Sample records for acid synthesis pathway

  1. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams


    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  2. Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.

  3. [Genetic code: codon bases--the symbols of amino acid synthesis and catabolism pathways].


    Konyshev, V A


    The correlations between genetic codes of amino acids and pathways of synthesis and catabolism of carbon backbone of amino acids are considered. Codes of amino acids which are synthesized from oxoacids of glycolysis, the Krebs cycle and glyoxalic cycle via transamination without any additional chemical reactions, are initiated with guanine (alanine, glutamic and aspartic acids, glycine). Codons of amino acids which are formed on the branches of glycolysis at the level of compounds with three carbon atoms, begin with uracil (phenylalanine, serine, leucine, tyrosine, cysteine, tryptophan). Codes of amino acids formed from aspartate begin with adenine (methionine, isoleucine, threonine, asparagine, lysine, serine), while those of the amino acids formed from the compounds with five carbon atoms (glutamic acid and phosphoribosyl pyrophosphate) begin with cytosine (arginine, proline, glutamine, histidine). The second letter of codons is linked to catabolic pathways of amino acids: most of amino acids entering glycolysis and the Krebs cycle through even-numbered carbon compounds, have adenine and uracil at the second position of codes (A-U type); most of amino acids entering the glycolysis and the Krebs cycle via odd-numbered carbon compounds, have codons with guanine and cytidine at the second position (G-C type). The usage of purine and pyrimidine as the third letter of weak codones in most of amino acids is linked to the enthropy of amino acid formation. A hypothesis claiming that the linear genetic code was assembled from the purine and pyrimidine derivatives which have acted as participants of primitive control of amino acid synthesis and catabolism, is suggested.

  4. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.


    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J


    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism.

  5. Fatty acid synthesis and pyruvate metabolism pathways remain active in dihydroartemisinin-induced dormant ring stages of Plasmodium falciparum.


    Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin


    Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment.

  6. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.


    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki


    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  7. Regulation of ascorbic acid and of xylulose synthesis in rat-liver extracts. The effect of starvation on the enzymes of the glucuronic acid pathway

    PubMed Central

    Stirpe, F.; Comporti, M.


    1. The synthesis of ascorbic acid in rat-liver extracts is impaired during starvation, and more from glucuronolactone and glucuronate than from gulonate and gulonolactone. 2. The formation of xylulose from gulonate and from gulonolactone is greatly enhanced during starvation, whereas it is decreased from glucuronolactone and from glucuronate. 3. The activity of the enzymes of the glucuronic acid pathway during starvation has been determined in rat-liver preparations. Gulonolactone oxidase is decreased, NAD-linked gulonate dehydrogenase is enhanced, and uronolactonase, aldonolactonase and NADP-linked hexonate dehydrogenase are unchanged. 4. The impairment of ascorbic acid synthesis from gulonate observed during starvation can be accounted for by the depressed activity of gulonolactone oxidase. 5. The cause of the enhanced formation of xylulose has been located in the sedimentable fraction of liver homogenate. 6. The hypothesis is formulated of an increased utilization of the glucuronic acid pathway during starvation. PMID:14340084

  8. Chenodeoxycholic acid synthesis in the hamster: a metabolic pathway via 3 beta, 7 alpha-dihydroxy-5-cholen-24-oic acid

    SciTech Connect

    Kulkarni, B.; Javitt, N.B.


    The quantitative significance of the metabolism of 3 beta, 7 alpha-dihydroxy-5-cholen-24-oic acid to chenodeoxycholic acid was evaluated in the hamster. A precursor-product relationship was established in this species by the finding that intravenous administration to an animal previously given cholesterol-4-14C caused a significant reduction in the specific activity of chenodeoxycholic acid. Administration of 12.9 mumole of the precursor was followed by a 10-fold increase in chenodeoxycholic acid excretion although the predominant excretory pathway was via biliary excretion as a monosulfate. The data indicate that synthesis of bile acid from cholesterol via the intermediate 3 beta, 7 alpha-dihydroxy-5-cholen-24-oic acid can be a quantitatively important pathway.

  9. Maintenance of essential amino acid synthesis pathways in the Blattabacterium cuenoti symbiont of a wood-feeding cockroach.


    Tokuda, Gaku; Elbourne, Liam D H; Kinjo, Yukihiro; Saitoh, Seikoh; Sabree, Zakee; Hojo, Masaru; Yamada, Akinori; Hayashi, Yoshinobu; Shigenobu, Shuji; Bandi, Claudio; Paulsen, Ian T; Watanabe, Hirofumi; Lo, Nathan


    In addition to harbouring intestinal symbionts, some animal species also possess intracellular symbiotic microbes. The relative contributions of gut-resident and intracellular symbionts to host metabolism, and how they coevolve are not well understood. Cockroaches and the termite Mastotermes darwiniensis present a unique opportunity to examine the evolution of spatially separated symbionts, as they harbour gut symbionts and the intracellular symbiont Blattabacterium cuenoti. The genomes of B. cuenoti from M. darwiniensis and the social wood-feeding cockroach Cryptocercus punctulatus are each missing most of the pathways for the synthesis of essential amino acids found in the genomes of relatives from non-wood-feeding hosts. Hypotheses to explain this pathway degradation include: (i) feeding on microbes present in rotting wood by ancestral hosts; (ii) the evolution of high-fidelity transfer of gut microbes via social behaviour. To test these hypotheses, we sequenced the B. cuenoti genome of a third wood-feeding species, the phylogenetically distant and non-social Panesthia angustipennis. We show that host wood-feeding does not necessarily lead to degradation of essential amino acid synthesis pathways in B. cuenoti, and argue that ancestral high-fidelity transfer of gut microbes best explains their loss in strains from M. darwiniensis and C. punctulatus.

  10. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    SciTech Connect

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.


    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease.

  11. Altering the Mitochondrial Fatty Acid Synthesis (mtFASII) Pathway Modulates Cellular Metabolic States and Bioactive Lipid Profiles as Revealed by Metabolomic Profiling

    PubMed Central

    Clay, Hayley B.; Parl, Angelika K.; Mitchell, Sabrina L.; Singh, Larry; Bell, Lauren N.; Murdock, Deborah G.


    Despite the presence of a cytosolic fatty acid synthesis pathway, mitochondria have retained their own means of creating fatty acids via the mitochondrial fatty acid synthesis (mtFASII) pathway. The reason for its conservation has not yet been elucidated. Therefore, to better understand the role of mtFASII in the cell, we used thin layer chromatography to characterize the contribution of the mtFASII pathway to the fatty acid composition of selected mitochondrial lipids. Next, we performed metabolomic analysis on HeLa cells in which the mtFASII pathway was either hypofunctional (through knockdown of mitochondrial acyl carrier protein, ACP) or hyperfunctional (through overexpression of mitochondrial enoyl-CoA reductase, MECR). Our results indicate that the mtFASII pathway contributes little to the fatty acid composition of mitochondrial lipid species examined. Additionally, loss of mtFASII function results in changes in biochemical pathways suggesting alterations in glucose utilization and redox state. Interestingly, levels of bioactive lipids, including lysophospholipids and sphingolipids, directly correlate with mtFASII function, indicating that mtFASII may be involved in the regulation of bioactive lipid levels. Regulation of bioactive lipid levels by mtFASII implicates the pathway as a mediator of intracellular signaling. PMID:26963735

  12. Integrated engineering of β-oxidation reversal and ω-oxidation pathways for the synthesis of medium chain ω-functionalized carboxylic acids.


    Clomburg, James M; Blankschien, Matthew D; Vick, Jacob E; Chou, Alexander; Kim, Seohyoung; Gonzalez, Ramon


    An engineered reversal of the β-oxidation cycle was exploited to demonstrate its utility for the synthesis of medium chain (6-10-carbons) ω-hydroxyacids and dicarboxylic acids from glycerol as the only carbon source. A redesigned β-oxidation reversal facilitated the production of medium chain carboxylic acids, which were converted to ω-hydroxyacids and dicarboxylic acids by the action of an engineered ω-oxidation pathway. The selection of a key thiolase (bktB) and thioesterase (ydiI) in combination with previously established core β-oxidation reversal enzymes, as well as the development of chromosomal expression systems for the independent control of pathway enzymes, enabled the generation of C6-C10 carboxylic acids and provided a platform for vector based independent expression of ω-functionalization enzymes. Using this approach, the expression of the Pseudomonas putida alkane monooxygenase system, encoded by alkBGT, in combination with all β-oxidation reversal enzymes resulted in the production of 6-hydroxyhexanoic acid, 8-hydroxyoctanoic acid, and 10-hydroxydecanoic acid. Following identification and characterization of potential alcohol and aldehyde dehydrogenases, chnD and chnE from Acinetobacter sp. strain SE19 were expressed in conjunction with alkBGT to demonstrate the synthesis of the C6-C10 dicarboxylic acids, adipic acid, suberic acid, and sebacic acid. The potential of a β-oxidation cycle with ω-oxidation termination pathways was further demonstrated through the production of greater than 0.8 g/L C6-C10 ω-hydroxyacids or about 0.5 g/L dicarboxylic acids of the same chain lengths from glycerol (an unrelated carbon source) using minimal media.

  13. Enterobacter sp. I-3, a bio-herbicide inhibits gibberellins biosynthetic pathway and regulates abscisic acid and amino acids synthesis to control plant growth.


    Radhakrishnan, Ramalingam; Park, Jae-Man; Lee, In-Jung


    Very few bacterial species were identified as bio-herbicides for weed control. The present research was focused to elucidate the plant growth retardant properties of Enterobacter sp. I-3 during their interaction by determining the changes in endogenous photosynthetic pigments, plant hormones and amino acids. The two bacterial isolates I-4-5 and I-3 were used to select the superior bacterium for controlling weed seeds (Echinochloa crus-galli L. and Portulaca oleracea L.) germination. The post-inoculation of I-3 (Enterobacter sp. I-3) significantly inhibited the weeds seed germination than their controls. The mechanism of bacterium induced plant growth reduction was identified in lettuce treated with I-3 bacterium and compared their effects with known chemical herbicide, trinexapac-ethyl (TE). The treatment of I-3 and TE showed a significant inhibitory effect on shoot length, leaf number, leaf length, leaf width, shoot weight, root weight and chlorophyll content in lettuce seedlings. The endogenous gibberellins (GAs) and abscisic acid (ABA) analysis showed that Enterobacter sp. I-3 treated plants had lower levels of GAs (GA12, GA19, GA20 and GA8) and GAs/ABA ratio and then, the higher level of ABA when compared to their controls. Indeed, the individual amino acids ie., aspartic acid, glutamic acid, glycine, threonine, alanine, serine, leucine, isoleucine and tyrosine were declined in TE and I-3 exposed plants. Our results suggest that the utilization of Enterobacter sp. I-3 inhibits the GAs pathway and amino acids synthesis in weeds to control their growth can be an alternative to chemical herbicides.

  14. Bile acids: regulation of synthesis.


    Chiang, John Y L


    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  15. Introduction of a bacterial acetyl-CoA synthesis pathway improves lactic acid production in Saccharomyces cerevisiae.


    Song, Ji-Yoon; Park, Joon-Song; Kang, Chang Duk; Cho, Hwa-Young; Yang, Dongsik; Lee, Seunghyun; Cho, Kwang Myung


    Acid-tolerant Saccharomyces cerevisiae was engineered to produce lactic acid by expressing heterologous lactate dehydrogenase (LDH) genes, while attenuating several key pathway genes, including glycerol-3-phosphate dehydrogenase1 (GPD1) and cytochrome-c oxidoreductase2 (CYB2). In order to increase the yield of lactic acid further, the ethanol production pathway was attenuated by disrupting the pyruvate decarboxylase1 (PDC1) and alcohol dehydrogenase1 (ADH1) genes. Despite an increase in lactic acid yield, severe reduction of the growth rate and glucose consumption rate owing to the absence of ADH1 caused a considerable decrease in the overall productivity. In Δadh1 cells, the levels of acetyl-CoA, a key precursor for biologically applicable components, could be insufficient for normal cell growth. To increase the cellular supply of acetyl-CoA, we introduced bacterial acetylating acetaldehyde dehydrogenase (A-ALD) enzyme (EC genes into the lactic acid-producing S. cerevisiae. Escherichia coli-derived A-ALD genes, mhpF and eutE, were expressed and effectively complemented the attenuated acetaldehyde dehydrogenase (ALD)/acetyl-CoA synthetase (ACS) pathway in the yeast. The engineered strain, possessing a heterologous acetyl-CoA synthetic pathway, showed an increased glucose consumption rate and higher productivity of lactic acid fermentation. The production of lactic acid was reached at 142g/L with production yield of 0.89g/g and productivity of 3.55gL(-1)h(-1) under fed-batch fermentation in bioreactor. This study demonstrates a novel approach that improves productivity of lactic acid by metabolic engineering of the acetyl-CoA biosynthetic pathway in yeast.

  16. Promotion of classic neutral bile acids synthesis pathway is responsible for cholesterol-lowing effect of Si-miao-yong-an decoction: Application of LC-MS/MS method to determine 6 major bile acids in rat liver and plasma.


    Liu, Ziying; Zhang, Yu; Zhang, Ruowen; Gu, Liqiang; Chen, Xiaohui


    Si-miao-yong-an decoction (SMYAD), a traditional Chinese medicine formula, significantly reduced plasma TC, LDL-c levels and increased HDL-c level in hyperlipidemia rats. Liver function test and tissue section examination indicated that SMYAD improved liver function and reduced fat accumulation in hyperlipidemia rat liver. A LC-MS/MS method was established and well validated to evaluate major bile acids derived from cholesterol metabolism through the classic neutral pathway and the alternative acidic pathway (cholic acid, chenodeoxycholic acid and their taurine and glycine conjugates) in liver and plasma. Increased total 6 bile acids concentrations in both liver and plasma were observed after oral administration of 12g/kg/d, 24g/kg/d and 36g/kg/d of SMYAD in a dose dependent manner which contributed to eliminate of cholesterol. Cholic acid, taurocholic acid and glycocholic acid act as the main products of bile acid classic neutral synthesis pathway and show sharp increase (p<0.01) after treatment of SMYAD at dosage of 24-36g/kg/d. For liver samples, taurocholic acid level act as the largest growth section, while in plasma samples, cholic acid act as the largest growth section after SMYAD treatment, compared with Model group. By contrast, the main products of alternative acidic pathway (chenodeoxycholic acid and its glycine and taurine conjugates) show no significant increase after treatment of SMYAD. In conclusion, the cholesterol lowing effect of SMYAD may be related with the accelerated transformation of cholesterol into bile acids through the classic neutral pathway.

  17. Amino Acid Biosynthesis Pathways in Diatoms

    PubMed Central

    Bromke, Mariusz A.


    Amino acids are not only building blocks for proteins but serve as precursors for the synthesis of many metabolites with multiple functions in growth and other biological processes of a living organism. The biosynthesis of amino acids is tightly connected with central carbon, nitrogen and sulfur metabolism. Recent publication of genome sequences for two diatoms Thalassiosira pseudonana and Phaeodactylum tricornutum created an opportunity for extensive studies on the structure of these metabolic pathways. Based on sequence homology found in the analyzed diatomal genes, the biosynthesis of amino acids in diatoms seems to be similar to higher plants. However, one of the most striking differences between the pathways in plants and in diatomas is that the latter possess and utilize the urea cycle. It serves as an important anaplerotic pathway for carbon fixation into amino acids and other N-containing compounds, which are essential for diatom growth and contribute to their high productivity. PMID:24957993

  18. Lewis Acid Induced Toggle from Ir(II) to Ir(IV) Pathways in Photocatalytic Reactions: Synthesis of Thiomorpholines and Thiazepanes from Aldehydes and SLAP Reagents

    PubMed Central


    Redox neutral photocatalytic transformations often require careful pairing of the substrates and photoredox catalysts in order to achieve a catalytic cycle. This can limit the range of viable transformations, as we recently observed in attempting to extend the scope of the photocatalytic synthesis of N-heterocycles using silicon amine protocol (SLAP) reagents to include starting materials that require higher oxidation potentials. We now report that the inclusion of Lewis acids in photocatalytic reactions of organosilanes allows access to a distinct reaction pathway featuring an Ir(III)*/Ir(IV) couple instead of the previously employed Ir(III)*/Ir(II) pathway, enabling the transformation of aromatic and aliphatic aldehydes to thiomorpholines and thiazepanes. The role of the Lewis acid in accepting an electron—either directly or via coordination to an imine—can be extended to other classes of photocatalysts and transformations, including oxidative cyclizations. The combination of light induced reactions and Lewis acids therefore promises access to new pathways and transformations that are not viable using the photocatalysts alone. PMID:28149955

  19. Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures

    PubMed Central

    Rodas-Junco, Beatriz A; Cab-Guillen, Yahaira; Muñoz-Sanchez, J Armando; Vázquez-Flota, Felipe; Monforte-Gonzalez, Miriam; Hérnandez-Sotomayor, S M Teresa


    Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.

  20. Synthesis of amino acids


    Davis, J.W. Jr.


    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  1. The effects of a low protein diet on amino acids and enzymes in the serine synthesis pathway in mice.


    Antflick, Jordan E; Baker, Glen B; Hampson, David Richard


    L-serine is required for cellular and tissue growth and is particularly important in the immature brain where it acts as a crucial neurotrophic factor. In this study, the levels of amino acids and enzymes in the L-serine biosynthetic pathway were examined in the forebrain, cerebellum, liver, and kidney after the exposure of mice to protein-restricted diets. The levels of L-serine, D-serine, and L-serine-O-phosphate were quantified by HPLC and quantitative Western blotting was used to measure changes in protein levels of five enzymes in the pathway. The L-serine biosynthetic enzyme phosphoserine phosphatase was strongly upregulated, while the serine degradative enzymes serine racemase and serine dehydratase were downregulated in the livers and kidneys of mice fed low (6%) or very low (2%) protein diets for 2 weeks compared with mice fed a normal diet (18% protein). No changes in these enzymes were seen in the brain. The levels of L-serine increased in the livers of mice fed 2% protein; in contrast, D-serine levels were reduced below the limit of detection in the livers of mice given either the 6 or 2% diets. D-Serine is a co-agonist at the NMDA class of glutamate receptors; no alterations in NMDA-R1 subunit expression were observed in liver or brain after protein restriction. These findings demonstrate that the expression of L-serine synthetic and degradative enzymes display reciprocal changes in the liver and kidney to increase L-serine and decrease D-serine levels under conditions of protein restriction, and that the brain is insulated from such changes.

  2. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.


    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  3. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.


    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  4. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood


    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  5. Genetic mapping of QTLs controlling fatty acids provided insights into the genetic control of fatty acid synthesis pathway in peanut (Arachis hypogaea L.).


    Wang, Ming Li; Khera, Pawan; Pandey, Manish K; Wang, Hui; Qiao, Lixian; Feng, Suping; Tonnis, Brandon; Barkley, Noelle A; Pinnow, David; Holbrook, Corley C; Culbreath, Albert K; Varshney, Rajeev K; Guo, Baozhu


    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C18:1) and linoleic acid (C18:2) accounting for about 80% of peanut oil, the six other fatty acids namely palmitic acid (C16:0), stearic acid (C18:0), arachidic acid (C20:0), gadoleic acid (C20:1), behenic acid (C22:0), and lignoceric acid (C24:0) are accounted for the rest 20%. To determine the genetic basis and to improve further understanding on effect of FAD2 genes on these fatty acids, two recombinant inbred line (RIL) populations namely S-population (high oleic line 'SunOleic 97R' × low oleic line 'NC94022') and T-population (normal oleic line 'Tifrunner' × low oleic line 'GT-C20') were developed. Genetic maps with 206 and 378 marker loci for the S- and the T-population, respectively were used for quantitative trait locus (QTL) analysis. As a result, a total of 164 main-effect (M-QTLs) and 27 epistatic (E-QTLs) QTLs associated with the minor fatty acids were identified with 0.16% to 40.56% phenotypic variation explained (PVE). Thirty four major QTLs (>10% of PVE) mapped on five linkage groups and 28 clusters containing more than three QTLs were also identified. These results suggest that the major QTLs with large additive effects would play an important role in controlling composition of these minor fatty acids in addition to the oleic and linoleic acids in peanut oil. The interrelationship among these fatty acids should be considered while breeding for improved peanut genotypes with good oil quality and desired fatty acid composition.

  6. Genetic mapping of QTLs controlling fatty acids provided insights into the genetic control of fatty acid synthesis pathway in peanut (Arachis hypogaea L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C1...

  7. Genetic Mapping of QTLs Controlling Fatty Acids Provided Insights into the Genetic Control of Fatty Acid Synthesis Pathway in Peanut (Arachis hypogaea L.)

    PubMed Central

    Wang, Hui; Qiao, Lixian; Feng, Suping; Tonnis, Brandon; Barkley, Noelle A.; Pinnow, David; Holbrook, Corley C.; Culbreath, Albert K.; Varshney, Rajeev K.; Guo, Baozhu


    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C18:1) and linoleic acid (C18:2) accounting for about 80% of peanut oil, the six other fatty acids namely palmitic acid (C16:0), stearic acid (C18:0), arachidic acid (C20:0), gadoleic acid (C20:1), behenic acid (C22:0), and lignoceric acid (C24:0) are accounted for the rest 20%. To determine the genetic basis and to improve further understanding on effect of FAD2 genes on these fatty acids, two recombinant inbred line (RIL) populations namely S-population (high oleic line ‘SunOleic 97R’ × low oleic line ‘NC94022’) and T-population (normal oleic line ‘Tifrunner’ × low oleic line ‘GT-C20’) were developed. Genetic maps with 206 and 378 marker loci for the S- and the T-population, respectively were used for quantitative trait locus (QTL) analysis. As a result, a total of 164 main-effect (M-QTLs) and 27 epistatic (E-QTLs) QTLs associated with the minor fatty acids were identified with 0.16% to 40.56% phenotypic variation explained (PVE). Thirty four major QTLs (>10% of PVE) mapped on five linkage groups and 28 clusters containing more than three QTLs were also identified. These results suggest that the major QTLs with large additive effects would play an important role in controlling composition of these minor fatty acids in addition to the oleic and linoleic acids in peanut oil. The interrelationship among these fatty acids should be considered while breeding for improved peanut genotypes with good oil quality and desired fatty acid composition. PMID:25849082

  8. Borinic acid catalysed peptide synthesis.


    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme


    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  9. Vitamins and aging: pathways to NAD+ synthesis.


    Denu, John M


    Recent genetic evidence reveals additional salvage pathways for NAD(+) synthesis. In this issue, Belenky et al. (2007) report that nicotinamide riboside, a new NAD(+) precursor, regulates Sir2 deacetylase activity and life span in yeast. The ability of nicotinamide riboside to enhance life span does not depend on calorie restriction.

  10. Dietary cholesterol supplementation to a plant-based diet suppresses the complete pathway of cholesterol synthesis and induces bile acid production in Atlantic salmon (Salmo salar L.).


    Kortner, Trond M; Björkhem, Ingemar; Krasnov, Aleksei; Timmerhaus, Gerrit; Krogdahl, Åshild


    Plants now supply more than 50 % of protein in Norwegian salmon aquafeeds. The inclusion of plant protein in aquafeeds may be associated with decreased lipid digestibility and cholesterol and bile salt levels, indicating that the replacement of fishmeal with plant protein could result in inadequate supplies of cholesterol in fish. A reduction in feed efficiency, fish growth and pathogen resistance is often observed in parallel to alterations in sterol metabolism. Previous studies have indicated that the negative effects induced by plant components can be attenuated when diets are supplemented with cholesterol. The present study evaluated the effects of dietary cholesterol supplementation (1·5 %) in Atlantic salmon fed a plant-based diet for 77 d. The weights of body, intestines and liver were recorded and blood, tissues, faeces, chyme and bile were sampled for the evaluation of effects on growth, nutrient utilisation and metabolism, and transcriptome and metabolite levels, with particular emphasis on sterol metabolism and organ structure and function. Cholesterol supplementation did not affect the growth or organ weights of Atlantic salmon, but seemed to promote the induction of cholesterol and plant sterol efflux in the intestine while suppressing sterol uptake. Cholesterol biosynthesis decreased correspondingly and conversion into bile acids increased. The marked effect of cholesterol supplementation on bile acid synthesis suggests that dietary cholesterol can be used to increase bile acid synthesis in fish. The present study clearly demonstrated how Atlantic salmon adjusted their metabolic functions in response to the dietary load of cholesterol. It has also expanded our understanding of sterol metabolism and turnover, adding to the existing, rather sparse, knowledge of these processes in fish.

  11. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.


    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  12. Escherichia coli Unsaturated Fatty Acid Synthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.


    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA. PMID:19679654

  13. Metabolic Engineering of a Novel Muconic Acid Biosynthesis Pathway via 4-Hydroxybenzoic Acid in Escherichia coli

    PubMed Central

    Sengupta, Sudeshna; Goonewardena, Lakshani; Juturu, Veeresh


    cis,cis-Muconic acid (MA) is a commercially important raw material used in pharmaceuticals, functional resins, and agrochemicals. MA is also a potential platform chemical for the production of adipic acid (AA), terephthalic acid, caprolactam, and 1,6-hexanediol. A strain of Escherichia coli K-12, BW25113, was genetically modified, and a novel nonnative metabolic pathway was introduced for the synthesis of MA from glucose. The proposed pathway converted chorismate from the aromatic amino acid pathway to MA via 4-hydroxybenzoic acid (PHB). Three nonnative genes, pobA, aroY, and catA, coding for 4-hydroxybenzoate hydrolyase, protocatechuate decarboxylase, and catechol 1,2-dioxygenase, respectively, were functionally expressed in E. coli to establish the MA biosynthetic pathway. E. coli native genes ubiC, aroFFBR, aroE, and aroL were overexpressed and the genes ptsH, ptsI, crr, and pykF were deleted from the E. coli genome in order to increase the precursors of the proposed MA pathway. The final engineered E. coli strain produced nearly 170 mg/liter of MA from simple carbon sources in shake flask experiments. The proposed pathway was proved to be functionally active, and the strategy can be used for future metabolic engineering efforts for production of MA from renewable sugars. PMID:26362984

  14. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages.


    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A; Yin, Yulong


    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05) gradually with increasing age. Bama mini-pigs had generally higher (P<0.05) muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but

  15. Genetics Home Reference: congenital bile acid synthesis defect type 1


    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  16. Genetics Home Reference: congenital bile acid synthesis defect type 2


    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  17. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi


    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  18. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages

    PubMed Central

    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A.; Yin, Yulong


    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05) gradually with increasing age. Bama mini-pigs had generally higher (P<0.05) muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but

  19. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth


    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  20. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.


    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko


    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  1. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John


    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  2. Amino acid synthesis in a supercritical carbon dioxide - water system.


    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji


    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  3. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji


    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  4. Enzymatic synthesis of cinnamic acid derivatives.


    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu


    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  5. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].


    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua


    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  6. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.


    Matsuno, Koya; Fujimura, Tatsuhito


    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  7. The Significance of Different Diacylgycerol Synthesis Pathways on Plant Oil Composition and Bioengineering

    PubMed Central

    Bates, Philip D.; Browse, John


    The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA) composition of triacylglycerol (TAG). Plants can use two main pathways to produce diacylglycerol (DAG), the immediate precursor molecule to TAG synthesis: (1) De novo DAG synthesis, and (2) conversion of the membrane lipid phosphatidylcholine (PC) to DAG. The FA esterified to PC are also the substrate for FA modification (e.g., desaturation, hydroxylation, etc.), such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions. PMID:22783267

  8. A Type II Pathway for Fatty Acid Biosynthesis Presents Drug Targets in Plasmodium falciparum

    PubMed Central

    Waller, Ross F.; Ralph, Stuart A.; Reed, Michael B.; Su, Vanessa; Douglas, James D.; Minnikin, David E.; Cowman, Alan F.; Besra, Gurdyal S.; McFadden, Geoffrey I.


    It has long been held that the malaria parasite, Plasmodium sp., is incapable of de novo fatty acid synthesis. This view has recently been overturned with the emergence of data for the presence of a fatty acid biosynthetic pathway in the relict plastid of P. falciparum (known as the apicoplast). This pathway represents the type II pathway common to plant chloroplasts and bacteria but distinct from the type I pathway of animals including humans. Specific inhibitors of the type II pathway, thiolactomycin and triclosan, have been reported to target this Plasmodium pathway. Here we report further inhibitors of the plastid-based pathway that inhibit Plasmodium parasites. These include several analogues of thiolactomycin, two with sixfold-greater efficacy than thiolactomycin. We also report that parasites respond very rapidly to such inhibitors and that the greatest sensitivity is seen in ring-stage parasites. This study substantiates the importance of fatty acid synthesis for blood-stage parasite survival and shows that this pathway provides scope for the development of novel antimalarial drugs. PMID:12499205

  9. A Novel Synthetic Pathway Enables Microbial Production of Polyphenols Independent from the Endogenous Aromatic Amino Acid Metabolism.


    Kallscheuer, Nicolai; Vogt, Michael; Marienhagen, Jan


    Numerous plant polyphenols have potential applications as pharmaceuticals or nutraceuticals. Stilbenes and flavonoids as most abundant polyphenols are synthesized from phenylpropanoids, which are exclusively derived from aromatic amino acids in nature. Several microorganisms were engineered for the synthesis of biotechnologically interesting plant polyphenols; however, low activity of heterologous ammonia lyases, linking endogenous microbial aromatic amino acid biosynthesis to phenylpropanoid synthesis, turned out to be the limiting step during microbial synthesis. We here developed an alternative strategy for polyphenol production from cheap benzoic acids by reversal of a β-oxidative phenylpropanoid degradation pathway avoiding any ammonia lyase activity. The synthetic pathway running in the non-natural direction is feasible with respect to thermodynamics and involved reaction mechanisms. Instantly, product titers of 5 mg/L resveratrol could be achieved in recombinant Corynebacterium glutamicum strains indicating that phenylpropanoid synthesis from 4-hydroxybenzoic acid can in principle be implemented independently from aromatic amino acids and ammonia lyase activity.

  10. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?1[OPEN

    PubMed Central

    Nichols, David S.; Smith, Jason; Chourey, Prem S.; McAdam, Erin L.; Quittenden, Laura


    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA. However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  11. Nitrated fatty acids: synthesis and measurement.


    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J


    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  12. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.


    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  13. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  14. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  15. [Total synthesis of nordihydroguaiaretic acid].


    Wu, A X; Zhao, Y R; Chen, N; Pan, X F


    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  16. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.


    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide


    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  17. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.


    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R


    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  18. Evolutionary algorithm for metabolic pathways synthesis.


    Gerard, Matias F; Stegmayer, Georgina; Milone, Diego H


    Metabolic pathway building is an active field of research, necessary to understand and manipulate the metabolism of organisms. There are different approaches, mainly based on classical search methods, to find linear sequences of reactions linking two compounds. However, an important limitation of these methods is the exponential increase of search trees when a large number of compounds and reactions is considered. Besides, such models do not take into account all substrates for each reaction during the search, leading to solutions that lack biological feasibility in many cases. This work proposes a new evolutionary algorithm that allows searching not only linear, but also branched metabolic pathways, formed by feasible reactions that relate multiple compounds simultaneously. Tests performed using several sets of reactions show that this algorithm is able to find feasible linear and branched metabolic pathways.

  19. Pinolenic Acid Downregulates Lipid Anabolic Pathway in HepG2 Cells.


    Lee, Ah Ron; Han, Sung Nim


    Pine nut oil (PNO) was reported to reduce lipid accumulation in the liver. However, the specific effect of pinolenic acid (18:3, all-cis-Δ5,9,12), a unique component of PNO, on lipid metabolism has not been studied. We hypothesized that pinolenic acid downregulates the lipid anabolic pathway in HepG2 cells. HepG2 cells were incubated in serum-free medium supplemented with 50 μM bovine serum albumin (BSA), palmitic acid, oleic acid, γ-linolenic acid, pinolenic acid, eicosapentaenoic acid (EPA), or α-linolenic acid for 24 h. Lipid accumulation was determined by Oil Red O (ORO) staining. The mRNA levels of genes related to fatty acid biosynthesis (SREBP1c, FAS, SCD1, and ACC1), fatty acid oxidation (ACC2, PPARα, CPT1A, and ACADL), cholesterol synthesis (SREBP2 and HMGCR), and lipoprotein uptake (LDLr) and of genes that may be involved in the downregulation of the lipogenic pathway (ACSL3, ACSL4, and ACSL5) were determined by qPCR. LDLR protein levels were measured by Western blot analysis. The mRNA levels of SREBP1c, FAS, and SCD1 were significantly downregulated by pinolenic acid treatment compared to BSA control (53, 54, and 38 % lower, respectively). In addition, the mRNA levels of HMGCR, ACSL3, and LDLr were significantly lower (30, 30, and 43 % lower, respectively), and ACSL4 tended to be lower in the pinolenic acid group (20 % lower, P = 0.082) relative to the control group. In conclusion, pinolenic acid downregulated the lipid anabolic pathway in HepG2 cells by reducing expression of genes related to lipid synthesis, lipoprotein uptake, and the regulation of the lipogenic pathway.

  20. The Biosynthetic Pathways for Shikimate and Aromatic Amino Acids in Arabidopsis thaliana

    PubMed Central

    Tzin, Vered; Galili, Gad


    The aromatic amino acids phenylalanine, tyrosine and tryptophan in plants are not only essential components of protein synthesis, but also serve as precursors for a wide range of secondary metabolites that are important for plant growth as well as for human nutrition and health. The aromatic amino acids are synthesized via the shikimate pathway followed by the branched aromatic amino acid metabolic pathway, with chorismate serving as a major branch point intermediate metabolite. Yet, the regulation of their synthesis is still far from being understood. So far, only three enzymes in this pathway, namely, chorismate mutase of phenylalanine and tyrosine synthesis, tryptophan synthase of tryptophan biosynthesis and arogenate dehydratase of phenylalanine biosynthesis, proved experimentally to be allosterically regulated. The major biosynthesis route of phenylalanine in plants occurs via arogenate. Yet, recent studies suggest that an alternative route of phynylalanine biosynthesis via phenylpyruvate may also exist in plants, similarly to many microorganisms. Several transcription factors regulating the expression of genes encoding enzymes of both the shikimate pathway and aromatic amino acid metabolism have also been recently identified in Arabidopsis and other plant species. PMID:22303258

  1. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.


    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  2. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.


    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter


    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  3. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.


    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  4. Inhibition of in vitro cholesterol synthesis by fatty acids.


    Kuroda, M; Endo, A


    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  5. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  6. A new regulatory mechanism for bacterial lipoic acid synthesis.


    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  7. A plausibly prebiotic synthesis of phosphonic acids.


    de Graaf, R M; Visscher, J; Schwartz, A W


    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  8. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.


    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  9. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  10. Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus


    Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.; ...


    Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Lastly, defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.

  11. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?


    Parsons, Joshua B; Rock, Charles O


    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  12. Benzene-free synthesis of adipic acid.


    Niu, Wei; Draths, K M; Frost, J W


    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  13. Synthesis of alpha-amino acids


    Davis, J.W. Jr.


    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  14. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.


    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  15. Pathways for virus assembly around nucleic acids

    PubMed Central

    Perlmutter, Jason D; Perkett, Matthew R


    Understanding the pathways by which viral capsid proteins assemble around their genomes could identify key intermediates as potential drug targets. In this work we use computer simulations to characterize assembly over a wide range of capsid protein-protein interaction strengths and solution ionic strengths. We find that assembly pathways can be categorized into two classes, in which intermediates are either predominantly ordered or disordered. Our results suggest that estimating the protein-protein and the protein-genome binding affinities may be sufficient to predict which pathway occurs. Furthermore, the calculated phase diagrams suggest that knowledge of the dominant assembly pathway and its relationship to control parameters could identify optimal strategies to thwart or redirect assembly to block infection. Finally, analysis of simulation trajectories suggests that the two classes of assembly pathways can be distinguished in single molecule fluorescence correlation spectroscopy or bulk time resolved small angle x-ray scattering experiments. PMID:25036288

  16. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu


    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  17. Ascorbate synthesis pathway, dual role of ascorbate in bone homeostasis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using mouse gene knock-out models, we identify aldehyde reductase (EC, Akr1a4 (GR)) and aldose reductase (EC, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) m...

  18. Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

    NASA Astrophysics Data System (ADS)

    Fu, Qi; Socki, Richard A.; Niles, Paul B.


    Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher δ13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of δ13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ∼31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of δ13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic

  19. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen


    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  20. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis

    PubMed Central

    Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula


    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography–mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography–tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos. PMID:25711705

  1. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis


    Tsogtbaatar, Enkhtuul; Cocuron, Jean -Christophe; Sonera, Marcos Corchado; ...


    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oilmore » synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography-mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. In conclusion, this study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos.« less

  2. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis.


    Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula


    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography-mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos.

  3. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo


    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  4. Hydroxyeicosatetraenoic acids released through the cytochrome P-450 pathway regulate 3T6 fibroblast growth.


    Nieves, Diana; Moreno, Juan José


    Eicosanoids participate in the regulation of cellular proliferation. Thus, we observed that prostaglandin E(2) interaction with membrane receptors is involved in the control of 3T6 fibroblast growth induced by serum. However, our results suggested that another arachidonic acid pathway might be implicated in these events. Our results show that 3T6 fibroblasts synthesized hydroxyeicosatetraenoic acids (HETEs) such as 12-HETE through the cytochrome P-450 (CYP450) pathway. However, 3T6 fibroblasts did not produce leukotriene B(4) (LTB(4)), and lipoxygenase inhibitors and LT antagonists failed to inhibit 3T6 fibroblast growth induced by FBS. In contrast, we observed that CYP450 inhibitors such as SKF-525A, 17-octadecynoic acid, 1-aminobenzotriazole, and 6-(2-propargyloxyphenyl)hexanoic acid reduced 12(S)-HETE levels, 3T6 fibroblast growth, and DNA synthesis induced by FBS. The impairment of DNA synthesis and 3T6 fibroblast growth induced by SKF-525A were reversed by exogenous addition of HETEs. Moreover, we report that 5-HETE, 12(S)-HETE, and 15(S)-HETE are mitogenic on 3T6 fibroblast in the absence of another growth factor, and this effect was dependent on the activation of the phosphatidylinositol-3-kinase pathway. In conclusion, our results show that HETEs, probably produced by CYP450, are involved in the control of 3T6 fibroblast growth.

  5. New Approaches to Target the Mycolic Acid Biosynthesis Pathway for the Development of Tuberculosis Therapeutics

    PubMed Central

    North, E. Jeffrey; Jackson, Mary; Lee, Richard E.


    Mycolic acids are the major lipid component of the unique mycobacterial cell wall responsible for the protection of the tuberculosis bacilli from many outside threats. Mycolic acids are synthesized in the cytoplasm and transported to the outer membrane as trehalose-containing glycolipids before being esterified to the arabinogalactan portion of the cell wall and outer membrane glycolipids. The large size of these unique fatty acids is a result of a huge metabolic investment that has been evolutionarily conserved, indicating the importance of these lipids to the mycobacterial cellular survival. There are many key enzymes involved in the mycolic acid biosynthetic pathway, including fatty acid synthesis (KasA, KasB, MabA, InhA, HadABC), mycolic acid modifying enzymes (SAM-dependent methyltransferases, aNAT), fatty acid activating and condensing enzymes (FadD32, Acc, Pks13), transporters (MmpL3) and tranferases (Antigen 85A-C) all of which are excellent potential drug targets. Not surprisingly, in recent years many new compounds have been reported to inhibit specific portions of this pathway, discovered through both phenotypic screening and target enzyme screening. In this review, we analyze the new and emerging inhibitors of this pathway discovered in the post-genomic era of tuberculosis drug discovery, several of which show great promise as selective tuberculosis therapeutics. PMID:24245756

  6. Metabolic engineering of Escherichia coli for 1-butanol and 1-propanol production via the keto-acid pathways.


    Shen, C R; Liao, J C


    Production of higher alcohols via the keto-acid intermediates found in microorganism's native amino-acid pathways has recently shown promising results. In this work, an Escherichia coli strain that produces 1-butanol and 1-propanol from glucose was constructed. The strain first converts glucose to 2-ketobutyrate, a common keto-acid intermediate for isoleucine biosynthesis. Then, 2-ketobutyrate is converted to 1-propanol through reactions catalyzed by the heterologous decarboxylase and dehydrogenase, or to 1-butanol via the chemistry involved in the synthesis of the unnatural amino acid norvaline. We systematically improved the synthesis of 1-propanol and 1-butanol through deregulation of amino-acid biosynthesis and elimination of competing pathways. The final strain demonstrated a production titer of 2 g/L with nearly 1:1 ratio of butanol and propanol.

  7. Valproic acid, a molecular lead to multiple regulatory pathways.


    Kostrouchová, M; Kostrouch, Z; Kostrouchová, M


    Valproic acid (2-propyl pentanoic acid) is a drug used for the treatment of epilepsy and bipolar disorder. Although very rare, side effects such as spina bifida and other defects of neural tube closure indicate that valproic acid interferes with developmental regulatory pathways. Recently obtained data show that valproic acid affects cell growth, differentiation, apoptosis and immunogenicity of cultured cancer cells and tumours. Focused studies uncovered the potential of valproic acid to interfere with multiple regulatory mechanisms including histone deacetylases, GSK3 alpha and beta, Akt, the ERK pathway, the phosphoinositol pathway, the tricarboxylic acid cycle, GABA, and the OXPHOS system. Valproic acid is emerging as a potential anticancer drug and may also serve as a molecular lead that can help design drugs with more specific and more potent effects on the one side and drugs with wide additive but weaker effects on the other. Valproic acid is thus a powerful molecular tool for better understanding and therapeutic targeting of pathways that regulate the behaviour of cancer cells.

  8. Akt Phosphorylation and Regulation of Transketolase Is a Nodal Point for Amino Acid Control of Purine Synthesis

    PubMed Central

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T.; Phan, Tony; Pilz, Renate B.; Boss, Gerry R.


    SUMMARY The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mTORC2 and IκB kinase regulate Akt activity, and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the non-oxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the non-oxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for two days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a new mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  9. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei


    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  10. Loss of Nuclear Receptor SHP Impairs but Does Not Eliminate Negative Feedback Regulation of Bile Acid Synthesis

    PubMed Central

    Kerr, Thomas A.; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W.; Schwarz, Margrit


    Summary The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  11. Variations in metabolic pathways create challenges for automated metabolic reconstructions: Examples from the tetrahydrofolate synthesis pathway

    PubMed Central

    de Crécy-Lagard, Valérie


    The availability of thousands of sequenced genomes has revealed the diversity of biochemical solutions to similar chemical problems. Even for molecules at the heart of metabolism, such as cofactors, the pathway enzymes first discovered in model organisms like Escherichia coli or Saccharomyces cerevisiae are often not universally conserved. Tetrahydrofolate (THF) (or its close relative tetrahydromethanopterin) is a universal and essential C1-carrier that most microbes and plants synthesize de novo. The THF biosynthesis pathway and enzymes are, however, not universal and alternate solutions are found for most steps, making this pathway a challenge to annotate automatically in many genomes. Comparing THF pathway reconstructions and functional annotations of a chosen set of folate synthesis genes in specific prokaryotes revealed the strengths and weaknesses of different microbial annotation platforms. This analysis revealed that most current platforms fail in metabolic reconstruction of variant pathways. However, all the pieces are in place to quickly correct these deficiencies if the different databases were built on each other's strengths. PMID:25210598

  12. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.


    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J


    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  13. Inhibition of Fatty Acid Synthase Reduces Blastocyst Hatching through Regulation of the AKT Pathway in Pigs

    PubMed Central

    Guo, Jing; Kim, Nam-Hyung; Cui, Xiang-Shun


    Fatty acid synthase (FASN) is an enzyme responsible for the de novo synthesis of long-chain fatty acids. During oncogenesis, FASN plays a role in growth and survival rather than acting within the energy storage pathways. Here, the function of FASN during early embryonic development was studied using its specific inhibitor, C75. We found that the presence of the inhibitor reduced blastocyst hatching. FASN inhibition decreased Cpt1 expression, leading to a reduction in mitochondria numbers and ATP content. This inhibition of FASN resulted in the down-regulation of the AKT pathway, thereby triggering apoptosis through the activation of the p53 pathway. Activation of the apoptotic pathway also leads to increased accumulation of reactive oxygen species and autophagy. In addition, the FASN inhibitor impaired cell proliferation, a parameter of blastocyst quality for outgrowth. The level of OCT4, an important factor in embryonic development, decreased after treatment with the FASN inhibitor. These results show that FASN exerts an effect on early embryonic development by regulating both fatty acid oxidation and the AKT pathway in pigs. PMID:28107461

  14. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.


    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  15. Synthesis of new kojic acid based unnatural α-amino acid derivatives.


    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan


    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  16. Extending shikimate pathway for the production of muconic acid and its precursor salicylic acid in Escherichia coli.


    Lin, Yuheng; Sun, Xinxiao; Yuan, Qipeng; Yan, Yajun


    cis,cis-Muconic acid (MA) and salicylic acid (SA) are naturally-occurring organic acids having great commercial value. MA is a potential platform chemical for the manufacture of several widely-used consumer plastics; while SA is mainly used for producing pharmaceuticals (for example, aspirin and lamivudine) and skincare and haircare products. At present, MA and SA are commercially produced by organic chemical synthesis using petro-derived aromatic chemicals, such as benzene, as starting materials, which is not environmentally friendly. Here, we report a novel approach for efficient microbial production of MA via extending shikimate pathway by introducing the hybrid of an SA biosynthetic pathway with its partial degradation pathway. First, we engineered a well-developed phenylalanine producing Escherichia coli strain into an SA overproducer by introducing isochorismate synthase and isochorismate pyruvate lyase. The engineered strain is able to produce 1.2g/L of SA from simple carbon sources, which is the highest titer reported so far. Further, the partial SA degradation pathway involving salicylate 1-monoxygenase and catechol 1,2-dioxygenase is established to achieve the conversion of SA to MA. Finally, a de novo MA biosynthetic pathway is assembled by integrating the established SA biosynthesis and degradation modules. Modular optimization enables the production of up to 1.5g/L MA within 48h in shake flasks. This study not only establishes an efficient microbial platform for the production of SA and MA, but also demonstrates a generalizable pathway design strategy for the de novo biosynthesis of valuable degradation metabolites.

  17. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.


    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  18. Metabolomics Analysis Reveals that AICAR Affects Glycerolipid, Ceramide and Nucleotide Synthesis Pathways in INS-1 Cells.


    ElAzzouny, Mahmoud A; Evans, Charles R; Burant, Charles F; Kennedy, Robert T


    AMPK regulates many metabolic pathways including fatty acid and glucose metabolism, both of which are closely associated with insulin secretion in pancreatic β-cells. Insulin secretion is regulated by metabolic coupling factors such as ATP/ADP ratio and other metabolites generated by the metabolism of nutrients such as glucose, fatty acid and amino acids. However, the connection between AMPK activation and insulin secretion in β-cells has not yet been fully elucidated at a metabolic level. To study the effect of AMPK activation on glucose stimulated insulin secretion, we applied the pharmacological activator 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) to an INS-1 (832/13) β-cell line. We measured the change in 66 metabolites in the presence or absence of AICAR using different stable isotopic labeled nutrients to probe selected pathways. AMPK activation by AICAR increased basal insulin secretion and reduced the glucose stimulation index. Although ATP/ADP ratios were not strongly affected by AICAR, several other metabolites and pathways important for insulin secretion were affected by AICAR treatment including long-chain CoAs, malonyl-CoA, 3-hydroxy-3 methylglutaryl CoA, diacylglycerol, and farnesyl pyrophosphate. Tracer studies using 13C-glucose revealed lower glucose flux in the purine and pyrimidine pathway and in the glycerolipid synthesis pathway. Untargeted metabolomics revealed reduction in ceramides caused by AICAR that may explain the beneficial role of AMPK in protecting β-cells from lipotoxicity. Taken together, the results provide an overall picture of the metabolic changes associated with AICAR treatment and how it modulates insulin secretion and β-cell survival.

  19. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].


    Herczeg, Mihály


    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  20. Effect of nitrogen deficiency on ascorbic acid biosynthesis and recycling pathway in cucumber seedlings.


    Zhang, Xue; Yu, Hong Jun; Zhang, Xiao Meng; Yang, Xue Yong; Zhao, Wen Chao; Li, Qiang; Jiang, Wei Jie


    L-Ascorbic acid (AsA, ascorbate) is one of the most abundant natural antioxidants, and it is an important factor in the nutritional quality of cucumber. In this work, key enzymes involved in the ascorbic acid biosynthesis and recycling pathway in cucumber seedlings under nitrogen deficiency were investigated at the levels of transcription and enzyme activity. The activities of myo-inositol oxygenase (MIOX) and transcript levels of MIOXs increased dramatically, while the activities of ascorbate oxidase (AO) and glutathione reductase (GR) and transcript levels of AOs and GR2 decreased significantly in N-limited leaves, as did the ascorbate concentration, in nitrogen-deficient cucumber seedlings. The activities of other enzymes and transcript levels of other genes involved in the ascorbate recycling pathway and ascorbate synthesis pathways decreased or remained unchanged under nitrogen deficiency. These results indicate that nitrogen deficiency induced genes involved in the ascorbate-glutathione recycling and myo-inositol pathway in cucumber leaves. Thus, the AO, GR and MIOX involved in the pathways might play roles in AsA accumulation.

  1. Resistance of lung fatty acid synthesis to inhibition by dietary fat in the meal-fed rat.


    Clarke, S D; Wilson, M D; Ibnoughazala, T


    One-half of the palmitate utilized by the lung for production of the surfactant phospholipid, dipalmitoyl phosphatidylcholine, originates from de novo palmitate synthesis in the lung. In this report the lung was examined for the influence of dietary fat on the lung de novo fatty acid synthesis pathway. Lung lipogenesis was reduced by fasting and accelerated by carbohydrate refeeding or insulin injection. However, in general lung fatty acid synthesis was unaffected by dietary fat. Supplementing one meal (high glucose diet) with as much as 36% additional fat kilocalories did not suppress lung fatty acid synthesis. An inhibition of fatty acid synthesis resulted from a fat supplement of +60 and +120% of meal kilocalories, but this inhibition was likely due to an attenuated rate of glucose absorption. Ingestion of a high carbohydrate diet supplemented with 10, 17, or 30% added kilocalories as safflower oil or palmitate had no effect on lipogenesis after 10 days. On the other hand, liver fatty acid synthesis and acetyl-CoA carboxylase were selectively suppressed by safflower oil, whereas dietary palmitate was ineffective as an inhibitor of lipogenesis. These data clearly demonstrate that the well-characterized preferential suppression of liver lipogenesis by dietary polyunsaturated fats does not extend to lung tissue, and, more importantly, the inhibition of liver lipogenesis is not secondary to an essential fatty acid deficiency. The marked resistance of lung fatty acid synthesis to inhibition by dietary fat might be a biological protective mechanism to ensure adequate palmitate for dipalmitoyl phosphatidylcholine synthesis.

  2. Analysis of the aspartic acid metabolic pathway using mutant genes.


    Azevedo, R A


    Amino acid metabolism is a fundamental process for plant growth and development. Although a considerable amount of information is available, little is known about the genetic control of enzymatic steps or regulation of several pathways. Much of the information about biochemical pathways has arisen from the use of mutants lacking key enzymes. Although mutants were largely used already in the 60's, by bacterial and fungal geneticists, it took plant research a long time to catch up. The advance in this area was rapid in the 80's, which was followed in the 90's by the development of techniques of plant transformation. In this review we present an overview of the aspartic acid metabolic pathway, the key regulatory enzymes and the mutants and transgenic plants produced for lysine and threonine metabolism. We also discuss and propose a new study of high-lysine mutants.

  3. Analysis of putative nonulosonic acid biosynthesis pathways in Archaea reveals a complex evolutionary history.


    Kandiba, Lina; Eichler, Jerry


    Sialic acids and the other nonulosonic acid sugars, legionaminic acid and pseudaminic acid, are nine carbon-containing sugars that can be detected as components of the glycans decorating proteins and other molecules in Eukarya and Bacteria. Yet, despite the prevalence of N-glycosylation in Archaea and the variety of sugars recruited for the archaeal version of this post-translational modification, only a single report of a nonulosonic acid sugar in an archaeal N-linked glycan has appeared. Hence, to obtain a clearer picture of nonulosonic acid sugar biosynthesis capability in Archaea, 122 sequenced genomes were scanned for the presence of genes involved in the biogenesis of these sugars. The results reveal that while Archaea and Bacteria share a common route of sialic acid biosynthesis, numerous archaeal nonulosonic acid sugar biosynthesis pathway components were acquired from elsewhere via various routes. Still, the limited number of Archaea encoding components involved in the synthesis of nonulosonic acid sugars implies that such saccharides are not major components of glycans in this domain.

  4. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål).


    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang


    The "target of rapamycin" (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens.

  5. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål)

    PubMed Central

    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang


    The “target of rapamycin” (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527

  6. Transcriptome survey of the lipid metabolic pathways involved in energy production and ecdysteroid synthesis in the salmon louse Caligus rogercresseyi (Crustacea: Copepoda).


    Gonçalves, Ana Teresa; Farlora, Rodolfo; Gallardo-Escárate, Cristian


    The goal of this study was to identify and analyze the lipid metabolic pathways involved in energy production and ecdysteroid synthesis in the ectoparasite copepod Caligus rogercresseyi. Massive transcriptome sequencing analysis was performed during the infectious copepodid larval stage, during the attached chalimus larval stage, and also in female and male adults. Thirty genes were selected for describing the pathways, and these were annotated for proteins or enzymes involved in lipid digestion, absorption, and transport; fatty acid degradation; the synthesis and degradation of ketone bodies; and steroid and ecdysteroid syntheses. Differential expression of these genes was analyzed by ontogenic stage and discussed considering each stage's feeding habits and energetic needs. Copepodids showed a low expression of fatty acid digestion genes, reflected by a non-feeding behavior, and the upregulation of genes involved in steroid biosynthesis, which was consistent with a pathway for cholesterol synthesis during ecdysis. The chalimus stage showed an upregulation of genes related to fatty acid digestion, absorption, and transport, as well as to fatty acid degradation and the synthesis of ketone bodies, therefore suggesting that lipids ingested from the mucus and skin of the host fish are metabolized as important sources of energy. Adult females also showed a pattern of high lipid metabolism for energy supply and mobilization in relation to reproduction and vitellogenesis. Adult females and males revealed different lipid metabolism patterns that reflected different energetic needs. This study reports for the first time the probable lipid metabolic pathways involved in the energy production and ecdysteroid synthesis of C. rogercresseyi.

  7. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.


    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  8. DOPA and DHN pathway orchestrate melanin synthesis in Aspergillus species.


    Pal, Anuradha K; Gajjar, Devarshi U; Vasavada, Abhay R


    Melanins are high molecular weight hydrophobic pigments that have been studied for their role in the virulence of fungal pathogens. We investigated the amount and type of melanin in 20 isolates of Aspergillus spp.; A. niger (n = 3), A. flavus (n = 5), A. tamarii (n = 3), A. terreus (n = 3), A. tubingensis (n = 3), A. sydowii (n = 3). Aspergillus spp. were identified by sequencing the internal transcribed spacer (ITS) region. Extraction of melanin from culture filtrate and fungal biomass was done and followed by qualitative and quantitative analysis of melanin pigment. Ultraviolet (UV), Fourier transformed infrared (FT-IR), and electron paramagnetic resonance (EPR) spectra analyses confirmed the presence of melanin. The melanin pathway was studied by analyzing the effects of inhibitors; kojic acid, tropolone, phthalide, and tricyclazole. The results indicate that in A. niger and A. tubingensis melanin was found in both culture filtrate and fungal biomass. For A. tamarii and A. flavus melanin was extracted from biomass only, whereas melanin was found only in culture filtrate for A. terreus. A negligible amount of melanin was found in A. sydowii. The maximum amount of melanin from culture filtrate and fungal biomass was found in A. niger and A. tamarrii, respectively. The DOPA (3,4-dihydroxyphenylalanine) pathway produces melanin in A. niger, A. tamarii and A. flavus, whereas the DHN (1,8-dihydroxynaphthalene) pathway produces melanin in A. tubingensis and A. terreus. It can be concluded that the amount and type of melanin in aspergilli largely differ from species to species.

  9. Enhanced production of fatty alcohols by engineering the TAGs synthesis pathway in Saccharomyces cerevisiae.


    Tang, Xiaoling; Chen, Wei Ning


    The production of fatty acid-derived chemicals has received a great deal of attention in recent years. In yeast cells, the main storage forms of fatty acids are TAGs. However, the conversion of TAGs into fatty acid derivatives suffers from a practical standpoint. Herein, a more direct strategy was applied to accumulate cellular fatty acyl-CoAs in Saccharomyces cerevisiae, which are the activated forms of fatty acids and used as important precursors for various converting enzymes. The dga1 gene was deleted to block the fatty acyl-CoAs dependent pathway of TAGs synthesis and a significant decrease in lipid content was observed. The FAR gene was cloned and overexpressed in the wild type strain and gene disrupted strain, to convert the fatty acyl-CoAs to the corresponding fatty acid derivatives. The metabolic engineered pathway resulted in enhanced production of fatty alcohols. Compared with the wild type strain with overexpressed FAR gene, the yield of fatty alcohols in the Δdga1 strain with FAR was dramatically increased: the intracellular fatty alcohols increased from 26 mg/L to 45 mg/L, while the extracellular fatty alcohols increased from 2.2 mg/L to 4.3 mg/L. By optimizing the culture medium with increased carbon concentration and limited nitrogen concentration, the fatty alcohols yield in the Δdga1 strain with FAR was further increased to 84 mg/L in cells and 14 mg/L secreted in broth. The results in this study demonstrated the feasibility of using the designed strategy to solve the bottleneck in utilizing TAGs for fatty acid derivatives production.

  10. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.


    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  11. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa


    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  12. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.


    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  13. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.


    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim


    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases.

  14. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.


    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes


    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  15. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central


    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  16. [Signaling pathway of meiosis induced by retinoic acid during spermatogenesis].


    Wang, Ke; Wu, Ying-Ji


    Retinoic acid (RA) is an oxidative metabolite of vitamin A (retinol, ROH) and plays an important role in the spermatogenesis (as in meiosis) of mammals. In mammalian testes, RA, in combination with its retinoic acid receptor (RAR), regulates the expressions of related target genes in various types of cells at different times. It activates meiosis by up-regulating the expressions of the genes that promote meiosis and down-regulate those that inhibit it during spermatogenesis in a specific stage. The results of researches on mammalian spermatogenesis have a great application value in reproductive biology, developmental biology, and reproductive engineering. Therefore, it is of considerable significance to study the signaling pathway of RA-induced meiosis during mammalian spermatogenesis. This article presents an introduction of the RA signal transduction system and its action mechanisms, as well as an overview on the signaling pathway of RA-activated meiosis during spermatogenesis.


    PubMed Central

    Frampton, E. W.


    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  18. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.


    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun


    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  19. Dissecting Abscisic Acid Signaling Pathways Involved in Cuticle Formation.


    Cui, Fuqiang; Brosché, Mikael; Lehtonen, Mikko T; Amiryousefi, Ali; Xu, Enjun; Punkkinen, Matleena; Valkonen, Jari P T; Fujii, Hiroaki; Overmyer, Kirk


    The cuticle is the outer physical barrier of aerial plant surfaces and an important interaction point between plants and the environment. Many environmental stresses affect cuticle formation, yet the regulatory pathways involved remain undefined. We used a genetics and gene expression analysis in Arabidopsis thaliana to define an abscisic acid (ABA) signaling loop that positively regulates cuticle formation via the core ABA signaling pathway, including the PYR/PYL receptors, PP2C phosphatase, and SNF1-Related Protein Kinase (SnRK) 2.2/SnRK2.3/SnRK2.6. Downstream of the SnRK2 kinases, cuticle formation was not regulated by the ABA-responsive element-binding transcription factors but rather by DEWAX, MYB16, MYB94, and MYB96. Additionally, low air humidity increased cuticle formation independent of the core ABA pathway and cell death/reactive oxygen species signaling attenuated expression of cuticle-biosynthesis genes. In Physcomitrella patens, exogenous ABA suppressed expression of cuticle-related genes, whose Arabidopsis orthologs were ABA-induced. Hence, the mechanisms regulating cuticle formation are conserved but sophisticated in land plants. Signaling specifically related to cuticle deficiency was identified to play a major role in the adaptation of ABA signaling pathway mutants to increased humidity and in modulating their immunity to Botrytis cinerea in Arabidopsis. These results define a cuticle-specific downstream branch in the ABA signaling pathway that regulates responses to the external environment.

  20. Synthesis of nucleotide–amino acid conjugates designed for photo-CIDNP experiments by a phosphotriester approach

    PubMed Central

    Morozova, Olga B; Silnikov, Vladimir N; Yurkovskaya, Alexandra V


    Summary Conjugates of 2’-deoxyguanosine, L-tryptophan and benzophenone designed to study pathways of fast radical reactions by the photo Chemically Induced Dynamic Nuclear Polarization (photo-CIDNP) method were obtained by the phosphotriester block liquid phase synthesis. The phosphotriester approach to the oligonucleotide synthesis was shown to be a versatile and economic strategy for preparing the required amount of high quality samples of nucleotide–amino acid conjugates. PMID:24367455

  1. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.


    Wong, J T; Bronskill, P M


    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  2. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  3. Signal pathways mediating oxytocin stimulation of prostaglandin synthesis in select target cells.


    Soloff, M S; Jeng, Y J; Copland, J A; Strakova, Z; Hoare, S


    A major action of oxytocin is to stimulate prostaglandin production in reproductive tissues. The two major enzyme systems involved are cytosolic phospholipase A2 (cPLA2), which catalyses the formation of arachidonic acid from membrane glycerophospholipids, and prostaglandin endoperoxide-H synthases-1 and -2, which allow conversion of arachidonic acid to prostaglandins. During gestation, the concentrations of all three enzymes rise in the rabbit amnion. Agonists, including oxytocin, increase cPLA2 activity, in part, by elevating intracellular Ca2+ concentration, which causes cPLA2 to be translocated from the cytosol to intracellular membrane binding sites. Cytosolic PLA2 is then activated by a mitogen-activated protein kinase (MAPK)-dependent step. Our studies have elucidated signal pathways involved in oxytocin-stimulated prostaglandin output in both rabbit amnion cells and Chinese hamster ovary cells stably transfected with the rat oxytocin receptor. The two cell types are alike with respect to oxytocin-stimulated intracellular Ca2+ transients, mediation via Gq, and the specific MAPK that catalyses the phosphorylation of cPLA2. However, they differ with respect to the mechanisms of upregulation of key enzymes involved in prostaglandin E2 synthesis. These findings illustrate the tiers of complementary mechanisms involved in oxytocin stimulation of prostaglandin E2, and the extent of the diversity in the cellular signalling pathways involved.

  4. Indole-3-acetic Acid Synthesis in Tumorous and Nontumorous Species of Nicotiana 1

    PubMed Central

    Liu, Shih-Tung; Katz, Charles D.; Knight, C. Arthur


    The synthesis of indole-3-acetic acid (IAA) in the enzyme extracts of Nicotiana glauca, Nicotiana langsdorffii, their F1 hybrid, their amphidiploid hybrid, and the nontumorous mutant of the hybrid was investigated. Tryptamine, a possible precursor of IAA biosynthesis in Nicotiana tabacum, was not found in the callus tissue of N. glauca, N. langsdorffii, and their F1 hybrid. In petiole slices, the synthesis of IAA progressively increased during 5 hours of incubation in [14C]tryptophan. The rate of synthesis was about equal in the hybrid and N. langsdorffii but lower in N. glauca on either a cell or fresh weight basis. It was also found that tryptophan was about 25 times more efficient than tryptamine in promoting synthesis of IAA in petiole slices. It was found that indoleacetaldehyde oxidase, indoleacetaldehyde reductase, and tryptophan aminotransferase activities were present in all of the species examined; however, tryptophan decarboxylase activity was not found. The tryptophan aminotransferase activity in N. glauca, N. langsdorffii, and the nontumorous mutant required α-ketoglutaric acid and pyridoxal 5-phosphate whereas the addition of pyridoxal 5-phosphate seemed not to increase the enzyme activity in tumor plants. The tryptophan aminotransferase in the amphidiploid hybrid was partially purified by acetone precipitation. The enzyme activity had a temperature optimum at 49 C and a pH optimum at 8.9. It is suggested that there is an indolepyruvic acid pathway in the synthesis of IAA in the Nicotiana species examined. PMID:16660376

  5. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.


    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  6. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  7. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  8. A New Pathway to Aspartic Acid from Urea and Maleic Acid Affected by Ultraviolet Light

    NASA Astrophysics Data System (ADS)

    Terasaki, Masanori; Nomoto, Shinya; Mita, Hajime; Shimoyama, Akira


    The photochemistry of a mixture of urea and maleic acid, which are thought to have been widely present on the primitive Earth, was studied in order to examine a possibility of the formation of amino acids. When an aqueous solution of urea and maleic acid was irradiated with an ultraviolet light of wavelength 172 nm, urea was revealed to be rather resistant to photochemical decomposition. In contrast, maleic acid was completely decomposed within 4 h, reflecting the reactivity of a C-C double bond in the molecule. In the reaction mixture, 2-isoureidosuccinic acid was detected. The acid was considered to be formed by addition of an isoureido radical which had been produced from urea by the action of a hydroxyl radical, to a C-C double bond of maleic acid. The isoureido group of the product was revealed to undergo thermal rearrangement to afford 2-ureidosuccinic acid (N-carbamoylaspartic acid). The result suggested a novel pathway leading to the formation of aspartic acid from non-amino acid precursors, possibly effected by UV-light on the primitive Earth. The formation of ureidocarboxylic acids is of another significance, since they are capable of undergoing thermal polymerization, resulting in formation of polyamino acids.

  9. Aromatic amino acids are utilized and protein synthesis is stimulated during amino acid infusion in the ovine fetus.


    Liechty, E A; Boyle, D W; Moorehead, H; Auble, L; Denne, S C


    The purpose of this study was to determine whether the ovine fetus is capable of increased disposal of an amino acid load; if so, would it respond by increased protein synthesis, amino acid catabolism or both? A further purpose of the study was to determine whether the pathways of aromatic amino acid catabolism are functional in the fetus. Late gestation ovine fetuses of well-nourished ewes received an infusion of Aminosyn PF alone (APF), and Aminosyn PF + glycyl-L-tyrosine (APF+GT) at rates estimated to double the intake of these amino acids. The initial study, using APF, was performed at 126 +/- 1.4 d; the APF+GT study was performed at 132 +/- 1.7 d (term = 150 d). Phenylalanine and tyrosine kinetics were determined using both stable and radioactive isotopes. Plasma concentrations of most amino acids, but not tyrosine, increased during both studies; tyrosine concentration increased only during the APF+GT study. Phenylalanine rate of appearance and phenylalanine hydroxylation increased during both studies. Tyrosine rate of appearance increased only during the APF+GT study; tyrosine oxidation did not increase during either study. Fetal protein synthesis increased significantly during both studies, producing a significant increase in fetal protein accretion. Fetal proteolysis was unchanged in response to either amino acid infusion. These results indicate that the fetus responds to an acute increase in amino acid supply primarily by increasing protein synthesis and accretion, with a smaller but significant increase in amino acid catabolism also. Both phenylalanine hydroxylation and tyrosine oxidation are active in the fetus, and the fetus is able to increase phenylalanine hydroxylation rapidly in response to increased supply.

  10. Nucleic acid arrays and methods of synthesis


    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles


    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  11. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.


    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi


    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  12. Pathways for abiotic organic synthesis at submarine hydrothermal fields

    PubMed Central

    McDermott, Jill M.; Seewald, Jeffrey S.; German, Christopher R.; Sylva, Sean P.


    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond. PMID:26056279

  13. Pathways for abiotic organic synthesis at submarine hydrothermal fields.


    McDermott, Jill M; Seewald, Jeffrey S; German, Christopher R; Sylva, Sean P


    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond.

  14. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.


    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  15. Evolution of abscisic acid synthesis and signaling mechanisms.


    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I


    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  16. A novel fermentation pathway in an Escherichia coli mutant producing succinic acid, acetic acid, and ethanol.

    SciTech Connect

    Donnelly, M. I.; Millard, C. S.; Clark, D. P.; Chen, M. J.; Rathke, J. W.; Southern Illinois Univ.


    Escherichia coli strain NZN111, which is unable to grow fermentatively because of insertional inactivation of the genes encoding pyruvate: formate lyase and the fermentative lactate dehydrogenase, gave rise spontaneously to a chromosomal mutation that restored its ability to ferment glucose. The mutant strain, named AFP111, fermented glucose more slowly than did its wild-type ancestor, strain W1485, and generated a very different spectrum of products. AFP111 produced succinic acid, acetic acid, and ethanol in proportions of approx 2:1:1. Calculations of carbon and electron balances accounted fully for the observed products; 1 mol of glucose was converted to 1 mol of succinic acid and 0.5 mol each of acetic acid and ethanol. The data support the emergence in E.coli of a novel succinic acid:acetic acid:ethanol fermentation pathway.

  17. Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.


    Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen


    Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis.

  18. Pathway engineering of Propionibacterium jensenii for improved production of propionic acid

    PubMed Central

    Liu, Long; Guan, Ningzi; Zhu, Gexin; Li, Jianghua; Shin, Hyun-dong; Du, Guocheng; Chen, Jian


    Propionic acid (PA) is an important chemical building block widely used in the food, pharmaceutical, and chemical industries. In our previous study, a shuttle vector was developed as a useful tool for engineering Propionibacterium jensenii, and two key enzymes—glycerol dehydrogenase and malate dehydrogenase—were overexpressed to improve PA titer. Here, we aimed to improve PA production further via the pathway engineering of P. jensenii. First, the phosphoenolpyruvate carboxylase gene (ppc) from Klebsiella pneumoniae was overexpressed to access the one-step synthesis of oxaloacetate directly from phosphoenolpyruvate without pyruvate as intermediate. Next, genes encoding lactate dehydrogenase (ldh) and pyruvate oxidase (poxB) were deleted to block the synthesis of the by-products lactic acid and acetic acid, respectively. Overexpression of ppc and deleting ldh improved PA titer from 26.95 ± 1.21 g·L−1 to 33.21 ± 1.92 g·L−1 and 30.50 ± 1.63 g·L−1, whereas poxB deletion decreased it. The influence of this pathway engineering on gene transcription, enzyme expression, NADH/NAD+ ratio, and metabolite concentration was also investigated. Finally, PA production in P. jensenii with ppc overexpression as well as ldh deletion was investigated, which resulted in further increases in PA titer to 34.93 ± 2.99 g·L−1 in a fed-batch culture. PMID:26814976

  19. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.


    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  20. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis

    SciTech Connect

    Tsogtbaatar, Enkhtuul; Cocuron, Jean -Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula


    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography-mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. In conclusion, this study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos.

  1. Regulation of Primary Metabolic Pathways in Oyster Mushroom Mycelia Induced by Blue Light Stimulation: Accumulation of Shikimic Acid

    PubMed Central

    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei


    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis. PMID:25721093

  2. Regulation of primary metabolic pathways in oyster mushroom mycelia induced by blue light stimulation: accumulation of shikimic acid.


    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei


    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis.

  3. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.


    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  4. Bioengineering of bacterial polymer inclusions catalyzing the synthesis of N-acetylneuraminic acid.


    Hooks, David O; Blatchford, Paul A; Rehm, Bernd H A


    N-Acetylneuraminic acid is produced by alkaline epimerization of N-acetylglucosamine to N-acetylmannosamine and then subsequent condensation with pyruvate catalyzed by free N-acetylneuraminic acid aldolase. The high-alkaline conditions of this process result in the degradation of reactants and products, while the purification of free enzymes to be used for the synthesis reaction is a costly process. The use of N-acetylglucosamine 2-epimerase has been seen as an alternative to the alkaline epimerization process. In this study, these two enzymes involved in N-acetylneuraminic acid production were immobilized to biopolyester beads in vivo in a one-step, cost-efficient process of production and isolation. Beads with epimerase-only, aldolase-only, and combined epimerase/aldolase activity were recombinantly produced in Escherichia coli. The enzymatic activities were 32 U, 590 U, and 2.2 U/420 U per gram dry bead weight, respectively. Individual beads could convert 18% and 77% of initial GlcNAc and ManNAc, respectively, at high substrate concentrations and near-neutral pH, demonstrating the application of this biobead technology to fine-chemical synthesis. Beads establishing the entire N-acetylneuraminic acid synthesis pathway were able to convert up to 22% of the initial N-acetylglucosamine after a 50-h reaction time into N-acetylneuraminic acid.

  5. Manipulating catalytic pathways: deoxygenation of palmitic acid on multifunctional catalysts.


    Peng, Baoxiang; Zhao, Chen; Kasakov, Stanislav; Foraita, Sebastian; Lercher, Johannes A


    The mechanism of the catalytic reduction of palmitic acid to n-pentadecane at 260 °C in the presence of hydrogen over catalysts combining multiple functions has been explored. The reaction involves rate-determining reduction of the carboxylic group of palmitic acid to give hexadecanal, which is catalyzed either solely by Ni or synergistically by Ni and the ZrO2 support. The latter route involves adsorption of the carboxylic acid group at an oxygen vacancy of ZrO2 and abstraction of the α-H with elimination of O to produce the ketene, which is in turn hydrogenated to the aldehyde over Ni sites. The aldehyde is subsequently decarbonylated to n-pentadecane on Ni. The rate of deoxygenation of palmitic acid is higher on Ni/ZrO2 than that on Ni/SiO2 or Ni/Al2O3, but is slower than that on H-zeolite-supported Ni. As the partial pressure of H2 is decreased, the overall deoxygenation rate decreases. In the absence of H2, ketonization catalyzed by ZrO2 is the dominant reaction. Pd/C favors direct decarboxylation (-CO2), while Pt/C and Raney Ni catalyze the direct decarbonylation pathway (-CO). The rate of deoxygenation of palmitic acid (in units of mmol moltotal metal(-1) h(-1)) decreases in the sequence r(Pt black) ≈r(Pd black) >r(Raney Ni) in the absence of H2 . In situ IR spectroscopy unequivocally shows the presence of adsorbed ketene (C=C=O) on the surface of ZrO2 during the reaction with palmitic acid at 260 °C in the presence or absence of H2.

  6. Induction of collagen synthesis by ascorbic acid. A possible mechanism.


    Pinnel, S R; Murad, S; Darr, D


    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  7. Proteolytic Pathways Induced by Herbicides That Inhibit Amino Acid Biosynthesis

    PubMed Central

    Zulet, Amaia; Gil-Monreal, Miriam; Villamor, Joji Grace; Zabalza, Ana; van der Hoorn, Renier A. L.; Royuela, Mercedes


    Background The herbicides glyphosate (Gly) and imazamox (Imx) inhibit the biosynthesis of aromatic and branched-chain amino acids, respectively. Although these herbicides inhibit different pathways, they have been reported to show several common physiological effects in their modes of action, such as increasing free amino acid contents and decreasing soluble protein contents. To investigate proteolytic activities upon treatment with Gly and Imx, pea plants grown in hydroponic culture were treated with Imx or Gly, and the proteolytic profile of the roots was evaluated through fluorogenic kinetic assays and activity-based protein profiling. Results Several common changes in proteolytic activity were detected following Gly and Imx treatment. Both herbicides induced the ubiquitin-26 S proteasome system and papain-like cysteine proteases. In contrast, the activities of vacuolar processing enzymes, cysteine proteases and metacaspase 9 were reduced following treatment with both herbicides. Moreover, the activities of several putative serine protease were similarly increased or decreased following treatment with both herbicides. In contrast, an increase in YVADase activity was observed under Imx treatment versus a decrease under Gly treatment. Conclusion These results suggest that several proteolytic pathways are responsible for protein degradation upon herbicide treatment, although the specific role of each proteolytic activity remains to be determined. PMID:24040092

  8. Substrate specificity of the sialic acid biosynthetic pathway

    SciTech Connect

    Jacobs, Christina L.; Goon, Scarlett; Yarema, Kevin J.; Hinderlich, Stephan; Hang, Howard C.; Chai, Diana H.; Bertozzi, Carolyn R.


    Unnatural analogs of sialic acid can be delivered to mammalian cell surfaces through the metabolic transformation of unnatural N-acetylmannosamine (ManNAc) derivatives. In previous studies, mannosamine analogs bearing simple N-acyl groups up to five carbon atoms in length were recognized as substrates by the biosynthetic machinery and transformed into cell-surface sialoglycoconjugates [Keppler, O. T., et al. (2001) Glycobiology 11, 11R-18R]. Such structural alterations to cell surface glycans can be used to probe carbohydrate-dependent phenomena. This report describes our investigation into the extent of tolerance of the pathway toward additional structural alterations of the N-acyl substituent of ManNAc. A panel of analogs with ketone-containing N-acyl groups that varied in the lengthor steric bulk was chemically synthesized and tested for metabolic conversion to cell-surface glycans. We found that extension of the N-acyl chain to six, seven, or eight carbon atoms dramatically reduced utilization by the biosynthetic machinery. Likewise, branching from the linear chain reduced metabolic conversion. Quantitation of metabolic intermediates suggested that cellular metabolism is limited by the phosphorylation of the N-acylmannosamines by ManNAc 6-kinase in the first step of the pathway. This was confirmed by enzymatic assay of the partially purified enzyme with unnatural substrates. Identification of ManNAc 6-kinase as a bottleneck for unnatural sialic acid biosynthesis provides a target for expanding the metabolic promiscuity of mammalian cells.

  9. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L


    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  10. Synthesis of α-aminoboronic acids.


    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos


    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  11. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.


    Awasthi, Neeraj Praphulla; Singh, R P


    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  12. Systems-level metabolic flux profiling identifies fatty acid synthesis as a target for antiviral therapy

    PubMed Central

    Munger, Joshua; Bennett, Bryson D; Parikh, Anuraag; Feng, Xiao-Jiang; McArdle, Jessica; Rabitz, Herschel A; Shenk, Thomas; Rabinowitz, Joshua D


    Viruses rely on the metabolic network of their cellular hosts to provide energy and building blocks for viral replication. We developed a flux measurement approach based on liquid chromatography–tandem mass spectrometry to quantify changes in metabolic activity induced by human cytomegalovirus (HCMV). This approach reliably elucidated fluxes in cultured mammalian cells by monitoring metabolome labeling kinetics after feeding cells 13C-labeled forms of glucose and glutamine. Infection with HCMV markedly upregulated flux through much of the central carbon metabolism, including glycolysis. Particularly notable increases occurred in flux through the tricarboxylic acid cycle and its efflux to the fatty acid biosynthesis pathway. Pharmacological inhibition of fatty acid biosynthesis suppressed the replication of both HCMV and influenza A, another enveloped virus. These results show that fatty acid synthesis is essential for the replication of two divergent enveloped viruses and that systems-level metabolic flux profiling can identify metabolic targets for antiviral therapy. PMID:18820684

  13. PeaT1-induced systemic acquired resistance in tobacco follows salicylic acid-dependent pathway.


    Zhang, Wei; Yang, Xiufen; Qiu, Dewen; Guo, Lihua; Zeng, Hongmei; Mao, Jianjun; Gao, Qiufeng


    Systemic acquired resistance (SAR) is an inducible defense mechanism which plays a central role in protecting plants from pathogen attack. A new elicitor, PeaT1 from Alternaria tenuissima, was expressed in Escherichia coil and characterized with systemic acquired resistance to tobacco mosaic virus (TMV). PeaT1-treated plants exhibited enhanced systemic resistance with a significant reduction in number and size of TMV lesions on wild tobacco leaves as compared with control. The quantitative analysis of TMV CP gene expression with real-time quantitative PCR showed there was reduction in TMV virus concentration after PeaT1 treatment. Similarly, peroxidase (POD) activity and lignin increased significantly after PeaT1 treatment. The real-time quantitative PCR revealed that PeaT1 also induced the systemic accumulation of pathogenesis-related gene, PR-1a and PR-1b which are the markers of systemic acquired resistance (SAR), NPR1 gene for salicylic acid (SA) signal transduction pathway and PAL gene for SA synthesis. The accumulation of SA and the failure in development of similar level of resistance as in wild type tobacco plants in PeaT1 treated nahG transgenic tobacco plants indicated that PeaT1-induced resistance depended on SA accumulation. The present work suggested that the molecular mechanism of PeaT1 inducing disease resistance in tobacco was likely through the systemic acquired resistance pathway mediated by salicylic acid and the NPR1 gene.

  14. Organochlorines inhibit acetaminophen glucuronidation by redirecting UDP-glucuronic acid towards the D-glucuronate pathway

    SciTech Connect

    Chan, Tom S. Wilson, John X.; Selliah, Subajini; Bilodeau, Marc; Zwingmann, Claudia; Poon, Raymond; O'Brien, Peter J.


    Industry-derived organochlorines are persistent environmental pollutants that are a continuing health concern. The effects of these compounds on drug metabolism are not well understood. In the current study we present evidence that the inhibition of acetaminophen (APAP) glucuronidation by minute concentrations of organochlorines correlates well with their ability to stimulate the D-glucuronate pathway leading to ascorbate synthesis. A set of 6 arylated organochlorines, including 5 PCB (polychlorinated biphenyl) congeners, were assessed for their effects on APAP glucuronidation in isolated hepatocytes from male Sprague-Dawley rats. The capacity of each organochlorine to inhibit APAP glucuronidation was found to be directly proportional to its capacity to stimulate ascorbate synthesis. PCB153, PCB28 and bis-(4-chlorophenyl sulfone) (BCPS) in increasing order were the most effective organochlorines for inhibiting APAP glucuronidation and stimulating the D-glucuronate pathway. None of the 3 inhibitors of APAP glucuronidation were able to alter the expression of UGT1A6, UGT1A7 and UGT1A8 (the major isoforms responsible for APAP glucuronidation in the rat), however, their efficacy at inhibiting APAP glucuronidation was proportional to their capacity to deplete UDP-glucuronic acid (UDPGA). BCPS-mediated inhibition of APAP glucuronidation in isolated hepatocytes had non-competitive characteristics and was insensitive to the inactivation of cytochrome P450. The effective organochlorines were also able to selectively stimulate the hydrolysis of UDPGA to UDP and glucuronate in isolated microsomes, but could not inhibit APAP glucuronidation in microsomes when UDPGA was in excess. We conclude that organochlorines are able to inhibit APAP glucuronidation in hepatocytes by depleting UDPGA via redirecting UDPGA towards the D-glucuronate pathway. Because the inhibition is non-competitive, low concentrations of these compounds could have long term inhibitory effects on the

  15. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.


    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  16. Synthesis of lyso(bis)phosphatidic acid in rabbit alveolar macrophages

    SciTech Connect

    Thornburg, T.; Roddick, V.; Wykle, R.L.; Waite, M.


    Reported here are studies on the biosynthetic pathway used by normal and BCG elicited alveolar macrophages for the synthesis of lyso(bis)phosphatidic acid (L(bis)PA). Earlier observations by this laboratory have shown that although L(bis)PA is abundant in these cells, there is little de novo synthesis of this lipid. Diaceyl phosphatidylglycerol (PG) labeled with either (1,2,3-/sup 3/H) glycerol or /sup 32/P demonstrated that PG is used as an exogenous substrate for L(bis)PA formation; both glycerol moieties are incorporated. Other phospholipids do not have this capacity. BCG-elicited macrophages are capable of only one-quarter the synthesis of L(bis)PA seen with normal cells, and also show a decreased amount of cell associated substrate. In addition, (/sup 3/H) 1-0-alkyl PG was used as a substrate to test the importance of the sn-1 acyl linkage in the synthetic pathway. This substrate produced less L(bis)PA while dramatically increasing the amounts of labelled phosphatidylethanolamine and phosphatidylcholine within the cell. The alkyl substrate also showed increased uptake by the cell. They conclude that the hydrolysis of the acyl group at the sn-1 position of PG is essential in the synthetic pathway leading to the production of L(bis)PA. They further suggest that the PG used by these cells as an exogenous substrate in vitro is obtained from the PG-rich surfactant surrounding the alveolar macrophage.

  17. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.


    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  18. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.


    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E


    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  19. Microbial chemical factories: recent advances in pathway engineering for synthesis of value added chemicals.


    Dhamankar, Himanshu; Prather, Kristala L J


    The dwindling nature of petroleum and other fossil reserves has provided impetus towards microbial synthesis of fuels and value added chemicals from biomass-derived sugars as a renewable resource. Microbes have naturally evolved enzymes and pathways that can convert biomass into hundreds of unique chemical structures, a property that can be effectively exploited for their engineering into Microbial Chemical Factories (MCFs). De novo pathway engineering facilitates expansion of the repertoire of microbially synthesized compounds beyond natural products. In this review, we visit some recent successes in such novel pathway engineering and optimization, with particular emphasis on the selection and engineering of pathway enzymes and balancing of their accessory cofactors.

  20. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.


    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  1. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  2. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.


    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  3. Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha[OPEN

    PubMed Central

    Eklund, D. Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P.; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L.


    The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. PMID:26036256

  4. Integrating nitric oxide into salicylic acid and jasmonic acid/ ethylene plant defense pathways.


    Mur, Luis A J; Prats, Elena; Pierre, Sandra; Hall, Michael A; Hebelstrup, Kim H


    Plant defense against pests and pathogens is known to be conferred by either salicylic acid (SA) or jasmonic acid (JA)/ethylene (ET) pathways, depending on infection or herbivore-grazing strategy. It is well attested that SA and JA/ET pathways are mutually antagonistic allowing defense responses to be tailored to particular biotic stresses. Nitric oxide (NO) has emerged as a major signal influencing resistance mediated by both signaling pathways but no attempt has been made to integrate NO into established SA/JA/ET interactions. NO has been shown to act as an inducer or suppressor of signaling along each pathway. NO will initiate SA biosynthesis and nitrosylate key cysteines on TGA-class transcription factors to aid in the initiation of SA-dependent gene expression. Against this, S-nitrosylation of NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1) will promote the NPR1 oligomerization within the cytoplasm to reduce TGA activation. In JA biosynthesis, NO will initiate the expression of JA biosynthetic enzymes, presumably to over-come any antagonistic effects of SA on JA-mediated transcription. NO will also initiate the expression of ET biosynthetic genes but a suppressive role is also observed in the S-nitrosylation and inhibition of S-adenosylmethionine transferases which provides methyl groups for ET production. Based on these data a model for NO action is proposed but we have also highlighted the need to understand when and how inductive and suppressive steps are used.

  5. Integrating nitric oxide into salicylic acid and jasmonic acid/ ethylene plant defense pathways

    PubMed Central

    Mur, Luis A. J.; Prats, Elena; Pierre, Sandra; Hall, Michael A.; Hebelstrup, Kim H.


    Plant defense against pests and pathogens is known to be conferred by either salicylic acid (SA) or jasmonic acid (JA)/ethylene (ET) pathways, depending on infection or herbivore-grazing strategy. It is well attested that SA and JA/ET pathways are mutually antagonistic allowing defense responses to be tailored to particular biotic stresses. Nitric oxide (NO) has emerged as a major signal influencing resistance mediated by both signaling pathways but no attempt has been made to integrate NO into established SA/JA/ET interactions. NO has been shown to act as an inducer or suppressor of signaling along each pathway. NO will initiate SA biosynthesis and nitrosylate key cysteines on TGA-class transcription factors to aid in the initiation of SA-dependent gene expression. Against this, S-nitrosylation of NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1) will promote the NPR1 oligomerization within the cytoplasm to reduce TGA activation. In JA biosynthesis, NO will initiate the expression of JA biosynthetic enzymes, presumably to over-come any antagonistic effects of SA on JA-mediated transcription. NO will also initiate the expression of ET biosynthetic genes but a suppressive role is also observed in the S-nitrosylation and inhibition of S-adenosylmethionine transferases which provides methyl groups for ET production. Based on these data a model for NO action is proposed but we have also highlighted the need to understand when and how inductive and suppressive steps are used. PMID:23818890

  6. Leucine alleviates dexamethasone-induced suppression of muscle protein synthesis via synergy involvement of mTOR and AMPK pathways

    PubMed Central

    Wang, Xiao J.; Yang, Xin; Wang, Ru X.; Jiao, Hong C.; Zhao, Jing P.; Song, Zhi G.; Lin, Hai


    Glucocorticoids (GCs) are negative muscle protein regulators that contribute to the whole-body catabolic state during stress. Mammalian target of rapamycin (mTOR)-signalling pathway, which acts as a central regulator of protein metabolism, can be activated by branched-chain amino acids (BCAA). In the present study, the effect of leucine on the suppression of protein synthesis induced by GCs and the pathway involved were investigated. In vitro experiments were conducted using cultured C2C12 myoblasts to study the effect of GCs on protein synthesis, and the involvement of mTOR pathway was investigated as well. After exposure to dexamethasone (DEX, 100 μmol/l) for 24 h, protein synthesis in muscle cells was significantly suppressed (P<0.05), the phosphorylations of mTOR, ribosomal protein S6 protein kinase 1 (p70s6k1) and eukaryotic initiation factor 4E binding protein 1 (4EBP1) were significantly reduced (P<0.05). Leucine supplementation (5 mmol/l, 10 mmol/l and 15 mmol/l) for 1 h alleviated the suppression of protein synthesis induced by DEX (P<0.05) and was accompanied with the increased phosphorylation of mTOR and decreased phosphorylation of AMPK (P<0.05). Branched-chain amino transferase 2 (BCAT2) mRNA level was not influenced by DEX (P>0.05) but was increased by leucine supplementation at a dose of 5 mmol/l (P<0.05). PMID:27129299

  7. Orthogonal Synthesis of Xeno Nucleic Acids.


    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François


    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  8. Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

    PubMed Central


    Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

  9. [Possible route for thiamine participation in fatty acid synthesis].


    Buko, V U; Larin, F S


    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  10. Synthesis of gold nanoparticles using various amino acids.


    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya


    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  11. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.


    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.



    How, Zuo Tong; Linge, Kathryn; Busetti, Francesco; Joll, Cynthia A


    Chlorination of amino acids can result in the formation of organic monochloramines or organic dichloramines, depending on the chlorine to amino acid ratio (Cl:AA). After formation, organic chloramines degrade into aldehydes, nitriles and N-chloraldimines. In this paper, the formation of organic chloramines from chlorination of lysine, tyrosine and valine were investigated. Chlorination of tyrosine and lysine demonstrated that the presence of a reactive secondary group can increase the Cl:AA ratio required for the formation of N,N-dichloramines, and potentially alter the reaction pathways between chlorine and amino acids, resulting in the formation of unexpected by-products. In a detailed investigation, we report rate constants for all reactions in the chlorination of valine, for the first time, using experimental results and modelling. At Cl:AA = 2.8, the chlorine was found to first react quickly with valine (5.4x104 M-1 s-1) to form N-monochlorovaline, with a slower subsequent reaction with N-monochlorovaline to form N,N-dichlorovaline (4.9x102 M-1 s-1), although some N-monochlorovaline degraded into isobutyraldehyde (1.0x10-4 s-1). The N,N-dichlorovaline then competitively degraded into isobutyronitrile (1.3x10-4 s-1) and N-chloroisobutyraldimine (1.2x10-4 s-1). In conventional drinking water disinfection, N-chloroisobutyraldimine can potentially be formed in concentrations higher than its odour threshold concentration, resulting in aesthetic challenges and an unknown health risk.

  13. Prostaglandin E2 promotes hepatic bile acid synthesis by an E prostanoid receptor 3-mediated hepatocyte nuclear receptor 4α/cholesterol 7α-hydroxylase pathway in mice.


    Yan, Shuai; Tang, Juan; Zhang, Yuyao; Wang, Yuanyang; Zuo, Shengkai; Shen, Yujun; Zhang, Qianqian; Chen, Di; Yu, Yu; Wang, Kai; Duan, Sheng-Zhong; Yu, Ying


    Prostaglandin E2 (PGE2 ) is an important lipid mediator of inflammation. However, whether and how PGE2 regulates hepatic cholesterol metabolism remains unknown. We found that expression of the PGE2 receptor, E prostanoid receptor 3 (EP3) expression is remarkably increased in hepatocytes in response to hyperlipidemic stress. Hepatocyte-specific deletion of EP3 receptor (EP3(hep-/-) ) results in hypercholesterolemia and augments diet-induced atherosclerosis in low-density lipoprotein receptor knockout (Ldlr(-/-) ) mice. Cholesterol 7α-hydroxylase (CYP7A1) is down-regulated in livers of EP3(hep-/-) Ldlr(-/-) mice, leading to suppressed hepatic bile acid (BA) biosynthesis. Mechanistically, hepatic-EP3 deficiency suppresses CYP7A1 expression by elevating protein kinase A (PKA)-dependent Ser143 phosphorylation of hepatocyte nuclear receptor 4α (HNF4α). Disruption of the PKA-HNF4α interaction and BA sequestration rescue impaired BA excretion and ameliorated atherosclerosis in EP3(hep-/-) Ldlr(-/-) mice.

  14. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.


    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  15. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.


    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu


    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  16. Transcription factors FabR and FadR regulate both aerobic and anaerobic pathways for unsaturated fatty acid biosynthesis in Shewanella oneidensis.


    Luo, Qixia; Shi, Miaomiao; Ren, Yedan; Gao, Haichun


    As genes for type II fatty acid synthesis are essential to the growth of Escherichia coli, its sole (anaerobic) pathway has significant potential as a target for novel antibacterial drug, and has been extensively studied. Despite this, we still know surprisingly little about fatty acid synthesis in bacteria because this anaerobic pathway in fact is not widely distributed. In this study, we show a novel model of unsaturated fatty acid (UFA) synthesis in Shewanella, emerging human pathogens in addition to well-known metal reducers. We identify both anaerobic and aerobic UFA biosynthesis pathways in the representative species, S. oneidensis. Uniquely, the bacterium also contains two regulators FabR and FadR, whose counterparts in other bacteria control the anaerobic pathway. However, we show that in S. oneidensis these two regulators are involved in regulation of both pathways, in either direct or indirect manner. Overall, our results indicate that the UFA biosynthesis and its regulation are far more complex than previously expected, and S. oneidensis serves as a good research model for further work.

  17. Lactide Synthesis and Chirality Control for Polylactic acid Production.


    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert


    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  18. A reconfigured Kennedy pathway which promotes efficient accumulation of medium chain fatty acids in leaf oils.


    Reynolds, Kyle B; Taylor, Matthew C; Cullerne, Darren P; Blanchard, Christopher L; Wood, Craig C; Singh, Surinder P; Petrie, James R


    Medium chain fatty acids (MCFA, C6-14 fatty acids) are an ideal feedstock for biodiesel and broader oleochemicals. In recent decades, several studies have used transgenic engineering to produce MCFA in seeds oils, though these modifications result in unbalance membrane lipid profiles that impair oil yields and agronomic performance. Given the ability to engineer non-seed organs to produce oils, we have previously demonstrated that MCFA profiles can be produced in leaves, but this also results in unbalanced membrane lipid profiles and undesirable chlorosis and cell death. Here we demonstrate that the introduction of a diacylglycerol acyltransferase from oil palm, EgDGAT1, was necessary to channel nascent MCFA directly into leaf oils and therefore bypassing MCFA residing in membrane lipids. This pathway resulted in increased flux towards MCFA rich leaf oils, reduced MCFA in leaf membrane lipids and, crucially, the alleviation of chlorosis. Deep sequencing of African oil palm (Elaeis guineensis) and coconut palm (Cocos nucifera) generated candidate genes of interest, which were then tested for their ability to improve oil accumulation. Thioesterases were explored for the production of lauric acid (C12:0) and myristic (C14:0). The thioesterases from Umbellularia californica and Cinnamomum camphora produced a total of 52% C12:0 and 40% C14:0, respectively, in transient leaf assays. This study demonstrated that the introduction of a complete acyl-CoA dependent pathway for the synthesis of MFCA-rich oils avoided disturbing membrane homeostasis and cell death phenotypes. This study outlines a transgenic strategy for the engineering of biomass crops with high levels of MCFA rich leaf oils. This article is protected by copyright. All rights reserved.

  19. RpiR Homologues May Link Staphylococcus aureus RNAIII Synthesis and Pentose Phosphate Pathway Regulation ▿ †

    PubMed Central

    Zhu, Yefei; Nandakumar, Renu; Sadykov, Marat R.; Madayiputhiya, Nandakumar; Luong, Thanh T.; Gaupp, Rosmarie; Lee, Chia Y.; Somerville, Greg A.


    Staphylococcus aureus is a medically important pathogen that synthesizes a wide range of virulence determinants. The synthesis of many staphylococcal virulence determinants is regulated in part by stress-induced changes in the activity of the tricarboxylic acid (TCA) cycle. One metabolic change associated with TCA cycle stress is an increased concentration of ribose, leading us to hypothesize that a pentose phosphate pathway (PPP)-responsive regulator mediates some of the TCA cycle-dependent regulatory effects. Using bioinformatics, we identified three potential ribose-responsive regulators that belong to the RpiR family of transcriptional regulators. To determine whether these RpiR homologues affect PPP activity and virulence determinant synthesis, the rpiR homologues were inactivated, and the effects on PPP activity and virulence factor synthesis were assessed. Two of the three homologues (RpiRB and RpiRC) positively influence the transcription of the PPP genes rpiA and zwf, while the third homologue (RpiRA) is slightly antagonistic to the other homologues. In addition, inactivation of RpiRC altered the temporal transcription of RNAIII, the effector molecule of the agr quorum-sensing system. These data confirm the close linkage of central metabolism and virulence determinant synthesis, and they establish a metabolic override for quorum-sensing-dependent regulation of RNAIII transcription. PMID:21926234

  20. A new general pathway for synthesis of reference compounds of N-terminal valine-isocyanate adducts.


    Davies, Ronnie; Rydberg, Per; Westberg, Emelie; Motwani, Hitesh V; Johnstone, Erik; Törnqvist, Margareta


    Adducts to Hb could be used as biomarkers to monitor exposure to isocyanates. Particularly useful is the measurement of carbamoylation of N-terminal valines in Hb, after detachment as hydantoins. The synthesis of references from the reactive isocyanates, especially diisocyanates, has been problematic due to side reactions and polymerization of the isocyanate starting material. A simpler, safer, and more general method for the synthesis of valine adducts of isocyanates has been developed using N-[(4-nitrophenyl)carbamate]valine methylamide (NPCVMA) as the key precursor to adducts of various mono- and diisocyanates of interest. By reacting NPCVMA with a range of isocyanate-related amines, carbamoylated valines are formed without the use of the reactive isocyanates. The carbamoylated products synthesized here were cyclized with good yields of the formed hydantoins. The carbamoylated derivative from phenyl isocyanate also showed quantitative yield in a test with cyclization under the conditions used in blood. This new pathway for the preparation of N-carbamoylated model compounds overcomes the above-mentioned problems in the synthesis and is a general and simplified approach, which could make such reference compounds of adducts to N-terminal valine from isocyanates accessible for biomonitoring purposes. The synthesized hydantoins corresponding to adducts from isocyanic acid, methyl isocyanate, phenyl isocyanate, and 2,6-toluene diisocyanate were characterized by LC-MS analysis. The background level of the hydantoin from isocyanic acid in human blood was analyzed with the LC-MS conditions developed.

  1. Arginine decarboxylase (ADC) and agmatinase (AGMAT): an alternative pathway for synthesis of polyamines in pig conceptuses and uteri

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Arginine, a precursor for the synthesis of nitric oxide (NO) and polyamines, is critical for implantation and development of the conceptus. We first reported that the arginine decarboxylase (ADC)/agmatinase(AGMAT) pathway as an alternative pathway for synthesis of polyamines in the ovine conceptuses...

  2. Intracellular composition of fatty acid affects the processing and function of tyrosinase through the ubiquitin–proteasome pathway

    PubMed Central

    Ando, Hideya; Wen, Zhi-Ming; Kim, Hee-Yong; Valencia, Julio C.; Costin, Gertrude-E.; Watabe, Hidenori; Yasumoto, Ken-ichi; Niki, Yoko; Kondoh, Hirofumi; Ichihashi, Masamitsu; Hearing, Vincent J.


    Proteasomes are multicatalytic proteinase complexes within cells that selectively degrade ubiquitinated proteins. We have recently demonstrated that fatty acids, major components of cell membranes, are able to regulate the proteasomal degradation of tyrosinase, a critical enzyme required for melanin biosynthesis, in contrasting manners by relative increases or decreases in the ubiquitinated tyrosinase. In the present study, we show that altering the intracellular composition of fatty acids affects the post-Golgi degradation of tyrosinase. Incubation with linoleic acid (C18:2) dramatically changed the fatty acid composition of cultured B16 melanoma cells, i.e. the remarkable increase in polyunsaturated fatty acids such as linoleic acid and arachidonic acid (C20:4) was compensated by the decrease in monounsaturated fatty acids such as oleic acid (C18:1) and palmitoleic acid (C16:1), with little effect on the proportion of saturated to unsaturated fatty acid. When the composition of intracellular fatty acids was altered, tyrosinase was rapidly processed to the Golgi apparatus from the ER (endoplasmic reticulum) and the degradation of tyrosinase was increased after its maturation in the Golgi. Retention of tyrosinase in the ER was observed when cells were treated with linoleic acid in the presence of proteasome inhibitors, explaining why melanin synthesis was decreased in cells treated with linoleic acid and a proteasome inhibitor despite the abrogation of tyrosinase degradation. These results suggest that the intracellular composition of fatty acid affects the processing and function of tyrosinase in connection with the ubiquitin–proteasome pathway and suggest that this might be a common physiological approach to regulate protein degradation. PMID:16232122

  3. Dual Role for Phospholipid:Diacylglycerol Acyltransferase: Enhancing Fatty Acid Synthesis and Diverting Fatty Acids from Membrane Lipids to Triacylglycerol in Arabidopsis Leaves[C][W

    PubMed Central

    Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng


    There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979

  4. Abscisic acid interacts antagonistically with salicylic acid signaling pathway in rice-Magnaporthe grisea interaction.


    Jiang, Chang-Jie; Shimono, Masaki; Sugano, Shoji; Kojima, Mikiko; Yazawa, Katsumi; Yoshida, Riichiro; Inoue, Haruhiko; Hayashi, Nagao; Sakakibara, Hitoshi; Takatsuji, Hiroshi


    Plant hormones play pivotal signaling roles in plant-pathogen interactions. Here, we report characterization of an antagonistic interaction of abscisic acid (ABA) with salicylic acid (SA) signaling pathways in the rice-Magnaporthe grisea interaction. Exogenous application of ABA drastically compromised the rice resistance to both compatible and incompatible M. grisea strains, indicating that ABA negatively regulates both basal and resistance gene-mediated blast resistance. ABA markedly suppressed the transcriptional upregulation of WRKY45 and OsNPR1, the two key components of the SA signaling pathway in rice, induced by SA or benzothiadiazole or by blast infection. Overexpression of OsNPR1 or WRKY45 largely negated the enhancement of blast susceptibility by ABA, suggesting that ABA acts upstream of WRKY45 and OsNPR1 in the rice SA pathway. ABA-responsive genes were induced during blast infection in a pattern reciprocal to those of WRKY45 and OsPR1b in the compatible rice-blast interaction but only marginally in the incompatible one. These results suggest that the balance of SA and ABA signaling is an important determinant for the outcome of the rice-M. grisea interaction. ABA was detected in hyphae and conidia of M. grisea as well as in culture media, implying that blast-fungus-derived ABA could play a role in triggering ABA signaling at host infection sites.

  5. Bile acid homeostasis controls CAR signaling pathways in mouse testis through FXRalpha.


    Martinot, Emmanuelle; Baptissart, Marine; Véga, Aurélie; Sèdes, Lauriane; Rouaisnel, Betty; Vaz, Fred; Saru, Jean-Paul; de Haze, Angélique; Baron, Silvère; Caira, Françoise; Beaudoin, Claude; Volle, David H


    Bile acids (BAs) are molecules with endocrine activities controlling several physiological functions such as immunity, glucose homeostasis, testicular physiology and male fertility. The role of the nuclear BA receptor FXRα in the control of BA homeostasis has been well characterized. The present study shows that testis synthetize BAs. We demonstrate that mice invalidated for the gene encoding FXRα have altered BA homeostasis in both liver and testis. In the absence of FXRα, BA exposure differently alters hepatic and testicular expression of genes involved in BA synthesis. Interestingly, Fxrα-/- males fed a diet supplemented with BAs show alterations of testicular physiology and sperm production. This phenotype was correlated with the altered testicular BA homeostasis and the production of intermediate metabolites of BAs which led to the modulation of CAR signaling pathways within the testis. The role of the CAR signaling pathways within testis was validated using specific CAR agonist (TCPOBOP) and inverse agonist (androstanol) that respectively inhibited or reproduced the phenotype observed in Fxrα-/- males fed BA-diet. These data open interesting perspectives to better define how BA homeostasis contributes to physiological or pathophysiological conditions via the modulation of CAR activity.

  6. Bile acid homeostasis controls CAR signaling pathways in mouse testis through FXRalpha

    PubMed Central

    Martinot, Emmanuelle; Baptissart, Marine; Véga, Aurélie; Sèdes, Lauriane; Rouaisnel, Betty; Vaz, Fred; Saru, Jean-Paul; de Haze, Angélique; Baron, Silvère; Caira, Françoise; Beaudoin, Claude; Volle, David H.


    Bile acids (BAs) are molecules with endocrine activities controlling several physiological functions such as immunity, glucose homeostasis, testicular physiology and male fertility. The role of the nuclear BA receptor FXRα in the control of BA homeostasis has been well characterized. The present study shows that testis synthetize BAs. We demonstrate that mice invalidated for the gene encoding FXRα have altered BA homeostasis in both liver and testis. In the absence of FXRα, BA exposure differently alters hepatic and testicular expression of genes involved in BA synthesis. Interestingly, Fxrα-/- males fed a diet supplemented with BAs show alterations of testicular physiology and sperm production. This phenotype was correlated with the altered testicular BA homeostasis and the production of intermediate metabolites of BAs which led to the modulation of CAR signaling pathways within the testis. The role of the CAR signaling pathways within testis was validated using specific CAR agonist (TCPOBOP) and inverse agonist (androstanol) that respectively inhibited or reproduced the phenotype observed in Fxrα-/- males fed BA-diet. These data open interesting perspectives to better define how BA homeostasis contributes to physiological or pathophysiological conditions via the modulation of CAR activity. PMID:28181583

  7. Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

    PubMed Central

    Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao


    Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

  8. First-principles prediction of stable SiC cage structures and their synthesis pathways

    NASA Astrophysics Data System (ADS)

    Pochet, Pascal; Genovese, Luigi; Caliste, Damien; Rousseau, Ian; Goedecker, Stefan; Deutsch, Thierry


    In this paper we use density functional theory calculations to investigate the structure and the stability of different SiC cagelike clusters. In addition to the fullerene family and the mixed four and six membered ring family, we introduce a family based on reconstructed nanotube slices. We propose an alternative synthesis pathway starting from SiC nanotubes.

  9. Computational modeling of a metabolic pathway in ceramide de novo synthesis.


    Dhingra, Shobhika; Freedenberg, Melissa; Quo, Chang F; Merrill, Alfred H; Wang, May D


    Studies have implicated ceramide as a key molecular agent in regulating programmed cell death, or apoptosis. Consequently, there is significant potential in targeting intracellular ceramide as a cancer therapeutic agent. The cell's major ceramide source is the ceramide de novo synthesis pathway, which consists of a complex network of interdependent enzyme-catalyzed biochemical reactions. To understand how ceramide works, we have initiated the study of the ceramide de novo synthesis pathway using computational modeling based on fundamental principles of biochemical kinetics. Specifically, we designed and developed the model in MATLAB SIMULINK for the behavior of dihydroceramide desaturase. Dihydroceramide desaturase is one of three key enzymes in the ceramide de novo synthesis pathway, and it converts a relatively inert precursor molecule, dihydroceramide into biochemically reactive ceramide. A major issue in modeling is parameter estimation. We solved this problem by adopting a heuristic strategy based on a priori knowledge from literature and experimental data. We evaluated model accuracy by comparing the model prediction results with interpolated experimental data. Our future work includes more experimental validation of the model, dynamic rate constants assessment, and expansion of the model to include additional enzymes in the ceramide de novo synthesis pathway.

  10. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.


    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  11. An in vitro investigation of the actions of reproductive hormones on the cervix of the ewe in the follicular stage: the effects of 17β-estradiol, oxytocin, FSH, and arachidonic acid on the cervical pathway for the synthesis of prostaglandin E2.


    Falchi, L; Scaramuzzi, R J


    During the periovulatory period, the cervix of the ewe relaxes and this mechanism is thought to be mediated by oxytocin and prostaglandin E2 (PGE2) in response to increased concentrations of 17β-estradiol and perhaps FSH. The aim of the study was to determine the in vitro effects of 17β-estradiol, FSH, oxytocin, and arachidonic acid (AA) on the synthesis of PGE2 and on the expression of oxytocin receptor (OTR), cytoplasmic phospholipase A2 (cPLA2), and cyclooxygenase 2 (COX-2) in explants of cervical tissue collected from ewes in the periovulatory phase of the estrous cycle. Cervical minces from ewes in the follicular phase of the estrous cycle were cultured in supplemented Eagle's Minimum Essential Medium for 48 hours with 17β-estradiol, FSH, oxytocin, or AA. After incubation, the tissue was stored at -80 °C and the media at -20 °C. Western immunoblotting was used to determine relative levels of OTR, cPLA2, and COX-2 in cervical tissue, and the media was analyzed by RIA, to determine the concentration of PGE2. The addition of 17β-estradiol increased the concentration of PGE2 in the media (P = 0.001), the levels of COX-2 (P = 0.02) and OTR (P = 0.006) but not those of cPLA2 (P = 0.15). The addition of FSH increased the levels of COX-2 (P = 0.01) but, it had no effect on the concentration of PGE2 (P = 0.08) or on the levels of OTR (P = 0.07) and cPLA2 (P = 0.15). Oxytocin did not increase the levels of COX-2 (P = 0.38) but increased those of OTR (P = 0.001) and cPLA2 (P = 0.01) but not on the concentration of PGE2 in the media. Arachidonic acid increased the levels of cPLA2 (P = 0.01) and those of COX-2 (P = 0.02) but not the concentration of PGE2 in the media. Our findings suggest that the PGE2-mediated mechanisms of cervical relaxation in the ewe during the follicular phase are stimulated by FSH, 17β-estradiol, oxytocin, and AA. They all appear to act by inducing receptors and enzymes along the synthetic pathway for PGE2.

  12. The cockroach Blattella germanica obtains nitrogen from uric acid through a metabolic pathway shared with its bacterial endosymbiont.


    Patiño-Navarrete, Rafael; Piulachs, Maria-Dolors; Belles, Xavier; Moya, Andrés; Latorre, Amparo; Peretó, Juli


    Uric acid stored in the fat body of cockroaches is a nitrogen reservoir mobilized in times of scarcity. The discovery of urease in Blattabacterium cuenoti, the primary endosymbiont of cockroaches, suggests that the endosymbiont may participate in cockroach nitrogen economy. However, bacterial urease may only be one piece in the entire nitrogen recycling process from insect uric acid. Thus, in addition to the uricolytic pathway to urea, there must be glutamine synthetase assimilating the released ammonia by the urease reaction to enable the stored nitrogen to be metabolically usable. None of the Blattabacterium genomes sequenced to date possess genes encoding for those enzymes. To test the host's contribution to the process, we have sequenced and analysed Blattella germanica transcriptomes from the fat body. We identified transcripts corresponding to all genes necessary for the synthesis of uric acid and its catabolism to urea, as well as for the synthesis of glutamine, asparagine, proline and glycine, i.e. the amino acids required by the endosymbiont. We also explored the changes in gene expression with different dietary protein levels. It appears that the ability to use uric acid as a nitrogen reservoir emerged in cockroaches after its age-old symbiotic association with bacteria.

  13. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.


    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  14. Differential modulation of citrate synthesis and release by fatty acids in perfused working rat hearts.


    Vincent, Genevieve; Bouchard, Bertrand; Khairallah, Maya; Des Rosiers, Christine


    The objective of this study was to test the effect of increasing fatty acid concentrations on substrate fluxes through pathways leading to citrate synthesis and release in the heart. This was accomplished using semirecirculating work-performing rat hearts perfused with substrate mixtures mimicking the in situ milieu (5.5 mM glucose, 8 nM insulin, 1 mM lactate, 0.2 mM pyruvate, and 0.4 mM oleate-albumin) and 13C methods. Raising the fatty acid concentration from 0.4 to 1 mM with long-chain oleate or medium-chain octanoate resulted in a lowering ( approximately 20%) of cardiac output and efficiency with unaltered O2 consumption. At the metabolic level, beyond the expected effects of high fatty acid levels on the contribution of pyruvate decarboxylation (reduced >3-fold) and beta-oxidation (enhanced approximately 3-fold) to citrate synthesis, there was also a 2.4-fold lowering of anaplerotic pyruvate carboxylation. Despite the dual inhibitory effect of high fatty acids on pyruvate decarboxylation and carboxylation, tissue citrate levels were twofold higher, but citrate release rates remained unchanged at 11-14 nmol/min, representing <0.5% of citric acid cycle flux. A similar trend was observed for most metabolic parameters after oleate or octanoate addition. Together, these results emphasize a differential modulation of anaplerotic pyruvate carboxylation and citrate release in the heart by fatty acids. We interpret the lack of effects of high fatty acid concentrations on citrate release rates as suggesting that, under physiological conditions, this process is maximal, probably limited by the activity of its mitochondrial or plasma membrane transporter. Limited citrate release at high fatty acid concentrations may have important consequences for the heart's fuel metabolism and function.

  15. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.


    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S


    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  16. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.


    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  17. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.


    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip


    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  18. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  19. Regulation of protein degradation pathways by amino acids and insulin in skeletal muscle of neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rapid gain in lean mass in neonates requires greater rates of protein synthesis than degradation. We previously delineated the molecular mechanisms by which insulin and amino acids, especially leucine, modulate skeletal muscle protein synthesis and how this changes with development. In the curre...

  20. Metabolic Interactions between the Lands Cycle and the Kennedy Pathway of Glycerolipid Synthesis in Arabidopsis Developing Seeds[W

    PubMed Central

    Wang, Liping; Shen, Wenyun; Kazachkov, Michael; Chen, Guanqun; Chen, Qilin; Carlsson, Anders S.; Stymne, Sten; Weselake, Randall J.; Zou, Jitao


    It has been widely accepted that the primary function of the Lands cycle is to provide a route for acyl remodeling to modify fatty acid (FA) composition of phospholipids derived from the Kennedy pathway. Lysophosphatidylcholine acyltransferase (LPCAT) is an evolutionarily conserved key enzyme in the Lands cycle. In this study, we provide direct evidence that the Arabidopsis thaliana LPCATs, LPCAT1 and LPCAT2, participate in the Lands cycle in developing seeds. In spite of a substantially reduced initial rate of nascent FA incorporation into phosphatidylcholine (PC), the PC level in the double mutant lpcat1 lpcat2-2 remained unchanged. LPCAT deficiency triggered a compensatory response of de novo PC synthesis and a concomitant acceleration of PC turnover that were attributable at least in part to PC deacylation. Acyl-CoA profile analysis revealed complicated metabolic alterations rather than merely reduced acyl group shuffling from PC in the mutant. Shifts in FA stereo-specific distribution in triacylglycerol of the mutant seed suggested a preferential retention of saturated acyl chains at the stereospecific numbering (sn)-1 position from PC and likely a channeling of lysophosphatidic acid, derived from PC, into the Kennedy pathway. Our study thus illustrates an intricate relationship between the Lands cycle and the Kennedy pathway. PMID:23150634

  1. Cancer Cells Differentially Activate and Thrive on De Novo Lipid Synthesis Pathways in a Low-Lipid Environment

    PubMed Central

    Daniëls, Veerle W.; Smans, Karine; Royaux, Ines; Chypre, Melanie


    Increased lipogenesis is a hallmark of a wide variety of cancers and is under intense investigation as potential antineoplastic target. Although brisk lipogenesis is observed in the presence of exogenous lipids, evidence is mounting that these lipids may adversely affect the efficacy of inhibitors of lipogenic pathways. Therefore, to fully exploit the therapeutic potential of lipid synthesis inhibitors, a better understanding of the interrelationship between de novo lipid synthesis and exogenous lipids and their respective role in cancer cell proliferation and therapeutic response to lipogenesis inhibitors is of critical importance. Here, we show that the proliferation of various cancer cell lines (PC3M, HepG2, HOP62 and T24) is attenuated when cultured in lipid-reduced conditions in a cell line-dependent manner, with PC3M being the least affected. Interestingly, all cell lines - lipogenic (PC3M, HepG2, HOP62) as well as non-lipogenic (T24) - raised their lipogenic activity in these conditions, albeit to a different degree. Cells that attained the highest lipogenic activity under these conditions were best able to cope with lipid reduction in term of proliferative capacity. Supplementation of the medium with very low density lipoproteins, free fatty acids and cholesterol reversed this activation, indicating that the mere lack of lipids is sufficient to activate de novo lipogenesis in cancer cells. Consequently, cancer cells grown in lipid-reduced conditions became more dependent on de novo lipid synthesis pathways and were more sensitive to inhibitors of lipogenic pathways, like Soraphen A and Simvastatin. Collectively, these data indicate that limitation of access to exogenous lipids, as may occur in intact tumors, activates de novo lipogenesis is cancer cells, helps them to thrive under these conditions and makes them more vulnerable to lipogenesis inhibitors. These observations have important implications for the design of new antineoplastic strategies targeting

  2. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.


    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie


    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  3. Synthesis of methylphosphonic acid by marine microbes: a source for methane in the aerobic ocean.


    Metcalf, William W; Griffin, Benjamin M; Cicchillo, Robert M; Gao, Jiangtao; Janga, Sarath Chandra; Cooke, Heather A; Circello, Benjamin T; Evans, Bradley S; Martens-Habbena, Willm; Stahl, David A; van der Donk, Wilfred A


    Relative to the atmosphere, much of the aerobic ocean is supersaturated with methane; however, the source of this important greenhouse gas remains enigmatic. Catabolism of methylphosphonic acid by phosphorus-starved marine microbes, with concomitant release of methane, has been suggested to explain this phenomenon, yet methylphosphonate is not a known natural product, nor has it been detected in natural systems. Further, its synthesis from known natural products would require unknown biochemistry. Here we show that the marine archaeon Nitrosopumilus maritimus encodes a pathway for methylphosphonate biosynthesis and that it produces cell-associated methylphosphonate esters. The abundance of a key gene in this pathway in metagenomic data sets suggests that methylphosphonate biosynthesis is relatively common in marine microbes, providing a plausible explanation for the methane paradox.

  4. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo


    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  5. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )


    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  6. Glycolysis, Glutaminolysis and Fatty Acid Synthesis are Required for Distinct Stages of KSHV Lytic Replication.


    Sanchez, Erica L; Pulliam, Thomas H; Dimaio, Terri A; Thalhofer, Angel B; Delgado, Tracie; Lagunoff, Michael


    Kaposi's Sarcoma-associated Herpesvirus (KSHV) is the etiologic agent of Kaposi's Sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including glycolysis, glutaminolysis and fatty acid synthesis (FAS) for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription while glutaminolysis is necessary for early gene translation, but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions, but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are non-infectious indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication providing novel therapeutic avenues for KS tumors.IMPORTANCE KSHV is the etiologic agent of Kaposi's Sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state where there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation. Our previous findings showed that

  7. The aspartate-family pathway of plants: linking production of essential amino acids with energy and stress regulation.


    Galili, Gad


    The Asp family pathway of plants is highly important from a nutritional standpoint because it leads to the synthesis of the four essential amino acids Lys, Thr, Met and Ile. These amino acids are not synthesized by human and its monogastric livestock and should be supplemented in their diets. Among the Asp-family amino acids, Lys is considered as the nutritionally most important essential amino acid because its level is most limiting in cereal grains, representing the largest source of plant foods and feeds worldwide. Metabolic engineering approaches led to significant increase in Lys level in seeds by enhancing its synthesis and reducing its catabolism. However, results from the model plant Arabidopsis showed that this approach may retard seed germination due to a major negative effect on the levels of a number of TCA cycle metabolites that associate with cellular energy. In the present review, we discuss the regulatory metabolic link of the Asp-family pathway with the TCA cycle and its biological significance upon exposure to stress conditions that cause energy deprivation. In addition, we also discuss how deep understanding of the regulatory metabolic link of the Asp-family pathway with energy and stress regulation can be used to improve Lys level in seeds of important crop species, minimizing the interference with the cellular energy status and plant-stress interaction. This review thus provides an example showing how deep understanding the inter-regulation of metabolism with plant stress physiology can lead to successful nutritional improvements with minimal negative effect on plant growth and response to stressful environments.

  8. Amino acids trigger down-regulation of superoxide via TORC pathway in the midgut of Rhodnius prolixus

    PubMed Central

    Gandara, Ana Caroline P.; Oliveira, José Henrique M.; Nunes, Rodrigo D.; Goncalves, Renata L.S.; Dias, Felipe A.; Hecht, Fabio; Fernandes, Denise C.; Genta, Fernando A.; Laurindo, Francisco R.M.; Oliveira, Marcus F.; Oliveira, Pedro L.


    Sensing incoming nutrients is an important and critical event for intestinal cells to sustain life of the whole organism. The TORC is a major protein complex involved in monitoring the nutritional status and is activated by elevated amino acid concentrations. An important feature of haematophagy is that huge amounts of blood are ingested in a single meal, which results in the release of large quantities of amino acids, together with the haemoglobin prosthetic group, haem, which decomposes hydroperoxides and propagates oxygen-derived free radicals. Our previous studies demonstrated that reactive oxygen species (ROS) levels were diminished in the mitochondria and midgut of the Dengue fever mosquito, Aedes aegypti, immediately after a blood meal. We proposed that this mechanism serves to avoid oxidative damage that would otherwise be induced by haem following a blood meal. Studies also performed in mosquitoes have shown that blood or amino acids controls protein synthesis through TORC activation. It was already proposed, in different models, a link between ROS and TOR, however, little is known about TOR signalling in insect midgut nor about the involvement of ROS in this pathway. Here, we studied the effect of a blood meal on ROS production in the midgut of Rhodnius prolixus. We observed that blood meal amino acids decreased ROS levels in the R. prolixus midgut immediately after feeding, via lowering mitochondrial superoxide production and involving the amino acid-sensing TORC pathway. PMID:26945025

  9. A distinct pathway for tetrahymanol synthesis in bacteria

    PubMed Central

    Banta, Amy B.; Wei, Jeremy H.; Welander, Paula V.


    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol. PMID:26483502

  10. A distinct pathway for tetrahymanol synthesis in bacteria

    NASA Astrophysics Data System (ADS)

    Banta, Amy B.; Wei, Jeremy H.; Welander, Paula V.


    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol.

  11. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.


    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda


    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress.

  12. 2-Keto acids based biosynthesis pathways for renewable fuels and chemicals.


    Tashiro, Yohei; Rodriguez, Gabriel M; Atsumi, Shota


    Global energy and environmental concerns have driven the development of biological chemical production from renewable sources. Biological processes using microorganisms are efficient and have been traditionally utilized to convert biomass (i.e., glucose) to useful chemicals such as amino acids. To produce desired fuels and chemicals with high yield and rate, metabolic pathways have been enhanced and expanded with metabolic engineering and synthetic biology approaches. 2-Keto acids, which are key intermediates in amino acid biosynthesis, can be converted to a wide range of chemicals. 2-Keto acid pathways were engineered in previous research efforts and these studies demonstrated that 2-keto acid pathways have high potential for novel metabolic routes with high productivity. In this review, we discuss recently developed 2-keto acid-based pathways.

  13. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others


    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  14. Activity-induced convergence of APP and BACE-1 in acidic microdomains via an endocytosis-dependent pathway.


    Das, Utpal; Scott, David A; Ganguly, Archan; Koo, Edward H; Tang, Yong; Roy, Subhojit


    The convergence of APP (substrate) and BACE-1 (enzyme) is a rate-limiting, obligatory event triggering the amyloidogenic pathway-a key step in Alzheimer's disease (AD) pathology. However, as both APP/BACE-1 are highly expressed in brain, mechanisms precluding their unabated convergence are unclear. Exploring dynamic localization of APP/BACE-1 in cultured hippocampal neurons, we found that after synthesis via the secretory pathway, dendritic APP/BACE-1-containing vesicles are largely segregated in physiologic states. While BACE-1 is sorted into acidic recycling endosomes, APP is conveyed in Golgi-derived vesicles. However, upon activity induction-a known trigger of the amyloidogenic pathway-APP is routed into BACE-1-positive recycling endosomes via a clathrin-dependent mechanism. A partitioning/convergence of APP/BACE-1 vesicles is also apparent in control/AD brains, respectively. Considering BACE-1 is optimally active in an acidic environment, our experiments suggest that neurons have evolved trafficking strategies that normally limit APP/BACE-1 proximity and also uncover a pathway routing APP into BACE-1-containing organelles, triggering amyloidogenesis.

  15. The shikimate pathway: review of amino acid sequence, function and three-dimensional structures of the enzymes.


    Mir, Rafia; Jallu, Shais; Singh, T P


    The aromatic compounds such as aromatic amino acids, vitamin K and ubiquinone are important prerequisites for the metabolism of an organism. All organisms can synthesize these aromatic metabolites through shikimate pathway, except for mammals which are dependent on their diet for these compounds. The pathway converts phosphoenolpyruvate and erythrose 4-phosphate to chorismate through seven enzymatically catalyzed steps and chorismate serves as a precursor for the synthesis of variety of aromatic compounds. These enzymes have shown to play a vital role for the viability of microorganisms and thus are suggested to present attractive molecular targets for the design of novel antimicrobial drugs. This review focuses on the seven enzymes of the shikimate pathway, highlighting their primary sequences, functions and three-dimensional structures. The understanding of their active site amino acid maps, functions and three-dimensional structures will provide a framework on which the rational design of antimicrobial drugs would be based. Comparing the full length amino acid sequences and the X-ray crystal structures of these enzymes from bacteria, fungi and plant sources would contribute in designing a specific drug and/or in developing broad-spectrum compounds with efficacy against a variety of pathogens.

  16. Liver glyconeogenesis: a pathway to cope with postprandial amino acid excess in high-protein fed rats?


    Azzout-Marniche, Dalila; Gaudichon, Claire; Blouet, Clémence; Bos, Cécile; Mathé, Véronique; Huneau, Jean-François; Tomé, Daniel


    This paper provides molecular evidence for a liver glyconeogenic pathway, that is, a concomitant activation of hepatic gluconeogenesis and glycogenesis, which could participate in the mechanisms that cope with amino acid excess in high-protein (HP) fed rats. This evidence is based on the concomitant upregulation of phosphoenolpyruvate carboxykinase (PEPCK) gene expression, downregulation of glucose 6-phosphatase catalytic subunit (G6PC1) gene expression, an absence of glucose release from isolated hepatocytes and restored hepatic glycogen stores in the fed state in HP fed rats. These effects are mainly due to the ability of high physiological concentrations of portal blood amino acids to counteract glucagon-induced liver G6PC1 but not PEPCK gene expression. These results agree with the idea that the metabolic pathway involved in glycogen synthesis is dependent upon the pattern of nutrient availability. This nonoxidative glyconeogenic disposal pathway of gluconeogenic substrates copes with amino excess and participates in adjusting both amino acid and glucose homeostasis. In addition, the pattern of PEPCK and G6PC1 gene expression provides evidence that neither the kidney nor the small intestine participated in gluconeogenic glucose production under our experimental conditions. Moreover, the main glucose-6-phosphatase (G6Pase) isoform expressed in the small intestine is the ubiquitous isoform of G6Pase (G6PC3) rather than the G6PC1 isoform expressed in gluconeogenic organs.

  17. Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives

    PubMed Central

    Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A


    Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513

  18. Evidence for transport intermediates in aromatic amino acid synthesis of non-green tissues

    SciTech Connect

    Leuschner, C.; Schultz, G. )


    Quinate (QA) is the predominant pre-aromatic compound formed at high rates in leaves of many plants at the early vegetation stage and transported through the phloem. The transfer of 3-dehydroquinate, 3-dehydroshikimate and (SkA) across the plastidial membranes has been evidenced. The question was whether the rate of QA uptake is comparable to that of the 3 SkA-pathway intermediates. To demonstrate this, /U-{sup 14}C/QA and /U-{sup 14}C/SkA were applied to Brassica rapa roots. Both compounds were uptaken at considerable rates and incorporated into aromatic amino acids (Phe + Tyr + Trp formation, in nmol/g fresh wt x h: applying 145 {mu}mol QA: 21.2; applying 156 {mu}mol Ska: 31.8). Thus, QA is a possible candidate for transport into non-green tissues for aromatic amino acid synthesis.

  19. Convergent and stereospecific synthesis of complex skipped polyenes and polyunsaturated fatty acids.


    Macklin, Todd K; Micalizio, Glenn C


    Skipped polyenes (that is, 1,4-dienes and higher homologues) are stereodefined components of a vast array of biologically important natural products, including polyunsaturated fatty acids. Although widespread in nature, these architectures are generally considered to represent significant barriers to efficient chemical synthesis. Partial reduction of skipped poly-ynes provides a pathway to a subset of such structures, but general chemical methods for the preparation of skipped polyenes that contain varied stereochemistries and substitution patterns are lacking. Here, we describe a metal-promoted reductive cross-coupling reaction between vinylcyclopropanes and alkynes (or vinylsilanes) that provides stereoselective access to a diverse array of skipped polyenes through a process that establishes one C-C bond, generates up to three stereodefined alkenes, and can be used to introduce stereogenic centres at the central positions of the skipped polyene motif. We also demonstrate the significance of the present bond construction by preparing substituted and stereodefined polyunsaturated synthetic fatty acids.

  20. Deciphering the roles of Arabidopsis LPCAT and PAH in phosphatidylcholine homeostasis and pathway coordination for chloroplast lipid synthesis.


    Wang, Liping; Kazachkov, Michael; Shen, Wenyun; Bai, Mei; Wu, Hong; Zou, Jitao


    Phosphatidylcholine (PC) is a key intermediate in the metabolic network of glycerolipid biosynthesis. Lysophosphatidylcholine acyltransferase (LPCAT) and phosphatidic acid phosphatase (PAH) are two key enzymes of PC homeostasis. We report that LPCAT activity is markedly induced in the Arabidopsis pah mutant. The quadruple pah lpcat mutant, with dual defects in PAH and LPCAT, had a level of lysophosphatidylcholine (LPC) that was much higher than that in the lpcat mutants and a PC content that was higher than that in the pah mutant. Comparative molecular profile analysis of monogalactosyldiacylglycerol and digalactosyldiacylglycerol revealed that both the pah and pah lpcat mutants had increased proportions of 34:6 from the prokaryotic pathway despite differing levels of LPCAT activity. We show that a decreased representation of the C16:0 C18:2 diacylglycerol moiety in PC was a shared feature of pah and pah lpcat, and that this change in PC metabolic profile correlated with the increased prokaryotic contribution to chloroplast lipid synthesis. We detected increased PC deacylation in the pah lpcat mutant that was attributable at least in part to the induced phospholipases. Increased LPC generation was also evident in the pah mutant, but the phospholipases were not induced, raising the possibility that PC deacylation is mediated by the reverse reaction of LPCAT. We discuss possible roles of LPCAT and PAH in PC turnover that impacts lipid pathway coordination for chloroplast lipid synthesis.

  1. Mining Enzyme Diversity of Transcriptome Libraries through DNA Synthesis for Benzylisoquinoline Alkaloid Pathway Optimization in Yeast.


    Narcross, Lauren; Bourgeois, Leanne; Fossati, Elena; Burton, Euan; Martin, Vincent J J


    The ever-increasing quantity of data deposited to GenBank is a valuable resource for mining new enzyme activities. Falling costs of DNA synthesis enables metabolic engineers to take advantage of this resource for identifying superior or novel enzymes for pathway optimization. Previously, we reported synthesis of the benzylisoquinoline alkaloid dihydrosanguinarine in yeast from norlaudanosoline at a molar conversion of 1.5%. Molar conversion could be improved by reduction of the side-product N-methylcheilanthifoline, a key bottleneck in dihydrosanguinarine biosynthesis. Two pathway enzymes, an N-methyltransferase and a cytochrome P450 of the CYP719A subfamily, were implicated in the synthesis of the side-product. Here, we conducted an extensive screen to identify enzyme homologues whose coexpression reduces side-product synthesis. Phylogenetic trees were generated from multiple sources of sequence data to identify a library of candidate enzymes that were purchased codon-optimized and precloned into expression vectors designed to facilitate high-throughput analysis of gene expression as well as activity assay. Simple in vivo assays were sufficient to guide the selection of superior enzyme homologues that ablated the synthesis of the side-product, and improved molar conversion of norlaudanosoline to dihydrosanguinarine to 10%.

  2. Single-step pathway for synthesis of glucosylglycerate in Persephonella marina.


    Fernandes, Chantal; Empadinhas, Nuno; da Costa, Milton S


    A single-step pathway for the synthesis of the compatible solute glucosylglycerate (GG) is proposed based on the activity of a recombinant glucosylglycerate synthase (Ggs) from Persephonella marina. The corresponding gene encoded a putative glycosyltransferase that was part of an operon-like structure which also contained the genes for glucosyl-3-phosphoglycerate synthase (GpgS) and glucosyl-3-phosphoglycerate phosphatase (GpgP), the enzymes that lead to the synthesis of GG through the formation of glucosyl-3-phosphoglycerate. The putative glucosyltransferase gene was expressed in Escherichia coli, and the recombinant product catalyzed the synthesis of GG in one step from ADP-glucose and d-glycerate, with K(m) values at 70 degrees C of 1.5 and 2.2 mM, respectively. This glucosylglycerate synthase (Ggs) was also able to use GDP- and UDP-glucose as donors to form GG, but the efficiencies were lower. Maximal activity was observed at temperatures between 80 and 85 degrees C, and Mg(2+) or Ca(2+) was required for catalysis. Ggs activity was maximal and remained nearly constant at pH values between 5.5 and pH 8.0, and the half-lives for inactivation were 74 h at 85 degrees C and 8 min at 100 degrees C. This is the first report of an enzyme catalyzing the synthesis of GG in one step and of the existence of two pathways for GG synthesis in the same organism.

  3. Vitamin B(12) synthesis and salvage pathways were acquired by horizontal gene transfer to the Thermotogales.


    Swithers, Kristen S; Petrus, Amanda K; Secinaro, Michael A; Nesbø, Camilla L; Gogarten, J Peter; Noll, Kenneth M; Butzin, Nicholas C


    The availability of genome sequences of Thermotogales species from across the order allows an examination of the evolutionary origins of phenotypic characteristics in this lineage. Several studies have shown that the Thermotogales have acquired large numbers of genes from distantly related lineages, particularly Firmicutes and Archaea. Here, we report the finding that some Thermotogales acquired the ability to synthesize vitamin B(12) by acquiring the requisite genes from these distant lineages. Thermosipho species, uniquely among the Thermotogales, contain genes that encode the means to synthesize vitamin B(12) de novo from glutamate. These genes are split into two gene clusters: the corrinoid synthesis gene cluster, that is unique to the Thermosipho and the cobinamide salvage gene cluster. The corrinoid synthesis cluster was acquired from the Firmicutes lineage, whereas the salvage pathway is an amalgam of bacteria- and archaea-derived proteins. The cobinamide salvage gene cluster has a patchy distribution among Thermotogales species, and ancestral state reconstruction suggests that this pathway was present in the common Thermotogales ancestor. We show that Thermosipho africanus can grow in the absence of vitamin B(12), so its de novo pathway is functional. We detected vitamin B(12) in the extracts of T. africanus cells to verify the synthetic pathway. Genes in T. africanus with apparent B(12) riboswitches were found to be down-regulated in the presence of vitamin B(12) consistent with their roles in B(12) synthesis and cobinamide salvage.

  4. Vitamin B12 Synthesis and Salvage Pathways Were Acquired by Horizontal Gene Transfer to the Thermotogales

    PubMed Central

    Swithers, Kristen S.; Petrus, Amanda K.; Secinaro, Michael A.; Nesbø, Camilla L.; Gogarten, J. Peter; Noll, Kenneth M.; Butzin, Nicholas C.


    The availability of genome sequences of Thermotogales species from across the order allows an examination of the evolutionary origins of phenotypic characteristics in this lineage. Several studies have shown that the Thermotogales have acquired large numbers of genes from distantly related lineages, particularly Firmicutes and Archaea. Here, we report the finding that some Thermotogales acquired the ability to synthesize vitamin B12 by acquiring the requisite genes from these distant lineages. Thermosipho species, uniquely among the Thermotogales, contain genes that encode the means to synthesize vitamin B12 de novo from glutamate. These genes are split into two gene clusters: the corrinoid synthesis gene cluster, that is unique to the Thermosipho and the cobinamide salvage gene cluster. The corrinoid synthesis cluster was acquired from the Firmicutes lineage, whereas the salvage pathway is an amalgam of bacteria- and archaea-derived proteins. The cobinamide salvage gene cluster has a patchy distribution among Thermotogales species, and ancestral state reconstruction suggests that this pathway was present in the common Thermotogales ancestor. We show that Thermosipho africanus can grow in the absence of vitamin B12, so its de novo pathway is functional. We detected vitamin B12 in the extracts of T. africanus cells to verify the synthetic pathway. Genes in T. africanus with apparent B12 riboswitches were found to be down-regulated in the presence of vitamin B12 consistent with their roles in B12 synthesis and cobinamide salvage. PMID:22798452

  5. The effect of eicosapentaenoic and docosahexaenoic acid on protein synthesis and breakdown in murine C2C12 myotubes

    SciTech Connect

    Kamolrat, Torkamol; Gray, Stuart R.


    Highlights: ► EPA can enhance protein synthesis and retard protein breakdown in muscle cells. ► These effects were concurrent with increases in p70s6k and FOXO3a phosphorylation. ► EPA may be a useful tool in the treatment of muscle wasting conditions. -- Abstract: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been found to stimulate protein synthesis with little information regarding their effects on protein breakdown. Furthermore whether there are distinct effects of EPA and DHA remains to be established. The aim of the current study was to determine the distinct effects of EPA and DHA on protein synthesis, protein breakdown and signalling pathways in C2C12 myotubes. Fully differentiated C2C12 cells were incubated for 24 h with 0.1% ethanol (control), 50 μM EPA or 50 μM DHA prior to experimentation. After serum (4 h) and amino acid (1 h) starvation cells were stimulated with 2 mM L-leucine and protein synthesis measured using {sup 3}H-labelled phenylalanine. Protein breakdown was measured using {sup 3}H-labelled phenylalanine and signalling pathways (Akt, mTOR, p70S6k, 4EBP1, rps6 and FOXO3a) via Western blots. Data revealed that after incubation with EPA protein synthesis was 25% greater (P < 0.05) compared to control cells, with no effect of DHA. Protein breakdown was 22% (P < 0.05) lower, compared to control cells, after incubation with EPA, with no effect of DHA. Analysis of signalling pathways revealed that both EPA and DHA incubation increased (P < 0.05) p70s6k phosphorylation, EPA increased (P < 0.05) FOXO3a phosphorylation, with no alteration in other signalling proteins. The current study has demonstrated distinct effects of EPA and DHA on protein metabolism with EPA showing a greater ability to result in skeletal muscle protein accretion.

  6. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.


    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  7. Transcriptomes of purified gastric ECL and parietal cells: identification of a novel pathway regulating acid secretion.


    Lambrecht, Nils W G; Yakubov, Iskandar; Zer, Cindy; Sachs, George


    The gastric entero-chromaffin-like (ECL) cell plays a key regulatory role in peripheral regulation of acid secretion due to the release of histamine that stimulates acid secretion by the parietal cell. Studies in intact animals, gastric glands, and isolated cells after short-term culture have shown expression of stimulatory CCK2 and PAC1 and inhibitory SST2 and Gal1 receptors as well as histidine decarboxylase. However, the pattern of its gene expression as a neuroendocrine cell has not been explored. Comparison of gene expression by 95% pure ECL cells obtained by density gradient, elutriation, and fluorescence-assisted cell sorting with isolates of the intact fundic gastric epithelium (i.e., "subtractive hybridization") identified a variety of additional expressed gene families characteristic of this neuroendocrine cell. These include genes 1) involved in neuropeptide synthesis and secretory vesicle exocytosis, 2) involved in control of inflammation, 3) implicated in healing of the epithelium, 4) encoding inhibitory Gi protein-coupled receptors, 5) playing a role in neuroendocrine regulation of food intake, and 6) encoding proteins likely involved in maintenance of circadian rhythm, in addition to the ECL cell-specific genes histidine decarboxylase and monoamine transporter. Particularly, the inhibitory apelin receptor gene, APJ, was highly expressed in the ECL cell preparation. Because parietal cells express apelin, immunohistochemical and functional studies showed that there is an inhibitory feed back loop between the parietal and ECL cell during gastrin stimulation, providing evidence for a novel pathway of downregulation of acid secretion due to interaction between these two cell types.

  8. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.


    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  9. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet


    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  10. Effects of metabolic pathway precursors and polydimethylsiloxane (PDMS) on poly-(gamma)-glutamic acid production by Bacillus subtilis BL53.


    de Cesaro, Alessandra; da Silva, Suse Botelho; Ayub, Marco Antônio Záchia


    The aims of this study were to evaluate the effects of the addition of metabolic precursors and polydimethylsiloxane (PDMS) as an oxygen carrier to cultures of Bacillus subtilis BL53 during the production of γ-PGA. Kinetics analyses of cultivations of different media showed that B. subtilis BL53 is an exogenous glutamic acid-dependent strain. When the metabolic pathway precursors of γ-PGA synthesis, L-glutamine and a-ketoglutaric acid, were added to the culture medium, production of the biopolymer was increased by 20 % considering the medium without these precursors. The addition of 10 % of the oxygen carrier PDMS to cultures caused a two-fold increase in the volumetric oxygen mass transfer coefficient (kLa), improving γ-PGA production and productivity. Finally, bioreactor cultures of B. subtilis BL53 adopting the combination of optimized medium E, added of glutamine, α-ketoglutaric acid, and PDMS, showed a productivity of 1 g L(-1) h(-1) of g-PGA after only 24 h of cultivation. Results of this study suggest that the use of metabolic pathway precursors glutamine and a-ketolgutaric acid, combined with the addition of PDMS as an oxygen carrier in bioreactors, can improve γ-PGA production and productivity by Bacillus strains .

  11. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  12. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.

    PubMed Central

    Brandl, M T; Lindow, S E


    Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cultures supplemented with L-tryptophan. The deduced amino acid sequence of the gene product has high similarity to that of the indolepyruvate decarboxylase of Enterobacter cloacae. Regions within pyruvate decarboxylases of various fungal and plant species also exhibited considerable homology to portions of this gene. This gene therefore presumably encodes an indolepyruvate decarboxylase (IpdC) which catalyzes the conversion of indole-3-pyruvic acid to indole-3-acetaldehyde. Insertions of Tn3-spice within ipdC abolished the ability of strain 299R to synthesize indole-3-acetaldehyde and tryptophol and reduced its IAA production in tryptophan-supplemented minimal medium by approximately 10-fold, thus providing genetic evidence for the role of the indolepyruvate pathway in IAA synthesis in this strain. An ipdC probe hybridized strongly with the genomic DNA of all E. herbicola strains tested in Southern hybridization studies, suggesting that the indolepyruvate pathway is common in this species. Maximum parsimony analysis revealed that the ipdC gene is highly conserved within this group and that strains of diverse geographic origin were very similar with respect to ipdC. PMID:8900003

  13. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.


    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying


    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  14. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology


    Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer PRINCIPAL INVESTIGATOR: Francis P. Kuhajda, M.D. CONTRACTING ORGANIZATION...SUBTITLE 5. FUNDING NUMBERS Xenograft Studies of Fatty Acid Synthesis DAMD17-96-1-6235 Inhibition as Novel Therapy for Breast Cancer 6. AUTHOR(S...5012. 13. ABSTRACT (Maximum 200 Words) This grant proposed to study the effect of fatty acid synthesis inhibition in human breast cancer xenografts

  15. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology


    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  16. Fatty acid synthesis and generation of glycerol-3-phosphate in brown adipose tissue from rats fed a cafeteria diet.


    Chaves, Valéria E; Frasson, Danúbia; Martins-Santos, Maria E S; Navegantes, Luiz C C; Galban, Victor D; Garófalo, Maria A R; Kettelhut, Isis C; Migliorini, Renato H


    In vivo fatty acid synthesis and the pathways of glycerol-3-phosphate (G3P) production were investigated in brown adipose tissue (BAT) from rats fed a cafeteria diet for 3 weeks. In spite of BAT activation, the diet promoted an increase in the carcass fatty acid content. Plasma insulin levels were markedly increased in cafeteria diet-fed rats. Two insulin-sensitive processes, in vivo fatty acid synthesis and in vivo glucose uptake (which was used to evaluate G3P generation via glycolysis) were increased in BAT from rats fed the cafeteria diet. Direct glycerol phosphorylation, evaluated by glycerokinase (GyK) activity and incorporation of [U-14C]glycerol into triacylglycerol (TAG)-glycerol, was also markedly increased in BAT from these rats. In contrast, the cafeteria diet induced a marked reduction of BAT glyceroneogenesis, evaluated by phosphoenolpyruvate carboxykinase-C activity and incorporation of [1-14C]pyruvate into TAG-glycerol. BAT denervation resulted in an approximately 50% reduction of GyK activity, but did not significantly affect BAT in vivo fatty acid synthesis, in vivo glucose uptake, or glyceroneogenesis. The data suggest that the supply of G3P for BAT TAG synthesis can be adjusted independently from the sympathetic nervous system and solely by reciprocal changes in the generation of G3P via glycolysis and via glyceroneogenesis, with no participation of direct phosphorylation of glycerol by GyK.

  17. Down regulation of gene related sex hormone synthesis pathway in mouse testes by miroestrol and deoxymiroestrol.


    Udomsuk, Latiporn; Juengwatanatrakul, Thaweesak; Putalun, Waraporn; Jarukamjorn, Kanokwan


    Miroestrol and deoxymiroestrol are phytoestrogens isolated from tuberous root of Pueraria candollei var. mirifica. Modulatory effects of miroestrol and deoxymiroestrol on enzymes involved in sex-hormone synthesis pathway in male C57BL/6 mice were investigated using semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR). Miroestrol and deoxymiroestrol suppressed the expressions of 3β-HSD, 17β-HSD1, and CYP17 while CYP19 mRNA expression was slightly decreased. In addition, the expression of 17β-HSD2 was induced in correlation with those did by estradiol. These observations supported that miroestrol and deoxymiroestrol could exhibit the same effect as estradiol regarding regulation of testicular gene related sex hormone synthesis pathway.

  18. Loss of glycogen debranching enzyme AGL drives bladder tumor growth via induction of hyaluronic acid synthesis

    PubMed Central

    Guin, Sunny; Ru, Yuanbin; Agarwal, Neeraj; Lew, Carolyn R.; Owens, Charles; Comi, Giacomo P.; Theodorescu, Dan


    Purpose We demonstrated that Amylo-alpha-1-6-glucosidase-4-alpha-glucanotransferase (AGL) is a tumor growth suppressor and prognostic marker in human bladder cancer. Here we determine how AGL loss enhances tumor growth, hoping to find therapeutically tractable targets/pathways that could be used in patients with low AGL expressing tumors. Experimental Design We transcriptionally profiled bladder cell lines with different AGL expression. By focusing on transcripts overexpressed as a function of low AGL and associated with adverse clinicopathologic variables in human bladder tumors, we sought to increase the chances of discovering novel therapeutic opportunities. Results One such transcript was hyaluronic acid synthase 2 (HAS2), an enzyme responsible for hyaluronic acid (HA) synthesis. HAS2 expression was inversely proportional to that of AGL in bladder cancer cells and immortalized and normal urothelium. HAS2 driven HA synthesis was enhanced in bladder cancer cells with low AGL and this drove anchorage dependent and independent growth. siRNA mediated depletion of HAS2 or inhibition of HA synthesis by 4-Methylumbelliferone (4MU) abrogated in vitro and xenograft growth of bladder cancer cells with low AGL. AGL and HAS2 mRNA expression in human tumors was inversely correlated in patient datasets. Patients with high HAS2 and low AGL tumor mRNA expression had poor survival lending clinical support to xenograft findings that HAS2 drives growth of tumors with low AGL. Conclusion Our study establishes HAS2 mediated HA synthesis as a driver of growth of bladder cancer with low AGL and provides preclinical rationale for personalized targeting of HAS2/HA signaling in patients with low AGL expressing tumors. PMID:26490312

  19. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.


    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali


    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  20. Enhancement of arachidonic acid signaling pathway by nicotinic acid receptor HM74A.


    Tang, Yuting; Zhou, Lubing; Gunnet, Joseph W; Wines, Pamela G; Cryan, Ellen V; Demarest, Keith T


    HM74A is a G protein-coupled receptor for nicotinic acid (niacin), which has been used clinically to treat dyslipidemia for decades. The molecular mechanisms whereby niacin exerts its pleiotropic effects on lipid metabolism remain largely unknown. In addition, the most common side effect in niacin therapy is skin flushing that is caused by prostaglandin release, suggesting that the phospholipase A(2) (PLA(2))/arachidonic acid (AA) pathway is involved. Various eicosanoids have been shown to activate peroxisome-proliferator activated receptors (PPAR) that play a diverse array of roles in lipid metabolism. To further elucidate the potential roles of HM74A in mediating the therapeutic effects and/or side effects of niacin, we sought to explore the signaling events upon HM74A activation. Here we demonstrated that HM74A synergistically enhanced UTP- and bradykinin-mediated AA release in a pertussis toxin-sensitive manner in A431 cells. Activation of HM74A also led to Ca(2+)-mobilization and enhanced bradykinin-promoted Ca(2+)-mobilization through Gi protein. While HM74A increased ERK1/2 activation by the bradykinin receptor, it had no effects on UTP-promoted ERK1/2 activation.Furthermore, UTP- and bradykinin-mediated AA release was significantly decreased in the presence of both MAPK kinase inhibitor PD 098059 and PKC inhibitor GF 109203X. However, the synergistic effects of HM74A were not dramatically affected by co-treatment with both inhibitors, indicating the cross-talk occurred at the receptor level. Finally, stimulation of A431 cells transiently transfected with PPRE-luciferase with AA significantly induced luciferase activity, mimicking the effects of PPARgamma agonist rosiglitazone, suggesting that alteration of AA signaling pathway can regulate gene expression via endogenous PPARs.

  1. Enhancement of arachidonic acid signaling pathway by nicotinic acid receptor HM74A

    SciTech Connect

    Tang, Yuting . E-mail:; Zhou, Lubing; Gunnet, Joseph W.; Wines, Pamela G.; Cryan, Ellen V.; Demarest, Keith T.


    HM74A is a G protein-coupled receptor for nicotinic acid (niacin), which has been used clinically to treat dyslipidemia for decades. The molecular mechanisms whereby niacin exerts its pleiotropic effects on lipid metabolism remain largely unknown. In addition, the most common side effect in niacin therapy is skin flushing that is caused by prostaglandin release, suggesting that the phospholipase A{sub 2} (PLA{sub 2})/arachidonic acid (AA) pathway is involved. Various eicosanoids have been shown to activate peroxisome-proliferator activated receptors (PPAR) that play a diverse array of roles in lipid metabolism. To further elucidate the potential roles of HM74A in mediating the therapeutic effects and/or side effects of niacin, we sought to explore the signaling events upon HM74A activation. Here we demonstrated that HM74A synergistically enhanced UTP- and bradykinin-mediated AA release in a pertussis toxin-sensitive manner in A431 cells. Activation of HM74A also led to Ca{sup 2+}-mobilization and enhanced bradykinin-promoted Ca{sup 2+}-mobilization through Gi protein. While HM74A increased ERK1/2 activation by the bradykinin receptor, it had no effects on UTP-promoted ERK1/2 activation.Furthermore, UTP- and bradykinin-mediated AA release was significantly decreased in the presence of both MAPK kinase inhibitor PD 098059 and PKC inhibitor GF 109203X. However, the synergistic effects of HM74A were not dramatically affected by co-treatment with both inhibitors, indicating the cross-talk occurred at the receptor level. Finally, stimulation of A431 cells transiently transfected with PPRE-luciferase with AA significantly induced luciferase activity, mimicking the effects of PPAR{gamma} agonist rosiglitazone, suggesting that alteration of AA signaling pathway can regulate gene expression via endogenous PPARs.

  2. Regulation of the salvage pathway of deoxynucleotides synthesis in apoptosis induced by growth factor deprivation.

    PubMed Central

    Oliver, F J; Collins, M K; López-Rivas, A


    Here we describe changes in dNTP metabolism that precede DNA fragmentation in a model of apoptosis driven by deprivation of the cytokine interleukin 3 (IL-3). In haemopoietic BAF3 cells, IL-3 withdrawal leads to a rapid decrease in the size of dATP, dTTP and dGTP pools without affecting dCTP levels. This imbalance in dNTP pools precedes DNA fragmentation and is accompanied by down-regulation of enzymes controlling the de novo and salvage pathways of dNTP synthesis, ribonucleotide reductase and thymidine kinase (TK) respectively. Readdition of IL-3 results in a rapid, protein synthesis-independent restoration of normal dNTP pools, enhanced TK activity and increased precursor incorporation through the salvage pathway. Up-regulation of TK activity after IL-3 readdition is prevented by the protein kinase C (PKC) inhibitor staurosporin, but not by tyrosine kinase inhibitors. Furthermore activation of PKC by phorbol esters mimics the stimulatory effect of IL-3 on TK activity, suggesting that PKC might be involved in regulating this effect. These results indicate that regulation by IL-3 of the salvage pathway of dNTP synthesis plays a role in the maintenance of cellular dNTP pool balance and suggests that alterations in dNTP metabolism after IL-3 deprivation could be a relevant event in the commitment of haemopoietic cells to apoptosis. PMID:8687383

  3. Synthesis and biological activity of novel deoxycholic acid derivatives.


    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F


    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  4. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.


    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia


    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  5. Engineering rTCA pathway and C4-dicarboxylate transporter for L-malic acid production.


    Chen, Xiulai; Wang, Yuancai; Dong, Xiaoxiang; Hu, Guipeng; Liu, Liming


    L-Malic acid is an important component of a vast array of food additives, antioxidants, disincrustants, pharmaceuticals, and cosmetics. Here, we presented a pathway optimization strategy and a transporter modification approach to reconstruct the L-malic acid biosynthesis pathway and transport system, respectively. First, pyruvate carboxylase (pyc) and malate dehydrogenase (mdh) from Aspergillus flavus and Rhizopus oryzae were combinatorially overexpressed to construct the reductive tricarboxylic acid (rTCA) pathway for L-malic acid biosynthesis. Second, the L-malic acid transporter (Spmae) from Schizosaccharomyces pombe was engineered by removing the ubiquitination motification to enhance the L-malic acid efflux system. Finally, the L-malic acid pathway was optimized by controlling gene expression levels, and the final L-malic acid concentration, yield, and productivity were up to 30.25 g L(-1), 0.30 g g(-1), and 0.32 g L(-1) h(-1) in the resulting strain W4209 with CaCO3 as a neutralizing agent, respectively. In addition, these corresponding parameters of pyruvic acid remained at 30.75 g L(-1), 0.31 g g(-1), and 0.32 g L(-1) h(-1), respectively. The metabolic engineering strategy used here will be useful for efficient production of L-malic acid and other chemicals.

  6. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.


    Kitadai, Norio


    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  7. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio


    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  8. Sorbic acid stress activates the Candida glabrata high osmolarity glycerol MAP kinase pathway

    PubMed Central

    Jandric, Zeljkica; Gregori, Christa; Klopf, Eva; Radolf, Martin; Schüller, Christoph


    Weak organic acids such as sorbic acid are important food preservatives and powerful fungistatic agents. These compounds accumulate in the cytosol and disturb the cellular pH and energy homeostasis. Candida glabrata is in many aspects similar to Saccharomyces cerevisiae. However, with regard to confrontation to sorbic acid, two of the principal response pathways behave differently in C. glabrata. In yeast, sorbic acid stress causes activation of many genes via the transcription factors Msn2 and Msn4. The C. glabrata homologs CgMsn2 and CgMsn4 are apparently not activated by sorbic acid. In contrast, in C. glabrata the high osmolarity glycerol (HOG) pathway is activated by sorbic acid. Here we show that the MAP kinase of the HOG pathway, CgHog1, becomes phosphorylated and has a function for weak acid stress resistance. Transcript profiling of weak acid treated C. glabrata cells suggests a broad and very similar response pattern of cells lacking CgHog1 compared to wild type which is over lapping with but distinct from S. cerevisiae. The PDR12 gene was the highest induced gene in both species and it required CgHog1 for full expression. Our results support flexibility of the response cues for general stress signaling pathways, even between closely related yeasts, and functional extension of a specific response pathway. PMID:24324463

  9. Direct biosynthesis of adipic acid from a synthetic pathway in recombinant Escherichia coli.


    Yu, Jia-Le; Xia, Xiao-Xia; Zhong, Jian-Jiang; Qian, Zhi-Gang


    The C6 dicarboxylic acid, adipic acid, is an important platform chemical in industry. Biobased production of adipic acid is a promising alternative to the current petrochemical route. Here, we report biosynthesis of adipic acid using an artificial pathway inspired by the reversal of beta-oxidation of dicarboxylic acids. The biosynthetic pathway comprises condensation of acetyl-CoA and succinyl-CoA to form the C6 backbone and subsequent reduction, dehydration, hydrogenation, and release of adipic acid from its thioester. The pathway was first tested in vitro with reconstituted pathway enzymes and then functionally introduced into Escherichia coli for the biosynthesis and excretion of adipic acid into the culture medium. The production titer was increased by approximately 20-fold through the combination of recruiting enzymes that were more suitable to catalyze the synthetic reactions and increasing availability of the condensation substrates. This work demonstrates direct biosynthesis of adipic acid via non-natural synthetic pathway, which may enable its renewable production.

  10. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  11. Arginine-dependent acid-resistance pathway in Shigella boydii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ability to survive the low pH of the human stomach is considered be an important virulent determinant. Acid tolerance of Shigella boydii 18 CDPH, the strain implicated in an outbreak may have played an important role in surviving the acidic food (bean salad). The strain was capable of inducing arg...

  12. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.


    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G


    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  13. Effect of acetate formation pathway and long chain fatty acid CoA-ligase on the free fatty acid production in E. coli expressing acy-ACP thioesterase from Ricinus communis.


    Li, Mai; Zhang, Xiujun; Agrawal, Arpita; San, Ka-Yiu


    Microbial biosynthesis of fatty acid like chemicals from renewable carbon sources has attracted significant attention in recent years. Free fatty acids can be used as precursors for the production of fuels or chemicals. Wild type E. coli strains produce fatty acids mainly for the biosynthesis of lipids and cell membranes and do not accumulate free fatty acids as intermediates in lipid biosynthesis. However, free fatty acids can be produced by breaking the fatty acid elongation through the overexpression of an acyl-ACP thioesterase. Since acetyl-CoA might be an important factor for fatty acid synthesis (acetate formation pathways are the main competitive pathways in consuming acetyl-CoA or pyruvate, a precursor of acetyl-CoA), and the long chain fatty acid CoA-ligase (FadD) plays a pivotal role in the transport and activation of exogenous fatty acids prior to their subsequent degradation, we examined the composition and the secretion of the free fatty acids in four different strains including the wild type MG1655, a mutant strain with inactivation of the fatty acid beta-oxidation pathway (fadD mutant (ML103)), and mutant strains with inactivation of the two major acetate production pathways (an ack-pta (acetate kinase/phosphotransacetylase), poxB (pyruvate oxidase) double mutant (ML112)) and a fadD, ack-pta, poxB triple mutant (ML115). The engineered E. coli cells expressing acyl-ACP thioesterase with glucose yield is higher than 40% of theoretical yield. Compared to MG1655(pXZ18) and ML103(pXZ18), acetate forming pathway deletion strains such as ML112(pXZ18) and ML115(pXZ18) produced similar quantity of total free fatty acids, which indicated that acetyl-CoA availability does not appear to be limiting factor for fatty acid production in these strains. However, these strains did show significant differences in the composition of free fatty acids. Different from MG1655(pXZ18) and ML103(pXZ18), acetate formation pathway deletion strains such as ML112(pXZ18) and ML115

  14. [Construction and fermentation control of reductive TCA pathway for malic acid production in Saccharomyces cerevisiae].


    Yan, Daojiang; Wang, Caixia; Zhou, Jiemin; Liu, Yilan; Yang, Maohua; Xing, Jianmin


    Malic acid is widely used in food, and chemical industries. Through overexpressing pyruvate carboxylase and malate dehydrogenase in pdc1-deficient Saccharomyces cerevisiae, malic acid was successfully produced through the reductive TCA pathway. No malic acid was detected in wild type Saccharomyces cerevisiae, however, 45 mmol/L malic acid was produced in engineered strain, and the concentration of byproduct ethanol also reduced by 18%. The production of malic acid enhanced 6% by increasing the concentration of Ca2+. In addition, the final concentration reached 52.5 mmol/L malic acid by addition of biotin. The increasing is almost 16% higher than that of the original strain.

  15. New insights into the regulation of plant immunity by amino acid metabolic pathways.


    Zeier, Jürgen


    Besides defence pathways regulated by classical stress hormones, distinct amino acid metabolic pathways constitute integral parts of the plant immune system. Mutations in several genes involved in Asp-derived amino acid biosynthetic pathways can have profound impact on plant resistance to specific pathogen types. For instance, amino acid imbalances associated with homoserine or threonine accumulation elevate plant immunity to oomycete pathogens but not to pathogenic fungi or bacteria. The catabolism of Lys produces the immune signal pipecolic acid (Pip), a cyclic, non-protein amino acid. Pip amplifies plant defence responses and acts as a critical regulator of plant systemic acquired resistance, defence priming and local resistance to bacterial pathogens. Asp-derived pyridine nucleotides influence both pre- and post-invasion immunity, and the catabolism of branched chain amino acids appears to affect plant resistance to distinct pathogen classes by modulating crosstalk of salicylic acid- and jasmonic acid-regulated defence pathways. It also emerges that, besides polyamine oxidation and NADPH oxidase, Pro metabolism is involved in the oxidative burst and the hypersensitive response associated with avirulent pathogen recognition. Moreover, the acylation of amino acids can control plant resistance to pathogens and pests by the formation of protective plant metabolites or by the modulation of plant hormone activity.

  16. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.


    Hansen, Alexandar L; Behrman, Edward J


    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  17. Reassembled biosynthetic pathway for large-scale carbohydrate synthesis: alpha-Gal epitope producing "superbug".


    Chen, Xi; Liu, Ziye; Zhang, Jianbo; Zhang, Wei; Kowal, Przemyslaw; Wang, Peng George


    A metabolic pathway engineered Escherichia coli strain (superbug) containing one plasmid harboring an artificial gene cluster encoding all the five enzymes in the biosynthetic pathway of Galalpha l,3Lac through galactose metabolism has been developed. The plasmid contains a lambda promoter, a c1857 repressor gene, an ampicillin resistance gene, and a T7 terminator. Each gene was preceded by a Shine - Dalgarno sequence for ribosome binding. In a reaction catalyzed by the recombinant E. coli strain, Galalpha 1,3Lac trisaccharide accumulated at concentrations of 14.2 mM (7.2 gL(-1)) in a reaction mixture containing galactose, glucose, lactose, and a catalytic amount of uridine 5'-diphosphoglucose. This work demonstrates that large-scale synthesis of complex oligosaccharides can be achieved economically and efficiently through a single, biosynthetic pathway engineered microorganism.

  18. Metabolic Pathways Involved in 2-Methoxyestradiol Synthesis and Their Role in Preeclampsia

    PubMed Central

    Perez-Sepulveda, Alejandra; España-Perrot, Pedro P.; Norwitz, Errol R.


    Preeclampsia (PE) remains a major cause of maternal/fetal morbidity–mortality worldwide. The first stage of PE is characterized by placental hypoxia due to a relative reduction in uteroplacental blood flow, resulting from restricted trophoblast invasion. However, hypoxia is also an essential element for the success of invasion. Under hypoxic conditions, 2-methoxyestradiol (2-ME) could induce the differentiation of cytotrophoblast cells into an invasive phenotype in culture. 2-Methoxyestradiol is generated by catechol-O-methyltransferase, an enzyme involved in the metabolic pathway of estrogens. During pregnancy, circulating 2-ME levels increase significantly when compared to the menstrual cycle. Interestingly, plasma levels of 2-ME are lower in women with PE than in controls, and these differences are apparent weeks or even months before the clinical manifestations of the disease. This article reviews the metabolic pathways involved in 2-ME synthesis and discusses the roles of these pathways in normal and abnormal pregnancies, with particular emphasis on PE. PMID:23456663

  19. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda


    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  20. Constructing de novo biosynthetic pathways for chemical synthesis inside living cells.


    Weeks, Amy M; Chang, Michelle C Y


    Living organisms have evolved a vast array of catalytic functions that make them ideally suited for the production of medicinally and industrially relevant small-molecule targets. Indeed, native metabolic pathways in microbial hosts have long been exploited and optimized for the scalable production of both fine and commodity chemicals. Our increasing capacity for DNA sequencing and synthesis has revealed the molecular basis for the biosynthesis of a variety of complex and useful metabolites and allows the de novo construction of novel metabolic pathways for the production of new and exotic molecular targets in genetically tractable microbes. However, the development of commercially viable processes for these engineered pathways is currently limited by our ability to quickly identify or engineer enzymes with the correct reaction and substrate selectivity as well as the speed by which metabolic bottlenecks can be determined and corrected. Efforts to understand the relationship among sequence, structure, and function in the basic biochemical sciences can advance these goals for synthetic biology applications while also serving as an experimental platform for elucidating the in vivo specificity and function of enzymes and reconstituting complex biochemical traits for study in a living model organism. Furthermore, the continuing discovery of natural mechanisms for the regulation of metabolic pathways has revealed new principles for the design of high-flux pathways with minimized metabolic burden and has inspired the development of new tools and approaches to engineering synthetic pathways in microbial hosts for chemical production.

  1. Constructing de novo biosynthetic pathways for chemical synthesis inside living cells†

    PubMed Central

    Weeks, Amy M.; Chang, Michelle C. Y.


    Living organisms have evolved a vast array of catalytic functions that make them ideally suited for the production of medicinally and industrially relevant small-molecule targets. Indeed, native metabolic pathways in microbial hosts have long been exploited and optimized for the scalable production of both fine and commodity chemicals. Our increasing capacity for DNA sequencing and synthesis has revealed the molecular basis for the biosynthesis of a variety of complex and useful metabolites and enables the de novo construction of novel metabolic pathways for the production of new and exotic molecular targets in genetically tractable microbes. However, the development of commercially viable processes for these engineered pathways is currently limited by our ability to quickly identify or engineer enzymes with the correct reaction and substrate selectivity as well as the speed by which metabolic bottlenecks can be determined and corrected. Efforts in understanding the relationship between sequence, structure, and function in the basic biochemical sciences can advance these goals for synthetic biology applications while also serving as an experimental platform to elucidate the in vivo specificity and function of enzymes and to reconstitute complex biochemical traits for study in a living model organism. Furthermore, the continuing discovery of natural mechanisms for the regulation of metabolic pathways has revealed new principles for the design of high-flux pathways with minimized metabolic burden and has inspired the development of new tools and approaches to engineer synthetic pathways in microbial hosts for chemical production. PMID:21591680

  2. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica


    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  3. Effect of mevalonic acid on cholesterol synthesis in bovine intramuscular and subcutaneous adipocytes.


    Liu, Xiaomu; You, Wei; Cheng, Haijian; Zhang, Qingfeng; Song, Enliang; Wan, Fachun; Han, Hong; Liu, Guifen


    Mevalonic acid (MVA) is a key material in the synthesis of cholesterol; indeed, intracellular cholesterol synthesis is also called the mevalonic acid pathway. 3-Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is an essential enzyme in cholesterol biosynthesis. This study suggests that MVA may play an important role in the differentiation of bovine adipose tissue in vivo. We investigated differential mRNA expression in bovine intramuscular preadipocytes (BIPs) and bovine subcutaneous preadipocytes (BSPs) by culturing cells from the longissimus dorsi muscle and subcutaneous fat tissues of Luxi yellow cattle. The morphology of lipid accumulation of bovine preadipocytes was detected by Oil Red O staining, and total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), and high-density lipoprotein cholesterol (HDLC) levels were measured. Temporospatial expression of HMGR was investigated by real-time quantitative polymerase chain reaction (PCR). The TC, LDLC, and HDLC content did not significantly differ over time but increased slowly with increasing MVA concentration. HMGR expression increased over time and with increasing concentrations of MVA. MVA increased adipose cell proliferation in a dose-dependent and time-dependent manner. MVA stimulated HMGR expression in two cell types and its influence on adipocyte differentiation.

  4. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.


    Cervantes-Madrid, Diana; Dueñas-González, Alfonso


    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors.

  5. Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications.


    Friedrich, Valentin; Janesch, Bettina; Windwarder, Markus; Maresch, Daniel; Braun, Matthias L; Megson, Zoë A; Vinogradov, Evgeny; Goneau, Marie-France; Sharma, Ashu; Altmann, Friedrich; Messner, Paul; Schoenhofen, Ian C; Schäffer, Christina


    Tannerella forsythia is an anaerobic, Gram-negative periodontal pathogen. A unique O-linked oligosaccharide decorates the bacterium's cell surface proteins and was shown to modulate the host immune response. In our study, we investigated the biosynthesis of the nonulosonic acid (NulO) present at the terminal position of this glycan. A bioinformatic analysis of T. forsythia genomes revealed a gene locus for the synthesis of pseudaminic acid (Pse) in the type strain ATCC 43037 while strains FDC 92A2 and UB4 possess a locus for the synthesis of legionaminic acid (Leg) instead. In contrast to the NulO in ATCC 43037, which has been previously identified as a Pse derivative (5-N-acetimidoyl-7-N-glyceroyl-3,5,7,9-tetradeoxy-l-glycero-l-manno-NulO), glycan analysis of strain UB4 performed in this study indicated a 350-Da, possibly N-glycolyl Leg (3,5,7,9-tetradeoxy-d-glycero-d-galacto-NulO) derivative with unknown C5,7 N-acyl moieties. We have expressed, purified and characterized enzymes of both NulO pathways to confirm these genes' functions. Using capillary electrophoresis (CE), CE-mass spectrometry and NMR spectroscopy, our studies revealed that Pse biosynthesis in ATCC 43037 essentially follows the UDP-sugar route described in Helicobacter pylori, while the pathway in strain FDC 92A2 corresponds to Leg biosynthesis in Campylobacter jejuni involving GDP-sugar intermediates. To demonstrate that the NulO biosynthesis enzymes are functional in vivo, we created knockout mutants resulting in glycans lacking the respective NulO. Compared to the wild-type strains, the mutants exhibited significantly reduced biofilm formation on mucin-coated surfaces, suggestive of their involvement in host-pathogen interactions or host survival. This study contributes to understanding possible biological roles of bacterial NulOs.

  6. Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications

    PubMed Central

    Windwarder, Markus; Maresch, Daniel; Braun, Matthias L.; Megson, Zoë A.; Vinogradov, Evgeny; Goneau, Marie-France; Sharma, Ashu; Altmann, Friedrich; Messner, Paul; Schoenhofen, Ian C.; Schäffer, Christina


    Tannerella forsythia is an anaerobic, Gram-negative periodontal pathogen. A unique O-linked oligosaccharide decorates the bacterium’s cell surface proteins and was shown to modulate the host immune response. In our study, we investigated the biosynthesis of the nonulosonic acid (NulO) present at the terminal position of this glycan. A bioinformatic analysis of T. forsythia genomes revealed a gene locus for the synthesis of pseudaminic acid (Pse) in the type strain ATCC 43037 while strains FDC 92A2 and UB4 possess a locus for the synthesis of legionaminic acid (Leg) instead. In contrast to the NulO in ATCC 43037, which has been previously identified as a Pse derivative (5-N-acetimidoyl-7-N-glyceroyl-3,5,7,9-tetradeoxy-l-glycero-l-manno-NulO), glycan analysis of strain UB4 performed in this study indicated a 350-Da, possibly N-glycolyl Leg (3,5,7,9-tetradeoxy-d-glycero-d-galacto-NulO) derivative with unknown C5,7 N-acyl moieties. We have expressed, purified and characterized enzymes of both NulO pathways to confirm these genes’ functions. Using capillary electrophoresis (CE), CE–mass spectrometry and NMR spectroscopy, our studies revealed that Pse biosynthesis in ATCC 43037 essentially follows the UDP-sugar route described in Helicobacter pylori, while the pathway in strain FDC 92A2 corresponds to Leg biosynthesis in Campylobacter jejuni involving GDP-sugar intermediates. To demonstrate that the NulO biosynthesis enzymes are functional in vivo, we created knockout mutants resulting in glycans lacking the respective NulO. Compared to the wild-type strains, the mutants exhibited significantly reduced biofilm formation on mucin-coated surfaces, suggestive of their involvement in host-pathogen interactions or host survival. This study contributes to understanding possible biological roles of bacterial NulOs. PMID:27986835

  7. Opposing effects of bile acids deoxycholic acid and ursodeoxycholic acid on signal transduction pathways in oesophageal cancer cells.


    Abdel-Latif, Mohamed M; Inoue, Hiroyasu; Reynolds, John V


    Ursodeoxycholic acid (UDCA) was reported to reduce bile acid toxicity, but the mechanisms underlying its cytoprotective effects are not fully understood. The aim of the present study was to examine the effects of UDCA on the modulation of deoxycholic acid (DCA)-induced signal transduction in oesophageal cancer cells. Nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) activity was assessed using a gel shift assay. NF-κB activation and translocation was performed using an ELISA-based assay and immunofluorescence analysis. COX-2 expression was analysed by western blotting and COX-2 promoter activity was assessed by luciferase assay. DCA induced NF-κB and AP-1 DNA-binding activities in SKGT-4 and OE33 cells. UDCA pretreatment inhibited DCA-induced NF-κB and AP-1 activation and NF-κB translocation. This inhibitory effect was coupled with a blockade of IκB-α degradation and inhibition of phosphorylation of IKK-α/β and ERK1/2. Moreover, UDCA pretreatment inhibited COX-2 upregulation. Using transient transfection of the COX-2 promoter, UDCA pretreatment abrogated DCA-induced COX-2 promoter activation. In addition, UDCA protected oesophageal cells from the apoptotic effects of deoxycholate. Our findings indicate that UDCA inhibits DCA-induced signalling pathways in oesophageal cancer cells. These data indicate a possible mechanistic role for the chemopreventive actions of UDCA in oesophageal carcinogenesis.

  8. Single-Step Pathway for Synthesis of Glucosylglycerate in Persephonella marina▿

    PubMed Central

    Fernandes, Chantal; Empadinhas, Nuno; da Costa, Milton S.


    A single-step pathway for the synthesis of the compatible solute glucosylglycerate (GG) is proposed based on the activity of a recombinant glucosylglycerate synthase (Ggs) from Persephonella marina. The corresponding gene encoded a putative glycosyltransferase that was part of an operon-like structure which also contained the genes for glucosyl-3-phosphoglycerate synthase (GpgS) and glucosyl-3-phosphoglycerate phosphatase (GpgP), the enzymes that lead to the synthesis of GG through the formation of glucosyl-3-phosphoglycerate. The putative glucosyltransferase gene was expressed in Escherichia coli, and the recombinant product catalyzed the synthesis of GG in one step from ADP-glucose and d-glycerate, with Km values at 70°C of 1.5 and 2.2 mM, respectively. This glucosylglycerate synthase (Ggs) was also able to use GDP- and UDP-glucose as donors to form GG, but the efficiencies were lower. Maximal activity was observed at temperatures between 80 and 85°C, and Mg2+ or Ca2+ was required for catalysis. Ggs activity was maximal and remained nearly constant at pH values between 5.5 and pH 8.0, and the half-lives for inactivation were 74 h at 85°C and 8 min at 100°C. This is the first report of an enzyme catalyzing the synthesis of GG in one step and of the existence of two pathways for GG synthesis in the same organism. PMID:17369297

  9. Evolution of pigment synthesis pathways by gene and genome duplication in fish

    PubMed Central

    Braasch, Ingo; Schartl, Manfred; Volff, Jean-Nicolas


    Background Coloration and color patterning belong to the most diverse phenotypic traits in animals. Particularly, teleost fishes possess more pigment cell types than any other group of vertebrates. As the result of an ancient fish-specific genome duplication (FSGD), teleost genomes might contain more copies of genes involved in pigment cell development than tetrapods. No systematic genomic inventory allowing to test this hypothesis has been drawn up so far for pigmentation genes in fish, and almost nothing is known about the evolution of these genes in different fish lineages. Results Using a comparative genomic approach including phylogenetic reconstructions and synteny analyses, we have studied two major pigment synthesis pathways in teleost fish, the melanin and the pteridine pathways, with respect to different types of gene duplication. Genes encoding three of the four enzymes involved in the synthesis of melanin from tyrosine have been retained as duplicates after the FSGD. In the pteridine pathway, two cases of duplicated genes originating from the FSGD as well as several lineage-specific gene duplications were observed. In both pathways, genes encoding the rate-limiting enzymes, tyrosinase and GTP-cyclohydrolase I (GchI), have additional paralogs in teleosts compared to tetrapods, which have been generated by different modes of duplication. We have also observed a previously unrecognized diversity of gchI genes in vertebrates. In addition, we have found evidence for divergent resolution of duplicated pigmentation genes, i.e., differential gene loss in divergent teleost lineages, particularly in the tyrosinase gene family. Conclusion Mainly due to the FSGD, teleost fishes apparently have a greater repertoire of pigment synthesis genes than any other vertebrate group. Our results support an important role of the FSGD and other types of duplication in the evolution of pigmentation in fish. PMID:17498288

  10. Decreased bile-acid synthesis in livers of hepatocyte-conditional NADPH-cytochrome P450 reductase-null mice results in increased bile acids in serum.


    Cheng, Xingguo; Zhang, Youcai; Klaassen, Curtis D


    NADPH-cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH-cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance-associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice.

  11. Circadian control of bile acid synthesis by a KLF15-Fgf15 axis

    PubMed Central

    Han, Sean (Shuxin); Zhang, Rongli; Jain, Rajan; Shi, Hong; Zhang, Lilei; Zhou, Guangjin; Sangwung, Panjamaporn; Tugal, Derin; Atkins, G. Brandon; Prosdocimo, Domenick A.; Lu, Yuan; Han, Xiaonan; Tso, Patrick; Liao, Xudong; Epstein, Jonathan A.; Jain, Mukesh K.


    Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15 signalling axis that regulates circadian BA production. Systemic Klf15 deficiency disrupted circadian expression of key BA synthetic enzymes, tissue BA levels and triglyceride/cholesterol absorption. Studies in liver-specific Klf15-knockout mice suggested a non-hepatic basis for regulation of BA production. Ileal Fgf15 is a potent inhibitor of BA synthesis. Using a combination of biochemical, molecular and functional assays (including ileectomy and bile duct catheterization), we identify KLF15 as the first endogenous negative regulator of circadian Fgf15 expression. Elucidation of this novel pathway controlling circadian BA production has important implications for physiologic control of nutrient availability and metabolic homeostasis. PMID:26040986

  12. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E


    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  13. Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways

    NASA Astrophysics Data System (ADS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.


    Stable hydrogen, carbon, and nitrogen isotopic ratios (δD, δ13C, and δ15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing δ13C and increasing δD with increasing carbon number in the α-H, α-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light δ13C signatures for β-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ω-amino acids). Higher deuterium enrichments are observed in α-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

  14. Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways

    NASA Technical Reports Server (NTRS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.


    Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

  15. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.


    Fujioka, T; Tsujita, Y; Shimotsu, H


    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  16. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters


    Moens, Luc


    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  17. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.


    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki


    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  18. Co-opting the Fanconi anemia genomic stability pathway enables herpesvirus DNA synthesis and productive growth.


    Karttunen, Heidi; Savas, Jeffrey N; McKinney, Caleb; Chen, Yu-Hung; Yates, John R; Hukkanen, Veijo; Huang, Tony T; Mohr, Ian


    DNA damage associated with viral DNA synthesis can result in double-strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi anemia (FA) genomic stability pathway is exploited by herpes simplex virus 1 (HSV-1) to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV-1-infected cells resulted in monoubiquitination of FA effector proteins FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments, and FANCI-D2 interacted with a multisubunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, whereas HSV-1 productive growth was impaired in monoubiquitination-defective FA cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for nonhomologous end-joining (NHEJ). This identifies the FA-pathway as a cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral life cycle.

  19. Harnessing Intracellular Biochemical Pathways for In Vitro Synthesis of Designer Tellurium Nanorods.


    Xiong, Ling-Hong; Cui, Ran; Zhang, Zhi-Ling; Tu, Jia-Wei; Shi, Yun-Bo; Pang, Dai-Wen


    Synthesizing nanomaterials of desired properties is a big challenge, which requires extremely harsh conditions and/or use of toxic materials. More recently developed in vivo methods have brought a different set of problems such as separation and purification of nanomaterials made in vivo. Here, a novel approach that harnesses cellular pathways for in vitro synthesis of high-quality tellurium nanorods with tunable lengths and optical properties is reported. It is first demonstrated that in vivo biochemical pathways could be used to synthesize Te nanorods via the intracellular reduction of TeO3(2-) in living Staphylococcus aureus cells. The pathways to set up a quasi-biological system for Te precursor formation are then utilized, which could further synthesize Te nanorods in vitro. This allows to successfully synthesize in vitro, under routine laboratory conditions, Te nanorods with uniform and tunable lengths, ranging from about 10 to 200 nm, and controllable optical properties with high molar extinction coefficients. The approach here should open new avenues for controllable, facile, and efficient synthesis of designer nanomaterials for diverse industrial and biomedical applications.

  20. Co-opting the Fanconi Anemia Genomic Stability Pathway Enables Herpesvirus DNA Synthesis and Productive Growth

    PubMed Central

    Karttunen, Heidi; Savas, Jeffrey N.; McKinney, Caleb; Chen, Yu-Hung; Yates, John R.; Hukkanen, Veijo; Huang, Tony T.; Mohr, Ian


    SUMMARY DNA damage associated with viral DNA synthesis can result in double strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi Anemia (FA) genomic stability pathway is exploited by HSV1 to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV1-infected cells resulted in monoubiquitination of FA effector proteins, FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments and FANCI-D2 interacted with a multi-subunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, while HSV1 productive growth was impaired in monoubiquitination-defective FA patient cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for non-homologous end-joining (NHEJ). This identifies the FA-pathway as a new cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral lifecycle. PMID:24954902

  1. Direct vs. indirect pathway of hepatic glycogen synthesis as a function of glucose infusion rate

    SciTech Connect

    Bagby, G.J.; Lang, C.H.; Johnson, J.L.; Blakesly, H.L.; Spitzer, J.J.


    This study was initiated to determine the influence of the rate of exogenous glucose administration on liver glycogen synthesis by the direct (glucose uptake and incorporation into glycogen) vs the indirect pathway (glucose degradation to 3-carbon intermediates, e.g., lactate, prior to incorporation into glycogen). Catheterized rats were fasted 2 days prior to receiving a 3 hr infusion of glucose at rates of 0 to 230 containing tracer (6-/sup 3/H)- and (U-/sup 14/C)-glucose. Plasma glucose (r = 0.80), insulin (r = 0.90) and lactate (r = 0.84) were correlated with glucose infusion rate. The rate of liver glycogen deposition (0.46 +/- 0.03 did not differ between a glucose infusion rate of 20 and 230 At the lowest and highest glucose infusion rates hepatic glycogenesis accounted for 87 +/- 6 and 9 +/- 1% of the total glucose load, respectively. The percent contribution of the direct pathways to glycogen deposition ((/sup 3/H) specific activity in hepatic glycogen/(/sup 3/H) specific activity in plasma glucose) increased from 16 +/- 3 to 83 +/- 5% from lowest to highest glucose infusion rates (prevailing plasma glucose concentrations: 9 +/- 1 and 21 +/- 2 mM, respectively). The results indicate that the relative contribution of the direct and indirect pathways of glucogen synthesis are dependent upon the glucose load or plasma glucose concentration.

  2. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.


    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A


    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  3. PHOSPHATIDIC ACID PHOSPHOHYDROLASE1 and 2 Regulate Phospholipid Synthesis at the Endoplasmic Reticulum in Arabidopsis[W

    PubMed Central

    Eastmond, Peter J.; Quettier, Anne-Laure; Kroon, Johan T.M.; Craddock, Christian; Adams, Nicolette; Slabas, Antoni R.


    Phospholipid biosynthesis is essential for the construction of most eukaryotic cell membranes, but how this process is regulated in plants remains poorly understood. Here, we show that in Arabidopsis thaliana, two Mg2+-dependent phosphatidic acid phosphohydrolases called PAH1 and PAH2 act redundantly to repress phospholipid biosynthesis at the endoplasmic reticulum (ER). Leaves from pah1 pah2 double mutants contain ~1.8-fold more phospholipid than the wild type and exhibit gross changes in ER morphology, which are consistent with massive membrane overexpansion. The net rate of incorporation of [methyl-14C]choline into phosphatidylcholine (PC) is ~1.8-fold greater in the double mutant, and the transcript abundance of several key genes that encode enzymes involved in phospholipid synthesis is increased. In particular, we show that PHOSPHORYLETHANOLAMINE N-METHYLTRANSFERASE1 (PEAMT1) is upregulated at the level of transcription in pah1 pah2 leaves. PEAMT catalyzes the first committed step of choline synthesis in Arabidopsis and defines a variant pathway for PC synthesis not found in yeasts or mammals. Our data suggest that PAH1/2 play a regulatory role in phospholipid synthesis that is analogous to that described in Saccharomyces cerevisiae. However, the target enzymes differ, and key components of the signal transduction pathway do not appear to be conserved. PMID:20699392

  4. Apigenin induces dermal collagen synthesis via smad2/3 signaling pathway.


    Zhang, Y; Wang, J; Cheng, X; Yi, B; Zhang, X; Li, Q


    Decrease in fibroblast-produced collagen has been proven to be the pivotal cause of skin aging, but there is no satisfactory drug which directly increases dermal thickness and collage density. Here we found that a flavonoid natural product, apigenin, could significantly increase collagen synthesis. NIH/3T3 and primary human dermal fibroblasts (HDFs) were incubated with various concentrations of apigenin, with dimethyl sulfoxide (DMSO) serving as the negative control. Real-time reverse-transcription polymerase chain reaction (PCR), Western Blot, and Toluidine blue staining demonstrated that apigenin stimulated type-I and type-III collagen synthesis of fibroblasts on the mRNA and protein levels. Meanwhile, apigenin did not induce expression of alpha smooth muscle actin (α-SMA) in vitro and in vivo, a fibrotic marker in living tissues. Then the production of collagen was confirmed by Masson's trichrome stain, Picrosirius red stain and immunohistochemistry in mouse models. We also clarified that this compound induced collagen synthesis by activating smad2/3 signaling pathway. Taken together, without obvious influence on fibroblasts' apoptosis and viability, apigenin could promote the type-I and type-III collagen synthesis of dermal fibroblasts in vitro and in vivo, thus suggesting that apigenin may serve as a potential agent for esthetic and reconstructive skin rejuvenation.

  5. Apigenin Induces Dermal Collagen Synthesis Via smad2/3 Signaling Pathway

    PubMed Central

    Zhang, Y.; Wang, J.; Cheng, X.; Yi, B.; Zhang, X.; Li, Q.


    Decrease in fibroblast-produced collagen has been proven to be the pivotal cause of skin aging, but there is no satisfactory drug which directly increases dermal thickness and collage density. Here we found that a flavonoid natural product, apigenin, could significantly increase collagen synthesis. NIH/3T3 and primary human dermal fibroblasts (HDFs) were incubated with various concentrations of apigenin, with dimethyl sulfoxide (DMSO) serving as the negative control. Real-time reverse-transcription polymerase chain reaction (PCR), Western Blot, and Toluidine blue staining demonstrated that apigenin stimulated type-I and type-III collagen synthesis of fibroblasts on the mRNA and protein levels. Meanwhile, apigenin did not induce expression of alpha smooth muscle actin (α-SMA) in vitro and in vivo, a fibrotic marker in living tissues. Then the production of collagen was confirmed by Masson’s trichrome stain, Picrosirius red stain and immunohistochemistry in mouse models. We also clarified that this compound induced collagen synthesis by activating smad2/3 signaling pathway. Taken together, without obvious influence on fibroblasts’ apoptosis and viability, apigenin could promote the type-I and type-III collagen synthesis of dermal fibroblasts in vitro and in vivo, thus suggesting that apigenin may serve as a potential agent for esthetic and reconstructive skin rejuvenation. PMID:26150153

  6. Nuclear factor erythroid 2-related factor 2 facilitates neuronal glutathione synthesis by upregulating neuronal excitatory amino acid transporter 3 expression.


    Escartin, Carole; Won, Seok Joon; Malgorn, Carole; Auregan, Gwennaelle; Berman, Ari E; Chen, Pei-Chun; Déglon, Nicole; Johnson, Jeffrey A; Suh, Sang Won; Swanson, Raymond A


    Astrocytes support neuronal antioxidant capacity by releasing glutathione, which is cleaved to cysteine in brain extracellular space. Free cysteine is then taken up by neurons through excitatory amino acid transporter 3 [EAAT3; also termed Slc1a1 (solute carrier family 1 member 1)] to support de novo glutathione synthesis. Activation of the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant responsive element (ARE) pathway by oxidative stress promotes astrocyte release of glutathione, but it remains unknown how this release is coupled to neuronal glutathione synthesis. Here we evaluated transcriptional regulation of the neuronal cysteine transporter EAAT3 by the Nrf2-ARE pathway. Nrf2 activators and Nrf2 overexpression both produced EAAT3 transcriptional activation in C6 cells. A conserved ARE-related sequence was found in the EAAT3 promoter of several mammalian species. This ARE-related sequence was bound by Nrf2 in mouse neurons in vivo as observed by chromatin immunoprecipitation. Chemical activation of the Nrf2-ARE pathway in mouse brain increased both neuronal EAAT3 levels and neuronal glutathione content, and these effects were abrogated in mice genetically deficient in either Nrf2 or EAAT3. Selective overexpression of Nrf2 in brain neurons by lentiviral gene transfer was sufficient to upregulate both neuronal EAAT3 protein and glutathione content. These findings identify a mechanism whereby Nrf2 activation can coordinate astrocyte glutathione release with neuronal glutathione synthesis through transcriptional upregulation of neuronal EAAT3 expression.

  7. Omega-6 and omega-3 fatty acids metabolism pathways in the body of pigs fed diets with different sources of fatty acids.


    Skiba, Grzegorz; Poławska, Ewa; Sobol, Monika; Raj, Stanisława; Weremko, Dagmara


    This study was carried out on 24 gilts (♀ Polish Large White × ♂ Danish Landrace) grown with body weight (BW) of 60 to 105 kg. The pigs were fed diets designed on the basis of a standard diet (appropriate for age and BW of pigs) where a part of the energy content was replaced by different fat supplements: linseed oil in Diet L, rapeseed oil in Diet R and fish oil in Diet F (6 gilts per dietary treatment). The fat supplements were sources of specific fatty acids (FA): in Diet L α-linolenic acid (C18:3 n-3, ALA); in Diet R linoleic acid (C18:2 n-6, LA) and in Diet F eicosapentaenoic acid (C20:5 n-3, EPA), docosapentaenoic acid (C22:5 n-3, DPA) and docosahexaenoic acid (C22:6 n-3, DHA). The protein, fat and total FA contents in the body did not differ among groups of pigs. The enhanced total intake of LA and ALA by pigs caused an increased deposition of these FA in the body (p < 0.01) and an increased potential body pool of these acids for further metabolism/conversions. The conversion efficiency of LA and ALA from the feed to the pig's body differed among groups (p < 0.01) and ranged from 64.4% to 67.2% and from 69.4% to 81.7%, respectively. In Groups L and R, the level of de novo synthesis of long-chain polyunsaturated FA was higher than in Group F. From the results, it can be concluded that the efficiency of deposition is greater for omega-3 FA than for omega-6 FA and depends on their dietary amount. The level of LA and ALA intake influences not only their deposition in the body but also the end products of the omega-3 and omega-6 pathways.

  8. Engineering fungal de novo fatty acid synthesis for short chain fatty acid production

    PubMed Central

    Gajewski, Jan; Pavlovic, Renata; Fischer, Manuel; Boles, Eckhard; Grininger, Martin


    Fatty acids (FAs) are considered strategically important platform compounds that can be accessed by sustainable microbial approaches. Here we report the reprogramming of chain-length control of Saccharomyces cerevisiae fatty acid synthase (FAS). Aiming for short-chain FAs (SCFAs) producing baker's yeast, we perform a highly rational and minimally invasive protein engineering approach that leaves the molecular mechanisms of FASs unchanged. Finally, we identify five mutations that can turn baker's yeast into a SCFA producing system. Without any further pathway engineering, we achieve yields in extracellular concentrations of SCFAs, mainly hexanoic acid (C6-FA) and octanoic acid (C8-FA), of 464 mg l−1 in total. Furthermore, we succeed in the specific production of C6- or C8-FA in extracellular concentrations of 72 and 245 mg l−1, respectively. The presented technology is applicable far beyond baker's yeast, and can be plugged into essentially all currently available FA overproducing microorganisms. PMID:28281527

  9. Saturated fatty acids activate TLR-mediated proinflammatory signaling pathways.


    Huang, Shurong; Rutkowsky, Jennifer M; Snodgrass, Ryan G; Ono-Moore, Kikumi D; Schneider, Dina A; Newman, John W; Adams, Sean H; Hwang, Daniel H


    Toll-like receptor 4 (TLR4) and TLR2 were shown to be activated by saturated fatty acids (SFAs) but inhibited by docosahexaenoic acid (DHA). However, one report suggested that SFA-induced TLR activation in cell culture systems is due to contaminants in BSA used for solubilizing fatty acids. This report raised doubt about proinflammatory effects of SFAs. Our studies herein demonstrate that sodium palmitate (C16:0) or laurate (C12:0) without BSA solubilization induced phosphorylation of inhibitor of nuclear factor-κB α, c-Jun N-terminal kinase (JNK), p44/42 mitogen-activated-kinase (ERK), and nuclear factor-κB subunit p65, and TLR target gene expression in THP1 monocytes or RAW264.7 macrophages, respectively, when cultured in low FBS (0.25%) medium. C12:0 induced NFκB activation through TLR2 dimerized with TLR1 or TLR6, and through TLR4. Because BSA was not used in these experiments, contaminants in BSA have no relevance. Unlike in suspension cells (THP-1), BSA-solubilized C16:0 instead of sodium C16:0 is required to induce TLR target gene expression in adherent cells (RAW264.7). C16:0-BSA transactivated TLR2 dimerized with TLR1 or TLR6 and through TLR4 as seen with C12:0. These results and additional studies with the LPS sequester polymixin B and in MyD88(-/-) macrophages indicated that SFA-induced activation of TLR2 or TLR4 is a fatty acid-specific effect, but not due to contaminants in BSA or fatty acid preparations.

  10. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.


    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard


    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  11. Mutations in the Prokaryotic Pathway Rescue the fatty acid biosynthesis1 Mutant in the Cold1[OPEN

    PubMed Central

    Gao, Jinpeng; Wallis, James G.; Browse, John


    The Arabidopsis (Arabidopsis thaliana) fatty acid biosynthesis1 (fab1) mutant has increased levels of the saturated fatty acid 16:0 due to decreased activity of 3-ketoacyl-acyl carrier protein (ACP) synthase II. In fab1 leaves, phosphatidylglycerol, the major chloroplast phospholipid, contains up to 45% high-melting-point molecular species (molecules that contain only 16:0, 16:1-trans, and 18:0), a trait associated with chilling-sensitive plants, compared with less than 10% in wild-type Arabidopsis. Although they do not exhibit typical chilling sensitivity, when exposed to low temperatures (2°C–6°C) for long periods, fab1 plants do suffer collapse of photosynthesis, degradation of chloroplasts, and eventually death. A screen for suppressors of this low-temperature phenotype has identified 11 lines, some of which contain additional alterations in leaf-lipid composition relative to fab1. Here, we report the identification of two suppressor mutations, one in act1, which encodes the chloroplast acyl-ACP:glycerol-3-phosphate acyltransferase, and one in lpat1, which encodes the chloroplast acyl-ACP:lysophosphatidic acid acyltransferase. These enzymes catalyze the first two steps of the prokaryotic pathway for glycerolipid synthesis, so we investigated whether other mutations in this pathway would rescue the fab1 phenotype. Both the gly1 mutation, which reduces glycerol-3-phosphate supply to the prokaryotic pathway, and fad6, which is deficient in the chloroplast 16:1/18:1 fatty acyl desaturase, were discovered to be suppressors. Analyses of leaf-lipid compositions revealed that mutations at all four of the suppressor loci result in reductions in the proportion of high-melting-point molecular species of phosphatidylglycerol relative to fab1. We conclude that these reductions are likely the basis for the suppressor phenotypes. PMID:26224803

  12. Transcript profile analysis reveals important roles of jasmonic acid signalling pathway in the response of sweet potato to salt stress.


    Zhang, Huan; Zhang, Qian; Zhai, Hong; Li, Yan; Wang, Xiangfeng; Liu, Qingchang; He, Shaozhen


    Sweet potato is an important food and bio-energy crop, and investigating the mechanisms underlying salt tolerance will provide information for salt-tolerant breeding of this crop. Here, the root transcriptomes of the salt-sensitive variety Lizixiang and the salt-tolerant line ND98 were compared to identify the genes and pathways involved in salt stress responses. In total, 8,744 and 10,413 differentially expressed genes (DEGs) in Lizixiang and ND98, respectively, were involved in salt responses. A lower DNA methylation level was detected in ND98 than in Lizixiang. In both genotypes, the DEGs, which function in phytohormone synthesis and signalling and ion homeostasis, may underlie the different degrees of salt tolerance. Significant up-regulations of the genes involved in the jasmonic acid (JA) biosynthesis and signalling pathways and ion transport, more accumulation of JA, a higher degree of stomatal closure and a lower level of Na(+) were found in ND98 compared to Lizixiang. This is the first report on transcriptome responses to salt tolerance in sweet potato. These results reveal that the JA signalling pathway plays important roles in the response of sweet potato to salt stress. This study provides insights into the mechanisms and genes involved in the salt tolerance of sweet potato.

  13. Transcript profile analysis reveals important roles of jasmonic acid signalling pathway in the response of sweet potato to salt stress

    PubMed Central

    Zhang, Huan; Zhang, Qian; Zhai, Hong; Li, Yan; Wang, Xiangfeng; Liu, Qingchang; He, Shaozhen


    Sweet potato is an important food and bio-energy crop, and investigating the mechanisms underlying salt tolerance will provide information for salt-tolerant breeding of this crop. Here, the root transcriptomes of the salt-sensitive variety Lizixiang and the salt-tolerant line ND98 were compared to identify the genes and pathways involved in salt stress responses. In total, 8,744 and 10,413 differentially expressed genes (DEGs) in Lizixiang and ND98, respectively, were involved in salt responses. A lower DNA methylation level was detected in ND98 than in Lizixiang. In both genotypes, the DEGs, which function in phytohormone synthesis and signalling and ion homeostasis, may underlie the different degrees of salt tolerance. Significant up-regulations of the genes involved in the jasmonic acid (JA) biosynthesis and signalling pathways and ion transport, more accumulation of JA, a higher degree of stomatal closure and a lower level of Na+ were found in ND98 compared to Lizixiang. This is the first report on transcriptome responses to salt tolerance in sweet potato. These results reveal that the JA signalling pathway plays important roles in the response of sweet potato to salt stress. This study provides insights into the mechanisms and genes involved in the salt tolerance of sweet potato. PMID:28084460

  14. The effects of centrally injected arachidonic acid on respiratory system: Involvement of cyclooxygenase to thromboxane signaling pathway.


    Erkan, Leman Gizem; Guvenc, Gokcen; Altinbas, Burcin; Niaz, Nasir; Yalcin, Murat


    Arachidonic acid (AA) is a polyunsaturated fatty acid that is present in the phospholipids of the cell membranes of the body and is abundant in the brain. Exogenously administered AA has been shown to affect brain metabolism and to exhibit cardiovascular and neuroendocrine actions. However, little is known regarding its respiratory actions and/or central mechanism of its respiratory effects. Therefore, the present study was designed to investigate the possible effects of centrally injected AA on respiratory system and the mediation of the central cyclooxygenase (COX) to thromboxane A2 (TXA2) signaling pathway on AA-induced respiratory effects in anaesthetized rats. Intracerebroventricular (i.c.v.) administration of AA induced dose- and time-dependent increase in tidal volume, respiratory rates and respiratory minute ventilation and also caused an increase in partial oxygen pressure (pO2) and decrease in partial carbon dioxide pressure (pCO2) in male anaesthetized Spraque Dawley rats. I.c.v. pretreatment with ibuprofen, a non-selective COX inhibitor, completely blocked the hyperventilation and blood gases changes induced by AA. In addition, central pretreatment with different doses of furegrelate, a TXA2 synthesis inhibitor, also partially prevented AA-evoked hyperventilation and blood gases effects. These data explicitly show that centrally administered AA induces hyperventilation with increasing pO2 and decreasing pCO2 levels which are mediated by the activation of central COX to TXA2 signaling pathway.

  15. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.


    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  16. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.


    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus


    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  17. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.


    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G


    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  18. Polyunsaturated fatty acids trigger apoptosis of colon cancer cells through a mitochondrial pathway

    PubMed Central

    Zhang, Chengcheng; Yu, Haining; Shen, Yuzhen; Ni, Xiaofeng; Das, Undurti N.


    Introduction Colorectal cancer is common in developed countries. Polyunsaturated fatty acids (PUFAs) have been reported to possess tumoricidal action, but the exact mechanism of their action is not clear. Material and methods In the present study, we studied the effect of various n-6 and n-3 fatty acids on the survival of the colon cancer cells LoVo and RKO and evaluated the possible involvement of a mitochondrial pathway in their ability to induce apoptosis. Results It was observed that n-3 α-linolenic acid, eicosapentaenoic acid and docosahexaenoic acid (ALA, EPA and DHA respectively) and n-6 linoleic acid, gamma-linolenic acid and arachidonic acid (LA, GLA and AA respectively) induced apoptosis of the colon cancer cells LoVo and RKO at concentrations above 120 μM (p < 0.01 compared to control). The semi-differentiated colon cancer cell line RKO was more sensitive to the cytotoxic action of PUFAs compared to the undifferentiated colon cancer cell line LoVo. PUFA-treated cells showed an increased number of lipid droplets in their cytoplasm. PUFA-induced apoptosis of LoVo and RKO cells is mediated through a mitochondria-mediated pathway as evidenced by loss of mitochondrial membrane potential, generation of ROS, accumulation of intracellular Ca2+, activation of caspase-9 and caspase-3, decreased ATP level and increase in the Bax/Bcl2 expression ratio. Conclusions PUFAs induced apoptosis of colon cancer cells through a mitochondrial dependent pathway. PMID:26528354

  19. Identification of a conserved protein involved in anaerobic unsaturated fatty acid synthesis in Neiserria gonorrhoeae: implications for facultative and obligate anaerobes that lack FabA.


    Isabella, Vincent M; Clark, Virginia L


    Transcriptome analysis of the facultative anaerobe, Neisseria gonorrhoeae, revealed that many genes of unknown function were induced under anaerobic conditions. Mutation of one such gene, NGO1024, encoding a protein belonging to the 2-nitropropane dioxygenase-like superfamily of proteins, was found to result in an inability of gonococci to grow anaerobically. Anaerobic growth of an NG1024 mutant was restored upon supplementation with unsaturated fatty acids (UFA), but not with the saturated fatty acid palmitate. Gonococcal fatty acid profiles confirmed that NGO1024 was involved in UFA synthesis anaerobically, but not aerobically, demonstrating that gonococci contain two distinct pathways for the production of UFAs, with a yet unidentified aerobic mechanism, and an anaerobic mechanism involving NGO1024. Expression of genes involved in classical anaerobic UFA synthesis, fabA, fabM and fabB, was toxic in gonococci and unable to complement a NGO1024 mutation, suggesting that the chemistry involved in gonococcal anaerobic UFA synthesis is distinct from that of the classical pathway. NGO1024 homologues, which we suggest naming UfaA, form a distinct lineage within the 2-nitropropane dioxygenase-like superfamily, and are found in many facultative and obligate anaerobes that produce UFAs but lack fabA, suggesting that UfaA is part of a widespread pathway involved in UFA synthesis.

  20. Metabolic pathways for lipid synthesis under nitrogen stress in Chlamydomonas and Nannochloropsis.


    Banerjee, Avik; Maiti, Subodh K; Guria, Chandan; Banerjee, Chiranjib


    Microalgae are currently being considered as a clean, sustainable and renewable energy source. Enzymes that catalyse the metabolic pathways for biofuel production are specific and require strict regulation and co-ordination. Thorough knowledge of these key enzymes along with their regulatory molecules is essential to enable rational metabolic engineering, to drive the metabolic flux towards the desired metabolites of importance. This paper reviews two key enzymes that play their role in production of bio-oil: DGAT (acyl-CoA:diacylglycerol acyltransferase) and PDAT (phospholipid:diacylglycerol acyltransferase). It also deals with the transcription factors that control the enzymes while cell undergoes a metabolic shift under stress. The paper also discusses the association of other enzymes and pathways that provide substrates and precursors for oil accumulation. Finally a futuristic solution has been proposed about a synthetic algal cell platform that would be committed towards biofuel synthesis.

  1. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.


    Wulster, G; Sacalis, J; Janes, H W


    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  2. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.


    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M


    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  3. Unsaturated Fatty Acid Synthesis in the Gastric Pathogen Helicobacter pylori Proceeds via a Backtracking Mechanism.


    Bi, Hongkai; Zhu, Lei; Jia, Jia; Zeng, Liping; Cronan, John E


    Helicobacter pylori is a Gram-negative bacterium that inhabits the upper gastrointestinal tract in humans, and the presence of this pathogen in the gut microbiome increases the risk of peptic ulcers and stomach cancer. H. pylori depends on unsaturated fatty acid (UFA) biosynthesis for maintaining membrane structure and function. Although some of the H. pylori enzymes involved in UFA biosynthesis are functionally homologous with the enzymes found in Escherichia coli, we show here that an enzyme HP0773, now annotated as FabX, uses an unprecedented backtracking mechanism to not only dehydrogenate decanoyl-acyl carrier protein (ACP) in a reaction that parallels that of acyl-CoA dehydrogenase, the first enzyme of the fatty acid β-oxidation cycle, but also isomerizes trans-2-decenoyl-ACP to cis-3-decenoyl-ACP, the key UFA synthetic intermediate. Thus, FabX reverses the normal fatty acid synthesis cycle in H. pylori at the C10 stage. Overall, this unusual FabX activity may offer a broader explanation for how many bacteria that lack the canonical pathway enzymes produce UFA-containing phospholipids.

  4. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei


    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  5. Urinary metabolomics in Fxr-null mice reveals activated adaptive metabolic pathways upon bile acid challenge.


    Cho, Joo-Youn; Matsubara, Tsutomu; Kang, Dong Wook; Ahn, Sung-Hoon; Krausz, Kristopher W; Idle, Jeffrey R; Luecke, Hans; Gonzalez, Frank J


    Farnesoid X receptor (FXR) is a nuclear receptor that regulates genes involved in synthesis, metabolism, and transport of bile acids and thus plays a major role in maintaining bile acid homeostasis. In this study, metabolomic responses were investigated in urine of wild-type and Fxr-null mice fed cholic acid, an FXR ligand, using ultra-performance liquid chromatography (UPLC) coupled with electrospray time-of-flight mass spectrometry (TOFMS). Multivariate data analysis between wild-type and Fxr-null mice on a cholic acid diet revealed that the most increased ions were metabolites of p-cresol (4-methylphenol), corticosterone, and cholic acid in Fxr-null mice. The structural identities of the above metabolites were confirmed by chemical synthesis and by comparing retention time (RT) and/or tandem mass fragmentation patterns of the urinary metabolites with the authentic standards. Tauro-3alpha,6,7alpha,12alpha-tetrol (3alpha,6,7alpha,12alpha-tetrahydroxy-5beta-cholestan-26-oyltaurine), one of the most increased metabolites in Fxr-null mice on a CA diet, is a marker for efficient hydroxylation of toxic bile acids possibly through induction of Cyp3a11. A cholestatic model induced by lithocholic acid revealed that enhanced expression of Cyp3a11 is the major defense mechanism to detoxify cholestatic bile acids in Fxr-null mice. These results will be useful for identification of biomarkers for cholestasis and for determination of adaptive molecular mechanisms in cholestasis.

  6. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng


    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  7. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.


    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  8. Biological Silicon Stimulates Collagen Type 1 and Osteocalcin Synthesis in Human Osteoblast-Like Cells Through the BMP-2/Smad/RUNX2 Signaling Pathway.


    Dong, Meng; Jiao, Guangjun; Liu, Haichun; Wu, Wenliang; Li, Shangzhi; Wang, Qingshi; Xu, Daxia; Li, Xiaofeng; Liu, Huan; Chen, Yunzhen


    Silicon is essential for bone formation. A low-silicon diet leads to bone defects, and numerous animal models have demonstrated that silicon supplementation increases bone mineral density (BMD) and reduces bone fragility. However, the exact mechanism of this action has not been characterized. In this study, we aimed to determine the role of biological silicon in the induction of osteoblast differentiation and the possible underlying mechanism. We examined whether orthosilicic acid promotes collagen type 1 (COL-1) and osteocalcin synthesis through the bone morphogenetic protein-2 (BMP-2)/Smad1/5/runt-related transcription factor 2 (RUNX2) signaling pathway by investigating its effect in vitro at several concentrations on COL-1 and osteocalcin synthesis in human osteosarcoma cell lines (MG-63 and U2-OS). The expression of relevant proteins was detected by Western blotting following exposure to noggin, an inhibitor of BMP-2. In MG-63 cells, immunofluorescence methods were applied to detect changes in the expression of BMP-2, phosphorylated Smad1/5 (P-Smad1/5), and RUNX2. Furthermore, rat bone mesenchymal stem cells (BMSCs) were used to determine the effect of orthosilicic acid on osteogenic differentiation. Exposure to 10 μM orthosilicic acid markedly increased the expression of BMP-2, P-Smad1/5, RUNX2, COL-1, and osteocalcin in osteosarcoma cell lines. Enhanced ALP activity and the formation of mineralized nodules were also observed under these conditions. Furthermore, preconditioning with noggin inhibited the silicon-induced upregulation of P-Smad1/5, RUNX2, and COL-1 expression. In conclusion, the BMP-2/Smad1/5/RUNX2 signaling pathway participates in the silicon-mediated induction of COL-1 and osteocalcin synthesis, and orthosilicic acid promotes the osteogenic differentiation of rat BMSCs.

  9. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.


    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu


    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  10. [Advanced biofuel-oriented engineering of fatty acid pathway: a review].


    Zhou, Yongjin J; Zhao, Zongbao K


    Biofuel is in high demand as an alternative energy source for petroleum and diesel. Fatty acid-based biofuel has higher energy density and better compatibility with existing infrastructures. Microbial fatty acid biosynthetic pathway is important to develop biofuel. In this article, recent progresses on the modification and reconstruction of fatty acid metabolism for the production of biofuel were reviewed, with a focus on micro-diesel, long chain fatty alcohol and alkane. Problems, solutions and directions for further development of fatty acid-based biofuel were also discussed in the respect of synthetic biology.

  11. Permanganate oxidation of α-amino acids: kinetic correlations for the nonautocatalytic and autocatalytic reaction pathways.


    Perez-Benito, Joaquin F


    The reactions of permanganate ion with seven α-amino acids in aqueous KH(2)PO(4)/K(2)HPO(4) buffers have been followed spectrophotometrically at two different wavelengths: 526 nm (decay of MnO(4)(-)) and 418 nm (formation of colloidal MnO(2)). All of the reactions studied were autocatalyzed by colloidal MnO(2), with the contribution of the autocatalytic reaction pathway decreasing in the order glycine > l-threonine > l-alanine > l-glutamic acid > l-leucine > l-isoleucine > l-valine. The rate constants corresponding to the nonautocatalytic and autocatalytic pathways were obtained by means of either a differential rate law or an integrated one, the latter requiring the use of an iterative method for its implementation. The activation parameters for the two pathways were determined and analyzed to obtain statistically significant correlations for the series of reactions studied. The activation enthalpy of the nonautocatalytic pathway showed a strong, positive dependence on the standard Gibbs energy for the dissociation of the protonated amino group of the α-amino acid. Linear enthalpy-entropy correlations were found for both pathways, leading to isokinetic temperatures of 370 ± 21 K (nonautocatalytic) and 364 ± 28 K (autocatalytic). Mechanisms in agreement with the experimental data are proposed for the two reaction pathways.

  12. Suppression of brain cholesterol synthesis in male Mecp2-deficient mice is age dependent and not accompanied by a concurrent change in the rate of fatty acid synthesis.


    Lopez, Adam M; Chuang, Jen-Chieh; Posey, Kenneth S; Turley, Stephen D


    Mutations in the X-linked gene methyl-CpG-binding protein 2 (MECP2) are the principal cause of Rett syndrome, a progressive neurodevelopmental disorder afflicting 1 in 10,000 to 15,000 females. Studies using hemizygous Mecp2 mouse models have revealed disruptions to some aspects of their lipid metabolism including a partial suppression of cholesterol synthesis in the brains of mature Mecp2 mutants. The present studies investigated whether this suppression is evident from early neonatal life, or becomes manifest at a later stage of development. We measured the rate of cholesterol synthesis, in vivo, in the brains of male Mecp2(-)(/y) and their Mecp2(+/y) littermates at 7, 14, 21, 28, 42 and 56 days of age. Brain weight was consistently lower in the Mecp2(-/y) mice than in their Mecp2(+/y) controls except at 7 days of age. In the 7- and 14-day-old mice there was no genotypic difference in the rate of brain cholesterol synthesis but, from 21 days and later, it was always marginally lower in the Mecp2(-/y) mice than in age-matched Mecp2(+/y) littermates. At no age was a genotypic difference detected in either the rate of fatty acid synthesis or cholesterol concentration in the brain. Cholesterol synthesis rates in the liver and lungs of 56-day-old Mecp2(-/y) mice were normal. The onset of lower rates of brain cholesterol synthesis at about the time closure of the blood brain barrier purportedly occurs might signify a disruption to mechanism(s) that dictate intracellular levels of cholesterol metabolites including oxysterols known to exert a regulatory influence on the cholesterol biosynthetic pathway.

  13. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.


    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc


    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica.

  14. Distinct amino acid-sensing mTOR pathways regulate skeletal myogenesis.


    Yoon, Mee-Sup; Chen, Jie


    Signaling through the mammalian target of rapamycin (mTOR) in response to amino acid availability controls many cellular and developmental processes. mTOR is a master regulator of myogenic differentiation, but the pathways mediating amino acid signals in this process are not known. Here we examine the Rag GTPases and the class III phosphoinositide 3-kinase (PI3K) Vps34, two mediators of amino acid signals upstream of mTOR complex 1 (mTORC1) in cell growth regulation, for their potential involvement in myogenesis. We find that, although both Rag and Vps34 mediate amino acid activation of mTORC1 in C2C12 myoblasts, they have opposing functions in myogenic differentiation. Knockdown of RagA/B enhances, whereas overexpression of active RagB/C mutants impairs, differentiation, and this inhibitory function of Rag is mediated by mTORC1 suppression of the IRS1-PI3K-Akt pathway. On the other hand, Vps34 is required for myogenic differentiation. Amino acids activate a Vps34-phospholipase D1 (PLD1) pathway that controls the production of insulin-like growth factor II, an autocrine inducer of differentiation, through the Igf2 muscle enhancer. The product of PLD, phosphatidic acid, activates the enhancer in a rapamycin-sensitive but mTOR kinase-independent manner. Our results uncover amino acid-sensing mechanisms controlling the homeostasis of myogenesis and underline the versatility and context dependence of mTOR signaling.

  15. Precipitation pathways for ferrihydrite formation in acidic solutions

    NASA Astrophysics Data System (ADS)

    Zhu, Mengqiang; Frandsen, Cathrine; Wallace, Adam F.; Legg, Benjamin; Khalid, Syed; Zhang, Hengzhong; Mørup, Steen; Banfield, Jillian F.; Waychunas, Glenn A.


    Iron oxides and oxyhydroxides form via Fe3+ hydrolysis and polymerization in many aqueous environments, but the pathway from Fe3+ monomers to oligomers and then to solid phase nuclei is unknown. In this work, using combined X-ray, UV-vis, and Mössbauer spectroscopic approaches, we were able to identify and quantify the long-time sought ferric speciation over time during ferric oxyhydroxide formation in partially-neutralized ferric nitrate solutions ([Fe3+] = 0.2 M, 1.8 < pH < 3). Results demonstrate that Fe exists mainly as Fe(H2O)63+, μ-oxo aquo dimers and ferrihydrite, and that with time, the μ-oxo dimer decreases while the other two species increase in their concentrations. No larger Fe oligomers were detected. Given that the structure of the μ-oxo dimer is incompatible with those of all Fe oxides and oxyhydroxides, our results suggest that reconfiguration of the μ-oxo dimer structure occurs prior to further condensation leading up to the nucleation of ferrihydrite. The structural reconfiguration is likely the rate-limiting step involved in the nucleation process.

  16. Precipitation pathways for ferrihydrite formation in acidic solutions

    SciTech Connect

    Zhu, Mengqiang; Khalid, Syed; Frandsen, Cathrine; Wallace, Adam F.; Legg, Benjamin; Zhang, Hengzhong; Morup, Steen; Banfield, Jillian F.; Waychunas, Glenn A.


    In this study, iron oxides and oxyhydroxides form via Fe3+ hydrolysis and polymerization in many aqueous environments, but the pathway from Fe3+ monomers to oligomers and then to solid phase nuclei is unknown. In this work, using combined X-ray, UV–vis, and Mössbauer spectroscopic approaches, we were able to identify and quantify the long-time sought ferric speciation over time during ferric oxyhydroxide formation in partially-neutralized ferric nitrate solutions ([Fe3+] = 0.2 M, 1.8 < pH < 3). Results demonstrate that Fe exists mainly as Fe(H2O)63+, μ-oxo aquo dimers and ferrihydrite, and that with time, the μ-oxo dimer decreases while the other two species increase in their concentrations. No larger Fe oligomers were detected. Given that the structure of the μ-oxo dimer is incompatible with those of all Fe oxides and oxyhydroxides, our results suggest that reconfiguration of the μ-oxo dimer structure occurs prior to further condensation leading up to the nucleation of ferrihydrite. The structural reconfiguration is likely the rate-limiting step involved in the nucleation process.

  17. Precipitation pathways for ferrihydrite formation in acidic solutions


    Zhu, Mengqiang; Khalid, Syed; Frandsen, Cathrine; ...


    In this study, iron oxides and oxyhydroxides form via Fe3+ hydrolysis and polymerization in many aqueous environments, but the pathway from Fe3+ monomers to oligomers and then to solid phase nuclei is unknown. In this work, using combined X-ray, UV–vis, and Mössbauer spectroscopic approaches, we were able to identify and quantify the long-time sought ferric speciation over time during ferric oxyhydroxide formation in partially-neutralized ferric nitrate solutions ([Fe3+] = 0.2 M, 1.8 < pH < 3). Results demonstrate that Fe exists mainly as Fe(H2O)63+, μ-oxo aquo dimers and ferrihydrite, and that with time, the μ-oxo dimer decreases while the othermore » two species increase in their concentrations. No larger Fe oligomers were detected. Given that the structure of the μ-oxo dimer is incompatible with those of all Fe oxides and oxyhydroxides, our results suggest that reconfiguration of the μ-oxo dimer structure occurs prior to further condensation leading up to the nucleation of ferrihydrite. The structural reconfiguration is likely the rate-limiting step involved in the nucleation process.« less

  18. Role of bile acids in the regulation of the metabolic pathways

    PubMed Central

    Taoka, Hiroki; Yokoyama, Yoko; Morimoto, Kohkichi; Kitamura, Naho; Tanigaki, Tatsuya; Takashina, Yoko; Tsubota, Kazuo; Watanabe, Mitsuhiro


    Recent studies have revealed that bile acids (BAs) are not only facilitators of dietary lipid absorption but also important signaling molecules exerting multiple physiological functions. Some major signaling pathways involving the nuclear BAs receptor farnesoid X receptor and the G protein-coupled BAs receptor TGR5/M-BAR have been identified to be the targets of BAs. BAs regulate their own homeostasis via signaling pathways. BAs also affect diverse metabolic pathways including glucose metabolism, lipid metabolism and energy expenditure. This paper suggests the mechanism of controlling metabolism via BA signaling and demonstrates that BA signaling is an attractive therapeutic target of the metabolic syndrome. PMID:27433295

  19. Role of fatty-acid synthesis in dendritic cell generation and function.


    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George


    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  20. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George


    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  1. Continuous multistep synthesis of perillic acid from limonene by catalytic biofilms under segmented flow.


    Willrodt, Christian; Halan, Babu; Karthaus, Lisa; Rehdorf, Jessica; Julsing, Mattijs K; Buehler, Katja; Schmid, Andreas


    The efficiency of biocatalytic reactions involving industrially interesting reactants is often constrained by toxification of the applied biocatalyst. Here, we evaluated the combination of biologically and technologically inspired strategies to overcome toxicity-related issues during the multistep oxyfunctionalization of (R)-(+)-limonene to (R)-(+)-perillic acid. Pseudomonas putida GS1 catalyzing selective limonene oxidation via the p-cymene degradation pathway and recombinant Pseudomonas taiwanensis VLB120 were evaluated for continuous perillic acid production. A tubular segmented-flow biofilm reactor was used in order to relieve oxygen limitations and to enable membrane mediated substrate supply as well as efficient in situ product removal. Both P. putida GS1 and P. taiwanensis VLB120 developed a catalytic biofilm in this system. The productivity of wild-type P. putida GS1 encoding the enzymes for limonene bioconversion was highly dependent on the carbon source and reached 34 g Ltube(-1)  day(-1) when glycerol was supplied. More than 10-fold lower productivities were reached irrespective of the applied carbon source when the recombinant P. taiwanensis VLB120 harboring p-cymene monooxygenase and p-cumic alcohol dehydrogenase was used as biocatalyst. The technical applicability for preparative perillic acid synthesis in the applied system was verified by purification of perillic acid from the outlet stream using an anion exchanger resin. This concept enabled the multistep production of perillic acid and which might be transferred to other reactions involving volatile reactants and toxic end-products. Biotechnol. Bioeng. 2017;114: 281-290. © 2016 Wiley Periodicals, Inc.

  2. Structural Conservation of Ligand Binding Reveals a Bile Acid-like Signaling Pathway in Nematodes*

    PubMed Central

    Zhi, Xiaoyong; Zhou, X. Edward; Melcher, Karsten; Motola, Daniel L.; Gelmedin, Verena; Hawdon, John; Kliewer, Steven A.; Mangelsdorf, David J.; Xu, H. Eric


    Bile acid-like molecules named dafachronic acids (DAs) control the dauer formation program in Caenorhabditis elegans through the nuclear receptor DAF-12. This mechanism is conserved in parasitic nematodes to regulate their dauer-like infective larval stage, and as such, the DAF-12 ligand binding domain has been identified as an important therapeutic target in human parasitic hookworm species that infect more than 600 million people worldwide. Here, we report two x-ray crystal structures of the hookworm Ancylostoma ceylanicum DAF-12 ligand binding domain in complex with DA and cholestenoic acid (a bile acid-like metabolite), respectively. Structure analysis and functional studies reveal key residues responsible for species-specific ligand responses of DAF-12. Furthermore, DA binds to DAF-12 mechanistically and is structurally similar to bile acids binding to the mammalian bile acid receptor farnesoid X receptor. Activation of DAF-12 by cholestenoic acid and the cholestenoic acid complex structure suggest that bile acid-like signaling pathways have been conserved in nematodes and mammals. Together, these results reveal the molecular mechanism for the interplay between parasite and host, provide a structural framework for DAF-12 as a promising target in treating nematode parasitism, and provide insight into the evolution of gut parasite hormone-signaling pathways. PMID:22170062

  3. [Exogenous NO mediated GSH-PCs synthesis pathway in tomato under copper stress].


    Wang, Jian; Yu, Shi-Xin; Zhang, Min; Cui, Xiu-Min


    Nitric oxide (NO), as a biologically active molecule, widely involved in the biotic and abiotic stresses. By using solution culture, this paper reported the dynamic changes in enzyme activity and metabolites related to GSH-PCs synthesis way mediated by exogenous NO in tomato (Lycopersicon esculentum). The results showed that exogenous NO could affect the metabolic pathway of GSH-PCs in tomato seedlings under copper stress. Compared with CK, the activity of γ-ECS and GS was significantly activated, consequently resulting in a sharp rise in GSH and PCs contents in tomato root. Moreover, γ-ECS and GS activity, GSH and PCs contents constantly rise with the extension of processing time under copper stress. Adding exogenous SNP could further improve γ-ECS and GS activity in tomato, and promote the production of GSH and PCs, which contributed to enhancing the ability of removing superoxide and chelating excess Cu2+ to reduce its biological toxicity. To a certain extent, GSH-PCs metabolic changes in leaf lagged behind that in roots. Exogenous BSO could significantly inhibit γ-ECS activity, and applying SNP could significantly reverse the inhibition on GSH and PCs synthesis by BSO. BSO had little effects on PCs content in leaf. Under copper stress, exogenous NO may initiate a signal mechanism and reduce the biotoxicity and oxidative damage caused by excessive Cu2+ by activating or enhancing the enzymatic and non-enzymatic systems in the GSH-PCs synthesis path.

  4. Metabolic pathways regulated by abscisic acid, salicylic acid and γ-aminobutyric acid in association with improved drought tolerance in creeping bentgrass (Agrostis stolonifera).


    Li, Zhou; Yu, Jingjin; Peng, Yan; Huang, Bingru


    Abscisic acid (ABA), salicylic acid (SA) and γ-aminobutyric acid (GABA) are known to play roles in regulating plant stress responses. This study was conducted to determine metabolites and associated pathways regulated by ABA, SA and GABA that could contribute to drought tolerance in creeping bentgrass (Agrostis stolonifera). Plants were foliar sprayed with ABA (5 μM), GABA (0.5 mM) and SA (10 μM) or water (untreated control) prior to 25 days drought stress in controlled growth chambers. Application of ABA, GABA or SA had similar positive effects on alleviating drought damages, as manifested by the maintenance of lower electrolyte leakage and greater relative water content in leaves of treated plants relative to the untreated control. Metabolic profiling showed that ABA, GABA and SA induced differential metabolic changes under drought stress. ABA mainly promoted the accumulation of organic acids associated with tricarboxylic acid cycle (aconitic acid, succinic acid, lactic acid and malic acid). SA strongly stimulated the accumulation of amino acids (proline, serine, threonine and alanine) and carbohydrates (glucose, mannose, fructose and cellobiose). GABA enhanced the accumulation of amino acids (GABA, glycine, valine, proline, 5-oxoproline, serine, threonine, aspartic acid and glutamic acid) and organic acids (malic acid, lactic acid, gluconic acid, malonic acid and ribonic acid). The enhanced drought tolerance could be mainly due to the enhanced respiration metabolism by ABA, amino acids and carbohydrates involved in osmotic adjustment (OA) and energy metabolism by SA, and amino acid metabolism related to OA and stress-defense secondary metabolism by GABA.

  5. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.


    Suć, Josipa; Jerić, Ivanka


    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  6. A convenient synthesis of anthranilic acids by Pd-catalyzed direct intermolecular ortho-C-H amidation of benzoic acids.


    Ng, Ka-Ho; Ng, Fo-Ning; Yu, Wing-Yiu


    An efficient method for synthesis of anthranilic acids by Pd-catalyzed ortho-C-H amidation of benzoic acids is disclosed. The amidation is proposed to proceed by carboxylate-assisted ortho-C-H palladation to form an arylpalladium(II) complex, followed by nitrene insertion to the Pd-C bond.


    PubMed Central

    Rasmussen, B.B.; Wolfe, R.R.; Volpi, E.


    BACKGROUND Muscle protein synthesis is stimulated in the elderly when amino acid availability is increased. OBJECTIVE To determine which mode of delivery of amino acids (intravenous vs. oral ingestion) is more effective in stimulating the rate of muscle protein synthesis in elderly subjects. DESIGN Fourteen elderly subjects were assigned to one of two groups. Following insertion of femoral arterial and venous catheters, subjects were infused with a primed, continuous infusion of L-[ring-2H5] phenylalanine. Blood samples and muscle biopsies were obtained to measure muscle protein fractional synthesis rate (FSR) with the precursor-product model, phenylalanine kinetics across the leg with the three-pool model, and whole body phenylalanine kinetics. Protein metabolism parameters were measured in the basal period, and during the administration of oral amino acids (n=8) or a similar amount of intravenous amino acids (n=6). RESULTS Enteral and parenteral amino acid administration increased amino acid arterial concentrations and delivery to the leg to a similar extent in both groups. Muscle protein synthesis as measured by both FSR, and the three-pool model, increased during amino acid administration (P < 0.05 vs. basal) in both groups with no differences between groups. Whole body proteolysis did not change with the oral amino acids whereas it increased slightly during parenteral amino acid administration. CONCLUSIONS Increased amino acid availability stimulates the rate of muscle protein synthesis independent of the route of administration (enteral vs. parenteral). PMID:12459885

  8. EIMS Fragmentation Pathways and MRM Quantification of 7α/β-Hydroxy-Dehydroabietic Acid TMS Derivatives.


    Rontani, Jean-François; Aubert, Claude; Belt, Simon T


    EI mass fragmentation pathways of TMS derivatives οf 7α/β-hydroxy-dehydroabietic acids resulting from NaBH(4)-reduction of oxidation products of dehydroabietic acid (a component of conifers) were investigated and deduced by a combination of (1) low energy CID-GC-MS/MS, (2) deuterium labeling, (3) different derivatization methods, and (4) GC-QTOF accurate mass measurements. Having identified the main fragmentation pathways, the TMS-derivatized 7α/β-hydroxy-dehydroabietic acids could be quantified in multiple reaction monitoring (MRM) mode in sea ice and sediment samples collected from the Arctic. These newly characterized transformation products of dehydroabietic acid constitute potential tracers of biotic and abiotic degradation of terrestrial higher plants in the environment.

  9. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik


    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  10. Putrescine stimulates the mTOR signaling pathway and protein synthesis in porcine trophectoderm cells.


    Kong, Xiangfeng; Wang, Xiaoqiu; Yin, Yulong; Li, Xilong; Gao, Haijun; Bazer, Fuller W; Wu, Guoyao


    Insufficient placental growth is a major factor contributing to intrauterine growth retardation in mammals. There is growing evidence that putrescine produced from arginine (Arg) and proline via ornithine decarboxylase is a key regulator of angiogenesis, embryogenesis, as well as placental and fetal growth. However, the underlying mechanisms are largely unknown. The present study tested the hypothesis that putrescine stimulates protein synthesis by activating the mechanistic target of rapamycin (mTOR) signaling pathway in porcine trophectoderm cell line 2 cells. The cells were cultured for 2 to 4 days in customized Arg-free Dulbecco modified Eagle Ham medium containing 0, 10, 25, or 50 μM putrescine or 100 μM Arg. Cell proliferation, protein synthesis, and degradation, as well as the abundance of total and phosphorylated mTOR, ribosomal protein S6 kinase 1, and eukaryotic initiation factor 4E-binding protein-1 (4EBP1), were determined. Our results indicate that putrescine promotes cell proliferation and protein synthesis in a dose- and time-dependent manner, which was inhibited by difluoro-methylornithine (an inhibitor of ornithine decarboxylase). Moreover, supplementation of culture medium with putrescine increased the abundance of phosphorylated mTOR and its downstream targets, 4EBP1 and p70 S6K1 proteins. Collectively, these findings reveal a novel and important role for putrescine in regulating the mTOR signaling pathway in porcine placental cells. We suggest that dietary supplementation with or intravenous administration of putrescine may provide a new and effective strategy to improve survival and growth of embryos/fetuses in mammals.

  11. Two Alternative Pathways for the Synthesis of the Rare Compatible Solute Mannosylglucosylglycerate in Petrotoga mobilis▿

    PubMed Central

    Fernandes, Chantal; Mendes, Vitor; Costa, Joana; Empadinhas, Nuno; Jorge, Carla; Lamosa, Pedro; Santos, Helena; da Costa, Milton S.


    The compatible solute mannosylglucosylglycerate (MGG), recently identified in Petrotoga miotherma, also accumulates in Petrotoga mobilis in response to hyperosmotic conditions and supraoptimal growth temperatures. Two functionally connected genes encoding a glucosyl-3-phosphoglycerate synthase (GpgS) and an unknown glycosyltransferase (gene Pmob_1143), which we functionally characterized as a mannosylglucosyl-3-phosphoglycerate synthase and designated MggA, were identified in the genome of Ptg. mobilis. This enzyme used the product of GpgS, glucosyl-3-phosphoglycerate (GPG), as well as GDP-mannose to produce mannosylglucosyl-3-phosphoglycerate (MGPG), the phosphorylated precursor of MGG. The MGPG dephosphorylation was determined in cell extracts, and the native enzyme was partially purified and characterized. Surprisingly, a gene encoding a putative glucosylglycerate synthase (Ggs) was also identified in the genome of Ptg. mobilis, and an active Ggs capable of producing glucosylglycerate (GG) from ADP-glucose and d-glycerate was detected in cell extracts and the recombinant enzyme was characterized, as well. Since GG has never been identified in this organism nor was it a substrate for the MggA, we anticipated the existence of a nonphosphorylating pathway for MGG synthesis. We putatively identified the corresponding gene, whose product had some sequence homology with MggA, but it was not possible to recombinantly express a functional enzyme from Ptg. mobilis, which we named mannosylglucosylglycerate synthase (MggS). In turn, a homologous gene from Thermotoga maritima was successfully expressed, and the synthesis of MGG was confirmed from GDP-mannose and GG. Based on the measurements of the relevant enzyme activities in cell extracts and on the functional characterization of the key enzymes, we propose two alternative pathways for the synthesis of the rare compatible solute MGG in Ptg. mobilis. PMID:20061481

  12. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.


    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi


    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins.

  13. Reassessment of the Genetic Regulation of Fatty Acid Synthesis in Escherichia coli: Global Positive Control by the Dual Functional Regulator FadR

    PubMed Central

    My, L.; Ghandour Achkar, N.; Viala, J. P.


    ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator

  14. Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria1[OPEN

    PubMed Central

    Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.


    Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016

  15. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA


    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  16. Metabolic analysis reveals changes in the mevalonate and juvenile hormone synthesis pathways linked to the mosquito reproductive physiology.


    Rivera-Perez, Crisalejandra; Nouzova, Marcela; Lamboglia, Ivanna; Noriega, Fernando G


    Juvenile hormone (JH) regulates reproductive maturation in insects; therefore interruption of JH biosynthesis has been considered as a strategy for the development of target-specific insecticides. The corpora allata (CA) from mosquitoes is highly specialized to supply variable levels of JH, which are linked to ovarian developmental stages and influenced by nutritional signals. However, very little is known about how changes in JH synthesis relate to reproductive physiology and how JH synthesis regulation is translated into changes in the CA machinery. With the advent of new methods that facilitate the analysis of transcripts, enzymes and metabolites in the minuscule CA, we were able to provide comprehensive descriptions of the mevalonic (MVA) and JH synthesis pathways by integrating information on changes in the basic components of those pathways. Our results revealed remarkable dynamic changes in JH synthesis and exposed part of a complex mechanism that regulates CA activity. Principal component (PC) analyses validated that both pathways (MVAP and JH-branch) are transcriptionally co-regulated as a single unit, and catalytic activities for the enzymes of the MVAP and JH-branch also changed in a coordinate fashion. Metabolite studies showed that global fluctuations in the intermediate pool sizes in the MVAP and JH-branch were often inversely related. PC analyses suggest that in female mosquitoes, there are at least 4 developmental switches that alter JH synthesis by modulating the flux at distinctive points in both pathways.

  17. From thiol to sulfonic acid: modeling the oxidation pathway of protein thiols by hydrogen peroxide.


    van Bergen, Laura A H; Roos, Goedele; De Proft, Frank


    Hydrogen peroxide is a natural oxidant that can oxidize protein thiols (RSH) via sulfenic acid (RSOH) and sulfinic acid (RSO2H) to sulfonic acid (RSO3H). In this paper, we study the complete anionic and neutral oxidation pathway from thiol to sulfonic acid. Reaction barriers and reaction free energies for all three oxidation steps are computed, both for the isolated substrates and for the substrates in the presence of different model ligands (CH4, H2O, NH3) mimicking the enzymatic environment. We found for all three barriers that the anionic thiolate is more reactive than the neutral thiol. However, the assistance of the environment in the neutral pathway in a solvent-assisted proton-exchange (SAPE) mechanism can lower the reaction barrier noticeably. Polar ligands can decrease the reaction barriers, whereas apolar ligands do not influence the barrier heights. The same holds for the reaction energies: they decrease (become more negative) in the presence of polar ligands whereas apolar ligands do not have an influence. The consistently negative consecutive reaction energies for the oxidation in the anionic pathway when going from thiolate over sulfenic and sulfinic acid to sulfonic acid are in agreement with biological reversibility.

  18. Identification of the Leucine-to-2-Methylbutyric Acid Catabolic Pathway of Lactococcus lactis† ‡

    PubMed Central

    Ganesan, Balasubramanian; Dobrowolski, Piotr; Weimer, Bart C.


    Nutrient starvation and nonculturability in bacteria lead to changes in metabolism not found during the logarithmic phase. Substrates alternate to those used during growth are metabolized in these physiological states, yielding secondary metabolites. In firmicutes and actinobacteria, amino acid catabolic pathways are induced during starvation and nonculturability. Examination of lactococci showed that the population entered a nonculturable state after carbohydrate depletion and was incapable of growth on solid media; however, the cells gained the ability to produce branched-chain fatty acids from amino acids. Gene expression profiling and in silico pathway analysis coupled with nuclear magnetic resonance spectroscopy were used to delineate the leucine catabolic pathway. Lactococci produced acetic and propionic acid during logarithmic growth and starvation. At the onset of nonculturability, 2-methylbutyric acid was produced via hydroxymethyl-glutaryl-coenzyme A (CoA) and acetyl-CoA, along with ATP and oxidation/reduction precursors. Gene expression profiling and genome sequence analysis showed that lactococci contained redundant genes for branched-chain fatty acid production that were regulated by an unknown mechanism linked to carbon metabolism. This work demonstrated the ability of a firmicute to induce new metabolic capabilities in the nonculturable state for producing energy and intermediates needed for transcription and translation. Phylogenetic analyses showed that homologues of these enzymes and their functional motifs were widespread across the domains of life. PMID:16751541

  19. Meristem maintenance, auxin, jasmonic and abscisic acid pathways as a mechanism for phenotypic plasticity in Antirrhinum majus

    NASA Astrophysics Data System (ADS)

    Weiss, Julia; Alcantud-Rodriguez, Raquel; Toksöz, Tugba; Egea-Cortines, Marcos


    Plants grow under climatic changing conditions that cause modifications in vegetative and reproductive development. The degree of changes in organ development i.e. its phenotypic plasticity seems to be determined by the organ identity and the type of environmental cue. We used intraspecific competition and found that Antirrhinum majus behaves as a decoupled species for lateral organ size and number. Crowding causes decreases in leaf size and increased leaf number whereas floral size is robust and floral number is reduced. Genes involved in shoot apical meristem maintenance like ROA and HIRZ, cell cycle (CYCD3a; CYCD3b, HISTONE H4) or organ polarity (GRAM) were not significantly downregulated under crowding conditions. A transcriptomic analysis of inflorescence meristems showed Gene Ontology enriched pathways upregulated including Jasmonic and Abscisic acid synthesis and or signalling. Genes involved in auxin synthesis such as AmTAR2 and signalling AmANT were not affected by crowding. In contrast, AmJAZ1, AmMYB21, AmOPCL1 and AmABA2 were significantly upregulated. Our work provides a mechanistic working hypothesis where a robust SAM and stable auxin signalling enables a homogeneous floral size while changes in JA and ABA signalling maybe responsible for the decreased leaf size and floral number.

  20. Meristem maintenance, auxin, jasmonic and abscisic acid pathways as a mechanism for phenotypic plasticity in Antirrhinum majus

    PubMed Central

    Weiss, Julia; Alcantud-Rodriguez, Raquel; Toksöz, Tugba; Egea-Cortines, Marcos


    Plants grow under climatic changing conditions that cause modifications in vegetative and reproductive development. The degree of changes in organ development i.e. its phenotypic plasticity seems to be determined by the organ identity and the type of environmental cue. We used intraspecific competition and found that Antirrhinum majus behaves as a decoupled species for lateral organ size and number. Crowding causes decreases in leaf size and increased leaf number whereas floral size is robust and floral number is reduced. Genes involved in shoot apical meristem maintenance like ROA and HIRZ, cell cycle (CYCD3a; CYCD3b, HISTONE H4) or organ polarity (GRAM) were not significantly downregulated under crowding conditions. A transcriptomic analysis of inflorescence meristems showed Gene Ontology enriched pathways upregulated including Jasmonic and Abscisic acid synthesis and or signalling. Genes involved in auxin synthesis such as AmTAR2 and signalling AmANT were not affected by crowding. In contrast, AmJAZ1, AmMYB21, AmOPCL1 and AmABA2 were significantly upregulated. Our work provides a mechanistic working hypothesis where a robust SAM and stable auxin signalling enables a homogeneous floral size while changes in JA and ABA signalling maybe responsible for the decreased leaf size and floral number. PMID:26804132

  1. Synthesis and cytotoxic activity of new betulin and betulinic acid esters with conjugated linoleic acid (CLA).


    Tubek, Barbara; Mituła, Paweł; Niezgoda, Natalia; Kempińska, Katarzyna; Wietrzyk, Joanna; Wawrzeńczyk, Czesław


    The synthesis of new ester derivatives of betulin (3a-c) and betulinic acid (4) with conjugated linoleic acid isomers (CLA; in a mixture of 43.4% 9c, 11t; 49.5% 10t, 12c; 7.1% other isomers) is presented. Esterification was carried out with N,N'-dicyclohexylcarbodiimide (DCC) as the coupling agent in the presence of 4-dimethylamino-pyridine (DMAP) in dichloromethane (or pyridine). The in vitro cytotoxic effect of betulin (1), betulinic acid (2), a mixture of CLA isomers and their derivatives (3a-c, 4) was examined using the MTT assay against four cancer cell lines (P388, CEM/C2, CCRF/CEM and HL-60) and the SRB assay on the HT-29 cell line. Ester 4 was the most active among the esters synthesized against the CEM/C2 cell line with an ID50 value 16.9 +/- 6.5 microg/mL. Betulin (1), betulinic acid (2) and CLA were the most active agents against the cancer cell lines studied.

  2. Production of Glucaric Acid from a Synthetic Pathway in Recombinant Escherichia coli▿ †

    PubMed Central

    Moon, Tae Seok; Yoon, Sang-Hwal; Lanza, Amanda M.; Roy-Mayhew, Joseph D.; Prather, Kristala L. Jones


    A synthetic pathway has been constructed for the production of glucuronic and glucaric acids from glucose in Escherichia coli. Coexpression of the genes encoding myo-inositol-1-phosphate synthase (Ino1) from Saccharomyces cerevisiae and myo-inositol oxygenase (MIOX) from mice led to production of glucuronic acid through the intermediate myo-inositol. Glucuronic acid concentrations up to 0.3 g/liter were measured in the culture broth. The activity of MIOX was rate limiting, resulting in the accumulation of both myo-inositol and glucuronic acid as final products, in approximately equal concentrations. Inclusion of a third enzyme, uronate dehydrogenase (Udh) from Pseudomonas syringae, facilitated the conversion of glucuronic acid to glucaric acid. The activity of this recombinant enzyme was more than 2 orders of magnitude higher than that of Ino1 and MIOX and increased overall flux through the pathway such that glucaric acid concentrations in excess of 1 g/liter were observed. This represents a novel microbial system for the biological production of glucaric acid, a “top value-added chemical” from biomass. PMID:19060162

  3. An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis

    PubMed Central

    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker


    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  4. Ascorbic acid formation and profiling of genes expressed in its synthesis and recycling in apple leaves of different ages.


    Li, Mingjun; Ma, Fengwang; Guo, Chunmiao; Liu, Jun


    Ascorbic acid (AsA), as a unique antioxidant and enzyme cofactor, has multiple roles in plants. However, there is very limited information on the mechanism of AsA accumulation and controlling in leaves. In this study, we determined AsA accumulation levels, analyzed expression patterns of the genes involved in synthesizing via l-galactose pathway and recycling as well as enzyme activities in apple (Malus domestica Borkh) leaves with different age. AsA content was found to increase with leaf development, reaching the highest level in 20-day-old leaves. This level was maintained in mature leaves until the dropping in senescent leaves. Comparing with young and senescent leaves, mature leaves had higher capability for AsA synthesis with high expression levels and activity of l-galactose dehydrogenase and l-galactono-1,4-lactone dehydrogenase. The mRNA expression of genes involved in AsA synthesis also showed highest abundance in 20-day-old leaves, though GDP-mannose-3',5'-epimerase and l-galactose-1-phosphate phosphatase expression reached the highest levels before 20 days old. These results suggest that AsA accumulation in apple leaves mainly occurs during the transition phase from young to mature leaves with high rates of synthesis and recycling, and that l-galactose-1-phosphate phosphatase could play an important role in regulating AsA biosynthesis via the l-galactose pathway.

  5. The rabbit pulmonary cytochrome P450 arachidonic acid metabolic pathway: characterization and significance.

    PubMed Central

    Zeldin, D C; Plitman, J D; Kobayashi, J; Miller, R F; Snapper, J R; Falck, J R; Szarek, J L; Philpot, R M; Capdevila, J H


    Cytochrome P450 metabolizes arachidonic acid to several unique and biologically active compounds in rabbit liver and kidney. Microsomal fractions prepared from rabbit lung homogenates metabolized arachidonic acid through cytochrome P450 pathways, yielding cis-epoxyeicosatrienoic acids (EETs) and their hydration products, vic-dihydroxyeicosatrienoic acids, mid-chain cis-trans conjugated dienols, and 19- and 20-hydroxyeicosatetraenoic acids. Inhibition studies using polyclonal antibodies prepared against purified CYP2B4 demonstrated 100% inhibition of arachidonic acid epoxide formation. Purified CYP2B4, reconstituted in the presence of NADPH-cytochrome P450 reductase and cytochrome b5, metabolized arachidonic acid, producing primarily EETs. EETs were detected in lung homogenate using gas chromatography/mass spectroscopy, providing evidence for the in vivo pulmonary cytochrome P450 epoxidation of arachidonic acid. Chiral analysis of these lung EETs demonstrated a preference for the 14(R),15(S)-, 11(S),12(R)-, and 8(S),9(R)-EET enantiomers. Both EETs and vic-dihydroxyeicosatrienoic acids were detected in bronchoalveolar lavage fluid. At micromolar concentrations, methylated 5,6-EET and 8,9-EET significantly relaxed histamine-contracted guinea pig hilar bronchi in vitro. In contrast, 20-hydroxyeicosatetraenoic acid caused contraction to near maximal tension. We conclude that CYP2B4, an abundant rabbit lung cytochrome P450 enzyme, is the primary constitutive pulmonary arachidonic acid epoxygenase and that these locally produced, biologically active eicosanoids may be involved in maintaining homeostasis within the lung. Images PMID:7738183

  6. White-to-brite conversion in human adipocytes promotes metabolic reprogramming towards fatty acid anabolic and catabolic pathways

    PubMed Central

    Barquissau, V.; Beuzelin, D.; Pisani, D.F.; Beranger, G.E.; Mairal, A.; Montagner, A.; Roussel, B.; Tavernier, G.; Marques, M.-A.; Moro, C.; Guillou, H.; Amri, E.-Z.; Langin, D.


    in PPARα-null mice displaying an impaired britening response. Conclusions Conversion of human white fat cells into brite adipocytes results in a major metabolic reprogramming inducing fatty acid anabolic and catabolic pathways. PDK4 redirects glucose from oxidation towards triglyceride synthesis and favors the use of fatty acids as energy source for uncoupling mitochondria. PMID:27110487

  7. Taurolithocholic acid promotes intrahepatic cholangiocarcinoma cell growth via muscarinic acetylcholine receptor and EGFR/ERK1/2 signaling pathway

    PubMed Central



    Cholangiocarcinoma (CCA) is a malignant cancer of the biliary tract and its occurrence is associated with chronic cholestasis which causes an elevation of bile acids in the liver and bile duct. The present study aimed to investigate the role and mechanistic effect of bile acids on the CCA cell growth. Intrahepatic CCA cell lines, RMCCA-1 and HuCCA-1, were treated with bile acids and their metabolites to determine the growth promoting effect. Cell viability, cell cycle analysis, EdU incorporation assays were conducted. Intracellular signaling proteins were detected by western immunoblotting. Among eleven forms of bile acids and their metabolites, only taurolithocholic acid (TLCA) concentration dependently (1–40 μM) increased the cell viability of RMCCA-1, but not HuCCA-1 cells. The cell cycle analysis showed induction of cells in the S phase and the EdU incorporation assay revealed induction of DNA synthesis in the TLCA-treated RMCCA-1 cells. Moreover, TLCA increased the phosphorylation of EGFR, ERK 1/2 and also increased the expression of cyclin D1 in RMCCA-1 cells. Furthermore, TLCA-induced RMCCA-1 cell growth could be inhibited by atropine, a non-selective muscarinic acetylcholine receptor (mAChR) antagonist, AG 1478, a specific EGFR inhibitor, or U 0126, a specific MEK 1/2 inhibitor. These results suggest that TLCA induces CCA cell growth via mAChR and EGFR/EKR1/2 signaling pathway. Moreover, the functional presence of cholinergic system plays a certain role in TLCA-induced CCA cell growth. PMID:25815516

  8. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  9. High-level production of ethylmalonyl-CoA pathway-derived dicarboxylic acids by Methylobacterium extorquens under cobalt-deficient conditions and by polyhydroxybutyrate negative strains.


    Sonntag, Frank; Müller, Jonas E N; Kiefer, Patrick; Vorholt, Julia A; Schrader, Jens; Buchhaupt, Markus


    Bio-based production of dicarboxylic acids is an emerging research field with remarkable progress during the last decades. The recently established synthesis of the ethylmalonyl-CoA pathway (EMCP)-derived dicarboxylic acids, mesaconic acid and (2S)-methylsuccinic acid, from the alternative carbon source methanol (Sonntag et al., Appl Microbiol Biotechnol 98:4533-4544, 2014) gave a proof of concept for the sustainable production of hitherto biotechnologically inaccessible monomers. In this study, substantial optimizations of the process by different approaches are presented. Abolishment of mesaconic and (2S)-methylsuccinic acid reuptake from culture supernatant and a productivity increase were achieved by 30-fold decreased sodium ion availability in culture medium. Undesired flux from EMCP into polyhydroxybutyrate (PHB) cycle was hindered by the knockout of polyhydroxyalkanoate synthase phaC which was concomitant with 5-fold increased product concentrations. However, frequently occurring suppressors of strain ΔphaC lost their beneficial properties probably due to redirected channeling of acetyl-CoA. Pool sizes of the product precursors were increased by exploiting the presence of two cobalt-dependent mutases in the EMCP: Fine-tuned growth-limiting cobalt concentrations led to 16-fold accumulation of mesaconyl- and (2S)-methylsuccinyl-CoA which in turn resulted in 6-fold increased concentrations of mesaconic and (2S)-methylsuccinic acids, with a combined titer of 0.65 g/l, representing a yield of 0.17 g/g methanol. This work represents an important step toward an industrially relevant production of ethylmalonyl-CoA pathway-derived dicarboxylic acids and the generation of a stable PHB synthesis negative Methylobacterium extorquens strain.

  10. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.


    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  11. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress.


    Simón, María Victoria; Agnolazza, Daniela L; German, Olga Lorena; Garelli, Andrés; Politi, Luis E; Agbaga, Martin-Paul; Anderson, Robert E; Rotstein, Nora P


    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here, we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat and hydrogen peroxide (H2 O2 ). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in retina photoreceptors, and its precursor, eicosapentaenoic acid (EPA) have multiple beneficial effects. Here, we show that retina neurons in vitro express the desaturase FADS2 and can synthesize DHA from EPA. Moreover, addition of EPA to these cultures protects photoreceptors from oxidative stress and promotes their differentiation through its metabolization to DHA.

  12. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong


    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  13. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  14. Activation of the Jasmonic Acid Plant Defence Pathway Alters the Composition of Rhizosphere Bacterial Communities

    PubMed Central

    Carvalhais, Lilia C.; Dennis, Paul G.; Badri, Dayakar V.; Tyson, Gene W.; Vivanco, Jorge M.; Schenk, Peer M.


    Jasmonic acid (JA) signalling plays a central role in plant defences against necrotrophic pathogens and herbivorous insects, which afflict both roots and shoots. This pathway is also activated following the interaction with beneficial microbes that may lead to induced systemic resistance. Activation of the JA signalling pathway via application of methyl jasmonate (MeJA) alters the composition of carbon containing compounds released by roots, which are implicated as key determinants of rhizosphere microbial community structure. In this study, we investigated the influence of the JA defence signalling pathway activation in Arabidopsis thaliana on the structure of associated rhizosphere bacterial communities using 16S rRNA gene amplicon pyrosequencing. Application of MeJA did not directly influence bulk soil microbial communities but significant changes in rhizosphere community composition were observed upon activation of the jasmonate signalling pathway. Our results suggest that JA signalling may mediate plant-bacteria interactions in the soil upon necrotrophic pathogen and herbivorous insect attacks. PMID:23424661

  15. Fatty Acid Biosynthesis Pathways in Methylomicrobium buryatense 5G(B1)

    PubMed Central

    Demidenko, Aleksandr; Akberdin, Ilya R.; Allemann, Marco; Allen, Eric E.; Kalyuzhnaya, Marina G.


    Methane utilization by methanotrophic bacteria is an attractive application for biotechnological conversion of natural or biogas into high-added-value products. Haloalcaliphilic methanotrophic bacteria belonging to the genus Methylomicrobium are among the most promising strains for methane-based biotechnology, providing easy and inexpensive cultivation, rapid growth, and the availability of established genetic tools. A number of methane bioconversions using these microbial cultures have been discussed, including the derivation of biodiesel, alkanes, and OMEGA-3 supplements. These compounds are derived from bacterial fatty acid pools. Here, we investigate fatty acid biosynthesis in Methylomicrobium buryatense 5G(B1). Most of the genes homologous to typical Type II fatty acid biosynthesis pathways could be annotated by bioinformatics analyses, with the exception of fatty acid transport and regulatory elements. Different approaches for improving fatty acid accumulation were investigated. These studies indicated that both fatty acid degradation and acetyl- and malonyl-CoA levels are bottlenecks for higher level fatty acid production. The best strain generated in this study synthesizes 111 ± 2 mg/gDCW of extractable fatty acids, which is ~20% more than the original strain. A candidate gene for fatty acid biosynthesis regulation, farE, was identified and studied. Its deletion resulted in drastic changes to the fatty acid profile, leading to an increased pool of C18-fatty acid methyl ester. The FarE-regulon was further investigated by RNA-seq analysis of gene expression in farE-knockout mutants and farE-overexpressing strains. These gene profiles highlighted a novel set of enzymes and regulators involved in fatty acid biosynthesis. The gene expression and fatty acid profiles of the different farE-strains support the hypothesis that metabolic fluxes upstream of fatty acid biosynthesis restrict fatty acid production in the methanotroph. PMID:28119683

  16. Synthesis of unnatural amino acids from serine derivatives by beta-fragmentation of primary alkoxyl radicals.


    Boto, Alicia; Gallardo, Juan A; Hernández, Dacil; Hernández, Rosendo


    The fragmentation of primary alkoxyl radicals has been scarcely used in synthesis since other competing processes (such as oxidation or hydrogen abstraction) usually predominate. However, when serine derivatives were used as substrates, the scission took place in excellent yields. Tandem scission-allylation, -alkylation, or -arylation reactions were subsequently developed. This one-pot methodology was applied to the synthesis of unnatural amino acids, which are useful synthetic blocks or amino acid surrogates in peptidomimetics.

  17. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.


    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh


    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  18. Distribution, synthesis, and absorption of kynurenic acid in plants.


    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A


    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement.

  19. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John


    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  20. Stromal uptake and transmission of acid is a pathway for venting cancer cell-generated acid

    PubMed Central

    Hulikova, Alzbeta; Black, Nicholas; Hsia, Lin-Ting; Wilding, Jennifer; Bodmer, Walter F.; Swietach, Pawel


    Proliferation and invasion of cancer cells require favorable pH, yet potentially toxic quantities of acid are produced metabolically. Membrane-bound transporters extrude acid from cancer cells, but little is known about the mechanisms that handle acid once it is released into the poorly perfused extracellular space. Here, we studied acid handling by myofibroblasts (colon cancer-derived Hs675.T, intestinal InMyoFib, embryonic colon-derived CCD-112-CoN), skin fibroblasts (NHDF-Ad), and colorectal cancer (CRC) cells (HCT116, HT29) grown in monoculture or coculture. Expression of the acid-loading transporter anion exchanger 2 (AE2) (SLC4A2 product) was detected in myofibroblasts and fibroblasts, but not in CRC cells. Compared with CRC cells, Hs675.T and InMyoFib myofibroblasts had very high capacity to absorb extracellular acid. Acid uptake into CCD-112-CoN and NHDF-Ad cells was slower and comparable to levels in CRC cells, but increased alongside SLC4A2 expression under stimulation with transforming growth factor β1 (TGFβ1), a cytokine involved in cancer–stroma interplay. Myofibroblasts and fibroblasts are connected by gap junctions formed by proteins such as connexin-43, which allows the absorbed acid load to be transmitted across the stromal syncytium. To match the stimulatory effect on acid uptake, cell-to-cell coupling in NHDF-Ad and CCD-112-CoN cells was strengthened with TGFβ1. In contrast, acid transmission was absent between CRC cells, even after treatment with TGFβ1. Thus, stromal cells have the necessary molecular apparatus for assembling an acid-venting route that can improve the flow of metabolic acid through tumors. Importantly, the activities of stromal AE2 and connexin-43 do not place an energetic burden on cancer cells, allowing resources to be diverted for other activities. PMID:27543333

  1. Cooperative Brønsted Acid-Type Organocatalysis for the Stereoselective Synthesis of Deoxyglycosides

    PubMed Central


    A practical approach for the α-stereoselective synthesis of deoxyglycosides using cooperative Brønsted acid-type organocatalysis has been developed. The method is tolerant of a wide range of glycoside donors and acceptors, and its versatility is exemplified in the one-pot synthesis of a trisaccharide. Mechanistic studies suggest that thiourea-induced acid amplification of the chiral acid via H-bonding is key for the enhancement in reaction rate and yield, while stereocontrol is dependent on the chirality of the acid. PMID:28004941

  2. Growth differentiation factor-9 stimulates progesterone synthesis in granulosa cells via a prostaglandin E2/EP2 receptor pathway.


    Elvin, J A; Yan, C; Matzuk, M M


    Growth differentiation factor-9 (GDF-9), an oocyte-secreted member of the transforming growth factor beta superfamily, progesterone receptor, cyclooxygenase 2 (Cox2; Ptgs2), and the EP2 prostaglandin E(2) (PGE(2)) receptor (EP2; Ptgerep2) are required for fertility in female but not male mice. To define the interrelationship of these factors, we used a preovulatory granulosa cell culture system in which we added recombinant GDF-9, prostaglandins, prostaglandin receptor agonists, or cyclooxygenase inhibitors. GDF-9 stimulated Cox2 mRNA within 2 h, and PGE(2) within 6 h; however, progesterone was not increased until 12 h after addition of GDF-9. This suggested that Cox2 is a direct downstream target of GDF-9 but that progesterone synthesis required an intermediate. To determine whether prostaglandin synthesis was required for progesterone production, we analyzed the effects of PGE(2) and cyclooxygenase inhibitors on this process. PGE(2) can stimulate progesterone synthesis by itself, although less effectively than GDF-9 (3-fold vs. 6-fold increase over 24 h, respectively). Furthermore, indomethacin or NS-398, inhibitors of Cox2, block basal and GDF-9-stimulated progesterone synthesis. However, addition of PGE(2) to cultures containing both GDF-9 and NS-398 overrides the NS-398 block in progesterone synthesis. To further define the PGE(2)-dependent pathway, we show that butaprost, a specific EP2 agonist, stimulates progesterone synthesis and overrides the NS-398 block. In addition, GDF-9 stimulates EP2 mRNA synthesis by a prostaglandin- and progesterone-independent pathway. Thus, GDF-9 induces an EP2 signal transduction pathway which appears to be required for progesterone synthesis in cumulus granulosa cells. These studies further demonstrate the importance of oocyte-somatic cell interactions in female reproduction.

  3. Ethacrynic acid inhibits multiple steps in the NF-kappaB signaling pathway.


    Han, Yusheng; Englert, Joshua A; Delude, Russell L; Fink, Mitchell P


    Ethacrynic acid has been used as a safe and effective diuretic for more than 30 years. In this study, we tested the hypothesis that ethacrynic acid is also an anti-inflammatory agent that inhibits signaling by the proinflammatory transcription factor NF-kappaB. We showed that ethacrynic acid inhibited luciferase expression in lipopolysaccharide-stimulated macrophage-like RAW 264.7 cells transfected with an NF-kappaB-dependent luciferase reporter vector and also inhibited NF-kappaB DNA binding in lipopolysaccharide-stimulated RAW 264.7 cells (electrophoretic mobility shift assay). Ethacrynic acid inhibited degradation of IkappaBalpha and IkappaBbeta in lipopolysaccharide-stimulated RAW 264.7 cells. Ethacrynic acid impaired DNA binding of wild-type p65 subunits of NF-kappaB in cells. However, DNA binding of a Cys--> Ser p65 mutant was not inhibited by ethacrynic acid, suggesting that ethacrynic acid inhibits DNA binding by alkylating p65 at Cys. In a cell-free system, binding of p50 homodimers to an NF-kappaB consensus sequence was inhibited by ethacrynic acid at concentrations from 10 to 100 microM, indicating that ethacrynic acid probably also covalently modifies the p50 subunit. These data indicate that ethacrynic acid inhibits activation of the NF-kappaB pathway at multiple points and suggest that this well-studied drug warrants further investigation as a potential therapeutic for various conditions that are associated with excessive inflammation.

  4. Exogenous amino acids stimulate net muscle protein synthesis in the elderly.

    PubMed Central

    Volpi, E; Ferrando, A A; Yeckel, C W; Tipton, K D; Wolfe, R R


    We have investigated the response of amino acid transport and protein synthesis in healthy elderly individuals (age 71+/-2 yr) to the stimulatory effect of increased amino acid availability. Muscle protein synthesis and breakdown, and amino acid transport were measured in the postabsorptive state and during the intravenous infusion of an amino acid mixture. Muscle-free amino acid kinetics were calculated by means of a three compartment model using data obtained by femoral arterio-venous catheterization and muscle biopsies from the vastus lateralis during the infusion of stable isotope tracers of amino acids. In addition, muscle protein fractional synthetic rate (FSR) was measured. Peripheral amino acid infusion significantly increased amino acid delivery to the leg, amino acid transport, and muscle protein synthesis when measured either with the three compartment model (P < 0.05) or with the traditional precursor-product approach (FSR increased from 0. 0474+/-0.0054 to 0.0940+/-0.0143%/h, P < 0.05). Because protein breakdown did not change during amino acid infusion, a positive net balance of amino acids across the muscle was achieved. We conclude that, although muscle mass is decreased in the elderly, muscle protein anabolism can nonetheless be stimulated by increased amino acid availability. We thus hypothesize that muscle mass could be better maintained with an increased intake of protein or amino acids. PMID:9576765

  5. Protein Analysis of Sapienic Acid-Treated Porphyromonas gingivalis Suggests Differential Regulation of Multiple Metabolic Pathways

    PubMed Central

    Dawson, Deborah V.; Blanchette, Derek R.; Drake, David R.; Wertz, Philip W.; Brogden, Kim A.


    ABSTRACT Lipids endogenous to skin and mucosal surfaces exhibit potent antimicrobial activity against Porphyromonas gingivalis, an important colonizer of the oral cavity implicated in periodontitis. Our previous work demonstrated the antimicrobial activity of the fatty acid sapienic acid (C16:1Δ6) against P. gingivalis and found that sapienic acid treatment alters both protein and lipid composition from those in controls. In this study, we further examined whole-cell protein differences between sapienic acid-treated bacteria and untreated controls, and we utilized open-source functional association and annotation programs to explore potential mechanisms for the antimicrobial activity of sapienic acid. Our analyses indicated that sapienic acid treatment induces a unique stress response in P. gingivalis resulting in differential expression of proteins involved in a variety of metabolic pathways. This network of differentially regulated proteins was enriched in protein-protein interactions (P = 2.98 × 10−8), including six KEGG pathways (P value ranges, 2.30 × 10−5 to 0.05) and four Gene Ontology (GO) molecular functions (P value ranges, 0.02 to 0.04), with multiple suggestive enriched relationships in KEGG pathways and GO molecular functions. Upregulated metabolic pathways suggest increases in energy production, lipid metabolism, iron acquisition and processing, and respiration. Combined with a suggested preferential metabolism of serine, which is necessary for fatty acid biosynthesis, these data support our previous findings that the site of sapienic acid antimicrobial activity is likely at the bacterial membrane. IMPORTANCE P. gingivalis is an important opportunistic pathogen implicated in periodontitis. Affecting nearly 50% of the population, periodontitis is treatable, but the resulting damage is irreversible and eventually progresses to tooth loss. There is a great need for natural products that can be used to treat and/or prevent the overgrowth of

  6. The inhibitory effect of glycolic acid and lactic acid on melanin synthesis in melanoma cells.


    Usuki, Akiko; Ohashi, Akiko; Sato, Hirofumi; Ochiai, Yasunobu; Ichihashi, Masamitsu; Funasaka, Yoko


    Alpha-hydroxy acids (AHAs) such as glycolic acid (GA) and lactic acid (LA) have been reported to be effective in treating pigmentary lesions such as melasma, solar lentigines, and postinflammatory hyperpigmentation. The mechanism of this effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion. However, the direct effect of AHAs on melanin synthesis has not yet been well studied. To elucidate such a direct effect of AHAs on melanogenesis, we performed melanin assays, growth curve determinations, Northern and Western blotting for melanogenic proteins [tyrosinase, tyrosinase related protein (TRP)-1 and TRP-2], and tyrosinase and, 4-dihydroxyphenylalaninechrome tautomerase enzyme activity assays using mouse B16 and human melanoma cells. GA or LA (at doses of 300 or 500 microg/ml) inhibited melanin formation in similar dose-dependent manner, without affecting cell growth. Although the mRNA and protein expression or molecular size of tyrosinase, TRP-1 and TRP-2 were not affected, tyrosinase activity was inhibited. To see whether GA and/or LA directly inhibit tyrosinase catalytic function, the effect of GA and LA on human tyrosinase purified from the melanosome-rich large granule fraction of human melanoma cells was performed. GA or LA were shown to inhibit tyrosinase enzyme activity directly, but this effect was not due to the acidity of GA or LA, because adjusting the pH to 5.6 (the pH of GA and LA at concentrations of 2500 microg/ml), did not affect tyrosinase activity. Taken together, these results show that GA and LA suppress melanin formation by directly inhibiting tyrosinase activity, an effect independent of their acidic nature. GA and LA might work on pigmentary lesions not only by accelerating the turnover of the epidermis but also by directly inhibiting melanin formation in melanocytes.

  7. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng


    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  8. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress

    PubMed Central

    Simón, María Victoria; Agnolazza, Daniela L.; German, Olga Lorena; Garelli, Andrés; Politi, Luis E.; Agbaga, Martin-Paul; Anderson, Robert E.; Rotstein, Nora P.


    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat (PQ) and hydrogen peroxide (H2O2). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. PMID:26662863

  9. Simultaneous synthesis of 2-phenylethanol and L-homophenylalanine using aromatic transaminase with yeast Ehrlich pathway.


    Hwang, Joon-Young; Park, Jihyang; Seo, Joo-Hyun; Cha, Minho; Cho, Byung-Kwan; Kim, Juhan; Kim, Byung-Gee


    2-Phenylethanol is a widely used aroma compound with rose-like fragrance and L-homophenylalanine is a building block of angiotensin-converting enzyme (ACE) inhibitor. 2-phenylethanol and L-homophenylalanine were synthesized simultaneously with high yield from 2-oxo-4-phenylbutyric acid and L-phenylalanine, respectively. A recombinant Escherichia coli harboring a coupled reaction pathway comprising of aromatic transaminase, phenylpyruvate decarboxylase, carbonyl reductase, and glucose dehydrogenase (GDH) was constructed. In the coupled reaction pathway, the transaminase reaction was coupled with the Ehrlich pathway of yeast; (1) a phenylpyruvate decarboxylase (YDR380W) as the enzyme to generate the substrate for the carbonyl reductase from phenylpyruvate (i.e., byproduct of the transaminase reaction) and to shift the reaction equilibrium of the transaminase reaction, and (2) a carbonyl reductase (YGL157W) to produce the 2-phenylethanol. Selecting the right carbonyl reductase showing the highest activity on phenylacetaldehyde with narrow substrate specificity was the key to success of the constructing the coupling reaction. In addition, NADPH regeneration was achieved by incorporating the GDH from Bacillus subtilis in the coupled reaction pathway. Based on 40 mM of L-phenylalanine used, about 96% final product conversion yield of 2-phenylethanol was achieved using the recombinant E. coli.

  10. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.


    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  11. An unexpected reaction pathway in the synthesis of the ABCE framework of strychnine-type alkaloids - A multidisciplinary study

    NASA Astrophysics Data System (ADS)

    Šoral, Michal; Markus, Jozef; Doháňošová, Jana; Šoralová, Stanislava; Dvoranová, Dana; Chyba, Andrej; Moncol, Ján; Berkeš, Dušan; Liptaj, Tibor


    Acid-catalyzed cyclization of spirocyclic 1‧-benzyl-2‧-(prop-2-en-1-yl)spiro[indole-3,3‧-pyrrolidine]-5‧-one (1) was performed. The pentacyclic product of Povarov-like imino-Diels-Alder reaction was isolated in high yield instead of expected tetracyclic aza-Prins intermediate. The unusual exotic alkaloid-type structure of the resulting molecule 2 was unambiguously confirmed by a detailed NMR analysis using a set of 2D NMR spectra including an INADEQUATE experiment. The relative configuration of 2 was predicted from the synthesis mechanism and DFT geometry calculations and independently confirmed using NOESY and residual dipolar coupling (RDC) assisted NMR analysis in stretched crosslinked polystyrene gels. The reversibility of the cycloaddition in aprotic solvents was observed. A new reaction pathway yielding a rare 6-5-5-5 tetracyclic spiroindoline 3 was suggested. The relative configuration within the tetracyclic framework was ultimately proved using Single-crystal X-ray diffraction analysis of compound 4.

  12. Dietary omega-3 fatty acid supplementation increases the rate of muscle protein synthesis in older adults: a randomized controlled trial123

    PubMed Central

    Smith, Gordon I; Atherton, Philip; Reeds, Dominic N; Mohammed, B Selma; Rankin, Debbie; Rennie, Michael J; Mittendorfer, Bettina


    Background: Loss of muscle mass with aging is a major public health concern. Omega-3 (n–3) fatty acids stimulate protein anabolism in animals and might therefore be useful for the treatment of sarcopenia. However, the effect of omega-3 fatty acids on human protein metabolism is unknown. Objective: The objective of this study was to evaluate the effect of omega-3 fatty acid supplementation on the rate of muscle protein synthesis in older adults. Design: Sixteen healthy, older adults were randomly assigned to receive either omega-3 fatty acids or corn oil for 8 wk. The rate of muscle protein synthesis and the phosphorylation of key elements of the anabolic signaling pathway were evaluated before and after supplementation during basal, postabsorptive conditions and during a hyperaminoacidemic-hyperinsulinemic clamp. Results: Corn oil supplementation had no effect on the muscle protein synthesis rate and the extent of anabolic signaling element phosphorylation in muscle. Omega-3 fatty acid supplementation had no effect on the basal rate of muscle protein synthesis (mean ± SEM: 0.051 ± 0.005%/h compared with 0.053 ± 0.008%/h before and after supplementation, respectively; P = 0.80) but augmented the hyperaminoacidemia-hyperinsulinemia–induced increase in the rate of muscle protein synthesis (from 0.009 ± 0.005%/h above basal values to 0.031 ± 0.003%/h above basal values; P < 0.01), which was accompanied by greater increases in muscle mTORSer2448 (P = 0.08) and p70s6kThr389 (P < 0.01) phosphorylation. Conclusion: Omega-3 fatty acids stimulate muscle protein synthesis in older adults and may be useful for the prevention and treatment of sarcopenia. This trial was registered at clinical as NCT00794079. PMID:21159787

  13. Solution phase parallel synthesis and evaluation of MAPK inhibitory activities of close structural analogues of a Ras pathway modulator.


    Lu, Yingchun; Sakamuri, Sukumar; Chen, Quin-Zene; Keng, Yen-Fang; Khazak, Vladimir; Illgen, Katrin; Schabbert, Silke; Weber, Lutz; Menon, Sanjay R


    A solution phase parallel synthesis approach was undertaken to rapidly explore the structure-activity relationship of an inhibitor of the Ras/Raf protein interaction identified from a small molecule compound library. Evaluation of the MAPK pathway signaling inhibitory activity of the synthesized analogues as well as their antiproliferative activity and ability to inhibit soft agar growth were performed.

  14. Necrotrophic pathogens use the salicylic acid signaling pathway to promote disease development in tomato.


    Rahman, Taha Abd El; Oirdi, Mohamed El; Gonzalez-Lamothe, Rocio; Bouarab, Kamal


    Plants use different immune pathways to combat pathogens. The activation of the jasmonic acid (JA)-signaling pathway is required for resistance against necrotrophic pathogens; however, to combat biotrophic pathogens, the plants activate mainly the salicylic acid (SA)-signaling pathway. SA can antagonize JA signaling and vice versa. NPR1 (noninducible pathogenesis-related 1) is considered a master regulator of SA signaling. NPR1 interacts with TGA transcription factors, ultimately leading to the activation of SA-dependent responses. SA has been shown to promote disease development caused by the necrotrophic pathogen Botrytis cinerea through NPR1, by suppressing the expression of two JA-dependent defense genes, proteinase inhibitors I and II. We show here that the transcription factor TGA1.a contributes to disease development caused by B. cinerea in tomato by suppressing the expression of proteinase inhibitors I and II. Finally, we present evidence that the SA-signaling pathway contributes to disease development caused by another necrotrophic pathogen, Alternaria solani, in tomato. Disease development promoted by SA through NPR1 requires the TGA1.a transcription factor. These data highlight how necrotrophs manipulate the SAsignaling pathway to promote their disease in tomato.

  15. A diet-sensitive BAF60a-mediated pathway links hepatic bile acid metabolism to cholesterol absorption and atherosclerosis

    PubMed Central

    Meng, Zhuo-Xian; Wang, Lin; Chang, Lin; Sun, Jingxia; Bao, Jiangyin; Li, Yaqiang; Chen, Y. Eugene; Lin, Jiandie D.


    Summary Dietary nutrients interact with gene networks to orchestrate adaptive responses during metabolic stress. Here we identify Baf60a as a diet-sensitive subunit of the SWI/SNF chromatin-remodeling complexes in the mouse liver that links the consumption of fat- and cholesterol-rich diet to elevated plasma cholesterol levels. Baf60a expression was elevated in the liver following feeding with a western diet. Hepatocyte-specific inactivation of Baf60a reduced bile acid production and cholesterol absorption, and attenuated diet-induced hypercholesterolemia and atherosclerosis in mice. Baf60a stimulates expression of genes involved in bile acid synthesis, modification, and transport through a CAR/Baf60a feedforward regulatory loop. Baf60a is required for the recruitment of the SWI/SNF chromatin-remodeling complexes to facilitate an activating epigenetic switch on target genes. These studies elucidate a regulatory pathway that mediates the hyperlipidemic and atherogenic effects of western diet consumption. PMID:26586440

  16. Coordinated Regulation of Species-Specific Hydroxycinnamic Acid Degradation and Siderophore Biosynthesis Pathways in Agrobacterium fabrum

    PubMed Central

    Baude, Jessica; Vial, Ludovic; Villard, Camille; Campillo, Tony; Lavire, Céline; Nesme, Xavier


    ABSTRACT The rhizosphere-inhabiting species Agrobacterium fabrum (genomospecies G8 of the Agrobacterium tumefaciens species complex) is known to degrade hydroxycinnamic acids (HCAs), especially ferulic acid and p-coumaric acid, via the novel A. fabrum HCA degradation pathway. Gene expression profiles of A. fabrum strain C58 were investigated in the presence of HCAs, using a C58 whole-genome oligoarray. Both ferulic acid and p-coumaric acid caused variations in the expression of more than 10% of the C58 genes. Genes of the A. fabrum HCA degradation pathway, together with the genes involved in iron acquisition, were among the most highly induced in the presence of HCAs. Two operons coding for the biosynthesis of a particular siderophore, as well as genes of the A. fabrum HCA degradation pathway, have been described as being specific to the species. We demonstrate here their coordinated expression, emphasizing the interdependence between the iron concentration in the growth medium and the rate at which ferulic acid is degraded by cells. The coordinated expression of these functions may be advantageous in HCA-rich but iron-starved environments in which microorganisms have to compete for both iron and carbon sources, such as in plant roots. The present results confirm that there is cooperation between the A. fabrum-specific genes, defining a particular ecological niche. IMPORTANCE We previously identified seven genomic regions in Agrobacterium fabrum that were specifically present in all of the members of this species only. Here we demonstrated that two of these regions, encoding the hydroxycinnamic acid degradation pathway and the iron acquisition pathway, were regulated in a coordinated manner. The coexpression of these functions may be advantageous in hydroxycinnamic acid-rich but iron-starved environments in which microorganisms have to compete for both iron and carbon sources, such as in plant roots. These data support the view that bacterial genomic species

  17. Design, synthesis and evaluation of semi-synthetic triazole-containing caffeic acid analogues as 5-lipoxygenase inhibitors.


    De Lucia, Daniela; Lucio, Oscar Méndez; Musio, Biagia; Bender, Andreas; Listing, Monika; Dennhardt, Sophie; Koeberle, Andreas; Garscha, Ulrike; Rizzo, Roberta; Manfredini, Stefano; Werz, Oliver; Ley, Steven V


    In this work the synthesis, structure-activity relationship (SAR) and biological evaluation of a novel series of triazole-containing 5-lipoxygenase (5-LO) inhibitors are described. The use of structure-guided drug design techniques provided compounds that demonstrated excellent 5-LO inhibition with IC50 of 0.2 and 3.2 μm in cell-based and cell-free assays, respectively. Optimization of binding and functional potencies resulted in the identification of compound 13d, which showed an enhanced activity compared to the parent bioactive compound caffeic acid 5 and the clinically approved zileuton 3. Compounds 15 and 16 were identified as lead compounds in inhibiting 5-LO products formation in neutrophils. Their interference with other targets on the arachidonic acid pathway was also assessed. Cytotoxicity tests were performed to exclude a relationship between cytotoxicity and the increased activity observed after structure optimization.

  18. Eicosanoid synthesis in cardiomyocytes: influence of hypoxia, reoxygenation, and polyunsaturated fatty acids.


    Oudot, F; Grynberg, A; Sergiel, J P


    The synthesis of eicosanoids was investigated in cultured rat ventricular myocytes. Under normoxia, the cardiomyocytes released 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha) and prostaglandin (PG) E2 and smaller amounts of PGF2 alpha and thromboxane B2. Hypoxia enhanced the production of PGE2 and PGF2 alpha, whereas the synthesis of 6-keto-PGF1 alpha was not affected. Conversely, posthypoxic reoxygenation greatly increased the synthesis of 6-keto-PGF1 alpha, whereas the synthesis of PGF2 alpha, was not affected and that of PGE2 was reduced. The cardiomyocyte polyunsaturated fatty acid (PUFA) profile was altered by arachidonic acid or eicosapentaenoic acid and docosahexaenoic acid. Under normoxia, the eicosanoid production appeared to be roughly related to the cell phospholipid arachidonic acid content. Conversely, during posthypoxic reoxygenation, the production of eicosanoids was related to the cell phospholipid n-3 PUFA content, with the n-3-rich cells displaying a marked inhibition of the synthesis. This inhibition was mainly attributed to eicosapentaenoic acid and/or docosapentaenoic acid. Whether this inhibition occurs in vivo during postischemic reperfusion, it may contribute to the beneficial effect of n-3 PUFA on the heart.

  19. Metabolic and endocrine modulation of anabolic and catabolic pathways of glucose and fatty acids. I. Chemical anatomy of the major metabolic pathways of the energogenic general function.


    Belloiu, D D; Belloiu, I


    This study is an attempt to integrate the intermediary metabolism of energogenic substrates--glucose and fatty acids--within the framework of the energogenic general function (EGF), which is active in two distinct phases: anabolic and catabolic. EGF is a component of the metabolic general function (MGF), which together with the reproductive general function and the adaptation general function may be taken to represent three main "general functions of organisms" common to all beings, whether animal or vegetal. This initial paper presents, descriptively and graphically, the main anabolic functions and pathways of glucose and fatty acids and, separately, the main catabolic ones, in other words, the "chemical anatomy" of EGF. The study begins with the anabolic "digestive" function of the digestive tract, concerning the digestion and absorption of carbohydrates and proteins. Conversion of the non-absorbable macromolecules of ingested carbohydrates into absorbable micromolecules of glucose, is shown to enable the latter, after absorption, to carry out the two characteristic anabolic processes: transmembrane "transport" and "condensation". Absorption and vehiculation of hydrophobic lipids is carried out by means of the major function of intestinal cells: synthesis of chylomicrons. Chylomicrons are hydrophilic special lipoprotein particles which are able to transport fats to the adipose tissue and cholesterol to the liver. In the liver the anabolic aspects of EGF are represented by two main functions: glycogeno-genesis, i.e. "non-reductive" condensation of glucose into glycogen stores, and lipoproteino-genesis, i.e. "reductive" condensation of glucose into lipoproteins or VLDL (very low density lipoproteins). VLDL are hydrophilic (vehiculable) spheric particles (containing triacylglycerols and cholesteryl esters in their core, and phospholipids, cholesterol and apolipoprotein-B at their surface), which are to be released into the general circulation. The anabolic phase in

  20. The Effect of Multiple Single Nucleotide Polymorphisms in the Folic Acid Pathway Genes on Homocysteine Metabolism

    PubMed Central

    Liang, Shuang; Zhou, Yuanpeng; Wang, Huijun; Qian, Yanyan; Ma, Duan; Tian, Weidong; Persaud-Sharma, Vishwani; Yu, Chen; Ren, Yunyun; Zhou, Shufeng; Li, Xiaotian


    Objective. To investigate the joint effects of the single nucleotide polymorphisms (SNPs) of genes in the folic acid pathway on homocysteine (Hcy) metabolism. Methods. Four hundred women with normal pregnancies were enrolled in this study. SNPs were identified by MassARRAY. Serum folic acid and Hcy concentration were measured. Analysis of variance (ANOVA) and support vector machine (SVM) regressions were used to analyze the joint effects of SNPs on the Hcy level. Results. SNPs of MTHFR (rs1801133 and rs3733965) were significantly associated with maternal serum Hcy level. In the different genotypes of MTHFR (rs1801133), SNPs of RFC1 (rs1051266), TCN2 (rs9606756), BHMT (rs3733890), and CBS (rs234713 and rs2851391) were linked with the Hcy level adjusted for folic acid concentration. The integrated SNPs scores were significantly associated with the residual Hcy concentration (RHC) (r = 0.247). The Hcy level was significantly higher in the group with high SNP scores than that in other groups with SNP scores of less than 0.2 (P = 0.000). Moreover, this difference was even more significant in moderate and high levels of folic acid. Conclusion. SNPs of genes in the folic acid pathway possibly affect the Hcy metabolism in the presence of moderate and high levels of folic acid. PMID:24524080

  1. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis

    PubMed Central

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing


    N-Acetylneuraminic acid lyase (NAL, E.C. number is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a “GRAS” (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  2. The control of ribonucleic acid synthesis in bacteria. The synthesis and stability of ribonucleic acids in relaxed and stringent amino acid auxotrophs of Escherichia coli.


    Gray, W J; Midgley, J E


    The biosynthesis and stability of various RNA fractions was studied in RC(str) and RC(rel) multiple amino acid auxotrophs of Escherichia coli. In conditions of amino acid deprivation, RC(str) mutants were labelled with exogenous nucleotide bases at less than 1% of the rate found in cultures growing normally in supplemented media. Studies by DNA-RNA hybridization and by other methods showed that, during a period of amino acid withdrawal, not more than 60-70% of the labelled RNA formed in RC(str) mutants had the characteristics of mRNA. Evidence was obtained for some degradation of newly formed 16S and 23S rRNA species to heterogeneous material of lower molecular weight. This led to overestimations of the mRNA content of rapidly labelled RNA from such methods as simple examination of sucrose-density-gradient profiles. In RC(rel) strains the absolute and relative rates of synthesis of the various RNA fractions were not greatly affected. However, the stability of about half of the mRNA fraction was increased in RC(rel) strains during amino acid starvation, giving kinetics of mRNA labelling and turnover that were identical with those found in either RC(str) or RC(rel) strains inhibited by high concentrations of chloramphenicol. Coincidence hybridization techniques showed that the mRNA content of amino acid-starved RC(str) auxotrophs was unchanged from that found in normally growing cells. In contrast, RC(rel) strains deprived of amino acids increased their mRNA content about threefold. In such cultures the mRNA content of accumulating newly formed RNA was a constant 16% by wt.

  3. Impact of high altitude on the hepatic fatty acid oxidation and synthesis in rats

    SciTech Connect

    Ni, Qian; Shao, Yuan; Wang, Ying Zhen; Jing, Yu Hong; Zhang, You Cheng


    Highlights: • Acute exposure to high altitude (HA) increased hepatic fatty acid (FA) β-oxidation. • Acute exposure of rats to HA increased hepatic FA synthesis. • PPARα and AMPK can regulate the FA metabolism. • FA may be a key energy fuel and a compensation for CHO during acute exposure to HA. • The acute changes of FA metabolism may be a mechanism of acclimatization. - Abstract: High altitude (HA) affects energy metabolism. The impact of acute and chronic HA acclimatization on the major metabolic pathways is still controversial. In this study, we aimed to unveil the impact of HA on the key enzymes involved in the fatty acid (FA) metabolism in liver. Rats were exposed to an altitude of 4300 m for 30 days and the expressions of two key proteins involved in FA β-oxidation (carnitine palmitoyl transferase I, CPT-I; and peroxisome proliferator-activated receptor alpha, PPARα), two proteins involved in FA synthesis (acetyl CoA carboxylase-1, ACC-1; and AMP-activated protein kinase, AMPK), as well as the total ketone body in the liver and the plasma FFAs were examined. Rats without HA exposure were used as controls. We observed that the acute exposure of rats to HA (3 days) led to a significant increase in the expressions of CPT-I and PPARα and in the total hepatic ketone body. Longer exposure (15 days) caused a marked decrease in the expression of CPT-I and PPARα. By 30 days after HA exposure, the expression levels of CPT-I and PPARα returned to the control level. The hepatic ACC-1 level showed a significant increase in rats exposed to HA for 1 and 3 days. In contrast, the hepatic level of AMPK showed a significant reduction throughout the experimental period. Plasma FFA concentrations did not show any significant changes following HA exposure. Thus, increased hepatic FA oxidation and synthesis in the early phase of HA exposure may be among the important mechanisms for the rats to respond to the hypoxic stress in order to acclimatize themselves to the

  4. Occurrence of Arginine Deiminase Pathway Enzymes in Arginine Catabolism by Wine Lactic Acid Bacteria

    PubMed Central

    Liu, S.; Pritchard, G. G.; Hardman, M. J.; Pilone, G. J.


    l-Arginine, an amino acid found in significant quantities in grape juice and wine, is known to be catabolized by some wine lactic acid bacteria. The correlation between the occurrence of arginine deiminase pathway enzymes and the ability to catabolize arginine was examined in this study. The activities of the three arginine deiminase pathway enzymes, arginine deiminase, ornithine transcarbamylase, and carbamate kinase, were measured in cell extracts of 35 strains of wine lactic acid bacteria. These enzymes were present in all heterofermentative lactobacilli and most leuconostocs but were absent in all the homofermentative lactobacilli and pediococci examined. There was a good correlation among arginine degradation, formation of ammonia and citrulline, and the occurrence of arginine deiminase pathway enzymes. Urea was not detected during arginine degradation, suggesting that the catabolism of arginine did not proceed via the arginase-catalyzed reaction, as has been suggested in some earlier studies. Detection of ammonia with Nessler's reagent was shown to be a simple, rapid test to assess the ability of wine lactic acid bacteria to degrade arginine, although in media containing relatively high concentrations (>0.5%) of fructose, ammonia formation is inhibited. PMID:16534912

  5. Structure and Functional Characterization of a Bile Acid 7α Dehydratase BaiE in Secondary Bile Acid Synthesis

    PubMed Central

    Bhowmik, Shiva; Chiu, Hsien-Po; Jones, David H.; Chiu, Hsiu-Ju; Miller, Mitchell D.; Xu, Qingping; Farr, Carol L.; Ridlon, Jason M.; Wells, James E.; Elsliger, Marc-André; Wilson, Ian A.; Hylemon, Phillip B.; Lesley, Scott A.


    Conversion of the primary bile acids cholic acid (CA) and chenodeoxycholic acid (CDCA) to the secondary bile acids deoxycholic acid (DCA) and lithocholic acid (LCA) is performed by a few species of intestinal bacteria in the genus Clostridium through a multistep biochemical pathway that removes a 7α-hydroxyl group. The rate-determining enzyme in this pathway is bile acid 7α-dehydratase (baiE). In this study, we report crystal structures of apo-BaiE and its putative product-bound (3-oxo-Δ4,6- lithocholyl-Coenzyme A (CoA)) complex. BaiE is a trimer with a twisted α+β barrel fold with similarity to the Nuclear Transport Factor 2 (NTF2) superfamily. Tyr30, Asp35 and His83 form a catalytic triad that is conserved across this family. Site-directed mutagenesis of BaiE from Clostridium scindens VPI 12708 confirmed that these residues are essential for catalysis and also confirmed the importance of other conserved residues, Tyr54 and Arg146, which are involved in substrate binding and affect catalytic turnover. Steady state kinetic studies revealed that the BaiE homologs are able to turn over 3-oxo-Δ4-bile acid and CoA-conjugated 3-oxo-Δ4-bile acid substrates with comparable efficiency questioning the role of CoA-conjugation in the bile acid metabolism pathway. PMID:26650892

  6. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine


    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  7. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.


    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine


    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise.

  8. Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

    PubMed Central


    Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD) 2 and fatty acid elongase (FAE) 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general development of C. sativa should

  9. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  10. Disorders of consciousness and pharmaceuticals that act on oxygen based amino acid and monoamine neurotransmitter pathways of the brain.


    Clauss, Ralf


    Oxygen based neurotransmitters in the synapses of the brain are proposed to play an important role in the generation of consciousness. They include the amino acids glutamate and GABA which use Krebs cycle precursors for their synthesis, and the monoamines dopamine, noradrenalin, adrenalin and serotonin, which are derived from tyrosine and tryptophan. During ischemia after an acute brain injury, a GABA surge often initiates brain suppression. It has been proposed that with chronic ischemia, a secondary, possibly epigenetic response occurs when neurotransmitters deplete, a glucose and oxygen saving mechanism termed neurodormancy that may invoke alternative long term low energy metabolic pathways in the brain, encountered in Disorders of Consciousness. Some medications can reverse Disorders of Consciousness in some patients. Virtually all of them act on neurotransmitter systems that use oxygen as a building block or as an energy source within the brain. Pharmaceuticals that act in the oxygen based amino acid systems of the brain include the GABAergic medications zolpidem and baclofen, while those that act in the monoamine axes include the dopaminergic medications L Dopa, amantadine, bromocriptine, apomorphine and methylphenidate, and the noradrenergic and serotonergic medications desipramine, amitriptyline, protriptyline and fluoxetine. Another group are the cholinesterase inhibitors, responsible for increasing acetylcholine, which is synthesized from the Krebs cycle initiator, acetyl CoA. It appears that pharmaceuticals that are active in the oxygen based neurotransmitter pathways of the brain are successful to arouse to consciousness patients that suffer from its disorders. Research needs to be supported as foundation to understand the biochemical mechanisms that are involved in consciousness disorders and to explore further the pharmacological treatment possibilities for these devastating neurological conditions.

  11. Parallel evolution of Nitric Oxide signaling: Diversity of synthesis & memory pathways

    PubMed Central

    Moroz, Leonid L.; Kohn, Andrea B.


    The origin of NO signaling can be traceable back to the origin of life with the large scale of parallel evolution of NO synthases (NOSs). Inducible-like NOSs may be the most basal prototype of all NOSs and that neuronal-like NOS might have evolved several times from this prototype. Other enzymatic and non-enzymatic pathways for NO synthesis have been discovered using reduction of nitrites, an alternative source of NO. Diverse synthetic mechanisms can co-exist within the same cell providing a complex NO-oxygen microenvironment tightly coupled with cellular energetics. The dissection of multiple sources of NO formation is crucial in analysis of complex biological processes such as neuronal integration and learning mechanisms when NO can act as a volume transmitter within memory-forming circuits. In particular, the molecular analysis of learning mechanisms (most notably in insects and gastropod molluscs) opens conceptually different perspectives to understand the logic of recruiting evolutionarily conserved pathways for novel functions. Giant uniquely identified cells from Aplysia and related species precent unuque opportunities for integrative analysis of NO signaling at the single cell level. PMID:21622160

  12. Stimulation of the Salicylic Acid Pathway Aboveground Recruits Entomopathogenic Nematodes Belowground

    PubMed Central

    Filgueiras, Camila Cramer; Willett, Denis S.; Junior, Alcides Moino; Pareja, Martin; Borai, Fahiem El; Dickson, Donald W.; Stelinski, Lukasz L.; Duncan, Larry W.


    Plant defense pathways play a critical role in mediating tritrophic interactions between plants, herbivores, and natural enemies. While the impact of plant defense pathway stimulation on natural enemies has been extensively explored aboveground, belowground ramifications of plant defense pathway stimulation are equally important in regulating subterranean pests and still require more attention. Here we investigate the effect of aboveground stimulation of the salicylic acid pathway through foliar application of the elicitor methyl salicylate on belowground recruitment of the entomopathogenic nematode, Steinernema diaprepesi. Also, we implicate a specific root-derived volatile that attracts S. diaprepesi belowground following aboveground plant stimulation by an elicitor. In four-choice olfactometer assays, citrus plants treated with foliar applications of methyl salicylate recruited S. diaprepesi in the absence of weevil feeding as compared with negative controls. Additionally, analysis of root volatile profiles of citrus plants receiving foliar application of methyl salicylate revealed production of d-limonene, which was absent in negative controls. The entomopathogenic nematode S. diaprepesi was recruited to d-limonene in two-choice olfactometer trials. These results reinforce the critical role of plant defense pathways in mediating tritrophic interactions, suggest a broad role for plant defense pathway signaling belowground, and hint at sophisticated plant responses to pest complexes. PMID:27136916

  13. Transcriptome analysis of bitter acid biosynthesis and precursor pathways in hop (Humulus lupulus)

    PubMed Central


    Background Bitter acids (e.g. humulone) are prenylated polyketides synthesized in lupulin glands of the hop plant (Humulus lupulus) which are important contributors to the bitter flavour and stability of beer. Bitter acids are formed from acyl-CoA precursors derived from branched-chain amino acid (BCAA) degradation and C5 prenyl diphosphates from the methyl-D-erythritol 4-phosphate (MEP) pathway. We used RNA sequencing (RNA-seq) to obtain the transcriptomes of isolated lupulin glands, cones with glands removed and leaves from high α-acid hop cultivars, and analyzed these datasets for genes involved in bitter acid biosynthesis including the supply of major precursors. We also measured the levels of BCAAs, acyl-CoA intermediates, and bitter acids in glands, cones and leaves. Results Transcripts encoding all the enzymes of BCAA metabolism were significantly more abundant in lupulin glands, indicating that BCAA biosynthesis and subsequent degradation occurs in these specialized cells. Branched-chain acyl-CoAs and bitter acids were present at higher levels in glands compared with leaves and cones. RNA-seq analysis showed the gland-specific expression of the MEP pathway, enzymes of sucrose degradation and several transcription factors that may regulate bitter acid biosynthesis in glands. Two branched-chain aminotransferase (BCAT) enzymes, HlBCAT1 and HlBCAT2, were abundant, with gene expression quantification by RNA-seq and qRT-PCR indicating that HlBCAT1 was specific to glands while HlBCAT2 was present in glands, cones and leaves. Recombinant HlBCAT1 and HlBCAT2 catalyzed forward (biosynthetic) and reverse (catabolic) reactions with similar kinetic parameters. HlBCAT1 is targeted to mitochondria where it likely plays a role in BCAA catabolism. HlBCAT2 is a plastidial enzyme likely involved in BCAA biosynthesis. Phylogenetic analysis of the hop BCATs and those from other plants showed that they group into distinct biosynthetic (plastidial) and catabolic (mitochondrial

  14. Hexanoic acid is a resistance inducer that protects tomato plants against Pseudomonas syringae by priming the jasmonic acid and salicylic acid pathways.


    Scalschi, Loredana; Vicedo, Begonya; Camañes, Gemma; Fernandez-Crespo, Emma; Lapeña, Leonor; González-Bosch, Carmen; García-Agustín, Pilar


    Hexanoic acid-induced resistance (Hx-IR) is effective against several pathogens in tomato plants. Our study of the mechanisms implicated in Hx-IR against Pseudomonas syringae pv. tomato DC3000 suggests that hexanoic acid (Hx) treatment counteracts the negative effect of coronatine (COR) and jasmonyl-isoleucine (JA-Ile) on the salicylic acid (SA) pathway. In Hx-treated plants, an increase in the expression of jasmonic acid carboxyl methyltransferase (JMT) and the SA marker genes PR1 and PR5 indicates a boost in this signalling pathway at the expense of a decrease in JA-Ile. Moreover, Hx treatment potentiates 12-oxo-phytodienoic acid accumulation, which suggests that this molecule might play a role per se in Hx-IR. These results support a positive relationship between the SA and JA pathways in Hx-primed plants. Furthermore, one of the mechanisms of virulence mediated by COR is stomatal re-opening on infection with P. syringae. In this work, we observed that Hx seems to inhibit stomatal opening in planta in the presence of COR, which suggests that, on infection in tomato, this treatment suppresses effector action to prevent bacterial entry into the mesophyll.

  15. Insulin is required for amino acid stimulation of dual pathways for translational control in skeletal muscle in the late-gestation ovine fetus.


    Brown, Laura D; Rozance, Paul J; Barry, James S; Friedman, Jacob E; Hay, William W


    During late gestation, amino acids and insulin promote skeletal muscle protein synthesis. However, the independent effects of amino acids and insulin on the regulation of mRNA translation initiation in the fetus are relatively unknown. The purpose of this study was to determine whether acute amino acid infusion in the late-gestation ovine fetus, with and without a simultaneous increase in fetal insulin concentration, activates translation initiation pathway(s) in skeletal muscle. Fetuses received saline (C), mixed amino acid infusion plus somatostatin infusion to suppress amino acid-stimulated fetal insulin secretion (AA+S), mixed amino acid infusion with concomitant physiological increase in fetal insulin (AA), or high-dose insulin infusion with euglycemia and euaminoacidemia (HI). After a 2-h infusion period, fetal skeletal muscle was harvested under in vivo steady-state conditions and frozen for quantification of proteins both upstream and downstream of mammalian target of rapamycin (mTOR). In the AA group, we found a threefold increase in ribosomal protein S6 kinase (p70(S6k)) and Erk1/2 phosphorylation; however, blocking the physiological rise in insulin with somatostatin in the AA+S group prevented this increase. In the HI group, Akt, Erk1/2, p70(S6k), and ribosomal protein S6 were highly phosphorylated and 4E-binding protein 1 (4E-BP1) associated with eukaryotic initiation factor (eIF)4E decreased by 30%. These data show that insulin is a significant regulator of intermediates involved in translation initiation in ovine fetal skeletal muscle. Furthermore, the effect of amino acids is dependent on a concomitant increase in fetal insulin concentrations, because amino acid infusion upregulates p70(S6k) and Erk only when amino acid-stimulated increase in insulin occurs.

  16. Fatty acid biosynthesis pathways in Methylomicrobium buryatense 5G(B1)


    Demidenko, Aleksandr; Akberdin, Ilya R.; Allemann, Marco; ...


    Methane utilization by methanotrophic bacteria is an attractive application for biotechnological conversion of natural or biogas into high-added-value products. Haloalcaliphilic methanotrophic bacteria belonging to the genus Methylomicrobium are among the most promising strains for methane-based biotechnology, providing easy and inexpensive cultivation, rapid growth, and the availability of established genetic tools. A number of methane bioconversions using these microbial cultures have been discussed, including the derivation of biodiesel, alkanes, and OMEGA-3 supplements. These compounds are derived from bacterial fatty acid pools. Here, we investigate fatty acid biosynthesis in Methylomicrobium buryatense 5G(B1). Most of the genes homologous to typical Type II fattymore » acid biosynthesis pathways could be annotated by bioinformatics analyses, with the exception of FA transport and regulatory elements. Different approaches for improving fatty acid accumulation were investigated. These studies indicated that both fatty acid degradation and acetyl- and malonyl-CoA levels are bottlenecks for higher level fatty acid production. The best strain generated in this study synthesizes 111 ± 2 mg/gDCW of extractable fatty acids, which is ~20% more than the original strain. A candidate gene for FA-biosynthesis regulation, farE, was identified and studied. Its deletion resulted in drastic changes to the FA profile, leading to an increased pool of C18-fatty acid methyl ester. The FarE-regulon was further investigated by RNA-seq analysis of gene expression in farE-knockout mutants and farE-overexpressing strains. These gene profiles highlighted a novel set of enzymes and regulators involved in fatty acid biosynthesis. As a result, the gene expression and fatty acid profiles of the different farE-strains support the hypothesis that metabolic fluxes upstream of fatty acid biosynthesis restrict fatty acid production in the methanotroph.« less

  17. Regulation of the Omega-3 Fatty Acid Biosynthetic Pathway in Atlantic Salmon Hepatocytes

    PubMed Central

    Ruyter, Bente; Berge, Gerd Marit; Sun, Yajing; Østbye, Tone-Kari Knutsdatter


    Limited availability of the n-3 fatty acids EPA and DHA have led to an interest in better understanding of the n-3 biosynthetic pathway and its regulation. The biosynthesis of alpha-linolenic acid to EPA and DHA involves several complex reaction steps including desaturation-, elongation- and peroxisomal beta-oxidation enzymes. The aims of the present experiments were to gain more knowledge on how this biosynthesis is regulated over time by different doses and fatty acid combinations. Hepatocytes isolated from salmon were incubated with various levels and combinations of oleic acid, EPA and DHA. Oleic acid led to a higher expression of the Δ6 fatty acid desaturase (fad) genes Δ6fad_a, Δ6fad_b, Δ6fad_c and the elongase genes elovl2 compared with cells cultured in medium enriched with DHA. Further, the study showed rhythmic variations in expression over time. Levels were reached where a further increase in specific fatty acids given to the cells not stimulated the conversion further. The gene expression of Δ6fad_a_and Δ6fad_b responded similar to fatty acid treatment, suggesting a co-regulation of these genes, whereas Δ5fad and Δ6fad_c showed a different regulation pattern. EPA and DHA induced different gene expression patterns, especially of Δ6fad_a. Addition of radiolabelled alpha-linolenic acid to the hepatocytes confirmed a higher degree of elongation and desaturation in cells treated with oleic acid compared to cells treated with DHA. This study suggests a complex regulation of the conversion process of n-3 fatty acids. Several factors, such as that the various gene copies are differently regulated, the gene expression show rhythmic variations and gene expression only affected to a certain level, determines when you get the maximum conversion of the beneficial n-3 fatty acids. PMID:27973547

  18. FabQ, a dual-function dehydratase/isomerase, circumvents the last step of the classical fatty acid synthesis cycle.


    Bi, Hongkai; Wang, Haihong; Cronan, John E


    In the classical anaerobic pathway of unsaturated fatty acid biosynthesis, that of Escherichia coli, the double bond is introduced into the growing acyl chain by the FabA dehydratase/isomerase. Another dehydratase, FabZ, functions in the chain elongation cycle. In contrast, Aerococcus viridans has only a single FabA/FabZ homolog we designate FabQ. FabQ can not only replace the function of E. coli FabZ in vivo, but it also catalyzes the isomerization required for unsaturated fatty acid biosynthesis. Most strikingly, FabQ in combination with E. coli FabB imparts the surprising ability to bypass reduction of the trans-2-acyl-ACP intermediates of classical fatty acid synthesis. FabQ allows elongation by progressive isomerization reactions to form the polyunsaturated fatty acid, 3-hydroxy-cis-5, 7-hexadecadienoic acid, both in vitro and in vivo. FabQ therefore provides a potential pathway for bacterial synthesis of polyunsaturated fatty acids.

  19. FabQ, a Dual-Function Dehydratase/Isomerase, Circumvents the Last Step of the Classical Fatty Acid Synthesis Cycle

    PubMed Central

    Bi, Hongkai; Wang, Haihong; Cronan, John E.


    SUMMARY In the classical anaerobic pathway of unsaturated fatty acid biosynthesis, that of Escherichia coli, the double bond is introduced into the growing acyl chain by the FabA dehydratase/isomerase. Another dehydratase, FabZ, functions in the chain elongation cycle. In contrast, Aerococcus viridans has only a single FabA/FabZ homolog we designate FabQ. FabQ can not only replace the function of E. coli FabZ in vivo, but it also catalyzes the isomerization required for unsaturated fatty acid biosynthesis. Most strikingly, FabQ in combination with E. coli FabB imparts the surprising ability to bypass reduction of the trans-2-acyl-ACP intermediates of classical fatty acid synthesis. FabQ allows elongation by progressive isomerization reactions to form the polyunsaturated fatty acid, 3-hydroxy-cis-5, 7-hexadecadienoic acid, both in vitro and in vivo. FabQ therefore provides a potential pathway for bacterial synthesis of polyunsaturated fatty acids. PMID:23972938

  20. Increased long chain acyl-Coa synthetase activity and fatty acid import is linked to membrane synthesis for development of picornavirus replication organelles.


    Nchoutmboube, Jules A; Viktorova, Ekaterina G; Scott, Alison J; Ford, Lauren A; Pei, Zhengtong; Watkins, Paul A; Ernst, Robert K; Belov, George A


    All positive strand (+RNA) viruses of eukaryotes replicate their genomes in association with membranes. The mechanisms of membrane remodeling in infected cells represent attractive targets for designing future therapeutics, but our understanding of this process is very limited. Elements of autophagy and/or the secretory pathway were proposed to be hijacked for building of picornavirus replication organelles. However, even closely related viruses differ significantly in their requirements for components of these pathways. We demonstrate here that infection with diverse picornaviruses rapidly activates import of long chain fatty acids. While in non-infected cells the imported fatty acids are channeled to lipid droplets, in infected cells the synthesis of neutral lipids is shut down and the fatty acids are utilized in highly up-regulated phosphatidylcholine synthesis. Thus the replication organelles are likely built from de novo synthesized membrane material, rather than from the remodeled pre-existing membranes. We show that activation of fatty acid import is linked to the up-regulation of cellular long chain acyl-CoA synthetase activity and identify the long chain acyl-CoA syntheatse3 (Acsl3) as a novel host factor required for polio replication. Poliovirus protein 2A is required to trigger the activation of import of fatty acids independent of its protease activity. Shift in fatty acid import preferences by infected cells results in synthesis of phosphatidylcholines different from those in uninfected cells, arguing that the viral replication organelles possess unique properties compared to the pre-existing membranes. Our data show how poliovirus can change the overall cellular membrane homeostasis by targeting one critical process. They explain earlier observations of increased phospholipid synthesis in infected cells and suggest a simple model of the structural development of the membranous scaffold of replication complexes of picorna-like viruses, that may be

  1. Biosynthesis of gallic acid in Rhus typhina: discrimination between alternative pathways from natural oxygen isotope abundance.


    Werner, Roland A; Rossmann, Andreas; Schwarz, Christine; Bacher, Adelbert; Schmidt, Hanns-Ludwig; Eisenreich, Wolfgang


    The biosynthetic pathway of gallic acid in leaves of Rhus typhina is studied by oxygen isotope ratio mass spectrometry at natural oxygen isotope abundance. The observed delta18O-values of gallic acid indicate an 18O-enrichment of the phenolic oxygen atoms of more than 30 per thousand above that of the leaf water. This enrichment implies biogenetical equivalence with oxygen atoms of carbohydrates but not with oxygen atoms introduced by monooxygenase activation of molecular oxygen. It can be concluded that all phenolic oxygen atoms of gallic acid are retained from the carbohydrate-derived precursor 5-dehydroshikimate. This supports that gallic acid is synthesized entirely or predominantly by dehydrogenation of 5-dehydroshikimate.

  2. [Metabolic pathway and metabolites of total diterpene acid isolated from Pseudolarix kaempferi].


    Liu, Peng; Guo, Hong-Zhu; Sun, Jiang-Hao; Xu, Man; Guo, Hui; Sun, Shi-Feng; Guo, De-An


    The preliminary metabolic profile of total diterpene acid (TDA) isolated from Pseudolarix kaempferi was investigated by using in vivo and in vitro tests. Pseudolaric acid C2 (PC2) was identified as the predominant metabolite in plasma, urine, bile and feces after both oral and intravenous administrations to rats using HPLC-UV and HPLC-ESI/MS(n), and demethoxydeacetoxypseudolaric acid B (DDPB), a metabolite proposed to be the glucoside of PC2 (PC2G), as well as pseudolaric acid C (PC), pseudolaric acid A (PA), pseudolaric acid A O-beta-D glucopyranoside (PAG), pseudolaric acid B O-beta-D glucopyranoside (PBG) and deacetylpseudolaric acid A (DPA) originated from TDA could also be detected. It was demonstrated by tests that the metabolism of TDA is independent of intestinal microflora, and neither of pepsin and trypsin is in charge of metabolism of TDA, TDA is also stable in both pH environments of gastric tract and intestinal tract. The metabolites of TDA in whole blood in vitro incubation were found to be PC2, DDPB and PC2G, which demonstrated that the metabolic reaction of TDA in vivo is mainly occurred in blood and contributed to be the hydrolysis of plasma esterase to ester bond, as well as the glucosylation reaction. These results clarified the metabolic pathway of TDA for the first time, which is of great significance to the in vivo active form and acting mechanism research of P. kaempferi.

  3. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.


    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  4. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf


    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  5. Prolonged stimulation of protein synthesis by leucine is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leucine is unique among the amino acids in its ability to enhance protein synthesis by activating translation initiation (Kimball and Jefferson, 2005). Our laboratory has shown that raising leucine to postprandial levels, whilst keeping all other amino acids at the post absorptive, level acutely st...

  6. Pyrazinoic acid decreases the proton motive force, respiratory ATP synthesis activity, and cellular ATP levels.


    Lu, Ping; Haagsma, Anna C; Pham, Hoang; Maaskant, Janneke J; Mol, Selena; Lill, Holger; Bald, Dirk


    Pyrazinoic acid, the active form of the first-line antituberculosis drug pyrazinamide, decreased the proton motive force and respiratory ATP synthesis rates in subcellular mycobacterial membrane assays. Pyrazinoic acid also significantly lowered cellular ATP levels in Mycobacterium bovis BCG. These results indicate that the predominant mechanism of killing by this drug may operate by depletion of cellular ATP reserves.

  7. Facile synthesis of nucleic acid-polymer amphiphiles and their self-assembly.


    Jia, Fei; Lu, Xueguang; Tan, Xuyu; Zhang, Ke


    A solid-phase synthesis for nucleic acid-polymer amphiphiles is developed. Using this strategy, several DNA-b-polymer amphiphiles are synthesized, and their self-assembly in aqueous solution is investigated. This general method can in principle be extended to nearly all polymers synthesized by atom transfer radical polymerization to produce a variety of nucleic acid-polymer conjugates.

  8. Synthesis of Nucleic Acid and Protein in L Cells Infected with the Agent of Meningopneumonitis

    PubMed Central

    Schechter, Esther M.


    Schechter, Esther M. (The University of Chicago, Chicago, Ill.). Synthesis of nucleic acid and protein in L cells infected with the agent of meningopneumonitis. J. Bacteriol. 91:2069–2080. 1966.—Synthesis of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein in uninfected L cells and in L cells infected with the meningopneumonitis agent was compared by measuring rates of incorporation of H3-cytidine and C14-lysine into nuclear, cytoplasmic, and agent fractions in successive 5-hr periods during the meningopneumonitis growth cycle. Synthesis of meningopneumonitis DNA, RNA, and protein was first clearly evident in the labeling period 15 to 20 hr after infection, soon after initiation of agent multiplication. The rates of synthesis of agent DNA, RNA, and protein increased logarithmically for a brief period and then declined. However, rates of isotope incorporation into all three meningopneumonitis macromolecules were sustained at near maximal values throughout the remainder of the meningopneumonitis growth cycle. These data are most readily interpreted in terms of multiplication of the meningopneumonitis agent by binary fission. The L cell response to infection was a decreased rate of DNA and RNA synthesis and an accelerated rate of cell death. Host protein synthesis was unaffected. The inhibition of nucleic acid synthesis in infected L cells probably involved competition between host and parasite for nucleic acid precursors. Different sublines of L cells varied greatly in the degree to which their nucleic acid-synthesizing mechanisms were damaged by infection. The cytoplasm of infected L cells contained newly synthesized DNA and RNA that could not be accounted for as intact meningopneumonitis cells. This nucleic acid probably arose from disintegration of the fragile intracellular forms of the meningopneumonitis agent. Images PMID:5937251

  9. Ellagic acid checks lymphoma promotion via regulation of PKC signaling pathway.


    Mishra, Sudha; Vinayak, Manjula


    Protein Kinase C (PKC) isozymes are key components involved in cell proliferation and their over activation leads to abnormal tumor growth. PKC follows signalling pathway by activation of downstream gene NF-kB and early transcription factor c-Myc. Over activation of NF-kB and c-Myc gene are also linked with unregulated proliferation of cancer cells. Therefore any agent which can inhibit the activation of Protein kinase C, NF-kB and c-Myc may be useful in reducing cancer progression. To investigate this hypothesis we have tested the effect of ellagic acid on these genes in Dalton's lymphoma bearing (DL). The role of ellagic acid was also tested in regulation of tumor suppressor gene Transforming growth factor-β1 (TGF-β1). DL mice were treated with three different doses (40, 60 and 80 mg/kg body weight) of ellagic acid. Ascites cells of mice were used for the experiments. Ellagic acid administration to DL mice decreased oxidative stress by reducing lipid peroxidation. Ellagic acid also down regulates the expression of classical isozymes of PKC i.e. PKCα, PKCβ, and PKCγ as well as activity of total PKC and NF-kB, indicating its antitumor action. The anticarcinogenic action of ellagic acid was also confirmed by up regulation of TGF-β1 and down regulation of c-Myc. Lymphoma prevention by ellagic acid is further supported by decrease in cell proliferation, cell viability, ascites fluid accumulation and increase in life span of DL mice. All these findings suggest that ellagic acid prevents the cancer progression by down regulation of PKC signaling pathway leading to cell proliferation.

  10. Biochemical and Structural Characterization of a Ureidoglycine Aminotransferase in the Klebsiella pneumoniae Uric Acid Catabolic Pathway

    SciTech Connect

    French, Jarrod B.; Ealick, Steven E.


    Many plants, fungi, and bacteria catabolize allantoin as a mechanism for nitrogen assimilation. Recent reports have shown that in plants and some bacteria the product of hydrolysis of allantoin by allantoinase is the unstable intermediate ureidoglycine. While this molecule can spontaneously decay, genetic analysis of some bacterial genomes indicates that an aminotransferase may be present in the pathway. Here we present evidence that Klebsiella pneumoniae HpxJ is an aminotransferase that preferentially converts ureidoglycine and an {alpha}-keto acid into oxalurate and the corresponding amino acid. We determined the crystal structure of HpxJ, allowing us to present an explanation for substrate specificity.

  11. Cross-talk between TLR4 and PPARγ pathways in the arachidonic acid-induced inflammatory response in pancreatic acini.


    Mateu, A; Ramudo, L; Manso, M A; De Dios, I


    Arachidonic acid (AA) is generally associated with inflammation in different settings. We assess the molecular mechanisms involved in the inflammatory response exerted by AA on pancreatic acini as an approach to acute pancreatitis (AP). Celecoxib (COX-2 inhibitor), TAK-242 (TLR4 inhibitor) and 15d-PGJ2 (PPARγ agonist) were used to ascertain the signaling pathways. In addition, we examine the effects of TAK-242 and 15d-PGJ2 on AP induced in rats by bile-pancreatic duct obstruction (BPDO). To carry out in vitro studies, acini were isolated from pancreas of control rats. Generation of PGE2 and TXB2, activation of pro-inflammatory pathways (MAPKs, NF-κB, and JAK/STAT3) and overexpression of CCL2 and P-selectin was found in AA-treated acini. In addition, AA up-regulated TLR4 and down-regulated PPARγ expression. Celecoxib prevented the up-regulation of CCL2 and P-selectin but did not show any effect on the AA-mediated changes in TLR4 and PPARγ expression. TAK-242, reduced the generation of AA metabolites and repressed both the cascade of pro-inflammatory events which led to CCL2 and P-selectin overexpression as well as the AA-induced PPARγ down-regulation. Thus, TLR4 acts as upstream activating pro-inflammatory and inhibiting anti-inflammatory pathways. 15d-PGJ2 down-regulated TLR4 expression and hence prevented the synthesis of AA metabolites and the inflammatory response mediated by them. Reciprocal negative cross-talk between TLR4 and PPARγ pathways is evidenced. In vivo experiments showed that TAK-242 and 15d-PGJ2 treatments reduced the inflammatory response in BPDO-induced AP. We conclude that through TLR4-dependent mechanisms, AA up-regulated CCL2 and P-selectin in pancreatic acini, partly mediated by the generation of PGE2 and TXB2, which activated pro-inflammatory pathways, but also directly by down-regulating PPARγ expression with anti-inflammatory activity. In vitro and in vivo studies support the role of TLR4 in AP and the use of TLR4 inhibitors and

  12. Total synthesis of racemic and (R) and (S)-4-methoxyalkanoic acids and their antifungal activity.


    Das, Biswanath; Shinde, Digambar Balaji; Kanth, Boddu Shashi; Kamle, Avijeet; Kumar, C Ganesh


    The total synthesis of 4-methoxydecanoic acid and 4-methoxyundecanoic acid in racemic and stereoselective [(R) and (S)] forms has been accomplished. For stereoselective synthesis of the compounds (S) and (R)-BINOL complexes have been used to generate the required chiral centres. The antifungal activity of these compounds has been studied against different organisms and the results were found to be impressive. The activity of the compounds in racemic and in stereoselective forms was compared. (R)-4-Methoxydecanoic acid was found to be most potent (MIC: 0.019 mg/mL against Candida albicans MTCC 227, C. albicans MTCC 4748, Aspergillus brasiliensis (niger) MTCC 281 and Issatchenkia orientalis MTCC 3020).

  13. Final Step of Phosphatidic Acid Synthesis in Pea Chloroplasts Occurs in the Inner Envelope Membrane 1

    PubMed Central

    Andrews, Jaen; Ohlrogge, John B.; Keegstra, Kenneth


    The second enzyme of phosphatidic acid synthesis from glycerol-3-phosphate, 1-acylglycerophospate acyltransferase, was localized to the inner envelope membrane of pea chloroplasts. The activity of this enzyme was measured by both a coupled enzyme assay and a direct enzyme assay. Using the coupled enzyme assay, phosphatidic acid phosphatase was also localized to the inner envelope membrane, although this enzyme has very low activity in pea chloroplasts. The addition of UDP-galactose to unfractionated pea chloroplast envelope preparations did not result in significant conversion of newly synthesized diacylglycerol to monogalactosyldiacylglycerol. Thus, the envelope synthesized phosphatidic acid may not be involved in galactolipid synthesis in pea chloroplasts. PMID:16664266

  14. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.


    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  15. Formamide Synthesis through Borinic Acid Catalysed Transamidation under Mild Conditions.


    Dine, Tharwat Mohy El; Evans, David; Rouden, Jacques; Blanchet, Jérôme


    A highly efficient and mild transamidation of amides with amines co-catalysed by borinic acid and acetic acid has been reported. A wide range of functionalised formamides was synthesized in excellent yields, including important chiral α-amino acid derivatives, with minor racemisation being observed. Experiments suggested that the reaction rely on a cooperative catalysis involving an enhanced boron-derived Lewis acidity rather than an improved Brønsted acidity of acetic acid.

  16. Retroconversion of docosapentaenoic acid (n-6): an alternative pathway for biosynthesis of arachidonic acid in Daphnia magna.


    Strandberg, Ursula; Taipale, Sami J; Kainz, Martin J; Brett, Michael T


    The aim of this study was to assess metabolic pathways for arachidonic acid (20:4n-6) biosynthesis in Daphnia magna. Neonates of D. magna were maintained on [(13)C] enriched Scenedesmus obliquus and supplemented with liposomes that contained separate treatments of unlabeled docosapentaenoic acid (22:5n-6), 20:4n-6, linoleic acid (18:2n-6) or oleic acid (18:1n-9). Daphnia in the control treatment, without any supplementary fatty acids (FA) containing only trace amounts of 20:4n-6 (~0.3% of all FA). As expected, the highest proportion of 20:4n-6 (~6.3%) was detected in Daphnia that received liposomes supplemented with this FA. Higher availability of 18:2n-6 in the diet increased the proportion of 18:2n-6 in Daphnia, but the proportion of 20:4n-6 was not affected. Daphnia supplemented with 22:5n-6 contained ~3.5% 20:4n-6 in the lipids and FA specific stable isotope analyses validated that the increase in the proportion of 20:4n-6 was due to retroconversion of unlabeled 22:5n-6. These results suggest that chain shortening of 22:5n-6 is a more efficient pathway to synthesize 20:4n-6 in D. magna than elongation and desaturation of 18:2n-6. These results may at least partially explain the discrepancies noticed between phytoplankton FA composition and the expected FA composition in freshwater cladocerans. Finally, retroconversion of dietary 22:5n-6 to 20:4n-6 indicates Daphnia efficiently retain long chain n-6 FA in lake food webs, which might be important for the nutritional ecology of fish.

  17. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.


    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q


    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  18. Tranexamic acid induces kaolin intake stimulating a pathway involving tachykinin neurokinin 1 receptors in rats.


    Kakiuchi, Hitoshi; Kawarai-Shimamura, Asako; Kuwagata, Makiko; Orito, Kensuke


    Tranexamic acid suppresses post-partum haemorrhage and idiopathic menorrhagia through its anti-fibrinolytic action. Although it is clinically useful, it is associated with high risks of side effects such as emesis. Understanding the mechanisms underlying tranexamic acid-induced emesis is very important to explore appropriate anti-emetic drugs for the prevention and/or suppression of emesis. In this study, we examined the receptors involved in tranexamic acid-induced kaolin intake in rats, which reflects the drug's clinical emetogenic potential in humans. Further, we examined the brain regions activated by administration of tranexamic acid and elucidated pivotal pathways of tranexamic acid-induced kaolin intake. We examined the effects of ondansetron, a 5-hydroxytryptamine 3 receptor antagonist, domperidone, a dopamine 2 receptor antagonist, and aprepitant, a tachykinin neurokinin 1 (NK1) receptor antagonist, on tranexamic acid-induced kaolin intake in rats. Then, we determined the brain regions that showed increased numbers of c-Fos immunoreactive cells. Finally, we examined the effects of an antagonist(s) that reduced tranexamic acid-induced kaolin intake on the increase in c-Fos immunoreactive cells. Aprepitant significantly decreased tranexamic acid-induced kaolin intake. However, neither ondansetron nor domperidone decreased kaolin intake. Tranexamic acid significantly increased c-Fos immunoreactive cells by approximately 5.5-fold and 22-fold in the area postrema and nucleus of solitary tract, respectively. Aprepitant decreased the number of c-Fos immunoreactive cells in both areas. Tranexamic acid induced kaolin intake possibly via stimulation of tachykinin NK1 receptors in rats. The tachykinin NK1 receptor could be targeted to prevent and/or suppress emesis in patients receiving tranexamic acid.

  19. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.


    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  20. Phospholipase D Signaling Pathways and Phosphatidic Acid as Therapeutic Targets in Cancer

    PubMed Central

    Bruntz, Ronald C.; Lindsley, Craig W.


    Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein–coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions. PMID:25244928

  1. Phospholipase D signaling pathways and phosphatidic acid as therapeutic targets in cancer.


    Bruntz, Ronald C; Lindsley, Craig W; Brown, H Alex


    Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein-coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions.

  2. The insulin/TOR signal transduction pathway is involved in the nutritional regulation of juvenile hormone synthesis in Aedes aegypti.


    Pérez-Hedo, Meritxell; Rivera-Perez, Crisalejandra; Noriega, Fernando G


    Juvenile hormone (JH) levels must be modulated to permit the normal progress of development and reproductive maturation in mosquitoes. JH is part of a transduction system that assesses nutritional information and controls reproduction in mosquitoes. Adult female Aedes aegypti show nutritionally-dependent dynamic changes in corpora allata (CA) JH biosynthetic activities. A coordinated expression of most JH biosynthetic enzymes has been described in female pupae and adult mosquitoes; increases or decreases in transcript levels for all the enzymes were concurrent with increases or decreases in JH synthesis; suggesting that transcriptional changes are at least partially responsible for the dynamic changes of JH biosynthesis. The goal of the present study is to identify signaling network components responsible for the nutritional-dependent changes of JH synthesis in the CA of mosquitoes. The insulin/TOR signaling network plays a central role in the transduction of nutritional signals that regulate cell growth and metabolism in insects. These pathways have also been suggested as a link between nutritional signals and JH synthesis regulation in the CA of cockroaches and flies. We used a combination of in vitro studies and in vivo genetic knockdown experiments to explore nutritional signaling pathways in the CA. Our results suggest that the insulin/TOR pathway plays a role in the transduction of the nutritional information that regulates JH synthesis in mosquitoes. Transcriptional regulation of the genes encoding JH biosynthetic enzymes is at least partially responsible for these nutritionally modulated changes of JH biosynthesis.

  3. An integrative model links multiple inputs and signaling pathways to the onset of DNA synthesis in hepatocytes

    PubMed Central

    Huard, Jérémy; Mueller, Stephanie; Gilles, Ernst D; Klingmüller, Ursula; Klamt, Steffen


    During liver regeneration, quiescent hepatocytes re-enter the cell cycle to proliferate and compensate for lost tissue. Multiple signals including hepatocyte growth factor, epidermal growth factor, tumor necrosis factor α, interleukin-6, insulin and transforming growth factor β orchestrate these responses and are integrated during the G1 phase of the cell cycle. To investigate how these inputs influence DNA synthesis as a measure for proliferation, we established a large-scale integrated logical model connecting multiple signaling pathways and the cell cycle. We constructed our model based upon established literature knowledge, and successively improved and validated its structure using hepatocyte-specific literature as well as experimental DNA synthesis data. Model analyses showed that activation of the mitogen-activated protein kinase and phosphatidylinositol 3-kinase pathways was sufficient and necessary for triggering DNA synthesis. In addition, we identified key species in these pathways that mediate DNA replication. Our model predicted oncogenic mutations that were compared with the COSMIC database, and proposed intervention targets to block hepatocyte growth factor-induced DNA synthesis, which we validated experimentally. Our integrative approach demonstrates that, despite the complexity and size of the underlying interlaced network, logical modeling enables an integrative understanding of signaling-controlled proliferation at the cellular level, and thus can provide intervention strategies for distinct perturbation scenarios at various regulatory levels. PMID:22443451

  4. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan


    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  5. Leucine-enriched essential amino acids attenuate muscle soreness and improve muscle protein synthesis after eccentric contractions in rats.


    Kato, Hiroyuki; Suzuki, Hiromi; Mimura, Masako; Inoue, Yoshiko; Sugita, Mayu; Suzuki, Katsuya; Kobayashi, Hisamine


    Eccentric exercise results in prolonged muscle weakness and muscle soreness, which are typical symptoms of muscle damage. Recovery from muscle damage is related to mammalian target of rapamycin (mTOR) activity. Leucine-enriched essential amino acids (LEAAs) stimulate muscle protein synthesis via activation of the mTOR pathway. Therefore, we investigated the effect of LEAAs on muscle protein synthesis and muscle soreness after eccentric contractions (EC). Male Sprague-Dawley rats (9-11 weeks old) were administered an LEAA solution (AminoL40; containing 40 % leucine and 60 % other essential amino acids) at 1 g/kg body weight or distilled water (control) 30 min before and 10 min after EC. Tibialis anterior (TA) muscle was exposed to 500 EC by electrical stimulation under anesthesia. The fractional synthesis rate (FSR; %/h) in the TA muscle was measured by incorporating L-[ring-(2)H5] phenylalanine into skeletal muscle protein. Muscle soreness was evaluated by the paw withdrawal threshold using the Randal-Selitto test with some modifications from 1 to 3 days after EC. The FSR in the EC-control group (0.147 ± 0.016 %/h) was significantly lower than in the sedentary group (0.188 ± 0.016 %/h, p < 0.05). AminoL40 administration significantly mitigated the EC-induced impairment of the FSR (0.172 ± 0.018 %/h). EC decreased the paw withdrawal threshold at 1 and 2 days after EC, which indicated that EC induced muscle soreness. Furthermore, AminoL40 administration alleviated the decreased paw withdrawal threshold. These findings suggest that LEAA supplementation improves the rate of muscle protein synthesis and ameliorates muscle soreness after eccentric exercise.

  6. A Heteromeric Membrane-Bound Prenyltransferase Complex from Hop Catalyzes Three Sequential Aromatic Prenylations in the Bitter Acid Pathway1[OPEN

    PubMed Central

    Li, Haoxun; Ban, Zhaonan; Qin, Hao; Ma, Liya; King, Andrew J.


    Bitter acids (α and β types) account for more than 30% of the fresh weight of hop (Humulus lupulus) glandular trichomes and are well known for their contribution to the bitter taste of beer. These multiprenylated chemicals also show diverse biological activities, some of which have potential benefits to human health. The bitter acid biosynthetic pathway has been investigated extensively, and the genes for the early steps of bitter acid synthesis have been cloned and functionally characterized. However, little is known about the enzyme(s) that catalyze three sequential prenylation steps in the β-bitter acid pathway. Here, we employed a yeast (Saccharomyces cerevisiae) system for the functional identification of aromatic prenyltransferase (PT) genes. Two PT genes (HlPT1L and HlPT2) obtained from a hop trichome-specific complementary DNA library were functionally characterized using this yeast system. Coexpression of codon-optimized PT1L and PT2 in yeast, together with upstream genes, led to the production of bitter acids, but no bitter acids were detected when either of the PT genes was expressed by itself. Stepwise mutation of the aspartate-rich motifs in PT1L and PT2 further revealed the prenylation sequence of these two enzymes in β-bitter acid biosynthesis: PT1L catalyzed only the first prenylation step, and PT2 catalyzed the two subsequent prenylation steps. A metabolon formed through interactions between PT1L and PT2 was demonstrated using a yeast two-hybrid system, reciprocal coimmunoprecipitation, and in vitro biochemical assays. These results provide direct evidence of the involvement of a functional metabolon of membrane-bound prenyltransferases in bitter acid biosynthesis in hop. PMID:25564559

  7. Docosahexaenoic Acid Modulates Invasion and Metastasis of Human Ovarian Cancer via Multiple Molecular Pathways

    PubMed Central

    Wang, Ying-Chun; Wu, Yi-Nan; Wang, Su-Li; Lin, Qing-Hua; He, Ming-Fang; Liu, Qiao-lin; Wang, Jin-Hua


    Objective We investigated the effect of docosahexaenoic acid (DHA) on the invasion and metastasis of ovarian cancer cells (A2780, HO8910, and SKOV-3). Methods Cytotoxicity assay was performed to determine the optimal doses of DHA in this experiment. The effects of DHA on invasion ability were assessed by invasion assay. The expressions of messenger RNA and/or proteins associated with invasion or metastasis were detected by quantitative Real Time-Polymerase Chain Reaction or Western blot. The effect of DHA on cell metastasis was assessed in xenograft model of zebrafish. Results Docosahexaenoic acid and α-linolenic acid could reduce the cell vitalities in dose-dependent manner. However, DHA inhibited the invasion and metastasis of ovarian cancer cells, but α-linolenic acid did not (**P < 0.01). Docosahexaenoic acid could downregulate the expressions of WAVE3, vascular endothelial cell growth factor, and MMP-9, and upregulate KISS-1, TIMP-1, and PPAR-γ, which negatively correlated with cell invasion and metastasis (*P < 0.05). Docosahexaenoic acid restrained the development of subintestinal vessels and cancer cell metastasis in xenograft model of zebrafish (**P < 0.01). Conclusions Docosahexaenoic acid inhibited the invasion and metastasis of ovarian cancer cells in vitro and in vivo through the modulation of NF-κB signaling pathway, suggesting that DHA is a promising candidate for ovarian cancer therapy. PMID:27258728

  8. Synthesis and anticancer activity of novel fluorinated asiatic acid derivatives.


    Gonçalves, Bruno M F; Salvador, Jorge A R; Marín, Silvia; Cascante, Marta


    A series of novel fluorinated Asiatic Acid (AA) derivatives were successfully synthesized, tested for their antiproliferative activity against HeLa and HT-29 cell lines, and their structure activity relationships were evaluated. The great majority of fluorinated derivatives showed stronger antiproliferative activity than AA in a concentration dependent manner. The most active compounds have a pentameric A-ring containing an α,β-unsaturated carbonyl group. The compounds with better cytotoxic activity were then evaluated against MCF-7, Jurkat, PC-3, A375, MIA PaCa-2 and BJ cell lines. Derivative 14 proved to be the most active compound among all tested derivatives and its mechanism of action was further investigated in HeLa cell line. The results showed that compound 14 induced cell cycle arrest in G0/G1 stage as a consequence of up-regulation of p21(cip1/waf1) and p27(kip1) and down-regulation of cyclin D3 and Cyclin E. Furthermore, compound 14 was found to induce caspase driven-apoptosis with activation of caspases-8 and caspase-3 and the cleavage of PARP. The cleavage of Bid into t-Bid, the up-regulation of Bax and the down-regulation of Bcl-2 were also observed after treatment of HeLa cells with compound 14. Taken together, these mechanistic studies revealed the involvement of extrinsic and intrinsic pathways in the apoptotic process induced by compound 14. Importantly, the antiproliferative activity of this compound on the non-tumor BJ human fibroblast cell line is weaker than in the tested cancer cell lines. The enhanced potency (between 45 and 90-fold more active than AA in a panel of cancer cell lines) and selectivity of this new AA derivative warrant further preclinical evaluation.

  9. Amino acid availability regulates S6K1 and protein synthesis in avian insulin-insensitive QM7 myoblasts.


    Tesseraud, Sophie; Bigot, Karine; Taouis, Mohammed


    The regulation of S6K1 by nutritional status and insulin has been recently reported in vivo in chicken muscle despite the relative insulin resistance of this tissue as estimated by phosphatidylinositol 3-kinase (PI3-kinase) activity. The present work aimed to study the impact of amino acids on S6K1 activity in quail muscle (QM7) myoblasts. Firstly, we characterized S6K1 in QM7 cells and demonstrated the absence of insulin receptors in these cells. Secondly, we showed that amino acids in the absence of insulin induced S6K1 phosphorylation on Thr389 and concomitantly increased its enzymatic activity. Amino acid-induced S6K1 activation was inhibited by LY294002 (PI3-kinase inhibitor) and rapamycin (inhibitor of the mammalian target of rapamycin, mTOR), suggesting the involvement of an avian homolog of mTOR. The availability of individual amino acids (methionine or leucine) regulated S6K1 phosphorylation on Thr389 and QM7 protein synthesis. In conclusion, amino acids regulate S6K1 phosphorylation and activity in QM7 cells through the mTOR/PI3-kinase pathway in an insulin-independent manner.

  10. Independent repression of bile acid synthesis and activation of c-Jun N-terminal kinase (JNK) by activated hepatocyte fibroblast growth factor receptor 4 (FGFR4) and bile acids.


    Yu, Chundong; Wang, Fen; Jin, Chengliu; Huang, Xinqiang; McKeehan, Wallace L


    The fibroblast growth factor (FGF) receptor complex is a regulator of adult organ homeostasis in addition to its central role in embryonic development and wound healing. FGF receptor 4 (FGFR4) is the sole FGFR receptor kinase that is significantly expressed in mature hepatocytes. Previously, we showed that mice lacking mouse FGFR4 (mR4(-/-)) exhibited elevated fecal bile acids, bile acid pool size, and expression of liver cholesterol 7alpha-hydroxylase (CYP7A1), the rate-limiting enzyme for canonical neutral bile acid synthesis. To prove that hepatocyte FGFR4 was a negative regulator of cholesterol metabolism and bile acid synthesis independent of background, we generated transgenic mice overexpressing a constitutively active human FGFR4 (CahR4) in hepatocytes and crossed them with the FGFR4-deficient mice to generate CahR4/mR4(-/-) mice. In mice expressing active FGFR4 in liver, fecal bile acid excretion was 64%, bile acid pool size was 47%, and Cyp7a1 expression was 10-30% of wild-type mice. The repressed level of Cyp7a1 expression was resistant to induction by a high cholesterol diet relative to wild-type mice. Expression of CahR4 in mR4(-/-) mouse livers depressed bile acid synthesis below wild-type levels from the elevated levels observed in mR4(-/-). Levels of phosphorylated c-Jun N-terminal kinase (JNK), which is part of a pathway implicated in bile acid-mediated repression of synthesis, was 30% of wild-type levels in mR4(-/-) livers, whereas CahR4 livers exhibited an average 2-fold increase. However, cholate still strongly induced phospho-JNK in mR4(-/-) livers. These results confirm that hepatocyte FGFR4 regulates bile acid synthesis by repression of Cyp7a1 expression. Hepatocyte FGFR4 may contribute to the repression of bile acid synthesis through JNK signaling but is not required for activation of JNK signaling by bile acids.

  11. Stable isotope studies reveal pathways for the incorporation of non-essential amino acids in Acyrthosiphon pisum (pea aphids).


    Haribal, Meena; Jander, Georg


    Plant roots incorporate inorganic nitrogen into the amino acids glutamine, glutamic acid, asparagine and aspartic acid, which together serve as the primary metabolites of nitrogen transport to other tissues. Given the preponderance of these four amino acids, phloem sap is a nutritionally unbalanced diet for phloem-feeding insects. Therefore, aphids and other phloem feeders typically rely on microbial symbionts for the synthesis of essential amino acids. To investigate the metabolism of the four main transport amino acids by the pea aphid (Acyrthosiphon pisum), and its Buchnera aphidicola endosymbionts, aphids were fed defined diets with stable isotope-labeled glutamine, glutamic acid, asparagine or aspartic acid (U-(13)C, U-(15)N; U-(15)N; α-(15)N; or γ-(15)N). The metabolic fate of the dietary (15)N and (13)C was traced using gas chromatography-mass spectrometry (GC-MS). Nitrogen was the major contributor to the observed amino acid isotopomers with one additional unit mass (M+1). However, there was differential incorporation, with the amine nitrogen of asparagine being incorporated into other amino acids more efficiently than the amide nitrogen. Higher isotopomers (M+2, M+3 and M+4) indicated the incorporation of varying numbers of (13)C atoms into essential amino acids. GC-MS assays also showed that, even with an excess of dietary labeled glutamine, glutamic acid, asparagine or aspartic acid, the overall content of these amino acids in aphid bodies was mostly the product of catabolism of dietary amino acids and subsequent re-synthesis within the aphids. Thus, these predominant dietary amino acids are not passed directly to Buchnera endosymbionts for synthesis of essential amino acids, but are rather are produced de novo, most likely by endogenous aphid enzymes.

  12. Identification of the phytosphingosine metabolic pathway leading to odd-numbered fatty acids.


    Kondo, Natsuki; Ohno, Yusuke; Yamagata, Maki; Obara, Takashi; Seki, Naoya; Kitamura, Takuya; Naganuma, Tatsuro; Kihara, Akio


    The long-chain base phytosphingosine is a component of sphingolipids and exists in yeast, plants and some mammalian tissues. Phytosphingosine is unique in that it possesses an additional hydroxyl group compared with other long-chain bases. However, its metabolism is unknown. Here we show that phytosphingosine is metabolized to odd-numbered fatty acids and is incorporated into glycerophospholipids both in yeast and mammalian cells. Disruption of the yeast gene encoding long-chain base 1-phosphate lyase, which catalyzes the committed step in the metabolism of phytosphingosine to glycerophospholipids, causes an ~40% reduction in the level of phosphatidylcholines that contain a C15 fatty acid. We also find that 2-hydroxypalmitic acid is an intermediate of the phytosphingosine metabolic pathway. Furthermore, we show that the yeast MPO1 gene, whose product belongs to a large, conserved protein family of unknown function, is involved in phytosphingosine metabolism. Our findings provide insights into fatty acid diversity and identify a pathway by which hydroxyl group-containing lipids are metabolized.

  13. An Abscisic Acid-Independent Oxylipin Pathway Controls Stomatal Closure and Immune Defense in Arabidopsis

    PubMed Central

    Mondy, Samuel; Tranchimand, Sylvain; Rumeau, Dominique; Boudsocq, Marie; Garcia, Ana Victoria; Douki, Thierry; Bigeard, Jean; Laurière, Christiane; Chevalier, Anne; Castresana, Carmen; Hirt, Heribert


    Plant stomata function in innate immunity against bacterial invasion and abscisic acid (ABA) has been suggested to regulate this process. Using genetic, biochemical, and pharmacological approaches, we demonstrate that (i) the Arabidopsis thaliana nine-specific-lipoxygenase encoding gene, LOX1, which is expressed in guard cells, is required to trigger stomatal closure in response to both bacteria and the pathogen-associated molecular pattern flagellin peptide flg22; (ii) LOX1 participates in stomatal defense; (iii) polyunsaturated fatty acids, the LOX substrates, trigger stomatal closure; (iv) the LOX products, fatty acid hydroperoxides, or reactive electrophile oxylipins induce stomatal closure; and (v) the flg22-mediated stomatal closure is conveyed by both LOX1 and the mitogen-activated protein kinases MPK3 and MPK6 and involves salicylic acid whereas the ABA-induced process depends on the protein kinases OST1, MPK9, or MPK12. Finally, we show that the oxylipin and the ABA pathways converge at the level of the anion channel SLAC1 to regulate stomatal closure. Collectively, our results demonstrate that early biotic signaling in guard cells is an ABA-independent process revealing a novel function of LOX1-dependent stomatal pathway in plant immunity. PMID:23526882

  14. Anterograde transport of horseradish peroxidase in the nigrostriatal pathway after neostriatal kainic acid lesions.


    Walker, P D; McAllister, J P


    We used the anterograde transport of HRP to analyze the nigrostriatal pathway after intrastriatal injections of kainic acid. A total volume of 1 microliter kainic acid (3 nM) was injected unilaterally into the neostriatum of adult rats. After 5, 10, or 35 days, HRP was injected into the ipsilateral substantia nigra. Sections stained for Nissl substance revealed that kainic acid damaged as much as three-quarters of the neostriatum. Lesion sites were characterized by gliosis and the absence of neurons. Alternate sections processed for HRP histochemistry and analyzed with bright- and dark-field microscopy revealed labeled axons and terminals in the lesion site. These findings were consistent in all three time periods. Much of the labeling was similar to that seen in neostriatal of control animals. However, the normal homogeneous pattern of the nigrostriatal terminal field was disrupted in all experimental groups, illustrated by changes in some labeling characteristics in the lesion site. These findings provide morphologic evidence for the preservation of much of the nigrostriatal pathway but indicate that some axons and their terminals may be altered after kainic acid injection.

  15. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.


    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  16. Synthesis of bile acid monosulphates by the isolated perfused rat kidney.

    PubMed Central

    Summerfield, J A; Gollan, J L; Billing, B H


    Perfusion of an isolated rat kidney with labelled bile acids, in a protein-free medium, resulted in the urinary excretion of the labelled bile acid, 3% being converted into polar metabolities in 1h. These metabolities were neither glycine nor taurine conjugates, nor bile acid glucuronides, and on solovolysis yielded the free bile acid. On t.l.c. the metabolite of [24-14C]lithocholic acid had the mobility of lithocholate 3-sulphate. The principal metabolite of [24-14C]chenodeoxycholic acid had the mobility of chenodeoxycholate 7-sulphate; trace amounts appeared as chenodeoxycholate 3-sulphate. [35S]sulphate was incorporated in chenodeoxycholic acid by the kidney, resulting in a similar pattern of sulphation. No disulphate salt of chenodeoxycholic acid was detected. These findings lend support to the hypothesis that renal synthesis may account for some of the bile acid sulphates present in urine in the cholestatic syndrome in man. PMID:942413

  17. Phytosphingosine degradation pathway includes fatty acid α-oxidation reactions in the endoplasmic reticulum.


    Kitamura, Takuya; Seki, Naoya; Kihara, Akio


    Although normal fatty acids (FAs) are degraded via β-oxidation, unusual FAs such as 2-hydroxy (2-OH) FAs and 3-methyl-branched FAs are degraded via α-oxidation. Phytosphingosine (PHS) is one of the long-chain bases (the sphingolipid components) and exists in specific tissues, including the epidermis and small intestine in mammals. In the degradation pathway, PHS is converted to 2-OH palmitic acid and then to pentadecanoic acid (C15:0-COOH) via FA α-oxidation. However, the detailed reactions and genes involved in the α-oxidation reactions of the PHS degradation pathway have yet to be determined. In the present study, we reveal the entire PHS degradation pathway: PHS is converted to C15:0-COOH via six reactions [phosphorylation, cleavage, oxidation, CoA addition, cleavage (C1 removal), and oxidation], in which the last three reactions correspond to the α-oxidation. The aldehyde dehydrogenase ALDH3A2 catalyzes both the first and second oxidation reactions (fatty aldehydes to FAs). In Aldh3a2-deficient cells, the unmetabolized fatty aldehydes are reduced to fatty alcohols and are incorporated into ether-linked glycerolipids. We also identify HACL2 (2-hydroxyacyl-CoA lyase 2) [previous name, ILVBL; ilvB (bacterial acetolactate synthase)-like] as the major 2-OH acyl-CoA lyase involved in the cleavage (C1 removal) reaction in the FA α-oxidation of the PHS degradation pathway. HACL2 is localized in the endoplasmic reticulum. Thus, in addition to the already-known FA α-oxidation in the peroxisomes, we have revealed the existence of FA α-oxidation in the endoplasmic reticulum in mammals.

  18. Lewis Acid Promoted Oxonium Ion Driven Carboamination of Alkynes for the Synthesis of 4-Alkoxy Quinolines.


    Gharpure, Santosh J; Nanda, Santosh K; Adate, Priyanka A; Shelke, Yogesh G


    Lewis acid mediated multisegment coupling cascade is designed for the synthesis of densely substituted 4-alkoxy quinolines via an oxonium ion triggered alkyne carboamination sequence involving C-C and C-N bond formations. Cyclic ether fused-quinolines could also be accessed using this fast, operationally simple, high yielding, chemoselective and functional group tolerant method. Versatility and utility of this methodology is demonstrated by postfunctionalization of products obtained and its use in synthesis of potent drug molecules.

  19. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra


    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  20. An integrated metabonomics and transcriptomics approach to understanding metabolic pathway disturbance induced by perfluorooctanoic acid.


    Peng, Siyuan; Yan, Lijuan; Zhang, Jie; Wang, Zhanlin; Tian, Meiping; Shen, Heqing


    Perfluorooctanoic acid (PFOA) is one of the most representative perfluorinated compounds and liver is the major organ where PFOA is accumulated. Although the multiple toxicities had been reported, its toxicological profile remained unclear. In this study, a systems toxicology strategy integrating liquid chromatography/mass spectrometry-based metabonomics and transcriptomics analyses was applied for the first time to investigate the effects of PFOA on a representative Chinese normal human liver cell line L-02, with focusing on the metabolic disturbance. Fifteen potential biomarkers were identified on metabolic level and most observations were consistent with the altered levels of gene expression. Our results showed that PFOA induced the perturbations in various metabolic processes in L-02 cells, especially lipid metabolism-related pathways. The up-stream mitochondrial carnitine metabolism was proved to be influenced by PFOA treatment. The specific transformation from carnitine to acylcarnitines, which showed a dose-dependent effect, and the expression level of key genes involved in this pathway were observed to be altered correspondingly. Furthermore, the down-stream cholesterol biosynthesis was directly confirmed to be up-regulated by both increased cholesterol content and elevated expression level of key genes. The PFOA-induced lipid metabolism-related effects in L-02 cells started from the fatty acid catabolism in cytosol, fluctuated to the processes in mitochondria, extended to the cholesterol biosynthesis. Many other metabolic pathways like amino acid metabolism and tricarboxylic acid cycle might also be disturbed. The findings obtained from the systems biological research provide more details about metabolic disorders induced by PFOA in human liver.

  1. Alteration of the specificity and regulation of fatty acid synthesis of Escherichia coli by expression of a plant medium-chain acyl-acyl carrier protein thioesterase.


    Voelker, T A; Davies, H M


    The expression of a plant (Umbellularia californica) medium-chain acyl-acyl carrier protein (ACP) thioesterase (BTE) cDNA in Escherichia coli results in a very high level of extractable medium-chain-specific hydrolytic activity but causes only a minor accumulation of medium-chain fatty acids. BTE's full impact on the bacterial fatty acid synthase is apparent only after expression in a strain deficient in fatty acid degradation, in which BTE increases the total fatty acid output of the bacterial cultures fourfold. Laurate (12:0), normally a minor fatty acid component of E. coli, becomes predominant, is secreted into the medium, and can accumulate to a level comparable to the total dry weight of the bacteria. Also, large quantities of 12:1, 14:0, and 14:1 are made. At the end of exponential growth, the pathway of saturated fatty acids is almost 100% diverted by BTE to the production of free medium-chain fatty acids, starving the cells for saturated acyl-ACP substrates for lipid biosynthesis. This results in drastic changes in membrane lipid composition from predominantly 16:0 to 18:1. The continued hydrolysis of medium-chain ACPs by the BTE causes the bacterial fatty acid synthase to produce fatty acids even when membrane production has ceased in stationary phase, which shows that the fatty acid synthesis rate can be uncoupled from phospholipid biosynthesis and suggests that acyl-ACP intermediates might normally act as feedback inhibitors for fatty acid synthase. As the fatty acid synthesis is increasingly diverted to medium chains with the onset of stationary phase, the rate of C12 production increases relative to C14 production. This observation is consistent with activity of the BTE on free acyl-ACP pools, as opposed to its interaction with fatty acid synthase-bound substrates.

  2. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.


    Qi, Zisong; Wang, Mei; Li, Xingwei


    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  3. Orthogonally Protected Furanoid Sugar Diamino Acids for Solid-Phase Synthesis of Oligosaccharide Mimetics.


    John, Franklin; Wittmann, Valentin


    Sugar diamino acids (SDAs), which differ from the widely used sugar amino acids in the presence of a second amino group connected to the carbohydrate core, share structural features of both amino acids and carbohydrates. They can be used for the preparation of linear and branched amide-linked oligosaccharide mimetics. Such oligomers carry free amino groups, which are positively charged at neutral pH, in a spatially defined way and, thus, represent a potential class of aminoglycoside mimetics. We report here the first examples of orthogonally protected furanoid SDAs and their use in solid-phase synthesis. Starting from d-glucose, we developed a divergent synthetic route to three derivatives of 3,5-diamino-3,5-dideoxy-d-ribofuranose. These building blocks are compatible with solid-phase peptide synthesis following the 9-fluorenylmethoxycarbonyl (Fmoc) strategy, which we demonstrate by the synthesis of an SDA tetramer.

  4. Alfa-lipoic acid protects testosterone secretion pathway and sperm quality against 4-tert-octylphenol induced reproductive toxicity.


    Othman, Azza I; El-Missiry, Mohamed A; Koriem, Khaled M; El-Sayed, Aml A


    The protective effect of α-lipoic acid (LA) (50 mg/kg bw) against 4-tert-octylphenol (OP) (50 mg/kg bw) induced reproductive toxicity in male rats was studied. LA was injected 1h prior to OP administration three times a week. OP caused significant increase in oxidative stress in hypothalamus and epididymal sperm, disturbed hormonal levels in serum, decreased sperm quality, increased DNA fragmentation and loss of 35 and 95 kDa proteins in sperm, as well as elevated proliferating index in testis. LA protected against oxidative stress through promoting the levels of glutathione and glutathione-S-transferase in hypothalamus and sperm. In addition, LA prevented the decrease in testosterone, dehydroepiandrosterone sulfate, 3β-hydroxysteroid dehydrogenase, and inhibited the elevations in sex-hormone-binding globulin levels and showed normal sperm quality. LA modulated proliferation of germ cell, protected against DNA fragmentation and maintained membrane protein organization in the sperm. In conclusion, LA normalized oxidative stress and protected testosterone synthesis pathway across hypothalamus-testicular axis and sperm quality indicating its defensive influence against OP-induced oxidative reproductive dysfunction in male rats.

  5. Gallic Acid Enriched Fraction of Phyllanthus emblica Potentiates Indomethacin-Induced Gastric Ulcer Healing via e-NOS-Dependent Pathway.


    Chatterjee, Ananya; Chatterjee, Sirshendu; Biswas, Angshuman; Bhattacharya, Sayanti; Chattopadhyay, Subrata; Bandyopadhyay, Sandip K


    The healing activity of gallic acid enriched ethanolic extract (GAE) of Phyllanthus emblica fruits (amla) against the indomethacin-induced gastric ulceration in mice was investigated. The activity was correlated with the ability of GAE to alter the cyclooxygenase- (COX-) dependent healing pathways. Histology of the stomach tissues revealed maximum ulceration on the 3rd day after indomethacin (18 mg/kg, single dose) administration that was associated with significant increase in inflammatory factors, namely, mucosal myeloperoxidase (MPO) activity and inducible nitric oxide synthase (i-NOS) expression. Proangiogenic parameters such as the levels of prostaglandin (PG) E(2), vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), von Willebrand Factor VIII, and endothelial NOS (e-NOS) were downregulated by indomethacin. Treatment with GAE (5 mg/kg/day) and omeprazole (3 mg/kg/day) for 3 days led to effective healing of the acute ulceration, while GAE could reverse the indomethacin-induced proinflammatory changes of the designated biochemical parameters. The ulcer healing activity of GAE was, however, compromised by coadministration of the nonspecific NOS inhibitor, N-nitro-L-arginine methyl ester (L-NAME), but not the i-NOS-specific inhibitor, L-N6-(1-iminoethyl) lysine hydrochloride (L-NIL). Taken together, these results suggested that the GAE treatment accelerates ulcer healing by inducing PGE(2) synthesis and augmenting e-NOS/i-NOS ratio.

  6. New hydroxamic acid derivatives of fluoroquinolones: synthesis and evaluation of antibacterial and anticancer properties.


    Rajulu, Gavara Govinda; Bhojya Naik, Halehatty Seephya; Viswanadhan, Abhilash; Thiruvengadam, Jayaraman; Rajesh, Kondodiyil; Ganesh, Sambasivam; Jagadheshan, Hiriyan; Kesavan, Poonimangadu Koppolu


    A series of new hydroxamic acid derivatives (6a-f) at C-3 position of fluoroquinolones were designed and synthesized through multistep synthesis. The design concept involved replacement of the 3-carboxylic acid in fluoquinolones with hydroxamic acid as an acid mimicking group. The synthetic work employed in this work provides a good example for the synthesis of pure hydroxamic acid based fluoroquinolones. The synthesized compounds were characterized by (1)H-NMR, electrospray ionization (ESI)-MS and IR. The new compounds were tested for their in vitro antimicrobial and anti-proliferative activity. Out of the six derivatives, compound 6e exhibited moderate antibacterial activity by inhibiting the growth of Escherichia coli and Klebsiella pneumoniae (MIC: 4.00-8.00 µg/mL). Compounds 6b and 6f displayed good growth inhibition against A549 Lung adenocarcinoma and HCT-116 Colon carcinoma cell lines.

  7. Synthesis of 5,9-hexacosadienoic acid phospholipids. 11. Phospholipid studies of marine organisms.


    Mena, P L; Djerassi, C


    The synthesis of phosphatidylcholines (PC), phosphatidylethanolamines (PE) and phosphatidylserines (PS) containing two acyl chains of the naturally occurring sponge fatty acid (5Z,9Z)-5,9-hexacosadienoic acid as well as its hitherto unknown geometrical isomers is described. The PCs were prepared by deacylation of natural lecithins, followed by reacylation with fatty acid anhydrides. The synthesis of mixed-acid PCs is also reported: a diacyl product was converted to the lyso-PC by treatment with phospholipase A2 and subsequent acylation of the secondary hydroxyl group to give the desired mixed-acid PCs. The PEs and the PSs were prepared from the corresponding PCs by enzymatic transphosphatidylation catalyzed by phospholipase D. Structural assignments of the compounds were confirmed by spectroscopy (1H-NMR and MS). Ammonia chemical ionization mass spectrometry provided molecular ion and significant fragment peaks for PCs and PEs.

  8. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.


    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  9. Stimulation of Ribonucleic Acid Synthesis by Chloramphenicol in a rel+ Aminoacyl-Transfer Ribonucleic Acid Synthetase Mutant of Escherichia coli

    PubMed Central

    Yegian, Charles D.; Vanderslice, Rebecca W.


    Escherichia coli strain 9D3 possesses a highly temperature-sensitive valyl-transfer ribonucleic acid (tRNA) synthetase (EC Since 9D3 is a rel+ strain, it cannot carry out net RNA synthesis at high temperature. A 100-μg amount of chloramphenicol (CAP) per ml added in the absence of valine cannot stimulate RNA synthesis. Either 300 μg of CAP or 100 μg of CAP plus 50 μg of valine per ml, however, promotes nearly maximal RNA synthesis. These results can be understood as follows. (i) Valyl-tRNA is required for net RNA synthesis, (ii) the synthetase lesion is incomplete, (iii) the rate of mutant acylation of tRNAval at high temperature is valine-dependent, and (iv) the CAP concentration determines the rate of residual protein synthesis. Data are also presented which demonstrate that the rate of net RNA synthesis can greatly increase long after the addition of CAP, if the amount of valyl-tRNA increases. PMID:4942766

  10. Harnessing Yeast Peroxisomes for Biosynthesis of Fatty-Acid-Derived Biofuels and Chemicals with Relieved Side-Pathway Competition.


    Zhou, Yongjin J; Buijs, Nicolaas A; Zhu, Zhiwei; Gómez, Diego Orol; Boonsombuti, Akarin; Siewers, Verena; Nielsen, Jens


    Establishing efficient synthetic pathways for microbial production of biochemicals is often hampered by competing pathways and/or insufficient precursor supply. Compartmentalization in cellular organelles can isolate synthetic pathways from competing pathways, and provide a compact and suitable environment for biosynthesis. Peroxisomes are cellular organelles where fatty acids are degraded, a process that is inhibited under typical fermentation conditions making them an interesting workhouse for production of fatty-acid-derived molecules. Here, we show that targeting synthetic pathways to peroxisomes can increase the production of fatty-acid-derived fatty alcohols, alkanes and olefins up to 700%. In addition, we demonstrate that biosynthesis of these chemicals in the peroxisomes results in significantly decreased accumulation of byproducts formed by competing enzymes. We further demonstrate that production can be enhanced up to 3-fold by increasing the peroxisome population. The strategies described here could be used for production of other chemicals, especially acyl-CoA-derived molecules.

  11. EPA, DHA, and Lipoic Acid Differentially Modulate the n-3 Fatty Acid Biosynthetic Pathway in Atlantic Salmon Hepatocytes.


    Bou, Marta; Østbye, Tone-Kari; Berge, Gerd M; Ruyter, Bente


    The aim of the present study was to investigate how EPA, DHA, and lipoic acid (LA) influence the different metabolic steps in the n-3 fatty acid (FA) biosynthetic pathway in hepatocytes from Atlantic salmon fed four dietary levels (0, 0.5, 1.0 and 2.0%) of EPA, DHA or a 1:1 mixture of these FA. The hepatocytes were incubated with [1-(14)C] 18:3n-3 in the presence or absence of LA (0.2 mM). Increased endogenous levels of EPA and/or DHA and LA exposure both led to similar responses in cells with reduced desaturation and elongation of [1-(14)C] 18:3n-3 to 18:4n-3, 20:4n-3, and EPA, in agreement with reduced expression of the Δ6 desaturase gene involved in the first step of conversion. DHA production, on the other hand, was maintained even in groups with high endogenous levels of DHA, possibly due to a more complex regulation of this last step in the n-3 metabolic pathway. Inhibition of the Δ6 desaturase pathway led to increased direct elongation to 20:3n-3 by both DHA and LA. Possibly the route by 20:3n-3 and then Δ8 desaturation to 20:4n-3, bypassing the first Δ6 desaturase step, can partly explain the maintained or even increased levels of DHA production. LA increased DHA production in the phospholipid fraction of hepatocytes isolated from fish fed 0 and 0.5% EPA and/or DHA, indicating that LA has the potential to further increase the production of this health-beneficial FA in fish fed diets with low levels of EPA and/or DHA.

  12. An Adaptation To Life In Acid Through A Novel Mevalonate Pathway

    PubMed Central

    Vinokur, Jeffrey M.; Cummins, Matthew C.; Korman, Tyler P.; Bowie, James U.


    Extreme acidophiles are capable of growth at pH values near zero. Sustaining life in acidic environments requires extensive adaptations of membranes, proton pumps, and DNA repair mechanisms. Here we describe an adaptation of a core biochemical pathway, the mevalonate pathway, in extreme acidophiles. Two previously known mevalonate pathways involve ATP dependent decarboxylation of either mevalonate 5-phosphate or mevalonate 5-pyrophosphate, in which a single enzyme carries out two essential steps: (1) phosphorylation of the mevalonate moiety at the 3-OH position and (2) subsequent decarboxylation. We now demonstrate that in extreme acidophiles, decarboxylation is carried out by two separate steps: previously identified enzymes generate mevalonate 3,5-bisphosphate and a new decarboxylase we describe here, mevalonate 3,5-bisphosphate decarboxylase, produces isopentenyl phosphate. Why use two enzymes in acidophiles when one enzyme provides both functionalities in all other organisms examined to date? We find that at low pH, the dual function enzyme, mevalonate 5-phosphate decarboxylase is unable to carry out the first phosphorylation step, yet retains its ability to perform decarboxylation. We therefore propose that extreme acidophiles had to replace the dual-purpose enzyme with two specialized enzymes to efficiently produce isoprenoids in extremely acidic environments. PMID:28004831

  13. Saturated fatty acids alter the late secretory pathway by modulating membrane properties.


    Payet, Laurie-Anne; Pineau, Ludovic; Snyder, Ellen C R; Colas, Jenny; Moussa, Ahmed; Vannier, Brigitte; Bigay, Joelle; Clarhaut, Jonathan; Becq, Frédéric; Berjeaud, Jean-Marc; Vandebrouck, Clarisse; Ferreira, Thierry


    Saturated fatty acids (SFA) have been reported to alter organelle integrity and function in many cell types, including muscle and pancreatic β-cells, adipocytes, hepatocytes and cardiomyocytes. SFA accumulation results in increased amounts of ceramides/sphingolipids and saturated phospholipids (PL). In this study, using a yeast-based model that recapitulates most of the trademarks of SFA-induced lipotoxicity in mammalian cells, we demonstrate that these lipid species act at different levels of the secretory pathway. Ceramides mostly appear to modulate the induction of the unfolded protein response and the transcription of nutrient transporters destined to the cell surface. On the other hand, saturated PL, by altering membrane properties, directly impact vesicular budding at later steps in the secretory pathway, i.e. at the trans-Golgi Network level. They appear to do so by increasing lipid order within intracellular membranes which, in turn, alters the recruitment of loose lipid packing-sensing proteins, required for optimal budding, to nascent vesicles. We propose that this latter general mechanism could account for the well-documented deleterious impacts of fatty acids on the last steps of the secretory pathway in several cell types.

  14. Low-energy boron fullerenes: Role of disorder and potential synthesis pathways

    NASA Astrophysics Data System (ADS)

    Pochet, Pascal; Genovese, Luigi; de, Sandip; Goedecker, Stefan; Caliste, Damien; Ghasemi, S. Alireza; Bao, Kuo; Deutsch, Thierry


    We show by means of first-principles calculations that in boron nanostructures a large variety of two-dimensional structures can be obtained, all with similar energetic properties. Some of these new structures are more stable than both the B80 fullerenes initially proposed by Szwacki [Phys. Rev. Lett.PRLTAO0031-900710.1103/PhysRevLett.98.166804 98, 166804 (2007)] and boron nanotubes. At variance from other systems like carbon, disordered configurations are energetically comparable with ordered ones. Cage-like structures that are not ordered are thus comparable in energy to the more ordered original B80 fullerene. A comparison with other more disordered structures like bulk-like boron clusters is also presented. We found that in the presence of other seed structures (like Sc3 or Sc3N), some endohedral cage-like structures are energetically preferred over bulk-like clusters. This result opens a new pathway for the synthesis of the B80 fullerene as an endohedral fullerene as was done in the case of the C80 fullerene.

  15. Design and Synthesis of Novel Small-molecule Inhibitors of the Hypoxia Inducible Factor Pathway

    PubMed Central

    Mooring, Suazette Reid; Jin, Hui; Devi, Narra S.; Jabbar, Adnan A.; Kaluz, Stefan; Liu, Yuan; Van Meir, Erwin G.; Wang, Binghe


    Hypoxia, a reduction in partial oxygen pressure, is a salient property of solid tumors. Hypoxia drives malignant progression and metastasis in tumors and participates in tumor resistance to radio- and chemotherapies. Hypoxia activates the hypoxia-inducible factor (HIF) family of transcription factors, which induce target genes that regulate adaptive biological processes such as anaerobic metabolism, cell motility and angiogenesis. Clinical evidence has demonstrated that expression of HIF-1 is strongly associated with poor patient prognosis and activation of HIF-1 contributes to malignant behavior and therapeutic resistance. Consequently, HIF-1 has become an important therapeutic target for inhibition by small molecules. Herein, we describe the design and synthesis of small molecules that inhibit the HIF-1 signaling pathway. Many of these compounds exhibit inhibitory activity in the nanomolar range. Separate mechanistic studies indicate that these inhibitors do not alter HIF-1 levels, but interfere with the HIF-1α/HIF-1β/p300/CBP complex formation by interacting with p300 and CBP. PMID:22032632

  16. Towards direct synthesis of alane: A predicted defect-mediated pathway confirmed experimentally

    SciTech Connect

    Wang, Lin -Lin; Herwadkar, Aditi; Reich, Jason M.; Johnson, Duane D.; House, Stephen D.; Pena-Martin, Pamela; Rockett, Angus A.; Robertson, Ian M.; Gupta, Shalabh; Pecharsky, Vitalij K.


    Here, alane (AlH3) is a unique energetic material that has not found a broad practical use for over 70 years because it is difficult to synthesize directly from its elements. Using density functional theory, we examine the defect-mediated formation of alane monomers on Al(111) in a two-step process: (1) dissociative adsorption of H2 and (2) alane formation, which are both endothermic on a clean surface. Only with Ti dopant to facilitate H2 dissociation and vacancies to provide Al adatoms, both processes become exothermic. In agreement, in situ scanning tunneling microscopy showed that during H2 exposure, alane monomers and clusters form primarily in the vicinity of Al vacancies and Ti atoms. Moreover, ball milling of the Al samples with Ti (providing necessary defects) showed a 10 % conversion of Al into AlH3 or closely related species at 344 bar H2, indicating that the predicted pathway may lead to the direct synthesis of alane from elements at pressures much lower than the 104 bar expected from bulk thermodynamics.

  17. Towards direct synthesis of alane: A predicted defect-mediated pathway confirmed experimentally


    Wang, Lin -Lin; Herwadkar, Aditi; Reich, Jason M.; ...


    Here, alane (AlH3) is a unique energetic material that has not found a broad practical use for over 70 years because it is difficult to synthesize directly from its elements. Using density functional theory, we examine the defect-mediated formation of alane monomers on Al(111) in a two-step process: (1) dissociative adsorption of H2 and (2) alane formation, which are both endothermic on a clean surface. Only with Ti dopant to facilitate H2 dissociation and vacancies to provide Al adatoms, both processes become exothermic. In agreement, in situ scanning tunneling microscopy showed that during H2 exposure, alane monomers and clusters formmore » primarily in the vicinity of Al vacancies and Ti atoms. Moreover, ball milling of the Al samples with Ti (providing necessary defects) showed a 10 % conversion of Al into AlH3 or closely related species at 344 bar H2, indicating that the predicted pathway may lead to the direct synthesis of alane from elements at pressures much lower than the 104 bar expected from bulk thermodynamics.« less

  18. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.


    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen


    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  19. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen


    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  20. Ca2+- and PKC-dependent stimulation of PGE2 synthesis by deoxycholic acid in human colonic fibroblasts.


    Zhu, Yingting; Hua, Ping; Rafiq, Shazia; Waffner, Eric J; Duffey, Michael E; Lance, Peter


    We investigated prostanoid biogenesis by human colonic fibroblasts (CCD-18Co cells and nine primary fibroblast cultures) exposed to a primary (cholic, CA) or a secondary (deoxycholic, DCA) bile acid. Basal PGE2 levels in CCD-18Co cultures and fibroblast strains initiated from normal and adenocarcinomatous colon, respectively, were 1.7 +/- 0.3, 4.0 +/- 2.0, and 15.0 +/- 4.8 ng/mg protein. Peak levels 24 h after exposure to DCA (300 microM) rose, respectively, seven-, six- and sevenfold, but CA elicited no such responses. Increases in PGE2 synthesis were preceded by sequential increases in PGH synthase-2 mRNA and protein expression and were fully prevented by a nonselective (indomethacin) or a selective (celecoxib) nonsteroidal anti-inflammatory drug. DCA, but not CA, caused abrupt, transient increases in fibroblast intracellular Ca2+ concentration ([Ca2+]i) approximately 1 min after exposure. Increased [Ca2+]i was required for DCA-mediated induction of PGE2 synthesis, and protein kinase C was a further essential component of this signaling pathway. Colonic fibroblasts may be a major target for prostanoid biogenesis induced by fecal bile acids and, potentially, other noxious actions of these agents.

  1. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.


    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R


    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  2. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  3. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center</