5-aryl-isoxazoles was designed, synthesized and evaluated for their biological activity. Different pharmacomodulations have been explored and the lipophilicity of these compounds was assessed. Investigation of the in vitro biological activity led to the identification of 5 compounds as potent FAAH inhibitors, their good FAAH inhibition capacity is probably correlated with their suitable lipophilicity. Specifically, compound 25 showed similar inhibition potency against FAAH in comparison with URB597, one of the most potent FAAH inhibitor known to date.

  11. Synthesis of 5-ethynyl-2'-deoxyuridine-5'-boranomono phosphate as a potential thymidylate synthase inhibitor.

    PubMed

    Khan, Shoeb I; Dobrikov, Mikhail I; Shaw, Barbara Ramsay

    2005-01-01

    The 5-ethynyl-2'-deoxyuridine nucleoside and the 5'-boranomonophosphate nucleotide were synthesized as analogs of 5-fluoro-2'-deoxyuridine monophosphate (5-FdUMP), a widely used mechanism-based inhibitor of thymidylate synthase. Synthesis was carried out from protected 5-iodo-2'-deoxyuridine and trimethylsilylacetylene by Sonogashira palladium-catalyzed cross coupling reaction followed by selective phosphorylation and finally boronation.

  12. Melanostatin, a new melanin synthesis inhibitor. Production, isolation, chemical properties, structure and biological activity.

    PubMed

    Ishihara, Y; Oka, M; Tsunakawa, M; Tomita, K; Hatori, M; Yamamoto, H; Kamei, H; Miyaki, T; Konishi, M; Oki, T

    1991-01-01

    Melanostatin, a new antibiotic with melanin synthesis inhibitor activity, was isolated from the fermentation broth of Streptomyces clavifer No. N924-2. Its structure was determined by spectral analysis and degradation experiments. Melanostatin strongly inhibited melanin formation in Streptomyces bikiniensis NRRL B-1049 and B16 melanoma cells.

  13. Histone Deacetylase Inhibitors: Synthesis of Cyclic Tetrapeptides and their Triazole Analogues

    PubMed Central

    Singh, Erinprit K.; Nazarova, Lidia A.; Lapera, Stephanie A.; Alexander, Leslie D.

    2010-01-01

    Synthesis of nine macrocyclic peptide HDAC inhibitors and three triazole derivatives are described. HDAC inhibitory activity of these compounds against HeLa cell lysate is evaluated. The biological data demonstrates that incorporation of a triazole unit improves the HDAC inhibitory activity. PMID:20865132

  14. The synthesis and biological evaluation of a novel series of phthalazine PDE4 inhibitors I.

    PubMed

    Napoletano, M; Norcini, G; Pellacini, F; Marchini, F; Morazzoni, G; Ferlenga, P; Pradella, L

    2000-10-02

    This communication describes the synthesis and in vitro evaluation of a novel and potent series of phosphodiesterase type IV (PDE4) inhibitors. The compounds described represent conformationally constrained analogues of RP 73401, Piclamilast. Preliminary evidences of reduced side effects of II compared to standards are also reported.

  15. The antibiotic micrococcin is a potent inhibitor of growth and protein synthesis in the malaria parasite.

    PubMed

    Rogers, M J; Cundliffe, E; McCutchan, T F

    1998-03-01

    The antibiotic micrococcin is a potent growth inhibitor of the human malaria parasite Plasmodium falciparum, with a 50% inhibitory concentration of 35 nM. This is comparable to or less than the corresponding levels of commonly used antimalarial drugs. Micrococcin, like thiostrepton, putatively targets protein synthesis in the plastid-like organelle of the parasite.

  16. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  17. Synthesis and optimization of N-heterocyclic pyridinones as catechol-O-methyltransferase (COMT) inhibitors.

    PubMed

    Zhao, Zhijian; Harrison, Scott T; Schubert, Jeffrey W; Sanders, John M; Polsky-Fisher, Stacey; Zhang, Nanyan Rena; McLoughlin, Debra; Gibson, Christopher R; Robinson, Ronald G; Sachs, Nancy A; Kandebo, Monika; Yao, Lihang; Smith, Sean M; Hutson, Pete H; Wolkenberg, Scott E; Barrow, James C

    2016-06-15

    A series of N-heterocyclic pyridinone catechol-O-methyltransferase (COMT) inhibitors were synthesized. Physicochemical properties, including ligand lipophilic efficiency (LLE) and clogP, were used to guide compound design and attempt to improve inhibitor pharmacokinetics. Incorporation of heterocyclic central rings provided improvements in physicochemical parameters but did not significantly reduce in vitro or in vivo clearance. Nevertheless, compound 11 was identified as a potent inhibitor with sufficient in vivo exposure to significantly affect the dopamine metabolites homovanillic acid (HVA) and dihydroxyphenylacetic acid (DOPAC), and indicate central COMT inhibition.

  18. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  19. Design, Synthesis and Inhibitory Activity of Photoswitchable RET Kinase Inhibitors

    PubMed Central

    Ferreira, Rubén; Nilsson, Jesper R.; Solano, Carlos; Andréasson, Joakim; Grøtli, Morten

    2015-01-01

    REarranged during Transfection (RET) is a transmembrane receptor tyrosine kinase required for normal development and maintenance of neurons of the central and peripheral nervous systems. Deregulation of RET and hyperactivity of the RET kinase is intimately connected to several types of human cancers, most notably thyroid cancers, making it an attractive therapeutic target for small-molecule kinase inhibitors. Novel approaches, allowing external control of the activity of RET, would be key additions to the signal transduction toolbox. In this work, photoswitchable RET kinase inhibitors based on azo-functionalized pyrazolopyrimidines were developed, enabling photonic control of RET activity. The most promising compound displays excellent switching properties and stability with good inhibitory effect towards RET in cell-free as well as live-cell assays and a significant difference in inhibitory activity between its two photoisomeric forms. As the first reported photoswitchable small-molecule kinase inhibitor, we consider the herein presented effector to be a significant step forward in the development of tools for kinase signal transduction studies with spatiotemporal control over inhibitor concentration in situ. PMID:25944708

  20. Selective indole-based ECE inhibitors: synthesis and pharmacological evaluation.

    PubMed

    Brands, Michael; Ergüden, Jens-Kerim; Hashimoto, Kentaro; Heimbach, Dirk; Krahn, Thomas; Schröder, Christian; Siegel, Stephan; Stasch, Johannes-Peter; Tsujishita, Hideki; Weigand, Stefan; Yoshida, Nagahiro H

    2006-01-01

    Inhibition of the metalloprotease ECE-1 may be beneficial for the treatment of coronary heart disease, cancer, renal failure, and urological disorders. A novel class of indole-based ECE inhibitors was identified by high throughput screening. Optimization of the original screening lead structure 6 led to highly potent inhibitors such as 11, which bears a bisaryl amide moiety linked to the indole C2 position through an amide group. Docking of 11 into a model structure of ECE revealed a unique binding mode in which the Zn center of the enzyme is not directly addressed by the inhibitor, but key interactions are suggested for the central amide group. Testing of the lead compound 6 in hypertensive Dahl S rats resulted in a decrease in blood pressure after an initial period in which the blood pressure remained unchanged, most probably the result of ET-1 already present. Indole derivative 6 also displays a cardio-protective effect in a mouse model of acute myocardial infarction after oral administration. The more potent chloropyridine derivative 9 antagonizes big-ET-1-induced increase in blood pressure in rats at intravenous administration of 3 mg kg-1. All ECE inhibitors of the indole class showed high selectivity for ECE over related metalloproteases such as NEP and ACE. Therefore, these compounds might have further potential as drugs for the treatment of coronary heart diseases.

  1. Design, Synthesis and Inhibitory Activity of Photoswitchable RET Kinase Inhibitors

    NASA Astrophysics Data System (ADS)

    Ferreira, Rubén; Nilsson, Jesper R.; Solano, Carlos; Andréasson, Joakim; Grøtli, Morten

    2015-05-01

    REarranged during Transfection (RET) is a transmembrane receptor tyrosine kinase required for normal development and maintenance of neurons of the central and peripheral nervous systems. Deregulation of RET and hyperactivity of the RET kinase is intimately connected to several types of human cancers, most notably thyroid cancers, making it an attractive therapeutic target for small-molecule kinase inhibitors. Novel approaches, allowing external control of the activity of RET, would be key additions to the signal transduction toolbox. In this work, photoswitchable RET kinase inhibitors based on azo-functionalized pyrazolopyrimidines were developed, enabling photonic control of RET activity. The most promising compound displays excellent switching properties and stability with good inhibitory effect towards RET in cell-free as well as live-cell assays and a significant difference in inhibitory activity between its two photoisomeric forms. As the first reported photoswitchable small-molecule kinase inhibitor, we consider the herein presented effector to be a significant step forward in the development of tools for kinase signal transduction studies with spatiotemporal control over inhibitor concentration in situ.

  2. Protein synthesis inhibitors prevent both spontaneous and hormone-dependent maturation of isolated mouse oocytes

    SciTech Connect

    Downs, S.M. )

    1990-11-01

    The present study was carried out to examine the role of protein synthesis in mouse oocyte maturation in vitro. In the first part of this study, the effects of cycloheximide (CX) were tested on spontaneous meiotic maturation when oocytes were cultured in inhibitor-free medium. CX reversibly suppressed maturation of oocytes as long as maturation was either initially prevented by the phosphodiesterase inhibitor, 3-isobutyl-1-methyl-xanthine (IBMX), or delayed by follicle-stimulating hormone (FSH). In the second part of this study, the actions of protein synthesis inhibitors were tested on hormone-induced maturation. CEO were maintained in meiotic arrest for 21-22 h with hypoxanthine, and germinal vesicle breakdown (GVB) was induced with follicle-stimulating hormone (FSH). Three different protein synthesis inhibitors (CX, emetine (EM), and puromycin (PUR)) each prevented the stimulatory action of FSH on GVB in a dose-dependent fashion. This was accompanied by a dose-dependent suppression of 3H-leucine incorporation by oocyte-cumulus cell complexes. The action of these inhibitors on FSH- and epidermal growth factor (EGF)-induced GVB was next compared. All three drugs lowered the frequency of GVB in the FSH-treated groups, below even that of the controls (drug + hypoxanthine); the drugs maintained meiotic arrest at the control frequencies in the EGF-treated groups. Puromycin aminonucleoside, an analog of PUR with no inhibitory action on protein synthesis, had no effect. The three inhibitors also suppressed the stimulatory action of FSH on oocyte maturation when meiotic arrest was maintained with the cAMP analog, dbcAMP.

  3. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  4. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  5. Design, synthesis, and biological activity of urea derivatives as anaplastic lymphoma kinase inhibitors.

    PubMed

    af Gennäs, Gustav Boije; Mologni, Luca; Ahmed, Shaheen; Rajaratnam, Mohanathas; Marin, Oriano; Lindholm, Niko; Viltadi, Michela; Gambacorti-Passerini, Carlo; Scapozza, Leonardo; Yli-Kauhaluoma, Jari

    2011-09-05

    In anaplastic large-cell lymphomas, chromosomal translocations involving the kinase domain of anaplastic lymphoma kinase (ALK), generally fused to the 5' part of the nucleophosmin gene, produce highly oncogenic ALK fusion proteins that deregulate cell cycle, apoptosis, and differentiation in these cells. Other fusion oncoproteins involving ALK, such as echinoderm microtubule-associated protein-like 4-ALK, were recently found in patients with non-small-cell lung, breast, and colorectal cancers. Recent research has focused on the development of inhibitors for targeted therapy of these ALK-positive tumors. Because kinase inhibitors that target the inactive conformation are thought to be more specific than ATP-targeted inhibitors, we investigated the possibility of using two known inhibitors, doramapimod and sorafenib, which target inactive kinases, to design new urea derivatives as ALK inhibitors. We generated a homology model of ALK in its inactive conformation complexed with doramapimod or sorafenib in its active site. The results elucidated why doramapimod is a weak inhibitor and why sorafenib does not inhibit ALK. Virtual screening of commercially available compounds using the homology model of ALK yielded candidate inhibitors, which were tested using biochemical assays. Herein we present the design, synthesis, biological activity, and structure-activity relationships of a novel series of urea compounds as potent ALK inhibitors. Some compounds showed inhibition of purified ALK in the high nanomolar range and selective antiproliferative activity on ALK-positive cells.

  6. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  7. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-08

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  8. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  9. Synthesis of a selective HDAC6 inhibitor active in neuroblasts.

    PubMed

    Zwick, Vincent; Simões-Pires, Claudia A; Nurisso, Alessandra; Petit, Charlotte; Dos Santos Passos, Carolina; Randazzo, Giuseppe Marco; Martinet, Nadine; Bertrand, Philippe; Cuendet, Muriel

    2016-10-15

    In recent years, the role of HDAC6 in neurodegeneration has been partially elucidated, which led some authors to propose HDAC6 inhibitors as a therapeutic strategy to treat neurodegenerative diseases. In an effort to develop a selective HDAC6 inhibitor which can cross the blood brain barrier (BBB), a modified hydroxamate derivative (compound 3) was designed and synthetized. This compound was predicted to have potential for BBB penetration based on in silico and in vitro evaluation of passive permeability. When tested for its HDAC inhibitory activity, the IC50 value of compound 3 towards HDAC6 was in the nM range in both enzymatic and cell-based assays. Compound 3 showed a cell-based selectivity profile close to that of tubastatin A in SH-SY5Y human neuroblastoma cells, and a good BBB permeability profile.

  10. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  11. Structure-activity relationships of pyrrole based S-nitrosoglutathione reductase inhibitors: pyrrole regioisomers and propionic acid replacement.

    PubMed

    Sun, Xicheng; Qiu, Jian; Strong, Sarah A; Green, Louis S; Wasley, Jan W F; Colagiovanni, Dorothy B; Mutka, Sarah C; Blonder, Joan P; Stout, Adam M; Richards, Jane P; Chun, Lawrence; Rosenthal, Gary J

    2011-06-15

    S-Nitrosoglutathione reductase (GSNOR) is a member of the alcohol dehydrogenase family (ADH) that regulates the levels of S-nitrosothiols (SNOs) through catabolism of S-nitrosoglutathione (GSNO). GSNO and SNOs are implicated in the pathogenesis of many diseases including those in respiratory, cardiovascular, and gastrointestinal systems. The pyrrole based N6022 was recently identified as a potent, selective, reversible, and efficacious GSNOR inhibitor which is currently undergoing clinical development. We describe here the synthesis and structure-activity relationships (SAR) of novel pyrrole based analogues of N6022 focusing on scaffold modification and propionic acid replacement. We identified equally potent and novel GSNOR inhibitors having pyrrole regioisomers as scaffolds using a structure based approach.

  12. Novel route to chaetomellic acid A and analogues: serendipitous discovery of a more competent FTase inhibitor

    PubMed Central

    Bellesia, Franco; Choi, Seoung-ryoung; Felluga, Fulvia; Fiscaletti, Giuliano; Ghelfi, Franco; Menziani, Maria Cristina; Parsons, Andrew F.; Poulter, C. Dale; Roncaglia, Fabrizio; Sabbatini, Massimo; Spinelli, Domenico

    2013-01-01

    A new practical route to chaetomellic acid A (ACA), based on the copper catalysed radical cyclization (RC) of (Z)-3-(2,2-dichloropropanoyl)-2-pentadecylidene-1,3-thiazinane, is described. Remarkably, the process entailed: i) a one-pot preparation of the intermediate N-α-perchloroacyl-2-(Z)-alkyliden-1,3-thiazinanes starting from N-(3-hydroxypropyl)palmitamide, ii) a two step smooth transformation of the RC products into ACA and iii) only one intermediate chromatographic purification step. The method offers a versatile approach to the preparation of ACA analogues, through the synthesis of an intermediate maleic anhydride with a vinylic group at the end of the aliphatic tail, a function that can be transformed through a thiol-ene coupling. Serendipitously, the disodium salt of 2-(9-(butylthio)nonyl)-3-methylmaleic acid, that we prepared as a representative sulfurated ACA analogue, was a more competent FTase inhibitor than ACA. This behaviour was analysed by a molecular docking study. PMID:23182215

  13. Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

    PubMed Central

    Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

    2011-01-01

    Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

  14. Inhibition of cholesterol synthesis by squalene synthase inhibitors does not induce myotoxicity in vitro.

    PubMed

    Flint, O P; Masters, B A; Gregg, R E; Durham, S K

    1997-07-01

    The cholesterol-lowering HMG CoA reductase inhibitors (HMGRI), pravastatin and lovastatin, have been associated with skeletal myopathy in humans and in rats. In a previous in vitro study, HMGRI-induced changes in neonatal rat skeletal muscle cells were characterized by reversible inhibition of protein synthesis and loss of differentiated myotubes at concentrations markedly lower than those inducing enzyme leakage. Myotoxicity was determined to be directly related to inhibition of HMG CoA reductase, since mevalonate, the immediate product of HMG CoA reductase metabolism, abrogated the drug-induced changes. Farnesol, geranylgeraniol, and squalene are metabolites of mevalonate. Squalene, formed from farnesol by squalene synthase, is the first metabolite solely committed to cholesterol synthesis. In contrast, geranylgeraniol, formed by the addition of an isoprene group to farnesol, is the first metabolite uncommitted to cholesterol synthesis. The objective of the present study was to determine the role of inhibition of cholesterol synthesis in HMGRI-induced in vitro myotoxicity. HMGRI-treated neonatal rat skeletal muscle cultures were supplemented with farnesol and geranylgeraniol, and in another study, muscle cultures were exposed to two squalene synthase inhibitors (SSI), BMS-187745 and its prodrug ester, BMS-188494. Endpoints evaluated for both studies included protein synthesis ([3H]leucine incorporation), total cellular protein (a measure of cell loss), intra- and extracellular lactate dehydrogenase activity (a measure of membrane integrity), cholesterol biosynthesis ([14C]acetate incorporation), and morphology. HMG CoA reductase inhibitor-induced morphologic changes and inhibition of protein synthesis were significantly ameliorated by supplementation with farnesol and geranylgeraniol. In contrast to HMGRI-induced in vitro myotoxicity, SSI induced an irreversible, minimal cytotoxicity at close to maximum soluble concentrations. These results indicate that

  15. Structural Requirements of HDAC Inhibitors: SAHA Analogs Functionalized Adjacent to the Hydroxamic Acid

    PubMed Central

    Bieliauskas, Anton V.; Weerasinghe, Sujith V. W.; Pflum, Mary Kay H.

    2007-01-01

    Inhibitors of histone deacetylase (HDAC) proteins such as suberoylanilide hydroxamic acid (SAHA) have emerged as effective therapeutic anti-cancer agents. To better understand the structural requirements of HDAC inhibitors, a small molecule library with a variety of substituents attached adjacent to the metal binding hydroxamic acid of SAHA was synthesized. The presence of a substituent adjacent to the hydroxamic acid led to an 800 to 5000-fold decrease in inhibition compared to SAHA. The observed results have implications for drug design, suggesting that HDAC inhibitors with substituents near the metal binding moiety will have inhibitory activities in the μM rather than nM range. PMID:17307359

  16. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  17. Impacts of lignocellulose-derived inhibitors on L-lactic acid fermentation by Rhizopus oryzae.

    PubMed

    Zhang, Li; Li, Xin; Yong, Qiang; Yang, Shang-Tian; Ouyang, Jia; Yu, Shiyuan

    2016-03-01

    Inhibitors generated in the pretreatment and hydrolysis of corn stover and corn cob were identified. In general, they inhibited cell growth, lactate dehydrogenase, and lactic acid production but with less or no adverse effect on alcohol dehydrogenase and ethanol production in batch fermentation by Rhizopus oryzae. Furfural and 5-hydroxymethyl furfural (HMF) were highly toxic at 0.5-1 g L(-1), while formic and acetic acids at less than 4 g L(-1) and levulinic acid at 10 g L(-1) were not toxic. Among the phenolic compounds at 1 g L(-1), trans-cinnamic acid and syringaldehyde had the highest toxicity while syringic, ferulic and p-coumaric acids were not toxic. Although these inhibitors were present at concentrations much lower than their separately identified toxic levels, lactic acid fermentation with the hydrolysates showed much inferior performance compared to the control without inhibitor, suggesting synergistic or compounded effects of the lignocellulose-degraded compounds on inhibiting lactic acid fermentation.

  18. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  19. Fatty Acid Synthesis and Control of Caspase 2 in Prostate Cancer

    DTIC Science & Technology

    2013-05-01

    July 2011- 30 June 2012 4 . TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fatty Acid Synthesis and control of Caspase 2 in Prostate Cancer 5b. GRANT...Introduction…………………………………………………………….………..….. 4 Body………………………………………………………………………………….. 4 -6 Key Research Accomplishments...combination  with  inhibitors  of  NADPH  production   ( DHEA ),  fatty  acid  synthesis,  (C75,  C93,  cerulenin)  and  CaMKII

  20. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  1. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases.

  2. A Novel Selective Prostaglandin E2 Synthesis Inhibitor Relieves Pyrexia and Chronic Inflammation in Rats.

    PubMed

    Sugita, Ryusuke; Kuwabara, Harumi; Sugimoto, Kotaro; Kubota, Kazufumi; Imamura, Yuichiro; Kiho, Toshihiro; Tengeiji, Atsushi; Kawakami, Katsuhiro; Shimada, Kohei

    2016-04-01

    Prostaglandin E2 (PGE2) is a terminal prostaglandin in the cyclooxygenase (COX) pathway. Inhibition of PGE2 production may relieve inflammatory symptoms such as fever, arthritis, and inflammatory pain. We report here the profile of a novel selective PGE2 synthesis inhibitor, compound A [N-[(1S,3S)-3-carbamoylcyclohexyl]-1-(6-methyl-3-phenylquinolin-2-yl)piperidine-4-carboxamide], in animal models of pyrexia and inflammation. The compound selectively suppressed the synthesis of PGE2 in human alveolar adenocarcinoma cell line A549 cells and rat macrophages. In the lipopolysaccharide-induced pyrexia model, this compound selectively reduced PGE2 production in cerebrospinal fluid and showed an anti-pyretic effect. In the adjuvant-induced arthritis model, compound A therapeutically decreased foot swelling in the established arthritis. Our data demonstrates that selective suppression of PGE2 synthesis shows anti-pyretic and anti-inflammatory effects, suggesting that selective PGE2 synthesis inhibitors can be applied as an alternative treatment to nonsteroidal, anti-inflammatory drugs (NSAIDs) or COX-2-selective inhibitors.

  3. Stimulation of tentoxin synthesis by aged-culture filtrates and continued synthesis in the presence of protein inhibitors.

    PubMed

    Sheu, J T; Talburt, D E

    1986-02-01

    Tentoxin, a cyclic tetrapeptide produced by Alternaria alternata (Fries) Keissler, induces chlorosis in certain seedling plants. It can be extracted from culture filtrates of the fungus. Tentoxin production is stimulated and increased by using a mixture of aged culture filtrates and modified Richards solution. Aged culture filtrates can be obtained from 3-week-old or older cultures of A. alternata in modified Richards solution or Pratts solution. A mixture of aged culture filtrate and fresh medium in the ratio 2:3 gives the maximal enhancement of tentoxin production. This growth system provided us with a model for studying the effects of protein synthesis inhibitors on tentoxin production. Two antibiotics which inhibit protein synthesis at the ribosomal level were tested on growth, protein synthesis, and tentoxin production in A. alternata cultures. Cycloheximide at concentrations of 500 mug/ml or emetine at concentrations of 250 mug/ml did not inhibit tentoxin synthesis, although they stopped mycelial growth and protein synthesis of the fungus at the logarithmic growth stage in the enhancement medium. These results led us to conclude that tentoxin, like certain other bioactive cyclic peptides, is synthesized by a nonribosomal peptide synthesis mechanism.

  4. The complete amino acid sequence of a trypsin inhibitor from Bauhinia variegata var. candida seeds.

    PubMed

    Di Ciero, L; Oliva, M L; Torquato, R; Köhler, P; Weder, J K; Camillo Novello, J; Sampaio, C A; Oliveira, B; Marangoni, S

    1998-11-01

    Trypsin inhibitors of two varieties of Bauhinia variegata seeds have been isolated and characterized. Bauhinia variegata candida trypsin inhibitor (BvcTI) and B. variegata lilac trypsin inhibitor (BvlTI) are proteins with Mr of about 20,000 without free sulfhydryl groups. Amino acid analysis shows a high content of aspartic acid, glutamic acid, serine, and glycine, and a low content of histidine, tyrosine, methionine, and lysine in both inhibitors. Isoelectric focusing for both varieties detected three isoforms (pI 4.85, 5.00, and 5.15), which were resolved by HPLC procedure. The trypsin inhibitors show Ki values of 6.9 and 1.2 nM for BvcTI and BvlTI, respectively. The N-terminal sequences of the three trypsin inhibitor isoforms from both varieties of Bauhinia variegata and the complete amino acid sequence of B. variegata var. candida L. trypsin inhibitor isoform 3 (BvcTI-3) are presented. The sequences have been determined by automated Edman degradation of the reduced and carboxymethylated proteins of the peptides resulting from Staphylococcus aureus protease and trypsin digestion. BvcTI-3 is composed of 167 residues and has a calculated molecular mass of 18,529. Homology studies with other trypsin inhibitors show that BvcTI-3 belongs to the Kunitz family. The putative active site encompasses Arg (63)-Ile (64).

  5. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors.

  6. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  7. Synthesis and SAR of Benzisothiazole- and Indolizine-β-d-glucopyranoside Inhibitors of SGLT2.

    PubMed

    Zhou, Huiqiang; Danger, Dana P; Dock, Steven T; Hawley, Lora; Roller, Shane G; Smith, Chari D; Handlon, Anthony L

    2010-04-08

    A series of benzisothiazole- and indolizine-β-d-glucopyranoside inhibitors of human SGLT2 are described. The synthesis of the C-linked heterocyclic glucosides took advantage of a palladium-catalyzed cross-coupling reaction between a glucal boronate and the corresponding bromo heterocycle. The compounds have been evaluated for their human SGLT2 inhibition potential using cell-based functional transporter assays, and their structure-activity relationships have been described. Benzisothiazole-C-glucoside 16d was found to be an inhibitor of SGLT2 with an IC50 of 10 nM.

  8. Design, synthesis, and evaluation of benzophenone derivatives as novel acetylcholinesterase inhibitors.

    PubMed

    Belluti, Federica; Piazzi, Lorna; Bisi, Alessandra; Gobbi, Silvia; Bartolini, Manuela; Cavalli, Andrea; Valenti, Piero; Rampa, Angela

    2009-03-01

    Starting from a structure-based drug design, new acetylcholinesterase inhibitors were designed and synthesized as analogues of donepezil. The compounds were composed by an aromatic function and a tertiary amino moiety connected by a suitable spacer. In particular, the benzophenone nucleus and the N,N-benzylmethylamine function were selected. The easily accessible three-step synthesis of these compounds resulted to be significantly less difficult and expensive than that of donepezil. Several compounds possess anti-cholinesterase activity in the order of micro and sub-micromolar. Particularly, compounds 1 and 10 were the most potent inhibitors of the series.

  9. Synthesis and evaluation of aminopyridine derivatives as potential BACE1 inhibitors.

    PubMed

    Konno, Hiroyuki; Sato, Taki; Saito, Yugo; Sakamoto, Iori; Akaji, Kenichi

    2015-11-15

    To identify a new non-peptidyl BACE1 inhibitor, we focused on the aminopyridine structure, which binds to the active sites of BACE1. Synthesis of aminopyridine derivatives and evaluation of inhibitory activity against rBACE1 are described. The 2-aminopyridine moiety and/or 3-methoxybenzaldehyde could be converted to terminal acetylene derivatives by the Sonogashira method. Sonogashira or Glaser cross-coupling reactions with the corresponding derivatives followed by hydrogenation could derive the designed compounds. Although inhibitory activities of the synthetic compounds against rBACE1 were weak, the aminopyridine motif has potential as a BACE1 inhibitor.

  10. Synthesis and biological evaluation of histone deacetylase inhibitors that are based on FR235222

    PubMed Central

    Singh, Erinprit K.; Ravula, Suchitra; Pan, Chung-Mao; Pan, Po-Shen; Vasko, Robert C.; Lapera, Stephanie A.; Weerasinghe, Sujith V. W.; Pflum, Mary Kay H.; McAlpine, Shelli R.

    2008-01-01

    We outline the synthesis of six novel derivatives that are based on a recently discovered HDAC inhibitor FR235222. Our work is the first report utilizing a novel binding element, guanidine, as metal coordinators in HDAC inhibitors. Further, we demonstrate that these compounds show cytotoxicity that parallels their ability to inhibit deacetylase activity, and that the most potent compounds maintain an l-Phe at position 1, and a d-Pro at position 4. Both inhibition of HDAC activity and cytotoxicity against the pancreatic cancer cell line BxPC3 are exhibited by these compounds, establishing that a guanidine unit can be utilized successfully to inhibit HDAC activity. PMID:18381239

  11. Design, synthesis, and evaluation of inhibitors of pyruvate phosphate dikinase.

    PubMed

    Wu, Chun; Dunaway-Mariano, Debra; Mariano, Patrick S

    2013-03-01

    Pyruvate phosphate dikinase (PPDK) catalyzes the phosphorylation reaction of pyruvate that forms phosphoenolpyruvate (PEP) via two partial reactions: PPDK + ATP + P(i) → PPDK-P + AMP + PP(i) and PPDK-P + pyruvate → PEP + PPDK. Based on its role in the metabolism of microbial human pathogens, PPDK is a potential drug target. A screen of substances that bind to the PPDK ATP-grasp domain active site revealed that flavone analogues are potent inhibitors of the Clostridium symbiosum PPDK. In silico modeling studies suggested that placement of a 3–6 carbon-tethered ammonium substituent at the 3′- or 4′-positions of 5,7-dihydroxyflavones would result in favorable electrostatic interactions with the PPDK Mg-ATP binding site. As a result, polymethylene-tethered amine derivatives of 5,7-dihydroxyflavones were prepared. Steady-state kinetic analysis of these substances demonstrates that the 4′-aminohexyl-5,7-dyhydroxyflavone 10 is a potent competitive PPDK inhibitor (K(i) = 1.6 ± 0.1 μM). Single turnover experiments were conducted using 4′-aminopropyl-5,7-dihydroxyflavone 7 to show that this flavone specifically targets the ATP binding site and inhibits catalysis of only the PPDK + ATP + P(i) → PPDK-P + AMP PP(i) partial reaction. Finally, the 4′-aminopbutyl-5,7-dihydroxyflavone 8 displays selectivity for inhibition of PPDK versus other enzymes that utilize ATP and NAD.

  12. Recent developments in the synthesis of acetylcholinesterase inhibitors.

    PubMed

    Marco, José L; Carreiras, M Carmo

    2003-09-01

    The acetylcholinesterase (AChE) and butyrylcholinesterase (BuChE) inhibitory activities of a series of pyrano[2,3-b]quinolines (2, 3), [1,8]naphthyridines (5, 6), 4-amino-2,3-diaryl-5,6,7,8-tetrahydrofuro[2,3-b]quinolines (11-13)/ 4-amino-6,7,8,9-tetrahydro-2,3-diphenyl-5H-cyclohepta[e]furo[2,3-b]pyridine (14), 4-amino-5,6,7,8-tetrahydro-2,3-diphenylthieno[2,3-b]quinoline (15)/ 4-amino-6,7,8,9-tetrahydro-2,3-diphenyl-5H-cyclohepta[e]thieno[2,3-b]pyridine (16) are described. These compounds are tacrine analogues that have been prepared from readily available polyfunctionalized ethyl [6-amino-5-cyano-4H-pyran]-3-carboxylates (9, 10), ethyl [6-amino-5-cyanopyridine]-3-carboxylates (7, 8), 2-amino-3-cyano-4,5-diarylfurans (17-19) and 2-amino-3-cyano-4,5-diphenylthiophene (20) via Friedländer condensation with selected ketones. These compounds are competitive and, in a few cases, non-competitive inhibitors for AChE, the most potent being compound (14), though three-fold less active than tacrine. The BuChE inhibitory activity is only significant in compounds 11 and 14, ten-fold less active than tacrine. Furthermore, the products 12 and 13 are selective and moderate AChE inhibitors.

  13. Design, synthesis and evaluation of polar head group containing 2-keto-oxazole inhibitors of FAAH.

    PubMed

    Rusch, Marion; Zahov, Stefan; Vetter, Ingrid R; Lehr, Matthias; Hedberg, Christian

    2012-01-15

    2-α-Keto oxazoles containing polar head groups in their C5-side chains were designed as fatty acid amide hydrolase (FAAH) inhibitors. Variation in the spacer length resulted in submicromolar α-keto-oxazole FAAH inhibitor (IC(50)=436 nM) presenting electrostatic stabilizing interactions between its polar head group contained in the C5-side chain and the hydrophilic pocket of the enzyme.

  14. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  15. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  16. 3-Heterocycle-phenyl N-alkylcarbamates as FAAH inhibitors: design, synthesis and 3D-QSAR studies.

    PubMed

    Käsnänen, Heikki; Myllymäki, Mikko J; Minkkilä, Anna; Kataja, Antti O; Saario, Susanna M; Nevalainen, Tapio; Koskinen, Ari M P; Poso, Antti

    2010-02-01

    Carbamates are a well-established class of fatty acid amide hydrolase (FAAH) inhibitors. Here we describe the synthesis of meta-substituted phenolic N-alkyl/aryl carbamates and their in vitro FAAH inhibitory activities. The most potent compound, 3-(oxazol-2yl)phenyl cyclohexylcarbamate (2 a), inhibited FAAH with a sub-nanomolar IC(50) value (IC(50)=0.74 nM). Additionally, we developed and validated three-dimensional quantitative structure-activity relationships (QSAR) models of FAAH inhibition combining the newly disclosed carbamates with our previously published inhibitors to give a total set of 99 compounds. Prior to 3D-QSAR modeling, the degree of correlation between FAAH inhibition and in silico reactivity was also established. Both 3D-QSAR methods used, CoMSIA and GRID/GOLPE, produced statistically significant models with coefficient of correlation for external prediction (R(2) (PRED)) values of 0.732 and 0.760, respectively. These models could be of high value in further FAAH inhibitor design.

  17. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  18. Design and Synthesis of Novel Macrocyclic Mer Tyrosine Kinase Inhibitors.

    PubMed

    Wang, Xiaodong; Liu, Jing; Zhang, Weihe; Stashko, Michael A; Nichols, James; Miley, Michael J; Norris-Drouin, Jacqueline; Chen, Zhilong; Machius, Mischa; DeRyckere, Deborah; Wood, Edgar; Graham, Douglas K; Earp, H Shelton; Kireev, Dmitri; Frye, Stephen V

    2016-12-08

    Mer tyrosine kinase (MerTK) is aberrantly elevated in various tumor cells and has a normal anti-inflammatory role in the innate immune system. Inhibition of MerTK may provide dual effects against these MerTK-expressing tumors through reducing cancer cell survival and redirecting the innate immune response. Recently, we have designed novel and potent macrocyclic pyrrolopyrimidines as MerTK inhibitors using a structure-based approach. The most active macrocycles had an EC50 below 40 nM in a cell-based MerTK phosphor-protein ELISA assay. The X-ray structure of macrocyclic analogue 3 complexed with MerTK was also resolved and demonstrated macrocycles binding in the ATP binding pocket of the MerTK protein as anticipated. In addition, the lead compound 16 (UNC3133) had a 1.6 h half-life and 16% oral bioavailability in a mouse PK study.

  19. Scaffold oriented synthesis. Part 3: design, synthesis and biological evaluation of novel 5-substituted indazoles as potent and selective kinase inhibitors employing [2+3] cycloadditions.

    PubMed

    Akritopoulou-Zanze, Irini; Wakefield, Brian D; Gasiecki, Alan; Kalvin, Douglas; Johnson, Eric F; Kovar, Peter; Djuric, Stevan W

    2011-03-01

    We report the synthesis and biological evaluation of 5-substituted indazoles and amino indazoles as kinase inhibitors. The compounds were synthesized in a parallel synthesis fashion from readily available starting materials employing [2+3] cycloaddition reactions and were evaluated against a panel of kinase assays. Potent inhibitors were identified for numerous kinases such as Rock2, Gsk3β, Aurora2 and Jak2.

  20. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  1. Trypsin inhibitors from the garden four o'clock (Mirabilis jalapa) and spinach (Spinacia oleracea) seeds: isolation, characterization and chemical synthesis.

    PubMed

    Kowalska, Jolanta; Pszczoła, Katarzyna; Wilimowska-Pelc, Anna; Lorenc-Kubis, Irena; Zuziak, Ewa; Ługowski, Mateusz; Łegowska, Anna; Kwiatkowska, Anna; Sleszyńska, Małgorzata; Lesner, Adam; Walewska, Aleksandra; Zabłotna, Ewa; Rolka, Krzysztof; Wilusz, Tadeusz

    2007-06-01

    Five serine proteinase inhibitors (Mirabilis jalapa trypsin inhibitors, MJTI I and II and Spinacia oleracea trypsin inhibitors, SOTI I, II, and III) from the garden four-o'clock (M. jalapa) and spinach (S. oleracea) seeds were isolated. The purification procedures included affinity chromatography on immobilized methylchymotrypsin in the presence of 5M NaCl, ion exchange chromatography and/or preparative electrophoresis, and finally RP-HPLC on a C-18 column. The inhibitors, crosslinked by three disulfide bridges, are built of 35 to 37 amino-acid residues. Their primary structures differ from those of known trypsin inhibitors, but showed significant similarity to the antimicrobial peptides isolated from the seeds of M. jalapa (MJ-AMP1, MJ-AMP2), Mesembryanthemum crystallinum (AMP1), and Phytolacca americana (AMP-2 and PAFP-S) and from the hemolymph of Acrocinus longimanus (Alo-1, 2 and 3). The association equilibrium constants (K(a)) with bovine beta-trypsin for the inhibitors from M. jalapa (MJTI I and II) and S. oleracea (SOTI I-III) were found to be about 10(7)M(-1). Fully active MJTI I and SOTI I were obtained by solid-phase peptide synthesis. The disulfide bridge pattern in both inhibitors (Cys1-Cys4, Cys2-Cys5 and Cys3-Cys6) was established after their digestion with thermolysin and proteinase K followed by the MALDI-TOF analysis.

  2. Amino Compounds as Inhibitors of De Novo Synthesis of Chlorobenzenes

    PubMed Central

    Wang, Si-Jia; He, Pin-Jing; Lu, Wen-Tao; Shao, Li-Ming; Zhang, Hua

    2016-01-01

    The inhibitory effects of four amino compounds on the formation of chlorobenzenes (CBzs) - dioxin precursors and indicators, and the inhibitory mechanisms were explored. The results show NH4H2PO4 can decrease the total yields of CBzs (1,2di-CBz, 1,3di-CBz, 1,4di-CBz, penta-CBz and hexa-CBz) by 98.1%±1.6% and 96.1%±0.7% under air and nitrogen flow. The inhibitory effects indicated by the total yields of CBzs follow the order NH4H2PO4 > NH4HF2 > (NH4)2SO4 > NH4Br under air flow and NH4H2PO4 ≈ (NH4)2SO4 ≈ NH4HF2 >NH4Br under nitrogen flow. The inhibition mechanism revealed by thermal analysis that CuCl2 was converted to CuPO3 by reacting with NH4H2PO4 below 200 °C, which can block the transfer of chlorine and formation of C–Cl bonds at 350 °C. The effects of the other three inhibitors were weaker because their reactions with CuCl2, which form other copper compounds, and the reaction of CuCl2 with carbon, which forms C–Cl bonds, were almost simultaneous and competitive. Oxygen influenced the yield of CBzs obviously, and the total yield of five CBzs sharply increased with oxygen. Because of their high efficiency, low environmental impact, low cost, and availability, amino compounds - especially NH4H2PO4 - can be utilized as inhibitors of CBzs during incineration. PMID:27034259

  3. Amino Compounds as Inhibitors of De Novo Synthesis of Chlorobenzenes

    NASA Astrophysics Data System (ADS)

    Wang, Si-Jia; He, Pin-Jing; Lu, Wen-Tao; Shao, Li-Ming; Zhang, Hua

    2016-04-01

    The inhibitory effects of four amino compounds on the formation of chlorobenzenes (CBzs) - dioxin precursors and indicators, and the inhibitory mechanisms were explored. The results show NH4H2PO4 can decrease the total yields of CBzs (1,2di-CBz, 1,3di-CBz, 1,4di-CBz, penta-CBz and hexa-CBz) by 98.1%±1.6% and 96.1%±0.7% under air and nitrogen flow. The inhibitory effects indicated by the total yields of CBzs follow the order NH4H2PO4 > NH4HF2 > (NH4)2SO4 > NH4Br under air flow and NH4H2PO4 ≈ (NH4)2SO4 ≈ NH4HF2 >NH4Br under nitrogen flow. The inhibition mechanism revealed by thermal analysis that CuCl2 was converted to CuPO3 by reacting with NH4H2PO4 below 200 °C, which can block the transfer of chlorine and formation of C–Cl bonds at 350 °C. The effects of the other three inhibitors were weaker because their reactions with CuCl2, which form other copper compounds, and the reaction of CuCl2 with carbon, which forms C–Cl bonds, were almost simultaneous and competitive. Oxygen influenced the yield of CBzs obviously, and the total yield of five CBzs sharply increased with oxygen. Because of their high efficiency, low environmental impact, low cost, and availability, amino compounds - especially NH4H2PO4 - can be utilized as inhibitors of CBzs during incineration.

  4. Discovery of a Specific Inhibitor of Pyomelanin Synthesis in Legionella pneumophila.

    PubMed

    Aubi, Oscar; Flydal, Marte I; Zheng, Huaixin; Skjærven, Lars; Rekand, Illimar; Leiros, Hanna-Kirsti S; Haug, Bengt Erik; Cianciotto, Nicholas P; Martinez, Aurora; Underhaug, Jarl

    2015-11-12

    Phenylalanine hydroxylase catalyzes the first step in the synthesis of pyomelanin, a pigment that aids in the acquisition of essential iron in certain bacteria. In this work, we present the development and application of a drug discovery protocol by targeting this enzyme in Legionella pneumophila, the major causative agent of Legionnaires' disease. We employ a combination of high-throughput screening to identify small-molecule binders, enzymatic activity measurements to identify inhibitors in vitro, and the verification of the inhibitory effect in vivo. The most potent inhibitor shows an IC50 value in the low micromolar range and successfully abolishes the synthesis of pyomelanin in L. pneumophila cultures at 10 μM. Thus, this compound represents a novel and effective tool for investigating the role of pyomelanin in the biology and pathogenicity of this organism. Altogether, the results demonstrate a successful pathway for drug development focusing on binding specificity in the initial high-throughput screening steps.

  5. Facile synthesis of chrysin-derivatives with promising activities as aromatase inhibitors.

    PubMed

    Mohammed, Hamdoon A; Ba, Lalla A; Burkholz, Torsten; Schumann, Elena; Diesel, Britta; Zapp, Josef; Kiemer, Alexandra K; Ries, Christina; Hartmann, Rolf W; Hosny, Mohammed; Jacob, Claus

    2011-01-01

    Flavones such as chrysin show structural similarities to androgens, the substrates of human aromatase, which converts androgens to estrogens. Aromatase is a key target in the treatment of hormone-dependent tumors, including breast cancer. Flavone-based aromatase inhibitors are of growing interest, and chrysin in particular provides a (natural) lead structure. This paper reports multicomponent synthesis as a means for facile modification of the chrysin core structure in order to add functional elements. A Mannich-type reaction was used to synthesize a range of mono- and disubstituted chrysin derivatives, some of which are more effective aromatase inhibitors than the benchmark compound, aminoglutethimide. Similarly, the reaction of chrysin with various isonitriles and acetylene dicarboxylates results in a new class of flavone derivatives, tricyclic pyrano-flavones which also inhibit human aromatase. Multicomponent reactions involving flavones therefore enable the synthesis of a variety of derivatives, some of which may be useful as anticancer agents.

  6. Synthetic silvestrol analogues as potent and selective protein synthesis inhibitors.

    PubMed

    Liu, Tao; Nair, Somarajan J; Lescarbeau, André; Belani, Jitendra; Peluso, Stéphane; Conley, James; Tillotson, Bonnie; O'Hearn, Patrick; Smith, Sherri; Slocum, Kelly; West, Kip; Helble, Joseph; Douglas, Mark; Bahadoor, Adilah; Ali, Janid; McGovern, Karen; Fritz, Christian; Palombella, Vito J; Wylie, Andrew; Castro, Alfredo C; Tremblay, Martin R

    2012-10-25

    Misregulation of protein translation plays a critical role in human cancer pathogenesis at many levels. Silvestrol, a cyclopenta[b]benzofuran natural product, blocks translation at the initiation step by interfering with assembly of the eIF4F translation complex. Silvestrol has a complex chemical structure whose functional group requirements have not been systematically investigated. Moreover, silvestrol has limited development potential due to poor druglike properties. Herein, we sought to develop a practical synthesis of key intermediates of silvestrol and explore structure-activity relationships around the C6 position. The ability of silvestrol and analogues to selectively inhibit the translation of proteins with high requirement on the translation-initiation machinery (i.e., complex 5'-untranslated region UTR) relative to simple 5'UTR was determined by a cellular reporter assay. Simplified analogues of silvestrol such as compounds 74 and 76 were shown to have similar cytotoxic potency and better ADME characteristics relative to those of silvestrol.

  7. Diversity-oriented synthesis yields novel multistage antimalarial inhibitors.

    PubMed

    Kato, Nobutaka; Comer, Eamon; Sakata-Kato, Tomoyo; Sharma, Arvind; Sharma, Manmohan; Maetani, Micah; Bastien, Jessica; Brancucci, Nicolas M; Bittker, Joshua A; Corey, Victoria; Clarke, David; Derbyshire, Emily R; Dornan, Gillian L; Duffy, Sandra; Eckley, Sean; Itoe, Maurice A; Koolen, Karin M J; Lewis, Timothy A; Lui, Ping S; Lukens, Amanda K; Lund, Emily; March, Sandra; Meibalan, Elamaran; Meier, Bennett C; McPhail, Jacob A; Mitasev, Branko; Moss, Eli L; Sayes, Morgane; Van Gessel, Yvonne; Wawer, Mathias J; Yoshinaga, Takashi; Zeeman, Anne-Marie; Avery, Vicky M; Bhatia, Sangeeta N; Burke, John E; Catteruccia, Flaminia; Clardy, Jon C; Clemons, Paul A; Dechering, Koen J; Duvall, Jeremy R; Foley, Michael A; Gusovsky, Fabian; Kocken, Clemens H M; Marti, Matthias; Morningstar, Marshall L; Munoz, Benito; Neafsey, Daniel E; Sharma, Amit; Winzeler, Elizabeth A; Wirth, Dyann F; Scherer, Christina A; Schreiber, Stuart L

    2016-10-20

    Antimalarial drugs have thus far been chiefly derived from two sources-natural products and synthetic drug-like compounds. Here we investigate whether antimalarial agents with novel mechanisms of action could be discovered using a diverse collection of synthetic compounds that have three-dimensional features reminiscent of natural products and are underrepresented in typical screening collections. We report the identification of such compounds with both previously reported and undescribed mechanisms of action, including a series of bicyclic azetidines that inhibit a new antimalarial target, phenylalanyl-tRNA synthetase. These molecules are curative in mice at a single, low dose and show activity against all parasite life stages in multiple in vivo efficacy models. Our findings identify bicyclic azetidines with the potential to both cure and prevent transmission of the disease as well as protect at-risk populations with a single oral dose, highlighting the strength of diversity-oriented synthesis in revealing promising therapeutic targets.

  8. Novel leucine ureido derivatives as aminopeptidase N inhibitors. Design, synthesis and activity evaluation.

    PubMed

    Ma, Chunhua; Cao, Jiangying; Liang, Xuewu; Huang, Yongxue; Wu, Ping; Li, Yingxia; Xu, Wenfang; Zhang, Yingjie

    2016-01-27

    Aminopeptidase N (APN/CD13) over-expressed on tumor cells and tumor microenvironment, plays critical roles in tumor invasion, metastasis and angiogenesis. Here we described the design, synthesis and preliminary activity studies of novel leucine ureido derivatives as aminopeptidase N (APN/CD13) inhibitors. The results showed that compound 7a had the most potent inhibitory activity against APN with the IC50 value of 20 nM, which could be used for further anticancer agent research.

  9. New aromatase inhibitors. Synthesis and biological activity of aryl-substituted pyrrolizine and indolizine derivatives.

    PubMed

    Sonnet, P; Dallemagne, P; Guillon, J; Enguehard, C; Stiebing, S; Tanguy, J; Bureau, R; Rault, S; Auvray, P; Moslemi, S; Sourdaine, P; Séralini, G E

    2000-05-01

    We report herein the design and the synthesis of some aryl-substituted pyrrolizine and indolizine derivatives, on the basis of a hypothetical pharmacophore structure designed to fit the catalytic site of the human cytochrome P450 aromatase. The in vitro biological evaluation of these compounds allowed us to point out two new potent non-steroidal aromatase inhibitors, MR 20494 and MR 20492, with IC50 values in the range of 0.1 microM.

  10. Fatty acid synthase inhibitors induce apoptosis in non-tumorigenic melan-a cells associated with inhibition of mitochondrial respiration.

    PubMed

    Rossato, Franco A; Zecchin, Karina G; La Guardia, Paolo G; Ortega, Rose M; Alberici, Luciane C; Costa, Rute A P; Catharino, Rodrigo R; Graner, Edgard; Castilho, Roger F; Vercesi, Aníbal E

    2014-01-01

    The metabolic enzyme fatty acid synthase (FASN) is responsible for the endogenous synthesis of palmitate, a saturated long-chain fatty acid. In contrast to most normal tissues, a variety of human cancers overexpress FASN. One such cancer is cutaneous melanoma, in which the level of FASN expression is associated with tumor invasion and poor prognosis. We previously reported that two FASN inhibitors, cerulenin and orlistat, induce apoptosis in B16-F10 mouse melanoma cells via the intrinsic apoptosis pathway. Here, we investigated the effects of these inhibitors on non-tumorigenic melan-a cells. Cerulenin and orlistat treatments were found to induce apoptosis and decrease cell proliferation, in addition to inducing the release of mitochondrial cytochrome c and activating caspases-9 and -3. Transfection with FASN siRNA did not result in apoptosis. Mass spectrometry analysis demonstrated that treatment with the FASN inhibitors did not alter either the mitochondrial free fatty acid content or composition. This result suggests that cerulenin- and orlistat-induced apoptosis events are independent of FASN inhibition. Analysis of the energy-linked functions of melan-a mitochondria demonstrated the inhibition of respiration, followed by a significant decrease in mitochondrial membrane potential (ΔΨm) and the stimulation of superoxide anion generation. The inhibition of NADH-linked substrate oxidation was approximately 40% and 61% for cerulenin and orlistat treatments, respectively, and the inhibition of succinate oxidation was approximately 46% and 52%, respectively. In contrast, no significant inhibition occurred when respiration was supported by the complex IV substrate N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD). The protection conferred by the free radical scavenger N-acetyl-cysteine indicates that the FASN inhibitors induced apoptosis through an oxidative stress-associated mechanism. In combination, the present results demonstrate that cerulenin and orlistat induce

  11. Fatty Acid Synthase Inhibitors Induce Apoptosis in Non-Tumorigenic Melan-A Cells Associated with Inhibition of Mitochondrial Respiration

    PubMed Central

    Rossato, Franco A.; Zecchin, Karina G.; La Guardia, Paolo G.; Ortega, Rose M.; Alberici, Luciane C.; Costa, Rute A. P.; Catharino, Rodrigo R.; Graner, Edgard; Castilho, Roger F.; Vercesi, Aníbal E.

    2014-01-01

    The metabolic enzyme fatty acid synthase (FASN) is responsible for the endogenous synthesis of palmitate, a saturated long-chain fatty acid. In contrast to most normal tissues, a variety of human cancers overexpress FASN. One such cancer is cutaneous melanoma, in which the level of FASN expression is associated with tumor invasion and poor prognosis. We previously reported that two FASN inhibitors, cerulenin and orlistat, induce apoptosis in B16-F10 mouse melanoma cells via the intrinsic apoptosis pathway. Here, we investigated the effects of these inhibitors on non-tumorigenic melan-a cells. Cerulenin and orlistat treatments were found to induce apoptosis and decrease cell proliferation, in addition to inducing the release of mitochondrial cytochrome c and activating caspases-9 and -3. Transfection with FASN siRNA did not result in apoptosis. Mass spectrometry analysis demonstrated that treatment with the FASN inhibitors did not alter either the mitochondrial free fatty acid content or composition. This result suggests that cerulenin- and orlistat-induced apoptosis events are independent of FASN inhibition. Analysis of the energy-linked functions of melan-a mitochondria demonstrated the inhibition of respiration, followed by a significant decrease in mitochondrial membrane potential (ΔΨm) and the stimulation of superoxide anion generation. The inhibition of NADH-linked substrate oxidation was approximately 40% and 61% for cerulenin and orlistat treatments, respectively, and the inhibition of succinate oxidation was approximately 46% and 52%, respectively. In contrast, no significant inhibition occurred when respiration was supported by the complex IV substrate N,N,N′,N′-tetramethyl-p-phenylenediamine (TMPD). The protection conferred by the free radical scavenger N-acetyl-cysteine indicates that the FASN inhibitors induced apoptosis through an oxidative stress-associated mechanism. In combination, the present results demonstrate that cerulenin and orlistat

  12. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  13. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  14. Structure-activity relationship of caffeic acid phenethyl ester analogs as new 5-lipoxygenase inhibitors.

    PubMed

    Doiron, Jérémie A; Leblanc, Luc M; Hébert, Martin J G; Levesque, Natalie A; Paré, Aurélie F; Jean-François, Jacques; Cormier, Marc; Surette, Marc E; Touaibia, Mohamed

    2016-09-26

    Leukotrienes (LTs) are a class of lipid mediators implicated in numerous inflammatory disorders. Caffeic acid phenethyl ester (CAPE) possesses potent anti-LTs activity through the inhibition of 5-lipoxygenase (5-LO), the key enzyme in the biosynthesis of LTs. In this study, we describe the design and synthesis of CAPE analogs as radical scavengers and 5-LO inhibitors. Caffeic esters bearing propargyl and allyl linkers between the caffeoyl and aryl moieties (4a-i and 5a-i, respectively) were synthesized by Sonogashira and Heck cross-coupling reactions to probe the effects of flexibility and aryl substitution on 5-LO inhibition. Caffeoyl alcohol and ethers (6, 7a-b) as well as caffeoyl aldehyde and ketones (8a-e) were synthesized to elucidate the importance of the ester linkage for inhibitory activity. All tested compounds proved to be good radical scavengers (IC50 of 10-30 μm). After preliminary anti-LTs activity screening in HEK293 cell models, 5-LO inhibition potential of selected compounds was determined in human polymorphonuclear leukocytes (PMNL). Most screened compounds outperformed CAPE 3 in concentration-dependent assays on PMNL, with ester dimers 4i and 5i along with caffeoyl ethers 7a-b being roughly eight-, seven-, and 16-fold more potent than Zileuton, with IC50 values of 0.36, 0.43, and 0.18 μm, respectively.

  15. Exploring the potential of boronic acids as inhibitors of OXA-24/40 β-lactamase.

    PubMed

    Werner, Josephine P; Mitchell, Joshua M; Taracila, Magdalena A; Bonomo, Robert A; Powers, Rachel A

    2017-03-01

    β-lactam antibiotics are crucial to the management of bacterial infections in the medical community. Due to overuse and misuse, clinically significant bacteria are now resistant to many commercially available antibiotics. The most widespread resistance mechanism to β-lactams is the expression of β-lactamase enzymes. To overcome β-lactamase mediated resistance, inhibitors were designed to inactivate these enzymes. However, current inhibitors (clavulanic acid, tazobactam, and sulbactam) for β-lactamases also contain the characteristic β-lactam ring, making them susceptible to resistance mechanisms employed by bacteria. This presents a critical need for novel, non-β-lactam inhibitors that can circumvent these resistance mechanisms. The carbapenem-hydrolyzing class D β-lactamases (CHDLs) are of particular concern, given that they efficiently hydrolyze potent carbapenem antibiotics. Unfortunately, these enzymes are not inhibited by clinically available β-lactamase inhibitors, nor are they effectively inhibited by the newest, non-β-lactam inhibitor, avibactam. Boronic acids are known transition state analog inhibitors of class A and C β-lactamases, and are not extensively characterized as inhibitors of class D β-lactamases. Importantly, boronic acids provide a novel way to potentially inhibit class D β-lactamases. Sixteen boronic acids were selected and tested for inhibition of the CHDL OXA-24/40. Several compounds were identified as effective inhibitors of OXA-24/40, with Ki values as low as 5 μM. The X-ray crystal structures of OXA-24/40 in complex with BA3, BA4, BA8, and BA16 were determined and revealed the importance of interactions with hydrophobic residues Tyr112 and Trp115. These boronic acids serve as progenitors in optimization efforts of a novel series of inhibitors for class D β-lactamases.

  16. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  17. Effects of inhibitors of key enzymes of sphingolipid metabolism on insulin-induced glucose uptake and glycogen synthesis in liver cells of old rats.

    PubMed

    Babenko, N A; Kharchenko, V S

    2015-01-01

    Sphingolipids play an important role in the development of insulin resistance. Ceramides are the most potent inhibitors of insulin signal transduction. Ceramides are generated in response to stress stimuli and in old age. In this work, we studied the possible contribution of different pathways of sphingolipid metabolism in age-dependent insulin resistance development in liver cells. Inhibition of key enzymes of sphingolipid synthesis (serine palmitoyl transferase, ceramide synthase) and degradation (neutral and acidic SMases) by means of specific inhibitors (myriocin, fumonisin B1, imipramine, and GW4869) was followed with the reduction of ceramide level and partly improved insulin regulation of glucose metabolism in "old" hepatocytes. Imipramine and GW4869 decreased significantly the acidic and neutral SMase activities, respectively. Treatment of "old" cells with myriocin or fumonisin B1 reduced the elevated in old age ceramide and SM synthesis. Ceramide and SM levels and glucose metabolism regulation by insulin could be improved with concerted action of all tested inhibitors of sphingolipid turnover on hepatocytes. The data demonstrate that not only newly synthesized ceramide and SM but also neutral and acidic SMase-dependent ceramide accumulation plays an important role in development of age-dependent insulin resistance.

  18. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  19. Synthesis of antimicrobial glucosamides as bacterial quorum sensing mechanism inhibitors.

    PubMed

    Biswas, Nripendra N; Yu, Tsz Tin; Kimyon, Önder; Nizalapur, Shashidhar; Gardner, Christopher R; Manefield, Mike; Griffith, Renate; Black, David StC; Kumar, Naresh

    2017-02-01

    Bacteria communicate with one another and regulate their pathogenicity through a phenomenon known as quorum sensing (QS). When the bacterial colony reaches a threshold density, the QS system induces the production of virulence factors and the formation of biofilms, a powerful defence system against the host's immune responses. The glucosamine monomer has been shown to disrupt the bacterial QS system by inhibiting autoinducer (AI) signalling molecules such as the acyl-homoserine lactones (AHLs). In this study, the synthesis of acetoxy-glucosamides 8, hydroxy-glucosamides 9 and 3-oxo-glucosamides 12 was performed via the 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC·HCl) and N,N'-dicyclohexylcarbodiimide (DCC) coupling methods. All of the synthesized compounds were tested against two bacterial strains, P. aeruginosa MH602 (LasI/R-type QS) and E. coli MT102 (LuxI/R-type QS), for QS inhibitory activity. The most active compound 9b showed 79.1% QS inhibition against P. aeruginosa MH602 and 98.4% against E. coli MT102, while compound 12b showed 64.5% inhibition against P. aeruginosa MH602 and 88.1% against E. coli MT102 strain at 2mM concentration. The ability of the compounds to inhibit the production of the virulence factor pyocyanin and biofilm formation in the P. aeruginosa (PA14) strain was also examined. Finally, computational docking studies were performed with the LasR receptor protein.

  20. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  1. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  2. Effect of a cyclooxygenase-2 inhibitor on postexercise muscle protein synthesis in humans

    PubMed Central

    Burd, Nicholas A.; Dickinson, Jared M.; LeMoine, Jennifer K.; Carroll, Chad C.; Sullivan, Bridget E.; Haus, Jacob M.; Jemiolo, Bozena; Trappe, Scott W.; Hughes, Gordon M.; Sanders, Charles E.

    2010-01-01

    Nonselective blockade of the cyclooxygenase (COX) enzymes in skeletal muscle eliminates the normal increase in muscle protein synthesis following resistance exercise. The current study tested the hypothesis that this COX-mediated increase in postexercise muscle protein synthesis is regulated specifically by the COX-2 isoform. Sixteen males (23 ± 1 yr) were randomly assigned to one of two groups that received three doses of either a selective COX-2 inhibitor (celecoxib; 200 mg/dose, 600 mg total) or a placebo in double-blind fashion during the 24 h following a single bout of knee extensor resistance exercise. At rest and 24 h postexercise, skeletal muscle protein fractional synthesis rate (FSR) was measured using a primed constant infusion of [2H5]phenylalanine coupled with muscle biopsies of the vastus lateralis, and measurements were made of mRNA and protein expression of COX-1 and COX-2. Mixed muscle protein FSR in response to exercise (P < 0.05) was not suppressed by the COX-2 inhibitor (0.056 ± 0.004 to 0.108 ± 0.014%/h) compared with placebo (0.074 ± 0.004 to 0.091 ± 0.005%/h), nor was there any difference (P > 0.05) between the placebo and COX-2 inhibitor postexercise when controlling for resting FSR. The COX-2 inhibitor did not influence COX-1 mRNA, COX-1 protein, or COX-2 protein levels, whereas it did increase (P < 0.05) COX-2 mRNA (3.0 ± 0.9-fold) compared with placebo (1.3 ± 0.3-fold). It appears that the elimination of the postexercise muscle protein synthesis response by nonselective COX inhibitors is not solely due to COX-2 isoform blockade. Furthermore, the current data suggest that the COX-1 enzyme is likely the main isoform responsible for the COX-mediated increase in muscle protein synthesis following resistance exercise in humans. PMID:19934404

  3. Inhibitor of DNA synthesis is present in normal chicken serum

    SciTech Connect

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-03-05

    The authors have found that heat-inactivated serum (57/sup 0/C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in /sup 3/H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of /sup 3/H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both /sup 3/H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines.

  4. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  5. Synthesis of selective inhibitors against V. cholerae sialidase and human cytosolic sialidase NEU2.

    PubMed

    Khedri, Zahra; Li, Yanhong; Cao, Hongzhi; Qu, Jingyao; Yu, Hai; Muthana, Musleh M; Chen, Xi

    2012-08-14

    Sialidases or neuraminidases catalyze the hydrolysis of terminal sialic acid residues from sialyl oligosaccharides and glycoconjugates. Despite successes in developing potent inhibitors specifically against influenza virus neuraminidases, the progress in designing and synthesizing selective inhibitors against bacterial and human sialidases has been slow. Guided by sialidase substrate specificity studies and sialidase crystal structural analysis, a number of 2-deoxy-2,3-dehydro-N-acetylneuraminic acid (DANA or Neu5Ac2en) analogues with modifications at C9 or at both C5 and C9 were synthesized. Inhibition studies of various bacterial sialidases and human cytosolic sialidase NEU2 revealed that Neu5Gc9N(3)2en and Neu5AcN(3)9N(3)2en are selective inhibitors against V. cholerae sialidase and human NEU2, respectively.

  6. Design and Synthesis of Phenylpyrrolidine Phenylglycinamides As Highly Potent and Selective TF-FVIIa Inhibitors

    PubMed Central

    2013-01-01

    Inhibitors of the Tissue Factor/Factor VIIa (TF-FVIIa) complex are promising novel anticoagulants that show excellent efficacy and minimal bleeding in preclinical models. On the basis of a zwitterionic phenylglycine acylsulfonamide 1, a phenylglycine benzylamide 2 was shown to possess improved permeability and oral bioavailability. Optimization of the benzylamide, guided by X-ray crystallography, led to a potent TF-FVIIa inhibitor 18i with promising oral bioavailability, but promiscuous activity in an in vitro safety panel of receptors and enzymes. Introducing an acid on the pyrrolidine ring, guided by molecular modeling, resulted in highly potent, selective, and efficacious TF-FVIIa inhibitors with clean in vitro safety profile. The pyrrolidine acid 20 showed a moderate clearance, low volume of distribution, and a short t1/2 in dog PK studies. PMID:24900796

  7. Caffeoylglycolic and caffeoylamino acid derivatives, halfmers of L-chicoric acid, as new HIV-1 integrase inhibitors.

    PubMed

    Lee, Seung Uk; Shin, Cha-Gyun; Lee, Chong-Kyo; Lee, Yong Sup

    2007-10-01

    Human immunodeficiency virus (HIV) integrase (IN) catalyzes the integration of HIV DNA copy into the host cell DNA. L-Chicoric acid (1) has been found to be one of the most potent HIV-1 integrase inhibitor. Caffeoylglycolic and caffeoylamino acid derivatives' halfmeric structures of L-chicoric acid 2 were synthesized for the purpose of simplifying the structure of L-chicoric acid. Among synthesized, compounds 2c and 3f showed HIV-1 IN inhibitory activities with IC(50) values of 10.5 and 12.0 microM, respectively, comparable to that of parent compound L-chicoric acid (IC(50)=15.7 microM).

  8. COMPARATIVE PATHOGENESIS OF HALOACETIC ACID AND PROTEIN KINASE INHIBITOR EMBRYOTOXICITY IN MOUSE WHOLE EMBRYO CULTURE

    EPA Science Inventory

    Comparative pathogenesis of haloacetic acid and protein kinase inhibitor embryotoxicity in mouse whole embryo culture.

    Ward KW, Rogers EH, Hunter ES 3rd.

    Curriculum in Toxicology, University of North Carolina at Chapel Hill, 27599-7270, USA.

    Haloacetic acids ...

  9. Synthesis of PSA Inhibitors as SPECT- and PET-Based Imaging Agents for Prostate Cancer

    DTIC Science & Technology

    2011-06-01

    for their ability to inhibit PSA and chymotrypsin. 15. SUBJECT TERMS Prostate cancer , PSA inhibitors, boronic acids, peptidomimetics, serine protease...prostate cancer . First, all men undergoing androgen ablation, eventually relapse and no longer respond to hormone treatment . Therefore, there is an...Imaging Agents for Prostate Cancer PRINCIPAL INVESTIGATOR: Maya Kostova, Ph.D. CONTRACTING ORGANIZATION: Johns Hopkins University

  10. Synthesis, kinetic mechanism and docking studies of vanillin derivatives as inhibitors of mushroom tyrosinase.

    PubMed

    Ashraf, Zaman; Rafiq, Muhammad; Seo, Sung-Yum; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf

    2015-09-01

    The purpose of the present study was to discover the extent of contribution to antityrosinase activity by adding hydroxy substituted benzoic acid, cinnamic acid and piperazine residues to vanillin. The study showed the transformation of vanillin into esters as shown in (4a-4d), (6a-6b), and (8a-8b). In addition, the relationship between structures of these esters and their mushroom tyrosinase inhibitory activity was explored. The kinetics of inhibition on mushroom tyrosinase by these esters was also investigated. It was found that hydroxyl substituted benzoic acid derivatives were weak inhibitors; however hydroxy or chloro substituted cinnamic acid and piperazine substituted derivatives were able to induce significant tyrosinase inhibition. The mushroom tyrosinase (PDBID 2ZWE) was docked with synthesized vanillin derivatives and their calculated binding energies were compared with experimental IC50 values which provided positive correlation. The most potent derivative 2-(4-formyl-2-methoxyphenoxy)-2-oxoethyl (2E)-3-(4-hydroxyphenyl)prop-2-enoate (6a) possesses hydroxy substituted cinnamic acid scaffold having IC50 value 16.13 μM with binding energy of -7.2 kcal/mol. The tyrosinase inhibitory activity of (6a) is comparable with standard kojic acid. Kinetic analysis indicated that compound 6a was mixed-type tyrosinase inhibitor with inhibition constant values Ki (13 μM) and Ki' (53 μM) and formed reversible enzyme inhibitor complex. The active vanillin analog (6a) was devoid of toxic effects as shown in cytotoxic studies.

  11. Review of synthesis, biological assay and QSAR studies of β-secretase inhibitors.

    PubMed

    Niño, Helena; García-Pintos, Isela; Rodríguez-Borges, José E; Escobar-Cubiella, Manolo; García-Mera, Xerardo; Prado-Prado, Francisco

    2011-12-01

    Alzheimer's disease (AD) is highly complex. While several pathologies characterize this disease, amyloid plaques, composed of the β-amyloid peptide, are hallmark neuropathological lesions in Alzheimer's disease brain. Indeed, a wealth of evidence suggests that β-amyloid is central to the pathophysiology of AD and is likely to play an early role in this intractable neurodegenerative disorder. The BACE-1 enzyme is essential for the generation of β-amyloid. BACE-1 knockout mice do not produce β-amyloid and are free from Alzheimer's associated pathologies, including neuronal loss and certain memory deficits. The fact that BACE-1 initiates the formation of β-amyloid, and the observation that BACE-1 levels are elevated in this disease provide direct and compelling reasons to develop therapies directed at BACE-1 inhibition, thus reducing β-amyloid and its associated toxicities. In this sense, quantitative structure-activity relationships (QSAR) could play an important role in studying these β-secretase inhibitors. QSAR models are necessary in order to guide the β-secretase synthesis. This work is aimed at reviewing different design and synthesis and computational studies for a very large and heterogeneous series of β-secretase inhibitors. First, we review design, synthesis, and Biological assay of β-secretase inhibitors. Next, we review 2D QSAR, 3D QSAR, CoMFA, CoMSIA and Docking with different compounds to find out the structural requirements. Next, we review QSAR studies using the method of Linear Discriminant Analysis (LDA) in order to understand the essential structural requirement for receptor binding for β- secretase inhibitors.

  12. Engineering methylaspartate ammonia lyase for the asymmetric synthesis of unnatural amino acids

    NASA Astrophysics Data System (ADS)

    Raj, Hans; Szymański, Wiktor; de Villiers, Jandré; Rozeboom, Henriëtte J.; Veetil, Vinod Puthan; Reis, Carlos R.; de Villiers, Marianne; Dekker, Frank J.; de Wildeman, Stefaan; Quax, Wim J.; Thunnissen, Andy-Mark W. H.; Feringa, Ben L.; Janssen, Dick B.; Poelarends, Gerrit J.

    2012-06-01

    The redesign of enzymes to produce catalysts for a predefined transformation remains a major challenge in protein engineering. Here, we describe the structure-based engineering of methylaspartate ammonia lyase (which in nature catalyses the conversion of 3-methylaspartate to ammonia and 2-methylfumarate) to accept a variety of substituted amines and fumarates and catalyse the asymmetric synthesis of aspartic acid derivatives. We obtained two single-active-site mutants, one exhibiting a wide nucleophile scope including structurally diverse linear and cyclic alkylamines and one with broad electrophile scope including fumarate derivatives with alkyl, aryl, alkoxy, aryloxy, alkylthio and arylthio substituents at the C2 position. Both mutants have an enlarged active site that accommodates the new substrates while retaining the high stereo- and regioselectivity of the wild-type enzyme. As an example, we demonstrate a highly enantio- and diastereoselective synthesis of threo-3-benzyloxyaspartate (an important inhibitor of neuronal excitatory glutamate transporters in the brain).

  13. Discovery of pyrazole carboxylic acids as potent inhibitors of rat long chain L-2-hydroxy acid oxidase.

    PubMed

    Barawkar, Dinesh A; Bandyopadhyay, Anish; Deshpande, Anil; Koul, Summon; Kandalkar, Sachin; Patil, Pradeep; Khose, Goraksha; Vyas, Samir; Mone, Mahesh; Bhosale, Shubhangi; Singh, Umesh; De, Siddhartha; Meru, Ashwin; Gundu, Jayasagar; Chugh, Anita; Palle, Venkata P; Mookhtiar, Kasim A; Vacca, Joseph P; Chakravarty, Prasun K; Nargund, Ravi P; Wright, Samuel D; Roy, Sophie; Graziano, Michael P; Cully, Doris; Cai, Tian-Quan; Singh, Sheo B

    2012-07-01

    Long chain L-2-hydroxy acid oxidase 2 (Hao2) is a peroxisomal enzyme expressed in the kidney and the liver. Hao2 was identified as a candidate gene for blood pressure (BP) quantitative trait locus (QTL) but the identity of its physiological substrate and its role in vivo remains largely unknown. To define a pharmacological role of this gene product, we report the development of selective inhibitors of Hao2. We identified pyrazole carboxylic acid hits 1 and 2 from screening of a compound library. Lead optimization of these hits led to the discovery of 15-XV and 15-XXXII as potent and selective inhibitors of rat Hao2. This report details the structure activity relationship of the pyrazole carboxylic acids as specific inhibitors of Hao2.

  14. 4-Quinolone-3-carboxylic acids as cell-permeable inhibitors of protein tyrosine phosphatase 1B.

    PubMed

    Zhi, Ying; Gao, Li-Xin; Jin, Yi; Tang, Chun-Lan; Li, Jing-Ya; Li, Jia; Long, Ya-Qiu

    2014-07-15

    Protein tyrosine phosphatase 1B is a negative regulator in the insulin and leptin signaling pathways, and has emerged as an attractive target for the treatment of type 2 diabetes and obesity. However, the essential pharmacophore of charged phosphotyrosine or its mimetic confer low selectivity and poor cell permeability. Starting from our previously reported aryl diketoacid-based PTP1B inhibitors, a drug-like scaffold of 4-quinolone-3-carboxylic acid was introduced for the first time as a novel surrogate of phosphotyrosine. An optimal combination of hydrophobic groups installed at C-6, N-1 and C-3 positions of the quinolone motif afforded potent PTP1B inhibitors with low micromolar IC50 values. These 4-quinolone-3-carboxylate based PTP1B inhibitors displayed a 2-10 fold selectivity over a panel of PTP's. Furthermore, the bidentate inhibitors of 4-quinolone-3-carboxylic acids conjugated with aryl diketoacid or salicylic acid were cell permeable and enhanced insulin signaling in CHO/hIR cells. The kinetic studies and molecular modeling suggest that the 4-quinolone-3-carboxylates act as competitive inhibitors by binding to the PTP1B active site in the WPD loop closed conformation. Taken together, our study shows that the 4-quinolone-3-carboxylic acid derivatives exhibit improved pharmacological properties over previously described PTB1B inhibitors and warrant further preclinical studies.

  15. Cholesterol synthesis inhibitors protect against platelet-activating factor-induced neuronal damage

    PubMed Central

    Bate, Clive; Rumbold, Louis; Williams, Alun

    2007-01-01

    Background Platelet-activating factor (PAF) is implicated in the neuronal damage that accompanies ischemia, prion disease and Alzheimer's disease (AD). Since some epidemiological studies demonstrate that statins, drugs that reduce cholesterol synthesis, have a beneficial effect on mild AD, we examined the effects of two cholesterol synthesis inhibitors on neuronal responses to PAF. Methods Primary cortical neurons were treated with cholesterol synthesis inhibitors (simvastatin or squalestatin) prior to incubation with different neurotoxins. The effects of these drugs on neuronal cholesterol levels and neuronal survival were measured. Immunoblots were used to determine the effects of simvastatin or squalestatin on the distribution of the PAF receptor and an enzyme linked immunoassay was used to quantify the amounts of PAF receptor. Results PAF killed primary neurons in a dose-dependent manner. Pre-treatment with simvastatin or squalestatin reduced neuronal cholesterol and increased the survival of PAF-treated neurons. Neuronal survival was increased 50% by 100 nM simvastatin, or 20 nM squalestatin. The addition of mevalonate restored cholesterol levels, and reversed the protective effect of simvastatin. Simvastatin or squalestatin did not affect the amounts of the PAF receptor but did cause it to disperse from within lipid rafts. Conclusion Treatment of neurons with cholesterol synthesis inhibitors including simvastatin and squalestatin protected neurons against PAF. Treatment caused a percentage of the PAF receptors to disperse from cholesterol-sensitive domains. These results raise the possibility that the effects of statins on neurodegenerative disease are, at least in part, due to desensitisation of neurons to PAF. PMID:17233902

  16. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  17. 2-aminohydroxamic acid derivatives as inhibitors of Bacillus cereus phosphatidylcholine preferred phospholipase C PC-PLC(Bc).

    PubMed

    González-Bulnes, Patricia; González-Roura, Albert; Canals, Daniel; Delgado, Antonio; Casas, Josefina; Llebaria, Amadeu

    2010-12-15

    Phosphatidylcholine preferring phospholipase C (PC-PLC) is an important enzyme that plays a key role in a variety of cellular events and lipid homoeostases. Bacillus cereus phospholipase C (PC-PLC(Bc)) has antigenic similarity with the elusive mammalian PC-PLC, which has not thus far been isolated and purified. Therefore the discovery of inhibitors of PC-PLC(Bc) is of current interest. Here, we describe the synthesis and biological evaluation of a new type of compounds inhibiting PC-PLC(Bc). These compounds have been designed by evolution of previously described 2-aminohydroxamic acid PC-PLC(Bc) inhibitors that block the enzyme by coordination of the zinc active site atoms present in PC-PLC(Bc) [Gonzalez-Roura, A.; Navarro, I.; Delgado, A.; Llebaria, A.; Casas, J. Angew. Chem. Int. Ed.2004, 43, 862]. The new compounds maintain the zinc coordinating groups and possess an extra trimethylammonium function, linked to the hydroxyamide nitrogen by an alkyl chain, which is expected to mimic the trimethylammonium group of the phosphatidylcholine PC-PLC(Bc) substrates. Some of the compounds described inhibit the enzyme with IC(50)'s in the low micromolar range. Unexpectedly, the most potent inhibitors found are those that possess a trimethylammonium group but have chemically blocked the zinc coordinating functionalities. The results obtained suggest that PC-PLC(Bc) inhibition is not due to the interaction of compounds with the phospholipase catalytic zinc atoms, but rather results from the inhibitor cationic group recognition by the PC-PLC(Bc) amino acids involved in choline lipid binding.

  18. Snake venoms. The amino-acid sequence of trypsin inhibitor E of Dendroaspis polylepis polylepis (Black Mamba) venom.

    PubMed

    Joubert, F J; Strydom, D J

    1978-06-01

    Trypsin inhibitor E from black mamba venom comprises 59 amino acid residues in a single polypeptide chain, cross-linked by three intrachain disulphide bridges. The complete primary structure of inhibitor E was elucidated. The sequence is homologous with trypsin inhibitors from different sources. Unique among this homologous series of proteinase inhibitors, inhibitor E has an affinity for transition metal ions, exemplified here by Cu2 and Co2+.

  19. Inhibitors of Fatty Acid Amide Hydrolase and Monoacylglycerol Lipase: New Targets for Future Antidepressants

    PubMed Central

    Ogawa, Shintaro; Kunugi, Hiroshi

    2015-01-01

    Cannabis and analogs of Δ9-tetrahydrocannabinol have been used for therapeutic purposes, but their therapeutic use remains limited because of various adverse effects. Endogenous cannabinoids have been discovered, and dysregulation of endocannabinoid signaling is implicated in the pathophysiology of major depressive disorder (MDD). Recently, endocannabinoid hydrolytic enzymes such as fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL) have become new therapeutic targets in the treatment of MDD. Several FAAH or MAGL inhibitors are reported to have no cannabimimetic side effects and, therefore, are new potential therapeutic options for patients with MDD who are resistant to first-line antidepressants (selective serotonin and serotonin-norepinephrine reuptake inhibitors). In this review, we focus on the possible relationships between MDD and the endocannabinoid system as well as the inhibitors’ therapeutic potential. MAGL inhibitors may reduce inflammatory responses through activation of cannabinoid receptor type 2. In the hypothalamic–pituitary–adrenal axis, repeated FAAH inhibitor administration may be beneficial for reducing circulating glucocorticoid levels. Both FAAH and MAGL inhibitors may contribute to dopaminergic system regulation. Recently, several new inhibitors have been developed with strong potency and selectivity. FAAH inhibitor, MAGL inhibitor, or dual blocker use would be promising new treatments for MDD. Further pre-clinical studies and clinical trials using these inhibitors are warranted. PMID:26630956

  20. Technical note: Tall oil fatty acid anhydrides as corrosion inhibitor intermediates

    SciTech Connect

    Fischer, E.R.; Parker, J.E. III

    1997-01-01

    Anhydrides derived from tall oil fatty acids offer enhanced corrosion inhibition properties compared to traditional dimer/trimer acids. The chemistry of this intermediate, its use in corrosion inhibition for downhole applications, and the synthesis of novel oil- and water-soluble derivatives were studied.

  1. Lichen secondary metabolite evernic acid as potential quorum sensing inhibitor against Pseudomonas aeruginosa.

    PubMed

    Gökalsın, Barış; Sesal, Nüzhet Cenk

    2016-09-01

    Cystic Fibrosis is a genetic disease and it affects the respiratory and digestive systems. Pseudomonas aeruginosa infections in Cystic Fibrosis are presented as the main cause for high mortality and morbidity rates. Pseudomonas aeruginosa populations can regulate their virulence gene expressions via the bacterial communication system: quorum sensing. Inhibition of quorum sensing by employing quorum sensing inhibitors can leave the bacteria vulnerable. Therefore, determining natural sources to obtain potential quorum sensing inhibitors is essential. Lichens have ethnobotanical value for their medicinal properties and it is possible that their secondary metabolites have quorum sensing inhibitor properties. This study aims to investigate an alternative treatment approach by utilizing lichen secondary metabolite evernic acid to reduce the expressions of Pseudomonas aeruginosa virulence factors by inhibiting quorum sensing. For this purpose, fluorescent monitor strains were utilized for quorum sensing inhibitor screens and quantitative reverse-transcriptase PCR analyses were conducted for comparison. Results indicate that evernic acid is capable of inhibiting Pseudomonas aeruginosa quorum sensing systems.

  2. Chitosan as a green inhibitor for copper corrosion in acidic medium.

    PubMed

    El-Haddad, Mahmoud N

    2013-04-01

    The behavior of copper in 0.5 M HCl acid containing different concentrations of chitosan has been studied by weight loss, potentiodynamic polarization, electrochemical impedance spectroscopy (EIS) and electrochemical frequency modulation (EFM) measurements. Potentiodynamic polarization measurements show that the chitosan acts essentially as a mixed-type inhibitor. EFM can be used as a rapid and non destructive technique for corrosion rate measurements without prior knowledge of Tafel constants. The results of EIS indicate that the value of CPEs tends to decrease and both charge transfer resistance and inhibition efficiency tend to increase by increasing the inhibitor concentration. The investigated inhibitor has shown good inhibition efficiency in 0.5 M HCl. The adsorption of inhibitor on the copper surface obeys Langmuir's isotherm. Metal surface characterization was performed using scanning electron microscope (SEM) and Fourier transform infrared spectroscopy (FT-IR). Also, the relationship between quantum chemical calculations and experimental inhibition efficiency of the inhibitor was discussed.

  3. Identification of small molecule sulfonic acids as ecto-5'-Nucleotidase inhibitors.

    PubMed

    Raza, Rabia; Saeed, Aamer; Lecka, Joanna; Sévigny, Jean; Iqbal, Jamshed

    2012-11-01

    Ecto-5'-Nucleotidase inhibitors have great potential as anti-tumor agents. We have investigated biochemical properties of human and rat ecto-5'-Nucleotidases and characterized 19 small molecule sulfonic acid derivatives as potential inhibitors of ecto-5'-Nucleotidases. We identified 11 potent inhibitors of human and rat ecto-5'-Nucleotidases and checked their selectivity. Compound 10 (Sodium 2,4-dinitrobenzenesulfonate) with K(i) value of 0.66 μM and 19 (N-(4-sulfamoylphenylcarbamothioyl) pivalamide) with K(i) value of 0.78 μM were identified as the most potent inhibitors for human and rat ecto-5'-Nucleotidase, respectively. The present compounds have low molecular weights, water solubility and equal potency as compared to the reported inhibitors.

  4. A Two-Step Synthesis of Virstatin, a Virulence Inhibitor of "Vibrio cholerae"

    ERIC Educational Resources Information Center

    McDonald, Chriss E.

    2009-01-01

    Virstatin, an "N"-butanoic acid substituted naphthalimide, inhibits the ability of "Vibrio cholerae" to cause disease. A three-week experiment involving synthesis, purification, and spectral characterization of this compound is described. This experiment is appropriate for organic chemistry. It has been performed with three lab sections of about…

  5. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  6. The identification of translesion DNA synthesis regulators: inhibitors in the spotlight

    PubMed Central

    Bertolin, AP; Mansilla, SF; Gottifredi, V

    2015-01-01

    Over the past half-century, we have become increasingly aware of the ubiquity of DNA damage. Under the constant exposure to exogenous and endogenous genomic stress, cells must attempt to replicate damaged DNA. The encounter of replication forks with DNA lesions triggers several cellular responses, including the activation of translesion DNA synthesis (TLS), which largely depends upon specialized DNA polymerases with flexible active sites capable of accommodating bulky DNA lesions. A detrimental aspect of TLS is its intrinsic mutagenic nature, and thus the activity of the TLS polymerases must ideally be restricted to synthesis on damaged DNA templates. Despite their potential clinical importance in chemotherapy, TLS inhibitors have been difficult to identify since a direct assay designed to quantify genomic TLS events is still unavailable. Herein we discuss the methods that have been used to validate TLS inhibitors such as USP1, p21 and Spartan, highlighting research that has revealed their contribution to the control of DNA synthesis on damaged and undamaged templates. PMID:26002196

  7. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  8. Naturally occurring conjugated octadecatrienoic acids are strong inhibitors of prostaglandin biosynthesis.

    PubMed

    Nugteren, D H; Christ-Hazelhof, E

    1987-03-01

    Fatty acids from natural sources (mostly seed oils) were isolated and assayed for their effect on the bioconversion of arachidonic acid into prostaglandin E2, using sheep vesicular gland microsomes. Homologues and isomers of the naturally occurring fatty acids, obtained by chemical modification and/or organic synthetic methods, were also tested. Two very active cyclooxygenase inhibitors were discovered, namely jacarandic acid (8Z, 10E, 12Z-octadecatrienoic acid), isolated from Jacaranda mimosifolia, the concentration which gives 50% inhibition ([I]50) being 2.4 microM and the synthetic 8Z, 10E, 12E-octadecatrienoic acid, having an [I]50 of 1.0 microM. Under the conditions of the assay (75 microM substrate), earlier described potent inhibitors showed the following [I]50's: indomethacin: 1.3 microM; 9,12-octadecadiynoic acid: 1.3 microM, 8Z, 12E, 14Z-eicosatrienoic acid: 2.7 microM; 5,8,11,14-eicosatetraynoic acid: 4.4 microM. At a concentration of about half that of the substrate, the following naturally occurring fatty acids revealed inhibition ([I]50): columbinic acid (29 microM), calendulic acid (31 microM), liagoric acid (31 microM), ximenynic acid (39 microM), crepenynic acid (40 microM) and timnodonic acid (43 microM). Other fatty acids, and some of the above acids, were converted themselves more or less rapidly, mostly into conjugated monohydroxy fatty acids.

  9. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  10. Steroid synthesis by Taenia crassiceps WFU cysticerci is regulated by enzyme inhibitors.

    PubMed

    Aceves-Ramos, A; Valdez, R A; Gaona, B; Willms, K; Romano, M C

    2013-07-01

    Cysticerci and tapeworms from Taenia crassiceps WFU, ORF and Taenia solium synthesize sex-steroid hormones in vitro. Corticosteroids increase the 17β-estradiol synthesis by T. crassiceps cysticerci. T. crassiceps WFU cysticerci synthesize corticosteroids, mainly 11-deoxycorticosterone (DOC). The aim of this work was to investigate whether classical steroidogenic inhibitors modify the capacity of T. crassiceps WFU cysticerci to synthesize corticosteroids and sex steroid hormones. For this purpose, T. crassiceps WFU cysticerci were obtained from the abdominal cavity of mice, pre-cultured for 24h in DMEM+antibiotics/antimycotics and cultured in the presence of tritiated progesterone ((3)H-P4), androstendione ((3)H-A4), or dehydroepiandrosterone ((3)H-DHEA) plus different doses of the corresponding inhibitors, for different periods. Blanks with the culture media adding the tritiated precursors were simultaneously incubated. At the end of the incubation period, parasites were separated and media extracted with ether. The resulting steroids were separated by thin layer chromatography (TLC). Data were expressed as percent transformation of the tritiated precursors. Results showed that after 2h of exposure of the cysticerci to 100 μM formestane, the (3)H-17β-estradiol synthesis from tritiated androstenedione was significantly inhibited. The incubation of cysticerci in the presence of (3)H-DHEA and danazol (100 nM) resulted in (3)H-androstenediol accumulation and a significant reduction of the 17β-estradiol synthesis. The cysticerci (3)H-DOC synthesis was significantly inhibited when the parasites were cultured in the presence of different ketoconazole dosis. The drug treatments did not affect parasite's viability. The results of this study showed that corticosteroid and sex steroid synthesis in T. crassiceps WFU cysticerci can be modified by steroidogenic enzyme inhibitors. As was shown previously by our laboratory and others, parasite survival and development depends

  11. Pyrazole phenylcyclohexylcarbamates as inhibitors of human fatty acid amide hydrolases (FAAH).

    PubMed

    Aghazadeh Tabrizi, Mojgan; Baraldi, Pier Giovanni; Ruggiero, Emanuela; Saponaro, Giulia; Baraldi, Stefania; Romagnoli, Romeo; Martinelli, Adriano; Tuccinardi, Tiziano

    2015-06-05

    Fatty acid amide hydrolase (FAAH) inhibitors have gained attention as potential therapeutic targets in the management of neuropathic pain. Here, we report a series of pyrazole phenylcyclohexylcarbamate derivatives standing on the known carbamoyl FAAH inhibitor URB597. Structural modifications led to the recognition of compound 22 that inhibited human recombinant FAAH (hrFAAH) in the low nanomolar range (IC50 = 11 nM). The most active compounds of this series showed significant selectivity toward monoacylglycerol lipase (MAGL) enzyme. In addition, molecular modeling and reversibility behavior of the new class of FAAH inhibitors are presented in this article.

  12. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  13. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  14. Design and synthesis of a series of serine derivatives as small molecule inhibitors of the SARS coronavirus 3CL protease.

    PubMed

    Konno, Hiroyuki; Wakabayashi, Masaki; Takanuma, Daiki; Saito, Yota; Akaji, Kenichi

    2016-03-15

    Synthesis of serine derivatives having the essential functional groups for the inhibitor of SARS 3CL protease and evaluation of their inhibitory activities using SARS 3CL R188I mutant protease are described. The lead compounds, functionalized serine derivatives, were designed based on the tetrapeptide aldehyde and Bai's cinnamoly inhibitor, and additionally performed with simulation on GOLD softwear. Structure activity relationship studies of the candidate compounds were given reasonable inhibitors ent-3 and ent-7k against SARS 3CL R188I mutant protease. These inhibitors showed protease selectivity and no cytotoxicity.

  15. Synthesis of the proteinase inhibitor LEKTI domain 6 by the fragment condensation method and regioselective disulfide bond formation.

    PubMed

    Vasileiou, Zoe; Barlos, Kostas K; Gatos, Dimitrios; Adermann, Knut; Deraison, Celine; Barlos, Kleomenis

    2010-01-01

    Proteinase inhibitors are of high pharmaceutical interest and are drug candidates for a variety of indications. Specific kallikrein inhibitors are important for their antitumor activity and their potential application to the treatment of skin diseases. In this study we describe the synthesis of domain 6 of the kallikrein inhibitor Lympho-Epithilial Kazal-Type Inhibitor (LEKTI) by the fragment condensation method and site-directed cystine bridge formation. To obtain the linear LEKTI precursor, the condensation was best performed in solution, coupling the protected fragment 1-22 to 23-68. This method yielded LEKTI domain 6 of high purity and equipotent to the recombinantly produced peptide.

  16. The Fatty Acid Synthase Inhibitor Platensimycin Improves Insulin Resistance without Inducing Liver Steatosis in Mice and Monkeys

    PubMed Central

    Nawrocki, Andrea R.; Zhou, Dan; Wu, Margaret; Previs, Stephen; Miller, Corey; Liu, Haiying; Hines, Catherine D. G.; Madeira, Maria; Cao, Jin; Herath, Kithsiri; Wang, Liangsu; Kelley, David E.; Li, Cai

    2016-01-01

    Objectives Platensimycin (PTM) is a natural antibiotic produced by Streptomyces platensis that selectively inhibits bacterial and mammalian fatty acid synthase (FAS) without affecting synthesis of other lipids. Recently, we reported that oral administration of PTM in mouse models (db/db and db/+) with high de novo lipogenesis (DNL) tone inhibited DNL and enhanced glucose oxidation, which in turn led to net reduction of liver triglycerides (TG), reduced ambient glucose, and improved insulin sensitivity. The present study was conducted to explore translatability and the therapeutic potential of FAS inhibition for the treatment of diabetes in humans. Methods We tested PTM in animal models with different DNL tones, i.e. intrinsic synthesis rates, which vary among species and are regulated by nutritional and disease states, and confirmed glucose-lowering efficacy of PTM in lean NHPs with quantitation of liver lipid by MRS imaging. To understand the direct effect of PTM on liver metabolism, we performed ex vivo liver perfusion study to compare FAS inhibitor and carnitine palmitoyltransferase 1 (CPT1) inhibitor. Results The efficacy of PTM is generally reproduced in preclinical models with DNL tones comparable to humans, including lean and established diet-induced obese (eDIO) mice as well as non-human primates (NHPs). Similar effects of PTM on DNL reduction were observed in lean and type 2 diabetic rhesus and lean cynomolgus monkeys after acute and chronic treatment of PTM. Mechanistically, PTM lowers plasma glucose in part by enhancing hepatic glucose uptake and glycolysis. Teglicar, a CPT1 inhibitor, has similar effects on glucose uptake and glycolysis. In sharp contrast, Teglicar but not PTM significantly increased hepatic TG production, thus caused liver steatosis in eDIO mice. Conclusions These findings demonstrate unique properties of PTM and provide proof-of-concept of FAS inhibition having potential utility for the treatment of diabetes and related metabolic

  17. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  18. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    DTIC Science & Technology

    2010-05-31

    targeting. Ursolic acid, a pentacyclic triterpenoid acid, as well as the tea polyphenols, epigallocatechin gallate (EGCG) and epicatechin gallate...glucose  utilization:  theory,  procedure,  and  normal  values  in  the  conscious  and  anesthetized  albino  rat. J Neurochem, 1977,  28(5), 897‐916

  19. Atorvastatin increases hepatic fatty acid beta-oxidation in sucrose-fed rats: comparison with an MTP inhibitor.

    PubMed

    Funatsu, Toshiyuki; Kakuta, Hirotoshi; Takasu, Toshiyuki; Miyata, Keiji

    2002-11-29

    We investigated the effects of atorvastatin, a widely used 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, and BMS-201038, a microsomal triglyceride transfer protein (MTP) inhibitor, in sucrose-fed hypertriglyceridemic rats to determine whether the activation of beta-oxidation by these compounds plays a role in their hypotriglyceridemic effect. The decrease in plasma triglyceride concentration and post-Triton very low-density lipoprotein (VLDL) triglyceride concentration, a measure of hepatic triglyceride secretion, by atorvastatin (30 mg/kg p.o.) for 2 weeks was to approximately the same degree as those by BMS-201038 (0.3 mg/kg). Atorvastatin (30 mg/kg) increased hepatic beta-oxidation activity by 54% (P < 0.01), while BMS-201038 (0.3 mg/kg) had no significant effect. Atorvastatin decreased hepatic triglyceride, fatty acid and cholesteryl ester concentrations by 21% to 39%, whereas BMS-201038 increased these variables by 28% to 307%. In the atorvastatin-treated groups, a significant relationship was seen not only between hepatic beta-oxidation activity and hepatic triglyceride concentration (R(2) = 0.535, P < 0.01), but also between hepatic and plasma triglyceride concentrations (R(2) = 0.586, P < 0.01). No effect of atorvastatin on hepatic fatty acid synthesis was observed. These results indicate that the activation of hepatic beta-oxidation by atorvastatin may contribute to the decrease in hepatic triglyceride concentration, leading to its hypotriglyceridemic effect.

  20. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  1. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    DTIC Science & Technology

    2011-05-01

    additional structural classes: benzimidazole-4,7-diones, benzo[d] oxazole -4,7-diones, quinoxaline-5,8-diones, quinoline-5,8-diones, benzo-1,2,4- triazine-6...developing six new ring systems (Figure 5, structures i–vi). Thus far we have made thio-substituted analogs of quinoline-5,8-diones (2i) and benzo[d] oxazole ...elaborated (Figure 5, panels A & B. As mentioned above, the synthesis of quinoline-5,8-diones (5i) and benzo[d] oxazole -4,7-diones (5ii) have been completed

  2. Design, synthesis, and 3D QSAR of novel potent and selective aromatase inhibitors.

    PubMed

    Leonetti, Francesco; Favia, Angelo; Rao, Angela; Aliano, Rosaria; Paluszcak, Anja; Hartmann, Rolf W; Carotti, Angelo

    2004-12-30

    The design, synthesis, and biological evaluation of a series of new aromatase inhibitors bearing an imidazole or triazole ring linked to a fluorene (A), indenodiazine (B), or coumarin scaffold (C) are reported. Properly substituted coumarin derivatives displayed the highest aromatase inhibitory potency and selectivity over 17-alpha-hydroxylase/17-20 lyase. The modeling of the aromatase inhibition data by Comparative Molecular Field Analysis (CoMFA/GOLPE 3D QSAR approach) led to the development of a PLS model with good fitting and predictive powers (n = 22, ONC = 3, r(2) = 0.949, s = 0.216, and q(2) = 0.715). The relationship between aromatase inhibition and the steric and electrostatic fields generated by the examined azole inhibitors enables a clear understanding of the nature and spatial location of the main interactions modulating the aromatase inhibitory potency.

  3. Synthesis and Evaluation of Quinazolines as Inhibitors of the Bacterial Cell Division Protein FtsZ.

    PubMed

    Nepomuceno, Gabriella M; Chan, Katie M; Huynh, Valerie; Martin, Kevin S; Moore, Jared T; O'Brien, Terrence E; Pollo, Luiz A E; Sarabia, Francisco J; Tadeus, Clarissa; Yao, Zi; Anderson, David E; Ames, James B; Shaw, Jared T

    2015-03-12

    The bacterial cell division protein FtsZ is one of many potential targets for the development of novel antibiotics. Recently, zantrin Z3 was shown to be a cross-species inhibitor of FtsZ; however, its specific interactions with the protein are still unknown. Herein we report the synthesis of analogues that contain a more tractable core structure and an analogue with single-digit micromolar inhibition of FtsZ's GTPase activity, which represents the most potent inhibitor of Escherichia coli FtsZ reported to date. In addition, the zantrin Z3 core has been converted to two potential photo-cross-linking reagents for proteomic studies that could shed light on the molecular interactions between FtsZ and molecules related to zantrin Z3.

  4. Synthesis of Novel Tricyclic Chromenone-Based Inhibitors of IRE-1 RNase Activity

    PubMed Central

    2015-01-01

    Inositol-requiring enzyme 1 (IRE-1) is a kinase/RNase ER stress sensor that is activated in response to excessive accumulation of unfolded proteins, hypoxic conditions, calcium imbalance, and other stress stimuli. Activation of IRE-1 RNase function exerts a cytoprotective effect and has been implicated in the progression of cancer via increased expression of the transcription factor XBP-1s. Here, we describe the synthesis and biological evaluation of novel chromenone-based covalent inhibitors of IRE-1. Preparation of a family of 8-formyltetrahydrochromeno[3,4-c]pyridines was achieved via a Duff formylation that is attended by an unusual cyclization reaction. Biological evaluation in vitro and in whole cells led to the identification of 30 as a potent inhibitor of IRE-1 RNase activity and XBP-1s expression in wild type B cells and human mantle cell lymphoma cell lines. PMID:24749861

  5. Synthesis and Evaluation of Quinazolines as Inhibitors of the Bacterial Cell Division Protein FtsZ

    PubMed Central

    2015-01-01

    The bacterial cell division protein FtsZ is one of many potential targets for the development of novel antibiotics. Recently, zantrin Z3 was shown to be a cross-species inhibitor of FtsZ; however, its specific interactions with the protein are still unknown. Herein we report the synthesis of analogues that contain a more tractable core structure and an analogue with single-digit micromolar inhibition of FtsZ’s GTPase activity, which represents the most potent inhibitor of Escherichia coli FtsZ reported to date. In addition, the zantrin Z3 core has been converted to two potential photo-cross-linking reagents for proteomic studies that could shed light on the molecular interactions between FtsZ and molecules related to zantrin Z3. PMID:25815151

  6. Identification of polymerase and processivity inhibitors of vaccinia DNA synthesis using a stepwise screening approach

    PubMed Central

    Silverman, Janice Elaine Y.; Ciustea, Mihai; Shudofsky, Abigail M. Druck; Bender, Florent; Shoemaker, Robert H.; Ricciardi, Robert P.

    2008-01-01

    Nearly all DNA polymerases require processivity factors to ensure continuous incorporation of nucleotides. Processivity factors are specific for their cognate DNA polymerases. For this reason, the vaccinia DNA polymerase (E9) and the proteins associated with processivity (A20 and D4) are excellent therapeutic targets. In this study, we show the utility of stepwise rapid plate assays that i) screen for compounds that block vaccinia DNA synthesis, ii) eliminate trivial inhibitors, e.g. DNA intercalators, and iii) distinguish whether inhibitors are specific for blocking DNA polymerase activity or processivity. The sequential plate screening of 2,222 compounds from the NCI Diversity Set library yielded a DNA polymerase inhibitor (NSC 55636) and a processivity inhibitor (NSC 123526) that were capable of reducing vaccinia viral plaques with minimal cellular cytotoxicity. These compounds are predicted to block cellular infection by the smallpox virus, variola, based on the very high sequence identity between A20, D4 and E9 of vaccinia and the corresponding proteins of variola. PMID:18621425

  7. Synthesis and characterization of potent inhibitors of Trypanosoma cruzi dihydrofolate reductase

    SciTech Connect

    Schormann, Norbert; Velu, Sadanandan E.; Murugesan, Srinivasan; Senkovich, Olga; Walker, Kiera; Chenna, Bala C.; Shinkre, Bidhan; Desai, Amar; Chattopadhyay, Debasish

    2010-09-17

    Dihydrofolate reductase (DHFR) of the parasite Trypanosoma cruzi (T. cruzi) is a potential target for developing drugs to treat Chagas disease. We have undertaken a detailed structure-activity study of this enzyme. We report here synthesis and characterization of six potent inhibitors of the parasitic enzyme. Inhibitory activity of each compound was determined against T. cruzi and human DHFR. One of these compounds, ethyl 4-(5-[(2,4-diamino-6-quinazolinyl)methyl]amino-2-methoxyphenoxy)butanoate (6b) was co-crystallized with the bifunctional dihydrofolate reductase-thymidylate synthase enzyme of T. cruzi and the crystal structure of the ternary enzyme:cofactor:inhibitor complex was determined. Molecular docking was used to analyze the potential interactions of all inhibitors with T. cruzi DHFR and human DHFR. Inhibitory activities of these compounds are discussed in the light of enzyme-ligand interactions. Binding affinities of each inhibitor for the respective enzymes were calculated based on the experimental or docked binding mode. An estimated 60-70% of the total binding energy is contributed by the 2,4-diaminoquinazoline scaffold.

  8. Phenotypic Screening Identifies Protein Synthesis Inhibitors as H-Ras-Nanocluster-Increasing Tumor Growth Inducers.

    PubMed

    Najumudeen, Arafath K; Posada, Itziar M D; Lectez, Benoit; Zhou, Yong; Landor, Sebastian K-J; Fallarero, Adyary; Vuorela, Pia; Hancock, John; Abankwa, Daniel

    2015-12-15

    Ras isoforms H-, N-, and K-ras are each mutated in specific cancer types at varying frequencies and have different activities in cell fate control. On the plasma membrane, Ras proteins are laterally segregated into isoform-specific nanoscale signaling hubs, termed nanoclusters. As Ras nanoclusters are required for Ras signaling, chemical modulators of nanoclusters represent ideal candidates for the specific modulation of Ras activity in cancer drug development. We therefore conducted a chemical screen with commercial and in-house natural product libraries using a cell-based H-ras-nanoclustering FRET assay. Next to established Ras inhibitors, such as a statin and farnesyl-transferase inhibitor, we surprisingly identified five protein synthesis inhibitors as positive regulators. Using commonly employed cycloheximide as a representative compound, we show that protein synthesis inhibition increased nanoclustering and effector recruitment specifically of active H-ras but not of K-ras. Consistent with these data, cycloheximide treatment activated both Erk and Akt kinases and specifically promoted H-rasG12V-induced, but not K-rasG12V-induced, PC12 cell differentiation. Intriguingly, cycloheximide increased the number of mammospheres, which are enriched for cancer stem cells. Depletion of H-ras in combination with cycloheximide significantly reduced mammosphere formation, suggesting an exquisite synthetic lethality. The potential of cycloheximide to promote tumor cell growth was also reflected in its ability to increase breast cancer cell tumors grown in ovo. These results illustrate the possibility of identifying Ras-isoform-specific modulators using nanocluster-directed screening. They also suggest an unexpected feedback from protein synthesis inhibition to Ras signaling, which might present a vulnerability in certain tumor cell types.

  9. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  10. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  11. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  12. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  13. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  14. The discovery of novel benzofuran-2-carboxylic acids as potent Pim-1 inhibitors.

    PubMed

    Xiang, Yibin; Hirth, Bradford; Asmussen, Gary; Biemann, Hans-Peter; Bishop, Kimberly A; Good, Andrew; Fitzgerald, Maria; Gladysheva, Tatiana; Jain, Annuradha; Jancsics, Katherine; Liu, Jinyu; Metz, Markus; Papoulis, Andrew; Skerlj, Renato; Stepp, J David; Wei, Ronnie R

    2011-05-15

    Novel benzofuran-2-carboxylic acids, exemplified by 29, 38 and 39, have been discovered as potent Pim-1 inhibitors using fragment based screening followed by X-ray structure guided medicinal chemistry optimization. The compounds demonstrate potent inhibition against Pim-1 and Pim-2 in enzyme assays. Compound 29 has been tested in the Ambit 442 kinase panel and demonstrates good selectivity for the Pim kinase family. X-ray structures of the inhibitor/Pim-1 binding complex reveal important salt-bridge and hydrogen bond interactions mediated by the compound's carboxylic acid and amino groups.

  15. Microwave assisted organic synthesis (MAOS) of small molecules as potential HIV-1 integrase inhibitors.

    PubMed

    Ferro, Stefania; Grazia, Sara De; De Luca, Laura; Gitto, Rosaria; Faliti, Caterina Elisa; Debyzer, Zeger; Chimirri, Alba

    2011-08-11

    Integrase (IN) represents a clinically validated target for the development of antivirals against human immunodeficiency virus (HIV). In recent years our research group has been engaged in the stucture-function study of this enzyme and in the development of some three-dimensional pharmacophore models which have led to the identification of a large series of potent HIV-1 integrase strand-transfer inhibitors (INSTIs) bearing an indole core. To gain a better understanding of the structure-activity relationships (SARs), herein we report the design and microwave-assisted synthesis of a novel series of 1-H-benzylindole derivatives.

  16. Enantioselective Synthesis and Profiling of Two Novel Diazabicyclooctanone β-Lactamase Inhibitors

    PubMed Central

    2014-01-01

    The enantioselective synthesis of two novel cyclopropane-fused diazabicyclooctanones is reported here. Starting from butadiene monoxide, the key enone intermediate 7 was prepared in six steps. Subsequent stereoselective introduction of the cyclopropane group and further transformation led to compounds 1a and 1b as their corresponding sodium salt. The great disparity regarding their hydrolytic stability was rationalized by the steric interaction between the cyclopropyl methylene and urea carbonyl. These two novel β-lactamase inhibitors were active against class A, C, and D enzymes. PMID:25313328

  17. Synthesis, biological evaluation and docking of novel bisamidinohydrazones as non-peptide inhibitors of furin.

    PubMed

    Kibirev, V K; Osadchuk, T V; Kozachenko, O P; Kholodovych, V; Fedoryak, D; Brovarets, V S

    2015-01-01

    A series of novel non-peptidicfurin inhibitors with values of inhibitory constants (Ki) in the range of 0.74-1.54 μM was obtained by interactions of aminoguanidine hydrocarbonate with three diaryldicarbalde- hydes. Correspondingly p-hydroquinone, piperazine and adipic acid were used as linkers between their ben- zene moieties. Docking studies of these new inhibitors into recently published 3D-structure of human furin (PDB code 4OMC) showed that they were able to interact with subsites S1 and S4 of the enzyme. The overall arrangement of bisamidinohydrazones into furin active site was similar to the position of the ligand co- crystallized with a protease. Observations obtained with molecular modeling allowed further guidance into chemical modifications of the synthesized inhibitors which improve their inhibitory activity.

  18. Recent Methodologies toward the Synthesis of Valdecoxib: A Potential 3,4-diarylisoxazolyl COX-2 Inhibitor

    PubMed Central

    Dadiboyena, Sureshbabu; Nefzi, Adel

    2011-01-01

    Non-steroidal anti-inflammatory drugs are widely used therapeutic agents in the treatment of inflammation, pain and fever. Cyclooxygenase catalyzes the initial step of biotransformation of arachidonic acid to prostanoids, and exist as three distinct isozymes; COX-I, COX-II and COX-III. Selective COX-II inhibitors are a class of potential anti-inflammatory, analgesic, and antipyretic drugs with reduced gastrointestinal (GI) side effects compared to nonselective inhibitors. 3,4-diarylisoxazole scaffold is recurrently found in a wide variety of NSAIDs, protein kinase inhibitors, hypertensive agents, and estrogen receptor (ER) modulators. In the present review, we document on the recent synthetic strategies of 3,4-diarylisoxazolyl scaffolds of valdecoxib and its relevant structural analogues. PMID:20724040

  19. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  20. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  1. Copper(I) mediated facile synthesis of potent tubulin polymerization inhibitor, 9-amino-α-noscapine from natural α-noscapine.

    PubMed

    Manchukonda, Naresh K; Sridhar, Balasubramanian; Naik, Pradeep K; Joshi, Harish C; Kantevari, Srinivas

    2012-04-15

    Facile synthesis of natural α-noscapine analogue, 9-amino-α-noscapine, a potent inhibitor of tubulin polymerization for cancer therapy, is achieved via copper(I) iodide mediated in situ aromatic azidation and reduction of 9-bromo-α-noscapine (obtained by bromination of natural α-noscapine) with NaN(3) in DMSO at 130°C in the presence of L-proline as an amino acid promoter. The protocol developed here avoided isolation of 9-azido-α-noscapine and did not cleave the sensitive C-C bond between two heterocyclic phthalide and isoquinoline units.

  2. Cinnamide Derivatives as Mammalian Arginase Inhibitors: Synthesis, Biological Evaluation and Molecular Docking

    PubMed Central

    Pham, Thanh-Nhat; Bordage, Simon; Pudlo, Marc; Demougeot, Céline; Thai, Khac-Minh; Girard-Thernier, Corine

    2016-01-01

    Arginases are enzymes that are involved in many human diseases and have been targeted for new treatments. Here a series of cinnamides was designed, synthesized and evaluated in vitro and in silico for their inhibitory activity against mammalian arginase. Using a microassay on purified liver bovine arginase (b-ARG I), (E)-N-(2-phenylethyl)-3,4-dihydroxycinnamide, also named caffeic acid phenylamide (CAPA), was shown to be slightly more active than our natural reference inhibitor, chlorogenic acid (IC50 = 6.9 ± 1.3 and 10.6 ± 1.6 µM, respectively) but it remained less active that the synthetic reference inhibitor Nω-hydroxy-nor-l-arginine nor-NOHA (IC50 = 1.7 ± 0.2 µM). Enzyme kinetic studies showed that CAPA was a competitive inhibitor of arginase with Ki = 5.5 ± 1 µM. Whereas the activity of nor-NOHA was retained (IC50 = 5.7 ± 0.6 µM) using a human recombinant arginase I (h-ARG I), CAPA showed poorer activity (IC50 = 60.3 ± 7.8 µM). However, our study revealed that the cinnamoyl moiety and catechol function were important for inhibitory activity. Docking results on h-ARG I demonstrated that the caffeoyl moiety could penetrate into the active-site pocket of the enzyme, and the catechol function might interact with the cofactor Mn2+ and several crucial amino acid residues involved in the hydrolysis mechanism of arginase. The results of this study suggest that 3,4-dihydroxycinnamides are worth being considered as potential mammalian arginase inhibitors, and could be useful for further research on the development of new arginase inhibitors. PMID:27690022

  3. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  4. Gentisic Acid, a Compound Associated with Plant Defense and a Metabolite of Aspirin, Heads a New Class of in Vivo Fibroblast Growth Factor Inhibitors*

    PubMed Central

    Fernández, Israel S.; Cuevas, Pedro; Angulo, Javier; López-Navajas, Pilar; Canales-Mayordomo, Ángeles; González-Corrochano, Rocío; Lozano, Rosa M.; Valverde, Serafín; Jiménez-Barbero, Jesús; Romero, Antonio; Giménez-Gallego, Guillermo

    2010-01-01

    Fibroblast growth factors are key proteins in many intercellular signaling networks. They normally remain attached to the extracellular matrix, which confers on them a considerable stability. The unrestrained accumulation of fibroblast growth factors in the extracellular milieu, either due to uncontrolled synthesis or enzymatic release, contributes to the pathology of many diseases. Consequently, the neutralization of improperly mobilized fibroblast growth factors is of clear therapeutic interest. In pursuing described rules to identify potential inhibitors of these proteins, gentisic acid, a plant pest-controlling compound, an aspirin and vegetarian diet common catabolite, and a component of many traditional liquors and herbal remedies, was singled out as a powerful inhibitor of fibroblast growth factors. Gentisic acid was used as a lead to identify additional compounds with better inhibitory characteristics generating a new chemical class of fibroblast growth factor inhibitors that includes the agent responsible for alkaptonuria. Through low and high resolution approaches, using representative members of the fibroblast growth factor family and their cell receptors, it was shown that this class of inhibitors may employ two different mechanisms to interfere with the assembly of the signaling complexes that trigger fibroblast growth factor-driven mitogenesis. In addition, we obtained evidence from in vivo disease models that this group of inhibitors may be of interest to treat cancer and angiogenesis-dependent diseases. PMID:20145243

  5. Piperazine and piperidine carboxamides and carbamates as inhibitors of fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL).

    PubMed

    Korhonen, Jani; Kuusisto, Anne; van Bruchem, John; Patel, Jayendra Z; Laitinen, Tuomo; Navia-Paldanius, Dina; Laitinen, Jarmo T; Savinainen, Juha R; Parkkari, Teija; Nevalainen, Tapio J

    2014-12-01

    The key hydrolytic enzymes of the endocannabinoid system, fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL), are potential targets for various therapeutic applications. In this paper, we present more extensively the results of our previous work on piperazine and piperidine carboxamides and carbamates as FAAH and MAGL inhibitors. The best compounds of these series function as potent and selective MAGL/FAAH inhibitors or as dual FAAH/MAGL inhibitors at nanomolar concentrations. This study revealed that MAGL inhibitors should comprise leaving-groups with a conjugate acid pKa of 8-10, while diverse leaving groups are tolerated for FAAH inhibitors.

  6. α-Ketoheterocycle-Based Inhibitors of Fatty Acid Amide Hydrolase (FAAH)

    PubMed Central

    2011-01-01

    A summary of the initial discovery and characterization of the enzyme fatty acid amide hydrolase (FAAH), and the subsequent advancement of an important class of competitive, reversible, potent, and selective inhibitors is presented. Initially explored using substrate-inspired inhibitors bearing electrophilic carbonyls, the examination of α-ketoheterocyle-based inhibitors of FAAH with the benefit of a unique activity-based protein-profiling (ABPP)-based proteome-wide selectivity assay, a powerful in vivo biomarker-based in vivo screen, and subsequent retrospective X-ray cocrystal structures with the enzyme, is summarized. These efforts defined the impact of the central activating heterocycle and its key substituents, provided key simplifications in the C2 acyl side chain and clear interpretations for the unique role and subsequent optimization of the central activating heterocycle, and established the basis for the recent further conformational constraints in the C2 acyl side chain, providing potent, long-acting, orally active FAAH inhibitors. PMID:22639704

  7. Inhibitors of Influenza Virus Polymerase Acidic (PA) Endonuclease: Contemporary Developments and Perspectives.

    PubMed

    Ju, Han; Zhang, Jian; Huang, Boshi; Kang, Dongwei; Huang, Bing; Liu, Xinyong; Zhan, Peng

    2017-02-07

    Influenza virus (IFV) causes periodic global influenza pandemics, resulting in substantial socioeconomic loss and burden on medical facilities. Yearly variation in the effectiveness of vaccines, slow responsiveness to vaccination in cases of pandemic IFV, and emerging resistance to available drugs highlight the need to develop additional small-molecular inhibitors that act on IFV proteins. One promising target is polymerase acidic (PA) endonuclease, which is a bridged dinuclear metalloenzyme that plays a crucial role in initiating IFV replication. During the past decade, intensive efforts have been made to develop small-molecular inhibitors of this endonuclease as candidate agents for treatment of IFV infection. Here, we review the current status of development of PA endonuclease inhibitors and we discuss the applicability of newer medicinal-chemistry strategies for the discovery more potent, selective, and safer inhibitors.

  8. Potent and Selective Peptidyl Boronic Acid Inhibitors of the Serine Protease Prostate-Specific Antigen

    PubMed Central

    LeBeau, Aaron M.; Singh, Pratap; Isaacs, John T.; Denmeade, Samuel R.

    2012-01-01

    SUMMARY Prostate cancer cells produce high (microgram to milligram/milliliter) levels of the serine protease Prostate-Specific Antigen (PSA). PSA is enzymatically active in the extracellular fluid surrounding prostate cancers but is found at 1,000- to 10,000-fold lower concentrations in the circulation, where it is inactivated due to binding to abundant serum protease inhibitors. The exclusive presence of high levels of active PSA within prostate cancer sites makes PSA an attractive candidate for targeted imaging and therapeutics. A synthetic approach based on a peptide substrate identified first peptide aldehyde and then boronic acid inhibitors of PSA. The best of these had the sequence Cbz-Ser-Ser-Lys-Leu-(boro)Leu, with a Ki for PSA of 65 nM. The inhibitor had a 60-fold higher Ki for chymotrypsin. A validated model of PSA’s catalytic site confirmed the critical interactions between the inhibitor and residues within the PSA enzyme. PMID:18635003

  9. Liquid chromatographic determination of hippuric acid for the evaluation of ethacrynic acid as angiotensin converting enzyme inhibitor.

    PubMed

    Mehanna, A S; Dowling, M

    1999-05-01

    A rapid, simple and interference-free method is described to evaluate the inhibitory effects of organic compounds on the activity of angiotensin converting enzyme irrespective of their acid-base properties. The assay is based on the high performance liquid chromatographic separation of the synthetic substrate hippuryl-L-histidyl-L-leucine, the hydrolysis product hippuric acid and the test compound. Using the new method, the diuretic drug ethacrynic acid was found to act as an inhibitor for the enzyme in a non competitive mode.

  10. Beyond gastric acid reduction: Proton pump inhibitors induce heme oxygenase-1 in gastric and endothelial cells

    SciTech Connect

    Becker, Jan C. . E-mail: beckeja@uni-muenster.de; Grosser, Nina; Waltke, Christian; Schulz, Stephanie; Erdmann, Kati; Domschke, Wolfram; Schroeder, Henning; Pohle, Thorsten

    2006-07-07

    Proton pump inhibitors (PPIs) have been demonstrated to prevent gastric mucosal injury by mechanisms independent of acid inhibition. Here we demonstrate that both omeprazole and lansoprazole protect human gastric epithelial and endothelial cells against oxidative stress. This effect was abrogated in the presence of the heme oxygenase-1 (HO-1) inhibitor ZnBG. Exposure to either PPI resulted in a strong induction of HO-1 expression on mRNA and protein level, and led to an increased activity of this enzyme. Expression of cyclooxygenase isoforms 1 and 2 remained unaffected, and COX-inhibitors did not antagonize HO-1 induction by PPIs. Our results suggest that the antioxidant defense protein HO-1 is a target of PPIs in both endothelial and gastric epithelial cells. HO-1 induction might account for the gastroprotective effects of PPIs independently of acid inhibition, especially in NSAID gastropathy. Moreover, our findings provide additional perspectives for a possible but yet unexplored use of PPIs in vasoprotection.

  11. Protein synthesis inhibitors attenuate water flow in vasopressin-stimulated toad urinary bladder

    SciTech Connect

    Hoch, B.S.; Ast, M.B.; Fusco, M.J.; Jacoby, M.; Levine, S.D. )

    1988-01-01

    Vasopressin stimulates the introduction of aggregated particles, which may represent pathways for water flow, into the luminal membrane of toad urinary bladder. It is not known whether water transport pathways are degraded on removal from membrane or whether they are recycled. The authors examined the effect of the protein synthesis inhibitors cycloheximide and puromycin using repeated 30-min cycles of vasopressin followed by washout of vasopressin, all in the presence of an osmotic gradient, a protocol that maximizes aggregate turnover. High dose cycloheximide inhibited flow immediately. Low dose cycloheximide did not affect initial flow. In the absence of vasopressin, inhibition did not develop. Despite the inhibition of flow in vasopressin-treated tissues, the cAMP-dependent protein kinase ratio was elevated in cycloheximide-treated tissues, suggesting modulation at a distal site in the stimulatory cascade. ({sup 14}C)urea permeability was not inhibited by cycloheximide. Puromycin also inhibited water flow by the fourth challenge with vasopressin. The data suggest that protein synthesis inhibitors attenuate flow at a site that is distal to cAMP-dependent protein kinase. However, the reversal of inhibition in MIX-treated tissues suggests that the water pathway can be fully manifested given suitable stimulation. They conclude that either large stores of the transport system are available or that the transport system is extensively recycled on retrieval from the membrane.

  12. Total synthesis and structure-activity relationship studies of a series of selective G protein inhibitors

    NASA Astrophysics Data System (ADS)

    Xiong, Xiao-Feng; Zhang, Hang; Underwood, Christina R.; Harpsøe, Kasper; Gardella, Thomas J.; Wöldike, Mie F.; Mannstadt, Michael; Gloriam, David E.; Bräuner-Osborne, Hans; Strømgaard, Kristian

    2016-11-01

    G proteins are key mediators of G protein-coupled receptor signalling, which facilitates a plethora of important physiological processes. The cyclic depsipeptides YM-254890 and FR900359 are the only known specific inhibitors of the Gq subfamily of G proteins; however, no synthetic route has been reported previously for these complex natural products and they are not easily isolated from natural sources. Here we report the first total synthesis of YM-254890 and FR900359, as well as of two known analogues, YM-385780 and YM-385781. The versatility of the synthetic approach also enabled the design and synthesis of ten analogues, which provided the first structure-activity relationship study for this class of compounds. Pharmacological characterization of all the compounds at Gq-, Gi- and Gs-mediated signalling provided succinct information on the structural requirements for inhibition, and demonstrated that both YM-254890 and FR900359 are highly potent inhibitors of Gq signalling, with FR900359 being the most potent. These natural products and their analogues represent unique tools for explorative studies of G protein inhibition.

  13. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  14. Synthesis of new (-)-Bestatin-based inhibitor libraries reveals a novel binding mode in the S1 pocket of the essential malaria M1 metalloaminopeptidase

    PubMed Central

    Velmourougane, Geetha; Harbut, Michael B.; Dalal, Seema; McGowan, Sheena; Oellig, Christine A.; Meinhardt, Nataline; Whisstock, James C.; Klemba, Michael; Greenbaum, Doron C.

    2012-01-01

    The malarial PfA-M1 metallo-aminopeptidase is considered a putative drug target. The natural product dipeptide mimetic, bestatin, is a potent inhibitor of PfA-M1. Herein we present a new, efficient and high-yielding protocol for the synthesis of bestatin derivatives from natural and unnatural N-Boc-D-amino acids. A diverse library of bestatin derivatives was synthesized with variants at the sidechain of either the α-hydroxy-β-amino acid (P1) or the adjacent natural α-amino acid (P1’). Surprisingly, we found that extended aromatic sidechains at the P1 position resulted in potent inhibition against PfA-M1. To understand these data, we determined the X-ray co-crystal structures of PfA-M1 with two derivatives having either a Tyr(OMe) 15 or Tyr(OBzl) 16 at the P1 position and observed substantial inhibitor-induced rearrangement of the primary loop within the PfA-M1 pocket that interacts with the P1 sidechain. Our data provide important insights for the rational design of more potent and selective inhibitors of this enzyme that may eventually lead to new therapies for malaria. PMID:21366301

  15. Studies on 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase using chorismate mutase inhibitors.

    PubMed

    Birck, M R; Husain, A; Sheflyan, G Y; Ganem, B; Woodard, R W

    2001-11-05

    The proposed cyclic mechanism of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase and the mechanism of chorismate mutase share certain structural and electronic similarities. In this report, we examine several inhibitors of chorismate mutase for their efficacy against KDO 8-P synthase.

  16. Synergism of antifungal activity between mitochondrial respiration inhibitors and kojic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Co-application of certain types of compounds with conventional antimicrobial drugs results in the enhancement of efficacy of drugs through a mechanism termed chemosensitization. We show that kojic acid (KA), a natural product, is a potent chemosensitizer to complex III inhibitors of mitochondrial re...

  17. HALOACETIC ACIDS AND KINASE INHIBITORS PERTURB MOUSE NEURAL CREST CELLS IN VITRO

    EPA Science Inventory

    HUNTER, E.S.1, J. SMITH2, J. ANDREWS1. 1 Reproductive Toxicology Division, NHEERL, US EPA, Research Triangle Park and 2 Department of Cell and Developmental Biology, UNC-CH, Chapel Hill, North Carolina. Haloacetic acids and kinase inhibitors perturb mouse neural crest cells in vi...

  18. Hydroxyindole Carboxylic Acid-Based Inhibitors for Receptor-Type Protein Tyrosine Protein Phosphatase Beta

    PubMed Central

    Zeng, Li-Fan; Zhang, Ruo-Yu; Bai, Yunpeng; Wu, Li; Gunawan, Andrea M.

    2014-01-01

    Abstract Aims: Protein tyrosine phosphatases (PTPs) play an important role in regulating a wide range of cellular processes. Understanding the role of PTPs within these processes has been hampered by a lack of potent and selective PTP inhibitors. Generating potent and selective probes for PTPs remains a significant challenge because of the highly conserved and positively charged PTP active site that also harbors a redox-sensitive Cys residue. Results: We describe a facile method that uses an appropriate hydroxyindole carboxylic acid to anchor the inhibitor to the PTP active site and relies on the secondary binding elements introduced through an amide-focused library to enhance binding affinity for the target PTP and to impart selectivity against off-target phosphatases. Here, we disclose a novel series of hydroxyindole carboxylic acid-based inhibitors for receptor-type tyrosine protein phosphatase beta (RPTPβ), a potential target that is implicated in blood vessel development. The representative RPTPβ inhibitor 8b-1 (L87B44) has an IC50 of 0.38 μM and at least 14-fold selectivity for RPTPβ over a large panel of PTPs. Moreover, 8b-1 also exhibits excellent cellular activity and augments growth factor signaling in HEK293, MDA-MB-468, and human umbilical vein endothelial cells. Innovation: The bicyclic salicylic acid pharmacophore-based focused library approach may provide a potential solution to overcome the bioavailability issue that has plagued the PTP drug discovery field for many years. Conclusion: A novel method is described for the development of bioavailable PTP inhibitors that utilizes bicyclic salicylic acid to anchor the inhibitors to the active site and peripheral site interactions to enhance binding affinity and selectivity. Antioxid. Redox Signal. 20, 2130–2140. PMID:24180557

  19. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  20. Lipoteichoic acid synthesis inhibition in combination with antibiotics abrogates growth of multidrug-resistant Enterococcus faecium.

    PubMed

    Paganelli, Fernanda L; van de Kamer, Tim; Brouwer, Ellen C; Leavis, Helen L; Woodford, Neil; Bonten, Marc J M; Willems, Rob J L; Hendrickx, Antoni P A

    2017-03-01

    Enterococcus faecium is a multidrug-resistant (MDR) nosocomial pathogen causing significant morbidity in debilitated patients. New antimicrobials are needed to treat antibiotic-resistant E. faecium infections in hospitalised patients. E. faecium incorporates lipoteichoic acid (LTA) (1,3-polyglycerol-phosphate linked to glycolipid) in its cell wall. The small-molecule inhibitor 1771 [2-oxo-2-(5-phenyl-1,3,4-oxadiazol-2-ylamino)ethyl 2-naphtho[2,1-b]furan-1-ylacetate] specifically blocks the activity of Staphylococcus aureus LtaS synthase, which polymerises 1,3-glycerolphosphate into LTA polymers. Here we characterised the effects of the small-molecule inhibitor 1771 on the growth of E. faecium isolates, alone (28 strains) or in combination with the antibiotics vancomycin, daptomycin, ampicillin, gentamicin or linezolid (15 strains), and on biofilm formation (16 strains). Inhibition of LTA synthesis at the surface of the cell by compound 1771 in combination with current antibiotic therapy abrogates enterococcal growth in vitro but does not affect mature E. faecium biofilms. Targeting LTA synthesis may provide new possibilities to treat MDR E. faecium infections.

  1. Novel Inhibitors of Rad6 Ubiquitin Conjugating Enzyme: Design, Synthesis, Identification, and Functional Characterization

    PubMed Central

    Nangia-Makker, Pratima; Balan, Vitaly; Morelli, Matteo; Kothayer, Hend; Westwell, Andrew D.; Shekhar, Malathy P.V.

    2013-01-01

    Protein ubiquitination is important for cell signaling, DNA repair, and proteasomal degradation, and it is not surprising that alterations in ubiquitination occur frequently in cancer. Ubiquitin-conjugating enzymes (E2) mediate ubiquitination by selective interactions with ubiquitin-activating (E1) and ubiquitin ligase (E3) enzymes, and thus selective E2 small molecule inhibitor (SMI) will provide specificity unattainable with proteasome inhibitors. Here we describe synthesis and functional characterization of the first SMIs of human E2 Rad6B, a fundamental component of translesion synthesis DNA repair. A pharmacophore model for consensus E2 ubiquitin-binding sites was generated for virtual screening to identify E2 inhibitor candidates. Twelve triazine (TZ) analogs screened in silico by molecular docking to the Rad6B X-ray structure were verified by their effect on Rad6B ubiquitination of histone H2A. TZs #8 and 9 docked to the Rad6B catalytic site with highest complementarity. TZs #1, 2, 8, and 9 inhibited Rad6B-ubiquitin thioester formation and subsequent ubiquitin transfer to histone H2A. SMI #9 inhibition of Rad6 was selective as BCA2 ubiquitination by E2 UbcH5 was unaffected by SMI #9. SMI #9 more potently inhibited proliferation, colony formation, and migration than SMI #8, and induced MDA-MB-231 breast cancer cell G2–M arrest and apoptosis. Ubiquitination assays using Rad6 immunoprecipitated from SMI #8- or 9-treated cells confirmed inhibition of endogenous Rad6 activity. Consistent with our previous data showing Rad6B-mediated polyubiquitination stabilizes β-catenin, MDAMB-231 treatment with SMIs #8 or 9 decreased β-catenin protein levels. Together these results describe identification of the first Rad6 SMIs. PMID:23339190

  2. Novel inhibitors of Rad6 ubiquitin conjugating enzyme: design, synthesis, identification, and functional characterization.

    PubMed

    Sanders, Matthew A; Brahemi, Ghali; Nangia-Makker, Pratima; Balan, Vitaly; Morelli, Matteo; Kothayer, Hend; Westwell, Andrew D; Shekhar, Malathy P V

    2013-04-01

    Protein ubiquitination is important for cell signaling, DNA repair, and proteasomal degradation, and it is not surprising that alterations in ubiquitination occur frequently in cancer. Ubiquitin-conjugating enzymes (E2) mediate ubiquitination by selective interactions with ubiquitin-activating (E1) and ubiquitin ligase (E3) enzymes, and thus selective E2 small molecule inhibitor (SMI) will provide specificity unattainable with proteasome inhibitors. Here we describe synthesis and functional characterization of the first SMIs of human E2 Rad6B, a fundamental component of translesion synthesis DNA repair. A pharmacophore model for consensus E2 ubiquitin-binding sites was generated for virtual screening to identify E2 inhibitor candidates. Twelve triazine (TZ) analogs screened in silico by molecular docking to the Rad6B X-ray structure were verified by their effect on Rad6B ubiquitination of histone H2A. TZs #8 and 9 docked to the Rad6B catalytic site with highest complementarity. TZs #1, 2, 8, and 9 inhibited Rad6B-ubiquitin thioester formation and subsequent ubiquitin transfer to histone H2A. SMI #9 inhibition of Rad6 was selective as BCA2 ubiquitination by E2 UbcH5 was unaffected by SMI #9. SMI #9 more potently inhibited proliferation, colony formation, and migration than SMI #8, and induced MDA-MB-231 breast cancer cell G2-M arrest and apoptosis. Ubiquitination assays using Rad6 immunoprecipitated from SMI #8- or 9-treated cells confirmed inhibition of endogenous Rad6 activity. Consistent with our previous data showing Rad6B-mediated polyubiquitination stabilizes β-catenin, MDA-MB-231 treatment with SMIs #8 or 9 decreased β-catenin protein levels. Together these results describe identification of the first Rad6 SMIs.

  3. Fatty acid amide hydrolase inhibitors confer anti-invasive and antimetastatic effects on lung cancer cells

    PubMed Central

    Winkler, Katrin; Ramer, Robert; Dithmer, Sophie; Ivanov, Igor; Merkord, Jutta; Hinz, Burkhard

    2016-01-01

    Inhibition of endocannabinoid degradation has been suggested as tool for activation of endogenous tumor defense. One of these strategies lies in blockade of fatty acid amide hydrolase (FAAH) which catalyzes the degradation of endocannabinoids (anandamide [AEA], 2-arachidonoylglycerol [2-AG]) and endocannabinoid-like substances (N-oleoylethanolamine [OEA], N-palmitoylethanolamine [PEA]). This study addressed the impact of two FAAH inhibitors (arachidonoyl serotonin [AA-5HT], URB597) on A549 lung cancer cell metastasis and invasion. LC-MS analyses revealed increased levels of FAAH substrates (AEA, 2-AG, OEA, PEA) in cells incubated with either FAAH inhibitor. In athymic nude mice FAAH inhibitors were shown to elicit a dose-dependent antimetastatic action yielding a 67% and 62% inhibition of metastatic lung nodules following repeated administration of 15 mg/kg AA-5HT and 5 mg/kg URB597, respectively. In vitro, a concentration-dependent anti-invasive action of either FAAH inhibitor was demonstrated, accompanied with upregulation of tissue inhibitor of matrix metalloproteinases-1 (TIMP-1). Using siRNA approaches, a causal link between the TIMP-1-upregulating and anti-invasive action of FAAH inhibitors was confirmed. Moreover, knockdown of FAAH by siRNA was shown to confer decreased cancer cell invasiveness and increased TIMP-1 expression. Inhibitor experiments point toward a role of CB2 and transient receptor potential vanilloid 1 in conferring anti-invasive effects of FAAH inhibitors and FAAH siRNA. Finally, antimetastatic and anti-invasive effects were confirmed for all FAAH substrates with AEA and OEA causing a TIMP-1-dependent anti-invasive action. Collectively, the present study provides first-time proof for an antimetastatic action of FAAH inhibitors. As mechanism of its anti-invasive properties an upregulation of TIMP-1 was identified. PMID:26930716

  4. Synthesis of Bi-substrate State Mimics of Dihydropteroate Synthase as Potential Inhibitors and Molecular Probes

    PubMed Central

    Qi, Jianjun; Virga, Kristopher G.; Das, Sourav; Zhao, Ying; Yun, Mi-Kyung; White, Stephen W.; Lee, Richard E.

    2010-01-01

    The increasing emergence of resistant bacteria drives us to design and develop new antimicrobial agents. Pursuant to that goal, a new targeting approach of the dihydropteroate synthase enzyme, which serves as the site of action for the sulfonamide class of antimicrobial agents, is being explored. Using structural information, a new class of transition state mimics has been designed and synthesized that have the capacity to bind to the pterin, phosphate and para-amino binding sites. The design, synthesis and evaluation of these compounds as inhibitors of Bacillus anthracis dihydropteroate synthase is described herein. Outcomes from this work have identified the first trivalent inhibitors of dihydropteroate synthase whose activity displayed slow binding inhibition. The most active compounds in this series contained an oxidized pterin ring. The binding of these inhibitors was modeled into the dihydropteroate synthase active site and demonstrated a good correlation with the observed bioassay data, as well as provided important insight for the future design of higher affinity transition state mimics. PMID:21216602

  5. The Design, Synthesis and Structure-Activity Relationship of Mixed Serotonin, Norepinephrine and Dopamine Uptake Inhibitors

    NASA Astrophysics Data System (ADS)

    Chen, Zhengming; Yang, Ji; Skolnick, Phil

    The evolution of antidepressants over the past four decades has involved the replacement of drugs with a multiplicity of effects (e.g., TCAs) by those with selective actions (i.e., SSRIs). This strategy was employed to reduce the adverse effects of TCAs, largely by eliminating interactions with certain neurotransmitters or receptors. Although these more selective compounds may be better tolerated by patients, selective drugs, specifically SSRIs, are not superior to older drugs in treating depressed patients as measured by response and remission rates. It may be an advantage to increase synaptic levels of both serotonin and norepinephrine, as in the case of dual uptake inhibitors like duloxetine and venlafaxine. An important recent development has been the emergence of the triple-uptake inhibitors (TUIs/SNDRIs), which inhibit the uptake of the three neurotransmitters most closely linked to depression: serotonin, norepinephrine, and dopamine. Preclinical studies and clinical trials indicate that a drug inhibiting the reuptake of all three of these neurotransmitters could produce more rapid onset of action and greater efficacy than traditional antidepressants. This review will detail the medicinal chemistry involved in the design, synthesis and discovery of mixed serotonin, norepinephrine and dopamine transporter uptake inhibitors.

  6. Design, Synthesis, and Protein Crystallography of Biaryltriazoles as Potent Tautomerase Inhibitors of Macrophage Migration Inhibitory Factor

    PubMed Central

    Dziedzic, Pawel; Cisneros, José A.; Robertson, Michael J.; Hare, Alissa A.; Danford, Nadia E.; Baxter, Richard H. G.; Jorgensen, William L.

    2015-01-01

    Optimization is reported for biaryltriazoles as inhibitors of the tautomerase activity of human macrophage migration inhibitory factor (MIF), a proinflammatory cytokine associated with numerous inflammatory diseases and cancer. A combined approach was taken featuring organic synthesis, enzymatic assaying, crystallography, and modeling including free-energy perturbation (FEP) calculations. X-ray crystal structures for 3a and 3b bound to MIF are reported and provided a basis for the modeling efforts. The accommodation of the inhibitors in the binding site is striking with multiple hydrogen bonds and aryl–aryl interactions. Additional modeling encouraged pursuit of 5-phenoxyquinolinyl analogues, which led to the very potent compound 3s. Activity was further enhanced by addition of a fluorine atom adjacent to the phenolic hydroxyl group as in 3w, 3z, 3aa, and 3bb to strengthen a key hydrogen bond. It is also shown that physical properties of the compounds can be modulated by variation of solvent-exposed substituents. Several of the compounds are likely the most potent known MIF tautomerase inhibitors; the most active ones are more than 1000-fold more active than the well-studied (R)-ISO-1 and more than 200-fold more active than the chromen-4-one Orita-13. PMID:25697265

  7. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  8. Effects of prostaglandins and prostaglandin synthesis inhibitors on sexual behavior in boars.

    PubMed

    Estienne, Mark J; Harper, Allen F; Beal, Wilfred E; Crawford, Russell J

    2007-07-01

    Experiments were conducted investigating the effects of prostaglandins and prostaglandin synthesis inhibitors on libido in boars. In Experiment 1, two prostaglandin products were compared with regard to expediting the training of boars for semen collection. On each of five consecutive days, boars received i.m. treatment with saline, dinoprost tromethamine or cloprostenol sodium (n=12/group). On each of day 1 (p=0.06), day 2 (p<0.05), and day 3 (p<0.05), but not on day 4 or 5 (p>0.1), the percentage of boars collected after dinoprost tromethamine, but not cloprostenol sodium, was greater than controls. In Experiments 2 and 3, libido in boars that were trained previously for semen collection was assessed after treatment with prostaglandin synthesis inhibitors, testing the hypothesis that endogenous release of prostaglandin is necessary for expression of sexual behaviors. In Experiment 2, boars treated with flunixin meglumine (n=12) had suppressed (p<0.01) levels of 15-ketodihydro-prostaglandin-F(2) (PGFM) in serum but characteristics of libido were similar (p>0.1) to controls (n=12). In Experiment 3, boars were administered indomethacin orally (n=12) or served as untreated controls (n=12). Indomethacin decreased (p<0.01) serum levels of PGFM, increased (p<0.05) the number of false mounts (mounting artificial sow but dismounting before an ejaculate was collected), and tended (p=0.09) to lengthen the interval between entering the collection pen and the start of ejaculation. These results suggest that prostaglandin synthesis and release is necessary for the complete display of normal sexual behaviors in boars.

  9. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  10. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  11. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  12. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  13. Amnesia produced by altered release of neurotransmitters after intraamygdala injections of a protein synthesis inhibitor

    PubMed Central

    Canal, Clinton E.; Chang, Qing; Gold, Paul E.

    2007-01-01

    Amnesia produced by protein synthesis inhibitors such as anisomycin provides major support for the prevalent view that the formation of long-lasting memories requires de novo protein synthesis. However, inhibition of protein synthesis might disrupt other neural functions to interfere with memory formation. Intraamygdala injections of anisomycin before inhibitory avoidance training impaired memory in rats tested 48 h later. Release of norepinephrine (NE), dopamine (DA), and serotonin, measured at the site of anisomycin infusions, increased quickly by ≈1,000–17,000%, far above the levels seen under normal conditions. NE and DA release later decreased far below baseline for several hours before recovering at 48 h. Intraamygdala injections of a β-adrenergic receptor antagonist or agonist, each timed to blunt effects of increases and decreases in NE release after anisomycin, attenuated anisomycin-induced amnesia. In addition, similar to the effects on memory seen with anisomycin, intraamygdala injections of a high dose of NE before training impaired memory tested at 48 h after training. These findings suggest that altered release of neurotransmitters may mediate amnesia produced by anisomycin and, further, raise important questions about the empirical bases for many molecular theories of memory formation. PMID:17640910

  14. Amnesia produced by altered release of neurotransmitters after intraamygdala injections of a protein synthesis inhibitor.

    PubMed

    Canal, Clinton E; Chang, Qing; Gold, Paul E

    2007-07-24

    Amnesia produced by protein synthesis inhibitors such as anisomycin provides major support for the prevalent view that the formation of long-lasting memories requires de novo protein synthesis. However, inhibition of protein synthesis might disrupt other neural functions to interfere with memory formation. Intraamygdala injections of anisomycin before inhibitory avoidance training impaired memory in rats tested 48 h later. Release of norepinephrine (NE), dopamine (DA), and serotonin, measured at the site of anisomycin infusions, increased quickly by approximately 1,000-17,000%, far above the levels seen under normal conditions. NE and DA release later decreased far below baseline for several hours before recovering at 48 h. Intraamygdala injections of a beta-adrenergic receptor antagonist or agonist, each timed to blunt effects of increases and decreases in NE release after anisomycin, attenuated anisomycin-induced amnesia. In addition, similar to the effects on memory seen with anisomycin, intraamygdala injections of a high dose of NE before training impaired memory tested at 48 h after training. These findings suggest that altered release of neurotransmitters may mediate amnesia produced by anisomycin and, further, raise important questions about the empirical bases for many molecular theories of memory formation.

  15. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  16. Structure-based design of non-natural amino-acid inhibitors of amyloid fibril formation

    SciTech Connect

    Sievers, Stuart A.; Karanicolas, John; Chang, Howard W.; Zhao, Anni; Jiang, Lin; Zirafi, Onofrio; Stevens, Jason T.; Münch, Jan; Baker, David; Eisenberg, David

    2011-09-20

    Many globular and natively disordered proteins can convert into amyloid fibrils. These fibrils are associated with numerous pathologies as well as with normal cellular functions, and frequently form during protein denaturation. Inhibitors of pathological amyloid fibril formation could be useful in the development of therapeutics, provided that the inhibitors were specific enough to avoid interfering with normal processes. Here we show that computer-aided, structure-based design can yield highly specific peptide inhibitors of amyloid formation. Using known atomic structures of segments of amyloid fibrils as templates, we have designed and characterized an all-D-amino-acid inhibitor of the fibril formation of the tau protein associated with Alzheimer's disease, and a non-natural L-amino-acid inhibitor of an amyloid fibril that enhances sexual transmission of human immunodeficiency virus. Our results indicate that peptides from structure-based designs can disrupt the fibril formation of full-length proteins, including those, such as tau protein, that lack fully ordered native structures. Because the inhibiting peptides have been designed on structures of dual-{beta}-sheet 'steric zippers', the successful inhibition of amyloid fibril formation strengthens the hypothesis that amyloid spines contain steric zippers.

  17. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  18. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  19. Synthesis and evaluation of 2,5-dihydrochorismate analogues as inhibitors of the chorismate-utilising enzymes.

    PubMed

    Payne, Richard J; Bulloch, Esther M M; Toscano, Miguel M; Jones, Michelle A; Kerbarh, Olivier; Abell, Chris

    2009-06-07

    A library of 2,5-dihydrochorismate analogues were designed as inhibitors of the chorismate-utilising enzymes including anthranilate synthase, isochorismate synthase, salicylate synthase and 4-amino-4-deoxychorismate synthase. The inhibitors were synthesised in seven or eight steps from shikimic acid, sourced from star anise. The compounds exhibited moderate but differential inhibition against the four chorismate-utilising enzymes.

  20. Widespread use of gastric acid inhibitors in infants: Are they needed? Are they safe?

    PubMed Central

    Safe, Mark; Chan, Wei H; Leach, Steven T; Sutton, Lee; Lui, Kei; Krishnan, Usha

    2016-01-01

    Gastroesophageal reflux is a common phenomenon in infants, but the differentiation between gastroesophageal reflux and gastroesophageal reflux disease can be difficult. Symptoms are non-specific and there is increasing evidence that the majority of symptoms may not be acid-related. Despite this, gastric acid inhibitors such as proton pump inhibitors are widely and increasingly used, often without objective evidence or investigations to guide treatment. Several studies have shown that these medications are ineffective at treating symptoms associated with reflux in the absence of endoscopically proven oesophagitis. With a lack of evidence for efficacy, attention is now being turned to the potential risks of gastric acid suppression. Previously assumed safety of these medications is being challenged with evidence of potential side effects including GI and respiratory infections, bacterial overgrowth, adverse bone health, food allergy and drug interactions. PMID:27867686

  1. Widespread use of gastric acid inhibitors in infants: Are they needed? Are they safe?

    PubMed

    Safe, Mark; Chan, Wei H; Leach, Steven T; Sutton, Lee; Lui, Kei; Krishnan, Usha

    2016-11-06

    Gastroesophageal reflux is a common phenomenon in infants, but the differentiation between gastroesophageal reflux and gastroesophageal reflux disease can be difficult. Symptoms are non-specific and there is increasing evidence that the majority of symptoms may not be acid-related. Despite this, gastric acid inhibitors such as proton pump inhibitors are widely and increasingly used, often without objective evidence or investigations to guide treatment. Several studies have shown that these medications are ineffective at treating symptoms associated with reflux in the absence of endoscopically proven oesophagitis. With a lack of evidence for efficacy, attention is now being turned to the potential risks of gastric acid suppression. Previously assumed safety of these medications is being challenged with evidence of potential side effects including GI and respiratory infections, bacterial overgrowth, adverse bone health, food allergy and drug interactions.

  2. Discovery and characterization of [(cyclopentyl)ethyl]benzoic acid inhibitors of microsomal prostaglandin E synthase-1.

    PubMed

    Partridge, Katherine M; Antonysamy, Stephen; Bhattachar, Shobha N; Chandrasekhar, Srinivasan; Fisher, Matthew J; Fretland, Adrian; Gooding, Karen; Harvey, Anita; Hughes, Norman E; Kuklish, Steven L; Luz, John G; Manninen, Peter R; McGee, James E; Mudra, Daniel R; Navarro, Antonio; Norman, Bryan H; Quimby, Steven J; Schiffler, Matthew A; Sloan, Ashley V; Warshawsky, Alan M; Weller, Jennifer M; York, Jeremy S; Yu, Xiao-Peng

    2017-03-15

    We describe a novel class of acidic mPGES-1 inhibitors with nanomolar enzymatic and human whole blood (HWB) potency. Rational design in conjunction with structure-based design led initially to the identification of anthranilic acid 5, an mPGES-1 inhibitor with micromolar HWB potency. Structural modifications of 5 improved HWB potency by over 1000×, reduced CYP2C9 single point inhibition, and improved rat clearance, which led to the selection of [(cyclopentyl)ethyl]benzoic acid compound 16 for clinical studies. Compound 16 showed an IC80 of 24nM for inhibition of PGE2 formation in vitro in LPS-stimulated HWB. A single oral dose resulted in plasma concentrations of 16 that exceeded its HWB IC80 in both rat (5mg/kg) and dog (3mg/kg) for over twelve hours.

  3. Discovery and molecular basis of potent noncovalent inhibitors of fatty acid amide hydrolase (FAAH).

    PubMed

    Min, Xiaoshan; Thibault, Stephen T; Porter, Amy C; Gustin, Darin J; Carlson, Timothy J; Xu, Haoda; Lindstrom, Michelle; Xu, Guifen; Uyeda, Craig; Ma, Zhihua; Li, Yihong; Kayser, Frank; Walker, Nigel P C; Wang, Zhulun

    2011-05-03

    Fatty acid amide hydrolase (FAAH), an amidase-signature family member, is an integral membrane enzyme that degrades lipid amides including the endogenous cannabinoid anandamide and the sleep-inducing molecule oleamide. Both genetic knock out and pharmacological administration of FAAH inhibitors in rodent models result in analgesic, anxiolytic, and antiinflammatory phenotypes. Targeting FAAH activity, therefore, presents a promising new therapeutic strategy for the treatment of pain and other neurological-related or inflammatory disorders. Nearly all FAAH inhibitors known to date attain their binding potency through a reversible or irreversible covalent modification of the nucleophile Ser241 in the unusual Ser-Ser-Lys catalytic triad. Here, we report the discovery and mechanism of action of a series of ketobenzimidazoles as unique and potent noncovalent FAAH inhibitors. Compound 2, a representative of these ketobenzimidazoles, was designed from a series of ureas that were identified from high-throughput screening. While urea compound 1 is characterized as an irreversible covalent inhibitor, the cocrystal structure of FAAH complexed with compound 2 reveals that these ketobenzimidazoles, though containing a carbonyl moiety, do not covalently modify Ser241. These inhibitors achieve potent inhibition of FAAH activity primarily from shape complementarity to the active site and through numerous hydrophobic interactions. These noncovalent compounds exhibit excellent selectivity and good pharmacokinetic properties. The discovery of this distinctive class of inhibitors opens a new avenue for modulating FAAH activity through nonmechanism-based inhibition.

  4. Image-Guided Synthesis Reveals Potent Blood-Brain Barrier Permeable Histone Deacetylase Inhibitors

    PubMed Central

    2014-01-01

    Recent studies have revealed that several histone deacetylase (HDAC) inhibitors, which are used to study/treat brain diseases, show low blood-brain barrier (BBB) penetration. In addition to low HDAC potency and selectivity observed, poor brain penetrance may account for the high doses needed to achieve therapeutic efficacy. Here we report the development and evaluation of highly potent and blood-brain barrier permeable HDAC inhibitors for CNS applications based on an image-guided approach involving the parallel synthesis and radiolabeling of a series of compounds based on the benzamide HDAC inhibitor, MS-275 as a template. BBB penetration was optimized by rapid carbon-11 labeling and PET imaging in the baboon model and using the imaging derived data on BBB penetration from each compound to feed back into the design process. A total of 17 compounds were evaluated, revealing molecules with both high binding affinity and BBB permeability. A key element conferring BBB penetration in this benzamide series was a basic benzylic amine. These derivatives exhibited 1–100 nM inhibitory activity against recombinant human HDAC1 and HDAC2. Three of the carbon-11 labeled aminomethyl benzamide derivatives showed high BBB penetration (∼0.015%ID/cc) and regional binding heterogeneity in the brain (high in thalamus and cerebellum). Taken together this approach has afforded a strategy and a predictive model for developing highly potent and BBB permeable HDAC inhibitors for CNS applications and for the discovery of novel candidate molecules for small molecule probes and drugs. PMID:24780082

  5. Aryl Piperazinyl Ureas as Inhibitors of Fatty Acid Amide Hydrolase (FAAH) in Rat, Dog, and Primate.

    PubMed

    Keith, John M; Apodaca, Rich; Tichenor, Mark; Xiao, Wei; Jones, William; Pierce, Joan; Seierstad, Mark; Palmer, James; Webb, Michael; Karbarz, Mark; Scott, Brian; Wilson, Sandy; Luo, Lin; Wennerholm, Michelle; Chang, Leon; Brown, Sean; Rizzolio, Michele; Rynberg, Raymond; Chaplan, Sandra; Breitenbucher, J Guy

    2012-10-11

    A series of aryl piperazinyl ureas that act as covalent inhibitors of fatty acid amide hydrolase (FAAH) is described. A potent and selective (does not inhibit FAAH-2) member of this class, JNJ-40355003, was found to elevate the plasma levels of three fatty acid amides: anandamide, oleoyl ethanolamide, and palmitoyl ethanolamide, in the rat, dog, and cynomolgous monkey. The elevation of the levels of these lipids in the plasma of monkeys suggests that FAAH-2 may not play a significant role in regulating plasma levels of fatty acid ethanolamides in primates.

  6. Synthesis and evaluation of constrained phosphoramidate inhibitors of prostate-specific membrane antigen.

    PubMed

    Ley, Corinne R; Beattie, Nathan R; Dannoon, Shorouk; Regan, Melanie; VanBrocklin, Henry; Berkman, Clifford E

    2015-06-15

    Prostate-specific membrane antigen (PSMA) is a cell-surface enzyme-biomarker that is actively pursued for targeted delivery of imaging and therapeutic agents for prostate cancer. Our lab has developed PSMA inhibitors based on a phosphoramidate scaffold, which has shown both high selectivity for PSMA-positive tumors and rapid clearance in vivo when radiolabeled with (18)F. However, this scaffold exhibits hydrolytic instability under low pH and high temperature conditions, barring the use of other imaging or therapeutic radionuclides such as (68)Ga or (177)Lu. Previous studies in our lab have shown a trend in increasing acid stability as the distance between the phosphoramidate core and the α-carboxylate of the P1 residue is increased. Therefore, a new generation of phosphoramidate inhibitors was developed based on trans-4-hydroxyproline as the P1 residue to restrict the interaction of the α-carboxylate to the phosphoramidate core. These hydroxyproline inhibitors demonstrated comparable IC50 values to earlier generations as well as enhanced thermal and acid stability.

  7. Cathepsin D-mediated yolk protein degradation is blocked by acid phosphatase inhibitors.

    PubMed

    Fialho, Eliane; Nakamura, Angelica; Juliano, Luiz; Masuda, Hatisaburo; Silva-Neto, Mário A C

    2005-04-15

    Vitellin (VT) is a lipoglycophosphoprotein stored inside the eggs of every oviparous organism during oogenesis. In the blood-sucking bug Rhodnius prolixus, VT is deposited inside growing oocytes together with two acid hydrolases: acid phosphatase (AP) and cathepsin D (CD). Egg fertilization triggers AP activity and VT proteolysis in vivo [Insect Biochem. Mol. Biol. 2002 (32) 847]. Here, we show that CD is the main protease targeting VT proteolysis during egg development. CD activity in total egg homogenates is blocked by the classical aspartyl protease inhibitor, pepstatin A. Surprisingly, AP inhibitors such as NaF, Na+/K+ tartrate, and inorganic phosphate also block VT proteolysis, whereas this effect is not observed when tyrosine phosphatase inhibitors such as vanadate and phenylarsine oxide or an inhibitor of alkaline phosphatases such as levamisole are used in a VT proteolysis assay. NaF concentrations that block isolated AP activity do not affect the activity of partially purified CD. Therefore, a specific repressor of VT proteolysis must be dephosphorylated by AP in vivo. In conclusion, these results demonstrate for the first time that acid hydrolases act cooperatively to promote yolk degradation during egg development in arthropods.

  8. Identification of Anziaic Acid, a Lichen Depside from Hypotrachyna sp., as a New Topoisomerase Poison Inhibitor

    PubMed Central

    Cheng, Bokun; Cao, Shugeng; Vasquez, Victor; Annamalai, Thirunavukkarasu; Tamayo-Castillo, Giselle; Clardy, Jon; Tse-Dinh, Yuk-Ching

    2013-01-01

    Topoisomerase inhibitors are effective for antibacterial and anticancer therapy because they can lead to the accumulation of the intermediate DNA cleavage complex formed by the topoisomerase enzymes, which trigger cell death. Here we report the application of a novel enzyme-based high-throughput screening assay to identify natural product extracts that can lead to increased accumulation of the DNA cleavage complex formed by recombinant Yersinia pestis topoisomerase I as part of a larger effort to identify new antibacterial compounds. Further characterization and fractionation of the screening positives from the primary assay led to the discovery of a depside, anziaic acid, from the lichen Hypotrachyna sp. as an inhibitor for both Y. pestis and Escherichia coli topoisomerase I. In in vitro assays, anziaic acid exhibits antibacterial activity against Bacillus subtilis and a membrane permeable strain of E. coli. Anziaic acid was also found to act as an inhibitor of human topoisomerase II but had little effect on human topoisomerase I. This is the first report of a depside with activity as a topoisomerase poison inhibitor and demonstrates the potential of this class of natural products as a source for new antibacterial and anticancer compounds. PMID:23593306

  9. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  10. N-aryl 2-aryloxyacetamides as a new class of fatty acid amide hydrolase (FAAH) inhibitors.

    PubMed

    Sunduru, Naresh; Svensson, Mona; Cipriano, Mariateresa; Marwaha, Sania; Andersson, C David; Svensson, Richard; Fowler, Christopher J; Elofsson, Mikael

    2017-12-01

    Fatty acid amide hydrolase (FAAH) is a promising target for the development of drugs to treat neurological diseases. In search of new FAAH inhibitors, we identified 2-(4-cyclohexylphenoxy)-N-(3-(oxazolo[4,5-b]pyridin-2-yl)phenyl)acetamide, 4g, with an IC50 of 2.6 µM as a chemical starting point for the development of potent FAAH inhibitors. Preliminary hit-to-lead optimisation resulted in 2-(4-phenylphenoxy)-N-(3-(oxazolo[4,5-b]pyridin-2-yl)phenyl)acetamide, 4i, with an IC50 of 0.35 µM.

  11. Triacontanol negatively modulates the jasmonic acid-stimulated proteinase inhibitors in tomato (Lycopersicon esculentum).

    PubMed

    Ramanarayan, Krishnamurthy; Swamy, Gangadharamurthy Sivakumar

    2004-04-01

    Triacontanol (TRIA), a long chain aliphatic alcohol (C30H61OH) reverses the effect of jasmonic acid (JA) in inducing proteinase inhibitors (PIs) in tomato leaves. Porcine pancreas trypsin and Spodoptera litura gut proteinases were inhibited in the presence of leaf proteins treated with JA, and TRIA partially reverses this effect. Spodoptera litura larvae fed with tomato leaves treated with JA were reduced in body weight and TRIA is able to partially reverse this JA-induced effect. These results reflect the partial reversal effect of TRIA in down regulating the JA-induced production of proteinase inhibitors.

  12. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  13. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  14. Design and Synthesis of a Focused Library of Diamino Triazines as Potential Mycobacterium tuberculosis DHFR Inhibitors

    PubMed Central

    2015-01-01

    We report design of a series of 2,4-diamino triazines as Mycobacterium tuberculosis (Mtb) dihydrofolate reductase inhibitors. The synthesized compounds were evaluated against Mtb (H37Rv and Dormant stage H37Ra), their cytotoxicity was assessed (HepG2 and A549 cell lines), and selectivity toward Mtb was evaluated by testing against other bacterial strains. Some derivatives showed promising activity along with low cytotoxicity. The most potent compound in the whole cell assay (MIC 0.325 μM against H37Rv) showed selectivity in the enzyme assay and exhibited synergy with second line anti-TB agent p-amino salicylic acid. This study therefore provides promising molecules for further development as antituberculosis DHFR inhibitors. PMID:26617968

  15. Fusaric acid and analogues as Gram-negative bacterial quorum sensing inhibitors.

    PubMed

    Tung, Truong Thanh; Jakobsen, Tim Holm; Dao, Trong Tuan; Fuglsang, Anja Thoe; Givskov, Michael; Christensen, Søren Brøgger; Nielsen, John

    2017-01-27

    Taking advantage of microwave-assisted synthesis, efficient and expedite procedures for preparation of a library of fusaric acid and 39 analogues are reported. The fusaric acid analogues were tested in cell-based screening assays for inhibition of the las and rhl quorum sensing system in Pseudomonas aeruginosa and the lux quorum sensing system in Vibrio fischeri. Eight of the 40 compounds in the library including fusaric acid inhibited lux quorum sensing and one compound inhibited activity of the las quorum sensing system. To our delight, none of the compounds showed growth inhibitory effects in the tested concentration ranges.

  16. Phthalazine PDE4 inhibitors. Part 3: the synthesis and in vitro evaluation of derivatives with a hydrogen bond acceptor.

    PubMed

    Napoletano, Mauro; Norcini, Gabriele; Pellacini, Franco; Marchini, Francesco; Morazzoni, Gabriele; Fattori, Raimondo; Ferlenga, Pierpaolo; Pradella, Lorenzo

    2002-01-07

    This communication describes the synthesis and in vitro evaluation of a novel and potent series of phthalazine phosphodiesterase type (IV) (PDE4) inhibitors. The interaction with two distinct polar binding sites allowed us to eliminate the cyclopentyloxy substitution from rolipram-like analogues.

  17. Phthalazine PDE4 inhibitors. Part 2: the synthesis and biological evaluation of 6-methoxy-1,4-disubstituted derivatives.

    PubMed

    Napoletano, M; Norcini, G; Pellacini, F; Marchini, F; Morazzoni, G; Ferlenga, P; Pradella, L

    2001-01-08

    This communication describes the synthesis and in vitro evaluation of a novel and potent series of phosphodiesterase type IV (PDE4) inhibitors. The compounds described present substituents in position 4 of the phthalazine ring to replace the commonly observed cyclopentyloxy moiety of rolipram analogues. Preliminary evidences of reduced side effects compared to standards and improved pharmacokinetic properties for selected derivatives are also reported.

  18. Infusion of protein synthesis inhibitors in the entorhinal cortex blocks consolidation but not reconsolidation of object recognition memory.

    PubMed

    Lima, Ramón H; Rossato, Janine I; Furini, Cristiane R; Bevilaqua, Lia R; Izquierdo, Iván; Cammarota, Martín

    2009-05-01

    Memory consolidation and reconsolidation require the induction of protein synthesis in some areas of the brain. Here, we show that infusion of the protein synthesis inhibitors anisomycin, emetine and cycloheximide in the entorhinal cortex immediately but not 180 min or 360 min after training in an object recognition learning task hinders long-term memory retention without affecting short-term memory or behavioral performance. Inhibition of protein synthesis in the entorhinal cortex after memory reactivation involving either a combination of familiar and novel objects or two familiar objects does not affect retention. Our data suggest that protein synthesis in the entorhinal cortex is necessary early after training for consolidation of object recognition memory. However, inhibition of protein synthesis in this cortical region after memory retrieval does not seem to affect the stability of the recognition trace.

  19. Structure of malonic acid-based inhibitors bound to human neutrophil collagenase. A new binding mode explains apparently anomalous data.

    PubMed Central

    Brandstetter, H.; Engh, R. A.; Von Roedern, E. G.; Moroder, L.; Huber, R.; Bode, W.; Grams, F.

    1998-01-01

    Matrix metalloproteinases (MMPs) are a family of zinc endopeptidases, which have been implicated in various disease processes. Various classes of MMP inhibitors, including hydroxamic acids, phosphinic acids, and thiols, have been previously described. Most of these mimic peptides, and most likely bind analogous to the corresponding peptide substrates. Among the hydroxamic acids, malonic acid derivatives have been used as MMP inhibitors, although optimization of their inhibition potency was not successful. Here we report the design of malonic acid-based inhibitors using the X-ray structure of a collagenase/inhibitor complex, which revealed a nonsubstrate-like binding mode. The proposed beta-type turn-like conformation for the improved inhibitors was confirmed by X-ray crystallography. The observation of nonsubstrate-like binding confirms the original strategy for structure-based modeling of improved malonic acid inhibitors, and explains kinetic data that are inconsistent with substrate-like binding. Detailed interactions for the improved inhibitors seen in the crystal structure also suggest possibilities for further modifications in cycles of structure based drug design. Indeed, we have designed nonpeptidic inhibitors with approximately 500-fold improved inhibition based on these structures. PMID:9655333

  20. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  1. Evaluation of a diverse set of potential P1 carboxylic acid bioisosteres in hepatitis C virus NS3 protease inhibitors.

    PubMed

    Rönn, Robert; Gossas, Thomas; Sabnis, Yogesh A; Daoud, Hanna; Kerblom, Eva; Danielson, U Helena; Sandström, Anja

    2007-06-15

    There is an urgent need for more efficient therapies for people infected with hepatitis C virus (HCV). HCV NS3 protease inhibitors have shown proof-of-concept in clinical trials, which make the virally encoded NS3 protease an attractive drug target. Product-based NS3 protease inhibitors comprising a P1 C-terminal carboxylic acid have shown to be effective and we were interested in finding alternatives to this crucial carboxylic acid group. Thus, a series of diverse P1 functional groups with different acidity and with possibilities to form a similar, or an even more powerful, hydrogen bond network as compared to the carboxylic acid were synthesized and incorporated into potential inhibitors of the NS3 protease. Biochemical evaluation of the inhibitors was performed in both enzyme and cell-based assays. Several non-acidic C-terminal groups, such as amides and hydrazides, were evaluated but failed to produce inhibitors more potent than the corresponding carboxylic acid inhibitor. The tetrazole moiety, although of similar acidity to a carboxylic acid, provided an inhibitor with mediocre potencies in both assays. However, the acyl cyanamide and the acyl sulfinamide groups rendered compounds with low nanomolar inhibitory potencies and were more potent than the corresponding carboxylic acid inhibitor in the enzymatic assay. Additionally, results from a pH-study suggest that the P(1) C-terminal of the inhibitors comprising a carboxylic acid, an acyl sulfonamide or an acyl cyanamide group binds in a similar mode in the active site of the NS3 protease.

  2. Circadian control of bile acid synthesis by a KLF15-Fgf15 axis

    PubMed Central

    Han, Sean (Shuxin); Zhang, Rongli; Jain, Rajan; Shi, Hong; Zhang, Lilei; Zhou, Guangjin; Sangwung, Panjamaporn; Tugal, Derin; Atkins, G. Brandon; Prosdocimo, Domenick A.; Lu, Yuan; Han, Xiaonan; Tso, Patrick; Liao, Xudong; Epstein, Jonathan A.; Jain, Mukesh K.

    2015-01-01

    Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15 signalling axis that regulates circadian BA production. Systemic Klf15 deficiency disrupted circadian expression of key BA synthetic enzymes, tissue BA levels and triglyceride/cholesterol absorption. Studies in liver-specific Klf15-knockout mice suggested a non-hepatic basis for regulation of BA production. Ileal Fgf15 is a potent inhibitor of BA synthesis. Using a combination of biochemical, molecular and functional assays (including ileectomy and bile duct catheterization), we identify KLF15 as the first endogenous negative regulator of circadian Fgf15 expression. Elucidation of this novel pathway controlling circadian BA production has important implications for physiologic control of nutrient availability and metabolic homeostasis. PMID:26040986

  3. Design and Synthesis of New Benzimidazole and Pyrimidine Derivatives as α-glucosidase Inhibitor.

    PubMed

    Mobinikhaledi, Akbar; Asghari, Behvar; Jabbarpour, Mahsa

    2015-01-01

    In an endeavor to find a novel series of antihyperglycemic agents, new benzimidazole and pyrimidine derivatives were successfully synthesized efficiently in high yield with high purity, starting from amino acids in the presence of phosphorus oxychloride (POCl3). The synthesized compounds were identified by (1)H-NMR, (13)C-NMR, FT-IR spectroscopic techniques and elemental analysis. All products were assayed for their inhibitory effects on yeast and rat intestinal α-glucosidases. The results revealed that compounds with aromatic amino acids moiety showed significant inhibition activity on the tested enzymes. Among the benzimidazole derivatives 4c and 4d exhibited the best activity against both of the tested enzymes. Also, among the pyrimidine derivatives 5c and 5d possessed significant inhibition action on the enzymes. The IC50 values for the most potent benzimidazole yeast and intestinal α-glucosidases inhibitor (4d) were found to be 9.1 and 36.7 µM, respectively. The IC50 values for the inhibition of yeast and intestinal α-glucosidases by the most active pyrimidine compound (5d) were calculated to be 8.3 and 21.8 µM, respectively. Overall, this study proved that benzimidazole and pyrimidine derivatives with aromatic amino acids moieties can represent novel promising α-glucosidase inhibitors.

  4. Design and Synthesis of New Benzimidazole and Pyrimidine Derivatives as α-glucosidase Inhibitor

    PubMed Central

    Mobinikhaledi, Akbar; Asghari, Behvar; Jabbarpour, Mahsa

    2015-01-01

    In an endeavor to find a novel series of antihyperglycemic agents, new benzimidazole and pyrimidine derivatives were successfully synthesized efficiently in high yield with high purity, starting from amino acids in the presence of phosphorus oxychloride (POCl3). The synthesized compounds were identified by 1H-NMR, 13C-NMR, FT-IR spectroscopic techniques and elemental analysis. All products were assayed for their inhibitory effects on yeast and rat intestinal α-glucosidases. The results revealed that compounds with aromatic amino acids moiety showed significant inhibition activity on the tested enzymes. Among the benzimidazole derivatives 4c and 4d exhibited the best activity against both of the tested enzymes. Also, among the pyrimidine derivatives 5c and 5d possessed significant inhibition action on the enzymes. The IC50 values for the most potent benzimidazole yeast and intestinal α-glucosidases inhibitor (4d) were found to be 9.1 and 36.7 µM, respectively. The IC50 values for the inhibition of yeast and intestinal α-glucosidases by the most active pyrimidine compound (5d) were calculated to be 8.3 and 21.8 µM, respectively. Overall, this study proved that benzimidazole and pyrimidine derivatives with aromatic amino acids moieties can represent novel promising α-glucosidase inhibitors. PMID:26330860

  5. Synthesis and evaluation of fluorobenzoylated di- and tripeptides as inhibitors of cyclooxygenase-2 (COX-2).

    PubMed

    Sharma, Sai Kiran; Al-Hourani, Baker Jawabrah; Wuest, Melinda; Mane, Jonathan Y; Tuszynski, Jack; Baracos, Vickie; Suresh, Mavanur; Wuest, Frank

    2012-04-01

    A series of fluorobenzoylated di- and tripeptides as potential leads for the development of molecular probes for imaging of COX-2 expression was prepared according to standard Fmoc-based solid-phase peptide synthesis. All peptides were assessed for their COX-2 inhibitory potency and selectivity profile in a fluorescence-based COX binding assay. Within the series of 15 peptides tested, cysteine-containing peptides numbered 7, 8, 11 and 12, respectively, were the most potent COX-2 inhibitors possessing IC(50) values ranging from 5 to 85 μM. Fluorobenzoylated tripeptides 7 and 8 displayed some COX-2 selectivity (COX-2 selectivity index 2.1 and 1.6), whereas fluorobenzoylated dipeptides 11 and 12 were shown not to be COX-2 selective. Fluorbenzoylated tripeptide FB-Phe-Cys-Ser-OH was further used in molecular modeling docking studies to determine the binding mode within the active site of the COX-2 enzyme.

  6. Novel peptidomimetics as BACE-1 inhibitors: synthesis, molecular modeling, and biological studies.

    PubMed

    Butini, Stefania; Gabellieri, Emanuele; Brindisi, Margherita; Casagni, Alice; Guarino, Egeria; Huleatt, Paul B; Relitti, Nicola; La Pietra, Valeria; Marinelli, Luciana; Giustiniano, Mariateresa; Novellino, Ettore; Campiani, Giuseppe; Gemma, Sandra

    2013-01-01

    Aiming at identifying new scaffolds for BACE-1 inhibition devoid of the pharmacokinetic drawbacks of peptide-like structures, we investigated a series of novel peptidomimetics based on a 1,4-benzodiazepine (BDZ) core 1a-h and their seco-analogues 2a-d. We herein discuss synthesis, molecular modeling and in vitro studies which, starting from 1a, led to the seco-analogues (R)-2c and (S)-2d endowed with BACE-1 inhibition properties in the micromolar range both on the isolated enzyme and in cellular studies. These data can encourage to pursue these analogues as hits for the development of a new series of BACE-1 inhibitors active on whole-cells.

  7. An inhibitor of chondroitin sulfate proteoglycan synthesis promotes central nervous system remyelination

    PubMed Central

    Keough, Michael B.; Rogers, James A.; Zhang, Ping; Jensen, Samuel K.; Stephenson, Erin L.; Chen, Tieyu; Hurlbert, Mitchel G.; Lau, Lorraine W.; Rawji, Khalil S.; Plemel, Jason R.; Koch, Marcus; Ling, Chang-Chun; Yong, V. Wee

    2016-01-01

    Remyelination is the generation of new myelin sheaths after injury facilitated by processes of differentiating oligodendrocyte precursor cells (OPCs). Although this repair phenomenon occurs in lesions of multiple sclerosis patients, many lesions fail to completely remyelinate. A number of factors have been identified that contribute to remyelination failure, including the upregulated chondroitin sulfate proteoglycans (CSPGs) that comprise part of the astrogliotic scar. We show that in vitro, OPCs have dramatically reduced process outgrowth in the presence of CSPGs, and a medication library that includes a number of recently reported OPC differentiation drugs failed to rescue this inhibitory phenotype on CSPGs. We introduce a novel CSPG synthesis inhibitor to reduce CSPG content and find rescued process outgrowth from OPCs in vitro and accelerated remyelination following focal demyelination in mice. Preventing CSPG deposition into the lesion microenvironment may be a useful strategy to promote repair in multiple sclerosis and other neurological disorders. PMID:27115988

  8. Larvicidal Activity of Novaluron, a Chitin Synthesis Inhibitor, Against the Housefly, Musca domestica

    PubMed Central

    Cetin, Huseyin; Erler, Fedai; Yanikoglu, Atila

    2006-01-01

    A chitin synthesis inhibitor, novaluron, was evaluated under laboratory conditions for its larvicidal activity against a field population of the housefly, Musca domestica L. (Diptera: Muscidae), by feeding and dipping methods. The concentrations used were 1, 2.5, 5, 10 and 20 mg a.i./kg in both methods. The product caused >80% larval mortality at 10 and 20 mg a.i./kg. Of the two methods, feeding was more effective for larvicidal activity at doses above 2.5 mg a.i./kg. After 72 hours, the LC50 and LC90 values were 1.66 and 8.25 mg a.i./kg, respectively, with the feeding method; and 2.72 and 17.88 mg a.i./kg, respectively, using the dipping method. The results showed that the product provided good control of housefly larvae and would greatly reduce adult emergence.

  9. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  10. Design, Synthesis and Evaluation of Marinopyrrole Derivatives as Selective Inhibitors of Mcl-1 Binding to Pro-apoptotic Bim and Dual Mcl-1/Bcl-xL Inhibitors

    PubMed Central

    Li, Rongshi; Daniel, Kenyon G.; Li, Jerry; Qin, Yong; Gavathiotis, Evripidis; Sebti, Said M.

    2015-01-01

    Inhibition of anti-apoptotic Mcl-1 is a promising anticancer strategy to overcome the survival and chemoresistance of a broad spectrum of human cancers. We previously reported on the identification of a natural product marinopyrrole A (1) that induces apoptosis in Mcl-1-dependent cells through Mcl-1 degradation. Here, we report the design and synthesis of novel marinopyrrole-based analogues and their evaluation as selective inhibitors of Mcl-1 as well as dual Mcl-1/Bcl-xL inhibitors. The most selective Mcl-1 antagonists were 34, 36 and 37 with 16-, 13- and 9-fold more selectivity for disrupting Mcl-1/Bim over Bcl-xL/Bim binding, respectively. Among the most potent dual inhibitors is 42 which inhibited Mcl-1/Bim and Bcl-xL/Bim binding 15-fold (IC50 = 600 nM) and 33-fold (500 nM) more potently than (±)-marinopyrrole A (1), respectively. Fluorescence quenching, NMR analysis and molecular docking indicated binding of marinopyrroles to the BH3 binding site of Mcl-1. Several marinopyrroles potently decreased Mcl-1 cellular levels and induced caspase 3 activation in human breast cancer cells. Our studies provide novel “lead” marinopyrroles for further optimization as selective Mcl-1 inhibitors and dual Mcl-1 and Bcl-xL inhibitors. PMID:25437618

  11. Glycolysis, Glutaminolysis and Fatty Acid Synthesis are Required for Distinct Stages of KSHV Lytic Replication.

    PubMed

    Sanchez, Erica L; Pulliam, Thomas H; Dimaio, Terri A; Thalhofer, Angel B; Delgado, Tracie; Lagunoff, Michael

    2017-03-08

    Kaposi's Sarcoma-associated Herpesvirus (KSHV) is the etiologic agent of Kaposi's Sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including glycolysis, glutaminolysis and fatty acid synthesis (FAS) for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription while glutaminolysis is necessary for early gene translation, but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions, but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are non-infectious indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication providing novel therapeutic avenues for KS tumors.IMPORTANCE KSHV is the etiologic agent of Kaposi's Sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state where there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation. Our previous findings showed that

  12. Green Synthesis and Urease Inhibitory Activity of Spiro-Pyrimidinethiones/Spiro-Pyrimidinones-Barbituric Acid Derivatives

    PubMed Central

    Mohammadi Ziarani, Ghodsi; Asadi, Shima; Faramarzi, Sakineh; Amanlou, Massoud

    2015-01-01

    Sulfonic acid functionalized SBA-15 (SBA-Pr-SO3H) with pore size 6 nm as an efficient heterogeneous nanoporous solid acid catalyst exhibited good catalytic activity in the Biginelli-like reaction in the synthesis of spiroheterobicyclic rings with good yield and good recyclability. Spiro-pyrimidinethiones/spiro-pyrimidinones-barbituric acid derivatives were synthesized in a simple and efficient method using the one-pot three-component reaction of a cyclic 1,3- dicarbonyl compounds (barbituric acid), an aromatic aldehyde and urea or thiourea in the presence of nanoporous silica SBA-Pr-SO3H under solvent free conditions. Urease inhibitory activity of spiro compounds were tested against Jack bean urease using Berthelot alkaline phenol–hypochlorite method. Five of 13 compounds were inhibitor and two of them were enzyme activators. Analysis of the docking results showed that, in most of the spiro molecules, one of the carbonyl groups is coordinated with both nickel atoms, while the other one is involved in the formation of hydrogen bonds with important active-site residues. The effect of inserting two methyl groups on N atoms of barbiturate ring, S substituted, ortho, meta and para substituted compounds were investigated too. PMID:26664377

  13. Acid sphingomyelinase inhibitors normalize pulmonary ceramide and inflammation in cystic fibrosis.

    PubMed

    Becker, Katrin Anne; Riethmüller, Joachim; Lüth, Anja; Döring, Gerd; Kleuser, Burkhard; Gulbins, Erich

    2010-06-01

    Employing genetic mouse models we have recently shown that ceramide accumulation is critically involved in the pathogenesis of cystic fibrosis (CF) lung disease. Genetic or systemic inhibition of the acid sphingomyelinase (Asm) is not feasible for treatment of patients or might cause adverse effects. Thus, a manipulation of ceramide specifically in lungs of CF mice must be developed. We tested whether inhalation of different acid sphingomyelinase inhibitors does reduce Asm activity and ceramide accumulation in lungs of CF mice. The efficacy and specificity of the drugs was determined. Ceramide was determined by mass spectrometry, DAG-kinase assays, and fluorescence microscopy. We determined pulmonary and systemic Asm activity, neutral sphingomyelinase (Nsm), ceramide, cytokines, and infection susceptibility. Mass spectroscopy, DAG-kinase assays, and semiquantitative immune fluorescence microscopy revealed that a standard diet did not influence ceramide in bronchial respiratory epithelial cells, while a diet with Peptamen severely affected the concentration of sphingolipids in CF lungs. Inhalation of the Asm inhibitors amitriptyline, trimipramine, desipramine, chlorprothixene, fluoxetine, amlodipine, or sertraline restored normal ceramide concentrations in murine bronchial epithelial cells, reduced inflammation in the lung of CF mice and prevented infection with Pseudomonas aeruginosa. All drugs showed very similar efficacy. Inhalation of the drugs was without systemic effects and did not inhibit Nsm. These findings employing several structurally different Asm inhibitors identify Asm as primary target in the lung to reduce ceramide concentrations. Inhaling an Asm inhibitor may be a beneficial treatment for CF, with minimal adverse systemic effects.

  14. Discovery and Characterization of Diazenylaryl Sulfonic Acids as Inhibitors of Viral and Bacterial Neuraminidases.

    PubMed

    Hoffmann, Anja; Richter, Martina; von Grafenstein, Susanne; Walther, Elisabeth; Xu, Zhongli; Schumann, Lilia; Grienke, Ulrike; Mair, Christina E; Kramer, Christian; Rollinger, Judith M; Liedl, Klaus R; Schmidtke, Michaela; Kirchmair, Johannes

    2017-01-01

    Viral neuraminidases are an established drug target to combat influenza. Severe complications observed in influenza patients are primarily caused by secondary infections with e.g., Streptococcus pneumoniae. These bacteria engage in a lethal synergism with influenza A viruses (IAVs) and also express neuraminidases. Therefore, inhibitors with dual activity on viral and bacterial neuraminidases are expected to be advantageous for the treatment of influenza infections. Here we report on the discovery and characterization of diazenylaryl sulfonic acids as dual inhibitors of viral and Streptococcus pneumoniae neuraminidase. The initial hit came from a virtual screening campaign for inhibitors of viral neuraminidases. For the most active compound, 7-[2-[4-[2-[4-[2-(2-hydroxy-3,6-disulfo-1-naphthalenyl)diazenyl]-2-methylphenyl]diazenyl]-2-methylphenyl]diazenyl]-1,3-naphthalenedisulfonic acid (NSC65847; 1), the Ki-values measured in a fluorescence-based assay were lower than 1.5 μM for both viral and pneumococcal neuraminidases. The compound also inhibited N1 virus variants containing neuraminidase inhibitor resistance-conferring substitutions. Via enzyme kinetics and nonlinear regression modeling, 1 was suggested to impair the viral neuraminidases and pneumococcal neuraminidase with a mixed-type inhibition mode. Given its antiviral and antipneumococcal activity, 1 was identified as a starting point for the development of novel, dual-acting anti-infectives.

  15. Discovery and Characterization of Diazenylaryl Sulfonic Acids as Inhibitors of Viral and Bacterial Neuraminidases

    PubMed Central

    Hoffmann, Anja; Richter, Martina; von Grafenstein, Susanne; Walther, Elisabeth; Xu, Zhongli; Schumann, Lilia; Grienke, Ulrike; Mair, Christina E.; Kramer, Christian; Rollinger, Judith M.; Liedl, Klaus R.; Schmidtke, Michaela; Kirchmair, Johannes

    2017-01-01

    Viral neuraminidases are an established drug target to combat influenza. Severe complications observed in influenza patients are primarily caused by secondary infections with e.g., Streptococcus pneumoniae. These bacteria engage in a lethal synergism with influenza A viruses (IAVs) and also express neuraminidases. Therefore, inhibitors with dual activity on viral and bacterial neuraminidases are expected to be advantageous for the treatment of influenza infections. Here we report on the discovery and characterization of diazenylaryl sulfonic acids as dual inhibitors of viral and Streptococcus pneumoniae neuraminidase. The initial hit came from a virtual screening campaign for inhibitors of viral neuraminidases. For the most active compound, 7-[2-[4-[2-[4-[2-(2-hydroxy-3,6-disulfo-1-naphthalenyl)diazenyl]-2-methylphenyl]diazenyl]-2-methylphenyl]diazenyl]-1,3-naphthalenedisulfonic acid (NSC65847; 1), the Ki-values measured in a fluorescence-based assay were lower than 1.5 μM for both viral and pneumococcal neuraminidases. The compound also inhibited N1 virus variants containing neuraminidase inhibitor resistance-conferring substitutions. Via enzyme kinetics and nonlinear regression modeling, 1 was suggested to impair the viral neuraminidases and pneumococcal neuraminidase with a mixed-type inhibition mode. Given its antiviral and antipneumococcal activity, 1 was identified as a starting point for the development of novel, dual-acting anti-infectives. PMID:28261167

  16. Structure-activity relationship analysis of the peptide deformylase inhibitor 5-bromo-1H-indole-3-acetohydroxamic acid.

    PubMed

    Petit, Sylvain; Duroc, Yann; Larue, Valéry; Giglione, Carmela; Léon, Carole; Soulama, Coralie; Denis, Alexis; Dardel, Frédéric; Meinnel, Thierry; Artaud, Isabelle

    2009-02-01

    The lead compound 5-bromoindolyl-3-acetohydroxamic acid (10) was recently identified as a potent inhibitor of bacterial peptide deformylases (PDFs). The synthesis and associated activities of new variants were investigated at position 5 to optimize the fit at the S1' subsite and at position 1 to improve both potency and antibacterial activity. A morphomimetic series, termed "reverse-indole" was synthesized. The indole derivatives remain selective in vitro inhibitors of PDF2 over PDF1. Bromide is the best group at position 5 and cannot be replaced by bulkier substituents. In this series, an N-benzyl group at position 1 in 19 e improves the potency relative to 10. In the case of PDF1, and unlike PDF2, potency is increased as the alkyl chain becomes longer and more ramified. These data support the results of NMR footprinting experiments that were performed with (15)N-labeled Ni-PDF and the corresponding 3-acetic acid derivatives. Most of the compounds have antibacterial activities toward B. subtilis, but are inefficient toward E. coli owing to active removal by the major efflux pumps. Among the reverse-indole derivatives, 23 c, which is the exact mirror image of 19 e, shows strong potency in vitro against PDF2, but little against PDF1, although this compound displays significant antibacterial activity toward an efflux-minus mutant of E. coli. All the compounds were assessed with major pathogenic bacteria, but most of them are inefficient antibacterial agents. The reverse-indole compounds 23 a and 23 c have potency against S. pneumoniae that is similar to that of actinonin.

  17. Synthesis of novel polybrominated benzimidazole derivatives-potential CK2 inhibitors with anticancer and proapoptotic activity.

    PubMed

    Łukowska-Chojnacka, Edyta; Wińska, Patrycja; Wielechowska, Monika; Poprzeczko, Martyna; Bretner, Maria

    2016-02-15

    The efficient method for the synthesis of novel cell permeable inhibitors of protein kinase CK2 with anticancer and proapoptotic activity has been developed. A series of polybrominated benzimiadazole derivatives substituted by various cyanoalkyl groups have been synthesized. Cyanoethyl derivatives were obtained by Michael type addition of 4,5,6,7-tetrabromo-1H-benzimidazole (TBBi) and 4,5,6,7-tetrabromo-2-methyl-1H-benzimidazole to acrylonitrile, whilst cyanomethyl, cyanopropyl and cyanobutyl analogs by N-alkylation of 4,5,6,7-tetrabromo-1H-benzimidazole and 4,5,6,7-tetrabromo-2-methyl-1H-benzimidazole with appropriate cyanoalkyl halides. The inhibitory activity against protein kinase rhCK2α catalytic subunit and cytotoxicity against two human cancer cell lines: acute lymphocytic leukemia (CCRF-CEM) and breast (MCF-7) were evaluated for all newly synthesized compounds. Additionally, the proapoptotic activity toward leukemia cells and intracellular inhibition of CK2 for the most cytotoxic derivatives have been performed, demonstrating 4,5,6,7-tetrabromo-2-methyl-1H-benzimidazole as a new selective inhibitor of rhCK2 with twenty-fold better proapoptotic activity than parental compound (TBBi).

  18. Stimulators and inhibitors of lymphocyte DNA synthesis in supernatants from human lymphoid cell lines.

    PubMed

    Vesole, D H; Goust, J M; Fett, J W; Fudenberg, H H

    1979-09-01

    Some T and B lymphoid cell lines (LCL) were found to secrete into their supernatants a substance able to stimulate lymphocyte proliferation. This substance produced an increase in [3H]thymidine uptake by mononuclear cells when added to unstimulated cultures (mitogenic effect) or when added to cultures stimulated with phytohemagglutinin (PHA) or pokeweed mitogen (PWM) (potentiating effect). When complete supernatants were used, the potentiating effect was sometimes masked by an inhibitor of DNA synthesis. Fractionation on Sephadex G-100 separated these two activities. The stimulatory substance eluted at a m.w. range of 15,000 to 30,000, and the inhibitor eluted with the albumin peak. B cells with or without monocytes were the most sensitive to the mitogenic effect, whereas T cells were unaffected. Responses to PHA and PWM were potentiated when T cells were present, but the maximum effect was observed when the proportion of T cells was less than 50%. The stimulatory material may be similar to lymphocyte mitogenic factor and may function as a T cell-replacing factor in B cell stimulation.

  19. Design, synthesis, and structure-activity relationship studies of a potent PACE4 inhibitor.

    PubMed

    Kwiatkowska, Anna; Couture, Frédéric; Levesque, Christine; Ly, Kévin; Desjardins, Roxane; Beauchemin, Sophie; Prahl, Adam; Lammek, Bernard; Neugebauer, Witold; Dory, Yves L; Day, Robert

    2014-01-09

    PACE4 plays an important role in the progression of prostate cancer and is an attractive target for the development of novel inhibitor-based tumor therapies. We previously reported the design and synthesis of a novel, potent, and relatively selective PACE4 inhibitor known as a Multi-Leu (ML) peptide. In the present work, we examined the ML peptide through detailed structure-activity relationship studies. A variety of ML-peptide analogues modified at the P8-P5 positions with leucine isomers (Nle, DLeu, and DNle) or substituted at the P1 position with arginine mimetics were tested for their inhibitory activity, specificity, stability, and antiproliferative effect. By incorporating d isomers at the P8 position or a decarboxylated arginine mimetic, we obtained analogues with an improved stability profile and excellent antiproliferative properties. The DLeu or DNle residue also has improved specificity toward PACE4, whereas specificity was reduced for a peptide modified with the arginine mimetic, such as 4-amidinobenzylamide.

  20. Review of synthesis, assay, and prediction of β and γ-secretase inhibitors.

    PubMed

    Niño, Helena; Rodríguez-Borges, José Enrique; García-Mera, Xerardo; Prado-Prado, Francisco

    2012-01-01

    Alzheimer's disease (AD) is characterize with several pathologies this disease, amyloid plaques, composed of the β-amyloid peptide and β-amyloid peptide are hallmark neuropathological lesions in Alzheimer's disease brain. Indeed, a wealth of evidence suggests that β-amyloid is central to the pathophysiology of AD and is likely to play an early role in this intractable neurodegenerative disorder. AD is the most prevalent form of dementia, and current indications show that twenty-nine million people live with AD worldwide, a figure expected rise exponentially over the coming decades. Clearly, blocking disease progression or, in the best-case scenario, preventing AD altogether would be of benefit in both social and economic terms. However, current AD therapies are merely palliative and only temporarily slow cognitive decline, and treatments that address the underlying pathologic mechanisms of AD are completely lacking. While familial AD (FAD) is caused by autosomal dominant mutations in either amyloid precursor protein (APP) or the presenilin (PS1, PS2) genes. First, we revised Desing, synthesis, and Biological assay of β and γ-secretase inhibitors. Next, we review 2D QSAR, 3D QSAR, CoMFA, CoMSIA and Docking with different compound to find out the structural requirements. Next, we revised QSAR studies using method of Artificial Neural Network (ANN) in order to understand the essential structural requirement for binding with receptor for β and γ-secretase inhibitors.

  1. Synthesis and biological evaluation of di-aryl urea derivatives as c-Kit inhibitors.

    PubMed

    Ravez, Séverine; Arsenlis, Stéphane; Barczyk, Amélie; Dupont, Anthony; Frédérick, Raphaël; Hesse, Stéphanie; Kirsch, Gilbert; Depreux, Patrick; Goossens, Laurence

    2015-11-15

    Inhibition of receptor tyrosine kinases (RTKs) continued to be a successful approach for the treatment of many types of human cancers and many potent small molecules kinase inhibitors have been discovered the last decade. In the present study, we describe the synthesis of thienopyrimidine derivatives and their pharmacological evaluation against nine kinases (EGFR, PDGFR-ß, c-Kit, c-Met, Src, Raf, VEGFR-1, -2 and -3). Most of the synthesized compounds showed from moderate to potent activities against c-Kit with IC50 values in the nanomolar range. Among them, 4-anilino(urea)thienopyrimidine analogs showed selectivity and potent c-Kit inhibition with IC50 values less than 6 nM. Docking simulation was performed for the most promising compound 9 into the c-Kit active site to determine the potential binding mode. This study reveal that the 4-anilino(urea)thienopyrimidine is an interesting scaffold to design novel potent and selective c-Kit inhibitors which may make promising candidates for cancers where c-Kit receptors are overexpressed.

  2. Synthesis and evaluation of inhibitors of bacterial drug efflux pumps of the major facilitator superfamily.

    PubMed

    Okandeji, Babajide O; Greenwald, Daniel M; Wroten, Jessica; Sello, Jason K

    2011-12-15

    Inhibitors of drug efflux pumps have great potential as pharmacological agents that restore the drug susceptibility of multidrug resistant bacterial pathogens. Most attention has been focused on the discovery of small molecules that inhibit the resistance nodulation division (RND) family drug efflux pumps in Gram-negative bacteria. The prototypical inhibitor of RND-family efflux pumps in Gram-negative bacteria is MC-207,110 (Phe-Arg-β-naphthylamide), a C-capped dipeptide. Here, we report that C-capped dipeptides inhibit two chloramphenicol-specific efflux pumps in Streptomyces coelicolor, a Gram-positive bacterium that is a relative of the human pathogen Mycobacterium tuberculosis. Diversity-oriented synthesis of a library of structurally related C-capped dipeptides via an Ugi four component reaction and screening of the resulting compounds resulted in the discovery of a compound that is threefold more potent as a suppressor of chloramphenicol resistance in S. coelicolor than MC-207,110. Since chloramphenicol resistance in S. coelicolor is mediated by major facilitator superfamily drug efflux pumps, our findings provide the first evidence that C-capped dipeptides can inhibit drug efflux pumps outside of the RND superfamily.

  3. [Controlling arachidonic acid metabolic network: from single- to multi-target inhibitors of key enzymes].

    PubMed

    Liu, Ying; Chen, Zheng; Shang, Er-chang; Yang, Kun; Wei, Deng-guo; Zhou, Lu; Jiang, Xiao-lu; He, Chong; Lai, Lu-hua

    2009-03-01

    Inflammatory diseases are common medical conditions seen in disorders of human immune system. There is a great demand for anti-inflammatory drugs. There are major inflammatory mediators in arachidonic acid metabolic network. Several enzymes in this network have been used as key targets for the development of anti-inflammatory drugs. However, specific single-target inhibitors can not sufficiently control the network balance and may cause side effects at the same time. Most inflammation induced diseases come from the complicated coupling of inflammatory cascades involving multiple targets. In order to treat these complicated diseases, drugs that can intervene multi-targets at the same time attracted much attention. The goal of this review is mainly focused on the key enzymes in arachidonic acid metabolic network, such as phospholipase A2, cyclooxygenase, 5-lipoxygenase and eukotriene A4 hydrolase. Advance in single target and multi-targe inhibitors is summarized.

  4. Structure-based approach for identification of novel phenylboronic acids as serine-β-lactamase inhibitors

    NASA Astrophysics Data System (ADS)

    Sgrignani, Jacopo; De Luca, Filomena; Torosyan, Hayarpi; Docquier, Jean-Denis; Duan, Da; Novati, Beatrice; Prati, Fabio; Colombo, Giorgio; Grazioso, Giovanni

    2016-10-01

    β-Lactamases are bacterial enzymes conferring resistance to β-lactam antibiotics in clinically-relevant pathogens, and represent relevant drug targets. Recently, the identification of new boronic acids (i.e. RPX7009) paved the way to the clinical application of these molecules as potential drugs. Here, we screened in silico a library of 1400 boronic acids as potential AmpC β-lactamase inhibitors. Six of the most promising candidates were evaluated in biochemical assays leading to the identification of potent inhibitors of clinically-relevant β-lactamases like AmpC, KPC-2 and CTX-M-15. One of the selected compounds showed nanomolar K i value with the clinically-relevant KPC-2 carbapenemase, while another one exhibited broad spectrum inhibition, being also active on Enterobacter AmpC and the OXA-48 class D carbapenemase.

  5. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  6. Isolation of 4,5-O-Dicaffeoylquinic Acid as a Pigmentation Inhibitor Occurring in Artemisia capillaris Thunberg and Its Validation In Vivo

    PubMed Central

    Tabassum, Nadia; Lee, Ji-Hyung; Yim, Soon-Ho; Batkhuu, Galzad Javzan

    2016-01-01

    There is a continual need to develop novel and effective melanogenesis inhibitors for the prevention of hyperpigmentation disorders. The plant Artemisia capillaris Thunberg (Oriental Wormwood) was screened for antipigmentation activity using murine cultured cells (B16-F10 malignant melanocytes). Activity-based fractionation using HPLC and NMR analyses identified the compound 4,5-O-dicaffeoylquinic acid as an active component in this plant. 4,5-O-Dicaffeoylquinic acid significantly reduced melanin synthesis and tyrosinase activity in a dose-dependent manner in the melanocytes. In addition, 4,5-O-dicaffeoylquinic acid treatment reduced the expression of tyrosinase-related protein-1. Significantly, we could validate the antipigmentation activity of this compound in vivo, using a zebrafish model. Moreover, 4,5-O-dicaffeoylquinic acid did not show toxicity in this animal model. Our discovery of 4,5-O-dicaffeoylquinic acid as an inhibitor of pigmentation that is active in vivo shows that this compound can be developed as an active component for formulations to treat pigmentation disorders. PMID:27528883

  7. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology

    2000-08-01

    Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer PRINCIPAL INVESTIGATOR: Francis P. Kuhajda, M.D. CONTRACTING ORGANIZATION...SUBTITLE 5. FUNDING NUMBERS Xenograft Studies of Fatty Acid Synthesis DAMD17-96-1-6235 Inhibition as Novel Therapy for Breast Cancer 6. AUTHOR(S...5012. 13. ABSTRACT (Maximum 200 Words) This grant proposed to study the effect of fatty acid synthesis inhibition in human breast cancer xenografts

  8. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  9. The NADPH oxidase inhibitor apocynin induces nitric oxide synthesis via oxidative stress

    SciTech Connect

    Riganti, Chiara

    2008-05-01

    We have recently shown that apocynin elicits an oxidative stress in N11 mouse glial cells and other cell types. Here we report that apocynin increased the accumulation of nitrite, the stable derivative of nitric oxide (NO), in the extracellular medium of N11 cell cultures, and the NO synthase (NOS) activity in cell lysates. The increased synthesis of NO was associated with increased expression of inducible NOS (iNOS) mRNA, increased nuclear translocation of the redox-sensitive transcription factor NF-{kappa}B and decreased intracellular level of its inhibitor IkB{alpha}. These effects, accompanied by increased production of H{sub 2}O{sub 2}, were very similar to those observed after incubation with bacterial lipopolysaccharide (LPS) and were inhibited by catalase. These results suggest that apocynin, similarly to LPS, induces increased NO synthesis by eliciting a generation of reactive oxygen species (ROS), which in turn causes NF-{kappa}B activation and increased expression of iNOS. Therefore, the increased bioavailability of NO reported in the literature after in vivo or in vitro treatments with apocynin might depend, at least partly, on the drug-elicited induction of iNOS, and not only on the inhibition of NADPH oxidase and the subsequent decreased scavenging of NO by oxidase-derived ROS, as it is often supposed.

  10. Synthesis and NMR structure of p41icf, a potent inhibitor of human cathepsin L.

    PubMed

    Chiva, Cristina; Barthe, Philippe; Codina, Anna; Gairí, Margarida; Molina, Franck; Granier, Claude; Pugnière, Martine; Inui, Tatsuya; Nishio, Hideki; Nishiuchi, Yuji; Kimura, Terutoshi; Sakakibara, Shumpei; Albericio, Fernando; Giralt, Ernest

    2003-02-12

    The total synthesis and structural characterization of the MHCII-associated p41 invariant chain fragment (P41icf) is described. P41icf plays a crucial role in the maturation of MHC class II molecules and antigen processing, acting as a highly selective cathepsin L inhibitor. P41icf synthesis was achieved using a combined solid-phase/solution approach. The entire molecule (65 residues, 7246 Da unprotected) was assembled in solution from fully protected peptides in the size range of 10 residues. After deprotection, oxidative folding in carefully adjusted experimental conditions led to the completely folded and functional P41icf with a disulfide pairing identical to that of native P41icf. CD, NMR, and surface plasmon resonance (SPR) were used for the structural and functional characterization of synthetic P41icf. CD thermal denaturation showed clear cooperative behavior. Tight cathepsin L binding was demonstrated by SPR. (1)H NMR spectroscopy at 800 MHz of unlabeled P41icf was used to solve the three-dimensional structure of the molecule. P41icf behaves as a well-folded protein domain with a topology very close to the crystallographic cathepsin L-bound form.

  11. Synthesis and biological evaluation of triazol-4-ylphenyl-bearing histone deacetylase inhibitors as anticancer agents.

    PubMed

    He, Rong; Chen, Yufeng; Chen, Yihua; Ougolkov, Andrei V; Zhang, Jin-San; Savoy, Doris N; Billadeau, Daniel D; Kozikowski, Alan P

    2010-02-11

    Our triazole-based histone deacetylase inhibitor (HDACI), octanedioic acid hydroxyamide[3-(1-phenyl-1H-[1,2,3]triazol-4-yl)phenyl]amide (4a), suppresses pancreatic cancer cell growth in vitro with the lowest IC(50) value of 20 nM against MiaPaca-2 cell. In this study, we continued our efforts to develop triazol-4-ylphenyl bearing hydroxamate analogues by embellishing the terminal phenyl ring of 4a with different substituents. The isoform inhibitory profile of these hydroxamate analogues was similar to those of 4a. All of these triazol-4-ylphenyl bearing hydroxamates are pan-HDACIs like SAHA. Moreover, compounds 4h and 11a were found to be very effective inhibitors of cancer cell growth in the HupT3 (IC(50) = 50 nM) and MiaPaca-2 (IC(50) = 40 nM) cancer cell lines, respectively. Compound 4a was found to reactivate the expression of CDK inhibitor proteins and to suppress pancreatic cancer cell growth in vivo. Taken together, these data further support the value of the triazol-4-ylphenyl bearing hydroxamates in identifying potential pancreatic cancer therapies.

  12. Products of the Black Sea alga Phyllophora nervosa as corrosion inhibitor for steel in acids

    SciTech Connect

    Popelyukh, G.M.; Andrianov, A.M.; Burtnenko, L.M.; Gazha, P.A.; Talavira, L.I.

    1986-05-01

    The authors have investigated the inhibiting properties of the processing products of the Black Sea red seaweed Phyllophora nervosa on specimens of steel St3 in phosphoric and hydrochloric acids of various concentrations at temperatures in the range from 30 to 95 /sup 0/C. They have studied how the concentrations of urotropin, sodium chloride, and Fe/sup 3 +/ ions influence the protective properties of the seaweed inhibitor. They have made preliminary investigations of the mechanisms of the protective action.

  13. Synthesis, screening and docking of small heterocycles as glycogen phosphorylase inhibitors.

    PubMed

    Schweiker, Stephanie S; Loughlin, Wendy A; Lohning, Anna S; Petersson, Maria J; Jenkins, Ian D

    2014-09-12

    A series of morpholine substituted amino acids (phenylalanine, leucine, lysine and glutamic acid) was synthesized. A fragment-based screening approach was then used to evaluate a series of small heterocycles, including morpholine, oxazoline, dihydro-1,3-oxazine, tetrahydro-1,3-oxazepine, thiazoline, tetrahydro-1,3-pyrimidine, tetrahydro-1,3-diazepine and hexahydro-1H-benzimidazole, as potential inhibitors of Glycogen Phosphorylase a. Thiazoline 7 displayed an improved potency (IC50 of 25 μM) and had good LE and LELP values, as compared to heterocycles 1, 5, 9-13 and 19 (IC50 values of 1.1 mM-23.9 mM). A docking study using the crystal structure of human liver Glycogen Phosphorylase, provided insight into the interactions of heterocycles 5, 7, 9-13 and 19 with Glycogen Phosphorylase.

  14. Effects of VMAT2 inhibitors lobeline and GZ-793A on methamphetamine-induced changes in dopamine release, metabolism and synthesis in vivo.

    PubMed

    Meyer, Andrew C; Neugebauer, Nichole M; Zheng, Guangrong; Crooks, Peter A; Dwoskin, Linda P; Bardo, Michael T

    2013-10-01

    Vesicular monoamine transporter-2 (VMAT2) inhibitors reduce methamphetamine (METH) reward in rats. The current study determined the effects of VMAT2 inhibitors lobeline (LOB; 1 or 3 mg/kg) and N-(1,2R-dihydroxylpropyl)-2,6-cis-di(4-methoxyphenethyl)piperidine hydrochloride (GZ-793A; 15 or 30 mg/kg) on METH-induced (0.5 mg/kg, SC) changes in extracellular dopamine (DA) and its metabolite dihydroxyphenylacetic acid (DOPAC) in the reward-relevant nucleus accumbens (NAc) shell using in vivo microdialysis. The effect of GZ-793A (15 mg/kg) on DA synthesis in tissue also was investigated in NAc, striatum, medial prefrontal cortex and orbitofrontal cortex. In NAc shell, METH produced a time-dependent increase in extracellular DA and decrease in DOPAC. Neither LOB nor GZ-793A alone altered extracellular DA; however, both drugs increased extracellular DOPAC. In combination with METH, LOB did not alter the effects of METH on DA; however, GZ-793A, which has greater selectivity than LOB for inhibiting VMAT2, reduced the duration of the METH-induced increase in extracellular DA. Both LOB and GZ-793A enhanced the duration of the METH-induced decrease in extracellular DOPAC. METH also increased tissue DA synthesis in NAc and striatum, whereas GZ-793A decreased synthesis; no effect of METH or GZ-793A on DA synthesis was found in medial prefrontal cortex or orbitofrontal cortex. These results suggest that selective inhibition of VMAT2 produces a time-dependent decrease in DA release in NAc shell as a result of alterations in tyrosine hydroxylase activity, which may play a role in the ability of GZ-793A to decrease METH reward.

  15. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  16. Novel bis-arylalkylamines as myeloperoxidase inhibitors: Design, synthesis, and structure-activity relationship study.

    PubMed

    Aldib, Iyas; Gelbcke, Michel; Soubhye, Jalal; Prévost, Martine; Furtmüller, Paul G; Obinger, Christian; Elfving, Betina; Alard, Ibaa Chikh; Roos, Goedele; Delporte, Cédric; Berger, Gilles; Dufour, Damien; Zouaoui Boudjeltia, Karim; Nève, Jean; Dufrasne, Francois; Van Antwerpen, Pierre

    2016-11-10

    Human myeloperoxidase (MPO) plays an important role in innate immunity but also aggravates tissue damage by oxidation of biomolecules at sites of inflammation. As a result from a recent high-throughput virtual screening approach for MPO inhibitors, bis-2,2'-[(dihydro-1,3(2H,4H) pyrimidinediyl)bis(methylene)]phenol was detected as a promising lead compound for inhibition of the MPO-typical two-electron oxidation of chloride to hypochlorous acid (IC50 = 0.5 μM). In the present pharmacomodulation study, 37 derivatives of this lead compound were designed and synthesized driven by comprehensive docking studies and the impact on the chlorination activity of MPO. We describe the structural requirements for optimum (i) binding to the heme periphery and (ii) inhibition capacity. Finally, the best three inhibitors (bis-arylalkylamine derivatives) were probed for interaction with the MPO redox intermediates Compound I and Compound II. Determined apparent bimolecular rate constants together with determination of reduction potential and nucleophilicity of the selected compounds allowed us to propose a mechanism of inhibition. The best inhibitor was found to promote the accumulation of inactive form of MPO-Compound II and has IC50 = 54 nM, demonstrating the successful approach of the drug design. Due to the similarity of ligand interactions between MPO and serotonine transporter, the selectivity of this inhibitor was also tested on the serotonin transporter providing a selectivity index of 14 (KiSERT/IC50MPO).

  17. The leaf extract of Siberian Crabapple (Malus baccata (Linn.) Borkh) contains potential fatty acid synthase inhibitors.

    PubMed

    Wei, Xiang; Zhao, Ran; Sun, Ying-Hui; Cong, Jian-Ping; Meng, Fan-Guo; Zhou, Hai-Meng

    2009-02-01

    The present work focused on the kinetics of the inhibitory effects of the leaf extract of Siberian Crabapple, named Shan jingzi in China, on chicken liver fatty acid synthase. The results showed that this extract had much stronger inhibitory ability on fatty acid synthase than that from green teas described in many previous reports. The inhibitory ability of this extract is closely related to the extracting solvent, and the time of extraction was also an important influencing factor. The inhibitory types of this extract on diffeerent substrates of chicken liver fatty acid synthase, acetyl-CoA, malonyl-CoA and NADPH, were found to be noncompetitive, uncompetitive and mixed, respectively. The studies here shed a new light on the exploration for inhibitors of fatty acid synthase.

  18. [Design, synthesis, and biological activities of histone deacetylase inhibitors with diketo ester as zinc binding group].

    PubMed

    Lu, Hui; Su, Hong; Yang, Bo; You, Qi-Dong

    2011-03-01

    Histone deacetylases (HDACs) inhibition causes hyperacetylation of histones leading to growth arrest, differentiation and apoptosis of tumor cells, representing a new strategy in cancer therapy. Many of previously reported HDACs inhibitors are hydroxamic acid derivatives, which could chelate the zinc ion in the active site in a bidentate fashion. However, hydroxamic acids occasionally have produced problems such as poor pharmacokinetics, severe toxicity and low selectivity. Herein we describe the identification of a new series of non-hydroxamate HDACs inhibitors bearing diketo ester moieties as zinc binding group. HDACs inhibition assay and antiproliferation assays in vitro against multiple cancer cell lines were used for evaluation. These compounds displayed low antiproliferative activity against solid tumor cells, while good antiproliferative activity against human leukemic monocyte lymphoma cell line U937. Compound CPUYS707 is the best with GI50 value of 0.31 micromol x L(-1) against U937 cells, which is more potent than SAHA and MS-275. HDACs inhibition activity of these compounds is lower than that expected, further evaluation is needed.

  19. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  20. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  1. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  2. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  3. The antiviral drug acyclovir is a slow-binding inhibitor of (D)-amino acid oxidase.

    PubMed

    Katane, Masumi; Matsuda, Satsuki; Saitoh, Yasuaki; Sekine, Masae; Furuchi, Takemitsu; Koyama, Nobuhiro; Nakagome, Izumi; Tomoda, Hiroshi; Hirono, Shuichi; Homma, Hiroshi

    2013-08-20

    d-Amino acid oxidase (DAO) is a degradative enzyme that is stereospecific for d-amino acids, including d-serine and d-alanine, which are believed to be coagonists of the N-methyl-d-aspartate (NMDA) receptor. To identify a new class of DAO inhibitor(s) that can be used to elucidate the molecular details of the active site environment of DAO, manifold biologically active compounds of microbial origin and pre-existing drugs were screened for their ability to inhibit DAO activity, and several compounds were identified as candidates. One of these compounds, acyclovir (ACV), a well-known antiviral drug used for the treatment of herpesvirus infections, was characterized and evaluated as a novel DAO inhibitor in vitro. Analysis showed that ACV acts on DAO as a reversible slow-binding inhibitor, and interestingly, the time required to achieve equilibrium between DAO, ACV, and the DAO/ACV complex was highly dependent on temperature. The binding mechanism of ACV to DAO was investigated in detail by several approaches, including kinetic analysis, structural modeling of DAO complexed with ACV, and site-specific mutagenesis of an active site residue postulated to be involved in the binding of ACV. The results confirm that ACV is a novel, active site-directed inhibitor of DAO that can be a valuable tool for investigating the structure-function relationships of DAO, including the molecular details of the active site environment of DAO. In particular, it appears that ACV can serve as an active site probe to study the structural basis of temperature-induced conformational changes of DAO.

  4. Discovery of Novel Oral Protein Synthesis Inhibitors of Mycobacterium tuberculosis That Target Leucyl-tRNA Synthetase

    PubMed Central

    Palencia, Andrés; Li, Xianfeng; Bu, Wei; Choi, Wai; Ding, Charles Z.; Easom, Eric E.; Feng, Lisa; Hernandez, Vincent; Houston, Paul; Liu, Liang; Meewan, Maliwan; Mohan, Manisha; Rock, Fernando L.; Sexton, Holly; Zhang, Suoming; Zhou, Yasheen; Wan, Baojie; Wang, Yuehong; Franzblau, Scott G.; Woolhiser, Lisa; Gruppo, Veronica; Lenaerts, Anne J.; O'Malley, Theresa; Parish, Tanya; Cooper, Christopher B.; Waters, M. Gerard; Ma, Zhenkun; Ioerger, Thomas R.; Sacchettini, James C.; Rullas, Joaquín; Angulo-Barturen, Iñigo; Pérez-Herrán, Esther; Mendoza, Alfonso; Barros, David; Cusack, Stephen; Plattner, Jacob J.

    2016-01-01

    The recent development and spread of extensively drug-resistant and totally drug-resistant resistant (TDR) strains of Mycobacterium tuberculosis highlight the need for new antitubercular drugs. Protein synthesis inhibitors have played an important role in the treatment of tuberculosis (TB) starting with the inclusion of streptomycin in the first combination therapies. Although parenteral aminoglycosides are a key component of therapy for multidrug-resistant TB, the oxazolidinone linezolid is the only orally available protein synthesis inhibitor that is effective against TB. Here, we show that small-molecule inhibitors of aminoacyl-tRNA synthetases (AARSs), which are known to be excellent antibacterial protein synthesis targets, are orally bioavailable and effective against M. tuberculosis in TB mouse infection models. We applied the oxaborole tRNA-trapping (OBORT) mechanism, which was first developed to target fungal cytoplasmic leucyl-tRNA synthetase (LeuRS), to M. tuberculosis LeuRS. X-ray crystallography was used to guide the design of LeuRS inhibitors that have good biochemical potency and excellent whole-cell activity against M. tuberculosis. Importantly, their good oral bioavailability translates into in vivo efficacy in both the acute and chronic mouse models of TB with potency comparable to that of the frontline drug isoniazid. PMID:27503647

  5. The Novel Azole R126638 Is a Selective Inhibitor of Ergosterol Synthesis in Candida albicans, Trichophyton spp., and Microsporum canis

    PubMed Central

    Vanden Bossche, Hugo; Ausma, Jannie; Bohets, Hilde; Vermuyten, Karen; Willemsens, Gustaaf; Marichal, Patrick; Meerpoel, Lieven; Odds, Frank; Borgers, Marcel

    2004-01-01

    R126638 is a novel triazole with in vitro activity similar to that of itraconazole against dermatophytes, Candida spp., and Malassezia spp. In animal models of dermatophyte infections, R126638 showed superior antifungal activity. R126638 inhibits ergosterol synthesis in Candida albicans, Trichophyton mentagrophytes, Trichophyton rubrum, and Microsporum canis at nanomolar concentrations, with 50% inhibitory concentrations (IC50s) similar to those of itraconazole. The decreased synthesis of ergosterol and the concomitant accumulation of 14α-methylsterols provide indirect evidence that R126638 inhibits the activity of CYP51 that catalyzes the oxidative removal of the 14α-methyl group of lanosterol or eburicol. The IC50s for cholesterol synthesis from acetate in human hepatoma cells were 1.4 μM for itraconazole and 3.1 μM for R126638. Compared to itraconazole (IC50 = 3.5 μM), R126638 is a poor inhibitor of the 1α-hydroxylation of 25-hydroxyvitamin D3 (IC50 > 10 μM). Micromolar concentrations of R126638 and itraconazole inhibited the 24-hydroxylation of 25-hydroxyvitamin D3 and the conversion of 1,25-dihydroxyvitamin D3 into polar metabolites. At concentrations up to 10 μM, R126638 had almost no effect on cholesterol side chain cleavage (CYP11A1), 11β-hydroxylase (CYP11B1), 17-hydroxylase and 17,20-lyase (CYP17), aromatase (CYP19), or 4-hydroxylation of all-trans retinoic acid (CYP26). At 10 μM, R126638 did not show clear inhibition of CYP1A2, CYP2A6, CYP2D6, CYP2C8, CYP2C9, CYP2C10, CYP2C19, or CYP2E1. Compared to itraconazole, R126638 had a lower interaction potential with testosterone 6β hydroxylation and cyclosporine hydroxylation, both of which are catalyzed by CYP3A4, whereas both antifungals inhibited the CYP3A4-catalyzed hydroxylation of midazolam similarly. The results suggest that R126638 has promising properties and merits further in vivo investigations for the treatment of dermatophyte and yeast infections. PMID:15328084

  6. Methylmalonic acid, a biochemical hallmark of methylmalonic acidurias but no inhibitor of mitochondrial respiratory chain.

    PubMed

    Kölker, Stefan; Schwab, Marina; Hörster, Friederike; Sauer, Sven; Hinz, Angela; Wolf, Nicole I; Mayatepek, Ertan; Hoffmann, Georg F; Smeitink, Jan A M; Okun, Jürgen G

    2003-11-28

    Methylmalonic acidurias are biochemically characterized by an accumulation of methylmalonic acid and alternative metabolites. An impairment of energy metabolism plays a key role in the pathophysiology of this disease, resulting in neurodegeneration of the basal ganglia and renal failure. It has become the subject of intense debates whether methylmalonic acid is the major toxin, inhibiting respiratory chain complex II. To elucidate whether methylmalonic acid is a respiratory chain inhibitor, we used spectrophotometric analysis of complex II activity in submitochondrial particles from bovine heart, radiometric analysis of 14C-labeled substrates (pyruvate, malate, succinate), and analysis of ATP production in muscle from mice. Methylmalonic acid revealed no direct effects on the respiratory chain function, i.e. on single electron transferring complexes I-IV, ATPase, and mitochondrial transporters. However, we identified a variety of variables that must be carefully controlled to avoid an artificial inhibition of complex II activity. In summary, the study verifies our hypothesis that methylmalonic acid is not the major toxic metabolite in methylmalonic acidurias. Inhibition of respiratory chain and tricarboxylic acid cycle is most likely induced by synergistically acting alternative metabolites, in particular 2-methylcitric acid, malonic acid, and propionyl-CoA.

  7. Optimization of the Central Heterocycle of α-Ketoheterocycle Inhibitors of Fatty Acid Amide Hydrolase

    PubMed Central

    Garfunkle, Joie; Ezzili, Cyrine; Rayl, Thomas J.; Hochstatter, Dustin G.; Hwang, Inkyu; Boger, Dale L.

    2008-01-01

    The synthesis and evaluation of a refined series of α-ketoheterocycles based on the oxazole 2 (OL-135) incorporating systematic changes in the central heterocycle bearing a key set of added substituents are described. The nature of the central heterocycle, even within the systematic and minor perturbations explored herein, significantly influenced the inhibitor activity: 1,3,4-oxadiazoles and 1,2,4-oxadiazoles 9 > tetrazoles, the isomeric 1,2,4-oxadiazoles 10, 1,3,4-thiadiazoles > oxazoles including 2 > 1,2-diazines > thiazoles > 1,3,4-triazoles. Most evident in these trends is the observation that introduction of an additional heteroatom at position 4 (oxazole numbering, N > O > CH) substantially increases activity that may be attributed to a reduced destabilizing steric interaction at the FAAH active site. Added heterocycle substituents displaying well defined trends may be utilized to enhance the inhibitor potency and, more significantly, to enhance the inhibitor selectivity. These trends, exemplified herein, emerge from both enhancements in the FAAH activity and simultaneous disruption of binding affinity for competitive off-target enzymes. PMID:18630870

  8. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  9. Inhibitors of acyl-CoA:cholesterol O-acyltransferase (ACAT) as hypocholesterolemic agents: synthesis and structure-activity relationships of novel series of sulfonamides, acylphosphonamides and acylphosphoramidates.

    PubMed

    Lee, H T; Roark, W H; Picard, J A; Sliskovic, D R; Roth, B D; Stanfield, R L; Hamelehle, K L; Bousley, R F; Krause, B R

    1998-02-03

    Sulfoacetic acid, phosphoramidate, and phosphoramide analogs of the ACAT inhibitors, CI-999 and CI-1011 were synthesized. The structure-activity relationships of these compounds as ACAT inhibitors are described.

  10. Zoledronic acid cooperates with a cyclooxygenase-2 inhibitor and gefitinib in inhibiting breast and prostate cancer.

    PubMed

    Melisi, Davide; Caputo, Rosa; Damiano, Vincenzo; Bianco, Roberto; Veneziani, Bianca Maria; Bianco, A Raffaele; De Placido, Sabino; Ciardiello, Fortunato; Tortora, Giampaolo

    2005-12-01

    Biphosphonates (BPs) are widely used to inhibit osteoclastic activity in malignant diseases such as bone metastatic breast and prostate carcinoma. Recent studies reported that BPs could also cause a direct antitumor effect, probably due to their ability to interfere with several intracellular signalling molecules. The enzyme cyclooxygenase-2 (COX-2) and the epidermal growth factor receptor (EGFR) play an important role in the control of cancer cell growth and inhibitors of COX-2 and EGFR have shown antitumor activity in vitro and in vivo in several tumor types. We, and others, have previously shown that EGFR and COX-2 may be directly related to each other and that their selective inhibitors may have a cooperative effect. In the present study we have evaluated the combined effect of zoledronic acid, the most potent nitrogen-containing BP, with the COX-2 inhibitor SC-236 and the selective EGFR-tyrosine kinase inhibitor gefitinib, on breast and prostate cancer models in vitro and in xenografted nude mice. We show that combination of zoledronic acid with SC-236 and gefitinib causes a cooperative antitumor effect accompanied by induction of apoptosis and regulation of the expression of mitogenic factors, proangiogenic factors and cell cycle controllers both in vitro and in xenografted nude mice. The modulatory effect on protein expression and the inhibitory effect on tumor growth is much more potent when the three agents are used together. Since studies are ongoing to explore the antitumor effect of zoledronic acid, our results provide new insights into the mechanism of action of these agents and a novel rationale to translate this feasible combination treatment strategy into a clinical setting.

  11. L-Cysteine/D,L-homocysteine-regulated ileum motility via system L and B°(,+) transporter: Modification by inhibitors of hydrogen sulfide synthesis and dietary treatments.

    PubMed

    Yamane, Satoshi; Nomura, Ryouya; Yanagihara, Madoka; Nakamura, Hiroyuki; Fujino, Hiromichi; Matsumoto, Kenjiro; Horie, Syunji; Murayama, Toshihiko

    2015-10-05

    Previous studies including ours demonstrated that L-cysteine treatments decreased motility in gastrointestinal tissues including the ileum via hydrogen sulfide (H2S), which is formed from sulfur-containing amino acids such as L-cysteine and L-homocysteine. However, the amino acid transport systems involved in L-cysteine/L-homocysteine-induced responses have not yet been elucidated in detail; therefore, we investigated these systems pharmacologically by measuring electrical stimulation (ES)-induced contractions with amino acids in mouse ileum preparations. The treatments with L-cysteine and D,L-homocysteine inhibited ES-induced contractions in ileum preparations from fasted mice, and these responses were decreased by the treatment with 2-aminobicyclo[2.2.1]heptane-2-carboxylate (BCH), an inhibitor of systems L and B°(,+). The results obtained using ileum preparations and a model cell line (PC12 cells) with various amino acids and BCH showed that not only L-cysteine, but also aminooxyacetic acid and D,L-propargylglycine, which act as H2S synthesis inhibitors, appeared to be taken up by these preparations/cells in L and B°(,+) system-dependent manners. The L-cysteine and D,L-homocysteine responses were delayed and abolished, respectively, in ileum preparations from fed mice. Our results suggested that the regulation of ileum motility by L-cysteine and D,L-homocysteine was dependent on BCH-sensitive systems, and varied depending on feeding in mice. Therefore, the effects of aminooxyacetic acid and D,L-propargylglycine on transport systems need to be considered in pharmacological analyses.

  12. Betulin, betulinic acid and butein are inhibitors of acetaldehyde-induced activation of liver stellate cells.

    PubMed

    Szuster-Ciesielska, Agnieszka; Plewka, Krzysztof; Kandefer-Szerszeń, Martyna

    2011-01-01

    Liver fibrosis has been reported to be inhibited in vivo by oleanolic and ursolic acids; however, the activity of other triterpenes like betulin and betulinic acid has not been examined. Butein has also been reported to prevent and partly reverse liver fibrosis in vivo, although its mechanism of action is poorly understood. Therefore, the aim of this study was to determine the antifibrotic potential of butein, betulin, and betulinic acid and examine their mechanisms of action in vitro. This study was conducted in rat stellate cells (HSCs) that were treated with acetaldehyde, which is the most reactive product of ethanol metabolism. Butein, betulin, and betulinic acid were preincubated with rat HSCs at non-toxic concentrations. Treatment effects were measured in regard to acetaldehyde-induced toxicity and cell migration, and several markers of HSC activation were evaluated, including smooth muscle α-actin (α-SMA) and procollagen I expression. In addition, changes in the release of reactive oxygen species (ROS) and cytokines such as tumor necrosis factor-α (TNF-α) and tumor growth factor-β1 (TGF-β1) and changes in the production of metalloproteinase-2 (MMP-2) and tissue inhibitors of metalloproteinases (TIMP-1 and TIMP-2) were determined. In vitro, HSCs were protected against acetaldehyde-induced toxicity by betulin but not by betulinic acid and butein. However, butein, betulin, and betulinic acid inhibited the production of ROS by HSCs treated with acetaldehyde and inhibited their migration. Butein also inhibited acetaldehyde-induced TGF-β1 production. Butein, betulin, and betulinic acid down-regulated acetaldehyde-induced production of TIMP-1 and TIMP-2. Betulin decreased the acetaldehyde-induced activity of MMP-2, but butein and betulinic acid did not. The results indicated that butein, betulin, and betulinic acid inhibited the acetaldehyde-induced activation of HSCs. Each drug functioned in a different manner, whereby some were acting as either

  13. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  14. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  15. Discovery of novel, non-acidic mPGES-1 inhibitors by virtual screening with a multistep protocol

    PubMed Central

    Noha, Stefan M.; Fischer, Katrin; Koeberle, Andreas; Garscha, Ulrike; Werz, Oliver; Schuster, Daniela

    2015-01-01

    Microsomal prostaglandin E2 synthase-1 (mPGES-1) inhibitors are considered as potential therapeutic agents for the treatment of inflammatory pain and certain types of cancer. So far, several series of acidic as well as non-acidic inhibitors of mPGES-1 have been discovered. Acidic inhibitors, however, may have issues, such as loss of potency in human whole blood and in vivo, stressing the importance of the design and identification of novel, non-acidic chemical scaffolds of mPGES-1 inhibitors. Using a multistep virtual screening protocol, the Vitas-M compound library (∼1.3 million entries) was filtered and 16 predicted compounds were experimentally evaluated in a biological assay in vitro. This approach yielded two molecules active in the low micromolar range (IC50 values: 4.5 and 3.8 μM, respectively). PMID:26088337

  16. Design, synthesis, functional and structural characterization of an inhibitor of N-acetylneuraminate-9-phosphate phosphatase: observation of extensive dynamics in an enzyme/inhibitor complex.

    PubMed

    Kim, Soong-Hoon; Constantine, Keith L; Duke, Gerald J; Goldfarb, Valentina; Hunt, John T; Johnson, Stephen; Kish, Kevin; Klei, Herbert E; McDonnell, Patricia A; Metzler, William J; Mueller, Luciano; Poss, Michael A; Fairchild, Craig R; Bhide, Rajeev S

    2013-07-15

    The design, synthesis and characterization of a phosphonate inhibitor of N-acetylneuraminate-9-phosphate phosphatase (HDHD4) is described. Compound 3, where the substrate C-9 oxygen was replaced with a nonlabile CH2 group, inhibits HDHD4 with a binding affinity (IC50 11μM) in the range of the native substrate Neu5Ac-9-P (compound 1, Km 47μM). Combined SAR, modeling and NMR studies are consistent with the phosphonate group in inhibitor 3 forming a stable complex with native Mg(2+). In addition to this key interaction, the C-1 carboxylate of the sugar interacts with a cluster of basic residues, K141, R104 and R72. Comparative NMR studies of compounds 3 and 1 with Ca(2+) and Mg(2+) are indicative of a highly dynamic process in the active site for the HDHD4/Mg(2+)/3 complex. Possible explanations for this observation are discussed.

  17. Suppression of asymmetric acid efflux and gravitropism in maize roots treated with auxin transport inhibitors of sodium orthovanadate

    NASA Technical Reports Server (NTRS)

    Mulkey, T. J.; Evans, M. L.

    1982-01-01

    In gravitropically stimulated roots of maize (Zea mays L., hybrid WF9 x 38MS), there is more acid efflux on the rapidly growing upper side than on the slowly growing lower side. In light of the Cholodny/Went hypothesis of gravitropism which states that gravitropic curvature results from lateral redistribution of auxin, the effects of auxin transport inhibitors on the development of acid efflux asymmetry and curvature in gravistimulated roots were examined. All the transport inhibitors tested prevented both gravitropism and the development of asymmetric acid efflux in gravistimulated roots. The results indicate that auxin redistribution may cause the asymmetry of acid efflux, a finding consistent with the Cholodny/Went hypothesis of gravitropism. As further evidence that auxin-induced acid efflux asymmetry may mediate gravitropic curvature, sodium orthovanadate, an inhibitor of auxin-induced H+ efflux was found to prevent both gravitropism and the development of asymmetric acid efflux in gravistimulated roots.

  18. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  19. Effect of NK-104, a new synthetic HMG-CoA reductase inhibitor, on triglyceride secretion and fatty acid oxidation in rat liver.

    PubMed

    Yamamoto, K; Todaka, N; Goto, H; Jayasooriya, A P; Sakono, M; Ogawa, Y; Fukuda, N

    1999-01-01

    For the investigation of the mechanism responsible for the hypotriglyceridemic effect of NK-104, a new synthetic inhibitor of HMG-CoA reductase, the rate-limiting enzyme for cholesterol synthesis, isolated rat liver was perfused with or without NK-104 in the presence of exogenous [1-(14)C]oleic acid substrate. Addition of NK-104 tended to increase the ketone body production while it caused a significant decrease in the secretion rate of triglyceride by the perfused liver without affecting uptake of exogenous [1-(14)C]oleic acid. The inhibitor also significantly decreased hepatic triglyceride concentration. The altered triglyceride secretion was accompanied by a concomitant decreased incorporation of exogenous [1-(14)C]oleate into triglyceride. The conversion of exogenous [1-(14)C]oleic acid substrate indicated an inverse relationship between the pathways of oxidation and esterification. No effect of NK-104 on hepatic secretion of cholesterol was observed. These results suggest that NK-104 exerts its hypotriglyceridemic action, primarily by diverting the exogenous free fatty acid to the pathways of oxidation at the expense of esterification.

  20. Differential in radiosensitizing potency of enantiomers of the fatty acid synthase inhibitor C75.

    PubMed

    Rae, Colin; Babich, John W; Mairs, Robert J

    2017-01-01

    The elevated activity of fatty acid synthase has been reported in a number of cancer types. Inhibition of this enzyme has been demonstrated to induce cancer cell death and reduce tumor growth. In addition, the fatty acid synthase inhibitor drug C75 has been reported to synergistically enhance the cancer-killing ability of ionizing radiation. However, clinical use of C75 has been limited due to its producing weight loss, believed to be caused by alterations in the activity of carnitine palmitoyltransferase-1. C75 is administered in the form of a racemic mixture of (-) and (+) enantiomers that may differ in their regulation of fatty acid synthase and carnitine palmitoyltransferase-1. Therefore, we assessed the relative cancer-killing potency of different enantiomeric forms of C75 in prostate cancer cells. These results suggest that (-)-C75 is the more cytotoxic enantiomer and has greater radiosensitizing capacity than (+)-C75. These observations will stimulate the development of fatty acid synthase inhibitors that are selective for cancer cells and enhance the tumor-killing activity of ionizing radiation, while minimizing weight loss in cancer patients.

  1. Differential in radiosensitizing potency of enantiomers of the fatty acid synthase inhibitor C75

    PubMed Central

    Babich, John W.; Mairs, Robert J.

    2016-01-01

    Abstract The elevated activity of fatty acid synthase has been reported in a number of cancer types. Inhibition of this enzyme has been demonstrated to induce cancer cell death and reduce tumor growth. In addition, the fatty acid synthase inhibitor drug C75 has been reported to synergistically enhance the cancer‐killing ability of ionizing radiation. However, clinical use of C75 has been limited due to its producing weight loss, believed to be caused by alterations in the activity of carnitine palmitoyltransferase‐1. C75 is administered in the form of a racemic mixture of (−) and (+) enantiomers that may differ in their regulation of fatty acid synthase and carnitine palmitoyltransferase‐1. Therefore, we assessed the relative cancer‐killing potency of different enantiomeric forms of C75 in prostate cancer cells. These results suggest that (−)‐C75 is the more cytotoxic enantiomer and has greater radiosensitizing capacity than (+)‐C75. These observations will stimulate the development of fatty acid synthase inhibitors that are selective for cancer cells and enhance the tumor‐killing activity of ionizing radiation, while minimizing weight loss in cancer patients. PMID:27901292

  2. Aminocarnitine and acylaminocarnitines: Carnitine acyltransferase inhibitors affecting long-chain fatty acid and glucose metabolism

    SciTech Connect

    Clark, D.J.

    1989-01-01

    DL-Aminocarnitine (DL-3-amino-4-trimethylaminobutyrate) and the acylaminocarnitines acetyl-, decanoyl- and palmitoyl-DL-aminocarnitine have been synthesized and tested as inhibitors of carnitine palmitoyl-transferase and carnitine acetyltransferase in vitro and in vivo. Acetyl-DL-aaminocarnitine is the most potent reversible inhibitor of carnitine acetyltransferase reported to date, and is competitive with respect to acetyl-L-carnitine. Mice given acetyl-DL-aminocarnitine metabolize (U-{sup 14}C)acetyl-L-carnitine at about 60% of the rate of control mice. Palmitoyl-DL-aminocarnitine is the most potent reversible inhibitor of carnitine palmitoyltransferase reported to date. Decanoyl-DL-aminocarnitine and DL-aminocarnitine are also very potent inhibitors; all compounds inhibit the catabolism of ({sup 14}C)palmitate to {sup 14}CO{sub 2} in intact mice by at least 50%. Carnitine palmitoyltransferase controls the entry of long-chain fatty acids into the mitochondrial matrix for {beta}-oxidation. The inhibition of carnitine palmitoyltransferase by aminocarnitine or acylaminocarnitines in vivo prevents or reverses ketogenesis in fasted mice, and causes the reversible accumulation of triglycerides in liver, kidney and plasma. Administration of DL-aminocarnitine to streptozotocindiabetic mice lowers plasma glucose levels and improves the glucose tolerance test.

  3. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  4. Synthesis and SAR optimization of diketo acid pharmacophore for HCV NS5B polymerase inhibition

    PubMed Central

    Bhatt, Aaditya; Gurukumar, K. R.; Basu, Amartya; Patel, Maulik R.; Kaushik-Basu, Neerja; Talele, Tanaji T.

    2011-01-01

    Hepatitis C virus (HCV) NS5B polymerase is a key target for anti-HCV therapeutics development. Here we report the synthesis and biological evaluation of a new series of α,γ-diketo acids (DKAs) as NS5B polymerase inhibitors. We initiated structure-activity relationship (SAR) optimization around the furan moiety of compound 1a [IC50 = 21.8 μM] to achieve more active NS5B inhibitors. This yielded compound 3a [IC50 = 8.2 μM] bearing the 5-bromobenzofuran-2-yl moiety, the first promising lead compound of the series. Varying the furan moiety with thiophene, thiazole and indazole moieties resulted in compound 11a [IC50 = 7.5 μM] bearing 3-methylthiophen-2-yl moiety. Finally replacement of the thiophene ring with a bioisosteric phenyl ring further improved the inhibitory activity as seen in compounds 21a [IC50 = 5.2 μM] and 24a [IC50 = 2.4 μM]. Binding mode of compound 24a using glide docking within the active site of NS5B polymerase will form the basis for future SAR optimization. PMID:21893371

  5. Characterization of inhibitory effects of the potential therapeutic inhibitors, benzoic acid and pyridine derivatives, on the monophenolase and diphenolase activities of tyrosinase

    PubMed Central

    Gheibi, Nematollah; Taherkhani, Negar; Ahmadi, Abolfazl; Haghbeen, Kamahldin; Ilghari, Dariush

    2015-01-01

    Objective(s): Involvement of tyrosinase in the synthesis of melanin and cell signaling pathway has made it an attractive target in the search for therapeutic inhibitors for treatment of different skin hyperpigmentation disorders and melanoma cancers. Materials and Methods: In the present study, we conducted a comprehensive kinetic analysis to understand the mechanisms of inhibition imposed by 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid on the monophenolase and diphenolase activities of the mushroom tyrosinase, and then MTT assay was exploited to evaluate their toxicity on the melanoma cells. Results: Kinetic analysis revealed that nicotinic acid and picolinic acid competitively restricted the monophenolase activity with inhibition constants (Ki) of 1.21 mM and 1.97 mM and the diphenolase activity with Kis of 2.4 mM and 2.93 mM, respectively. 2-aminobenzoic acid and 4-aminobenzoic acid inhibited the monophenolase activity in a non-competitive fashion with Kis of 5.15 µM and 3.8 µM and the diphenolase activity with Kis of 4.72 µM and 20 µM, respectively. Conclusion: Our cell-based data revealed that only the pyridine derivatives imposed cytotoxicity in melanoma cells. Importantly, the concentrations of the inhibitors leading to 50% decrease in the cell density (IC50) were comparable to those causing 50% drop in the enzyme activity, implying that the observed cytotoxicity is highly likely due to the tyrosinase inhibition. Moreover, our cell-based data exhibited that the pyridine derivatives acted as anti-proliferative agents, perhaps inducing cytotoxicity in the melanoma cells through inhibition of the tyrosinase activities. PMID:25810885

  6. Squaric Acid-Based Peptidic Inhibitors of Matrix Metalloprotease-1 (MMP-1)

    PubMed Central

    Onaran, M. Burak; Comeau, Anthony B.; Seto, Christopher T.

    2008-01-01

    A series of squaric acid-peptide conjugates were synthesized and evaluated as inhibitors of MMP-1. The cyclobut-3-enedione core was substituted at the 3-position with several functional groups, such as -N(alkyl)OH, -NHOH and –OH, that are designed to bind to the zinc atom in the active site of the metalloprotease. The 4-position of the cyclobut-3-enedione was derivatized with mono- or dipeptides that are designed to bind in the S1′ and S2′ subsites of the enzyme, and position the metal chelating group appropriately in the active site for binding to zinc. Positional scanning revealed that -N(Me)OH provided the highest level of inhibition among the chelating groups that were tested, and Leu-Tle-NHMe was the preferred amino acid sequence. A combination of these groups yielded an inhibitor with an IC50 value of 95 μM. For one inhibitor, conversion of one of the carbonyl groups on the cyclobut-3-enedione core to a thiocarbonyl group resulted in a 18-fold increase in potency, and yielded a compound with an IC50 value of 15 μM. PMID:16356002

  7. Design and synthesis of a novel, orally active, brain penetrant, tri-substituted thiophene based JNK inhibitor

    SciTech Connect

    Bowers, Simeon; Truong, Anh P.; Neitz, R. Jeffrey; Neitzel, Martin; Probst, Gary D.; Hom, Roy K.; Peterson, Brian; Galemmo, Jr., Robert A.; Konradi, Andrei W.; Sham, Hing L.; Tóth, Gergley; Pan, Hu; Yao, Nanhua; Artis, Dean R.; Brigham, Elizabeth F.; Quinn, Kevin P.; Sauer, John-Michael; Powell, Kyle; Ruslim, Lany; Ren, Zhao; Bard, Frédérique; Yednock, Ted A.; Griswold-Prenner, Irene

    2012-02-28

    The SAR of a series of tri-substituted thiophene JNK3 inhibitors is described. By optimizing both the N-aryl acetamide region of the inhibitor and the 4-position of the thiophene we obtained single digit nanomolar compounds, such as 47, which demonstrated an in vivo effect on JNK activity when dosed orally in our kainic acid mouse model as measured by phospho-c-jun reduction.

  8. Quantitative structure-activity relationship and molecular docking studies of a series of quinazolinonyl analogues as inhibitors of gamma amino butyric acid aminotransferase.

    PubMed

    Abdulfatai, Usman; Uzairu, Adamu; Uba, Sani

    2017-01-01

    Quantitative structure-activity relationship and molecular docking studies were carried out on a series of quinazolinonyl analogues as anticonvulsant inhibitors. Density Functional Theory (DFT) quantum chemical calculation method was used to find the optimized geometry of the anticonvulsants inhibitors. Four types of molecular descriptors were used to derive a quantitative relation between anticonvulsant activity and structural properties. The relevant molecular descriptors were selected by Genetic Function Algorithm (GFA). The best model was validated and found to be statistically significant with squared correlation coefficient (R(2)) of 0.934, adjusted squared correlation coefficient (R(2)adj) value of 0.912, Leave one out (LOO) cross validation coefficient (Q(2)) value of 0.8695 and the external validation (R(2)pred) of 0.72. Docking analysis revealed that the best compound with the docking scores of -9.5 kcal/mol formed hydrophobic interaction and H-bonding with amino acid residues of gamma aminobutyric acid aminotransferase (GABAAT). This research has shown that the binding affinity generated was found to be better than the commercially sold anti-epilepsy drug, vigabatrin. Also, it was found to be better than the one reported by other researcher. Our QSAR model and molecular docking results corroborate with each other and propose the directions for the design of new inhibitors with better activity against GABAAT. The present study will help in rational drug design and synthesis of new selective GABAAT inhibitors with predetermined affinity and activity and provides valuable information for the understanding of interactions between GABAAT and the anticonvulsants inhibitors.

  9. Amino acid availability regulates S6K1 and protein synthesis in avian insulin-insensitive QM7 myoblasts.

    PubMed

    Tesseraud, Sophie; Bigot, Karine; Taouis, Mohammed

    2003-04-10

    The regulation of S6K1 by nutritional status and insulin has been recently reported in vivo in chicken muscle despite the relative insulin resistance of this tissue as estimated by phosphatidylinositol 3-kinase (PI3-kinase) activity. The present work aimed to study the impact of amino acids on S6K1 activity in quail muscle (QM7) myoblasts. Firstly, we characterized S6K1 in QM7 cells and demonstrated the absence of insulin receptors in these cells. Secondly, we showed that amino acids in the absence of insulin induced S6K1 phosphorylation on Thr389 and concomitantly increased its enzymatic activity. Amino acid-induced S6K1 activation was inhibited by LY294002 (PI3-kinase inhibitor) and rapamycin (inhibitor of the mammalian target of rapamycin, mTOR), suggesting the involvement of an avian homolog of mTOR. The availability of individual amino acids (methionine or leucine) regulated S6K1 phosphorylation on Thr389 and QM7 protein synthesis. In conclusion, amino acids regulate S6K1 phosphorylation and activity in QM7 cells through the mTOR/PI3-kinase pathway in an insulin-independent manner.

  10. Design, Synthesis, and Evaluation of Donepezil-Like Compounds as AChE and BACE-1 Inhibitors.

    PubMed

    Costanzo, Paola; Cariati, Luca; Desiderio, Doriana; Sgammato, Roberta; Lamberti, Anna; Arcone, Rosaria; Salerno, Raffaele; Nardi, Monica; Masullo, Mariorosario; Oliverio, Manuela

    2016-05-12

    An ecofriendly synthetic pathway for the synthesis of donepezil precursors is described. Alternative energy sources were used for the total synthesis in order to improve yields, regioselectively, and rate of each synthetic step and to reduce the coproduction of waste at the same time. For all products, characterized by an improved structural rigidity respect to donepezil, the inhibitor activity on AChE, the selectivity vs BuChE, the side-activity on BACE-1, and the effect on SHSY-5Y neuroblastoma cells viability were tested. Two potential new lead compounds for a dual therapeutic strategy against Alzheimer's disease were envisaged.

  11. Synthesis, Pharmacological Profile and Docking Studies of New Sulfonamides Designed as Phosphodiesterase-4 Inhibitors

    PubMed Central

    Cardozo, Suzana Vanessa S.; Carvalho, Vinicius de Frias; Romeiro, Nelilma Correia; Silva, Patrícia Machado Rodrigues e; Martins, Marco Aurélio; Barreiro, Eliezer J.; Lima, Lídia Moreira

    2016-01-01

    Prior investigations showed that increased levels of cyclic AMP down-regulate lung inflammatory changes, stimulating the interest in phosphodiesterase (PDE)4 as therapeutic target. Here, we described the synthesis, pharmacological profile and docking properties of a novel sulfonamide series (5 and 6a-k) designed as PDE4 inhibitors. Compounds were screened for their selectivity against the four isoforms of human PDE4 using an IMAP fluorescence polarized protocol. The effect on allergen- or LPS-induced lung inflammation and airway hyper-reactivity (AHR) was studied in A/J mice, while the xylazine/ketamine-induced anesthesia test was employed as a behavioral correlate of emesis in rodents. As compared to rolipram, the most promising screened compound, 6a (LASSBio-448) presented a better inhibitory index concerning PDE4D/PDE4A or PDE4D/PDE4B. Accordingly, docking analyses of the putative interactions of LASSBio-448 revealed similar poses in the active site of PDE4A and PDE4C, but slight unlike orientations in PDE4B and PDE4D. LASSBio-448 (100 mg/kg, oral), 1 h before provocation, inhibited allergen-induced eosinophil accumulation in BAL fluid and lung tissue samples. Under an interventional approach, LASSBio-448 reversed ongoing lung eosinophilic infiltration, mucus exacerbation, peribronchiolar fibrosis and AHR by allergen provocation, in a mechanism clearly associated with blockade of pro-inflammatory mediators such as IL-4, IL-5, IL-13 and eotaxin-2. LASSBio-448 (2.5 and 10 mg/kg) also prevented inflammation and AHR induced by LPS. Finally, the sulfonamide derivative was shown to be less pro-emetic than rolipram and cilomilast in the assay employed. These findings suggest that LASSBio-448 is a new PDE4 inhibitor with marked potential to prevent and reverse pivotal pathological features of diseases characterized by lung inflammation, such as asthma. PMID:27695125

  12. Synthesis of 2-arylindole derivatives and evaluation as nitric oxide synthase and NFκB inhibitors.

    PubMed

    Yu, Xufen; Park, Eun-Jung; Kondratyuk, Tamara P; Pezzuto, John M; Sun, Dianqing

    2012-11-28

    Development of small molecule drug-like inhibitors blocking both nitric oxide synthase and NFκB could offer a synergistic therapeutic approach in the prevention and treatment of inflammation and cancer. During the course of evaluating the biological potential of a commercial compound library, 2-phenylindole (1) displayed inhibitory activity against nitrite production and NFκB with IC(50) values of 38.1 ± 1.8 and 25.4 ± 2.1 μM, respectively. Based on this lead, synthesis and systematic optimization have been undertaken in an effort to find novel and more potent nitric oxide synthase and NFκB inhibitors with antiinflammatory and cancer preventive potential. First, chemical derivatizations of 1 and 2-phenylindole-3-carboxaldehyde (4) were performed to generate a panel of N-alkylated indoles and 3-oxime derivatives 2–7. Second, a series of diversified 2-arylindole derivatives (10) were synthesized from an array of substituted 2-iodoanilines (8) and terminal alkynes (9) by applying a one-pot palladium catalyzed Sonogashira-type alkynylation and base-assisted cycloaddition. Subsequent biological evaluations revealed 3-carboxaldehyde oxime and cyano substituted 2-phenylindoles 5 and 7 exhibited the strongest nitrite inhibitory activities (IC(50) = 4.4 ± 0.5 and 4.8 ± 0.4 μM, respectively); as well as NFκB inhibition (IC(50) = 6.9 ± 0.8 and 8.5 ± 2.0 μM, respectively). In addition, the 6′-MeO-naphthalen-2′-yl indole derivative 10at displayed excellent inhibitory activity against NFκB with an IC(50) value of 0.6 ± 0.2 μM.

  13. A Systems Pharmacology Perspective on the Clinical Development of Fatty Acid Amide Hydrolase Inhibitors for Pain

    PubMed Central

    Benson, N; Metelkin, E; Demin, O; Li, G L; Nichols, D; van der Graaf, P H

    2014-01-01

    The level of the endocannabinoid anandamide is controlled by fatty acid amide hydrolase (FAAH). In 2011, PF-04457845, an irreversible inhibitor of FAAH, was progressed to phase II clinical trials for osteoarthritic pain. This article discusses a prospective, integrated systems pharmacology model evaluation of FAAH as a target for pain in humans, using physiologically based pharmacokinetic and systems biology approaches. The model integrated physiological compartments; endocannabinoid production, degradation, and disposition data; PF-04457845 pharmacokinetics and pharmacodynamics, and cannabinoid receptor CB1-binding kinetics. The modeling identified clear gaps in our understanding and highlighted key risks going forward, in particular relating to whether methods are in place to demonstrate target engagement and pharmacological effect. The value of this modeling exercise will be discussed in detail and in the context of the clinical phase II data, together with recommendations to enable optimal future evaluation of FAAH inhibitors. PMID:24429592

  14. Boswellic acids: A leukotriene inhibitor also effective through topical application in inflammatory disorders.

    PubMed

    Singh, S; Khajuria, A; Taneja, S C; Johri, R K; Singh, J; Qazi, G N

    2008-06-01

    Boswellic acids (BA), a natural mixture isolated from oleo gum resin of Boswellia serrata comprised of four major pentacyclic triterpene acids: beta-boswellic acid (the most abundant), 3-acteyl-beta-boswellic acid, 11-keto-beta-boswellic acid, and 3-acetyl-11-keto-beta-boswellic acid, is reported to be effective as anti-inflammatory, immunomodulatory, anti-tumor, anti-asthmatic and in Chron's disease. It inhibits pro-inflammatory mediators in the body, specifically leukotrienes via inhibition of 5-lipoxygenase, the key enzyme of leukotriene synthesis, is the scientifically proved mechanism for its anti-inflammatory/anti-arthritic activity. All previous work on BA for its biological activity has been done through the systemic application but no pre-clinical data reported for its anti-inflammatory activity by topical application. We here by report anti-inflammatory activity of BA through this route by applying different acute and chronic models of inflammation i.e., arachidonic acid and croton oil-induced mouse ear edema, carrageenan-induced rats paw edema and adjuvant-induced developing arthritis in rats. The results of the study revealed that the effect observed through this route is in accordance to the study conducted with the systemic route, thus establishing that BA when used through topical application is as effective as through the systemic route.

  15. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  16. Pyrazinamide, but not pyrazinoic acid, is a competitive inhibitor of NADPH binding to Mycobacterium tuberculosis fatty acid synthase I.

    PubMed

    Sayahi, Halimah; Zimhony, Oren; Jacobs, William R; Shekhtman, Alexander; Welch, John T

    2011-08-15

    Pyrazinamide (PZA), an essential component of short-course anti-tuberculosis chemotherapy, was shown by Saturation Transfer Difference (STD) NMR methods to act as a competitive inhibitor of NADPH binding to purified Mycobacterium tuberculosis fatty acid synthase I (FAS I). Both PZA and pyrazinoic acid (POA) reversibly bind to FAS I but at different binding sites. The competitive binding of PZA and NADPH suggests potential FAS I binding sites. POA was not previously known to have any specific binding interactions. The STD NMR of NADPH bound to the mycobacterial FAS I was consistent with the orientation reported in published single crystal X-ray diffraction studies of fungal FAS I. Overall the differences in binding between PZA and POA are consistent with previous recognition of the importance of intracellular accumulation of POA for anti-mycobacterial activity.

  17. An integrated approach for discovery of highly potent and selective Mnk inhibitors: Screening, synthesis and SAR analysis.

    PubMed

    Teo, Theodosia; Yang, Yuchao; Yu, Mingfeng; Basnet, Sunita K C; Gillam, Todd; Hou, Jinqiang; Schmid, Raffaella M; Kumarasiri, Malika; Diab, Sarah; Albrecht, Hugo; Sykes, Matthew J; Wang, Shudong

    2015-10-20

    Deregulation of protein synthesis is a common event in cancer. As MAPK-interacting kinases (Mnks) play critical roles in regulation of protein synthesis, they have emerged as novel anti-cancer targets. Mnks phosphorylate eukaryotic initiation factor 4E (eIF4E) and promote eIF4E-mediated oncogenic activity. Given that the kinase activity of Mnks is essential for oncogenesis but is dispensable for normal development, the discovery of potent and selective pharmacological Mnk inhibitors provides pharmacological target validation and offers a new strategy for cancer treatment. Herein, comprehensive in silico screening approaches were deployed, and three thieno[2,3-d]pyrimidine and pyrazolo[3,4-d]pyrimidine derivatives were identified as hit compounds. Further chemical modification of thieno[2,3-d]pyrimidine derivative 3 has given rise to a series of highly potent Mnk2 inhibitors that could be potential leads for the treatment of acute myeloid leukemia.

  18. Synthesis of 7-oxo-dihydrospiro[indazole-5,4'-piperidine] acetyl-CoA carboxylase inhibitors.

    PubMed

    Bagley, Scott W; Southers, James A; Cabral, Shawn; Rose, Colin R; Bernhardson, David J; Edmonds, David J; Polivkova, Jana; Yang, Xiaojing; Kung, Daniel W; Griffith, David A; Bader, Scott J

    2012-02-03

    Synthesis of oxo-dihydrospiroindazole-based acetyl-CoA carboxylase (ACC) inhibitors is reported. The dihydrospiroindazoles were assembled in a regioselective manner in six steps from substituted hydrazines and protected 4-formylpiperidine. Enhanced regioselectivity in the condensation between a keto enamine and substituted hydrazines was observed when using toluene as the solvent, leading to selective formation of 1-substituted spiroindazoles. The 2-substituted spiroindazoles were formed selectively from alkyl hydrazones by ring closure with Vilsmeier reagent. The key step in the elaboration to the final products is the conversion of an intermediate olefin to the desired ketone through elimination of HBr from an O-methyl bromohydrin. This methodology enabled the synthesis of each desired regioisomer on 50-75 g scale with minimal purification. Acylation of the resultant spirocyclic amines provided potent ACC inhibitors.

  19. Solution structure of the squash aspartic acid proteinase inhibitor (SQAPI) and mutational analysis of pepsin inhibition.

    PubMed

    Headey, Stephen J; Macaskill, Ursula K; Wright, Michele A; Claridge, Jolyon K; Edwards, Patrick J B; Farley, Peter C; Christeller, John T; Laing, William A; Pascal, Steven M

    2010-08-27

    The squash aspartic acid proteinase inhibitor (SQAPI), a proteinaceous proteinase inhibitor from squash, is an effective inhibitor of a range of aspartic proteinases. Proteinaceous aspartic proteinase inhibitors are rare in nature. The only other example in plants probably evolved from a precursor serine proteinase inhibitor. Earlier work based on sequence homology modeling suggested SQAPI evolved from an ancestral cystatin. In this work, we determined the solution structure of SQAPI using NMR and show that SQAPI shares the same fold as a plant cystatin. The structure is characterized by a four-strand anti-parallel beta-sheet gripping an alpha-helix in an analogous manner to fingers of a hand gripping a tennis racquet. Truncation and site-specific mutagenesis revealed that the unstructured N terminus and the loop connecting beta-strands 1 and 2 are important for pepsin inhibition, but the loop connecting strands 3 and 4 is not. Using ambiguous restraints based on the mutagenesis results, SQAPI was then docked computationally to pepsin. The resulting model places the N-terminal strand of SQAPI in the S' side of the substrate binding cleft, whereas the first SQAPI loop binds on the S side of the cleft. The backbone of SQAPI does not interact with the pepsin catalytic Asp(32)-Asp(215) diad, thus avoiding cleavage. The data show that SQAPI does share homologous structural elements with cystatin and appears to retain a similar protease inhibitory mechanism despite its different target. This strongly supports our hypothesis that SQAPI evolved from an ancestral cystatin.

  20. Solution Structure of the Squash Aspartic Acid Proteinase Inhibitor (SQAPI) and Mutational Analysis of Pepsin Inhibition

    PubMed Central

    Headey, Stephen J.; MacAskill, Ursula K.; Wright, Michele A.; Claridge, Jolyon K.; Edwards, Patrick J. B.; Farley, Peter C.; Christeller, John T.; Laing, William A.; Pascal, Steven M.

    2010-01-01

    The squash aspartic acid proteinase inhibitor (SQAPI), a proteinaceous proteinase inhibitor from squash, is an effective inhibitor of a range of aspartic proteinases. Proteinaceous aspartic proteinase inhibitors are rare in nature. The only other example in plants probably evolved from a precursor serine proteinase inhibitor. Earlier work based on sequence homology modeling suggested SQAPI evolved from an ancestral cystatin. In this work, we determined the solution structure of SQAPI using NMR and show that SQAPI shares the same fold as a plant cystatin. The structure is characterized by a four-strand anti-parallel β-sheet gripping an α-helix in an analogous manner to fingers of a hand gripping a tennis racquet. Truncation and site-specific mutagenesis revealed that the unstructured N terminus and the loop connecting β-strands 1 and 2 are important for pepsin inhibition, but the loop connecting strands 3 and 4 is not. Using ambiguous restraints based on the mutagenesis results, SQAPI was then docked computationally to pepsin. The resulting model places the N-terminal strand of SQAPI in the S′ side of the substrate binding cleft, whereas the first SQAPI loop binds on the S side of the cleft. The backbone of SQAPI does not interact with the pepsin catalytic Asp32–Asp215 diad, thus avoiding cleavage. The data show that SQAPI does share homologous structural elements with cystatin and appears to retain a similar protease inhibitory mechanism despite its different target. This strongly supports our hypothesis that SQAPI evolved from an ancestral cystatin. PMID:20538608

  1. Design and Synthesis of Coumarin Derivatives as Novel PI3K Inhibitors.

    PubMed

    Chen-Chen, Ma; Liu, Zhao-Peng

    2016-02-23

    A variety of coumarin derivatives possessing the pyridinylurea units were designed to increase their potency and isoform selectivity against PI3Ks. These novel coumarins 4a-m were prepared from 5-methyl-pyridin-2-ylamine in a straightforward way via the protection of the amino by Boc groups, benzyl bromination, ethyl acetoacetate alkylation with the generated bromomethyl pyridine, Pechmann coumarin core construction, and ureas formation by the coupling of amine 3 with a variety of aryl isocyanates. When the alkylated acetoacetate 2 was reacted with resorcinol in concentrated sulfuric acid, a cascade reaction occurred that included the Pechmann cyclization to form the coumarin core, removal of the N-Boc protective groups to generate a tert-butyl carbocation, and the Friedel-Crafts tert-butylation of the phenol ring. In general, these coumarin analogs exhibited good in vitro growth inhibitory activities against tumor K562, Hela, A549 and MCF-7 cells. Some of them showed comparable or better potency than BENC-511. Compounds 4b and 4h were found to be much more potent PI3K (~10-fold) inhibitors than S14161 or BENC-511. In addition, coumarin 4b was more selective to PI3Kα/β over PI3Kδ/γ, while analog 4h was a selective PI3Kα/β/δ inhibitor. Moreover, compound 4h suppressed the phosphorylation of Akt, increased the cleaved caspase 3 and PARP, and induced K562 cell apoptosis.

  2. Design and synthesis of aza-flavones as a new class of xanthine oxidase inhibitors.

    PubMed

    Dhiman, Rajni; Sharma, Sahil; Singh, Gagandip; Nepali, Kunal; Singh Bedi, Preet Mohinder

    2013-01-01

    In an attempt to develop non-purine-based xanthine oxidase (XO) inhibitors, keeping in view the complications reported with the use of purine-based XO inhibitors, the flavone framework (a class possessing XO inhibitory potential) was used as lead structure for further optimization. By means of structure-based classical bioisosterism, quinolone was used as an isoster for chromone (a bicyclic unit present in flavones), owing to the bioactive potential and drug-like properties of quinolones. This type of replacement does not alter the shape and structural features required for XO inhibition, and also provides some additional interaction sites, without the loss of hydrogen bonding and hydrophobic and arene-arene interactions. In the present study, a series of 2-aryl/heteroaryl-4-quinolones (aza analogs of flavones) was rationally designed, synthesized and evaluated for in vitro XO inhibitory activity. Some notions about structure-activity relationships are presented indicating the influence of the nature of the 2-aryl ring on the inhibitory activity. Important interactions of the most active compound 3l (IC(50)  = 6.24 µM) with the amino acid residues of the active site of XO were figured out by molecular modeling.

  3. Synthesis and Biological Investigation of Oxazole Hydroxamates as Highly Selective Histone Deacetylase 6 (HDAC6) Inhibitors.

    PubMed

    Senger, Johanna; Melesina, Jelena; Marek, Martin; Romier, Christophe; Oehme, Ina; Witt, Olaf; Sippl, Wolfgang; Jung, Manfred

    2016-02-25

    Histone deacetylase 6 (HDAC6) catalyzes the removal of an acetyl group from lysine residues of several non-histone proteins. Here we report the preparation of thiazole-, oxazole-, and oxadiazole-containing biarylhydroxamic acids by a short synthetic procedure. We identified them as selective HDAC6 inhibitors by investigating the inhibition of recombinant HDAC enzymes and the protein acetylation in cells by Western blotting (tubulin vs histone acetylation). The most active compounds exhibited nanomolar potency and high selectivity for HDAC6. For example, an oxazole hydroxamate inhibits HDAC6 with an IC50 of 59 nM and has a selectivity index of >200 against HDAC1 and HDAC8. This is the first report showing that the nature of a heterocycle directly connected to a zinc binding group (ZBG) can be used to modulate subtype selectivity and potency for HDAC6 inhibitors to such an extent. We rationalize the high potency and selectivity of the oxazoles by molecular modeling and docking.

  4. Design, synthesis and activity evaluation of novel peptide fusion inhibitors targeting HIV-1 gp41.

    PubMed

    Tan, Jianjun; Su, Min; Zeng, Yi; Wang, Cunxin

    2016-01-15

    Human immunodeficiency virus type 1 (HIV-1), the pathogen of acquired immunodeficiency syndrome (AIDS), causes about 2 million people to death every year. Fusion inhibitors targeted the envelope protein (gp41) represent a novel and alternative approach for anti-AIDS therapy, which terminates the HIV-1 life cycle at an early stage. Using CP621-652 as a template, a series of peptides were designed, synthesized and evaluated in vitro assays. An interesting phenomenon was found that the substitution of hydrophobic residues at solvent accessible sites could increase the anti-HIV activity when the C-terminal sequence was extended with an enough numbers of amino acids. After the active peptides was synthesized and evaluated, peptide 8 showed the best anti-HIV-1 IIIB whole cell activity (MAGI IC50=53.02 nM). Further study indicated that peptide 8 bound with the gp41 NHR helix, and then blocked the conformation of 6-helix, thus inhibited virus-cell membrane fusion. The results would be helpful for the design of peptide fusion inhibitors against HIV-1 infection.

  5. Voglibose-inspired synthesis of new potent α-glucosidase inhibitors N-1,3-dihydroxypropylaminocyclitols.

    PubMed

    Worawalai, Wisuttaya; Sompornpisut, Pornthep; Wacharasindhu, Sumrit; Phuwapraisirisan, Preecha

    2016-06-24

    Voglibose, an N-1,3-dihydroxypropylaminocyclitol, has widely been used as an effective α-glucosidase inhibitor for diabetes therapy. Several attempts have been made to synthesize closely related analogues through the coupling of various aminocyclitols and propane-1,3-diol; however, most of them showed weaker or no inhibition. In this communication, we synthesized a pair of new N-1,3-dihydroxypropylaminocyclitols (10 and 11) using (+)-proto-quercitol (1) as a cyclitol core structure. The newly synthesized compounds revealed potent rat intestinal α-glucosidases, particularly against maltase, with IC50 values at submicromolar. Subsequent study on mechanisms underlying the inhibition of 11 indicated the competitive manner towards maltase and sucrase. The potent inhibition of these compounds was elaborated by docking study, in which their binding profiles towards key amino acid residues in the active site were similar to that of voglibose. Therefore, introduction of propane-1,3-diol moiety to suitable cyclohexane core structure such as aminoquercitol would be a potential approach to discover a new series of effective α-glucosidase inhibitors.

  6. Selective inhibition of cholesterol synthesis in liver versus extrahepatic tissues by HMG-CoA reductase inhibitors.

    PubMed

    Parker, R A; Clark, R W; Sit, S Y; Lanier, T L; Grosso, R A; Wright, J J

    1990-07-01

    Hepatic specificity of inhibitors of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase may be achieved by efficient first-pass liver extraction resulting in low circulating drug levels, as with lovastatin, or by lower cellular uptake in peripheral tissues, seen with pravastatin. BMY-21950 and its lactone form BMY-22089, new synthetic inhibitors of HMG-CoA reductase, were compared with the major reference agent lovastatin and with the synthetic inhibitor fluindostatin in several in vitro and in vivo models of potency and tissue selectivity. The kinetic mechanism and the potency of BMY-21950 as a competitive inhibitor of isolated HMG-CoA reductase were comparable to the reference agents. The inhibitory potency (cholesterol synthesis assayed by 3H2O or [14C]acetate incorporation) of BMY-21950 in rat hepatocytes (IC50 = 21 nM) and dog liver slices (IC50 = 23 nM) equalled or exceeded the potencies of the reference agents. Hepatic cholesterol synthesis in vivo in rats was effectively inhibited by BMY-21950 and its lactone form BMY-22089 (ED50 = 0.1 mg/kg p.o.), but oral doses (20 mg/kg) that suppressed liver synthesis by 83-95% inhibited sterol synthesis by only 17-24% in the ileum. In contrast, equivalent doses of lovastatin markedly inhibited cholesterol synthesis in both organs. In tissue slices from rat ileum, cell dispersions from testes, adrenal, and spleen, and in bovine ocular lens epithelial cells, BMY-21950 inhibited sterol synthesis weakly in vitro with IC50 values 76- and 188-times higher than in hepatocytes; similar effects were seen for BMY-22089. However, the IC50 ratios (tissue/hepatocyte) for lovastatin and fluindostatin were near unity in these models. Thus, BMY-21950 and BMY-22089 are the first potent synthetic HMG-CoA reductase inhibitors that possess a very high degree of liver selectivity based upon differential inhibition sensitivities in tissues. This cellular uptake-based property of hepatic specificity of BMY-21950 and BMY-22089, also

  7. Design and synthesis of non-hydrolyzable homoisoprenoid α-monofluorophosphonate inhibitors of PPAPDC family integral membrane lipid phosphatases.

    PubMed

    Subramanian, Thangaiah; Ren, Hongmei; Subramanian, Karunai Leela; Sunkara, Manjula; Onono, Fredrick O; Morris, Andrew J; Spielmann, H Peter

    2014-09-15

    An efficient, diversity oriented synthesis of homoisoprenoid α-monofluorophosphonates utilizing electrophilic fluorination is presented along with their activity as inhibitors of PPAPDC2 family integral membrane lipid phosphatases. These novel phosphatase-resistant analogues of isoprenoid monophosphates are a platform for further structure-activity relationship studies and provide access to other isoprenoid family members where the phosphate ester oxygen is replaced by a α-monofluoromethylene moiety.

  8. Towards inhibitors of glycosyltransferases: A novel approach to the synthesis of 3-acetamido-3-deoxy-D-psicofuranose derivatives

    PubMed Central

    Koóš, Miroslav; Lin, Chun-Hung

    2015-01-01

    Summary A novel synthetic strategy leading to 3-acetamido-3-deoxy-D-psicofuranose 9 is presented. The latter compound, after some manipulations, was transformed into fully protected 3-acetamido-3-deoxy-D-psicofuranose 11 as a potential substrate for the synthesis of N-acetylglucosaminyltransferase inhibitors designed by computational methods. After the attempted thioglycosylation of 11 with EtSH in the presence of BF3·OEt2, 2-methyloxazoline derivatives 13 and 14 were isolated. PMID:26425214

  9. Antiplasmodial activities of homogentisic acid derivative protein kinase inhibitors isolated from a Vanuatu marine sponge Pseudoceratina sp.

    PubMed

    Lebouvier, Nicolas; Jullian, Valérie; Desvignes, Isabelle; Maurel, Séverine; Parenty, Arnaud; Dorin-Semblat, Dominique; Doerig, Christian; Sauvain, Michel; Laurent, Dominique

    2009-11-23

    As part of our search for new antimalarial drugs in South Pacific marine sponges, we have looked for inhibitors of Pfnek-1, a specific protein kinase of Plasmodium falciparum. On the basis of promising activity in a preliminary screening, the ethanolic crude extract of a new species of Pseudoceratina collected in Vanuatu was selected for further investigation. A bioassay-guided fractionation led to the isolation of a derivative of homogentisic acid [methyl (2,4-dibromo-3,6-dihydroxyphenyl)acetate, 4a] which inhibited Pfnek-1 with an IC(50) around 1.8 muM. This product was moderately active in vitro against a FcB1 P. falciparum strain (IC(50) = 12 muM). From the same sponge, we isolated three known compounds [11,19-dideoxyfistularin-3 (1), 11-deoxyfistularin-3 (2) and dibromo-verongiaquinol (3)] which were inactive against Pfnek-1. Synthesis and biological evaluation of some derivatives of 4a are reported.

  10. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  11. Inhibition of Pig Phosphoenolpyruvate Carboxykinase Isoenzymes by 3-Mercaptopicolinic Acid and Novel Inhibitors.

    PubMed

    Hidalgo, Jorge; Latorre, Pedro; Carrodeguas, José Alberto; Velázquez-Campoy, Adrián; Sancho, Javier; López-Buesa, Pascual

    2016-01-01

    There exist two isoforms of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) in pig populations that differ in a single amino acid (Met139Leu). The isoenzymes have different kinetic properties, affecting more strongly the Km and Vmax of nucleotides. They are associated to different phenotypes modifying traits of considerable economic interest. In this work we use inhibitors of phosphoenolpyruvate carboxykinase activity to search for further differences between these isoenzymes. On the one hand we have used the well-known inhibitor 3-mercaptopicolinic acid. Its inhibition patterns were the same for both isoenzymes: a three-fold decrease of the Ki values for GTP in 139Met and 139Leu (273 and 873 μM, respectively). On the other hand, through screening of a chemical library we have found two novel compounds with inhibitory effects of a similar magnitude to that of 3-mercaptopicolinic acid but with less solubility and specificity. One of these novel compounds, (N'1-({5-[1-methyl-5-(trifluoromethyl)-1H-pyrazol-3-yl]-2-thienyl}methylidene)-2,4-dichlorobenzene-1-carbohydrazide), exhibited significantly different inhibitory effects on either isoenzyme: it enhanced threefold the apparent Km value for GTP in 139Met, whereas in 139Leu, it reduced it from 99 to 69 μM. The finding of those significant differences in the binding of GTP reinforces the hypothesis that the Met139Leu substitution affects strongly the nucleotide binding site of PEPCK-C.

  12. Inhibition of Pig Phosphoenolpyruvate Carboxykinase Isoenzymes by 3-Mercaptopicolinic Acid and Novel Inhibitors

    PubMed Central

    Hidalgo, Jorge; Latorre, Pedro; Carrodeguas, José Alberto; Velázquez-Campoy, Adrián; Sancho, Javier; López-Buesa, Pascual

    2016-01-01

    There exist two isoforms of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) in pig populations that differ in a single amino acid (Met139Leu). The isoenzymes have different kinetic properties, affecting more strongly the Km and Vmax of nucleotides. They are associated to different phenotypes modifying traits of considerable economic interest. In this work we use inhibitors of phosphoenolpyruvate carboxykinase activity to search for further differences between these isoenzymes. On the one hand we have used the well-known inhibitor 3-mercaptopicolinic acid. Its inhibition patterns were the same for both isoenzymes: a three-fold decrease of the Ki values for GTP in 139Met and 139Leu (273 and 873 μM, respectively). On the other hand, through screening of a chemical library we have found two novel compounds with inhibitory effects of a similar magnitude to that of 3-mercaptopicolinic acid but with less solubility and specificity. One of these novel compounds, (N'1-({5-[1-methyl-5-(trifluoromethyl)-1H-pyrazol-3-yl]-2-thienyl}methylidene)-2,4-dichlorobenzene-1-carbohydrazide), exhibited significantly different inhibitory effects on either isoenzyme: it enhanced threefold the apparent Km value for GTP in 139Met, whereas in 139Leu, it reduced it from 99 to 69 μM. The finding of those significant differences in the binding of GTP reinforces the hypothesis that the Met139Leu substitution affects strongly the nucleotide binding site of PEPCK-C. PMID:27391465

  13. Tannic acid, a potent inhibitor of epidermal growth factor receptor tyrosine kinase.

    PubMed

    Yang, Er Bin; Wei, Liu; Zhang, Kai; Chen, Yu Zong; Chen, Wei Ning

    2006-03-01

    Increasing evidence supports the hypothesis that tannic acid, a plant polyphenol, exerts anticarcinogenic activity in chemically induced cancers. In the present study, tannic acid was found to strongly inhibit tyrosine kinase activity of epidermal growth factor receptor (EGFr) in vitro (IC50 = 323 nM). In contrast, the inhibition by tannic acid of p60(c-src) tyrosine kinase (IC50 = 14 microM) and insulin receptor tyrosine kinase (IC50 = 5 microM) was much weaker. The inhibition of EGFr tyrosine kinase by tannic acid was competitive with respect to ATP and non-competitive with respect to peptide substrate. In cultured cells, growth factor-induced tyrosine phosphorylation of growth factor receptors, including EGFr, platelet-derived growth factor receptor, and basic fibroblast growth factor receptor, was inhibited by tannic acid. No inhibition of insulin-induced tyrosine phosphorylation of insulin receptor and insulin-receptor substrate-1 was observed. EGF-stimulated growth of HepG2 cells was inhibited in the presence of tannic acid. The inhibition of serine/threonine-specific protein kinases, including cAMP-dependent protein kinase, protein kinase C and mitogen-activated protein kinase, by tannic acid was only detected at relatively high concentration, IC50 being 3, 325 and 142 microM respectively. The molecular modeling study suggested that tannic acid could be docked into the ATP binding pockets of either EGFr or insulin receptor. These results demonstrate that tannic acid is an in vitro potent inhibitor of EGFr tyrosine kinase.

  14. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  15. The Histone Deacetylase Inhibitor Suberoylanilide Hydroxamic Acid Alleviates Salinity Stress in Cassava

    PubMed Central

    Patanun, Onsaya; Ueda, Minoru; Itouga, Misao; Kato, Yukari; Utsumi, Yoshinori; Matsui, Akihiro; Tanaka, Maho; Utsumi, Chikako; Sakakibara, Hitoshi; Yoshida, Minoru; Narangajavana, Jarunya; Seki, Motoaki

    2017-01-01

    Cassava (Manihot esculenta Crantz) demand has been rising because of its various applications. High salinity stress is a major environmental factor that interferes with normal plant growth and limits crop productivity. As well as genetic engineering to enhance stress tolerance, the use of small molecules is considered as an alternative methodology to modify plants with desired traits. The effectiveness of histone deacetylase (HDAC) inhibitors for increasing tolerance to salinity stress has recently been reported. Here we use the HDAC inhibitor, suberoylanilide hydroxamic acid (SAHA), to enhance tolerance to high salinity in cassava. Immunoblotting analysis reveals that SAHA treatment induces strong hyper-acetylation of histones H3 and H4 in roots, suggesting that SAHA functions as the HDAC inhibitor in cassava. Consistent with increased tolerance to salt stress under SAHA treatment, reduced Na+ content and increased K+/Na+ ratio were detected in SAHA-treated plants. Transcriptome analysis to discover mechanisms underlying salinity stress tolerance mediated through SAHA treatment reveals that SAHA enhances the expression of 421 genes in roots under normal condition, and 745 genes at 2 h and 268 genes at 24 h under both SAHA and NaCl treatment. The mRNA expression of genes, involved in phytohormone [abscisic acid (ABA), jasmonic acid (JA), ethylene, and gibberellin] biosynthesis pathways, is up-regulated after high salinity treatment in SAHA-pretreated roots. Among them, an allene oxide cyclase (MeAOC4) involved in a crucial step of JA biosynthesis is strongly up-regulated by SAHA treatment under salinity stress conditions, implying that JA pathway might contribute to increasing salinity tolerance by SAHA treatment. Our results suggest that epigenetic manipulation might enhance tolerance to high salinity stress in cassava. PMID:28119717

  16. Bisindolylmaleimide protein-kinase-C inhibitors delay the decline in DNA synthesis in mouse hair follicle organ cultures.

    PubMed

    Harmon, C S; Nevins, T D; Ducote, J; Lutz, D

    1997-01-01

    We have used a series of bisindolylmaleimide selective protein-kinase C (PKC) inhibitors to investigate the role of this enzyme in the regulation of cell proliferation in mouse hair follicle organ cultures. Mouse whisker follicles were isolated by microdissection, and rates of DNA synthesis during culture were determined from 3H-thymidine incorporation. The bisindolylmaleimides Ro 31-7549, Ro 31-8161, Ro 31-8425 and Ro 31-8830 inhibit isolated brain PKC with IC50 values of 8-80 nM, are > 60-fold less potent against protein kinase A, and inhibit PKC-mediated protein phosphorylation in platelets with IC50 values in the range 0.25-4.4 microM. These PKC inhibitors were found to increase levels of mouse hair follicle DNA synthesis, with EC50 values in the range 1-4 microM and maximal levels in the range 151-197% of control. Ro 31-7549 had an IC50 value 50-fold lower than that of minoxidil, while the maximal level of DNA synthesis for the PKC inhibitor was 86% higher. Incubation of mouse hair follicles with Ro 31-7549 resulted in a delay of approximately 24 h in the onset of decline in follicular DNA synthesis rates. Ro 31-6045 and Ro 31-7208, bisindolylmaleimides without activity in the platelet PKC assay, did not affect mouse hair follicle DNA synthesis rates. Taken together, these findings show that PKC mediates, at least in part, the rapid loss of proliferative activity that occurs in mouse whisker follicles in culture, and provide further evidence that PKC plays a role as a negative proliferative signal in hair follicles.

  17. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  18. Functionalized imidazolium and benzimidazolium salts as paraoxonase 1 inhibitors: Synthesis, characterization and molecular docking studies.

    PubMed

    Karataş, Mert Olgun; Uslu, Harun; Alıcı, Bülent; Gökçe, Başak; Gencer, Nahit; Arslan, Oktay; Arslan, N Burcu; Özdemir, Namık

    2016-03-15

    Paraoxonase (PON) is a key enzyme in metabolism of living organisms and decreased activity of PON1 was acknowledged as a risk for atherosclerosis and organophosphate toxicity. The present study describes the synthesis, characterization, PON1 inhibitory properties and molecular docking studies of functionalized imidazolium and benzimidazolium salts (1a-5g). The structures of all compounds were elucidated by IR, NMR, elemental analysis and structures of compounds 2b and 2c were characterized by single-crystal X-ray diffraction. Compound 1c, a coumarin substituted imidazolium salt showed the best inhibitory effect on the activity of PON1 with good IC50 value (6.37 μM). Kinetic investigation was evaluated for this compound and results showed that this compound is competitive inhibitor of PON1 with Ki value of 2.39 μM. Molecular docking studies were also performed for most active compound 1c and one of least active compound 2c in order to determine the probable binding model into active site of PON1 and validation of the experimental results.

  19. Design and Synthesis of Novel Small-molecule Inhibitors of the Hypoxia Inducible Factor Pathway

    PubMed Central

    Mooring, Suazette Reid; Jin, Hui; Devi, Narra S.; Jabbar, Adnan A.; Kaluz, Stefan; Liu, Yuan; Van Meir, Erwin G.; Wang, Binghe

    2012-01-01

    Hypoxia, a reduction in partial oxygen pressure, is a salient property of solid tumors. Hypoxia drives malignant progression and metastasis in tumors and participates in tumor resistance to radio- and chemotherapies. Hypoxia activates the hypoxia-inducible factor (HIF) family of transcription factors, which induce target genes that regulate adaptive biological processes such as anaerobic metabolism, cell motility and angiogenesis. Clinical evidence has demonstrated that expression of HIF-1 is strongly associated with poor patient prognosis and activation of HIF-1 contributes to malignant behavior and therapeutic resistance. Consequently, HIF-1 has become an important therapeutic target for inhibition by small molecules. Herein, we describe the design and synthesis of small molecules that inhibit the HIF-1 signaling pathway. Many of these compounds exhibit inhibitory activity in the nanomolar range. Separate mechanistic studies indicate that these inhibitors do not alter HIF-1 levels, but interfere with the HIF-1α/HIF-1β/p300/CBP complex formation by interacting with p300 and CBP. PMID:22032632

  20. Design and synthesis of HIV-1 protease inhibitors for a long-acting injectable drug application.

    PubMed

    Kesteleyn, Bart; Amssoms, Katie; Schepens, Wim; Hache, Geerwin; Verschueren, Wim; Van De Vreken, Wim; Rombauts, Klara; Meurs, Greet; Sterkens, Patrick; Stoops, Bart; Baert, Lieven; Austin, Nigel; Wegner, Jörg; Masungi, Chantal; Dierynck, Inge; Lundgren, Stina; Jönsson, Daniel; Parkes, Kevin; Kalayanov, Genadiy; Wallberg, Hans; Rosenquist, Asa; Samuelsson, Bertil; Van Emelen, Kristof; Thuring, Jan Willem

    2013-01-01

    The design and synthesis of novel HIV-1 protease inhibitors (PIs) (1-22), which display high potency against HIV-1 wild-type and multi-PI-resistant HIV-mutant clinical isolates, is described. Lead optimization was initiated from compound 1, a Phe-Phe hydroxyethylene peptidomimetic PI, and was directed towards the discovery of new PIs suitable for a long-acting (LA) injectable drug application. Introducing a heterocyclic 6-methoxy-3-pyridinyl or a 6-(dimethylamino)-3-pyridinyl moiety (R(3)) at the para-position of the P1' benzyl fragment generated compounds with antiviral potency in the low single digit nanomolar range. Halogenation or alkylation of the metabolic hot spots on the various aromatic rings resulted in PIs with high stability against degradation in human liver microsomes and low plasma clearance in rats. Replacing the chromanolamine moiety (R(1)) in the P2 protease binding site by a cyclopentanolamine or a cyclohexanolamine derivative provided a series of high clearance PIs (16-22) with EC(50)s on wild-type HIV-1 in the range of 0.8-1.8 nM. PIs 18 and 22, formulated as nanosuspensions, showed gradual but sustained and complete release from the injection site over two months in rats, and were therefore identified as interesting candidates for a LA injectable drug application for treating HIV/AIDS.

  1. Evaluation of Two Formulated Chitin Synthesis Inhibitors, Hexaflumuron and Lufenuron Against the Raisin Moth, Ephestia figulilella

    PubMed Central

    Khajepour, Simin; Izadi, Hamzeh; Asari, Mohammad Javad

    2012-01-01

    The raisin moth, Ephestia figulilella Gregson (Lepidoptera: Pyralidae), has a nearly cosmopolitan distribution, and causes severe quantitative and qualitative losses throughout the world. The larvae attack various drying and dried fruits, fallen figs, and damaged or moldy clusters of grapes on vines. Control of this pest in storage depends mostly on synthetic pesticides with several adverse side effects. To mitigate the adverse effects of these pesticides, investigations have focused on the development of compounds with more selectivity, and short residual life. In this research, insecticidal effects of two chitin synthesis inhibitors, hexaflumuron and lufenuron, were investigated against E. figulilella. Graded concentrations of each pesticide were prepared with distilled water. One-day-old fifth instar were sprayed by Potter's precision spray tower. Application of hexaflumuron and lufenuron on last instar larvae of E. figulilella caused not only mortality in larval stage, but also caused defects in pupal and adult stages. Larval mortality increased as concentration increased. The longevity of the fifth instars in both hexaflumuron and lufenuron treatments, in comparison with the controls, increased by more than 12 days. The longevity of adults decreased by about 10 days. Probit analysis data revealed that the sensitivity of the test insect to hexaflumuron (EC50 = 95.38 ppm) was greater than lufenuron (EC50= 379.21 ppm). PMID:23425138

  2. Synthesis and Identification of Pregnenolone Derivatives as Inhibitors of Isozymes of 5α-Reductase.

    PubMed

    Chávez-Riveros, Alejandra; Bratoeff, Eugene; Heuze, Yvonne; Soriano, Juan; Moreno, Isabel; Sánchez-Márquez, Araceli; Cabeza, Marisa

    2015-09-17

    Hyperplasia of the prostate gland and prostate cancer have been associated with high levels of serum 5α-dihydrotestosterone. This steroid is formed from testosterone by the activity of the enzyme 5α-reductase (5α-R) present in the prostate. Thus, inhibition of this enzyme could be a goal for therapies to treat these diseases. This study reports the synthesis and effects of five different 21-esters of pregnenolone derivatives as inhibitors of 5α-R types 1 and 2. The activity of these steroidal compounds was determined using in vivo and in vitro experiments. The results indicate that of the five steroids studied, the 21(p-fluoro)benzoyloxypregna-4,16-diene-3,6,20-trione derivative, whose structure has not yet been reported, has the best molecular conformation to inhibit the in vitro activity of both types of 5α-R. In addition, this steroid also displayed activity in vivo. Apparently, its pharmacological effect was increased by the presence of a keto group at C-6, because this group decreased the possibility that the steroid would be metabolized by hepatic enzymes. In addition, the double bond present at C-4 of this compound also enhanced its inhibitory activity on 5α-R, and the C-21 ester moiety increased its liphophilicity. Therefore, its solubility in the cell membrane and its pharmacological activity were both increased.

  3. QSAR studies, synthesis and antibacterial assessment of new inhibitors against multidrug-resistant Mycobacterium tuberculosis.

    PubMed

    Kovalishyn, Vasyl; Brovarets, Volodymyr; Blagodatnyi, Volodymyr; Kopernyk, Iryna; Hodyna, Diana; Chumachenko, Svitlana; Shablykin, Oleg; Kozachenko, Oleksandr; Vovk, Myhailo; Barus, Marianna; Bratenko, Myhailo; Metelytsia, Larysa

    2016-11-08

    This paper describes Quantitative Structure-Activity Relationships (QSAR) studies using Artificial Neural Networks (ANN), synthesis and in vitro antitubercular activity of several potent compounds against H37Rv and resistant Mycobacterium tuberculosis (Mtb) strains. Eight QSAR models were built using various types of descriptors with four publicly available structurally diverse datasets, including recent data from PubChem and ChEMBL. The predictive power of the obtained QSAR models was evaluated with a cross-validation procedure, giving a q2=0.74-0.78 for regression models and overall accuracy 78.9-94.4% for classification models. The external test sets were predicted with accuracies in the range of 84.1-95.0% (for the active/inactive classifications) and q2=0.80-0.83 for regressions. The 15 synthesized compounds showed inhibitory activity against H37Rv strain whereas the compounds 1-7 were also active against resistant Mtb strain (resistant to isoniazid and rifampicin). The results indicated that compounds 1-7 could serve as promising leads for further optimization as novel antibacterial inhibitors, in particular, for the treatment of drug resistance of Mtb forms.

  4. Synthesis and Pharmacokinetic Evaluation of Siderophore Biosynthesis Inhibitors for Mycobacterium tuberculosis

    PubMed Central

    Nelson, Kathryn M.; Viswanathan, Kishore; Dawadi, Surendra; Duckworth, Benjamin P.; Boshoff, Helena I.; Barry, Clifton E.; Aldrich, Courtney C.

    2015-01-01

    MbtA catalyzes the first committed biosynthetic step of the mycobactins, which are important virulence factors associated with iron acquisition in Mycobacterium tuberculosis. MbtA is a validated therapeutic target for antitubercular drug development. 5′-O-[N-(salicyl)sulfamoyl]adenosine (1) is a bisubstrate inhibitor of MbtA and exhibits exceptionally potent biochemical and antitubercular activity. However, 1 suffers from sub-optimal drug disposition properties resulting in a short half-life (t1/2), low exposure (AUC), and low bioavailability (F). Four strategies were pursued to address these liabilities including the synthesis of prodrugs, increasing the pKa of the acyl-sulfonyl moiety, modulation of the lipophilicity, and strategic introduction of fluorine into 1. Complete pharmacokinetic (PK) analysis of all compounds was performed. The most successful modifications involved fluorination of the nucleoside that provided substantial improvements in t1/2 and AUC. Increasing the pKa of the acyl-sulfonyl linker yielded incremental enhancements while modulation of the lipophilicity and prodrug approaches led to substantially poorer PK parameters. PMID:26110337

  5. Alpha-fluoromethylhistidine, a histamine synthesis inhibitor, inhibits orexin-induced wakefulness in rats.

    PubMed

    Yasuko, Seki; Atanda, Akanmu Moses; Masato, Matsuura; Kazuhiko, Yanai; Kazuki, Honda

    2010-02-11

    Orexins A and B are involved in the regulation of feeding and arousal state. Previously, we reported that third intracerebroventricular (icv) infusion of both orexins A and B induced a significant arousal effect in rats. We determined the effects of intraperitoneal (i.p.) injection of alpha-fluoromethylhistidine (alpha-FMH), a histamine synthesis inhibitor, on orexin-induced wakefulness in freely behaving rats. Male Sprague-Dawley rats were chronically implanted with cortical electroencephalogram (EEG) and neck electromyogram (EMG) electrodes, and a cannula for icv infusion. EEG and EMG were monitored for three consecutive days during continuous icv saline infusion at a rate of 10 microl/h. For a 5-h diurnal period, orexin-B (10 nmol/50 microl saline) replaced the icv infusion of saline. alpha-FMH (100mg/kg, i.p.) was administered 6h before icv infusion of orexin-B. Orexin-B at a dose of 10 nmol/h markedly increased the amount of wakefulness by 99.4% (p<0.05) over the baseline value, whereas alpha-FMH decreased orexin-B-induced wakefulness by 48.8%. Orexin-B-induced suppression of non-REM sleep was reversed by alpha-FMH treatment. Pretreatment with alpha-FMH, significantly inhibited orexin-B-induced wakefulness in rats. The findings of this study therefore suggest that arousal-state regulation by orexin neurons is possibly mediated via the histaminergic system in the tuberomammilary nucleus.

  6. Synthesis of three bromophenols from red algae as PTP1B inhibitors

    NASA Astrophysics Data System (ADS)

    Guo, Shuju; Li, Jing; Li, Ting; Shi, Dayong; Han, Lijun

    2011-01-01

    Bromophenols are a set of natural products widely distributed in seaweed, most of which exhibit interesting and useful biological activities. To develop a reliable and efficient synthetic route to these natural bromophenols, three of them, 3,4-dibromo-5-(2'-bromo-3',4'-dihydroxy-6'-methoxymethyl-benzyl)-benzene-1,2-diol (compound 9), 3,4-dibromo-5-(2'-bromo-6'-ethoxy methyl-3',4'-dihydroxybenzyl)-benzene-1,2-diol (compound 10), and 3-bromo-4-(3'-bromo-4',5'-dihydroxy benzyl)-5-(ethoxymethyl)-benzene-1,2-diol (compound 14), isolated from red marine algae, have been synthesized in eight steps with an overall yield of 14.4%, 14.4%, and 18.2% respectively, via a practical approach employing bromination, Wolff-Kishner-Huang reduction and a Friedel-Crafts reaction as key steps. The protein tyrosine phosphatase 1B (PTP1B) inhibitory activities of the synthetic compounds were evaluated by the colorimetric assay. The results show that these compounds are moderate PTP1B inhibitors. The synthesis of these bromophenol derivatives makes in vivo studies of their structure-activity relationships and inhibition activity against PTP1B possible.

  7. Molecular design and synthesis of novel peptides from amphibians skin acting as inhibitors of cholinesterase enzymes.

    PubMed

    Siano, Alvaro; Garibotto, Francisco F; Andujar, Sebastian A; Baldoni, Hector A; Tonarelli, Georgina G; Enriz, Ricardo D

    2017-03-01

    Cholinesterases are a family of enzymes that catalyze the hydrolysis of neurotransmitter acetylcholine. There are two types of cholinesterases, acetylcholinesterase (AChE) and butyrylcholinesterase (BChE), which differ in their distribution in the body. Currently, cholinesterase inhibitors (ChEI) represent the treatment of choice for Alzheimer's disease (AD). In this paper, we report the synthesis and inhibitory effect on both enzymes of four new peptides structurally related to P1-Hp-1971 (amphibian skin peptide found in our previous work. Sequence: TKPTLLGLPLGAGPAAGPGKR-NH2 ). The bioassay data and cytotoxicity test show that some of the compounds possess a significant AChE and BChE inhibition and no toxic effect. The present work demonstrates that diminution of the size of the original peptide could potentially result in new compounds with significant cholinesterase inhibition activity, although it appears that there is an optimal size for the sequence. We also conducted an exhaustive molecular modeling study to better understand the mechanism of action of these compounds by combining docking techniques with molecular dynamics simulations on BChE. This is the first report about amphibian peptides and the second one of natural peptides with ChE inhibitory activity. Copyright © 2017 European Peptide Society and John Wiley & Sons, Ltd.

  8. Pyridopyrimidine derivatives as inhibitors of cyclic nucleotide synthesis: Application for treatment of diarrhea

    PubMed Central

    Kots, Alexander Y.; Choi, Byung-Kwon; Estrella-Jimenez, Maria E.; Warren, Cirle A.; Gilbertson, Scott R.; Guerrant, Richard L.; Murad, Ferid

    2008-01-01

    Acute secretory diarrhea induced by infection with enterotoxigenic strains of Escherichia coli involves binding of stable toxin (STa) to its receptor on the intestinal brush border, guanylyl cyclase type C (GC-C). Intracellular cGMP is elevated, inducing increase in chloride efflux and subsequent accumulation of fluid in the intestinal lumen. We have screened a library of compounds and identified a pyridopyrimidine derivatives {5-(3-bromophenyl)-1,3-dimethyl-5,11-dihydro-1H-indeno[2′,1′:5,6]pyrido[2,3-d]pyrimidine-2,4,6-trione; BPIPP} as an inhibitor of GC-C that can suppress STa-stimulated cGMP accumulation by decreasing GC-C activation in intact T84 human colorectal carcinoma cells. BPIPP inhibited stimulation of guanylyl cyclases, including types A and B and soluble isoform in various cells. BPIPP suppressed stimulation of adenylyl cyclase and significantly decreased the activities of adenylyl cyclase toxin of Bordetella pertussis and edema toxin of Bacillus anthracis. The effects of BPIPP on cyclic nucleotide synthesis were observed only in intact cells. The mechanism of BPIPP-dependent inhibition appears to be complex and indirect, possibly associated with phospholipase C and tyrosine-specific phosphorylation. BPIPP inhibited chloride-ion transport stimulated by activation of guanylyl or adenylyl cyclases and suppressed STa-induced fluid accumulation in an in vivo rabbit intestinal loop model. Thus, BPIPP may be a promising lead compound for treatment of diarrhea and other diseases. PMID:18559851

  9. Novel chemo-enzymatic oligomers of cinnamic acids as direct and indirect inhibitors of coagulation proteinases.

    PubMed

    Monien, Bernhard H; Henry, Brian L; Raghuraman, Arjun; Hindle, Michael; Desai, Umesh R

    2006-12-01

    Thrombin and factor Xa, two important procoagulant enzymes, have been prime targets for regulation of clotting through the direct and indirect mechanism of inhibition. Our efforts on exploiting the indirect mechanism led us to study a carboxylic acid-based scaffold, which displayed major acceleration in the inhibition of these enzymes [J. Med. Chem.2005, 48, 1269, 5360]. This work advances the study to chemo-enzymatically prepared oligomers of 4-hydroxycinnamic acids, DHPs, which display interesting anticoagulant properties. Oligomers, ranging in size from tetramers to pentadecamers, were prepared through peroxidase-catalyzed oxidative coupling of caffeic, ferulic, and sinapic acids, and sulfated using triethylamine-sulfur trioxide complex. Chromatographic, spectroscopic, and elemental studies suggest that the DHPs are heterogeneous, polydisperse preparations composed of inter-monomer linkages similar to those found in natural lignins. Measurement of activated thromboplastin and prothrombin time indicates that both the sulfated and unsulfated derivatives of the DHPs display anticoagulant activity, which is dramatically higher than that of the reference polyacrylic acids. More interestingly, this activity approaches that of low-molecular-weight heparin with the sulfated derivative showing approximately 2- to 3-fold greater potency than the unsulfated parent. Studies on the inhibition of factor Xa and thrombin indicate that the oligomers exert their anticoagulant effect through both direct and indirect inhibition mechanisms. This dual inhibition property of 4-hydroxycinnamic acid-based DHP oligomers is the first example in inhibitors of coagulation. This work puts forward a novel, non-heparin structure, which may be exploited for the design of potent, dual action inhibitors of coagulation through combinatorial virtual screening on a library of DHP oligomers.

  10. Regioselective Synthesis of a Family of β‐Lactams Bearing a Triazole Moiety as Potential Apoptosis Inhibitors

    PubMed Central

    Garrido, Maria; Corredor, Miriam; Orzáez, Mar; Alfonso, Ignacio

    2016-01-01

    Abstract Apoptosis is a biological process important to several human diseases; it is strongly regulated through protein–protein interactions and complex formation. We previously reported the synthesis of apoptosis inhibitors bearing an exocyclic triazole amide isoster by using an Ugi four‐component coupling reaction (Ugi‐4CC), followed by a base‐promoted intramolecular cyclization. Depending on the substitution patterns and the reaction conditions, this cyclization forms the six‐ or four‐membered ring. Two compounds bearing the β‐lactam scaffold turned out to be the most potent inhibitors. This encouraged us to optimize the modulation of the cyclization, and prepare a library of 15 β‐lactams with total regioselectivity. Moreover, we aimed to improve the bioavailability of these compounds through the introduction of diversity at different substitution positions. The activity of these compounds as apoptosis inhibitors in cellular extracts has been evaluated, showing an increase in their potency. PMID:27777842

  11. Regioselective Synthesis of a Family of β-Lactams Bearing a Triazole Moiety as Potential Apoptosis Inhibitors.

    PubMed

    Garrido, Maria; Corredor, Miriam; Orzáez, Mar; Alfonso, Ignacio; Messeguer, Angel

    2016-10-01

    Apoptosis is a biological process important to several human diseases; it is strongly regulated through protein-protein interactions and complex formation. We previously reported the synthesis of apoptosis inhibitors bearing an exocyclic triazole amide isoster by using an Ugi four-component coupling reaction (Ugi-4CC), followed by a base-promoted intramolecular cyclization. Depending on the substitution patterns and the reaction conditions, this cyclization forms the six- or four-membered ring. Two compounds bearing the β-lactam scaffold turned out to be the most potent inhibitors. This encouraged us to optimize the modulation of the cyclization, and prepare a library of 15 β-lactams with total regioselectivity. Moreover, we aimed to improve the bioavailability of these compounds through the introduction of diversity at different substitution positions. The activity of these compounds as apoptosis inhibitors in cellular extracts has been evaluated, showing an increase in their potency.

  12. Chemical synthesis and structural characterization of the RGD-protein decorsin: a potent inhibitor of platelet aggregation.

    PubMed Central

    Polverino de Laureto, P.; Scaramella, E.; De Filippis, V.; Marin, O.; Doni, M. G.; Fontana, A.

    1998-01-01

    Decorsin is a 39-residue RGD-protein crosslinked by three disulfide bridges isolated from the leech Macrobdella decora belonging to the family of GPIIb-IIIa antagonists and acting as a potent inhibitor of platelet aggregation. Here we report the solid-phase synthesis of decorsin using the Fmoc strategy. The crude polypeptide was purified by reverse-phase HPLC in its reduced form and allowed to refold in the presence of glutathione. The homogeneity of the synthetic oxidized decorsin was established by reverse-phase HPLC and capillary zone electrophoresis. The results of amino acid analysis after acid hydrolysis of the synthetic protein, NH2-terminal sequencing and mass determination (4,377 Da) by electrospray mass spectrometry were in full agreement with this theory. The correct pairing of the three disulfide bridges in synthetic decorsin was determined by a combined approach of both peptide mapping using proteolytic enzymes and analysis of the disulfide chirality by CD spectroscopy in the near-UV region. Synthetic decorsin inhibited human platelet aggregation with an IC50 of approximately 0.1 microM, a figure quite similar to that determined utilizing decorsin from natural source. In particular, the synthetic protein was 2,000-fold more potent than a model RGD-peptide (e.g., Arg-Gly-Asp-Ser) in inhibiting platelet aggregation. Thermal denaturation experiments of synthetic decorsin, monitored by CD spectroscopy, revealed its high thermal stability (Tm approximately 74 degrees C). The features of the oxidative refolding process of reduced decorsin, as well as the thermal stability of the oxidized species, were compared with those previously determined for the NH2-terminal core domain fragment 1-41 or 1-43 from hirudin. This fragment shows similarity in size, pairing of the three disulfides and three-dimensional structure with those of decorsin, even if very low sequence similarity. It is suggested that the less efficient oxidative folding and the enhanced thermal

  13. Benzimidazole as corrosion inhibitor for heat treated 6061 Al- SiCp composite in acetic acid

    NASA Astrophysics Data System (ADS)

    Chacko, Melby; Nayak, Jagannath

    2015-06-01

    6061 Al-SiCpcomposite was solutionizedat 350 °C for 30 minutes and water quenched. It was then underaged at 140 °C (T6 treatment). The aging behaviour of the composite was studied using Rockwell B hardness measurement. Corrosion behaviour of the underaged sample was studied in different concentrations of acetic acid and at different temperatures. Benzimidazole at different concentrations was used for the inhibition studies. Inhibition efficiency of benzimidazole was calculated for different experimental conditions. Thermodynamic parameters were found out which suggested benzimidazole is an efficient inhibitor and it adsorbed on to the surface of composite by mixed adsorption where chemisorption is predominant.

  14. Sterculic Acid and Its Analogues Are Potent Inhibitors of Toxoplasma gondii

    PubMed Central

    Hao, Pan; Alaraj, Intisar Q. M.; Dulayymi, Juma’a R. Al; Baird, Mark S.; Liu, Jing; Liu, Qun

    2016-01-01

    Toxoplasmosis is a serious disease caused by Toxoplasma gondii, one of the most widespread parasites in the world. Lipid metabolism is important in the intracellular stage of T. gondii. Stearoyl-CoA desaturase (SCD), a key enzyme for the synthesis of unsaturated fatty acid is predicted to exist in T. gondii. Sterculic acid has been shown to specifically inhibit SCD activity. Here, we examined whether sterculic acid and its methyl ester analogues exhibit anti-T. gondii effects in vitro. T. gondii-infected Vero cells were disintegrated at 36 hr because of the propagation and egress of intracellular tachyzoites. All test compounds inhibited tachyzoite propagation and egress, reducing the number of ruptured Vero cells by the parasites. Sterculic acid and the methyl esters also inhibited replication of intracellular tachyzoites in HFF cells. Among the test compounds, sterculic acid showed the most potent activity against T. gondii, with an EC50 value of 36.2 μM, compared with EC50 values of 248-428 μM for the methyl esters. Our study demonstrated that sterculic acid and its analogues are effective in inhibition of T. gondii growth in vitro, suggesting that these compounds or analogues targeting SCD could be effective agents for the treatment of toxoplasmosis. PMID:27180571

  15. Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria1[OPEN

    PubMed Central

    Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.

    2016-01-01

    Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016

  16. Synthesis and cholinesterase inhibition of cativic acid derivatives.

    PubMed

    Alza, Natalia P; Richmond, Victoria; Baier, Carlos J; Freire, Eleonora; Baggio, Ricardo; Murray, Ana Paula

    2014-08-01

    Alzheimer's disease (AD) is a neurodegenerative disorder associated with memory impairment and cognitive deficit. Most of the drugs currently available for the treatment of AD are acetylcholinesterase (AChE) inhibitors. In a preliminary study, significant AChE inhibition was observed for the ethanolic extract of Grindelia ventanensis (IC₅₀=0.79 mg/mL). This result prompted us to isolate the active constituent, a normal labdane diterpenoid identified as 17-hydroxycativic acid (1), through a bioassay guided fractionation. Taking into account that 1 showed moderate inhibition of AChE (IC₅₀=21.1 μM), selectivity over butyrylcholinesterase (BChE) (IC₅₀=171.1 μM) and that it was easily obtained from the plant extract in a very good yield (0.15% w/w), we decided to prepare semisynthetic derivatives of this natural diterpenoid through simple structural modifications. A set of twenty new cativic acid derivatives (3-6) was prepared from 1 through transformations on the carboxylic group at C-15, introducing a C2-C6 linker and a tertiary amine group. They were tested for their inhibitory activity against AChE and BChE and some structure-activity relationships were outlined. The most active derivative was compound 3c, with an IC₅₀ value of 3.2 μM for AChE. Enzyme kinetic studies and docking modeling revealed that this inhibitor targeted both the catalytic active site and the peripheral anionic site of this enzyme. Furthermore, 3c showed significant inhibition of AChE activity in SH-SY5Y human neuroblastoma cells, and was non-cytotoxic.

  17. Synthesis and SAR of new pyrazolo[4,3-h]quinazoline-3-carboxamide derivatives as potent and selective MPS1 kinase inhibitors.

    PubMed

    Caldarelli, Marina; Angiolini, Mauro; Disingrini, Teresa; Donati, Daniele; Guanci, Marco; Nuvoloni, Stefano; Posteri, Helena; Quartieri, Francesca; Silvagni, Marco; Colombo, Riccardo

    2011-08-01

    The synthesis and SAR of a series of novel pyrazolo-quinazolines as potent and selective MPS1 inhibitors are reported. We describe the optimization of the initial hit, identified by screening the internal library collection, into an orally available, potent and selective MPS1 inhibitor.

  18. Synthesis and optimization of thiadiazole derivatives as a novel class of substrate competitive c-Jun N-terminal kinase inhibitors

    PubMed Central

    De, Surya K.; Chen, Vida; Stebbins, John L.; Chen, Li-Hsing; Cellitti, Jason F.; Machleidt, Thomas; Barile, Elisa; Riel-Mehan, Megan; Dahl, Russell; Yang, Li; Emdadi, Aras; Murphy, Ria; Pellecchia, Maurizio

    2009-01-01

    A series of thiadiazole derivatives has been designed as potential allosteric, substrate competitive inhibitors of the protein kinase JNK. We report on the synthesis, characterization and evaluation of a series of compounds that resulted in the identification of potent and selective JNK inhibitors targeting its JIP-1 docking site. PMID:20045647

  19. Regioselective synthesis of 5- and 6-methoxybenzimidazole-1,3,5-triazines as inhibitors of phosphoinositide 3-kinase.

    PubMed

    Miller, Michelle S; Pinson, Jo-Anne; Zheng, Zhaohua; Jennings, Ian G; Thompson, Philip E

    2013-02-01

    Phosphoinositide 3-kinases (PI3K) hold significant therapeutic potential as novel targets for the treatment of cancer. ZSTK474 (4a) is a potent, pan-PI3K inhibitor currently under clinical evaluation for the treatment of cancer. Structural studies have shown that derivatisation at the 5- or 6-position of the benzimidazole ring may influence potency and isoform selectivity. However, synthesis of these derivatives by the traditional route results in a mixture of the two regioisomers. We have developed a straightforward regioselective synthesis that gave convenient access to 5- and 6-methoxysubstituted benzimidazole derivatives of ZSTK474. While 5-methoxy substitution abolished activity at all isoforms, the 6-methoxy substitution is consistently 10-fold more potent. This synthesis will allow convenient access to further 6-position derivatives, thus allowing the full scope of the structure-activity relationships of ZSTK474 to be probed.

  20. Synthesis and fungicidal activity of aryl carbamic acid-5-aryl-2-furanmethyl ester.

    PubMed

    Li, Ying; Li, Bao-Ju; Ling, Yun; Miao, Hong-Jian; Shi, Yan-Xia; Yang, Xin-Ling

    2010-03-10

    Chitin, a major structural component of insect cuticle and fungus cell wall but absent in plants and vertebrates, is regarded as a safe and selective target for pest control agents. Chitin synthesis inhibitors (CSIs) have been well-known as insect growth regulators (IGRs) but rarely found as fungicides in agriculture. To find novel CSIs with good activity, benzoylphenylurea, a typical kind of CSIs, was chosen as the lead compound and 26 novel aryl carbamic acid-5-aryl-2-furanmethyl esters were designed by converting the urea linkages of benzoylphenylureas to carbamic acid esters and changing the aniline parts into furanmethyl groups. The title compounds were synthesized and their structures confirmed by IR, (1)H NMR, and elemental analysis. Preliminary insecticidal and fungicidal bioassays were carried out. The results indicated that the title compounds had no insecticidal effect on Culex pipiens pallens and Plutella xylostella Linnaeus , but most compounds exhibited good fungicidal activities against Corynespora cassiicola , Thanatephorus cucumeris , Botrytis cinerea , and Fusarium oxysporum . In particular, compounds V-4, V-6, V-7, and V-8 showed better activities against the four strains than those of the commercialized fungicides. The morphologic result suggested that compound V-21 had disturbed the cell wall formation of C. cassiicola. The results indicated that modification on the urea linkage of benzoylphenylurea was an effective way to discover new candidates for fungicides.