Science.gov

Sample records for acid synthesis pathway

  1. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  2. Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1991-01-01

    The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.

  3. Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1991-01-01

    The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.

  4. [Genetic code: codon bases--the symbols of amino acid synthesis and catabolism pathways].

    PubMed

    Konyshev, V A

    1983-01-01

    The correlations between genetic codes of amino acids and pathways of synthesis and catabolism of carbon backbone of amino acids are considered. Codes of amino acids which are synthesized from oxoacids of glycolysis, the Krebs cycle and glyoxalic cycle via transamination without any additional chemical reactions, are initiated with guanine (alanine, glutamic and aspartic acids, glycine). Codons of amino acids which are formed on the branches of glycolysis at the level of compounds with three carbon atoms, begin with uracil (phenylalanine, serine, leucine, tyrosine, cysteine, tryptophan). Codes of amino acids formed from aspartate begin with adenine (methionine, isoleucine, threonine, asparagine, lysine, serine), while those of the amino acids formed from the compounds with five carbon atoms (glutamic acid and phosphoribosyl pyrophosphate) begin with cytosine (arginine, proline, glutamine, histidine). The second letter of codons is linked to catabolic pathways of amino acids: most of amino acids entering glycolysis and the Krebs cycle through even-numbered carbon compounds, have adenine and uracil at the second position of codes (A-U type); most of amino acids entering the glycolysis and the Krebs cycle via odd-numbered carbon compounds, have codons with guanine and cytidine at the second position (G-C type). The usage of purine and pyrimidine as the third letter of weak codones in most of amino acids is linked to the enthropy of amino acid formation. A hypothesis claiming that the linear genetic code was assembled from the purine and pyrimidine derivatives which have acted as participants of primitive control of amino acid synthesis and catabolism, is suggested.

  5. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    PubMed

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Bacterial Fatty Acid Synthesis and its Relationships with Polyketide Synthetic Pathways

    PubMed Central

    Cronan, John E.; Thomas, Jacob

    2014-01-01

    This review presents the most thoroughly studied bacterial fatty acid synthetic pathway, that of Escherichia coli and then discusses the exceptions to the E. coli pathway present in other bacteria. The known interrelationships between the fatty acid and polyketide synthetic pathways are also assessed, mainly in the Streptomyces group of bacteria. Finally, we present a compendium of methods for analysis of bacterial fatty acid synthetic pathways. PMID:19362649

  7. The Potential of 11C-acetate PET for Monitoring the Fatty Acid Synthesis Pathway in Tumors

    PubMed Central

    DeFord-Watts, Laura M.; Mintz, Akiva; Kridel, Steven J.

    2013-01-01

    Positron emission tomography (PET) is a molecular imaging modality that provides the opportunity to rapidly and non-invasively visualize tumors derived from multiple organs. In order to do so, PET utilizes radiotracers, such as 18F-FDG and 11C-acetate, whose uptake coincides with altered metabolic pathways within tumors. Increased expression and activity of enzymes in the fatty acid synthesis pathway is a frequent hallmark of cancer cells. As a result, this pathway has become a prime target for therapeutic intervention. Although multiple drugs have been developed that both directly and indirectly interfere with fatty acid synthesis, an optimal means to assess their efficacy is lacking. Given that 11C-acetate is directly linked to the fatty acid synthesis pathway, this probe provides a unique opportunity to monitor lipogenic tumors by PET. Herein, we review the relevance of the fatty acid synthesis pathway in cancer. Furthermore, we address the potential utility of 11C-acetate PET in imaging tumors, especially those that are not FDG-avid. Last, we discuss several therapeutic interventions that could benefit from 11C-acetate PET to monitor therapeutic response in patients with certain types of cancers. PMID:23597406

  8. Bile acid synthesis in man. In vivo activity of the 25-hydroxylation pathway.

    PubMed Central

    Duane, W C; Pooler, P A; Hamilton, J N

    1988-01-01

    During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side-chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. We have previously shown in the rat that the contribution of the 25-hydroxylation pathway can be quantitated in vivo by measuring production of [14C]acetone from [14C]26-cholesterol. In the present study, we adapted this method to human subjects. 4 d after oral administration of 100 microCi of [14C]26-cholesterol and 1 d after beginning a constant infusion of 16.6 mumol/min unlabeled acetone, three men and two women underwent breath collections. Expired acetone was trapped and purified as the 2,4 dinitrophenylhydrazine derivative. 14CO2 was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied by the acetone infusion rate to calculate production of [14C]acetone. [14C]Acetone production averaged 4.9% of total release of 14C from [14C]26-cholesterol, estimated by 14CO2 output. The method was validated by showing that [14C]acetone production from [14C]isopropanol averaged 86.9% of the [14C]-isopropanol infusion rate. We conclude that in man, as in the rat, the 25-hydroxylation pathway accounts for less than 5% of bile acid synthesis. PMID:3134400

  9. Fatty acid synthesis and pyruvate metabolism pathways remain active in dihydroartemisinin-induced dormant ring stages of Plasmodium falciparum.

    PubMed

    Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin

    2014-08-01

    Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment.

  10. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  11. Chenodeoxycholic acid synthesis in the hamster: a metabolic pathway via 3 beta, 7 alpha-dihydroxy-5-cholen-24-oic acid

    SciTech Connect

    Kulkarni, B.; Javitt, N.B.

    1982-11-01

    The quantitative significance of the metabolism of 3 beta, 7 alpha-dihydroxy-5-cholen-24-oic acid to chenodeoxycholic acid was evaluated in the hamster. A precursor-product relationship was established in this species by the finding that intravenous administration to an animal previously given cholesterol-4-14C caused a significant reduction in the specific activity of chenodeoxycholic acid. Administration of 12.9 mumole of the precursor was followed by a 10-fold increase in chenodeoxycholic acid excretion although the predominant excretory pathway was via biliary excretion as a monosulfate. The data indicate that synthesis of bile acid from cholesterol via the intermediate 3 beta, 7 alpha-dihydroxy-5-cholen-24-oic acid can be a quantitatively important pathway.

  12. Maintenance of essential amino acid synthesis pathways in the Blattabacterium cuenoti symbiont of a wood-feeding cockroach.

    PubMed

    Tokuda, Gaku; Elbourne, Liam D H; Kinjo, Yukihiro; Saitoh, Seikoh; Sabree, Zakee; Hojo, Masaru; Yamada, Akinori; Hayashi, Yoshinobu; Shigenobu, Shuji; Bandi, Claudio; Paulsen, Ian T; Watanabe, Hirofumi; Lo, Nathan

    2013-06-23

    In addition to harbouring intestinal symbionts, some animal species also possess intracellular symbiotic microbes. The relative contributions of gut-resident and intracellular symbionts to host metabolism, and how they coevolve are not well understood. Cockroaches and the termite Mastotermes darwiniensis present a unique opportunity to examine the evolution of spatially separated symbionts, as they harbour gut symbionts and the intracellular symbiont Blattabacterium cuenoti. The genomes of B. cuenoti from M. darwiniensis and the social wood-feeding cockroach Cryptocercus punctulatus are each missing most of the pathways for the synthesis of essential amino acids found in the genomes of relatives from non-wood-feeding hosts. Hypotheses to explain this pathway degradation include: (i) feeding on microbes present in rotting wood by ancestral hosts; (ii) the evolution of high-fidelity transfer of gut microbes via social behaviour. To test these hypotheses, we sequenced the B. cuenoti genome of a third wood-feeding species, the phylogenetically distant and non-social Panesthia angustipennis. We show that host wood-feeding does not necessarily lead to degradation of essential amino acid synthesis pathways in B. cuenoti, and argue that ancestral high-fidelity transfer of gut microbes best explains their loss in strains from M. darwiniensis and C. punctulatus.

  13. Pathway to Synthesis and Processing of Mycolic Acids in Mycobacterium tuberculosis

    PubMed Central

    Takayama, Kuni; Wang, Cindy; Besra, Gurdyal S.

    2005-01-01

    Mycobacterium tuberculosis is known to synthesize α-, methoxy-, and keto-mycolic acids. We propose a detailed pathway to the biosynthesis of all mycolic acids in M. tuberculosis. Fatty acid synthetase I provides C20-S-coenzyme A to the fatty acid synthetase II system (FAS-IIA). Modules of FAS-IIA and FAS-IIB introduce cis unsaturation at two locations on a growing meroacid chain to yield three different forms of cis,cis-diunsaturated fatty acids (intermediates to α-, methoxy-, and keto-meroacids). These are methylated, and the mature meroacids and carboxylated C26-S-acyl carrier protein enter into the final Claisen-type condensation with polyketide synthase-13 (Pks13) to yield mycolyl-S-Pks13. We list candidate genes in the genome encoding the proposed dehydrase and isomerase in the FAS-IIA and FAS-IIB modules. We propose that the processing of mycolic acids begins by transfer of mycolic acids from mycolyl-S-Pks13 to d-mannopyranosyl-1-phosphoheptaprenol to yield 6-O-mycolyl-β-d-mannopyranosyl-1-phosphoheptaprenol and then to trehalose 6-phosphate to yield phosphorylated trehalose monomycolate (TMM-P). Phosphatase releases the phosphate group to yield TMM, which is immediately transported outside the cell by the ABC transporter. Antigen 85 then catalyzes the transfer of a mycolyl group from TMM to the cell wall arabinogalactan and to other TMMs to produce arabinogalactan-mycolate and trehalose dimycolate, respectively. We list candidate genes in the genome that encode the proposed mycolyltransferases I and II, phosphatase, and ABC transporter. The enzymes within this total pathway are targets for new drug discovery. PMID:15653820

  14. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    SciTech Connect

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.

    2013-11-15

    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease.

  15. Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures.

    PubMed

    Rodas-Junco, Beatriz A; Cab-Guillén, Yahaira; Muñoz-Sánchez, J Armando; Vázquez-Flota, Felipe; Monforte-González, Miriam; Hernández-Sotomayor, S M Teresa

    2013-10-01

    Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.

  16. The Arabidopsis DELAYED DEHISCENCE1 Gene Encodes an Enzyme in the Jasmonic Acid Synthesis Pathway

    PubMed Central

    Sanders, Paul M.; Lee, Pei Yun; Biesgen, Christian; Boone, James D.; Beals, Thomas P.; Weiler, Elmar W.; Goldberg, Robert B.

    2000-01-01

    delayed dehiscence1 is an Arabidopsis T-DNA mutant in which anthers release pollen grains too late for pollination to occur. The delayed dehiscence1 defect is caused by a delay in the stomium degeneration program. The gene disrupted in delayed dehiscence1 encodes 12-oxophytodienoate reductase, an enzyme in the jasmonic acid biosynthesis pathway. We rescued the mutant phenotype by exogenous application of jasmonic acid and obtained seed set from previously male-sterile plants. In situ hybridization studies showed that during the early stages of floral development, DELAYED DEHISCENCE1 mRNA accumulated within all floral organs. Later, DELAYED DEHISCENCE1 mRNA accumulated specifically within the pistil, petals, and stamen filaments. DELAYED DEHISCENCE1 mRNA was not detected in the stomium and septum cells of the anther that are involved in pollen release. The T-DNA insertion in delayed dehiscence1 eliminated both DELAYED DEHISCENCE1 mRNA accumulation and 12-oxophytodienoate reductase activity. These experiments suggest that jasmonic acid signaling plays a role in controlling the time of anther dehiscence within the flower. PMID:10899973

  17. Altering the Mitochondrial Fatty Acid Synthesis (mtFASII) Pathway Modulates Cellular Metabolic States and Bioactive Lipid Profiles as Revealed by Metabolomic Profiling

    PubMed Central

    Clay, Hayley B.; Parl, Angelika K.; Mitchell, Sabrina L.; Singh, Larry; Bell, Lauren N.; Murdock, Deborah G.

    2016-01-01

    Despite the presence of a cytosolic fatty acid synthesis pathway, mitochondria have retained their own means of creating fatty acids via the mitochondrial fatty acid synthesis (mtFASII) pathway. The reason for its conservation has not yet been elucidated. Therefore, to better understand the role of mtFASII in the cell, we used thin layer chromatography to characterize the contribution of the mtFASII pathway to the fatty acid composition of selected mitochondrial lipids. Next, we performed metabolomic analysis on HeLa cells in which the mtFASII pathway was either hypofunctional (through knockdown of mitochondrial acyl carrier protein, ACP) or hyperfunctional (through overexpression of mitochondrial enoyl-CoA reductase, MECR). Our results indicate that the mtFASII pathway contributes little to the fatty acid composition of mitochondrial lipid species examined. Additionally, loss of mtFASII function results in changes in biochemical pathways suggesting alterations in glucose utilization and redox state. Interestingly, levels of bioactive lipids, including lysophospholipids and sphingolipids, directly correlate with mtFASII function, indicating that mtFASII may be involved in the regulation of bioactive lipid levels. Regulation of bioactive lipid levels by mtFASII implicates the pathway as a mediator of intracellular signaling. PMID:26963735

  18. Integrated engineering of β-oxidation reversal and ω-oxidation pathways for the synthesis of medium chain ω-functionalized carboxylic acids.

    PubMed

    Clomburg, James M; Blankschien, Matthew D; Vick, Jacob E; Chou, Alexander; Kim, Seohyoung; Gonzalez, Ramon

    2015-03-01

    An engineered reversal of the β-oxidation cycle was exploited to demonstrate its utility for the synthesis of medium chain (6-10-carbons) ω-hydroxyacids and dicarboxylic acids from glycerol as the only carbon source. A redesigned β-oxidation reversal facilitated the production of medium chain carboxylic acids, which were converted to ω-hydroxyacids and dicarboxylic acids by the action of an engineered ω-oxidation pathway. The selection of a key thiolase (bktB) and thioesterase (ydiI) in combination with previously established core β-oxidation reversal enzymes, as well as the development of chromosomal expression systems for the independent control of pathway enzymes, enabled the generation of C6-C10 carboxylic acids and provided a platform for vector based independent expression of ω-functionalization enzymes. Using this approach, the expression of the Pseudomonas putida alkane monooxygenase system, encoded by alkBGT, in combination with all β-oxidation reversal enzymes resulted in the production of 6-hydroxyhexanoic acid, 8-hydroxyoctanoic acid, and 10-hydroxydecanoic acid. Following identification and characterization of potential alcohol and aldehyde dehydrogenases, chnD and chnE from Acinetobacter sp. strain SE19 were expressed in conjunction with alkBGT to demonstrate the synthesis of the C6-C10 dicarboxylic acids, adipic acid, suberic acid, and sebacic acid. The potential of a β-oxidation cycle with ω-oxidation termination pathways was further demonstrated through the production of greater than 0.8 g/L C6-C10 ω-hydroxyacids or about 0.5 g/L dicarboxylic acids of the same chain lengths from glycerol (an unrelated carbon source) using minimal media.

  19. Enterobacter sp. I-3, a bio-herbicide inhibits gibberellins biosynthetic pathway and regulates abscisic acid and amino acids synthesis to control plant growth.

    PubMed

    Radhakrishnan, Ramalingam; Park, Jae-Man; Lee, In-Jung

    2016-12-01

    Very few bacterial species were identified as bio-herbicides for weed control. The present research was focused to elucidate the plant growth retardant properties of Enterobacter sp. I-3 during their interaction by determining the changes in endogenous photosynthetic pigments, plant hormones and amino acids. The two bacterial isolates I-4-5 and I-3 were used to select the superior bacterium for controlling weed seeds (Echinochloa crus-galli L. and Portulaca oleracea L.) germination. The post-inoculation of I-3 (Enterobacter sp. I-3) significantly inhibited the weeds seed germination than their controls. The mechanism of bacterium induced plant growth reduction was identified in lettuce treated with I-3 bacterium and compared their effects with known chemical herbicide, trinexapac-ethyl (TE). The treatment of I-3 and TE showed a significant inhibitory effect on shoot length, leaf number, leaf length, leaf width, shoot weight, root weight and chlorophyll content in lettuce seedlings. The endogenous gibberellins (GAs) and abscisic acid (ABA) analysis showed that Enterobacter sp. I-3 treated plants had lower levels of GAs (GA12, GA19, GA20 and GA8) and GAs/ABA ratio and then, the higher level of ABA when compared to their controls. Indeed, the individual amino acids ie., aspartic acid, glutamic acid, glycine, threonine, alanine, serine, leucine, isoleucine and tyrosine were declined in TE and I-3 exposed plants. Our results suggest that the utilization of Enterobacter sp. I-3 inhibits the GAs pathway and amino acids synthesis in weeds to control their growth can be an alternative to chemical herbicides.

  20. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  1. Introduction of a bacterial acetyl-CoA synthesis pathway improves lactic acid production in Saccharomyces cerevisiae.

    PubMed

    Song, Ji-Yoon; Park, Joon-Song; Kang, Chang Duk; Cho, Hwa-Young; Yang, Dongsik; Lee, Seunghyun; Cho, Kwang Myung

    2016-05-01

    Acid-tolerant Saccharomyces cerevisiae was engineered to produce lactic acid by expressing heterologous lactate dehydrogenase (LDH) genes, while attenuating several key pathway genes, including glycerol-3-phosphate dehydrogenase1 (GPD1) and cytochrome-c oxidoreductase2 (CYB2). In order to increase the yield of lactic acid further, the ethanol production pathway was attenuated by disrupting the pyruvate decarboxylase1 (PDC1) and alcohol dehydrogenase1 (ADH1) genes. Despite an increase in lactic acid yield, severe reduction of the growth rate and glucose consumption rate owing to the absence of ADH1 caused a considerable decrease in the overall productivity. In Δadh1 cells, the levels of acetyl-CoA, a key precursor for biologically applicable components, could be insufficient for normal cell growth. To increase the cellular supply of acetyl-CoA, we introduced bacterial acetylating acetaldehyde dehydrogenase (A-ALD) enzyme (EC 1.2.1.10) genes into the lactic acid-producing S. cerevisiae. Escherichia coli-derived A-ALD genes, mhpF and eutE, were expressed and effectively complemented the attenuated acetaldehyde dehydrogenase (ALD)/acetyl-CoA synthetase (ACS) pathway in the yeast. The engineered strain, possessing a heterologous acetyl-CoA synthetic pathway, showed an increased glucose consumption rate and higher productivity of lactic acid fermentation. The production of lactic acid was reached at 142g/L with production yield of 0.89g/g and productivity of 3.55gL(-1)h(-1) under fed-batch fermentation in bioreactor. This study demonstrates a novel approach that improves productivity of lactic acid by metabolic engineering of the acetyl-CoA biosynthetic pathway in yeast. Copyright © 2016. Published by Elsevier Inc.

  2. Improvement of bioinsecticides production through mutagenesis of Bacillus thuringiensis by u.v. and nitrous acid affecting metabolic pathways and/or delta-endotoxin synthesis.

    PubMed

    Ghribi, D; Zouari, N; Jaoua, S

    2004-01-01

    The present work aimed to obtain bioinsecticide over-producing mutants through classical mutagenesis of vegetative cells of Bacillus thuringiensis (Bt) by using u.v. and nitrous acid, and to evidence the involvement of cell metabolism in delta-endotoxin synthesis. Vegetative cells of Bt were treated by nitrous acid (0.17 mg ml(-1)) or exposed to u.v. rays (emitted at a wave length of 240 nm). The isolated survivors were screened on the basis of the production of delta-endotoxins and biomass in glucose and/or in gruel-based media at two aeration conditions. Bioinsecticide over-producing mutants were obtained with high frequencies because random mutations were shown to affect cell metabolism at different pathways related to the regulation of delta-endotoxin synthesis. Classical mutagenesis of Bt cells lead to the isolation of a large variety of delta-endotoxin over-producing mutants that could be classified into six groups based on the location of the mutations, particularly in metabolism pathways and delta-endotoxin synthesis. High frequencies of delta-endotoxin over-producing mutants of Bt could be obtained through classical mutagenesis of vegetative cells. This should contribute to a significant reduction of production and utilization costs of Bt bioinsecticides.

  3. Lewis Acid Induced Toggle from Ir(II) to Ir(IV) Pathways in Photocatalytic Reactions: Synthesis of Thiomorpholines and Thiazepanes from Aldehydes and SLAP Reagents

    PubMed Central

    2016-01-01

    Redox neutral photocatalytic transformations often require careful pairing of the substrates and photoredox catalysts in order to achieve a catalytic cycle. This can limit the range of viable transformations, as we recently observed in attempting to extend the scope of the photocatalytic synthesis of N-heterocycles using silicon amine protocol (SLAP) reagents to include starting materials that require higher oxidation potentials. We now report that the inclusion of Lewis acids in photocatalytic reactions of organosilanes allows access to a distinct reaction pathway featuring an Ir(III)*/Ir(IV) couple instead of the previously employed Ir(III)*/Ir(II) pathway, enabling the transformation of aromatic and aliphatic aldehydes to thiomorpholines and thiazepanes. The role of the Lewis acid in accepting an electron—either directly or via coordination to an imine—can be extended to other classes of photocatalysts and transformations, including oxidative cyclizations. The combination of light induced reactions and Lewis acids therefore promises access to new pathways and transformations that are not viable using the photocatalysts alone. PMID:28149955

  4. Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures

    PubMed Central

    Rodas-Junco, Beatriz A; Cab-Guillen, Yahaira; Muñoz-Sanchez, J Armando; Vázquez-Flota, Felipe; Monforte-Gonzalez, Miriam; Hérnandez-Sotomayor, S M Teresa

    2013-01-01

    Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.

  5. Amino Acid Biosynthesis Pathways in Diatoms

    PubMed Central

    Bromke, Mariusz A.

    2013-01-01

    Amino acids are not only building blocks for proteins but serve as precursors for the synthesis of many metabolites with multiple functions in growth and other biological processes of a living organism. The biosynthesis of amino acids is tightly connected with central carbon, nitrogen and sulfur metabolism. Recent publication of genome sequences for two diatoms Thalassiosira pseudonana and Phaeodactylum tricornutum created an opportunity for extensive studies on the structure of these metabolic pathways. Based on sequence homology found in the analyzed diatomal genes, the biosynthesis of amino acids in diatoms seems to be similar to higher plants. However, one of the most striking differences between the pathways in plants and in diatomas is that the latter possess and utilize the urea cycle. It serves as an important anaplerotic pathway for carbon fixation into amino acids and other N-containing compounds, which are essential for diatom growth and contribute to their high productivity. PMID:24957993

  6. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  7. Reduction of Benzenoid Synthesis in Petunia Flowers Reveals Multiple Pathways to Benzoic Acid and Enhancement in Auxin Transport[W

    PubMed Central

    Orlova, Irina; Marshall-Colón, Amy; Schnepp, Jennifer; Wood, Barbara; Varbanova, Marina; Fridman, Eyal; Blakeslee, Joshua J.; Peer, Wendy Ann; Murphy, Angus S.; Rhodes, David; Pichersky, Eran; Dudareva, Natalia

    2006-01-01

    In plants, benzoic acid (BA) is believed to be synthesized from Phe through shortening of the propyl side chain by two carbons. It is hypothesized that this chain shortening occurs via either a β-oxidative or non-β-oxidative pathway. Previous in vivo isotope labeling and metabolic flux analysis of the benzenoid network in petunia (Petunia hybrida) flowers revealed that both pathways yield benzenoid compounds and that benzylbenzoate is an intermediate between l-Phe and BA. To test this hypothesis, we generated transgenic petunia plants in which the expression of BPBT, the gene encoding the enzyme that uses benzoyl-CoA and benzyl alcohol to make benzylbenzoate, was reduced or eliminated. Elimination of benzylbenzoate formation decreased the endogenous pool of BA and methylbenzoate emission but increased emission of benzyl alcohol and benzylaldehyde, confirming the contribution of benzylbenzoate to BA formation. Labeling experiments with 2H5-Phe revealed a dilution of isotopic abundance in most measured compounds in the dark, suggesting an alternative pathway from a precursor other than Phe, possibly phenylpyruvate. Suppression of BPBT activity also affected the overall morphology of petunia plants, resulting in larger flowers and leaves, thicker stems, and longer internodes, which was consistent with the increased auxin transport in transgenic plants. This suggests that BPBT is involved in metabolic processes in vegetative tissues as well. PMID:17194766

  8. The effects of a low protein diet on amino acids and enzymes in the serine synthesis pathway in mice.

    PubMed

    Antflick, Jordan E; Baker, Glen B; Hampson, David Richard

    2010-06-01

    L-serine is required for cellular and tissue growth and is particularly important in the immature brain where it acts as a crucial neurotrophic factor. In this study, the levels of amino acids and enzymes in the L-serine biosynthetic pathway were examined in the forebrain, cerebellum, liver, and kidney after the exposure of mice to protein-restricted diets. The levels of L-serine, D-serine, and L-serine-O-phosphate were quantified by HPLC and quantitative Western blotting was used to measure changes in protein levels of five enzymes in the pathway. The L-serine biosynthetic enzyme phosphoserine phosphatase was strongly upregulated, while the serine degradative enzymes serine racemase and serine dehydratase were downregulated in the livers and kidneys of mice fed low (6%) or very low (2%) protein diets for 2 weeks compared with mice fed a normal diet (18% protein). No changes in these enzymes were seen in the brain. The levels of L-serine increased in the livers of mice fed 2% protein; in contrast, D-serine levels were reduced below the limit of detection in the livers of mice given either the 6 or 2% diets. D-Serine is a co-agonist at the NMDA class of glutamate receptors; no alterations in NMDA-R1 subunit expression were observed in liver or brain after protein restriction. These findings demonstrate that the expression of L-serine synthetic and degradative enzymes display reciprocal changes in the liver and kidney to increase L-serine and decrease D-serine levels under conditions of protein restriction, and that the brain is insulated from such changes.

  9. Quantitative metabolic flux analysis reveals an unconventional pathway of fatty acid synthesis in cancer cells deficient for the mitochondrial citrate transport protein.

    PubMed

    Jiang, Lei; Boufersaoui, Adam; Yang, Chendong; Ko, Bookyung; Rakheja, Dinesh; Guevara, Gerardo; Hu, Zeping; DeBerardinis, Ralph J

    2017-09-01

    The mitochondrial citrate transport protein (CTP), encoded by SLC25A1, accommodates bidirectional trafficking of citrate between the mitochondria and cytosol, supporting lipid biosynthesis and redox homeostasis. Genetic CTP deficiency causes a fatal neurodevelopmental syndrome associated with the accumulation of L- and D-2-hydroxyglutaric acid, and elevated CTP expression is associated with poor prognosis in several types of cancer, emphasizing the importance of this transporter in multiple human pathologies. Here we describe the metabolic consequences of CTP deficiency in cancer cells. As expected from the phenotype of CTP-deficient humans, somatic CTP loss in cancer cells induces broad dysregulation of mitochondrial metabolism, resulting in accumulation of lactate and of the L- and D- enantiomers of 2-hydroxyglutarate (2HG) and depletion of TCA cycle intermediates. It also eliminates mitochondrial import of citrate from the cytosol. To quantify the impact of CTP deficiency on metabolic flux, cells were cultured with a set of (13)C-glucose and (13)C-glutamine tracers with resulting data integrated by metabolic flux analysis (MFA). CTP-deficient cells displayed a major restructuring of central carbon metabolism, including suppression of pyruvate dehydrogenase (PDH) and induction of glucose-dependent anaplerosis through pyruvate carboxylase (PC). We also observed an unusual lipogenic pathway in which carbon from glucose supplies mitochondrial production of alpha-ketoglutarate (AKG), which is then trafficked to the cytosol and used to supply reductive carboxylation by isocitrate dehydrogenase 1 (IDH1). The resulting citrate is cleaved to produce lipogenic acetyl-CoA, thereby completing a novel pathway of glucose-dependent reductive carboxylation. In CTP deficient cells, IDH1 inhibition suppresses lipogenesis from either glucose or glutamine, implicating IDH1 as a required component of fatty acid synthesis in states of CTP deficiency. Copyright © 2016 International

  10. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  11. The synthesis and transformations of uronic acid nucleosides

    NASA Astrophysics Data System (ADS)

    Timoshchuk, V. A.

    1994-08-01

    The results of studies on the synthesis and transformations of uronic acid nucleosides are surveyed. Various pathways leading to the synthesis of uronic acid nucleoside are examined, including methods involving specific and nonspecific oxidation of nucleosides, and the glycosylation and modification of the sugar residue or the heterocyclic base. The bibliography includes 97 references.

  12. Mitochondrial fatty acid synthesis and respiration.

    PubMed

    Hiltunen, J Kalervo; Autio, Kaija J; Schonauer, Melissa S; Kursu, V A Samuli; Dieckmann, Carol L; Kastaniotis, Alexander J

    2010-01-01

    Recent studies have revealed that mitochondria are able to synthesize fatty acids in a malonyl-CoA/acyl carrier protein (ACP)-dependent manner. This pathway resembles bacterial fatty acid synthesis (FAS) type II, which uses discrete, nuclearly encoded proteins. Experimental evidence, obtained mainly through using yeast as a model system, indicates that this pathway is essential for mitochondrial respiratory function. Curiously, the deficiency in mitochondrial FAS cannot be complemented by inclusion of fatty acids in the culture medium or by products of the cytosolic FAS complex. Defects in mitochondrial FAS in yeast result in the inability to grow on nonfermentable carbon sources, the loss of mitochondrial cytochromes a/a3 and b, mitochondrial RNA processing defects, and loss of cellular lipoic acid. Eukaryotic FAS II generates octanoyl-ACP, a substrate for mitochondrial lipoic acid synthase. Endogenous lipoic acid synthesis challenges the hypothesis that lipoic acid can be provided as an exogenously supplied vitamin. Purified eukaryotic FAS II enzymes are catalytically active in vitro using substrates with an acyl chain length of up to 16 carbon atoms. However, with the exception of 3-hydroxymyristoyl-ACP, a component of respiratory complex I in higher eukaryotes, the fate of long-chain fatty acids synthesized by the mitochondrial FAS pathway remains an enigma. The linkage of FAS II genes to published animal models for human disease supports the hypothesis that mitochondrial FAS dysfunction leads to the development of disorders in mammals.

  13. Inhibition of de novo Palmitate Synthesis by Fatty Acid Synthase Induces Apoptosis in Tumor Cells by Remodeling Cell Membranes, Inhibiting Signaling Pathways, and Reprogramming Gene Expression.

    PubMed

    Ventura, Richard; Mordec, Kasia; Waszczuk, Joanna; Wang, Zhaoti; Lai, Julie; Fridlib, Marina; Buckley, Douglas; Kemble, George; Heuer, Timothy S

    2015-08-01

    Inhibition of de novo palmitate synthesis via fatty acid synthase (FASN) inhibition provides an unproven approach to cancer therapy with a strong biological rationale. FASN expression increases with tumor progression and associates with chemoresistance, tumor metastasis, and diminished patient survival in numerous tumor types. TVB-3166, an orally-available, reversible, potent, and selective FASN inhibitor induces apoptosis, inhibits anchorage-independent cell growth under lipid-rich conditions, and inhibits in-vivo xenograft tumor growth. Dose-dependent effects are observed between 20-200 nM TVB-3166, which agrees with the IC50 in biochemical FASN and cellular palmitate synthesis assays. Mechanistic studies show that FASN inhibition disrupts lipid raft architecture, inhibits biological pathways such as lipid biosynthesis, PI3K-AKT-mTOR and β-catenin signal transduction, and inhibits expression of oncogenic effectors such as c-Myc; effects that are tumor-cell specific. Our results demonstrate that FASN inhibition has anti-tumor activities in biologically diverse preclinical tumor models and provide mechanistic and pharmacologic evidence that FASN inhibition presents a promising therapeutic strategy for treating a variety of cancers, including those expressing mutant K-Ras, ErbB2, c-Met, and PTEN. The reported findings inform ongoing studies to link mechanisms of action with defined tumor types and advance the discovery of biomarkers supporting development of FASN inhibitors as cancer therapeutics. Fatty acid synthase (FASN) is a vital enzyme in tumor cell biology; the over-expression of FASN is associated with diminished patient prognosis and resistance to many cancer therapies. Our data demonstrate that selective and potent FASN inhibition with TVB-3166 leads to selective death of tumor cells, without significant effect on normal cells, and inhibits in vivo xenograft tumor growth at well-tolerated doses. Candidate biomarkers for selecting tumors highly sensitive

  14. Inhibition of de novo Palmitate Synthesis by Fatty Acid Synthase Induces Apoptosis in Tumor Cells by Remodeling Cell Membranes, Inhibiting Signaling Pathways, and Reprogramming Gene Expression

    PubMed Central

    Ventura, Richard; Mordec, Kasia; Waszczuk, Joanna; Wang, Zhaoti; Lai, Julie; Fridlib, Marina; Buckley, Douglas; Kemble, George; Heuer, Timothy S.

    2015-01-01

    Inhibition of de novo palmitate synthesis via fatty acid synthase (FASN) inhibition provides an unproven approach to cancer therapy with a strong biological rationale. FASN expression increases with tumor progression and associates with chemoresistance, tumor metastasis, and diminished patient survival in numerous tumor types. TVB-3166, an orally-available, reversible, potent, and selective FASN inhibitor induces apoptosis, inhibits anchorage-independent cell growth under lipid-rich conditions, and inhibits in-vivo xenograft tumor growth. Dose-dependent effects are observed between 20–200 nM TVB-3166, which agrees with the IC50 in biochemical FASN and cellular palmitate synthesis assays. Mechanistic studies show that FASN inhibition disrupts lipid raft architecture, inhibits biological pathways such as lipid biosynthesis, PI3K–AKT–mTOR and β-catenin signal transduction, and inhibits expression of oncogenic effectors such as c-Myc; effects that are tumor-cell specific. Our results demonstrate that FASN inhibition has anti-tumor activities in biologically diverse preclinical tumor models and provide mechanistic and pharmacologic evidence that FASN inhibition presents a promising therapeutic strategy for treating a variety of cancers, including those expressing mutant K-Ras, ErbB2, c-Met, and PTEN. The reported findings inform ongoing studies to link mechanisms of action with defined tumor types and advance the discovery of biomarkers supporting development of FASN inhibitors as cancer therapeutics. Research in context Fatty acid synthase (FASN) is a vital enzyme in tumor cell biology; the over-expression of FASN is associated with diminished patient prognosis and resistance to many cancer therapies. Our data demonstrate that selective and potent FASN inhibition with TVB-3166 leads to selective death of tumor cells, without significant effect on normal cells, and inhibits in vivo xenograft tumor growth at well-tolerated doses. Candidate biomarkers for

  15. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  16. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  17. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  18. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Astrophysics Data System (ADS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-08-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  19. Genetic mapping of QTLs controlling fatty acids provided insights into the genetic control of fatty acid synthesis pathway in peanut (Arachis hypogaea L.).

    PubMed

    Wang, Ming Li; Khera, Pawan; Pandey, Manish K; Wang, Hui; Qiao, Lixian; Feng, Suping; Tonnis, Brandon; Barkley, Noelle A; Pinnow, David; Holbrook, Corley C; Culbreath, Albert K; Varshney, Rajeev K; Guo, Baozhu

    2015-01-01

    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C18:1) and linoleic acid (C18:2) accounting for about 80% of peanut oil, the six other fatty acids namely palmitic acid (C16:0), stearic acid (C18:0), arachidic acid (C20:0), gadoleic acid (C20:1), behenic acid (C22:0), and lignoceric acid (C24:0) are accounted for the rest 20%. To determine the genetic basis and to improve further understanding on effect of FAD2 genes on these fatty acids, two recombinant inbred line (RIL) populations namely S-population (high oleic line 'SunOleic 97R' × low oleic line 'NC94022') and T-population (normal oleic line 'Tifrunner' × low oleic line 'GT-C20') were developed. Genetic maps with 206 and 378 marker loci for the S- and the T-population, respectively were used for quantitative trait locus (QTL) analysis. As a result, a total of 164 main-effect (M-QTLs) and 27 epistatic (E-QTLs) QTLs associated with the minor fatty acids were identified with 0.16% to 40.56% phenotypic variation explained (PVE). Thirty four major QTLs (>10% of PVE) mapped on five linkage groups and 28 clusters containing more than three QTLs were also identified. These results suggest that the major QTLs with large additive effects would play an important role in controlling composition of these minor fatty acids in addition to the oleic and linoleic acids in peanut oil. The interrelationship among these fatty acids should be considered while breeding for improved peanut genotypes with good oil quality and desired fatty acid composition.

  20. Genetic mapping of QTLs controlling fatty acids provided insights into the genetic control of fatty acid synthesis pathway in peanut (Arachis hypogaea L.)

    USDA-ARS?s Scientific Manuscript database

    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C1...

  1. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  2. Genetic Mapping of QTLs Controlling Fatty Acids Provided Insights into the Genetic Control of Fatty Acid Synthesis Pathway in Peanut (Arachis hypogaea L.)

    PubMed Central

    Wang, Hui; Qiao, Lixian; Feng, Suping; Tonnis, Brandon; Barkley, Noelle A.; Pinnow, David; Holbrook, Corley C.; Culbreath, Albert K.; Varshney, Rajeev K.; Guo, Baozhu

    2015-01-01

    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C18:1) and linoleic acid (C18:2) accounting for about 80% of peanut oil, the six other fatty acids namely palmitic acid (C16:0), stearic acid (C18:0), arachidic acid (C20:0), gadoleic acid (C20:1), behenic acid (C22:0), and lignoceric acid (C24:0) are accounted for the rest 20%. To determine the genetic basis and to improve further understanding on effect of FAD2 genes on these fatty acids, two recombinant inbred line (RIL) populations namely S-population (high oleic line ‘SunOleic 97R’ × low oleic line ‘NC94022’) and T-population (normal oleic line ‘Tifrunner’ × low oleic line ‘GT-C20’) were developed. Genetic maps with 206 and 378 marker loci for the S- and the T-population, respectively were used for quantitative trait locus (QTL) analysis. As a result, a total of 164 main-effect (M-QTLs) and 27 epistatic (E-QTLs) QTLs associated with the minor fatty acids were identified with 0.16% to 40.56% phenotypic variation explained (PVE). Thirty four major QTLs (>10% of PVE) mapped on five linkage groups and 28 clusters containing more than three QTLs were also identified. These results suggest that the major QTLs with large additive effects would play an important role in controlling composition of these minor fatty acids in addition to the oleic and linoleic acids in peanut oil. The interrelationship among these fatty acids should be considered while breeding for improved peanut genotypes with good oil quality and desired fatty acid composition. PMID:25849082

  3. Vitamins and aging: pathways to NAD+ synthesis.

    PubMed

    Denu, John M

    2007-05-04

    Recent genetic evidence reveals additional salvage pathways for NAD(+) synthesis. In this issue, Belenky et al. (2007) report that nicotinamide riboside, a new NAD(+) precursor, regulates Sir2 deacetylase activity and life span in yeast. The ability of nicotinamide riboside to enhance life span does not depend on calorie restriction.

  4. Conjugated Fatty Acid Synthesis

    PubMed Central

    Rawat, Richa; Yu, Xiao-Hong; Sweet, Marie; Shanklin, John

    2012-01-01

    Conjugated linolenic acids (CLNs), 18:3 Δ9,11,13, lack the methylene groups found between the double bonds of linolenic acid (18:3 Δ9,12,15). CLNs are produced by conjugase enzymes that are homologs of the oleate desaturases FAD2. The goal of this study was to map the domain(s) within the Momordica charantia conjugase (FADX) responsible for CLN formation. To achieve this, a series of Momordica FADX-Arabidopsis FAD2 chimeras were expressed in the Arabidopsis fad3fae1 mutant, and the transformed seeds were analyzed for the accumulation of CLN. These experiments identified helix 2 and the first histidine box as a determinant of conjugase product partitioning into punicic acid (18:3 Δ9cis,11trans,13cis) or α-eleostearic acid (18:3 Δ9cis,11trans,13trans). This was confirmed by analysis of a FADX mutant containing six substitutions in which the sequence of helix 2 and first histidine box was converted to that of FAD2. Each of the six FAD2 substitutions was individually converted back to the FADX equivalent identifying residues 111 and 115, adjacent to the first histidine box, as key determinants of conjugase product partitioning. Additionally, expression of FADX G111V and FADX G111V/D115E resulted in an approximate doubling of eleostearic acid accumulation to 20.4% and 21.2%, respectively, compared with 9.9% upon expression of the native Momordica FADX. Like the Momordica conjugase, FADX G111V and FADX D115E produced predominantly α-eleostearic acid and little punicic acid, but the FADX G111V/D115E double mutant produced approximately equal amounts of α-eleostearic acid and its isomer, punicic acid, implicating an interactive effect of residues 111 and 115 in punicic acid formation. PMID:22451660

  5. Incorporation of Extracellular Fatty Acids by a Fatty Acid Kinase-Dependent Pathway in Staphylococcus aureus

    PubMed Central

    Parsons, Joshua B.; Frank, Matthew W.; Jackson, Pamela; Subramanian, Chitra; Rock, Charles O.

    2014-01-01

    Summary Acyl-CoA and acyl-acyl carrier protein (ACP) synthetases activate exogenous fatty acids for incorporation into phospholipids in Gram-negative bacteria. However, Gram-positive bacteria utilize an acyltransferase pathway for the biogenesis of phosphatidic acid that begins with the acylation of sn-glycerol-3-phosphate by PlsY using an acyl-phosphate (acyl-PO4) intermediate. PlsX generates acyl-PO4 from the acyl-ACP end-products of fatty acid synthesis. The plsX gene of Staphylococcus aureus was inactivated and the resulting strain was both a fatty acid auxotroph and required de novo fatty acid synthesis for growth. Exogenous fatty acids were only incorporated into the 1-position and endogenous acyl groups were channeled into the 2-position of the phospholipids in strain PDJ39 (ΔplsX). Extracellular fatty acids were not elongated. Removal of the exogenous fatty acid supplement led to the rapid accumulation of intracellular acyl-ACP and the abrupt cessation of fatty acid synthesis. Extracts from the ΔplsX strain exhibited an ATP-dependent fatty acid kinase activity, and the acyl-PO4 was converted to acyl-ACP when purified PlsX is added. These data reveal the existence of a novel fatty acid kinase pathway for the incorporation of exogenous fatty acids into S. aureus phospholipids. PMID:24673884

  6. Dietary cholesterol supplementation to a plant-based diet suppresses the complete pathway of cholesterol synthesis and induces bile acid production in Atlantic salmon (Salmo salar L.).

    PubMed

    Kortner, Trond M; Björkhem, Ingemar; Krasnov, Aleksei; Timmerhaus, Gerrit; Krogdahl, Åshild

    2014-06-28

    Plants now supply more than 50 % of protein in Norwegian salmon aquafeeds. The inclusion of plant protein in aquafeeds may be associated with decreased lipid digestibility and cholesterol and bile salt levels, indicating that the replacement of fishmeal with plant protein could result in inadequate supplies of cholesterol in fish. A reduction in feed efficiency, fish growth and pathogen resistance is often observed in parallel to alterations in sterol metabolism. Previous studies have indicated that the negative effects induced by plant components can be attenuated when diets are supplemented with cholesterol. The present study evaluated the effects of dietary cholesterol supplementation (1·5 %) in Atlantic salmon fed a plant-based diet for 77 d. The weights of body, intestines and liver were recorded and blood, tissues, faeces, chyme and bile were sampled for the evaluation of effects on growth, nutrient utilisation and metabolism, and transcriptome and metabolite levels, with particular emphasis on sterol metabolism and organ structure and function. Cholesterol supplementation did not affect the growth or organ weights of Atlantic salmon, but seemed to promote the induction of cholesterol and plant sterol efflux in the intestine while suppressing sterol uptake. Cholesterol biosynthesis decreased correspondingly and conversion into bile acids increased. The marked effect of cholesterol supplementation on bile acid synthesis suggests that dietary cholesterol can be used to increase bile acid synthesis in fish. The present study clearly demonstrated how Atlantic salmon adjusted their metabolic functions in response to the dietary load of cholesterol. It has also expanded our understanding of sterol metabolism and turnover, adding to the existing, rather sparse, knowledge of these processes in fish.

  7. β-Hydroxybutyric acid inhibits growth hormone-releasing hormone synthesis and secretion through the GPR109A/extracellular signal-regulated 1/2 signalling pathway in the hypothalamus.

    PubMed

    Fu, S-P; Liu, B-R; Wang, J-F; Xue, W-J; Liu, H-M; Zeng, Y-L; Huang, B-X; Li, S-N; Lv, Q-K; Wang, W; Liu, J-X

    2015-03-01

    β-Hydroxybutyric acid (BHBA) has recently been shown to regulate hormone synthesis and secretion in the hypothalamus. However, little is known about the effects of BHBA-mediated hormone regulation or the detailed mechanisms by which BHBA regulates growth hormone-releasing hormone (GHRH) synthesis and secretion. In the present study, we examined the expression of the BHBA receptor GPR109A in primary hypothalamic cell cultures. We hypothesised that BHBA regulates GHRH via GPR109A and its downstream signals. Initial in vivo studies conducted in rats demonstrated that GHRH mRNA expression in the hypothalamus was strongly inversely correlated with BHBA levels in the cerebrospinal fluid during postnatal development (r = -0.89, P < 0.01). Furthermore, i.c.v. administration of BHBA acutely decreased GHRH mRNA expression in rats. Further in vitro studies revealed a decrease in GHRH synthesis and secretion in primary hypothalamic cells after treatment with BHBA; this effect was inhibited when hypothalamic cells were pretreated with pertussis toxin (PTX). BHBA had no effect on GHRH synthesis and secretion in GT1-7 cells, which do not exhibit cell surface expression of GPR109A. Furthermore, BHBA acutely decreased the transcription of the homeobox gene for Gsh-1 in the hypothalamus in both in vivo and in vitro, and this effect was also inhibited by PTX in vitro. In primary hypothalamic cells, BHBA activated the extracellular signal-regulated kinase (ERK)1/2, p38 and c-Jun N-terminal kinase mitogen-activated protein kinase (MAPK) kinases, as shown by western blot analysis. Moreover, inhibition of ERK1/2 with U0126 attenuated the BHBA-mediated reduction in Gsh-1 expression and GHRH synthesis and secretion. These results strongly suggest that BHBA directly regulates GHRH synthesis and secretion via the GPR109A/ERK1/2 MAPK pathway, and also that Gsh-1 is essential for this function. © 2015 British Society for Neuroendocrinology.

  8. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  9. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  10. Hydrothermal synthesis of amino acids

    NASA Astrophysics Data System (ADS)

    Marshall, William L.

    1994-05-01

    This study presents further evidence that amino acids can be synthesized rapidly in hydrothermal solutions from reactants that may have been present in primitive environments. Aqueous NH 4HCO 3 solutions were reacted with C 2H 2, H 2, and O 2 (formed in situ from CaC 2, Ca, and H 2O 2) at 200-275°C over 0.2-2 h periods to synthesize several amino acids and abundant amines. These amino acid and amine producing reactions were not observed to occur below 150°C. Amino acids and amines also were synthesized at 210°C from solutions of NH 4OH, HCHO, NaCN, and H 2. When NH 4OH was replaced by NH 4HCO 3, the syntheses predominantly confirmed the recent results of RENNET et al. (1992). Additionally, amino acids and amines were observed to form by reactions among NH 4OH, HCHO, and H 2 at hydrothermal conditions, essentially confirming the results of FOX and WINDSOR (1970). Inclusion of both carbonate and O 2 in these latter solutions greatly enhanced the production rate of amino acids. The amines synthesized hydrothermally could be significant if they are precursors in the amino acid syntheses either at hydrothermal or later at lower temperatures. These observations provide additional input to the current questions of synthesis, stability, and decomposition of amino acids at hydrothermal conditions, and their possible relevance to the origin of life.

  11. Metabolic Engineering of a Novel Muconic Acid Biosynthesis Pathway via 4-Hydroxybenzoic Acid in Escherichia coli

    PubMed Central

    Sengupta, Sudeshna; Goonewardena, Lakshani; Juturu, Veeresh

    2015-01-01

    cis,cis-Muconic acid (MA) is a commercially important raw material used in pharmaceuticals, functional resins, and agrochemicals. MA is also a potential platform chemical for the production of adipic acid (AA), terephthalic acid, caprolactam, and 1,6-hexanediol. A strain of Escherichia coli K-12, BW25113, was genetically modified, and a novel nonnative metabolic pathway was introduced for the synthesis of MA from glucose. The proposed pathway converted chorismate from the aromatic amino acid pathway to MA via 4-hydroxybenzoic acid (PHB). Three nonnative genes, pobA, aroY, and catA, coding for 4-hydroxybenzoate hydrolyase, protocatechuate decarboxylase, and catechol 1,2-dioxygenase, respectively, were functionally expressed in E. coli to establish the MA biosynthetic pathway. E. coli native genes ubiC, aroFFBR, aroE, and aroL were overexpressed and the genes ptsH, ptsI, crr, and pykF were deleted from the E. coli genome in order to increase the precursors of the proposed MA pathway. The final engineered E. coli strain produced nearly 170 mg/liter of MA from simple carbon sources in shake flask experiments. The proposed pathway was proved to be functionally active, and the strategy can be used for future metabolic engineering efforts for production of MA from renewable sugars. PMID:26362984

  12. Atmospheric oxidation pathways of acetic acid.

    PubMed

    Rosado-Reyes, Claudette M; Francisco, Joseph S

    2006-04-06

    One of the most abundant carboxylic acids measured in the atmosphere is acetic acid (CH(3)C(O)OH), present in rural, urban, and remote marine environments in the low-ppb range. Acetic acid concentrations are not well reproduced in global 3-D atmospheric models because of the poor inventory of sources and sinks to model its global distribution. To understand the complete oxidation of acetic acid in the atmosphere initiated by OH radicals, ab initio calculations are performed to describe in detail the energetics of the reaction potential energy surface (PES). The proposed reaction mechanism suggests that the CH(3)C(O)OH + OH reaction takes place via three pathways: the addition of OH to the central carbon, the abstraction of a methyl hydrogen, and the abstraction of an acidic hydrogen. The PES is characterized by prereactive H-complexes, transition states, and more interestingly unique radical-mediated isomerization reactions. From the analysis of the energetics, acetic acid atmospheric oxidation will proceed mainly via the abstraction of the acidic hydrogen, consistent with previous experimental and theoretical studies. The major byproducts from each pathway are identified. Glyoxylic acid is suggested to be a major byproduct of the atmospheric oxidation of acetic acid. The atmospheric fate of glyoxylic acid is discussed.

  13. The shikimate pathway and aromatic amino Acid biosynthesis in plants.

    PubMed

    Maeda, Hiroshi; Dudareva, Natalia

    2012-01-01

    L-tryptophan, L-phenylalanine, and L-tyrosine are aromatic amino acids (AAAs) that are used for the synthesis of proteins and that in plants also serve as precursors of numerous natural products, such as pigments, alkaloids, hormones, and cell wall components. All three AAAs are derived from the shikimate pathway, to which ≥30% of photosynthetically fixed carbon is directed in vascular plants. Because their biosynthetic pathways have been lost in animal lineages, the AAAs are essential components of the diets of humans, and the enzymes required for their synthesis have been targeted for the development of herbicides. This review highlights recent molecular identification of enzymes of the pathway and summarizes the pathway organization and the transcriptional/posttranscriptional regulation of the AAA biosynthetic network. It also identifies the current limited knowledge of the subcellular compartmentalization and the metabolite transport involved in the plant AAA pathways and discusses metabolic engineering efforts aimed at improving production of the AAA-derived plant natural products.

  14. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  15. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Printable PDF Open All ... view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  16. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Printable PDF Open All ... view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  17. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages.

    PubMed

    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A; Yin, Yulong

    2015-01-01

    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05) gradually with increasing age. Bama mini-pigs had generally higher (P<0.05) muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but

  18. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  19. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages

    PubMed Central

    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A.; Yin, Yulong

    2015-01-01

    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05) gradually with increasing age. Bama mini-pigs had generally higher (P<0.05) muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but

  20. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  2. Development of a model describing regulation of casein synthesis by the mammalian target of rapamycin (mTOR) signaling pathway in response to insulin, amino acids, and acetate.

    PubMed

    Castro, J J; Arriola Apelo, S I; Appuhamy, J A D R N; Hanigan, M D

    2016-08-01

    To improve dietary protein use efficiency in lactating cows, mammary protein synthesis responses to AA, energy substrates, and hormones must be better understood. These entities exert their effects through stimulation of mRNA translation via control of initiation and elongation rates at the cellular level. A central protein kinase of this phenomenon is the mammalian target of rapamycin (mTOR), which transfers the nutritional and hormonal stimuli onto a series of proteins downstream through a cascade of phosphorylation reactions that ultimately affect protein synthesis. The objective of this work was to further develop an existing mechanistic model of mTOR phosphorylation responses to insulin and total essential AA to include the effects of specific essential AA and acetate mediated by signaling proteins including protein kinase B (Akt), adenosine monophosphate activated protein kinase (AMPK), and mTOR and to add a representation of milk protein synthesis. Data from 6 experiments in MAC-T cells and mammary tissue slices previously conducted in our laboratory were assembled and used to parameterize the dynamic system of differential equations representing Akt, AMPK, and mTOR in their phosphorylated and dephosphorylated states and the resulting regulation of milk protein synthesis. The model predicted phosphorylated Akt, mTOR, AMPK, and casein synthesis rates with root mean square prediction errors of 16.8, 28.4, 33.0, and 54.9%, respectively. All other dependent variables were free of mean and slope bias, indicating an adequate representation of the data. Whereas mTOR was not very sensitive to changes in insulin or acetate levels, it was highly sensitive to leucine and isoleucine, and this signal appeared to be effectively transduced to casein synthesis. Although prior work had observed a relationship with additional essential AA, and data supporting those conclusions were present in the data set, we were unable to derive significant relationships with any essential

  3. Metabolic modeling of Rosmarinic acid biosynthetic pathway

    PubMed Central

    Sundaram, Shanthy; Tripathi, Ashutosh; Gupta, Deepak K

    2010-01-01

    Rosmarinic acid (RA) is an ester of caffeic acid and 3, 4‐dihydroxyphenyllacticacid. It is commonly found in Coleus blumei, Salvia officinalis, Melissa officinalis and Rosmarinus officinalis. The biosynthesis of RA starts with precursor molecules L‐phenylalanine and L‐tyrosine. Simulation of RA biosynthetic pathway was done using Gepasi Software, includes the reaction kinetics of each step of the pathway and different integration methods such as Euler's method. Optimization of the significant parameters responsible for RA biosynthesis was carried out. As the goal of the work was to increase the productivity of i.e. to maximize the concentration of the RA, the final concentration of RA ([RA]t) was selected as an objective function and selected initial concentration of the Caffeoyl‐3’‐4’hydroxyphenyllactic acid (3’C4HPLA) as parameter constraint and varied its initial concentration as: 0≤ [3’C4HPLA]i ≤ 0.025. Several optimization methods such as Simulated annealing, Evolutionary algorithms and Genetic algorithms were used to optimize the objective function. After optimization the final concentration of RA was slightly higher (4.566132e‐002 mM) than before optimization (4.047119e‐ 002 mM). On the basis of results obtained, it is clear that 4‐hydroxyphenyllactic acid and 3’C4HPLA play major role in the high productivity of the RA. PMID:21364781

  4. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  5. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  6. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  7. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  8. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.

  9. Flaviviruses Are Sensitive to Inhibition of Thymidine Synthesis Pathways

    PubMed Central

    Fischer, Matthew A.; Smith, Jessica L.; Shum, David; Stein, David A.; Parkins, Christopher; Bhinder, Bhavneet; Radu, Constantin; Hirsch, Alec J.; Djaballah, Hakim; Nelson, Jay A.

    2013-01-01

    Dengue virus has emerged as a global health threat to over one-third of humankind. As a positive-strand RNA virus, dengue virus relies on the host cell metabolism for its translation, replication, and egress. Therefore, a better understanding of the host cell metabolic pathways required for dengue virus infection offers the opportunity to develop new approaches for therapeutic intervention. In a recently described screen of known drugs and bioactive molecules, we observed that methotrexate and floxuridine inhibited dengue virus infections at low micromolar concentrations. Here, we demonstrate that all serotypes of dengue virus, as well as West Nile virus, are highly sensitive to both methotrexate and floxuridine, whereas other RNA viruses (Sindbis virus and vesicular stomatitis virus) are not. Interestingly, flavivirus replication was restored by folinic acid, a thymidine precursor, in the presence of methotrexate and by thymidine in the presence of floxuridine, suggesting an unexpected role for thymidine in flavivirus replication. Since thymidine is not incorporated into RNA genomes, it is likely that increased thymidine production is indirectly involved in flavivirus replication. A possible mechanism is suggested by the finding that p53 inhibition restored dengue virus replication in the presence of floxuridine, consistent with thymidine-less stress triggering p53-mediated antiflavivirus effects in infected cells. Our data reveal thymidine synthesis pathways as new and unexpected therapeutic targets for antiflaviviral drug development. PMID:23824813

  10. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  11. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  12. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  13. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  14. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  15. Optimal ratios of essential amino acids stimulate β-casein synthesis via activation of the mammalian target of rapamycin signaling pathway in MAC-T cells and bovine mammary tissue explants.

    PubMed

    Li, S S; Loor, J J; Liu, H Y; Liu, L; Hosseini, A; Zhao, W S; Liu, J X

    2017-08-01

    Amino acids are the building blocks of proteins and serve as key molecular components upstream of the signaling pathways that regulate protein synthesis. The objective of this study was to systematically investigate the effect of essential AA ratios on milk protein synthesis in vitro and to elucidate some of the underlying mechanisms. Triplicate cultures of MAC-T cells and bovine mammary tissue explants (MTE) were incubated with the optimal AA ratio (OPAA; Lys:Met, 2.9:1; Thr:Phe, 1.05:1; Lys:Thr, 1.8:1; Lys:His, 2.38:1; and Lys:Val, 1.23:1) in the presence of rapamycin (control), OPAA, a Lys:Thr ratio of 2.1:1, a Lys:Thr ratio of 1.3:1, a Lys:His ratio of 3.05:1, or a Lys:Val ratio of 1.62:1 for 12 h; the other AA concentrations were equal to OPAA. In some experiments, the cells were cultured with OPAA with or without rapamycin (100 ng/mL) or with mammalian target of rapamycin (mTOR) small interference RNA, and the MTE were exposed to OPAA with rapamycin for β-casein expression. Among the treatments, the expression of β-casein was greatest in the MTE cultured with OPAA. In MAC-T cells, the OPAA upregulated the mRNA expression of SLC1A5 and SLC7A5 but downregulated the expression of IRS1, AKT3, EEF1A1, and EEF2 compared with the control. The OPAA had no effect on the mTOR phosphorylation status but increased the phosphorylation of S6K1 and RPS6. When the MTE were treated with rapamycin in the presence of OPAA, the expression of β-casein was markedly decreased. The phosphorylation of RPS6 and 4EBP1 also was reduced in MAC-T cells. A similar negative effect on the expression of RPS6KB1 and EIF4EBP1 was detected when the cells were cultured with either rapamycin or mTOR small interference RNA. The optimal AA ratio stimulated β-casein expression partly by enhancing the transport of AA into the cells, cross-talk with insulin signaling and a subsequent enhancement of mTOR signaling, or translation elongation in both MAC-T cells and bovine MTE. Copyright © 2017

  16. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  17. The Significance of Different Diacylgycerol Synthesis Pathways on Plant Oil Composition and Bioengineering

    PubMed Central

    Bates, Philip D.; Browse, John

    2012-01-01

    The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA) composition of triacylglycerol (TAG). Plants can use two main pathways to produce diacylglycerol (DAG), the immediate precursor molecule to TAG synthesis: (1) De novo DAG synthesis, and (2) conversion of the membrane lipid phosphatidylcholine (PC) to DAG. The FA esterified to PC are also the substrate for FA modification (e.g., desaturation, hydroxylation, etc.), such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions. PMID:22783267

  18. A Type II Pathway for Fatty Acid Biosynthesis Presents Drug Targets in Plasmodium falciparum

    PubMed Central

    Waller, Ross F.; Ralph, Stuart A.; Reed, Michael B.; Su, Vanessa; Douglas, James D.; Minnikin, David E.; Cowman, Alan F.; Besra, Gurdyal S.; McFadden, Geoffrey I.

    2003-01-01

    It has long been held that the malaria parasite, Plasmodium sp., is incapable of de novo fatty acid synthesis. This view has recently been overturned with the emergence of data for the presence of a fatty acid biosynthetic pathway in the relict plastid of P. falciparum (known as the apicoplast). This pathway represents the type II pathway common to plant chloroplasts and bacteria but distinct from the type I pathway of animals including humans. Specific inhibitors of the type II pathway, thiolactomycin and triclosan, have been reported to target this Plasmodium pathway. Here we report further inhibitors of the plastid-based pathway that inhibit Plasmodium parasites. These include several analogues of thiolactomycin, two with sixfold-greater efficacy than thiolactomycin. We also report that parasites respond very rapidly to such inhibitors and that the greatest sensitivity is seen in ring-stage parasites. This study substantiates the importance of fatty acid synthesis for blood-stage parasite survival and shows that this pathway provides scope for the development of novel antimalarial drugs. PMID:12499205

  19. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?1[OPEN

    PubMed Central

    Nichols, David S.; Smith, Jason; Chourey, Prem S.; McAdam, Erin L.; Quittenden, Laura

    2016-01-01

    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA. However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  20. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

    PubMed

    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

    2012-05-18

    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  1. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  2. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  3. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  4. Evolutionary algorithm for metabolic pathways synthesis.

    PubMed

    Gerard, Matias F; Stegmayer, Georgina; Milone, Diego H

    2016-06-01

    Metabolic pathway building is an active field of research, necessary to understand and manipulate the metabolism of organisms. There are different approaches, mainly based on classical search methods, to find linear sequences of reactions linking two compounds. However, an important limitation of these methods is the exponential increase of search trees when a large number of compounds and reactions is considered. Besides, such models do not take into account all substrates for each reaction during the search, leading to solutions that lack biological feasibility in many cases. This work proposes a new evolutionary algorithm that allows searching not only linear, but also branched metabolic pathways, formed by feasible reactions that relate multiple compounds simultaneously. Tests performed using several sets of reactions show that this algorithm is able to find feasible linear and branched metabolic pathways. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  6. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  7. Pinolenic Acid Downregulates Lipid Anabolic Pathway in HepG2 Cells.

    PubMed

    Lee, Ah Ron; Han, Sung Nim

    2016-07-01

    Pine nut oil (PNO) was reported to reduce lipid accumulation in the liver. However, the specific effect of pinolenic acid (18:3, all-cis-Δ5,9,12), a unique component of PNO, on lipid metabolism has not been studied. We hypothesized that pinolenic acid downregulates the lipid anabolic pathway in HepG2 cells. HepG2 cells were incubated in serum-free medium supplemented with 50 μM bovine serum albumin (BSA), palmitic acid, oleic acid, γ-linolenic acid, pinolenic acid, eicosapentaenoic acid (EPA), or α-linolenic acid for 24 h. Lipid accumulation was determined by Oil Red O (ORO) staining. The mRNA levels of genes related to fatty acid biosynthesis (SREBP1c, FAS, SCD1, and ACC1), fatty acid oxidation (ACC2, PPARα, CPT1A, and ACADL), cholesterol synthesis (SREBP2 and HMGCR), and lipoprotein uptake (LDLr) and of genes that may be involved in the downregulation of the lipogenic pathway (ACSL3, ACSL4, and ACSL5) were determined by qPCR. LDLR protein levels were measured by Western blot analysis. The mRNA levels of SREBP1c, FAS, and SCD1 were significantly downregulated by pinolenic acid treatment compared to BSA control (53, 54, and 38 % lower, respectively). In addition, the mRNA levels of HMGCR, ACSL3, and LDLr were significantly lower (30, 30, and 43 % lower, respectively), and ACSL4 tended to be lower in the pinolenic acid group (20 % lower, P = 0.082) relative to the control group. In conclusion, pinolenic acid downregulated the lipid anabolic pathway in HepG2 cells by reducing expression of genes related to lipid synthesis, lipoprotein uptake, and the regulation of the lipogenic pathway.

  8. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  9. Chemical Synthesis of Modified Hyaluronic Acid Disaccharides.

    PubMed

    Mende, Marco; Nieger, Martin; Bräse, Stefan

    2017-09-07

    Herein we report a chemical synthesis towards new modified hyaluronic acid oligomers by using only commercially available d-glucose and d-glucosamine hydrochloride. The various protected hyaluronic acid disaccharides were synthesized bearing new functional groups at C-6 of the β-d-glucuronic acid moiety with a view to structure-related biological activity tests. The orthogonal protecting group pattern allows ready access to the corresponding higher oligomers. Also, (1) H NMR studies of the new derivatives demonstrated the effect of the various functional groups on the intramolecular electronic environment. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  11. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  12. The Biosynthetic Pathways for Shikimate and Aromatic Amino Acids in Arabidopsis thaliana

    PubMed Central

    Tzin, Vered; Galili, Gad

    2010-01-01

    The aromatic amino acids phenylalanine, tyrosine and tryptophan in plants are not only essential components of protein synthesis, but also serve as precursors for a wide range of secondary metabolites that are important for plant growth as well as for human nutrition and health. The aromatic amino acids are synthesized via the shikimate pathway followed by the branched aromatic amino acid metabolic pathway, with chorismate serving as a major branch point intermediate metabolite. Yet, the regulation of their synthesis is still far from being understood. So far, only three enzymes in this pathway, namely, chorismate mutase of phenylalanine and tyrosine synthesis, tryptophan synthase of tryptophan biosynthesis and arogenate dehydratase of phenylalanine biosynthesis, proved experimentally to be allosterically regulated. The major biosynthesis route of phenylalanine in plants occurs via arogenate. Yet, recent studies suggest that an alternative route of phynylalanine biosynthesis via phenylpyruvate may also exist in plants, similarly to many microorganisms. Several transcription factors regulating the expression of genes encoding enzymes of both the shikimate pathway and aromatic amino acid metabolism have also been recently identified in Arabidopsis and other plant species. PMID:22303258

  13. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  14. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  15. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  16. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  17. Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?

    PubMed Central

    Parsons, Joshua B.; Rock, Charles O.

    2011-01-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391

  18. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  19. Tetrahydrobiopterin Biosynthesis as a Potential Target of the Kynurenine Pathway Metabolite Xanthurenic Acid.

    PubMed

    Haruki, Hirohito; Hovius, Ruud; Pedersen, Miriam Grønlund; Johnsson, Kai

    2016-01-08

    Tryptophan metabolites in the kynurenine pathway are up-regulated by pro-inflammatory cytokines or glucocorticoids, and are linked to anti-inflammatory and immunosuppressive activities. In addition, they are up-regulated in pathologies such as cancer, autoimmune diseases, and psychiatric disorders. The molecular mechanisms of how kynurenine pathway metabolites cause these effects are incompletely understood. On the other hand, pro-inflammatory cytokines also up-regulate the amounts of tetrahydrobiopterin (BH4), an enzyme cofactor essential for the synthesis of several neurotransmitter and nitric oxide species. Here we show that xanthurenic acid is a potent inhibitor of sepiapterin reductase (SPR), the final enzyme in de novo BH4 synthesis. The crystal structure of xanthurenic acid bound to the active site of SPR reveals why among all kynurenine pathway metabolites xanthurenic acid is the most potent SPR inhibitor. Our findings suggest that increased xanthurenic acid levels resulting from up-regulation of the kynurenine pathway could attenuate BH4 biosynthesis and BH4-dependent enzymatic reactions, linking two major metabolic pathways known to be highly up-regulated in inflammation.

  20. Glycerolipid synthesis in Chlorella kessleri 11h. I. Existence of a eukaryotic pathway.

    PubMed

    Sato, Norihiro; Tsuzuki, Mikio; Kawaguchi, Akihiko

    2003-07-04

    The fatty acid distributions at the sn-1 and sn-2 positions in major chloroplast lipids of Chlorella kessleri 11h, monogalactosyl diacylglycerol (MGDG) and digalactosyl diacylglycerol (DGDG), were determined to show the coexistence of both C16 and C18 acids at the sn-2 position, i.e. of prokaryotic and eukaryotic types in these galactolipids. For investigation of the biosynthetic pathway for glycerolipids in C. kessleri 11h, cells were fed with [14C]acetate for 30 min, and then the distribution of the radioactivity among glycerolipids and their constituent fatty acids during the subsequent chase period was determined. MGDG and DGDG were labeled predominantly as the sn-1-C18-sn-2-C16 (C18/C16) species as early as by the start of the chase, which suggested the synthesis of these lipids within chloroplasts via a prokaryotic pathway. On the other hand, the sn-1-C18-sn-2-C18 (C18/C18) species of these galactolipids gradually gained radioactivity at later times, concomitant with a decrease in the radioactivity of the C18/C18 species of phosphatidylcholine (PC). The change at later times can be explained by the conversion of the C18/C18 species of PC into galactolipids through a eukaryotic pathway. The results showed that C. kessleri 11h, distinct from most of other green algal species that were postulated mainly to use a prokaryotic pathway for the synthesis of chloroplast lipids, is similar to a group of higher plants designated as 16:3 plants in terms of the cooperation of prokaryotic and eukaryotic pathways to synthesize chloroplast lipids. We propose that the physiological function of the eukaryotic pathway in C. kessleri 11h is to supply chloroplast membranes with 18:3/18:3-MGDG for their functioning, and that the acquisition of a eukaryotic pathway by green algae was favorable for evolution into land plants.

  1. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  2. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  3. Total Synthesis of (-)-Nahuoic Acid Ci (Bii).

    PubMed

    Liu, Qi; Deng, Yifan; Smith, Amos B

    2017-09-21

    A convergent total synthesis of (-)-nahuoic acid Ci(Bii) (3), a novel cis-decalin polyketide, has been achieved. Key synthetic transformations include Type II Anion Relay Chemistry (ARC) to construct the polyol chain, a Ti-catalyzed asymmetric Diels-Alder reaction to generate the cis-decalin skeleton, and a late-stage large fragment union exploiting a Micalizio alkoxide-directed alkyne-alkene coupling tactic.

  4. Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus

    DOE PAGES

    Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.; ...

    2014-09-29

    Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Lastly, defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.

  5. Exploring biochemical pathways for mono-ethylene glycol (MEG) synthesis from synthesis gas.

    PubMed

    Islam, M Ahsanul; Hadadi, Noushin; Ataman, Meric; Hatzimanikatis, Vassily; Stephanopoulos, Gregory

    2017-05-01

    Mono-ethylene glycol (MEG) is an important petrochemical with widespread use in numerous consumer products. The current industrial MEG-production process relies on non-renewable fossil fuel-based feedstocks, such as petroleum, natural gas, and naphtha; hence, it is useful to explore alternative routes of MEG-synthesis from gases as they might provide a greener and more sustainable alternative to the current production methods. Technologies of synthetic biology and metabolic engineering of microorganisms can be deployed for the expression of new biochemical pathways for MEG-synthesis from gases, provided that such promising alternative routes are first identified. We used the BNICE.ch algorithm to develop novel and previously unknown biological pathways to MEG from synthesis gas by leveraging the Wood-Ljungdahl pathway of carbon fixation of acetogenic bacteria. We developed a set of useful pathway pruning and analysis criteria to systematically assess thousands of pathways generated by BNICE.ch. Published genome-scale models of Moorella thermoacetica and Clostridium ljungdahlii were used to perform the pathway yield calculations and in-depth analyses of seven (7) newly developed biological MEG-producing pathways from gases, including CO2, CO, and H2. These analyses helped identify not only better candidate pathways, but also superior chassis organisms that can be used for metabolic engineering of the candidate pathways. The pathway generation, pruning, and detailed analysis procedures described in this study can also be used to develop biochemical pathways for other commodity chemicals from gaseous substrates. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  6. Ascorbate synthesis pathway, dual role of ascorbate in bone homeostasis

    USDA-ARS?s Scientific Manuscript database

    Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) m...

  7. Regulation of protein synthesis by amino acids in muscle of neonates

    PubMed Central

    Suryawan, Agus; Davis, Teresa A.

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241

  8. Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

    NASA Astrophysics Data System (ADS)

    Fu, Qi; Socki, Richard A.; Niles, Paul B.

    2015-04-01

    Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher δ13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of δ13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ∼31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of δ13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic

  9. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  10. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors.

    PubMed

    Lei, Anping; Chen, Huan; Shen, Guoming; Hu, Zhangli; Chen, Lei; Wang, Jiangxin

    2012-03-26

    Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production.

  11. Pathway of thiamine pyrophosphate synthesis in Micrococcus denitrificans.

    PubMed Central

    Sanemori, H; Egi, Y; Kawasaki, T

    1976-01-01

    The pathway of thiamine pyrophosphate (TPP) biosynthesis, which is formed either from exogeneously added thiamine or from the pyrimidine and thiazole moieties of thiamine, in Micrococcus denitrificans was investigated. The following indirect evidence shows that thiamine pyrophosphokinase (EC 2.7.6.2) catalyzes the synthesis of TPP from thiamine: (i) [35S]thiamine incubated with cells of this microorganism was detected in the form of [35S]thiamine; (ii) thiamine gave a much faster rate of TPP synthesis than thiamine monophosphate (TMP) when determined with the extracts; and (iii) a partially purified preparation of the extracts can use thiamine, but not TMP, as the substrate. The activities of the four enzymes involved in TMP synthesis from pyrimidine and thiazole moieties of thiamine were detected in the extracts of M. denitrificans. The extracts contained a high activity of the phosphatase, probably specific for TMP. After M. denitrificans cells were grown on a minimal medium containing 3 mM adenosine, which causes derepression of de novo thiamine biosynthesis in Escherichia coli, the activities of the four enzymes involved with TMP synthesis, the TMP phosphatase, and the thiamine pyrophosphokinase were enhanced two- to threefold. These results indicate that TPP is synthesized directly from thiamine without forming TMP as an intermediate and that de novo synthesis of TPP from the pyrimidine and thiazole moieties involves the formation of TMP, followed by hydrolysis to thiamine, which is then converted to TPP directly. Thus, the pathway of TPP synthesis from TMP synthesized de novo in M. denitrificans is different from that found in E. coli, in which TMP synthesized de novo is converted directly to TPP without producing thiamine. PMID:181359

  12. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  13. Pathways for virus assembly around nucleic acids

    PubMed Central

    Perlmutter, Jason D; Perkett, Matthew R

    2014-01-01

    Understanding the pathways by which viral capsid proteins assemble around their genomes could identify key intermediates as potential drug targets. In this work we use computer simulations to characterize assembly over a wide range of capsid protein-protein interaction strengths and solution ionic strengths. We find that assembly pathways can be categorized into two classes, in which intermediates are either predominantly ordered or disordered. Our results suggest that estimating the protein-protein and the protein-genome binding affinities may be sufficient to predict which pathway occurs. Furthermore, the calculated phase diagrams suggest that knowledge of the dominant assembly pathway and its relationship to control parameters could identify optimal strategies to thwart or redirect assembly to block infection. Finally, analysis of simulation trajectories suggests that the two classes of assembly pathways can be distinguished in single molecule fluorescence correlation spectroscopy or bulk time resolved small angle x-ray scattering experiments. PMID:25036288

  14. Mass-Spectrometry-Based Quantification of Protein-Bound Fatty Acid Synthesis Intermediates from Escherichia coli.

    PubMed

    Noga, Marek J; Cerri, Mattia; Imholz, Nicole; Tulinski, Pawel; Şahin, Enes; Bokinsky, Gregory

    2016-10-07

    The production of fatty acids from simple nutrients occurs via a complex biosynthetic pathway with dozens of intermediate compounds and multiple branch points. Despite its importance for microbial physiology and biotechnology, critical aspects of fatty acid biosynthesis, especially dynamics of in vivo regulation, remain poorly characterized. We have developed a liquid chromatography/mass spectroscopy (LC-MS) method for relative quantification of fatty acid synthesis intermediates in Escherichia coli, a model organism for studies of fatty acid metabolism. The acyl carrier protein, a vehicle for the substrates and intermediates of fatty acid synthesis, is extracted from E. coli, proteolytically digested, resolved using reverse-phase LC, and detected using electrospray ionization coupled with a tandem MS. Our method reliably resolves 21 intermediates of fatty acid synthesis, with an average relative standard deviation in ratios of individual acyl-ACP species to total ACP concentrations of 20%. We demonstrate that fast sampling and quenching of cells is essential to accurately characterize intracellular concentrations of ACP species. We apply our method to examine the rapid response of fatty acid metabolism to the antibiotic cerulenin. We anticipate that our method will enable the characterization of in vivo regulation and kinetics of microbial fatty acid synthesis at unprecedented detail and will improve integration of fatty acid synthesis into models of microbial metabolism.

  15. Exploring De Novo metabolic pathways from pyruvate to propionic acid.

    PubMed

    Stine, Andrew; Zhang, Miaomin; Ro, Soo; Clendennen, Stephanie; Shelton, Michael C; Tyo, Keith E J; Broadbelt, Linda J

    2016-03-01

    Industrial biotechnology provides an efficient, sustainable solution for chemical production. However, designing biochemical pathways based solely on known reactions does not exploit its full potential. Enzymes are known to accept non-native substrates, which may allow novel, advantageous reactions. We have previously developed a computational program named Biological Network Integrated Computational Explorer (BNICE) to predict promiscuous enzyme activities and design synthetic pathways, using generalized reaction rules curated from biochemical reaction databases. Here, we use BNICE to design pathways synthesizing propionic acid from pyruvate. The currently known natural pathways produce undesirable by-products lactic acid and succinic acid, reducing their economic viability. BNICE predicted seven pathways containing four reaction steps or less, five of which avoid these by-products. Among the 16 biochemical reactions comprising these pathways, 44% were validated by literature references. More than 28% of these known reactions were not in the BNICE training dataset, showing that BNICE was able to predict novel enzyme substrates. Most of the pathways included the intermediate acrylic acid. As acrylic acid bioproduction has been well advanced, we focused on the critical step of reducing acrylic acid to propionic acid. We experimentally validated that Oye2p from Saccharomyces cerevisiae can catalyze this reaction at a slow turnover rate (10(-3) s(-1) ), which was unknown to occur with this enzyme, and is an important finding for further propionic acid metabolic engineering. These results validate BNICE as a pathway-searching tool that can predict previously unknown promiscuous enzyme activities and show that computational methods can elucidate novel biochemical pathways for industrial applications. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:303-311, 2016. © 2016 American Institute of Chemical Engineers.

  16. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  17. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis

    DOE PAGES

    Tsogtbaatar, Enkhtuul; Cocuron, Jean -Christophe; Sonera, Marcos Corchado; ...

    2015-02-22

    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oilmore » synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography-mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. In conclusion, this study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos.« less

  18. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis

    PubMed Central

    Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula

    2015-01-01

    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography–mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography–tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos. PMID:25711705

  19. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis.

    PubMed

    Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula

    2015-07-01

    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography-mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos.

  20. Pathways for virus assembly around nucleic acids.

    PubMed

    Perlmutter, Jason D; Perkett, Matthew R; Hagan, Michael F

    2014-09-09

    Understanding the pathways by which viral capsid proteins assemble around their genomes could identify key intermediates as potential drug targets. In this work, we use computer simulations to characterize assembly over a wide range of capsid protein-protein interaction strengths and solution ionic strengths. We find that assembly pathways can be categorized into two classes, in which intermediates are either predominantly ordered or disordered. Our results suggest that estimating the protein-protein and the protein-genome binding affinities may be sufficient to predict which pathway occurs. Furthermore, the calculated phase diagrams suggest that knowledge of the dominant assembly pathway and its relationship to control parameters could identify optimal strategies to thwart or redirect assembly to block infection. Finally, analysis of simulation trajectories suggests that the two classes of assembly pathways can be distinguished in single-molecule fluorescence correlation spectroscopy or bulk time-resolved small-angle X-ray scattering experiments. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  2. Akt Phosphorylation and Regulation of Transketolase Is a Nodal Point for Amino Acid Control of Purine Synthesis

    PubMed Central

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T.; Phan, Tony; Pilz, Renate B.; Boss, Gerry R.

    2014-01-01

    SUMMARY The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mTORC2 and IκB kinase regulate Akt activity, and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the non-oxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the non-oxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for two days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a new mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  3. Akt phosphorylation and regulation of transketolase is a nodal point for amino acid control of purine synthesis.

    PubMed

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T; Phan, Tony; Pilz, Renate B; Boss, Gerry R

    2014-07-17

    The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mammalian target of rapamycin 2 and IκB kinase regulate Akt activity and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the nonoxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the nonoxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for 2 days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Hydroxyeicosatetraenoic acids released through the cytochrome P-450 pathway regulate 3T6 fibroblast growth.

    PubMed

    Nieves, Diana; Moreno, Juan José

    2006-12-01

    Eicosanoids participate in the regulation of cellular proliferation. Thus, we observed that prostaglandin E(2) interaction with membrane receptors is involved in the control of 3T6 fibroblast growth induced by serum. However, our results suggested that another arachidonic acid pathway might be implicated in these events. Our results show that 3T6 fibroblasts synthesized hydroxyeicosatetraenoic acids (HETEs) such as 12-HETE through the cytochrome P-450 (CYP450) pathway. However, 3T6 fibroblasts did not produce leukotriene B(4) (LTB(4)), and lipoxygenase inhibitors and LT antagonists failed to inhibit 3T6 fibroblast growth induced by FBS. In contrast, we observed that CYP450 inhibitors such as SKF-525A, 17-octadecynoic acid, 1-aminobenzotriazole, and 6-(2-propargyloxyphenyl)hexanoic acid reduced 12(S)-HETE levels, 3T6 fibroblast growth, and DNA synthesis induced by FBS. The impairment of DNA synthesis and 3T6 fibroblast growth induced by SKF-525A were reversed by exogenous addition of HETEs. Moreover, we report that 5-HETE, 12(S)-HETE, and 15(S)-HETE are mitogenic on 3T6 fibroblast in the absence of another growth factor, and this effect was dependent on the activation of the phosphatidylinositol-3-kinase pathway. In conclusion, our results show that HETEs, probably produced by CYP450, are involved in the control of 3T6 fibroblast growth.

  5. Metabolic engineering of Escherichia coli for 1-butanol and 1-propanol production via the keto-acid pathways.

    PubMed

    Shen, C R; Liao, J C

    2008-11-01

    Production of higher alcohols via the keto-acid intermediates found in microorganism's native amino-acid pathways has recently shown promising results. In this work, an Escherichia coli strain that produces 1-butanol and 1-propanol from glucose was constructed. The strain first converts glucose to 2-ketobutyrate, a common keto-acid intermediate for isoleucine biosynthesis. Then, 2-ketobutyrate is converted to 1-propanol through reactions catalyzed by the heterologous decarboxylase and dehydrogenase, or to 1-butanol via the chemistry involved in the synthesis of the unnatural amino acid norvaline. We systematically improved the synthesis of 1-propanol and 1-butanol through deregulation of amino-acid biosynthesis and elimination of competing pathways. The final strain demonstrated a production titer of 2 g/L with nearly 1:1 ratio of butanol and propanol.

  6. New Approaches to Target the Mycolic Acid Biosynthesis Pathway for the Development of Tuberculosis Therapeutics

    PubMed Central

    North, E. Jeffrey; Jackson, Mary; Lee, Richard E.

    2015-01-01

    Mycolic acids are the major lipid component of the unique mycobacterial cell wall responsible for the protection of the tuberculosis bacilli from many outside threats. Mycolic acids are synthesized in the cytoplasm and transported to the outer membrane as trehalose-containing glycolipids before being esterified to the arabinogalactan portion of the cell wall and outer membrane glycolipids. The large size of these unique fatty acids is a result of a huge metabolic investment that has been evolutionarily conserved, indicating the importance of these lipids to the mycobacterial cellular survival. There are many key enzymes involved in the mycolic acid biosynthetic pathway, including fatty acid synthesis (KasA, KasB, MabA, InhA, HadABC), mycolic acid modifying enzymes (SAM-dependent methyltransferases, aNAT), fatty acid activating and condensing enzymes (FadD32, Acc, Pks13), transporters (MmpL3) and tranferases (Antigen 85A-C) all of which are excellent potential drug targets. Not surprisingly, in recent years many new compounds have been reported to inhibit specific portions of this pathway, discovered through both phenotypic screening and target enzyme screening. In this review, we analyze the new and emerging inhibitors of this pathway discovered in the post-genomic era of tuberculosis drug discovery, several of which show great promise as selective tuberculosis therapeutics. PMID:24245756

  7. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  8. Loss of Nuclear Receptor SHP Impairs but Does Not Eliminate Negative Feedback Regulation of Bile Acid Synthesis

    PubMed Central

    Kerr, Thomas A.; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W.; Schwarz, Margrit

    2014-01-01

    Summary The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  9. Valproic acid, a molecular lead to multiple regulatory pathways.

    PubMed

    Kostrouchová, M; Kostrouch, Z; Kostrouchová, M

    2007-01-01

    Valproic acid (2-propyl pentanoic acid) is a drug used for the treatment of epilepsy and bipolar disorder. Although very rare, side effects such as spina bifida and other defects of neural tube closure indicate that valproic acid interferes with developmental regulatory pathways. Recently obtained data show that valproic acid affects cell growth, differentiation, apoptosis and immunogenicity of cultured cancer cells and tumours. Focused studies uncovered the potential of valproic acid to interfere with multiple regulatory mechanisms including histone deacetylases, GSK3 alpha and beta, Akt, the ERK pathway, the phosphoinositol pathway, the tricarboxylic acid cycle, GABA, and the OXPHOS system. Valproic acid is emerging as a potential anticancer drug and may also serve as a molecular lead that can help design drugs with more specific and more potent effects on the one side and drugs with wide additive but weaker effects on the other. Valproic acid is thus a powerful molecular tool for better understanding and therapeutic targeting of pathways that regulate the behaviour of cancer cells.

  10. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  11. Occurrence of agmatine pathway for putrescine synthesis in Selenomonas ruminatium.

    PubMed

    Liao, Shaofu; Poonpairoj, Phuntip; Ko, Kyong-Cheol; Takatuska, Yumiko; Yamaguchi, Yoshihiro; Abe, Naoki; Kaneko, Jun; Kamio, Yoshiyuki

    2008-02-01

    Selenomonas ruminantium synthesizes cadaverine and putrescine from L-lysine and L-ornithine as the essential constituents of its peptidoglycan by a constitutive lysine/ornithine decarboxylase (LDC/ODC). S. ruminantium grew normally in the presence of the specific inhibitor for LDC/ODC, DL-alpha-difluoromethylornithine, when arginine was supplied in the medium. In this study, we discovered the presence of arginine decarboxylase (ADC), the key enzyme in agmatine pathway for putrescine synthesis, in S. ruminantium. We purified and characterized ADC and cloned its gene (adc) from S. ruminantium chromosomal DNA. ADC showed more than 60% identity with those of LDC/ODC/ADCs from Gram-positive bacteria, but no similarity to that from Gram-negative bacteria. In this study, we also cloned the aguA and aguB genes, encoding agmatine deiminase (AguA) and N-carbamoyl-putrescine amidohydrolase (AguB), both of which are involved in conversion from agmatine into putrescine. AguA and AguB were expressed in S. ruminantium. Hence, we concluded that S. ruminantium has both ornithine and agmatine pathways for the synthesis of putrescine.

  12. Variations in metabolic pathways create challenges for automated metabolic reconstructions: Examples from the tetrahydrofolate synthesis pathway

    PubMed Central

    de Crécy-Lagard, Valérie

    2014-01-01

    The availability of thousands of sequenced genomes has revealed the diversity of biochemical solutions to similar chemical problems. Even for molecules at the heart of metabolism, such as cofactors, the pathway enzymes first discovered in model organisms like Escherichia coli or Saccharomyces cerevisiae are often not universally conserved. Tetrahydrofolate (THF) (or its close relative tetrahydromethanopterin) is a universal and essential C1-carrier that most microbes and plants synthesize de novo. The THF biosynthesis pathway and enzymes are, however, not universal and alternate solutions are found for most steps, making this pathway a challenge to annotate automatically in many genomes. Comparing THF pathway reconstructions and functional annotations of a chosen set of folate synthesis genes in specific prokaryotes revealed the strengths and weaknesses of different microbial annotation platforms. This analysis revealed that most current platforms fail in metabolic reconstruction of variant pathways. However, all the pieces are in place to quickly correct these deficiencies if the different databases were built on each other's strengths. PMID:25210598

  13. Ambient pressure synthesis of MIL-100(Fe) MOF from homogeneous solution using a redox pathway.

    PubMed

    Jeremias, Felix; Henninger, Stefan K; Janiak, Christoph

    2016-05-17

    Micro- to mesoporous iron(iii) trimesate MIL-100(Fe) is a MOF of high interest for numerous applications. With regard to large-scale synthesis, e.g., by continuous flow or the in situ deposition of coatings, a replacement for the conventional, hydrothermal low-yield fluoride-containing synthesis is desirable. In this contribution, we present a method to synthesize crystalline fluoride-free MIL-100(Fe) from iron(iii) nitrate and trimesic acid in zeotropic DMSO/water solution at normal ambient pressure involving a DMSO-nitrate redox pathway. Yields of 72%, surface areas of SBET = 1791 m(2) g(-1) and pore volumes of Vpore = 0.82 cm(3) g(-1) were achieved.

  14. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  15. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  16. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  17. Inhibition of Fatty Acid Synthase Reduces Blastocyst Hatching through Regulation of the AKT Pathway in Pigs

    PubMed Central

    Guo, Jing; Kim, Nam-Hyung; Cui, Xiang-Shun

    2017-01-01

    Fatty acid synthase (FASN) is an enzyme responsible for the de novo synthesis of long-chain fatty acids. During oncogenesis, FASN plays a role in growth and survival rather than acting within the energy storage pathways. Here, the function of FASN during early embryonic development was studied using its specific inhibitor, C75. We found that the presence of the inhibitor reduced blastocyst hatching. FASN inhibition decreased Cpt1 expression, leading to a reduction in mitochondria numbers and ATP content. This inhibition of FASN resulted in the down-regulation of the AKT pathway, thereby triggering apoptosis through the activation of the p53 pathway. Activation of the apoptotic pathway also leads to increased accumulation of reactive oxygen species and autophagy. In addition, the FASN inhibitor impaired cell proliferation, a parameter of blastocyst quality for outgrowth. The level of OCT4, an important factor in embryonic development, decreased after treatment with the FASN inhibitor. These results show that FASN exerts an effect on early embryonic development by regulating both fatty acid oxidation and the AKT pathway in pigs. PMID:28107461

  18. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  19. Resistance of lung fatty acid synthesis to inhibition by dietary fat in the meal-fed rat.

    PubMed

    Clarke, S D; Wilson, M D; Ibnoughazala, T

    1984-03-01

    One-half of the palmitate utilized by the lung for production of the surfactant phospholipid, dipalmitoyl phosphatidylcholine, originates from de novo palmitate synthesis in the lung. In this report the lung was examined for the influence of dietary fat on the lung de novo fatty acid synthesis pathway. Lung lipogenesis was reduced by fasting and accelerated by carbohydrate refeeding or insulin injection. However, in general lung fatty acid synthesis was unaffected by dietary fat. Supplementing one meal (high glucose diet) with as much as 36% additional fat kilocalories did not suppress lung fatty acid synthesis. An inhibition of fatty acid synthesis resulted from a fat supplement of +60 and +120% of meal kilocalories, but this inhibition was likely due to an attenuated rate of glucose absorption. Ingestion of a high carbohydrate diet supplemented with 10, 17, or 30% added kilocalories as safflower oil or palmitate had no effect on lipogenesis after 10 days. On the other hand, liver fatty acid synthesis and acetyl-CoA carboxylase were selectively suppressed by safflower oil, whereas dietary palmitate was ineffective as an inhibitor of lipogenesis. These data clearly demonstrate that the well-characterized preferential suppression of liver lipogenesis by dietary polyunsaturated fats does not extend to lung tissue, and, more importantly, the inhibition of liver lipogenesis is not secondary to an essential fatty acid deficiency. The marked resistance of lung fatty acid synthesis to inhibition by dietary fat might be a biological protective mechanism to ensure adequate palmitate for dipalmitoyl phosphatidylcholine synthesis.

  20. Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha.

    PubMed

    Eklund, D Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L

    2015-06-01

    The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. © 2015 American Society of Plant Biologists. All rights reserved.

  1. Metabolomics Analysis Reveals that AICAR Affects Glycerolipid, Ceramide and Nucleotide Synthesis Pathways in INS-1 Cells.

    PubMed

    ElAzzouny, Mahmoud A; Evans, Charles R; Burant, Charles F; Kennedy, Robert T

    2015-01-01

    AMPK regulates many metabolic pathways including fatty acid and glucose metabolism, both of which are closely associated with insulin secretion in pancreatic β-cells. Insulin secretion is regulated by metabolic coupling factors such as ATP/ADP ratio and other metabolites generated by the metabolism of nutrients such as glucose, fatty acid and amino acids. However, the connection between AMPK activation and insulin secretion in β-cells has not yet been fully elucidated at a metabolic level. To study the effect of AMPK activation on glucose stimulated insulin secretion, we applied the pharmacological activator 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) to an INS-1 (832/13) β-cell line. We measured the change in 66 metabolites in the presence or absence of AICAR using different stable isotopic labeled nutrients to probe selected pathways. AMPK activation by AICAR increased basal insulin secretion and reduced the glucose stimulation index. Although ATP/ADP ratios were not strongly affected by AICAR, several other metabolites and pathways important for insulin secretion were affected by AICAR treatment including long-chain CoAs, malonyl-CoA, 3-hydroxy-3 methylglutaryl CoA, diacylglycerol, and farnesyl pyrophosphate. Tracer studies using 13C-glucose revealed lower glucose flux in the purine and pyrimidine pathway and in the glycerolipid synthesis pathway. Untargeted metabolomics revealed reduction in ceramides caused by AICAR that may explain the beneficial role of AMPK in protecting β-cells from lipotoxicity. Taken together, the results provide an overall picture of the metabolic changes associated with AICAR treatment and how it modulates insulin secretion and β-cell survival.

  2. Metabolomics Analysis Reveals that AICAR Affects Glycerolipid, Ceramide and Nucleotide Synthesis Pathways in INS-1 Cells

    PubMed Central

    ElAzzouny, Mahmoud A.; Evans, Charles R.; Burant, Charles F; Kennedy, Robert T.

    2015-01-01

    AMPK regulates many metabolic pathways including fatty acid and glucose metabolism, both of which are closely associated with insulin secretion in pancreatic β-cells. Insulin secretion is regulated by metabolic coupling factors such as ATP/ADP ratio and other metabolites generated by the metabolism of nutrients such as glucose, fatty acid and amino acids. However, the connection between AMPK activation and insulin secretion in β-cells has not yet been fully elucidated at a metabolic level. To study the effect of AMPK activation on glucose stimulated insulin secretion, we applied the pharmacological activator 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) to an INS-1 (832/13) β-cell line. We measured the change in 66 metabolites in the presence or absence of AICAR using different stable isotopic labeled nutrients to probe selected pathways. AMPK activation by AICAR increased basal insulin secretion and reduced the glucose stimulation index. Although ATP/ADP ratios were not strongly affected by AICAR, several other metabolites and pathways important for insulin secretion were affected by AICAR treatment including long-chain CoAs, malonyl-CoA, 3-hydroxy-3 methylglutaryl CoA, diacylglycerol, and farnesyl pyrophosphate. Tracer studies using 13C-glucose revealed lower glucose flux in the purine and pyrimidine pathway and in the glycerolipid synthesis pathway. Untargeted metabolomics revealed reduction in ceramides caused by AICAR that may explain the beneficial role of AMPK in protecting β-cells from lipotoxicity. Taken together, the results provide an overall picture of the metabolic changes associated with AICAR treatment and how it modulates insulin secretion and β-cell survival. PMID:26107620

  3. Classical dendritic cells mediate fibrosis directly via the retinoic acid pathway in severe eye allergy

    PubMed Central

    Ahadome, Sarah D.; Mathew, Rose; Reyes, Nancy J.; Mettu, Priyatham S.; Cousins, Scott W.; Calder, Virginia L.; Saban, Daniel R.

    2016-01-01

    Fibrosis is a shared end-stage pathway to lung, liver, and heart failure. In the ocular mucosa (conjunctiva), fibrosis leads to blindness in trachoma, pemphigoid, and allergy. The indirect fibrogenic role of DCs via T cell activation and inflammatory cell recruitment is well documented. However, here we demonstrate that DCs can directly induce fibrosis. In the mouse model of allergic eye disease (AED), classical CD11b+ DCs in the ocular mucosa showed increased activity of aldehyde dehydrogenase (ALDH), the enzyme required for retinoic acid synthesis. In vitro, CD11b+ DC–derived ALDH was associated with 9-cis-retinoic acid ligation to retinoid x receptor (RXR), which induced conjunctival fibroblast activation. In vivo, stimulating RXR led to rapid onset of ocular mucosal fibrosis, whereas inhibiting ALDH activity in DCs or selectively depleting DCs markedly reduced fibrosis. Collectively, these data reveal a profibrotic ALDH-dependent pathway by DCs and uncover a role for DC retinoid metabolism. PMID:27595139

  4. Extending shikimate pathway for the production of muconic acid and its precursor salicylic acid in Escherichia coli.

    PubMed

    Lin, Yuheng; Sun, Xinxiao; Yuan, Qipeng; Yan, Yajun

    2014-05-01

    cis,cis-Muconic acid (MA) and salicylic acid (SA) are naturally-occurring organic acids having great commercial value. MA is a potential platform chemical for the manufacture of several widely-used consumer plastics; while SA is mainly used for producing pharmaceuticals (for example, aspirin and lamivudine) and skincare and haircare products. At present, MA and SA are commercially produced by organic chemical synthesis using petro-derived aromatic chemicals, such as benzene, as starting materials, which is not environmentally friendly. Here, we report a novel approach for efficient microbial production of MA via extending shikimate pathway by introducing the hybrid of an SA biosynthetic pathway with its partial degradation pathway. First, we engineered a well-developed phenylalanine producing Escherichia coli strain into an SA overproducer by introducing isochorismate synthase and isochorismate pyruvate lyase. The engineered strain is able to produce 1.2g/L of SA from simple carbon sources, which is the highest titer reported so far. Further, the partial SA degradation pathway involving salicylate 1-monoxygenase and catechol 1,2-dioxygenase is established to achieve the conversion of SA to MA. Finally, a de novo MA biosynthetic pathway is assembled by integrating the established SA biosynthesis and degradation modules. Modular optimization enables the production of up to 1.5g/L MA within 48h in shake flasks. This study not only establishes an efficient microbial platform for the production of SA and MA, but also demonstrates a generalizable pathway design strategy for the de novo biosynthesis of valuable degradation metabolites. Copyright © 2014. Published by Elsevier Inc.

  5. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  6. Photoredox activation of carbon dioxide for amino acid synthesis in continuous flow

    NASA Astrophysics Data System (ADS)

    Seo, Hyowon; Katcher, Matthew H.; Jamison, Timothy F.

    2017-05-01

    Although carbon dioxide (CO2) is highly abundant, its low reactivity has limited its use in chemical synthesis. In particular, methods for carbon-carbon bond formation generally rely on two-electron mechanisms for CO2 activation and require highly activated reaction partners. Alternatively, radical pathways accessed via photoredox catalysis could provide new reactivity under milder conditions. Here we demonstrate the direct coupling of CO2 and amines via the single-electron reduction of CO2 for the photoredox-catalysed continuous flow synthesis of α-amino acids. By leveraging the advantages of utilizing gases and photochemistry in flow, a commercially available organic photoredox catalyst effects the selective α-carboxylation of amines that bear various functional groups and heterocycles. The preliminary mechanistic studies support CO2 activation and carbon-carbon bond formation via single-electron pathways, and we expect that this strategy will inspire new perspectives on using this feedstock chemical in organic synthesis.

  7. Effect of nitrogen deficiency on ascorbic acid biosynthesis and recycling pathway in cucumber seedlings.

    PubMed

    Zhang, Xue; Yu, Hong Jun; Zhang, Xiao Meng; Yang, Xue Yong; Zhao, Wen Chao; Li, Qiang; Jiang, Wei Jie

    2016-11-01

    L-Ascorbic acid (AsA, ascorbate) is one of the most abundant natural antioxidants, and it is an important factor in the nutritional quality of cucumber. In this work, key enzymes involved in the ascorbic acid biosynthesis and recycling pathway in cucumber seedlings under nitrogen deficiency were investigated at the levels of transcription and enzyme activity. The activities of myo-inositol oxygenase (MIOX) and transcript levels of MIOXs increased dramatically, while the activities of ascorbate oxidase (AO) and glutathione reductase (GR) and transcript levels of AOs and GR2 decreased significantly in N-limited leaves, as did the ascorbate concentration, in nitrogen-deficient cucumber seedlings. The activities of other enzymes and transcript levels of other genes involved in the ascorbate recycling pathway and ascorbate synthesis pathways decreased or remained unchanged under nitrogen deficiency. These results indicate that nitrogen deficiency induced genes involved in the ascorbate-glutathione recycling and myo-inositol pathway in cucumber leaves. Thus, the AO, GR and MIOX involved in the pathways might play roles in AsA accumulation. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  9. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  10. Analysis of putative nonulosonic acid biosynthesis pathways in Archaea reveals a complex evolutionary history.

    PubMed

    Kandiba, Lina; Eichler, Jerry

    2013-08-01

    Sialic acids and the other nonulosonic acid sugars, legionaminic acid and pseudaminic acid, are nine carbon-containing sugars that can be detected as components of the glycans decorating proteins and other molecules in Eukarya and Bacteria. Yet, despite the prevalence of N-glycosylation in Archaea and the variety of sugars recruited for the archaeal version of this post-translational modification, only a single report of a nonulosonic acid sugar in an archaeal N-linked glycan has appeared. Hence, to obtain a clearer picture of nonulosonic acid sugar biosynthesis capability in Archaea, 122 sequenced genomes were scanned for the presence of genes involved in the biogenesis of these sugars. The results reveal that while Archaea and Bacteria share a common route of sialic acid biosynthesis, numerous archaeal nonulosonic acid sugar biosynthesis pathway components were acquired from elsewhere via various routes. Still, the limited number of Archaea encoding components involved in the synthesis of nonulosonic acid sugars implies that such saccharides are not major components of glycans in this domain.

  11. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål).

    PubMed

    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

    2016-03-28

    The "target of rapamycin" (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens.

  12. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål)

    PubMed Central

    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

    2016-01-01

    The “target of rapamycin” (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527

  13. Analysis of the aspartic acid metabolic pathway using mutant genes.

    PubMed

    Azevedo, R A

    2002-01-01

    Amino acid metabolism is a fundamental process for plant growth and development. Although a considerable amount of information is available, little is known about the genetic control of enzymatic steps or regulation of several pathways. Much of the information about biochemical pathways has arisen from the use of mutants lacking key enzymes. Although mutants were largely used already in the 60's, by bacterial and fungal geneticists, it took plant research a long time to catch up. The advance in this area was rapid in the 80's, which was followed in the 90's by the development of techniques of plant transformation. In this review we present an overview of the aspartic acid metabolic pathway, the key regulatory enzymes and the mutants and transgenic plants produced for lysine and threonine metabolism. We also discuss and propose a new study of high-lysine mutants.

  14. Arabidopsis leaf necrosis caused by simulated acid rain is related to the salicylic acid signaling pathway.

    PubMed

    Lee, Youngmi; Park, Jongbum; Im, Kyunghoan; Kim, Kiyoon; Lee, Jungwoo; Lee, Kyungyeoll; Park, Jung-An; Lee, Taek-Kyun; Park, Dae-Sup; Yang, Joo-Sung; Kim, Donggiun; Lee, Sukchan

    2006-01-01

    Arabidopsis leaves treated with simulated acid rain (SiAR) showed phenotypes similar to necrotic lesions caused by biotic stresses like Pseudomonad infiltration. Exposure of Arabidopsis to SiAR resulted in the up-regulation of genes known to be induced by the salicylic acid (SA)-mediated pathogen resistance response. The expression of enhanced disease susceptibility (EDS), nonexpressor of PR (NPR) and pathogen-related 1 (PR1), all of which are involved in the salicylic acid signaling pathway, were increased after SiAR exposure. However, vegetative storage protein (VSP), a member of the jasmonic acid pathway did not show a significant change in transcript level. SiAR treatment of transgenic plants expressing salicylate hydroxylase (Nah-G), which prevents the accumulation of salicylic acid, underwent more extensive necrosis than wild-type plants, indicating that the signaling pathway activated by SiAR may overlap with the SA-dependent, systemic acquired resistance pathway. Both Col-0 and Nah-G plants showed sensitivity to SiAR and sulfuric SiAR (S-SiAR) by developing necrotic lesions. Neither Col-0 plants nor Nah-G plants showed sensitivity to nitric SiAR (N-SiAR). These results suggest that SiAR activates at least the salicylic acid pathway and activation of this pathway is sensitive to sulfuric acid.

  15. Implementing enhanced recovery pathways: a literature review with realist synthesis.

    PubMed

    Coxon, Astrid; Nielsen, Karina; Cross, Jane; Fox, Chris

    2017-10-01

    Enhanced Recovery Pathways (ERPs) are an increasingly popular, evidenced-based approach to surgery, designed to improve patient outcomes and reduce costs. Despite evidence demonstrating the benefits of these pathways, implementation and adherence have been inconsistent. Using realist synthesis, this review explored the current literature surrounding the implementation of ERPs in the UK. Knowledge consolidation between authors and consulting with field experts helped to guide the search strategy. Relevant medical and social science databases were searched from 2000 to 2016, as well as a general web search. A total of 17 papers were identified, including original research, reviews, case studies and guideline documents. Full texts were analysed, cross-examined, and data extracted and synthesised. Several implementation strategies were identified, including the contexts in which these operated, the subsequent mechanisms of action that were triggered, and the outcome patterns they produced. Context-Mechanism-Outcome (CMO) configurations were generated, tested, and refined. These were grouped to develop two programme theories concerning ERP implementation, one related to the strategy of consulting with staff, the other with appointing a change agent to coordinate and drive the implementation process. These theories highlight instances in which implementation could be improved. Current literature in ERP research is primarily focussed on measuring patient outcomes and cost effectiveness, and as a result, important detail regarding the implementation process is often not reported or described robustly. This review not only provides recommendations for future improvements in ERP implementation, but also highlights specific areas of focus for furthering ERP implementation research.

  16. Synthesis and degradation pathways, functions, and pathology of ceramides and epidermal acylceramides.

    PubMed

    Kihara, Akio

    2016-07-01

    Ceramide (Cer) is a structural backbone of sphingolipids and is composed of a long-chain base and a fatty acid. Existence of a variety of Cer species, which differ in chain-length, hydroxylation status, and/or double bond number of either of their hydrophobic chains, has been reported. Ceramide is produced by Cer synthases. Mammals have six Cer synthases (CERS1-6), each of which exhibits characteristic substrate specificity toward acyl-CoAs with different chain-lengths. Knockout mice for each Cer synthase show corresponding, isozyme-specific phenotypes, revealing the functional differences of Cers with different chain-lengths. Cer diversity is especially prominent in epidermis. Changes in Cer levels, composition, and chain-lengths are associated with atopic dermatitis. Acylceramide (acyl-Cer) specifically exists in epidermis and plays an essential role in skin permeability barrier formation. Accordingly, defects in acyl-Cer synthesis cause the cutaneous disorder ichthyosis with accompanying severe skin barrier defects. Although the molecular mechanism by which acyl-Cer is generated was long unclear, most genes involved in its synthesis have been identified recently. In Cer degradation pathways, the long-chain base moiety of Cer is converted to acyl-CoA, which is then incorporated mainly into glycerophospholipids. This pathway generates the lipid mediator sphingosine 1-phosphate. This review will focus on recent advances in our understanding of the synthesis and degradation pathways, physiological functions, and pathology of Cers/acyl-Cers. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  18. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  19. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  20. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  1. Prebiotic synthesis of carboxylic acids, amino acids and nucleic acid bases from formamide under photochemical conditions⋆

    NASA Astrophysics Data System (ADS)

    Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele

    2017-07-01

    The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.

  2. Ribonucleic Acid Synthesis by Cucumber Chromatin

    PubMed Central

    Johnson, Kenneth D.; Purves, William K.

    1970-01-01

    When intact etiolated 2-day cucumber (Cucumis sativus) embryos were treated with indoleacetic acid (IAA), gibberellin A7 (GA7), or kinetin, chromatin derived from the embryonic axes exhibited an increased capacity to support RNA synthesis in either the presence or the absence of bacterial RNA polymerase. An IAA effect on cucumber RNA polymerase activity was evident after 4 hours of hormone treatment; the IAA effect on DNA template activity (bacterial RNA polymerase added) occurred after longer treatments (12 hours). GA7 also promoted template activity, but again only after a prior stimulation of endogenous chromatin activity. After 12 hours of kinetin treatment, both endogenous chromatin and DNA template activities were substantially above control values, but longer kinetin treatments caused these activities to decline in magnitude. When chromatin was prepared from hypocotyl segments that were floated on a GA7 solution, a GA-induced increase in endogenous chromatin activity occurred, but only if cotyledon tissue was left attached to the segments during the period of hormone treatment. Age of the seedling tissue had a profound influence on the chromatin characteristics. With progression of development from the 2-day to the 4-day stage, the endogenous chromatin activity declined while the DNA template activity increased. PMID:16657509

  3. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.

    PubMed

    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes

    2014-05-01

    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  4. DOPA and DHN pathway orchestrate melanin synthesis in Aspergillus species.

    PubMed

    Pal, Anuradha K; Gajjar, Devarshi U; Vasavada, Abhay R

    2014-01-01

    Melanins are high molecular weight hydrophobic pigments that have been studied for their role in the virulence of fungal pathogens. We investigated the amount and type of melanin in 20 isolates of Aspergillus spp.; A. niger (n = 3), A. flavus (n = 5), A. tamarii (n = 3), A. terreus (n = 3), A. tubingensis (n = 3), A. sydowii (n = 3). Aspergillus spp. were identified by sequencing the internal transcribed spacer (ITS) region. Extraction of melanin from culture filtrate and fungal biomass was done and followed by qualitative and quantitative analysis of melanin pigment. Ultraviolet (UV), Fourier transformed infrared (FT-IR), and electron paramagnetic resonance (EPR) spectra analyses confirmed the presence of melanin. The melanin pathway was studied by analyzing the effects of inhibitors; kojic acid, tropolone, phthalide, and tricyclazole. The results indicate that in A. niger and A. tubingensis melanin was found in both culture filtrate and fungal biomass. For A. tamarii and A. flavus melanin was extracted from biomass only, whereas melanin was found only in culture filtrate for A. terreus. A negligible amount of melanin was found in A. sydowii. The maximum amount of melanin from culture filtrate and fungal biomass was found in A. niger and A. tamarrii, respectively. The DOPA (3,4-dihydroxyphenylalanine) pathway produces melanin in A. niger, A. tamarii and A. flavus, whereas the DHN (1,8-dihydroxynaphthalene) pathway produces melanin in A. tubingensis and A. terreus. It can be concluded that the amount and type of melanin in aspergilli largely differ from species to species.

  5. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases.

  6. Enhanced production of fatty alcohols by engineering the TAGs synthesis pathway in Saccharomyces cerevisiae.

    PubMed

    Tang, Xiaoling; Chen, Wei Ning

    2015-02-01

    The production of fatty acid-derived chemicals has received a great deal of attention in recent years. In yeast cells, the main storage forms of fatty acids are TAGs. However, the conversion of TAGs into fatty acid derivatives suffers from a practical standpoint. Herein, a more direct strategy was applied to accumulate cellular fatty acyl-CoAs in Saccharomyces cerevisiae, which are the activated forms of fatty acids and used as important precursors for various converting enzymes. The dga1 gene was deleted to block the fatty acyl-CoAs dependent pathway of TAGs synthesis and a significant decrease in lipid content was observed. The FAR gene was cloned and overexpressed in the wild type strain and gene disrupted strain, to convert the fatty acyl-CoAs to the corresponding fatty acid derivatives. The metabolic engineered pathway resulted in enhanced production of fatty alcohols. Compared with the wild type strain with overexpressed FAR gene, the yield of fatty alcohols in the Δdga1 strain with FAR was dramatically increased: the intracellular fatty alcohols increased from 26 mg/L to 45 mg/L, while the extracellular fatty alcohols increased from 2.2 mg/L to 4.3 mg/L. By optimizing the culture medium with increased carbon concentration and limited nitrogen concentration, the fatty alcohols yield in the Δdga1 strain with FAR was further increased to 84 mg/L in cells and 14 mg/L secreted in broth. The results in this study demonstrated the feasibility of using the designed strategy to solve the bottleneck in utilizing TAGs for fatty acid derivatives production.

  7. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  8. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  9. A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development

    PubMed Central

    Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David

    2013-01-01

    SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300

  10. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  11. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  12. Coupling of Fatty Acid and Phospholipid Synthesis in Bacillus subtilis▿

    PubMed Central

    Paoletti, Luciana; Lu, Ying-Jie; Schujman, Gustavo E.; de Mendoza, Diego; Rock, Charles O.

    2007-01-01

    plsX (acyl-acyl carrier protein [ACP]:phosphate acyltransferase), plsY (yneS) (acyl-phosphate:glycerol-phosphate acyltransferase), and plsC (yhdO) (acyl-ACP:1-acylglycerol-phosphate acyltransferase) function in phosphatidic acid formation, the precursor to membrane phospholipids. The physiological functions of these genes was inferred from their in vitro biochemical activities, and this study investigated their roles in gram-positive phospholipid metabolism through the analysis of conditional knockout strains in the Bacillus subtilis model system. The depletion of PlsX led to the cessation of both fatty acid synthesis and phospholipid synthesis. The inactivation of PlsY also blocked phospholipid synthesis, but fatty acid formation continued due to the appearance of acylphosphate intermediates and fatty acids arising from their hydrolysis. Phospholipid synthesis ceased following PlsC depletion, but fatty acid synthesis continued at a high rate, leading to the accumulation of fatty acids arising from the dephosphorylation of 1-acylglycerol-3-P followed by the deacylation of monoacylglycerol. Analysis of glycerol 3-P acylation in B. subtilis membranes showed that PlsY was an acylphosphate-specific acyltransferase, whereas PlsC used only acyl-ACP as an acyl donor. PlsX was found in the soluble fraction of disrupted cells but was associated with the cell membrane in intact organisms. These data establish that PlsX is a key enzyme that coordinates the production of fatty acids and membrane phospholipids in B. subtilis. PMID:17557823

  13. Synthesis of nucleotide–amino acid conjugates designed for photo-CIDNP experiments by a phosphotriester approach

    PubMed Central

    Morozova, Olga B; Silnikov, Vladimir N; Yurkovskaya, Alexandra V

    2013-01-01

    Summary Conjugates of 2’-deoxyguanosine, L-tryptophan and benzophenone designed to study pathways of fast radical reactions by the photo Chemically Induced Dynamic Nuclear Polarization (photo-CIDNP) method were obtained by the phosphotriester block liquid phase synthesis. The phosphotriester approach to the oligonucleotide synthesis was shown to be a versatile and economic strategy for preparing the required amount of high quality samples of nucleotide–amino acid conjugates. PMID:24367455

  14. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  15. Oleic acid-enhanced transdermal delivery pathways of fluorescent nanoparticles

    NASA Astrophysics Data System (ADS)

    Lo, Wen; Ghazaryan, Ara; Tso, Chien-Hsin; Hu, Po-Sheng; Chen, Wei-Liang; Kuo, Tsung-Rong; Lin, Sung-Jan; Chen, Shean-Jen; Chen, Chia-Chun; Dong, Chen-Yuan

    2012-05-01

    Transdermal delivery of nanocarriers provides an alternative pathway to transport therapeutic agents, alleviating pain, improving compliance of patients, and increasing overall effectiveness of delivery. In this work, enhancement of transdermal delivery of fluorescent nanoparticles and sulforhodamine B with assistance of oleic acid was visualized utilizing multiphoton microscopy (MPM) and analyzed quantitatively using multi-photon excitation-induced fluorescent signals. Results of MPM imaging and MPM intensity-based spatial depth-dependent analysis showed that oleic acid is effective in facilitating transdermal delivery of nanoparticles.

  16. [Signaling pathway of meiosis induced by retinoic acid during spermatogenesis].

    PubMed

    Wang, Ke; Wu, Ying-Ji

    2013-02-01

    Retinoic acid (RA) is an oxidative metabolite of vitamin A (retinol, ROH) and plays an important role in the spermatogenesis (as in meiosis) of mammals. In mammalian testes, RA, in combination with its retinoic acid receptor (RAR), regulates the expressions of related target genes in various types of cells at different times. It activates meiosis by up-regulating the expressions of the genes that promote meiosis and down-regulate those that inhibit it during spermatogenesis in a specific stage. The results of researches on mammalian spermatogenesis have a great application value in reproductive biology, developmental biology, and reproductive engineering. Therefore, it is of considerable significance to study the signaling pathway of RA-induced meiosis during mammalian spermatogenesis. This article presents an introduction of the RA signal transduction system and its action mechanisms, as well as an overview on the signaling pathway of RA-activated meiosis during spermatogenesis.

  17. Development of lysophosphatidic acid pathway modulators as therapies for fibrosis.

    PubMed

    Budd, David C; Qian, Yimin

    2013-10-01

    Lysophosphatidic acid (LPA) is a class of bioactive phospholipid that displays a wide range of cellular effects via LPA receptors, of which six have been identified (LPAR1-6). In serum and plasma, LPA production occurs mainly by the hydrolysis of lysophosphatidylcholine by the phospholipase D activity of autotaxin (ATX). The involvement of the LPA pathway in driving chronic wound-healing conditions, such as idiopathic pulmonary fibrosis, has suggested targets in this pathway could provide potential therapeutic approaches. Mice with LPAR1 knockout or tissue-specific ATX deletion have demonstrated reduced lung fibrosis following bleomycin challenge. Therefore, strategies aimed at antagonizing LPA receptors or inhibiting ATX have gained considerable attention. This Review will summarize the current status of identifying small-molecule modulators of the LPA pathway. The therapeutic utility of LPA modulators for the treatment of fibrotic diseases will soon be revealed as clinical trials are already in progress in this area.

  18. Indole-3-acetic Acid Synthesis in Tumorous and Nontumorous Species of Nicotiana 1

    PubMed Central

    Liu, Shih-Tung; Katz, Charles D.; Knight, C. Arthur

    1978-01-01

    The synthesis of indole-3-acetic acid (IAA) in the enzyme extracts of Nicotiana glauca, Nicotiana langsdorffii, their F1 hybrid, their amphidiploid hybrid, and the nontumorous mutant of the hybrid was investigated. Tryptamine, a possible precursor of IAA biosynthesis in Nicotiana tabacum, was not found in the callus tissue of N. glauca, N. langsdorffii, and their F1 hybrid. In petiole slices, the synthesis of IAA progressively increased during 5 hours of incubation in [14C]tryptophan. The rate of synthesis was about equal in the hybrid and N. langsdorffii but lower in N. glauca on either a cell or fresh weight basis. It was also found that tryptophan was about 25 times more efficient than tryptamine in promoting synthesis of IAA in petiole slices. It was found that indoleacetaldehyde oxidase, indoleacetaldehyde reductase, and tryptophan aminotransferase activities were present in all of the species examined; however, tryptophan decarboxylase activity was not found. The tryptophan aminotransferase activity in N. glauca, N. langsdorffii, and the nontumorous mutant required α-ketoglutaric acid and pyridoxal 5-phosphate whereas the addition of pyridoxal 5-phosphate seemed not to increase the enzyme activity in tumor plants. The tryptophan aminotransferase in the amphidiploid hybrid was partially purified by acetone precipitation. The enzyme activity had a temperature optimum at 49 C and a pH optimum at 8.9. It is suggested that there is an indolepyruvic acid pathway in the synthesis of IAA in the Nicotiana species examined. PMID:16660376

  19. Constrained Multistate Sequence Design for Nucleic Acid Reaction Pathway Engineering.

    PubMed

    Wolfe, Brian R; Porubsky, Nicholas J; Zadeh, Joseph N; Dirks, Robert M; Pierce, Niles A

    2017-03-01

    We describe a framework for designing the sequences of multiple nucleic acid strands intended to hybridize in solution via a prescribed reaction pathway. Sequence design is formulated as a multistate optimization problem using a set of target test tubes to represent reactant, intermediate, and product states of the system, as well as to model crosstalk between components. Each target test tube contains a set of desired "on-target" complexes, each with a target secondary structure and target concentration, and a set of undesired "off-target" complexes, each with vanishing target concentration. Optimization of the equilibrium ensemble properties of the target test tubes implements both a positive design paradigm, explicitly designing for on-pathway elementary steps, and a negative design paradigm, explicitly designing against off-pathway crosstalk. Sequence design is performed subject to diverse user-specified sequence constraints including composition constraints, complementarity constraints, pattern prevention constraints, and biological constraints. Constrained multistate sequence design facilitates nucleic acid reaction pathway engineering for diverse applications in molecular programming and synthetic biology. Design jobs can be run online via the NUPACK web application.

  20. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    USDA-ARS?s Scientific Manuscript database

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  1. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    USDA-ARS?s Scientific Manuscript database

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  2. Ferrocene-containing nucleic acids. Synthesis and electrochemical properties

    NASA Astrophysics Data System (ADS)

    Zatsepin, Timofei S.; Andreev, Sergei Yu; Hianik, T.; Oretskaya, Tat'yana S.

    2003-06-01

    The published data on the synthesis of ferrocene-containing nucleic acid fragments are generalised. The known methods are systematised and their advantages and disadvantages are discussed. The use of nucleoside, nucleotide and oligonucleotide conjugates with ferrocene in the design of systems for electrochemical detection of nucleic acids is considered.

  3. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  4. Signal pathways mediating oxytocin stimulation of prostaglandin synthesis in select target cells.

    PubMed

    Soloff, M S; Jeng, Y J; Copland, J A; Strakova, Z; Hoare, S

    2000-03-01

    A major action of oxytocin is to stimulate prostaglandin production in reproductive tissues. The two major enzyme systems involved are cytosolic phospholipase A2 (cPLA2), which catalyses the formation of arachidonic acid from membrane glycerophospholipids, and prostaglandin endoperoxide-H synthases-1 and -2, which allow conversion of arachidonic acid to prostaglandins. During gestation, the concentrations of all three enzymes rise in the rabbit amnion. Agonists, including oxytocin, increase cPLA2 activity, in part, by elevating intracellular Ca2+ concentration, which causes cPLA2 to be translocated from the cytosol to intracellular membrane binding sites. Cytosolic PLA2 is then activated by a mitogen-activated protein kinase (MAPK)-dependent step. Our studies have elucidated signal pathways involved in oxytocin-stimulated prostaglandin output in both rabbit amnion cells and Chinese hamster ovary cells stably transfected with the rat oxytocin receptor. The two cell types are alike with respect to oxytocin-stimulated intracellular Ca2+ transients, mediation via Gq, and the specific MAPK that catalyses the phosphorylation of cPLA2. However, they differ with respect to the mechanisms of upregulation of key enzymes involved in prostaglandin E2 synthesis. These findings illustrate the tiers of complementary mechanisms involved in oxytocin stimulation of prostaglandin E2, and the extent of the diversity in the cellular signalling pathways involved.

  5. Niacin Sensitivity and the Arachidonic Acid Pathway in Schizophrenia

    PubMed Central

    Messamore, Erik; Hoffman, William F.; Yao, Jeffrey K.

    2010-01-01

    Objective Schizophrenia is associated with a blunted flush response to niacin. Since niacin-induced skin flushing is mediated by vasodilators derived from arachidonic acid (AA), we tested whether the blunted flush response to niacin is a marker of AA deficiency. Methods Eight concentrations of methylnicotinate were applied to the forearms of 20 adults with schizophrenia and 20 controls. Laser Doppler measurement of blood flow responses was used to derive values for niacin sensitivity (defined as the concentration eliciting half-maximal response, i.e., EC50 value) and efficacy (defined as the maximal evoked blood flow response). RBC membrane fatty acids were analyzed by gas chromatography. Results Niacin sensitivity and efficacy were reduced in schizophrenia. In the control group, there was significant correlation between AA levels and niacin sensitivity as well as a trend toward correlation between AA levels and niacin efficacy. In contrast, neither sensitivity nor efficacy of niacin correlated with AA levels in schizophrenia. An expected correlation between the levels of AA and its elongation product (adrenic acid) was absent in schizophrenia. Adrenic acid levels correlated with niacin efficacy in schizophrenia. Conclusions The schizophrenia-associated niacin response abnormality involves both diminished sensitivity and reduced efficacy. The lack of expected correlation between levels of AA and adrenic acid suggests homeostatic imbalance within the n-6 polyunsaturated fatty acid (PUFA) pathway in schizophrenia. Though AA levels were unrelated to measures of niacin response in schizophrenia, the correlation between adrenic acid and niacin efficacy in schizophrenia suggests relevance of the n-6 PUFA pathway to the blunted niacin response. PMID:20417059

  6. [Novel L-amino acid ligases catalyzing oligopeptide synthesis].

    PubMed

    Kino, Kuniki

    2010-11-01

    L-Amino acid ligase (EC 6.3.2.28) is a microbial enzyme catalyzing formation of an alpha-peptide bond from unprotected L-amino acids in an ATP-dependent manner. The YwfE protein from Bacillus subtilis 168 was the first reported L-amino acid ligase, and it synthesizes various dipeptides. Thereafter, several L-amino acid ligases were newly obtained by in silico analysis using the ATP-grasp motif. But these L-amino acid ligases synthesize only dipeptide and no longer peptide. A novel L-amino acid ligase capable of catalyzing oligopeptide synthesis is required to increase the variety of peptides. We have previously found a new member of L-amino acid ligase, RizA, from B. subtilis NBRC3134, a microorganism that produces the peptide-antibiotic rhizocticin. We newly found that a gene at approximately 9 kbp upstream of rizA encoded a novel L-amino acid ligase RizB. Recombinant RizB synthesized homo-oligomers of branched-chain amino acids consisting of 2 to 5 amino acids, and also synthesized various heteropeptides. RizB is the first reported L-amino acid ligase that catalyzes oligopeptide synthesis. In addition, we obtained L-amino acid ligases showing oligopeptide synthesis activities by in silico analysis using BLAST, which is a set of similarity search programs. These L-amino acid ligases showed low similarity in amino acid sequence, but commonly used branched-chain amino acids, such as RizB, as substrates. Furthermore, the spr0969 protein of Streptococcus pneumoniae synthesized longer peptides than those synthesized by RizB, and the BAD_1200 protein of Bifidobacteria adolescentis showed higher activity toward aromatic amino acids than toward branched-chain ones.

  7. Fatty Acid Concentration and Phase Transitions Modulate Aβ Aggregation Pathways.

    PubMed

    Rana, Pratip; Dean, Dexter N; Steen, Edward D; Vaidya, Ashwin; Rangachari, Vijayaraghavan; Ghosh, Preetam

    2017-09-04

    Aggregation of amyloid β (Aβ) peptides is a significant event that underpins Alzheimer disease (AD) pathology. Aβ aggregates, especially the low-molecular weight oligomers, are the primary toxic agents in AD and hence, there is increasing interest in understanding their formation and behavior. Aggregation is a nucleation-dependent process in which the pre-nucleation events are dominated by Aβ homotypic interactions. Dynamic flux and stochasticity during pre-nucleation renders the reactions susceptible to perturbations by other molecules. In this context, we investigate the heterotypic interactions between Aβ and fatty acids (FAs) by two independent tool-sets such as reduced order modelling (ROM) and ensemble kinetic simulation (EKS). We observe that FAs influence Aβ dynamics distinctively in three broadly-defined FA concentration regimes containing non-micellar, pseudo-micellar or micellar phases. While the non-micellar phase promotes on-pathway fibrils, pseudo-micellar and micellar phases promote predominantly off-pathway oligomers, albeit via subtly different mechanisms. Importantly off-pathway oligomers saturate within a limited molecular size, and likely with a different overall conformation than those formed along the on-pathway, suggesting the generation of distinct conformeric strains of Aβ, which may have profound phenotypic outcomes. Our results validate previous experimental observations and provide insights into potential influence of biological interfaces in modulating Aβ aggregation pathways.

  8. Dissecting Abscisic Acid Signaling Pathways Involved in Cuticle Formation.

    PubMed

    Cui, Fuqiang; Brosché, Mikael; Lehtonen, Mikko T; Amiryousefi, Ali; Xu, Enjun; Punkkinen, Matleena; Valkonen, Jari P T; Fujii, Hiroaki; Overmyer, Kirk

    2016-06-06

    The cuticle is the outer physical barrier of aerial plant surfaces and an important interaction point between plants and the environment. Many environmental stresses affect cuticle formation, yet the regulatory pathways involved remain undefined. We used a genetics and gene expression analysis in Arabidopsis thaliana to define an abscisic acid (ABA) signaling loop that positively regulates cuticle formation via the core ABA signaling pathway, including the PYR/PYL receptors, PP2C phosphatase, and SNF1-Related Protein Kinase (SnRK) 2.2/SnRK2.3/SnRK2.6. Downstream of the SnRK2 kinases, cuticle formation was not regulated by the ABA-responsive element-binding transcription factors but rather by DEWAX, MYB16, MYB94, and MYB96. Additionally, low air humidity increased cuticle formation independent of the core ABA pathway and cell death/reactive oxygen species signaling attenuated expression of cuticle-biosynthesis genes. In Physcomitrella patens, exogenous ABA suppressed expression of cuticle-related genes, whose Arabidopsis orthologs were ABA-induced. Hence, the mechanisms regulating cuticle formation are conserved but sophisticated in land plants. Signaling specifically related to cuticle deficiency was identified to play a major role in the adaptation of ABA signaling pathway mutants to increased humidity and in modulating their immunity to Botrytis cinerea in Arabidopsis. These results define a cuticle-specific downstream branch in the ABA signaling pathway that regulates responses to the external environment.

  9. Aromatic amino acids are utilized and protein synthesis is stimulated during amino acid infusion in the ovine fetus.

    PubMed

    Liechty, E A; Boyle, D W; Moorehead, H; Auble, L; Denne, S C

    1999-06-01

    The purpose of this study was to determine whether the ovine fetus is capable of increased disposal of an amino acid load; if so, would it respond by increased protein synthesis, amino acid catabolism or both? A further purpose of the study was to determine whether the pathways of aromatic amino acid catabolism are functional in the fetus. Late gestation ovine fetuses of well-nourished ewes received an infusion of Aminosyn PF alone (APF), and Aminosyn PF + glycyl-L-tyrosine (APF+GT) at rates estimated to double the intake of these amino acids. The initial study, using APF, was performed at 126 +/- 1.4 d; the APF+GT study was performed at 132 +/- 1.7 d (term = 150 d). Phenylalanine and tyrosine kinetics were determined using both stable and radioactive isotopes. Plasma concentrations of most amino acids, but not tyrosine, increased during both studies; tyrosine concentration increased only during the APF+GT study. Phenylalanine rate of appearance and phenylalanine hydroxylation increased during both studies. Tyrosine rate of appearance increased only during the APF+GT study; tyrosine oxidation did not increase during either study. Fetal protein synthesis increased significantly during both studies, producing a significant increase in fetal protein accretion. Fetal proteolysis was unchanged in response to either amino acid infusion. These results indicate that the fetus responds to an acute increase in amino acid supply primarily by increasing protein synthesis and accretion, with a smaller but significant increase in amino acid catabolism also. Both phenylalanine hydroxylation and tyrosine oxidation are active in the fetus, and the fetus is able to increase phenylalanine hydroxylation rapidly in response to increased supply.

  10. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  11. Evolution of abscisic acid synthesis and signaling mechanisms.

    PubMed

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I

    2011-05-10

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  12. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  13. Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.

    PubMed

    Jiang, Jianghui; Xu, Jiaxi

    2017-04-16

    4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.

  14. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  15. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  16. Pathways for abiotic organic synthesis at submarine hydrothermal fields.

    PubMed

    McDermott, Jill M; Seewald, Jeffrey S; German, Christopher R; Sylva, Sean P

    2015-06-23

    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond.

  17. Pathways for abiotic organic synthesis at submarine hydrothermal fields

    PubMed Central

    McDermott, Jill M.; Seewald, Jeffrey S.; German, Christopher R.; Sylva, Sean P.

    2015-01-01

    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond. PMID:26056279

  18. A metabolic pathway for catabolizing levulinic acid in bacteria.

    PubMed

    Rand, Jacqueline M; Pisithkul, Tippapha; Clark, Ryan L; Thiede, Joshua M; Mehrer, Christopher R; Agnew, Daniel E; Campbell, Candace E; Markley, Andrew L; Price, Morgan N; Ray, Jayashree; Wetmore, Kelly M; Suh, Yumi; Arkin, Adam P; Deutschbauer, Adam M; Amador-Noguez, Daniel; Pfleger, Brian F

    2017-09-25

    Microorganisms can catabolize a wide range of organic compounds and therefore have the potential to perform many industrially relevant bioconversions. One barrier to realizing the potential of biorefining strategies lies in our incomplete knowledge of metabolic pathways, including those that can be used to assimilate naturally abundant or easily generated feedstocks. For instance, levulinic acid (LA) is a carbon source that is readily obtainable as a dehydration product of lignocellulosic biomass and can serve as the sole carbon source for some bacteria. Yet, the genetics and structure of LA catabolism have remained unknown. Here, we report the identification and characterization of a seven-gene operon that enables LA catabolism in Pseudomonas putida KT2440. When the pathway was reconstituted with purified proteins, we observed the formation of four acyl-CoA intermediates, including a unique 4-phosphovaleryl-CoA and the previously observed 3-hydroxyvaleryl-CoA product. Using adaptive evolution, we obtained a mutant of Escherichia coli LS5218 with functional deletions of fadE and atoC that was capable of robust growth on LA when it expressed the five enzymes from the P. putida operon. This discovery will enable more efficient use of biomass hydrolysates and metabolic engineering to develop bioconversions using LA as a feedstock.Levulinic acid (LA) is a value-added chemical easily obtained from biomass. The pathway enabling LA degradation in Pseudomonas putida requires five enzymes and can be engineered into Escherichia coli, which could enable further biotechnological applications.

  19. A New Pathway to Aspartic Acid from Urea and Maleic Acid Affected by Ultraviolet Light

    NASA Astrophysics Data System (ADS)

    Terasaki, Masanori; Nomoto, Shinya; Mita, Hajime; Shimoyama, Akira

    2002-04-01

    The photochemistry of a mixture of urea and maleic acid, which are thought to have been widely present on the primitive Earth, was studied in order to examine a possibility of the formation of amino acids. When an aqueous solution of urea and maleic acid was irradiated with an ultraviolet light of wavelength 172 nm, urea was revealed to be rather resistant to photochemical decomposition. In contrast, maleic acid was completely decomposed within 4 h, reflecting the reactivity of a C-C double bond in the molecule. In the reaction mixture, 2-isoureidosuccinic acid was detected. The acid was considered to be formed by addition of an isoureido radical which had been produced from urea by the action of a hydroxyl radical, to a C-C double bond of maleic acid. The isoureido group of the product was revealed to undergo thermal rearrangement to afford 2-ureidosuccinic acid (N-carbamoylaspartic acid). The result suggested a novel pathway leading to the formation of aspartic acid from non-amino acid precursors, possibly effected by UV-light on the primitive Earth. The formation of ureidocarboxylic acids is of another significance, since they are capable of undergoing thermal polymerization, resulting in formation of polyamino acids.

  20. Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.

    PubMed

    Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen

    2017-04-01

    Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis.

  1. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  2. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  3. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  4. Bioengineering of bacterial polymer inclusions catalyzing the synthesis of N-acetylneuraminic acid.

    PubMed

    Hooks, David O; Blatchford, Paul A; Rehm, Bernd H A

    2013-05-01

    N-Acetylneuraminic acid is produced by alkaline epimerization of N-acetylglucosamine to N-acetylmannosamine and then subsequent condensation with pyruvate catalyzed by free N-acetylneuraminic acid aldolase. The high-alkaline conditions of this process result in the degradation of reactants and products, while the purification of free enzymes to be used for the synthesis reaction is a costly process. The use of N-acetylglucosamine 2-epimerase has been seen as an alternative to the alkaline epimerization process. In this study, these two enzymes involved in N-acetylneuraminic acid production were immobilized to biopolyester beads in vivo in a one-step, cost-efficient process of production and isolation. Beads with epimerase-only, aldolase-only, and combined epimerase/aldolase activity were recombinantly produced in Escherichia coli. The enzymatic activities were 32 U, 590 U, and 2.2 U/420 U per gram dry bead weight, respectively. Individual beads could convert 18% and 77% of initial GlcNAc and ManNAc, respectively, at high substrate concentrations and near-neutral pH, demonstrating the application of this biobead technology to fine-chemical synthesis. Beads establishing the entire N-acetylneuraminic acid synthesis pathway were able to convert up to 22% of the initial N-acetylglucosamine after a 50-h reaction time into N-acetylneuraminic acid.

  5. Differential diagnosis in patients with suspected bile acid synthesis defects

    PubMed Central

    Haas, Dorothea; Gan-Schreier, Hongying; Langhans, Claus-Dieter; Rohrer, Tilman; Engelmann, Guido; Heverin, Maura; Russell, David W; Clayton, Peter T; Hoffmann, Georg F; Okun, Jürgen G

    2012-01-01

    AIM: To investigate the clinical presentations associated with bile acid synthesis defects and to describe identification of individual disorders and diagnostic pitfalls. METHODS: Authors describe semiquantitative determination of 16 urinary bile acid metabolites by electrospray ionization-tandem mass spectrometry. Sample preparation was performed by solid-phase extraction. The total analysis time was 2 min per sample. Authors determined bile acid metabolites in 363 patients with suspected defects in bile acid metabolism. RESULTS: Abnormal bile acid metabolites were found in 36 patients. Two patients had bile acid synthesis defects but presented with atypical presentations. In 2 other patients who were later shown to be affected by biliary atresia and cystic fibrosis the profile of bile acid metabolites was initially suggestive of a bile acid synthesis defect. Three adult patients suffered from cerebrotendinous xanthomatosis. Nineteen patients had peroxisomal disorders, and 10 patients had cholestatic hepatopathy of other cause. CONCLUSION: Screening for urinary cholanoids should be done in every infant with cholestatic hepatopathy as well as in children with progressive neurological disease to provide specific therapy. PMID:22416181

  6. Enzymatic synthesis of 4-pentulosonate (4-keto-D-pentonate) from D-aldopentose and D-pentonate by two different pathways using membrane enzymes of acetic acid bacteria.

    PubMed

    Adachi, Osao; Hours, Roque A; Shinagawa, Emiko; Akakabe, Yoshihiko; Yakushi, Toshiharu; Matsushita, Kazunobu

    2011-01-01

    4-Keto-D-arabonate (D-threo-pent-4-ulosonate) and 4-keto-D-ribonate (D-erythro-pent-4-ulosonate) were prepared from D-arabinose and D-ribose by two successive reactions of membrane-bound enzymes, D-aldopentose 4-dehydrogenase and 4-keto-D-aldopentose 1-dehydrogenase of Gluconobacter suboxydans IFO 12528. Alternatively, they were prepared from D-arabonate and D-ribonate with another membrane-bound enzyme, D-pentonate 4-dehydrogenase. Analytical data confirmed the chemical structures of the 4-pentulosonates prepared. This is the first report of successful enzymatic synthesis of 4-pentulosonates.

  7. Synthesis and characterization of Sant-75 derivatives as Hedgehog-pathway inhibitors.

    PubMed

    Che, Chao; Li, Song; Yang, Bo; Xin, Shengchang; Yu, Zhixiong; Shao, Taofeng; Tao, Chuanye; Lin, Shuo; Yang, Zhen

    2012-01-01

    Sant-75 is a newly identified potent inhibitor of the hedgehog pathway. We designed a diversity-oriented synthesis program, and synthesized a series of Sant-75 analogues, which lays the foundation for further investigation of the structure-activity relationship of this important class of hedgehog-pathway inhibitors.

  8. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis

    SciTech Connect

    Tsogtbaatar, Enkhtuul; Cocuron, Jean -Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula

    2015-02-22

    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography-mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. In conclusion, this study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos.

  9. Porous AgPt@Pt Nanooctahedra as an Efficient Catalyst toward Formic Acid Oxidation with Predominant Dehydrogenation Pathway.

    PubMed

    Jiang, Xian; Yan, Xiaoxiao; Ren, Wangyu; Jia, Yufeng; Chen, Jianian; Sun, Dongmei; Xu, Lin; Tang, Yawen

    2016-11-16

    For direct formic acid fuel cells (DFAFCs), the dehydrogenation pathway is a desired reaction pathway, to boost the overall cell efficiency. Elaborate composition tuning and nanostructure engineering provide two promising strategies to design efficient electrocatalysts for DFAFCs. Herein, we present a facile synthesis of porous AgPt bimetallic nanooctahedra with enriched Pt surface (denoted as AgPt@Pt nanooctahedra) by a selective etching strategy. The smart integration of geometric and electronic effect confers a substantial enhancement of desired dehydrogenation pathway as well as electro-oxidation activity for the formic acid oxidation reaction (FAOR). We anticipate that the obtained nanocatalyst may hold great promises in fuel cell devices, and furthermore, the facile synthetic strategy demonstrated here can be extendable for the fabrication of other multicomponent nanoalloys with desirable morphologies and enhanced electrocatalytic performances.

  10. Carbocyclic fatty acids in plants: Biochemical and molecular genetic characterization of cyclopropane fatty acid synthesis of Sterculia foetida

    PubMed Central

    Bao, Xiaoming; Katz, Sue; Pollard, Mike; Ohlrogge, John

    2002-01-01

    Fatty acids containing three-member carbocyclic rings are found in bacteria and plants. Bacteria synthesize cyclopropane fatty acids (CPA-FAs) only by the addition of a methylene group from S-adenosylmethionine to the cis-double bond of monoenoic phospholipid-bound fatty acids. In plants CPA-FAs are usually minor components with cyclopropene fatty acids (CPE-FAs) more abundant. Sterculia foetida seed oil contains 65–78% CPE-FAs, principally sterculic acid. To address carbocyclic fatty acid synthesis in plants, a cDNA library was constructed from developing seeds during the period of maximum oil deposition. About 0.4% of 5,300 expressed sequence tags were derived from one gene, which shared similarities to the bacterial CPA-FA synthase. However, the predicted protein is twice as large as the bacterial homolog and represents a fusion of an FAD-containing oxidase at the N terminus and a methyltransferase at the C terminus. Functional analysis of the isolated full-length cDNA was conducted in tobacco suspension cells where its expression resulted in the accumulation of up to 6.2% dihydrosterculate of total fatty acids. In addition, the dihydrosterculate was specifically labeled by [methyl-14C]methionine and by [14C]oleic acid in the transgenic tobacco cells. In in vitro assay of S. foetida seed extracts, S-adenosylmethionine served as a methylene donor for the synthesis of dihydrosterculate from oleate. Dihydrosterculate accumulated largely in phosphatidylcholine in both systems. Together, a CPA-FA synthase was identified from S. foetida, and the pathway in higher plants that produce carbocyclic fatty acids was defined as by transfer of C1 units, most likely from S-adenosylmethionine to oleate. PMID:11997456

  11. A novel fermentation pathway in an Escherichia coli mutant producing succinic acid, acetic acid, and ethanol.

    SciTech Connect

    Donnelly, M. I.; Millard, C. S.; Clark, D. P.; Chen, M. J.; Rathke, J. W.; Southern Illinois Univ.

    1998-04-01

    Escherichia coli strain NZN111, which is unable to grow fermentatively because of insertional inactivation of the genes encoding pyruvate: formate lyase and the fermentative lactate dehydrogenase, gave rise spontaneously to a chromosomal mutation that restored its ability to ferment glucose. The mutant strain, named AFP111, fermented glucose more slowly than did its wild-type ancestor, strain W1485, and generated a very different spectrum of products. AFP111 produced succinic acid, acetic acid, and ethanol in proportions of approx 2:1:1. Calculations of carbon and electron balances accounted fully for the observed products; 1 mol of glucose was converted to 1 mol of succinic acid and 0.5 mol each of acetic acid and ethanol. The data support the emergence in E.coli of a novel succinic acid:acetic acid:ethanol fermentation pathway.

  12. Synthesis of imidazol-1-yl-acetic acid hydrochloride: A key intermediate for zoledronic acid

    PubMed Central

    Manne, Narendra; Ray, Purna Chandra

    2008-01-01

    Summary A convenient and practical synthesis of imidazol-1-yl-acetic acid hydrochloride was achieved via N-alkylation of imidazole using tert-butyl chloroacetate followed by a non-aqueous ester cleavage of the resulting imidazol-1-yl-acetic acid tert-butyl ester in the presence of titanium tetrachloride. The synthesized imidazol-1-yl-acetic acid hydrochloride was then utilized to prepare zoledronic acid. PMID:19104672

  13. Intracellular synthesis of glutamic acid in Bacillus methylotrophicus SK19.001, a glutamate-independent poly(γ-glutamic acid)-producing strain.

    PubMed

    Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo

    2016-01-15

    Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.

  14. Pathway engineering of Propionibacterium jensenii for improved production of propionic acid

    PubMed Central

    Liu, Long; Guan, Ningzi; Zhu, Gexin; Li, Jianghua; Shin, Hyun-dong; Du, Guocheng; Chen, Jian

    2016-01-01

    Propionic acid (PA) is an important chemical building block widely used in the food, pharmaceutical, and chemical industries. In our previous study, a shuttle vector was developed as a useful tool for engineering Propionibacterium jensenii, and two key enzymes—glycerol dehydrogenase and malate dehydrogenase—were overexpressed to improve PA titer. Here, we aimed to improve PA production further via the pathway engineering of P. jensenii. First, the phosphoenolpyruvate carboxylase gene (ppc) from Klebsiella pneumoniae was overexpressed to access the one-step synthesis of oxaloacetate directly from phosphoenolpyruvate without pyruvate as intermediate. Next, genes encoding lactate dehydrogenase (ldh) and pyruvate oxidase (poxB) were deleted to block the synthesis of the by-products lactic acid and acetic acid, respectively. Overexpression of ppc and deleting ldh improved PA titer from 26.95 ± 1.21 g·L−1 to 33.21 ± 1.92 g·L−1 and 30.50 ± 1.63 g·L−1, whereas poxB deletion decreased it. The influence of this pathway engineering on gene transcription, enzyme expression, NADH/NAD+ ratio, and metabolite concentration was also investigated. Finally, PA production in P. jensenii with ppc overexpression as well as ldh deletion was investigated, which resulted in further increases in PA titer to 34.93 ± 2.99 g·L−1 in a fed-batch culture. PMID:26814976

  15. Pathway engineering of Propionibacterium jensenii for improved production of propionic acid.

    PubMed

    Liu, Long; Guan, Ningzi; Zhu, Gexin; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian

    2016-01-27

    Propionic acid (PA) is an important chemical building block widely used in the food, pharmaceutical, and chemical industries. In our previous study, a shuttle vector was developed as a useful tool for engineering Propionibacterium jensenii, and two key enzymes-glycerol dehydrogenase and malate dehydrogenase-were overexpressed to improve PA titer. Here, we aimed to improve PA production further via the pathway engineering of P. jensenii. First, the phosphoenolpyruvate carboxylase gene (ppc) from Klebsiella pneumoniae was overexpressed to access the one-step synthesis of oxaloacetate directly from phosphoenolpyruvate without pyruvate as intermediate. Next, genes encoding lactate dehydrogenase (ldh) and pyruvate oxidase (poxB) were deleted to block the synthesis of the by-products lactic acid and acetic acid, respectively. Overexpression of ppc and deleting ldh improved PA titer from 26.95 ± 1.21 g·L(-1) to 33.21 ± 1.92 g·L(-1) and 30.50 ± 1.63 g·L(-1), whereas poxB deletion decreased it. The influence of this pathway engineering on gene transcription, enzyme expression, NADH/NAD(+) ratio, and metabolite concentration was also investigated. Finally, PA production in P. jensenii with ppc overexpression as well as ldh deletion was investigated, which resulted in further increases in PA titer to 34.93 ± 2.99 g·L(-1) in a fed-batch culture.

  16. Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver

    PubMed Central

    Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.

    1969-01-01

    1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319

  17. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  18. Regulation of Primary Metabolic Pathways in Oyster Mushroom Mycelia Induced by Blue Light Stimulation: Accumulation of Shikimic Acid

    PubMed Central

    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei

    2015-01-01

    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis. PMID:25721093

  19. Regulation of primary metabolic pathways in oyster mushroom mycelia induced by blue light stimulation: accumulation of shikimic acid.

    PubMed

    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei

    2015-02-27

    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis.

  20. Systems-level metabolic flux profiling identifies fatty acid synthesis as a target for antiviral therapy

    PubMed Central

    Munger, Joshua; Bennett, Bryson D; Parikh, Anuraag; Feng, Xiao-Jiang; McArdle, Jessica; Rabitz, Herschel A; Shenk, Thomas; Rabinowitz, Joshua D

    2010-01-01

    Viruses rely on the metabolic network of their cellular hosts to provide energy and building blocks for viral replication. We developed a flux measurement approach based on liquid chromatography–tandem mass spectrometry to quantify changes in metabolic activity induced by human cytomegalovirus (HCMV). This approach reliably elucidated fluxes in cultured mammalian cells by monitoring metabolome labeling kinetics after feeding cells 13C-labeled forms of glucose and glutamine. Infection with HCMV markedly upregulated flux through much of the central carbon metabolism, including glycolysis. Particularly notable increases occurred in flux through the tricarboxylic acid cycle and its efflux to the fatty acid biosynthesis pathway. Pharmacological inhibition of fatty acid biosynthesis suppressed the replication of both HCMV and influenza A, another enveloped virus. These results show that fatty acid synthesis is essential for the replication of two divergent enveloped viruses and that systems-level metabolic flux profiling can identify metabolic targets for antiviral therapy. PMID:18820684

  1. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Manipulating catalytic pathways: deoxygenation of palmitic acid on multifunctional catalysts.

    PubMed

    Peng, Baoxiang; Zhao, Chen; Kasakov, Stanislav; Foraita, Sebastian; Lercher, Johannes A

    2013-04-08

    The mechanism of the catalytic reduction of palmitic acid to n-pentadecane at 260 °C in the presence of hydrogen over catalysts combining multiple functions has been explored. The reaction involves rate-determining reduction of the carboxylic group of palmitic acid to give hexadecanal, which is catalyzed either solely by Ni or synergistically by Ni and the ZrO2 support. The latter route involves adsorption of the carboxylic acid group at an oxygen vacancy of ZrO2 and abstraction of the α-H with elimination of O to produce the ketene, which is in turn hydrogenated to the aldehyde over Ni sites. The aldehyde is subsequently decarbonylated to n-pentadecane on Ni. The rate of deoxygenation of palmitic acid is higher on Ni/ZrO2 than that on Ni/SiO2 or Ni/Al2O3, but is slower than that on H-zeolite-supported Ni. As the partial pressure of H2 is decreased, the overall deoxygenation rate decreases. In the absence of H2, ketonization catalyzed by ZrO2 is the dominant reaction. Pd/C favors direct decarboxylation (-CO2), while Pt/C and Raney Ni catalyze the direct decarbonylation pathway (-CO). The rate of deoxygenation of palmitic acid (in units of mmol moltotal metal(-1) h(-1)) decreases in the sequence r(Pt black) ≈r(Pd black) >r(Raney Ni) in the absence of H2 . In situ IR spectroscopy unequivocally shows the presence of adsorbed ketene (C=C=O) on the surface of ZrO2 during the reaction with palmitic acid at 260 °C in the presence or absence of H2.

  3. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  4. Cannabinoids influence lipid-arachidonic acid pathways in schizophrenia.

    PubMed

    Smesny, Stefan; Rosburg, Timm; Baur, Kati; Rudolph, Nicole; Sauer, Heinrich

    2007-10-01

    Increasing evidence suggests modulating effects of cannabinoids on time of onset, severity, and outcome of schizophrenia. Efforts to discover the underlying pathomechanism have led to the assumption of gene x environment interactions, including premorbid genetical vulnerability and worsening effects of continuing cannabis use. The objective of this cross-sectional study is to investigate the relationship between delta-9-tetrahydrocannabinol intake and niacin sensitivity in schizophrenia patients and healthy controls. Intensity of niacin skin flushing, indicating disturbed prostaglandin-mediated processes, was used as peripheral marker of lipid-arachidonic acid pathways and investigated in cannabis-consuming and nonconsuming schizophrenia patients and in healthy controls. Methylnicotinate was applied in three concentrations onto the forearm skin. Flush response was assessed in 3-min intervals over 15 min using optical reflection spectroscopy. In controls, skin flushing was significantly decreased in cannabis-consuming as compared to nonconsuming individuals. When comparing the nonconsuming subgroups, patients showed significantly decreased flush response. The populations as a whole (patients and controls) showed an inverse association between skin flushing and sum scores of Symptom Check List 90-R. Results demonstrate an impact of long-term cannabis use on lipid-arachidonic acid pathways. Considering pre-existing vulnerability of lipid metabolism in schizophrenia, observed effects of cannabis use support the notion of a gene x environment interaction.

  5. Substrate specificity of the sialic acid biosynthetic pathway

    SciTech Connect

    Jacobs, Christina L.; Goon, Scarlett; Yarema, Kevin J.; Hinderlich, Stephan; Hang, Howard C.; Chai, Diana H.; Bertozzi, Carolyn R.

    2001-07-18

    Unnatural analogs of sialic acid can be delivered to mammalian cell surfaces through the metabolic transformation of unnatural N-acetylmannosamine (ManNAc) derivatives. In previous studies, mannosamine analogs bearing simple N-acyl groups up to five carbon atoms in length were recognized as substrates by the biosynthetic machinery and transformed into cell-surface sialoglycoconjugates [Keppler, O. T., et al. (2001) Glycobiology 11, 11R-18R]. Such structural alterations to cell surface glycans can be used to probe carbohydrate-dependent phenomena. This report describes our investigation into the extent of tolerance of the pathway toward additional structural alterations of the N-acyl substituent of ManNAc. A panel of analogs with ketone-containing N-acyl groups that varied in the lengthor steric bulk was chemically synthesized and tested for metabolic conversion to cell-surface glycans. We found that extension of the N-acyl chain to six, seven, or eight carbon atoms dramatically reduced utilization by the biosynthetic machinery. Likewise, branching from the linear chain reduced metabolic conversion. Quantitation of metabolic intermediates suggested that cellular metabolism is limited by the phosphorylation of the N-acylmannosamines by ManNAc 6-kinase in the first step of the pathway. This was confirmed by enzymatic assay of the partially purified enzyme with unnatural substrates. Identification of ManNAc 6-kinase as a bottleneck for unnatural sialic acid biosynthesis provides a target for expanding the metabolic promiscuity of mammalian cells.

  6. Proteolytic Pathways Induced by Herbicides That Inhibit Amino Acid Biosynthesis

    PubMed Central

    Zulet, Amaia; Gil-Monreal, Miriam; Villamor, Joji Grace; Zabalza, Ana; van der Hoorn, Renier A. L.; Royuela, Mercedes

    2013-01-01

    Background The herbicides glyphosate (Gly) and imazamox (Imx) inhibit the biosynthesis of aromatic and branched-chain amino acids, respectively. Although these herbicides inhibit different pathways, they have been reported to show several common physiological effects in their modes of action, such as increasing free amino acid contents and decreasing soluble protein contents. To investigate proteolytic activities upon treatment with Gly and Imx, pea plants grown in hydroponic culture were treated with Imx or Gly, and the proteolytic profile of the roots was evaluated through fluorogenic kinetic assays and activity-based protein profiling. Results Several common changes in proteolytic activity were detected following Gly and Imx treatment. Both herbicides induced the ubiquitin-26 S proteasome system and papain-like cysteine proteases. In contrast, the activities of vacuolar processing enzymes, cysteine proteases and metacaspase 9 were reduced following treatment with both herbicides. Moreover, the activities of several putative serine protease were similarly increased or decreased following treatment with both herbicides. In contrast, an increase in YVADase activity was observed under Imx treatment versus a decrease under Gly treatment. Conclusion These results suggest that several proteolytic pathways are responsible for protein degradation upon herbicide treatment, although the specific role of each proteolytic activity remains to be determined. PMID:24040092

  7. Role of Ribonucleic Acid Synthesis in Replication of Deoxyribonucleic Acid

    PubMed Central

    Pato, Martin L.

    1975-01-01

    An experiment previously interpreted to show a ribonucleic acid requirement for propagation of deoxyribonucleic replication is reexamined and the earlier interpretation is shown to be incorrect. PMID:1090599

  8. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  9. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  10. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    USDA-ARS?s Scientific Manuscript database

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  11. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.

    PubMed

    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei

    2010-06-11

    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC.

  12. Taurine homeostasis requires de novo synthesis via cysteine sulfinic acid decarboxylase during zebrafish early embryogenesis.

    PubMed

    Chang, Yen-Chia; Ding, Shih-Torng; Lee, Yen-Hua; Wang, Ya-Ching; Huang, Ming-Feng; Liu, I-Hsuan

    2013-02-01

    Cysteine sulfinic acid decarboxylase (Csad) is the rate-limiting enzyme in the de novo biosynthesis of taurine. There are a number of physiological roles of taurine, such as bile salt synthesis, osmoregulation, lipid metabolism, and oxidative stress inhibition. To investigate the role of de novo synthesis of taurine during embryonic development, zebrafish csad was cloned and functionally analyzed. Semi-quantitative RT-PCR showed that csad transcripts are maternally deposited, while whole-mount in situ hybridization demonstrated that csad is expressed in yolk syncytial layer and various embryonic tissues such as notochord, brain, retina, pronephric duct, liver, and pancreas. Knockdown of csad significantly reduced the embryonic taurine level, and the affected embryos had increased early mortality and cardiac anomalies. mRNA coinjection and taurine supplementation rescued the cardiac phenotypes suggesting that taurine originating from the de novo synthesis pathway plays a role in cardiac development. Our findings indicated that the de novo synthesis pathway via Csad plays a critical role in taurine homeostasis and cardiac development in zebrafish early embryos.

  13. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  14. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.

    1986-01-01

    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  15. Synthesis of lyso(bis)phosphatidic acid in rabbit alveolar macrophages

    SciTech Connect

    Thornburg, T.; Roddick, V.; Wykle, R.L.; Waite, M.

    1987-05-01

    Reported here are studies on the biosynthetic pathway used by normal and BCG elicited alveolar macrophages for the synthesis of lyso(bis)phosphatidic acid (L(bis)PA). Earlier observations by this laboratory have shown that although L(bis)PA is abundant in these cells, there is little de novo synthesis of this lipid. Diaceyl phosphatidylglycerol (PG) labeled with either (1,2,3-/sup 3/H) glycerol or /sup 32/P demonstrated that PG is used as an exogenous substrate for L(bis)PA formation; both glycerol moieties are incorporated. Other phospholipids do not have this capacity. BCG-elicited macrophages are capable of only one-quarter the synthesis of L(bis)PA seen with normal cells, and also show a decreased amount of cell associated substrate. In addition, (/sup 3/H) 1-0-alkyl PG was used as a substrate to test the importance of the sn-1 acyl linkage in the synthetic pathway. This substrate produced less L(bis)PA while dramatically increasing the amounts of labelled phosphatidylethanolamine and phosphatidylcholine within the cell. The alkyl substrate also showed increased uptake by the cell. They conclude that the hydrolysis of the acyl group at the sn-1 position of PG is essential in the synthetic pathway leading to the production of L(bis)PA. They further suggest that the PG used by these cells as an exogenous substrate in vitro is obtained from the PG-rich surfactant surrounding the alveolar macrophage.

  16. Fatty Acid Phytyl Ester Synthesis in Chloroplasts of Arabidopsis[W

    PubMed Central

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-01-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. PMID:22623494

  17. Imidazoleacetic acid-ribotide in vestibulo-sympathetic pathway neurons.

    PubMed

    Holstein, Gay R; Friedrich, Victor L; Martinelli, Giorgio P

    2016-10-01

    Imidazole-4-acetic acid-ribotide (IAARP) is a putative neurotransmitter/modulator and an endogenous regulator of sympathetic drive, notably systemic blood pressure, through binding to imidazoline receptors. IAARP is present in neurons and processes throughout the CNS, but is particularly prevalent in regions that are involved in blood pressure control. The goal of this study was to determine whether IAARP is present in neurons in the caudal vestibular nuclei that participate in the vestibulo-sympathetic reflex (VSR) pathway. This pathway is important in modulating blood pressure upon changes in head position with regard to gravity, as occurs when humans rise from a supine position and when quadrupeds climb or rear. Sinusoidal galvanic vestibular stimulation was used to activate the VSR and cfos gene expression in VSR pathway neurons of rats. These subjects had previously received a unilateral FluoroGold tracer injection in the rostral or caudal ventrolateral medullary region. The tracer was transported retrogradely and filled vestibular neuronal somata with direct projections to the injected region. Brainstem sections through the caudal vestibular nuclei were immunostained to visualize FluoroGold, cFos protein, IAARP and glutamate immunofluorescence. The results demonstrate that IAARP is present in vestibular neurons of the VSR pathway, where it often co-localizes with intense glutamate immunofluorescence. The co-localization of IAARP and intense glutamate immunofluorescence in VSR neurons may represent an efficient chemoanatomical configuration, allowing the vestibular system to rapidly up- and down-modulate the activity of presympathetic neurons in the ventrolateral medulla, thereby altering blood pressure.

  18. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  19. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  20. Inhibition of Deoxyribonucleic Acid Synthesis and Bud Formation by Nalidixic Acid in Hyphomicrobium neptunium

    PubMed Central

    Weiner, Ronald M.; Blackman, Marcia A.

    1973-01-01

    The relationship between chromosome replication and morphogenesis in the budding bacterium Hyphomicrobium neptunium has been investigated. Nalidixic acid was found to completely inhibit deoxyribonucleic acid synthesis, but not ribonucleic acid synthesis. The antibiotic was bacteriostatic to the organism for the initial 5 h of exposure; thereafter it was bacteriocidal. Observation of inhibited cultures revealed cells that had produced abnormally long stalks, but no buds. These results indicate that bud formation is coupled to chromosome replication in H. neptunium. They do not exclude the possibilities that cross wall formation and bud separation may also be coupled to chromosome replication. Images PMID:4127631

  1. Replacement of a Metabolic Pathway for Large-Scale Production of Lactic Acid from Engineered Yeasts

    PubMed Central

    Porro, Danilo; Bianchi, Michele M.; Brambilla, Luca; Menghini, Rossella; Bolzani, Davide; Carrera, Vittorio; Lievense, Jefferson; Liu, Chi-Li; Ranzi, Bianca Maria; Frontali, Laura; Alberghina, Lilia

    1999-01-01

    Interest in the production of l-(+)-lactic acid is presently growing in relation to its applications in the synthesis of biodegradable polymer materials. With the aim of obtaining efficient production and high productivity, we introduced the bovine l-lactate dehydrogenase gene (LDH) into a wild-type Kluyveromyces lactis yeast strain. The observed lactic acid production was not satisfactory due to the continued coproduction of ethanol. A further restructuring of the cellular metabolism was obtained by introducing the LDH gene into a K. lactis strain in which the unique pyruvate decarboxylase gene had been deleted. With this modified strain, in which lactic fermentation substituted completely for the pathway leading to the production of ethanol, we obtained concentrations, productivities, and yields of lactic acid as high as 109 g liter−1, 0.91 g liter−1 h−1, and 1.19 mol per mole of glucose consumed, respectively. The organic acid was also produced at pH levels lower than those usual for bacterial processes. PMID:10473436

  2. Mutations in the Prokaryotic Pathway Rescue the fatty acid biosynthesis1 Mutant in the Cold.

    PubMed

    Gao, Jinpeng; Wallis, James G; Browse, John

    2015-09-01

    The Arabidopsis (Arabidopsis thaliana) fatty acid biosynthesis1 (fab1) mutant has increased levels of the saturated fatty acid 16:0 due to decreased activity of 3-ketoacyl-acyl carrier protein (ACP) synthase II. In fab1 leaves, phosphatidylglycerol, the major chloroplast phospholipid, contains up to 45% high-melting-point molecular species (molecules that contain only 16:0, 16:1-trans, and 18:0), a trait associated with chilling-sensitive plants, compared with less than 10% in wild-type Arabidopsis. Although they do not exhibit typical chilling sensitivity, when exposed to low temperatures (2°C-6°C) for long periods, fab1 plants do suffer collapse of photosynthesis, degradation of chloroplasts, and eventually death. A screen for suppressors of this low-temperature phenotype has identified 11 lines, some of which contain additional alterations in leaf-lipid composition relative to fab1. Here, we report the identification of two suppressor mutations, one in act1, which encodes the chloroplast acyl-ACP:glycerol-3-phosphate acyltransferase, and one in lpat1, which encodes the chloroplast acyl-ACP:lysophosphatidic acid acyltransferase. These enzymes catalyze the first two steps of the prokaryotic pathway for glycerolipid synthesis, so we investigated whether other mutations in this pathway would rescue the fab1 phenotype. Both the gly1 mutation, which reduces glycerol-3-phosphate supply to the prokaryotic pathway, and fad6, which is deficient in the chloroplast 16:1/18:1 fatty acyl desaturase, were discovered to be suppressors. Analyses of leaf-lipid compositions revealed that mutations at all four of the suppressor loci result in reductions in the proportion of high-melting-point molecular species of phosphatidylglycerol relative to fab1. We conclude that these reductions are likely the basis for the suppressor phenotypes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  3. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  4. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  5. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  6. Arachidonic acid stimulates DNA synthesis in brown preadipocytes through the activation of protein kinase C and MAPK.

    PubMed

    Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus

    2012-10-01

    Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. PeaT1-induced systemic acquired resistance in tobacco follows salicylic acid-dependent pathway.

    PubMed

    Zhang, Wei; Yang, Xiufen; Qiu, Dewen; Guo, Lihua; Zeng, Hongmei; Mao, Jianjun; Gao, Qiufeng

    2011-04-01

    Systemic acquired resistance (SAR) is an inducible defense mechanism which plays a central role in protecting plants from pathogen attack. A new elicitor, PeaT1 from Alternaria tenuissima, was expressed in Escherichia coil and characterized with systemic acquired resistance to tobacco mosaic virus (TMV). PeaT1-treated plants exhibited enhanced systemic resistance with a significant reduction in number and size of TMV lesions on wild tobacco leaves as compared with control. The quantitative analysis of TMV CP gene expression with real-time quantitative PCR showed there was reduction in TMV virus concentration after PeaT1 treatment. Similarly, peroxidase (POD) activity and lignin increased significantly after PeaT1 treatment. The real-time quantitative PCR revealed that PeaT1 also induced the systemic accumulation of pathogenesis-related gene, PR-1a and PR-1b which are the markers of systemic acquired resistance (SAR), NPR1 gene for salicylic acid (SA) signal transduction pathway and PAL gene for SA synthesis. The accumulation of SA and the failure in development of similar level of resistance as in wild type tobacco plants in PeaT1 treated nahG transgenic tobacco plants indicated that PeaT1-induced resistance depended on SA accumulation. The present work suggested that the molecular mechanism of PeaT1 inducing disease resistance in tobacco was likely through the systemic acquired resistance pathway mediated by salicylic acid and the NPR1 gene.

  8. Fatty acid synthesis is critical for stem cell pluripotency via promoting mitochondrial fission.

    PubMed

    Wang, Lihua; Zhang, Tong; Wang, Lin; Cai, Yongping; Zhong, Xiuying; He, Xiaoping; Hu, Lan; Tian, Shengya; Wu, Mian; Hui, Lijian; Zhang, Huafeng; Gao, Ping

    2017-05-15

    Pluripotent stem cells are known to display distinct metabolic phenotypes than their somatic counterparts. While accumulating studies are focused on the roles of glucose and amino acid metabolism in facilitating pluripotency, little is known regarding the role of lipid metabolism in regulation of stem cell activities. Here, we show that fatty acid (FA) synthesis activation is critical for stem cell pluripotency. Our initial observations demonstrated enhanced lipogenesis in pluripotent cells and during cellular reprogramming. Further analysis indicated that de novo FA synthesis controls cellular reprogramming and embryonic stem cell pluripotency through mitochondrial fission. Mechanistically, we found that de novo FA synthesis regulated by the lipogenic enzyme ACC1 leads to the enhanced mitochondrial fission via (i) consumption of AcCoA which affects acetylation-mediated FIS1 ubiquitin-proteasome degradation and (ii) generation of lipid products that drive the mitochondrial dynamic equilibrium toward fission. Moreover, we demonstrated that the effect of Acc1 on cellular reprogramming via mitochondrial fission also exists in human iPSC induction. In summary, our study reveals a critical involvement of the FA synthesis pathway in promoting ESC pluripotency and iPSC formation via regulating mitochondrial fission. © 2017 The Authors.

  9. Nutrigenomics, rumen-derived bioactive fatty acids, and the regulation of milk fat synthesis.

    PubMed

    Bauman, Dale E; Harvatine, Kevin J; Lock, Adam L

    2011-08-21

    Mammary synthesis of milk fat continues to be an active research area, with significant advances in the regulation of lipid synthesis by bioactive fatty acids (FAs). The biohydrogenation theory established that diet-induced milk fat depression (MFD) in the dairy cow is caused by an inhibition of mammary synthesis of milk fat by specific FAs produced during ruminal biohydrogenation. The first such FA shown to affect milk fat synthesis was trans-10, cis-12 conjugated linoleic acid, and its effects have been well characterized, including dose-response relationships. During MFD, lipogenic capacity and transcription of key mammary lipogenic genes are coordinately down-regulated. Results provide strong evidence for sterol response element-binding protein-1 (SREBP1) and Spot 14 as biohydrogenation intermediate responsive lipogenic signaling pathway for ruminants and rodents. The study of MFD and its regulation by specific rumen-derived bioactive FAs represents a successful example of nutrigenomics in present-day animal nutrition research and offers several potential applications in animal agriculture.

  10. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  11. Organochlorines inhibit acetaminophen glucuronidation by redirecting UDP-glucuronic acid towards the D-glucuronate pathway

    SciTech Connect

    Chan, Tom S. Wilson, John X.; Selliah, Subajini; Bilodeau, Marc; Zwingmann, Claudia; Poon, Raymond; O'Brien, Peter J.

    2008-11-01

    Industry-derived organochlorines are persistent environmental pollutants that are a continuing health concern. The effects of these compounds on drug metabolism are not well understood. In the current study we present evidence that the inhibition of acetaminophen (APAP) glucuronidation by minute concentrations of organochlorines correlates well with their ability to stimulate the D-glucuronate pathway leading to ascorbate synthesis. A set of 6 arylated organochlorines, including 5 PCB (polychlorinated biphenyl) congeners, were assessed for their effects on APAP glucuronidation in isolated hepatocytes from male Sprague-Dawley rats. The capacity of each organochlorine to inhibit APAP glucuronidation was found to be directly proportional to its capacity to stimulate ascorbate synthesis. PCB153, PCB28 and bis-(4-chlorophenyl sulfone) (BCPS) in increasing order were the most effective organochlorines for inhibiting APAP glucuronidation and stimulating the D-glucuronate pathway. None of the 3 inhibitors of APAP glucuronidation were able to alter the expression of UGT1A6, UGT1A7 and UGT1A8 (the major isoforms responsible for APAP glucuronidation in the rat), however, their efficacy at inhibiting APAP glucuronidation was proportional to their capacity to deplete UDP-glucuronic acid (UDPGA). BCPS-mediated inhibition of APAP glucuronidation in isolated hepatocytes had non-competitive characteristics and was insensitive to the inactivation of cytochrome P450. The effective organochlorines were also able to selectively stimulate the hydrolysis of UDPGA to UDP and glucuronate in isolated microsomes, but could not inhibit APAP glucuronidation in microsomes when UDPGA was in excess. We conclude that organochlorines are able to inhibit APAP glucuronidation in hepatocytes by depleting UDPGA via redirecting UDPGA towards the D-glucuronate pathway. Because the inhibition is non-competitive, low concentrations of these compounds could have long term inhibitory effects on the

  12. Stimulation of hepatic glycogen synthesis by amino acids.

    PubMed Central

    Katz, J; Golden, S; Wals, P A

    1976-01-01

    Hepatocytes isolated from livers of fasted rats form little glycogen from glucose or lactate at concentrations below 20 mM. Glycogen is formed in substantial quantities at a glucose concentration of 60 mM. In the presence of 10 mM glucose, 20-30% as much glycogen as glucose is formed from fructose, sorbitol, or dihydroxyacetone. The addition of either glutamine, alanine, or asparagine stimulates the formation of glycogen from lactate 10- to 40-fold. The formation of glucose and glycogen is then about equal, and glycogen deposition in hepatocytes is similar to rates attained in vivo after fasted rats are refed. The amino acids stimulate 1.5- to 2-fold glycogen synthesis from fructose, and 2- to 4-fold synthesis from dihyDROXYACETONE. Ammonium chloride is about one-half as effective as amino acids in stimulating glycogen synthesis when glucose with lactate are substrates. It increased glycogen synthesis 25-50% from fructose but inhibited synthesis from dihydroxyacetone plus glucose. PMID:1068456

  13. Microbial chemical factories: recent advances in pathway engineering for synthesis of value added chemicals.

    PubMed

    Dhamankar, Himanshu; Prather, Kristala L J

    2011-08-01

    The dwindling nature of petroleum and other fossil reserves has provided impetus towards microbial synthesis of fuels and value added chemicals from biomass-derived sugars as a renewable resource. Microbes have naturally evolved enzymes and pathways that can convert biomass into hundreds of unique chemical structures, a property that can be effectively exploited for their engineering into Microbial Chemical Factories (MCFs). De novo pathway engineering facilitates expansion of the repertoire of microbially synthesized compounds beyond natural products. In this review, we visit some recent successes in such novel pathway engineering and optimization, with particular emphasis on the selection and engineering of pathway enzymes and balancing of their accessory cofactors.

  14. The mevalonate pathway and the synthesis of juvenile hormone in insects.

    PubMed

    Bellés, Xavier; Martín, David; Piulachs, Maria-Dolors

    2005-01-01

    The mevalonate pathway in insects has two important peculiarities, the absence of the sterol branch and the synthesis of juvenile hormone (JH), that may have influenced the mechanisms of regulation. The data available on these mechanisms indicate that cholesterol does not play a regulatory role and that JH modulates transcript levels of a number of genes of the mevalonate pathway or can influence the translatability and/or stability of the transcripts themselves. These data suggest that the mevalonate pathway in insects can best be interpreted in terms of coordinated regulation, in which regulators act in parallel to a number of enzymes, as occurs in the cholesterol-driven pathway in vertebrates.

  15. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  16. Effects of brefeldin A and nordihydroguaiaretic acid on endomembrane dynamics and lipid synthesis in plant cells.

    PubMed

    Mérigout, Patricia; Képès, François; Perret, Anne-Marie; Satiat-Jeunemaitre, Béatrice; Moreau, Patrick

    2002-05-08

    Effects of brefeldin A (BFA) and nordihydroguaiaretic acid (NDGA) on endomembrane structures and lipid synthesis were compared in maize root cells and tobacco Bright Yellow-2 cells. Immunofluorescence and electron microscopy studies showed that NDGA altered the structure and distribution of the endoplasmic reticulum (ER) within 1 h but not of the Golgi apparatus whereas, as shown previously, BFA altered that organization of the Golgi apparatus and, only subsequently, of the ER. Biochemical studies revealed that both drugs and especially BFA led to a strong inhibition of the phytosterol biosynthetic pathway: BFA led to accumulation of sterol precursors. The importance of phytosterols in membrane architecture and membrane trafficking is discussed.

  17. Fatty Acid Synthesis and Control of Caspase 2 in Prostate Cancer

    DTIC Science & Technology

    2013-05-01

    DHEA ),  fatty  acid  synthesis,  (C75,  C93,  cerulenin)  and  CaMKII...the   pentose  phosphate  pathway  ( DHEA  and  2DG)  enhanced  the  death  of  these  cells  over  that   induced...DU145   prostate   cancer   cells  were   treated   with   docetaxel   and   either   DHEA   or  

  18. Transcriptome survey of the lipid metabolic pathways involved in energy production and ecdysteroid synthesis in the salmon louse Caligus rogercresseyi (Crustacea: Copepoda).

    PubMed

    Gonçalves, Ana Teresa; Farlora, Rodolfo; Gallardo-Escárate, Cristian

    2014-10-01

    The goal of this study was to identify and analyze the lipid metabolic pathways involved in energy production and ecdysteroid synthesis in the ectoparasite copepod Caligus rogercresseyi. Massive transcriptome sequencing analysis was performed during the infectious copepodid larval stage, during the attached chalimus larval stage, and also in female and male adults. Thirty genes were selected for describing the pathways, and these were annotated for proteins or enzymes involved in lipid digestion, absorption, and transport; fatty acid degradation; the synthesis and degradation of ketone bodies; and steroid and ecdysteroid syntheses. Differential expression of these genes was analyzed by ontogenic stage and discussed considering each stage's feeding habits and energetic needs. Copepodids showed a low expression of fatty acid digestion genes, reflected by a non-feeding behavior, and the upregulation of genes involved in steroid biosynthesis, which was consistent with a pathway for cholesterol synthesis during ecdysis. The chalimus stage showed an upregulation of genes related to fatty acid digestion, absorption, and transport, as well as to fatty acid degradation and the synthesis of ketone bodies, therefore suggesting that lipids ingested from the mucus and skin of the host fish are metabolized as important sources of energy. Adult females also showed a pattern of high lipid metabolism for energy supply and mobilization in relation to reproduction and vitellogenesis. Adult females and males revealed different lipid metabolism patterns that reflected different energetic needs. This study reports for the first time the probable lipid metabolic pathways involved in the energy production and ecdysteroid synthesis of C. rogercresseyi. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. High yielding synthesis of N-ethyl dehydroamino acids.

    PubMed

    Monteiro, Luís S; Suárez, Ana S

    2012-10-01

    Recently we reported the use of a sequence of alkylation and dehydration methodologies to obtain N-ethyl-α, β-dehydroamino acid derivatives. The application of this N-alkylation procedure to several methyl esters of β,β-dibromo and β-bromo, β-substituted dehydroamino acids protected with standard amine protecting groups was subsequently reported. The corresponding N-ethyl, β-bromo dehydroamino acid derivatives were obtained in fair to high yields and some were used as substrates in Suzuki cross-coupling reactions to give N-ethyl, β,β-disubstituted dehydroalanine derivatives. Herein, we further explore N-ethylation of β-halo dehydroamino acid derivatives using triethyloxonium tetrafluoroborate as alkylating agent, but substituting N,N-diisopropylethylamine for potassium tert-butoxide as auxiliary base. In these conditions, for all β-halo dehydroamino acid derivatives, reactions were complete and the N-ethylated derivative could be isolated in high yield. This method was also applied for N-ethylation of non-halogenated dehydroamino acids. Again, with all compounds the reactions were complete and the N-ethyl dehydroamino acid derivatives could be isolated in high yields. Some of these N-ethyl dehydroamino acid methyl ester derivatives were converted in high yields to their corresponding acids and coupled to an amino acid methyl ester to give N-ethyl dehydrodipeptide derivatives in good yields. Thus, this method constitutes a general procedure for high yielding synthesis of N-ethylated dehydroamino acids, which can be further applied in peptide synthesis.

  20. Leucine alleviates dexamethasone-induced suppression of muscle protein synthesis via synergy involvement of mTOR and AMPK pathways

    PubMed Central

    Wang, Xiao J.; Yang, Xin; Wang, Ru X.; Jiao, Hong C.; Zhao, Jing P.; Song, Zhi G.; Lin, Hai

    2016-01-01

    Glucocorticoids (GCs) are negative muscle protein regulators that contribute to the whole-body catabolic state during stress. Mammalian target of rapamycin (mTOR)-signalling pathway, which acts as a central regulator of protein metabolism, can be activated by branched-chain amino acids (BCAA). In the present study, the effect of leucine on the suppression of protein synthesis induced by GCs and the pathway involved were investigated. In vitro experiments were conducted using cultured C2C12 myoblasts to study the effect of GCs on protein synthesis, and the involvement of mTOR pathway was investigated as well. After exposure to dexamethasone (DEX, 100 μmol/l) for 24 h, protein synthesis in muscle cells was significantly suppressed (P<0.05), the phosphorylations of mTOR, ribosomal protein S6 protein kinase 1 (p70s6k1) and eukaryotic initiation factor 4E binding protein 1 (4EBP1) were significantly reduced (P<0.05). Leucine supplementation (5 mmol/l, 10 mmol/l and 15 mmol/l) for 1 h alleviated the suppression of protein synthesis induced by DEX (P<0.05) and was accompanied with the increased phosphorylation of mTOR and decreased phosphorylation of AMPK (P<0.05). Branched-chain amino transferase 2 (BCAT2) mRNA level was not influenced by DEX (P>0.05) but was increased by leucine supplementation at a dose of 5 mmol/l (P<0.05). PMID:27129299

  1. Prostaglandin E2 promotes hepatic bile acid synthesis by an E prostanoid receptor 3-mediated hepatocyte nuclear receptor 4α/cholesterol 7α-hydroxylase pathway in mice.

    PubMed

    Yan, Shuai; Tang, Juan; Zhang, Yuyao; Wang, Yuanyang; Zuo, Shengkai; Shen, Yujun; Zhang, Qianqian; Chen, Di; Yu, Yu; Wang, Kai; Duan, Sheng-Zhong; Yu, Ying

    2017-03-01

    Prostaglandin E2 (PGE2 ) is an important lipid mediator of inflammation. However, whether and how PGE2 regulates hepatic cholesterol metabolism remains unknown. We found that expression of the PGE2 receptor, E prostanoid receptor 3 (EP3) expression is remarkably increased in hepatocytes in response to hyperlipidemic stress. Hepatocyte-specific deletion of EP3 receptor (EP3(hep-/-) ) results in hypercholesterolemia and augments diet-induced atherosclerosis in low-density lipoprotein receptor knockout (Ldlr(-/-) ) mice. Cholesterol 7α-hydroxylase (CYP7A1) is down-regulated in livers of EP3(hep-/-) Ldlr(-/-) mice, leading to suppressed hepatic bile acid (BA) biosynthesis. Mechanistically, hepatic-EP3 deficiency suppresses CYP7A1 expression by elevating protein kinase A (PKA)-dependent Ser143 phosphorylation of hepatocyte nuclear receptor 4α (HNF4α). Disruption of the PKA-HNF4α interaction and BA sequestration rescue impaired BA excretion and ameliorated atherosclerosis in EP3(hep-/-) Ldlr(-/-) mice.

  2. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  3. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Integrating nitric oxide into salicylic acid and jasmonic acid/ ethylene plant defense pathways.

    PubMed

    Mur, Luis A J; Prats, Elena; Pierre, Sandra; Hall, Michael A; Hebelstrup, Kim H

    2013-01-01

    Plant defense against pests and pathogens is known to be conferred by either salicylic acid (SA) or jasmonic acid (JA)/ethylene (ET) pathways, depending on infection or herbivore-grazing strategy. It is well attested that SA and JA/ET pathways are mutually antagonistic allowing defense responses to be tailored to particular biotic stresses. Nitric oxide (NO) has emerged as a major signal influencing resistance mediated by both signaling pathways but no attempt has been made to integrate NO into established SA/JA/ET interactions. NO has been shown to act as an inducer or suppressor of signaling along each pathway. NO will initiate SA biosynthesis and nitrosylate key cysteines on TGA-class transcription factors to aid in the initiation of SA-dependent gene expression. Against this, S-nitrosylation of NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1) will promote the NPR1 oligomerization within the cytoplasm to reduce TGA activation. In JA biosynthesis, NO will initiate the expression of JA biosynthetic enzymes, presumably to over-come any antagonistic effects of SA on JA-mediated transcription. NO will also initiate the expression of ET biosynthetic genes but a suppressive role is also observed in the S-nitrosylation and inhibition of S-adenosylmethionine transferases which provides methyl groups for ET production. Based on these data a model for NO action is proposed but we have also highlighted the need to understand when and how inductive and suppressive steps are used.

  5. Integrating nitric oxide into salicylic acid and jasmonic acid/ ethylene plant defense pathways

    PubMed Central

    Mur, Luis A. J.; Prats, Elena; Pierre, Sandra; Hall, Michael A.; Hebelstrup, Kim H.

    2013-01-01

    Plant defense against pests and pathogens is known to be conferred by either salicylic acid (SA) or jasmonic acid (JA)/ethylene (ET) pathways, depending on infection or herbivore-grazing strategy. It is well attested that SA and JA/ET pathways are mutually antagonistic allowing defense responses to be tailored to particular biotic stresses. Nitric oxide (NO) has emerged as a major signal influencing resistance mediated by both signaling pathways but no attempt has been made to integrate NO into established SA/JA/ET interactions. NO has been shown to act as an inducer or suppressor of signaling along each pathway. NO will initiate SA biosynthesis and nitrosylate key cysteines on TGA-class transcription factors to aid in the initiation of SA-dependent gene expression. Against this, S-nitrosylation of NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1) will promote the NPR1 oligomerization within the cytoplasm to reduce TGA activation. In JA biosynthesis, NO will initiate the expression of JA biosynthetic enzymes, presumably to over-come any antagonistic effects of SA on JA-mediated transcription. NO will also initiate the expression of ET biosynthetic genes but a suppressive role is also observed in the S-nitrosylation and inhibition of S-adenosylmethionine transferases which provides methyl groups for ET production. Based on these data a model for NO action is proposed but we have also highlighted the need to understand when and how inductive and suppressive steps are used. PMID:23818890

  6. Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha[OPEN

    PubMed Central

    Eklund, D. Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P.; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L.

    2015-01-01

    The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. PMID:26036256

  7. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  8. Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

    PubMed Central

    2012-01-01

    Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

  9. Dual Role for Phospholipid:Diacylglycerol Acyltransferase: Enhancing Fatty Acid Synthesis and Diverting Fatty Acids from Membrane Lipids to Triacylglycerol in Arabidopsis Leaves[C][W

    PubMed Central

    Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng

    2013-01-01

    There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979

  10. Chlorination of Amino Acids: Reaction Pathways and Reaction Rates.

    PubMed

    How, Zuo Tong; Linge, Kathryn L; Busetti, Francesco; Joll, Cynthia A

    2017-05-02

    Chlorination of amino acids can result in the formation of organic monochloramines or organic dichloramines, depending on the chlorine to amino acid ratio (Cl:AA). After formation, organic chloramines degrade into aldehydes, nitriles and N-chloraldimines. In this paper, the formation of organic chloramines from chlorination of lysine, tyrosine and valine were investigated. Chlorination of tyrosine and lysine demonstrated that the presence of a reactive secondary group can increase the Cl:AA ratio required for the formation of N,N-dichloramines, and potentially alter the reaction pathways between chlorine and amino acids, resulting in the formation of unexpected byproducts. In a detailed investigation, we report rate constants for all reactions in the chlorination of valine, for the first time, using experimental results and modeling. At Cl:AA = 2.8, the chlorine was found to first react quickly with valine (5.4 × 10(4) M(-1) s(-1)) to form N-monochlorovaline, with a slower subsequent reaction with N-monochlorovaline to form N,N-dichlorovaline (4.9 × 10(2) M(-1) s(-1)), although some N-monochlorovaline degraded into isobutyraldehyde (1.0 × 10(-4) s(-1)). The N,N-dichlorovaline then competitively degraded into isobutyronitrile (1.3 × 10(-4) s(-1)) and N-chloroisobutyraldimine (1.2 × 10(-4) s(-1)). In conventional drinking water disinfection, N-chloroisobutyraldimine can potentially be formed in concentrations higher than its odor threshold concentration, resulting in aesthetic challenges and an unknown health risk.

  11. RpiR Homologues May Link Staphylococcus aureus RNAIII Synthesis and Pentose Phosphate Pathway Regulation ▿ †

    PubMed Central

    Zhu, Yefei; Nandakumar, Renu; Sadykov, Marat R.; Madayiputhiya, Nandakumar; Luong, Thanh T.; Gaupp, Rosmarie; Lee, Chia Y.; Somerville, Greg A.

    2011-01-01

    Staphylococcus aureus is a medically important pathogen that synthesizes a wide range of virulence determinants. The synthesis of many staphylococcal virulence determinants is regulated in part by stress-induced changes in the activity of the tricarboxylic acid (TCA) cycle. One metabolic change associated with TCA cycle stress is an increased concentration of ribose, leading us to hypothesize that a pentose phosphate pathway (PPP)-responsive regulator mediates some of the TCA cycle-dependent regulatory effects. Using bioinformatics, we identified three potential ribose-responsive regulators that belong to the RpiR family of transcriptional regulators. To determine whether these RpiR homologues affect PPP activity and virulence determinant synthesis, the rpiR homologues were inactivated, and the effects on PPP activity and virulence factor synthesis were assessed. Two of the three homologues (RpiRB and RpiRC) positively influence the transcription of the PPP genes rpiA and zwf, while the third homologue (RpiRA) is slightly antagonistic to the other homologues. In addition, inactivation of RpiRC altered the temporal transcription of RNAIII, the effector molecule of the agr quorum-sensing system. These data confirm the close linkage of central metabolism and virulence determinant synthesis, and they establish a metabolic override for quorum-sensing-dependent regulation of RNAIII transcription. PMID:21926234

  12. A new general pathway for synthesis of reference compounds of N-terminal valine-isocyanate adducts.

    PubMed

    Davies, Ronnie; Rydberg, Per; Westberg, Emelie; Motwani, Hitesh V; Johnstone, Erik; Törnqvist, Margareta

    2010-03-15

    Adducts to Hb could be used as biomarkers to monitor exposure to isocyanates. Particularly useful is the measurement of carbamoylation of N-terminal valines in Hb, after detachment as hydantoins. The synthesis of references from the reactive isocyanates, especially diisocyanates, has been problematic due to side reactions and polymerization of the isocyanate starting material. A simpler, safer, and more general method for the synthesis of valine adducts of isocyanates has been developed using N-[(4-nitrophenyl)carbamate]valine methylamide (NPCVMA) as the key precursor to adducts of various mono- and diisocyanates of interest. By reacting NPCVMA with a range of isocyanate-related amines, carbamoylated valines are formed without the use of the reactive isocyanates. The carbamoylated products synthesized here were cyclized with good yields of the formed hydantoins. The carbamoylated derivative from phenyl isocyanate also showed quantitative yield in a test with cyclization under the conditions used in blood. This new pathway for the preparation of N-carbamoylated model compounds overcomes the above-mentioned problems in the synthesis and is a general and simplified approach, which could make such reference compounds of adducts to N-terminal valine from isocyanates accessible for biomonitoring purposes. The synthesized hydantoins corresponding to adducts from isocyanic acid, methyl isocyanate, phenyl isocyanate, and 2,6-toluene diisocyanate were characterized by LC-MS analysis. The background level of the hydantoin from isocyanic acid in human blood was analyzed with the LC-MS conditions developed.

  13. Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

    PubMed Central

    Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

    2011-01-01

    Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

  14. Arginine decarboxylase (ADC) and agmatinase (AGMAT): an alternative pathway for synthesis of polyamines in pig conceptuses and uteri

    USDA-ARS?s Scientific Manuscript database

    Arginine, a precursor for the synthesis of nitric oxide (NO) and polyamines, is critical for implantation and development of the conceptus. We first reported that the arginine decarboxylase (ADC)/agmatinase(AGMAT) pathway as an alternative pathway for synthesis of polyamines in the ovine conceptuses...

  15. Skeletal diversity via a branched pathway: efficient synthesis of 29 400 discrete, polycyclic compounds and their arraying into stock solutions.

    PubMed

    Kwon, Ohyun; Park, Seung Bum; Schreiber, Stuart L

    2002-11-13

    We report the synthesis and arraying of 29 400 structurally diverse and complex polycyclic carbocycles using diversity-oriented synthesis (DOS) and the "one bead-one stock solution" technology platform. Skeletal diversity, a difficult challenge in DOS, was achieved with a branching reaction pathway using one or two Diels-Alder reactions. This pathway yields small molecules having 10 different skeletons.

  16. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  17. Transcription factors FabR and FadR regulate both aerobic and anaerobic pathways for unsaturated fatty acid biosynthesis in Shewanella oneidensis.

    PubMed

    Luo, Qixia; Shi, Miaomiao; Ren, Yedan; Gao, Haichun

    2014-01-01

    As genes for type II fatty acid synthesis are essential to the growth of Escherichia coli, its sole (anaerobic) pathway has significant potential as a target for novel antibacterial drug, and has been extensively studied. Despite this, we still know surprisingly little about fatty acid synthesis in bacteria because this anaerobic pathway in fact is not widely distributed. In this study, we show a novel model of unsaturated fatty acid (UFA) synthesis in Shewanella, emerging human pathogens in addition to well-known metal reducers. We identify both anaerobic and aerobic UFA biosynthesis pathways in the representative species, S. oneidensis. Uniquely, the bacterium also contains two regulators FabR and FadR, whose counterparts in other bacteria control the anaerobic pathway. However, we show that in S. oneidensis these two regulators are involved in regulation of both pathways, in either direct or indirect manner. Overall, our results indicate that the UFA biosynthesis and its regulation are far more complex than previously expected, and S. oneidensis serves as a good research model for further work.

  18. Abscisic-acid-induced cellular apoptosis and differentiation in glioma via the retinoid acid signaling pathway.

    PubMed

    Zhou, Nan; Yao, Yu; Ye, Hongxing; Zhu, Wei; Chen, Liang; Mao, Ying

    2016-04-15

    Retinoid acid (RA) plays critical roles in regulating differentiation and apoptosis in a variety of cancer cells. Abscisic acid (ABA) and RA are direct derivatives of carotenoids and share structural similarities. Here we proposed that ABA may also play a role in cellular differentiation and apoptosis by sharing a similar signaling pathway with RA that may be involved in glioma pathogenesis. We reported for the first time that the ABA levels were twofold higher in low-grade gliomas compared with high-grade gliomas. In glioma tissues, there was a positive correlation between the ABA levels and the transcription of cellular retinoic acid-binding protein 2 (CRABP2) and a negative correlation between the ABA levels and transcription of fatty acid-binding protein 5 (FABP5). ABA treatment induced a significant increase in the expression of CRABP2 and a decrease in the expression of peroxisome proliferator-activated receptor (PPAR) in glioblastoma cells. Remarkably, both cellular apoptosis and differentiation were increased in the glioblastoma cells after ABA treatment. ABA-induced cellular apoptosis and differentiation were significantly reduced by selectively silencing RAR-α, while RAR-α overexpression exaggerated the ABA-induced effects. These results suggest that ABA may play a role in the pathogenesis of glioma by promoting cellular apoptosis and differentiation through the RA signaling pathway. © 2015 UICC.

  19. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  20. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  1. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  2. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  3. A concise synthesis of berkelic acid inspired by combining the natural products spicifernin and pulvilloric acid.

    PubMed

    Bender, Christopher F; Yoshimoto, Francis K; Paradise, Christopher L; De Brabander, Jef K

    2009-08-19

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid, an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24-28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in a 10 step linear sequence and 11-27% overall yield.

  4. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  5. Synthesis of the putative structure of 15-oxopuupehenoic acid.

    PubMed

    Boulifa, Ettahir; Fernández, Antonio; Alvarez, Esteban; Alvarez-Manzaneda, Ramón; Mansour, Ahmed I; Chahboun, Rachid; Alvarez-Manzaneda, Enrique

    2014-11-07

    Synthesis of the putative structure of the marine natural 15-oxopuupehenoic acid has been achieved starting from commercial (-)-sclareol. Key steps of the synthetic sequence are the Robinson annulation of a β-ketoester and methyl vinyl ketone and an unprecedented cyclization of the resulting α,β-enone, which is mediated by tin(IV) chloride in the presence of N-phenylselenophthalimide. The physical properties of the synthetic compound are somewhat different from those reported for the natural product.

  6. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  7. A reconfigured Kennedy pathway which promotes efficient accumulation of medium chain fatty acids in leaf oils.

    PubMed

    Reynolds, Kyle B; Taylor, Matthew C; Cullerne, Darren P; Blanchard, Christopher L; Wood, Craig C; Singh, Surinder P; Petrie, James R

    2017-03-16

    Medium chain fatty acids (MCFA, C6-14 fatty acids) are an ideal feedstock for biodiesel and broader oleochemicals. In recent decades, several studies have used transgenic engineering to produce MCFA in seeds oils, though these modifications result in unbalance membrane lipid profiles that impair oil yields and agronomic performance. Given the ability to engineer non-seed organs to produce oils, we have previously demonstrated that MCFA profiles can be produced in leaves, but this also results in unbalanced membrane lipid profiles and undesirable chlorosis and cell death. Here we demonstrate that the introduction of a diacylglycerol acyltransferase from oil palm, EgDGAT1, was necessary to channel nascent MCFA directly into leaf oils and therefore bypassing MCFA residing in membrane lipids. This pathway resulted in increased flux towards MCFA rich leaf oils, reduced MCFA in leaf membrane lipids and, crucially, the alleviation of chlorosis. Deep sequencing of African oil palm (Elaeis guineensis) and coconut palm (Cocos nucifera) generated candidate genes of interest, which were then tested for their ability to improve oil accumulation. Thioesterases were explored for the production of lauric acid (C12:0) and myristic (C14:0). The thioesterases from Umbellularia californica and Cinnamomum camphora produced a total of 52% C12:0 and 40% C14:0, respectively, in transient leaf assays. This study demonstrated that the introduction of a complete acyl-CoA dependent pathway for the synthesis of MFCA-rich oils avoided disturbing membrane homeostasis and cell death phenotypes. This study outlines a transgenic strategy for the engineering of biomass crops with high levels of MCFA rich leaf oils. This article is protected by copyright. All rights reserved.

  8. Differential modulation of citrate synthesis and release by fatty acids in perfused working rat hearts.

    PubMed

    Vincent, Genevieve; Bouchard, Bertrand; Khairallah, Maya; Des Rosiers, Christine

    2004-01-01

    The objective of this study was to test the effect of increasing fatty acid concentrations on substrate fluxes through pathways leading to citrate synthesis and release in the heart. This was accomplished using semirecirculating work-performing rat hearts perfused with substrate mixtures mimicking the in situ milieu (5.5 mM glucose, 8 nM insulin, 1 mM lactate, 0.2 mM pyruvate, and 0.4 mM oleate-albumin) and 13C methods. Raising the fatty acid concentration from 0.4 to 1 mM with long-chain oleate or medium-chain octanoate resulted in a lowering ( approximately 20%) of cardiac output and efficiency with unaltered O2 consumption. At the metabolic level, beyond the expected effects of high fatty acid levels on the contribution of pyruvate decarboxylation (reduced >3-fold) and beta-oxidation (enhanced approximately 3-fold) to citrate synthesis, there was also a 2.4-fold lowering of anaplerotic pyruvate carboxylation. Despite the dual inhibitory effect of high fatty acids on pyruvate decarboxylation and carboxylation, tissue citrate levels were twofold higher, but citrate release rates remained unchanged at 11-14 nmol/min, representing <0.5% of citric acid cycle flux. A similar trend was observed for most metabolic parameters after oleate or octanoate addition. Together, these results emphasize a differential modulation of anaplerotic pyruvate carboxylation and citrate release in the heart by fatty acids. We interpret the lack of effects of high fatty acid concentrations on citrate release rates as suggesting that, under physiological conditions, this process is maximal, probably limited by the activity of its mitochondrial or plasma membrane transporter. Limited citrate release at high fatty acid concentrations may have important consequences for the heart's fuel metabolism and function.

  9. Intracellular composition of fatty acid affects the processing and function of tyrosinase through the ubiquitin–proteasome pathway

    PubMed Central

    Ando, Hideya; Wen, Zhi-Ming; Kim, Hee-Yong; Valencia, Julio C.; Costin, Gertrude-E.; Watabe, Hidenori; Yasumoto, Ken-ichi; Niki, Yoko; Kondoh, Hirofumi; Ichihashi, Masamitsu; Hearing, Vincent J.

    2005-01-01

    Proteasomes are multicatalytic proteinase complexes within cells that selectively degrade ubiquitinated proteins. We have recently demonstrated that fatty acids, major components of cell membranes, are able to regulate the proteasomal degradation of tyrosinase, a critical enzyme required for melanin biosynthesis, in contrasting manners by relative increases or decreases in the ubiquitinated tyrosinase. In the present study, we show that altering the intracellular composition of fatty acids affects the post-Golgi degradation of tyrosinase. Incubation with linoleic acid (C18:2) dramatically changed the fatty acid composition of cultured B16 melanoma cells, i.e. the remarkable increase in polyunsaturated fatty acids such as linoleic acid and arachidonic acid (C20:4) was compensated by the decrease in monounsaturated fatty acids such as oleic acid (C18:1) and palmitoleic acid (C16:1), with little effect on the proportion of saturated to unsaturated fatty acid. When the composition of intracellular fatty acids was altered, tyrosinase was rapidly processed to the Golgi apparatus from the ER (endoplasmic reticulum) and the degradation of tyrosinase was increased after its maturation in the Golgi. Retention of tyrosinase in the ER was observed when cells were treated with linoleic acid in the presence of proteasome inhibitors, explaining why melanin synthesis was decreased in cells treated with linoleic acid and a proteasome inhibitor despite the abrogation of tyrosinase degradation. These results suggest that the intracellular composition of fatty acid affects the processing and function of tyrosinase in connection with the ubiquitin–proteasome pathway and suggest that this might be a common physiological approach to regulate protein degradation. PMID:16232122

  10. Insulin and amino acids independently stimulate skeletal muscle protein synthesis in neonatal pigs.

    PubMed

    O'Connor, Pamela M J; Bush, Jill A; Suryawan, Agus; Nguyen, Hanh V; Davis, Teresa A

    2003-01-01

    Infusion of physiological levels of insulin and/or amino acids reproduces the feeding-induced stimulation of muscle protein synthesis in neonates. To determine whether insulin and amino acids independently stimulate skeletal muscle protein synthesis in neonates, insulin secretion was blocked with somatostatin in fasted 7-day-old pigs (n = 8-12/group) while glucose and glucagon were maintained at fasting levels and insulin was infused to simulate either less than fasting, fasting, intermediate, or fed insulin levels. At each dose of insulin, amino acids were clamped at either the fasting or fed level; at the highest insulin dose, amino acids were also reduced to less than fasting levels. Skeletal muscle protein synthesis was measured using a flooding dose of l-[4-(3)H]phenylalanine. Hyperinsulinemia increased protein synthesis in skeletal muscle during hypoaminoacidemia and euaminoacidemia. Hyperaminoacidemia increased muscle protein synthesis during hypoinsulinemia and euinsulinemia. There was a dose-response effect of both insulin and amino acids on muscle protein synthesis. At each insulin dose, hyperaminoacidemia increased muscle protein synthesis. The effects of insulin and amino acids on muscle protein synthesis were largely additive until maximal rates of protein synthesis were achieved. Amino acids enhanced basal protein synthesis rates but did not enhance the sensitivity or responsiveness of muscle protein synthesis to insulin. The results suggest that insulin and amino acids independently stimulate protein synthesis in skeletal muscle of the neonate.

  11. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  12. An in vitro investigation of the actions of reproductive hormones on the cervix of the ewe in the follicular stage: the effects of 17β-estradiol, oxytocin, FSH, and arachidonic acid on the cervical pathway for the synthesis of prostaglandin E2.

    PubMed

    Falchi, L; Scaramuzzi, R J

    2015-04-01

    During the periovulatory period, the cervix of the ewe relaxes and this mechanism is thought to be mediated by oxytocin and prostaglandin E2 (PGE2) in response to increased concentrations of 17β-estradiol and perhaps FSH. The aim of the study was to determine the in vitro effects of 17β-estradiol, FSH, oxytocin, and arachidonic acid (AA) on the synthesis of PGE2 and on the expression of oxytocin receptor (OTR), cytoplasmic phospholipase A2 (cPLA2), and cyclooxygenase 2 (COX-2) in explants of cervical tissue collected from ewes in the periovulatory phase of the estrous cycle. Cervical minces from ewes in the follicular phase of the estrous cycle were cultured in supplemented Eagle's Minimum Essential Medium for 48 hours with 17β-estradiol, FSH, oxytocin, or AA. After incubation, the tissue was stored at -80 °C and the media at -20 °C. Western immunoblotting was used to determine relative levels of OTR, cPLA2, and COX-2 in cervical tissue, and the media was analyzed by RIA, to determine the concentration of PGE2. The addition of 17β-estradiol increased the concentration of PGE2 in the media (P = 0.001), the levels of COX-2 (P = 0.02) and OTR (P = 0.006) but not those of cPLA2 (P = 0.15). The addition of FSH increased the levels of COX-2 (P = 0.01) but, it had no effect on the concentration of PGE2 (P = 0.08) or on the levels of OTR (P = 0.07) and cPLA2 (P = 0.15). Oxytocin did not increase the levels of COX-2 (P = 0.38) but increased those of OTR (P = 0.001) and cPLA2 (P = 0.01) but not on the concentration of PGE2 in the media. Arachidonic acid increased the levels of cPLA2 (P = 0.01) and those of COX-2 (P = 0.02) but not the concentration of PGE2 in the media. Our findings suggest that the PGE2-mediated mechanisms of cervical relaxation in the ewe during the follicular phase are stimulated by FSH, 17β-estradiol, oxytocin, and AA. They all appear to act by inducing receptors and enzymes along the synthetic pathway for PGE2.

  13. Synthesis of methylphosphonic acid by marine microbes: a source for methane in the aerobic ocean.

    PubMed

    Metcalf, William W; Griffin, Benjamin M; Cicchillo, Robert M; Gao, Jiangtao; Janga, Sarath Chandra; Cooke, Heather A; Circello, Benjamin T; Evans, Bradley S; Martens-Habbena, Willm; Stahl, David A; van der Donk, Wilfred A

    2012-08-31

    Relative to the atmosphere, much of the aerobic ocean is supersaturated with methane; however, the source of this important greenhouse gas remains enigmatic. Catabolism of methylphosphonic acid by phosphorus-starved marine microbes, with concomitant release of methane, has been suggested to explain this phenomenon, yet methylphosphonate is not a known natural product, nor has it been detected in natural systems. Further, its synthesis from known natural products would require unknown biochemistry. Here we show that the marine archaeon Nitrosopumilus maritimus encodes a pathway for methylphosphonate biosynthesis and that it produces cell-associated methylphosphonate esters. The abundance of a key gene in this pathway in metagenomic data sets suggests that methylphosphonate biosynthesis is relatively common in marine microbes, providing a plausible explanation for the methane paradox.

  14. Computational modeling of a metabolic pathway in ceramide de novo synthesis.

    PubMed

    Dhingra, Shobhika; Freedenberg, Melissa; Quo, Chang F; Merrill, Alfred H; Wang, May D

    2007-01-01

    Studies have implicated ceramide as a key molecular agent in regulating programmed cell death, or apoptosis. Consequently, there is significant potential in targeting intracellular ceramide as a cancer therapeutic agent. The cell's major ceramide source is the ceramide de novo synthesis pathway, which consists of a complex network of interdependent enzyme-catalyzed biochemical reactions. To understand how ceramide works, we have initiated the study of the ceramide de novo synthesis pathway using computational modeling based on fundamental principles of biochemical kinetics. Specifically, we designed and developed the model in MATLAB SIMULINK for the behavior of dihydroceramide desaturase. Dihydroceramide desaturase is one of three key enzymes in the ceramide de novo synthesis pathway, and it converts a relatively inert precursor molecule, dihydroceramide into biochemically reactive ceramide. A major issue in modeling is parameter estimation. We solved this problem by adopting a heuristic strategy based on a priori knowledge from literature and experimental data. We evaluated model accuracy by comparing the model prediction results with interpolated experimental data. Our future work includes more experimental validation of the model, dynamic rate constants assessment, and expansion of the model to include additional enzymes in the ceramide de novo synthesis pathway.

  15. First-principles prediction of stable SiC cage structures and their synthesis pathways

    NASA Astrophysics Data System (ADS)

    Pochet, Pascal; Genovese, Luigi; Caliste, Damien; Rousseau, Ian; Goedecker, Stefan; Deutsch, Thierry

    2010-07-01

    In this paper we use density functional theory calculations to investigate the structure and the stability of different SiC cagelike clusters. In addition to the fullerene family and the mixed four and six membered ring family, we introduce a family based on reconstructed nanotube slices. We propose an alternative synthesis pathway starting from SiC nanotubes.

  16. Abscisic acid interacts antagonistically with salicylic acid signaling pathway in rice-Magnaporthe grisea interaction.

    PubMed

    Jiang, Chang-Jie; Shimono, Masaki; Sugano, Shoji; Kojima, Mikiko; Yazawa, Katsumi; Yoshida, Riichiro; Inoue, Haruhiko; Hayashi, Nagao; Sakakibara, Hitoshi; Takatsuji, Hiroshi

    2010-06-01

    Plant hormones play pivotal signaling roles in plant-pathogen interactions. Here, we report characterization of an antagonistic interaction of abscisic acid (ABA) with salicylic acid (SA) signaling pathways in the rice-Magnaporthe grisea interaction. Exogenous application of ABA drastically compromised the rice resistance to both compatible and incompatible M. grisea strains, indicating that ABA negatively regulates both basal and resistance gene-mediated blast resistance. ABA markedly suppressed the transcriptional upregulation of WRKY45 and OsNPR1, the two key components of the SA signaling pathway in rice, induced by SA or benzothiadiazole or by blast infection. Overexpression of OsNPR1 or WRKY45 largely negated the enhancement of blast susceptibility by ABA, suggesting that ABA acts upstream of WRKY45 and OsNPR1 in the rice SA pathway. ABA-responsive genes were induced during blast infection in a pattern reciprocal to those of WRKY45 and OsPR1b in the compatible rice-blast interaction but only marginally in the incompatible one. These results suggest that the balance of SA and ABA signaling is an important determinant for the outcome of the rice-M. grisea interaction. ABA was detected in hyphae and conidia of M. grisea as well as in culture media, implying that blast-fungus-derived ABA could play a role in triggering ABA signaling at host infection sites.

  17. Twinfilin 1 enhances milk bio-synthesis and proliferation of bovine mammary epithelial cells via the mTOR signaling pathway.

    PubMed

    Li, Lu; Liu, Lijie; Qu, Bo; Li, Xueying; Gao, Xuejun; Zhang, Minghui

    2017-10-21

    Twinfilin1 (TWF1) is an actin monomer-binding protein, which biological function has not yet been fully uncovered. In our previous study, we found by mass spectrometry analysis that TWF1 might be one of the major proteins responsible for milk bio-synthesis and proliferation of bovine mammary epithelial cells (BMECs). The purpose of this study was to explore the possible mechanism by which TWF1 regulates signaling pathways that enhance milk bio-synthesis and proliferation of BMECs. We first explored the effects of TWF1 on milk bio-synthesis and cell proliferation, and analyzed the role of TWF1 on the protein levels of signaling molecules (mTOR, SREBP-1c and Cyclin D1) related to milk bio-synthesis and cell proliferation. Then we determinate the impacts of amino acids (methionine and leucine) and hormones (estrogen and prolactin) on the expressions of TWF1. These results reveal that TWF1 is highly induced by the stimulation of amino acids and hormones and involved in regulation of milk bio-synthesis and cell proliferation via the mTOR pathway in BMECs. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Bile acid homeostasis controls CAR signaling pathways in mouse testis through FXRalpha

    PubMed Central

    Martinot, Emmanuelle; Baptissart, Marine; Véga, Aurélie; Sèdes, Lauriane; Rouaisnel, Betty; Vaz, Fred; Saru, Jean-Paul; de Haze, Angélique; Baron, Silvère; Caira, Françoise; Beaudoin, Claude; Volle, David H.

    2017-01-01

    Bile acids (BAs) are molecules with endocrine activities controlling several physiological functions such as immunity, glucose homeostasis, testicular physiology and male fertility. The role of the nuclear BA receptor FXRα in the control of BA homeostasis has been well characterized. The present study shows that testis synthetize BAs. We demonstrate that mice invalidated for the gene encoding FXRα have altered BA homeostasis in both liver and testis. In the absence of FXRα, BA exposure differently alters hepatic and testicular expression of genes involved in BA synthesis. Interestingly, Fxrα-/- males fed a diet supplemented with BAs show alterations of testicular physiology and sperm production. This phenotype was correlated with the altered testicular BA homeostasis and the production of intermediate metabolites of BAs which led to the modulation of CAR signaling pathways within the testis. The role of the CAR signaling pathways within testis was validated using specific CAR agonist (TCPOBOP) and inverse agonist (androstanol) that respectively inhibited or reproduced the phenotype observed in Fxrα-/- males fed BA-diet. These data open interesting perspectives to better define how BA homeostasis contributes to physiological or pathophysiological conditions via the modulation of CAR activity. PMID:28181583

  19. Bile acid homeostasis controls CAR signaling pathways in mouse testis through FXRalpha.

    PubMed

    Martinot, Emmanuelle; Baptissart, Marine; Véga, Aurélie; Sèdes, Lauriane; Rouaisnel, Betty; Vaz, Fred; Saru, Jean-Paul; de Haze, Angélique; Baron, Silvère; Caira, Françoise; Beaudoin, Claude; Volle, David H

    2017-02-09

    Bile acids (BAs) are molecules with endocrine activities controlling several physiological functions such as immunity, glucose homeostasis, testicular physiology and male fertility. The role of the nuclear BA receptor FXRα in the control of BA homeostasis has been well characterized. The present study shows that testis synthetize BAs. We demonstrate that mice invalidated for the gene encoding FXRα have altered BA homeostasis in both liver and testis. In the absence of FXRα, BA exposure differently alters hepatic and testicular expression of genes involved in BA synthesis. Interestingly, Fxrα-/- males fed a diet supplemented with BAs show alterations of testicular physiology and sperm production. This phenotype was correlated with the altered testicular BA homeostasis and the production of intermediate metabolites of BAs which led to the modulation of CAR signaling pathways within the testis. The role of the CAR signaling pathways within testis was validated using specific CAR agonist (TCPOBOP) and inverse agonist (androstanol) that respectively inhibited or reproduced the phenotype observed in Fxrα-/- males fed BA-diet. These data open interesting perspectives to better define how BA homeostasis contributes to physiological or pathophysiological conditions via the modulation of CAR activity.

  20. Activation of the Diacetyl/Acetoin Pathway in Lactococcus lactis subsp. lactis bv. diacetylactis CRL264 by Acidic Growth▿ †

    PubMed Central

    García-Quintáns, Nieves; Repizo, Guillermo; Martín, Mauricio; Magni, Christian; López, Paloma

    2008-01-01

    Lactococcus lactis subsp. lactis bv. diacetylactis strains are aroma-producing organisms used in starter cultures for the elaboration of dairy products. This species is essentially a fermentative microorganism, which cometabolizes glucose and citrate to yield aroma compounds through the diacetyl/acetoin biosynthetic pathway. Our previous results have shown that under acidic growth Lactococcus bv. diacetylactis CRL264 expresses coordinately the genes responsible for citrate transport and its conversion into pyruvate. In the present work the impact of acidic growth on glucose, citrate, and pyruvate metabolism of Lactococcus bv. diacetylactis CRL264 has been investigated by proteomic analysis. The results indicated that acid growth triggers the conversion of citrate, but not glucose, into α-acetolactate via pyruvate. Moreover, they showed that low pH has no influence on levels of lactate dehydrogenase and pyruvate dehydrogenase. Therefore, the influence of external pH on regulation of the diacetyl/acetoin biosynthetic pathway in Lactococcus bv. diacetylactis CRL264 has been analyzed at the transcriptional level. Expression of the als, aldB, aldC, and butBA genes encoding the enzymes involved in conversion of pyruvate into aroma compounds has been investigated by primer extension, reverse transcription-PCR analysis, and transcriptional fusions. The results support that this biosynthetic pathway is induced at the transcriptional level by acidic growth conditions, presumably contributing to lactococcal pH homeostasis by synthesis of neutral compounds and by decreasing levels of pyruvate. PMID:18245243

  1. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  2. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  3. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress.

  4. Lettuce seed germination: modulation of pregermination protein synthesis by gibberellic Acid, abscisic Acid, and cytokinin.

    PubMed

    Fountain, D W; Bewley, J D

    1976-10-01

    Protein synthesis in gibberellin-treated lettuce (Lactuca sativa) seeds has been studied during the lag phase between the beginning of imbibition and the first signs of radicle protrusion. When compared to the water-imbibed controls, both polyribosome populations and radioactive leucine incorporation into protein increase in the embryos of GA(3)- induced seeds early in the imbibition period. Since these results are contradictory to previously published studies, the reasons for the differences are outlined and various alternative possibilities eliminated. The protocol for protein extraction, particularly the speed at which the supernatant from the seed homogenate is cleared, is important for demonstrating the GA(3)-mediated changes. Embryos maintained in the dormant state by abscisic acid still conduct considerable amounts of protein synthesis, and this is enhanced by concentrations of 6-benzylaminopurine which also promote germination. Therefore, the actions of GA(3), abscisic acid, and cytokinin on lettuce seed germination are mediated, directly or indirectly, via protein synthesis.

  5. Metabolic Interactions between the Lands Cycle and the Kennedy Pathway of Glycerolipid Synthesis in Arabidopsis Developing Seeds[W

    PubMed Central

    Wang, Liping; Shen, Wenyun; Kazachkov, Michael; Chen, Guanqun; Chen, Qilin; Carlsson, Anders S.; Stymne, Sten; Weselake, Randall J.; Zou, Jitao

    2012-01-01

    It has been widely accepted that the primary function of the Lands cycle is to provide a route for acyl remodeling to modify fatty acid (FA) composition of phospholipids derived from the Kennedy pathway. Lysophosphatidylcholine acyltransferase (LPCAT) is an evolutionarily conserved key enzyme in the Lands cycle. In this study, we provide direct evidence that the Arabidopsis thaliana LPCATs, LPCAT1 and LPCAT2, participate in the Lands cycle in developing seeds. In spite of a substantially reduced initial rate of nascent FA incorporation into phosphatidylcholine (PC), the PC level in the double mutant lpcat1 lpcat2-2 remained unchanged. LPCAT deficiency triggered a compensatory response of de novo PC synthesis and a concomitant acceleration of PC turnover that were attributable at least in part to PC deacylation. Acyl-CoA profile analysis revealed complicated metabolic alterations rather than merely reduced acyl group shuffling from PC in the mutant. Shifts in FA stereo-specific distribution in triacylglycerol of the mutant seed suggested a preferential retention of saturated acyl chains at the stereospecific numbering (sn)-1 position from PC and likely a channeling of lysophosphatidic acid, derived from PC, into the Kennedy pathway. Our study thus illustrates an intricate relationship between the Lands cycle and the Kennedy pathway. PMID:23150634

  6. The cockroach Blattella germanica obtains nitrogen from uric acid through a metabolic pathway shared with its bacterial endosymbiont.

    PubMed

    Patiño-Navarrete, Rafael; Piulachs, Maria-Dolors; Belles, Xavier; Moya, Andrés; Latorre, Amparo; Peretó, Juli

    2014-07-01

    Uric acid stored in the fat body of cockroaches is a nitrogen reservoir mobilized in times of scarcity. The discovery of urease in Blattabacterium cuenoti, the primary endosymbiont of cockroaches, suggests that the endosymbiont may participate in cockroach nitrogen economy. However, bacterial urease may only be one piece in the entire nitrogen recycling process from insect uric acid. Thus, in addition to the uricolytic pathway to urea, there must be glutamine synthetase assimilating the released ammonia by the urease reaction to enable the stored nitrogen to be metabolically usable. None of the Blattabacterium genomes sequenced to date possess genes encoding for those enzymes. To test the host's contribution to the process, we have sequenced and analysed Blattella germanica transcriptomes from the fat body. We identified transcripts corresponding to all genes necessary for the synthesis of uric acid and its catabolism to urea, as well as for the synthesis of glutamine, asparagine, proline and glycine, i.e. the amino acids required by the endosymbiont. We also explored the changes in gene expression with different dietary protein levels. It appears that the ability to use uric acid as a nitrogen reservoir emerged in cockroaches after its age-old symbiotic association with bacteria.

  7. Cancer Cells Differentially Activate and Thrive on De Novo Lipid Synthesis Pathways in a Low-Lipid Environment

    PubMed Central

    Daniëls, Veerle W.; Smans, Karine; Royaux, Ines; Chypre, Melanie

    2014-01-01

    Increased lipogenesis is a hallmark of a wide variety of cancers and is under intense investigation as potential antineoplastic target. Although brisk lipogenesis is observed in the presence of exogenous lipids, evidence is mounting that these lipids may adversely affect the efficacy of inhibitors of lipogenic pathways. Therefore, to fully exploit the therapeutic potential of lipid synthesis inhibitors, a better understanding of the interrelationship between de novo lipid synthesis and exogenous lipids and their respective role in cancer cell proliferation and therapeutic response to lipogenesis inhibitors is of critical importance. Here, we show that the proliferation of various cancer cell lines (PC3M, HepG2, HOP62 and T24) is attenuated when cultured in lipid-reduced conditions in a cell line-dependent manner, with PC3M being the least affected. Interestingly, all cell lines - lipogenic (PC3M, HepG2, HOP62) as well as non-lipogenic (T24) - raised their lipogenic activity in these conditions, albeit to a different degree. Cells that attained the highest lipogenic activity under these conditions were best able to cope with lipid reduction in term of proliferative capacity. Supplementation of the medium with very low density lipoproteins, free fatty acids and cholesterol reversed this activation, indicating that the mere lack of lipids is sufficient to activate de novo lipogenesis in cancer cells. Consequently, cancer cells grown in lipid-reduced conditions became more dependent on de novo lipid synthesis pathways and were more sensitive to inhibitors of lipogenic pathways, like Soraphen A and Simvastatin. Collectively, these data indicate that limitation of access to exogenous lipids, as may occur in intact tumors, activates de novo lipogenesis is cancer cells, helps them to thrive under these conditions and makes them more vulnerable to lipogenesis inhibitors. These observations have important implications for the design of new antineoplastic strategies targeting

  8. Rewiring the reductive tricarboxylic acid pathway and L-malate transport pathway of Aspergillus oryzae for overproduction of L-malate.

    PubMed

    Liu, Jingjing; Xie, Zhipeng; Shin, Hyun-Dong; Li, Jianghua; Du, Guocheng; Chen, Jian; Liu, Long

    2017-07-10

    Aspergillus oryzae finds wide application in the food, feed, and wine industries, and is an excellent cell factory platform for production of organic acids. In this work, we achieved the overproduction of L-malate by rewiring the reductive tricarboxylic acid (rTCA) pathway and L-malate transport pathway of A. oryzae NRRL 3488. First, overexpression of native pyruvate carboxylase and malate dehydrogenase in the rTCA pathway improved the L-malate titer from 26.1gL(-1) to 42.3gL(-1) in shake flask culture. Then, the oxaloacetate anaplerotic reaction was constructed by heterologous expression of phosphoenolpyruvate carboxykinase and phosphoenolpyruvate carboxylase from Escherichia coli, increasing the L-malate titer to 58.5gL(-1). Next, the export of L-malate from the cytoplasm to the external medium was strengthened by overexpression of a C4-dicarboxylate transporter gene from A. oryzae and an L-malate permease gene from Schizosaccharomyces pombe, improving the L-malate titer from 58.5gL(-1) to 89.5gL(-1). Lastly, guided by transcription analysis of the expression profile of key genes related to L-malate synthesis, the 6-phosphofructokinase encoded by the pfk gene was identified as a potential limiting step for L-malate synthesis. Overexpression of pfk with the strong sodM promoter increased the L-malate titer to 93.2gL(-1). The final engineered A. oryzae strain produced 165gL(-1) L-malate with a productivity of 1.38gL(-1)h(-1) in 3-L fed-batch culture. Overall, we constructed an efficient L-malate producer by rewiring the rTCA pathway and L-malate transport pathway of A. oryzae NRRL 3488, and the engineering strategy adopted here may be useful for the construction of A. oryzae cell factories to produce other organic acids. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. A distinct pathway for tetrahymanol synthesis in bacteria

    PubMed Central

    Banta, Amy B.; Wei, Jeremy H.; Welander, Paula V.

    2015-01-01

    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol. PMID:26483502

  10. A distinct pathway for tetrahymanol synthesis in bacteria

    NASA Astrophysics Data System (ADS)

    Banta, Amy B.; Wei, Jeremy H.; Welander, Paula V.

    2015-11-01

    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol.

  11. Dietary omega-3 fatty acid supplementation increases the rate of muscle protein synthesis in older adults: a randomized controlled trial.

    PubMed

    Smith, Gordon I; Atherton, Philip; Reeds, Dominic N; Mohammed, B Selma; Rankin, Debbie; Rennie, Michael J; Mittendorfer, Bettina

    2011-02-01

    Loss of muscle mass with aging is a major public health concern. Omega-3 (n-3) fatty acids stimulate protein anabolism in animals and might therefore be useful for the treatment of sarcopenia. However, the effect of omega-3 fatty acids on human protein metabolism is unknown. The objective of this study was to evaluate the effect of omega-3 fatty acid supplementation on the rate of muscle protein synthesis in older adults. Sixteen healthy, older adults were randomly assigned to receive either omega-3 fatty acids or corn oil for 8 wk. The rate of muscle protein synthesis and the phosphorylation of key elements of the anabolic signaling pathway were evaluated before and after supplementation during basal, postabsorptive conditions and during a hyperaminoacidemic-hyperinsulinemic clamp. Corn oil supplementation had no effect on the muscle protein synthesis rate and the extent of anabolic signaling element phosphorylation in muscle. Omega-3 fatty acid supplementation had no effect on the basal rate of muscle protein synthesis (mean ± SEM: 0.051 ± 0.005%/h compared with 0.053 ± 0.008%/h before and after supplementation, respectively; P = 0.80) but augmented the hyperaminoacidemia-hyperinsulinemia-induced increase in the rate of muscle protein synthesis (from 0.009 ± 0.005%/h above basal values to 0.031 ± 0.003%/h above basal values; P < 0.01), which was accompanied by greater increases in muscle mTOR(Ser2448) (P = 0.08) and p70s6k(Thr389) (P < 0.01) phosphorylation. Omega-3 fatty acids stimulate muscle protein synthesis in older adults and may be useful for the prevention and treatment of sarcopenia. This trial was registered at clinical trials.gov as NCT00794079.

  12. Regulation of protein degradation pathways by amino acids and insulin in skeletal muscle of neonatal pigs

    USDA-ARS?s Scientific Manuscript database

    The rapid gain in lean mass in neonates requires greater rates of protein synthesis than degradation. We previously delineated the molecular mechanisms by which insulin and amino acids, especially leucine, modulate skeletal muscle protein synthesis and how this changes with development. In the curre...

  13. Determination of key enzymes for threonine synthesis through in vitro metabolic pathway analysis.

    PubMed

    Zhang, Yanfei; Meng, Qinglong; Ma, Hongwu; Liu, Yongfei; Cao, Guoqiang; Zhang, Xiaoran; Zheng, Ping; Sun, Jibin; Zhang, Dawei; Jiang, Wenxia; Ma, Yanhe

    2015-06-13

    The overexpression of key enzymes in a metabolic pathway is a frequently used genetic engineering strategy for strain improvement. Metabolic control analysis has been proposed to quantitatively determine key enzymes. However, the lack of quality data often makes it difficult to correctly identify key enzymes through control analysis. Here, we proposed a method combining in vitro metabolic pathway analysis and proteomics measurement to find the key enzymes in threonine synthesis pathway. All enzymes in the threonine synthesis pathway were purified for the reconstruction and perturbation of the in vitro pathway. Label-free proteomics technology combined with APEX (absolute protein expression measurements) data analysis method were employed to determine the absolute enzyme concentrations in the crude enzyme extract obtained from a threonine production strain during the fastest threonine production period. The flux control coefficient of each enzyme in the pathway was then calculated by measuring the flux changes after titration of the corresponding enzyme. The isoenzyme LysC catalyzing the first step in the pathway has the largest flux control coefficient, and thus its concentration change has the biggest impact on pathway flux. To verify that the key enzyme identified through in vitro pathway analysis is also the key enzyme in vivo, we overexpressed LysC in the original threonine production strain. Fermentation results showed that the threonine concentration was increased 30% and the yield was increased 20%. In vitro metabolic pathways simulating in vivo cells can be built based on precise measurement of enzyme concentrations through proteomics technology and used for the determination of key enzymes through metabolic control analysis. This provides a new way to find gene overexpression targets for industrial strain improvement.

  14. Evidence for transport intermediates in aromatic amino acid synthesis of non-green tissues

    SciTech Connect

    Leuschner, C.; Schultz, G. )

    1990-05-01

    Quinate (QA) is the predominant pre-aromatic compound formed at high rates in leaves of many plants at the early vegetation stage and transported through the phloem. The transfer of 3-dehydroquinate, 3-dehydroshikimate and (SkA) across the plastidial membranes has been evidenced. The question was whether the rate of QA uptake is comparable to that of the 3 SkA-pathway intermediates. To demonstrate this, /U-{sup 14}C/QA and /U-{sup 14}C/SkA were applied to Brassica rapa roots. Both compounds were uptaken at considerable rates and incorporated into aromatic amino acids (Phe + Tyr + Trp formation, in nmol/g fresh wt x h: applying 145 {mu}mol QA: 21.2; applying 156 {mu}mol Ska: 31.8). Thus, QA is a possible candidate for transport into non-green tissues for aromatic amino acid synthesis.

  15. Convergent and stereospecific synthesis of complex skipped polyenes and polyunsaturated fatty acids.

    PubMed

    Macklin, Todd K; Micalizio, Glenn C

    2010-08-01

    Skipped polyenes (that is, 1,4-dienes and higher homologues) are stereodefined components of a vast array of biologically important natural products, including polyunsaturated fatty acids. Although widespread in nature, these architectures are generally considered to represent significant barriers to efficient chemical synthesis. Partial reduction of skipped poly-ynes provides a pathway to a subset of such structures, but general chemical methods for the preparation of skipped polyenes that contain varied stereochemistries and substitution patterns are lacking. Here, we describe a metal-promoted reductive cross-coupling reaction between vinylcyclopropanes and alkynes (or vinylsilanes) that provides stereoselective access to a diverse array of skipped polyenes through a process that establishes one C-C bond, generates up to three stereodefined alkenes, and can be used to introduce stereogenic centres at the central positions of the skipped polyene motif. We also demonstrate the significance of the present bond construction by preparing substituted and stereodefined polyunsaturated synthetic fatty acids.

  16. Synthesis and pro-apoptotic activity of novel glycyrrhetinic acid derivatives.

    PubMed

    Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A

    2011-03-21

    Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives

    PubMed Central

    Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A

    2011-01-01

    Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513

  18. Ursolic Acid Inhibits Adipogenesis in 3T3-L1 Adipocytes through LKB1/AMPK Pathway

    PubMed Central

    He, Yonghan; Li, Ying; Zhao, Tiantian; Wang, Yanwen; Sun, Changhao

    2013-01-01

    Background Ursolic acid (UA) is a triterpenoid compound with multiple biological functions. This compound has recently been reported to possess an anti-obesity effect; however, the mechanisms are less understood. Objective As adipogenesis plays a critical role in obesity, the present study was conducted to investigate the effect of UA on adipogenesis and mechanisms of action in 3T3-L1 preadipocytes. Methods and Results The 3T3-L1 preadipocytes were induced to differentiate in the presence or absence of UA for 6 days. The cells were determined for proliferation, differentiation, fat accumulation as well as the protein expressions of molecular targets that regulate or are involved in fatty acid synthesis and oxidation. The results demonstrated that ursolic acid at concentrations ranging from 2.5 µM to 10 µM dose-dependently attenuated adipogenesis, accompanied by reduced protein expression of CCAAT element binding protein β (C/EBPβ), peroxisome proliferator-activated receptor γ (PPARγ), CCAAT element binding protein α (C/EBPα) and sterol regulatory element binding protein 1c (SREBP-1c), respectively. Ursolic acid increased the phosphorylation of acetyl-CoA carboxylase (ACC) and protein expression of carnitine palmitoyltransferase 1 (CPT1), but decreased protein expression of fatty acid synthase (FAS) and fatty acid-binding protein 4 (FABP4). Ursolic acid increased the phosphorylation of AMP-activated protein kinase (AMPK) and protein expression of (silent mating type information regulation 2, homolog) 1 (Sirt1). Further studies demonstrated that the anti-adipogenic effect of UA was reversed by the AMPK siRNA, but not by the Sirt1 inhibitor nicotinamide. Liver kinase B1 (LKB1), the upstream kinase of AMPK, was upregulated by UA. When LKB1 was silenced with siRNA or the inhibitor radicicol, the effect of UA on AMPK activation was diminished. Conclusions Ursolic acid inhibited 3T3-L1 preadipocyte differentiation and adipogenesis through the LKB1/AMPK pathway

  19. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  20. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  1. Synthesis of teichoic acid by Bacillus subtilis protoplasts.

    PubMed Central

    Bertram, K C; Hancock, I C; Baddiley, J

    1981-01-01

    Protoplasts of Bacillus subtilis W23 readily synthesized ribitol teichoic acid from nucleotide precursors in the surrounding medium. With cytidine diphosphate-ribitol they made poly(ribitol phosphate), presumably attached to lipoteichoic acid carrier; when cytidine diphosphate-glycerol and uridine diphosphate-N-acetylglucosamine were also present a 10-fold increase in the rate of polymer synthesis occurred, and the product contained both the main chain and the linkage unit. Synthesis was inhibited by trypsin or p-chloromercuribenzenesulfonate in the medium, and we concluded that it occurred at the outer surface of the membrane. During synthesis, which was also achieved readily by whole cells after a brief period of wall lysis, the cytidine phosphate portion of the nucleotide precursors did not pass through the membrane. No evidence could be obtained for a transphosphorylation mechanism for the translocation process. It is suggested that reaction with exogenous substrates was due to temporary exposure of a protein component of the enzyme complex at the outer surface of the membrane during the normal biosynthetic cycle. PMID:6271728

  2. The aspartate-family pathway of plants: linking production of essential amino acids with energy and stress regulation.

    PubMed

    Galili, Gad

    2011-02-01

    The Asp family pathway of plants is highly important from a nutritional standpoint because it leads to the synthesis of the four essential amino acids Lys, Thr, Met and Ile. These amino acids are not synthesized by human and its monogastric livestock and should be supplemented in their diets. Among the Asp-family amino acids, Lys is considered as the nutritionally most important essential amino acid because its level is most limiting in cereal grains, representing the largest source of plant foods and feeds worldwide. Metabolic engineering approaches led to significant increase in Lys level in seeds by enhancing its synthesis and reducing its catabolism. However, results from the model plant Arabidopsis showed that this approach may retard seed germination due to a major negative effect on the levels of a number of TCA cycle metabolites that associate with cellular energy. In the present review, we discuss the regulatory metabolic link of the Asp-family pathway with the TCA cycle and its biological significance upon exposure to stress conditions that cause energy deprivation. In addition, we also discuss how deep understanding of the regulatory metabolic link of the Asp-family pathway with energy and stress regulation can be used to improve Lys level in seeds of important crop species, minimizing the interference with the cellular energy status and plant-stress interaction. This review thus provides an example showing how deep understanding the inter-regulation of metabolism with plant stress physiology can lead to successful nutritional improvements with minimal negative effect on plant growth and response to stressful environments.

  3. Decreased mTOR signaling pathway in human idiopathic autism and in rats exposed to valproic acid.

    PubMed

    Nicolini, Chiara; Ahn, Younghee; Michalski, Bernadeta; Rho, Jong M; Fahnestock, Margaret

    2015-01-20

    The molecular mechanisms underlying autistic behaviors remain to be elucidated. Mutations in genes linked to autism adversely affect molecules regulating dendritic spine formation, function and plasticity, and some increase the mammalian target of rapamycin, mTOR, a regulator of protein synthesis at spines. Here, we investigated whether the Akt/mTOR pathway is disrupted in idiopathic autism and in rats exposed to valproic acid, an animal model exhibiting autistic-like behavior. Components of the mTOR pathway were assayed by Western blotting in postmortem fusiform gyrus samples from 11 subjects with idiopathic autism and 13 controls and in valproic acid versus saline-exposed rat neocortex. Additionally, protein levels of brain-derived neurotrophic factor receptor (TrkB) isoforms and the postsynaptic organizing molecule PSD-95 were measured in autistic versus control subjects. Full-length TrkB, PI3K, Akt, phosphorylated and total mTOR, p70S6 kinase, eIF4B and PSD-95 were reduced in autistic versus control fusiform gyrus. Similarly, phosphorylated and total Akt, mTOR and 4E-BP1 and phosphorylated S6 protein were decreased in valproic acid- versus saline-exposed rats. However, no changes in 4E-BP1 or eIF4E were found in autistic brains. In contrast to some monogenic disorders with high rates of autism, our data demonstrate down-regulation of the Akt/mTOR pathway, specifically via p70S6K/eIF4B, in idiopathic autism. These findings suggest that disruption of this pathway in either direction is widespread in autism and can have adverse consequences for synaptic function. The use of valproic acid, a histone deacetylase inhibitor, in rats successfully modeled these changes, implicating an epigenetic mechanism in these pathway disruptions.

  4. Amino acids trigger down-regulation of superoxide via TORC pathway in the midgut of Rhodnius prolixus

    PubMed Central

    Gandara, Ana Caroline P.; Oliveira, José Henrique M.; Nunes, Rodrigo D.; Goncalves, Renata L.S.; Dias, Felipe A.; Hecht, Fabio; Fernandes, Denise C.; Genta, Fernando A.; Laurindo, Francisco R.M.; Oliveira, Marcus F.; Oliveira, Pedro L.

    2016-01-01

    Sensing incoming nutrients is an important and critical event for intestinal cells to sustain life of the whole organism. The TORC is a major protein complex involved in monitoring the nutritional status and is activated by elevated amino acid concentrations. An important feature of haematophagy is that huge amounts of blood are ingested in a single meal, which results in the release of large quantities of amino acids, together with the haemoglobin prosthetic group, haem, which decomposes hydroperoxides and propagates oxygen-derived free radicals. Our previous studies demonstrated that reactive oxygen species (ROS) levels were diminished in the mitochondria and midgut of the Dengue fever mosquito, Aedes aegypti, immediately after a blood meal. We proposed that this mechanism serves to avoid oxidative damage that would otherwise be induced by haem following a blood meal. Studies also performed in mosquitoes have shown that blood or amino acids controls protein synthesis through TORC activation. It was already proposed, in different models, a link between ROS and TOR, however, little is known about TOR signalling in insect midgut nor about the involvement of ROS in this pathway. Here, we studied the effect of a blood meal on ROS production in the midgut of Rhodnius prolixus. We observed that blood meal amino acids decreased ROS levels in the R. prolixus midgut immediately after feeding, via lowering mitochondrial superoxide production and involving the amino acid-sensing TORC pathway. PMID:26945025

  5. Facile synthesis of glycosylated Fmoc amino acid building blocks assisted by microwave irradiation.

    PubMed

    Yao, Nianhuan; Fung, Gabriel; Malekan, Hamed; Ye, Long; Kurth, Mark J; Lam, Kit S

    2010-10-13

    The synthesis of glycosylated Fmoc amino acids by reaction of mono- and disaccharide peracetates with Fmoc amino acids having free carboxyl groups was rapidly promoted by Lewis acids (SnCl(4), BF(3)·Et(2)O) under microwave irradiation. The products are useful building blocks for the synthesis of glycopeptides. Copyright © 2010 Elsevier Ltd. All rights reserved.

  6. The effect of eicosapentaenoic and docosahexaenoic acid on protein synthesis and breakdown in murine C2C12 myotubes

    SciTech Connect

    Kamolrat, Torkamol; Gray, Stuart R.

    2013-03-22

    Highlights: ► EPA can enhance protein synthesis and retard protein breakdown in muscle cells. ► These effects were concurrent with increases in p70s6k and FOXO3a phosphorylation. ► EPA may be a useful tool in the treatment of muscle wasting conditions. -- Abstract: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been found to stimulate protein synthesis with little information regarding their effects on protein breakdown. Furthermore whether there are distinct effects of EPA and DHA remains to be established. The aim of the current study was to determine the distinct effects of EPA and DHA on protein synthesis, protein breakdown and signalling pathways in C2C12 myotubes. Fully differentiated C2C12 cells were incubated for 24 h with 0.1% ethanol (control), 50 μM EPA or 50 μM DHA prior to experimentation. After serum (4 h) and amino acid (1 h) starvation cells were stimulated with 2 mM L-leucine and protein synthesis measured using {sup 3}H-labelled phenylalanine. Protein breakdown was measured using {sup 3}H-labelled phenylalanine and signalling pathways (Akt, mTOR, p70S6k, 4EBP1, rps6 and FOXO3a) via Western blots. Data revealed that after incubation with EPA protein synthesis was 25% greater (P < 0.05) compared to control cells, with no effect of DHA. Protein breakdown was 22% (P < 0.05) lower, compared to control cells, after incubation with EPA, with no effect of DHA. Analysis of signalling pathways revealed that both EPA and DHA incubation increased (P < 0.05) p70s6k phosphorylation, EPA increased (P < 0.05) FOXO3a phosphorylation, with no alteration in other signalling proteins. The current study has demonstrated distinct effects of EPA and DHA on protein metabolism with EPA showing a greater ability to result in skeletal muscle protein accretion.

  7. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  8. 2-Keto acids based biosynthesis pathways for renewable fuels and chemicals.

    PubMed

    Tashiro, Yohei; Rodriguez, Gabriel M; Atsumi, Shota

    2015-03-01

    Global energy and environmental concerns have driven the development of biological chemical production from renewable sources. Biological processes using microorganisms are efficient and have been traditionally utilized to convert biomass (i.e., glucose) to useful chemicals such as amino acids. To produce desired fuels and chemicals with high yield and rate, metabolic pathways have been enhanced and expanded with metabolic engineering and synthetic biology approaches. 2-Keto acids, which are key intermediates in amino acid biosynthesis, can be converted to a wide range of chemicals. 2-Keto acid pathways were engineered in previous research efforts and these studies demonstrated that 2-keto acid pathways have high potential for novel metabolic routes with high productivity. In this review, we discuss recently developed 2-keto acid-based pathways.

  9. Deciphering the roles of Arabidopsis LPCAT and PAH in phosphatidylcholine homeostasis and pathway coordination for chloroplast lipid synthesis.

    PubMed

    Wang, Liping; Kazachkov, Michael; Shen, Wenyun; Bai, Mei; Wu, Hong; Zou, Jitao

    2014-12-01

    Phosphatidylcholine (PC) is a key intermediate in the metabolic network of glycerolipid biosynthesis. Lysophosphatidylcholine acyltransferase (LPCAT) and phosphatidic acid phosphatase (PAH) are two key enzymes of PC homeostasis. We report that LPCAT activity is markedly induced in the Arabidopsis pah mutant. The quadruple pah lpcat mutant, with dual defects in PAH and LPCAT, had a level of lysophosphatidylcholine (LPC) that was much higher than that in the lpcat mutants and a PC content that was higher than that in the pah mutant. Comparative molecular profile analysis of monogalactosyldiacylglycerol and digalactosyldiacylglycerol revealed that both the pah and pah lpcat mutants had increased proportions of 34:6 from the prokaryotic pathway despite differing levels of LPCAT activity. We show that a decreased representation of the C16:0 C18:2 diacylglycerol moiety in PC was a shared feature of pah and pah lpcat, and that this change in PC metabolic profile correlated with the increased prokaryotic contribution to chloroplast lipid synthesis. We detected increased PC deacylation in the pah lpcat mutant that was attributable at least in part to the induced phospholipases. Increased LPC generation was also evident in the pah mutant, but the phospholipases were not induced, raising the possibility that PC deacylation is mediated by the reverse reaction of LPCAT. We discuss possible roles of LPCAT and PAH in PC turnover that impacts lipid pathway coordination for chloroplast lipid synthesis.

  10. Mining Enzyme Diversity of Transcriptome Libraries through DNA Synthesis for Benzylisoquinoline Alkaloid Pathway Optimization in Yeast.

    PubMed

    Narcross, Lauren; Bourgeois, Leanne; Fossati, Elena; Burton, Euan; Martin, Vincent J J

    2016-12-16

    The ever-increasing quantity of data deposited to GenBank is a valuable resource for mining new enzyme activities. Falling costs of DNA synthesis enables metabolic engineers to take advantage of this resource for identifying superior or novel enzymes for pathway optimization. Previously, we reported synthesis of the benzylisoquinoline alkaloid dihydrosanguinarine in yeast from norlaudanosoline at a molar conversion of 1.5%. Molar conversion could be improved by reduction of the side-product N-methylcheilanthifoline, a key bottleneck in dihydrosanguinarine biosynthesis. Two pathway enzymes, an N-methyltransferase and a cytochrome P450 of the CYP719A subfamily, were implicated in the synthesis of the side-product. Here, we conducted an extensive screen to identify enzyme homologues whose coexpression reduces side-product synthesis. Phylogenetic trees were generated from multiple sources of sequence data to identify a library of candidate enzymes that were purchased codon-optimized and precloned into expression vectors designed to facilitate high-throughput analysis of gene expression as well as activity assay. Simple in vivo assays were sufficient to guide the selection of superior enzyme homologues that ablated the synthesis of the side-product, and improved molar conversion of norlaudanosoline to dihydrosanguinarine to 10%.

  11. Single-step pathway for synthesis of glucosylglycerate in Persephonella marina.

    PubMed

    Fernandes, Chantal; Empadinhas, Nuno; da Costa, Milton S

    2007-06-01

    A single-step pathway for the synthesis of the compatible solute glucosylglycerate (GG) is proposed based on the activity of a recombinant glucosylglycerate synthase (Ggs) from Persephonella marina. The corresponding gene encoded a putative glycosyltransferase that was part of an operon-like structure which also contained the genes for glucosyl-3-phosphoglycerate synthase (GpgS) and glucosyl-3-phosphoglycerate phosphatase (GpgP), the enzymes that lead to the synthesis of GG through the formation of glucosyl-3-phosphoglycerate. The putative glucosyltransferase gene was expressed in Escherichia coli, and the recombinant product catalyzed the synthesis of GG in one step from ADP-glucose and d-glycerate, with K(m) values at 70 degrees C of 1.5 and 2.2 mM, respectively. This glucosylglycerate synthase (Ggs) was also able to use GDP- and UDP-glucose as donors to form GG, but the efficiencies were lower. Maximal activity was observed at temperatures between 80 and 85 degrees C, and Mg(2+) or Ca(2+) was required for catalysis. Ggs activity was maximal and remained nearly constant at pH values between 5.5 and pH 8.0, and the half-lives for inactivation were 74 h at 85 degrees C and 8 min at 100 degrees C. This is the first report of an enzyme catalyzing the synthesis of GG in one step and of the existence of two pathways for GG synthesis in the same organism.

  12. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  13. Activity-induced convergence of APP and BACE-1 in acidic microdomains via an endocytosis-dependent pathway.

    PubMed

    Das, Utpal; Scott, David A; Ganguly, Archan; Koo, Edward H; Tang, Yong; Roy, Subhojit

    2013-08-07

    The convergence of APP (substrate) and BACE-1 (enzyme) is a rate-limiting, obligatory event triggering the amyloidogenic pathway-a key step in Alzheimer's disease (AD) pathology. However, as both APP/BACE-1 are highly expressed in brain, mechanisms precluding their unabated convergence are unclear. Exploring dynamic localization of APP/BACE-1 in cultured hippocampal neurons, we found that after synthesis via the secretory pathway, dendritic APP/BACE-1-containing vesicles are largely segregated in physiologic states. While BACE-1 is sorted into acidic recycling endosomes, APP is conveyed in Golgi-derived vesicles. However, upon activity induction-a known trigger of the amyloidogenic pathway-APP is routed into BACE-1-positive recycling endosomes via a clathrin-dependent mechanism. A partitioning/convergence of APP/BACE-1 vesicles is also apparent in control/AD brains, respectively. Considering BACE-1 is optimally active in an acidic environment, our experiments suggest that neurons have evolved trafficking strategies that normally limit APP/BACE-1 proximity and also uncover a pathway routing APP into BACE-1-containing organelles, triggering amyloidogenesis.

  14. Activity-induced convergence of APP and BACE-1 in acidic microdomains via an endocytosis-dependent pathway

    PubMed Central

    Das, Utpal; Scott, David; Ganguly, Archan; Koo, Edward H.; Tang, Yong; Roy, Subhojit

    2013-01-01

    The convergence of APP (substrate) and BACE-1 (enzyme) is a rate-limiting, obligatory event triggering the amyloidogenic pathway – a key step in Alzheimer’s disease (AD) pathology. However, as both APP/BACE-1 are highly expressed in brain, mechanisms precluding their unabated convergence are unclear. Exploring dynamic localization of APP/BACE-1 in cultured hippocampal neurons, we found that after synthesis via the secretory-pathway, dendritic APP/BACE-1-containing vesicles are largely segregated in physiologic states. While BACE-1 is largely sorted into acidic recycling endosomes, APP is conveyed in Golgi-derived vesicles. However upon activity-induction – a known trigger of the amyloidogenic pathway – APP is routed into BACE-1-positive recycling endosomes via a clathrin-dependent mechanism. A partitioning/convergence of APP/BACE-1 vesicles is also apparent in control/AD brains respectively. Considering BACE-1 is optimally active in an acidic environment, our experiments suggest that neurons have evolved trafficking strategies that normally limit APP/BACE-1 proximity; and also uncover a pathway routing APP into BACE-1-containing organelles – triggering amyloidogenesis. PMID:23931995

  15. Vitamin B(12) synthesis and salvage pathways were acquired by horizontal gene transfer to the Thermotogales.

    PubMed

    Swithers, Kristen S; Petrus, Amanda K; Secinaro, Michael A; Nesbø, Camilla L; Gogarten, J Peter; Noll, Kenneth M; Butzin, Nicholas C

    2012-01-01

    The availability of genome sequences of Thermotogales species from across the order allows an examination of the evolutionary origins of phenotypic characteristics in this lineage. Several studies have shown that the Thermotogales have acquired large numbers of genes from distantly related lineages, particularly Firmicutes and Archaea. Here, we report the finding that some Thermotogales acquired the ability to synthesize vitamin B(12) by acquiring the requisite genes from these distant lineages. Thermosipho species, uniquely among the Thermotogales, contain genes that encode the means to synthesize vitamin B(12) de novo from glutamate. These genes are split into two gene clusters: the corrinoid synthesis gene cluster, that is unique to the Thermosipho and the cobinamide salvage gene cluster. The corrinoid synthesis cluster was acquired from the Firmicutes lineage, whereas the salvage pathway is an amalgam of bacteria- and archaea-derived proteins. The cobinamide salvage gene cluster has a patchy distribution among Thermotogales species, and ancestral state reconstruction suggests that this pathway was present in the common Thermotogales ancestor. We show that Thermosipho africanus can grow in the absence of vitamin B(12), so its de novo pathway is functional. We detected vitamin B(12) in the extracts of T. africanus cells to verify the synthetic pathway. Genes in T. africanus with apparent B(12) riboswitches were found to be down-regulated in the presence of vitamin B(12) consistent with their roles in B(12) synthesis and cobinamide salvage.

  16. Vitamin B12 Synthesis and Salvage Pathways Were Acquired by Horizontal Gene Transfer to the Thermotogales

    PubMed Central

    Swithers, Kristen S.; Petrus, Amanda K.; Secinaro, Michael A.; Nesbø, Camilla L.; Gogarten, J. Peter; Noll, Kenneth M.; Butzin, Nicholas C.

    2012-01-01

    The availability of genome sequences of Thermotogales species from across the order allows an examination of the evolutionary origins of phenotypic characteristics in this lineage. Several studies have shown that the Thermotogales have acquired large numbers of genes from distantly related lineages, particularly Firmicutes and Archaea. Here, we report the finding that some Thermotogales acquired the ability to synthesize vitamin B12 by acquiring the requisite genes from these distant lineages. Thermosipho species, uniquely among the Thermotogales, contain genes that encode the means to synthesize vitamin B12 de novo from glutamate. These genes are split into two gene clusters: the corrinoid synthesis gene cluster, that is unique to the Thermosipho and the cobinamide salvage gene cluster. The corrinoid synthesis cluster was acquired from the Firmicutes lineage, whereas the salvage pathway is an amalgam of bacteria- and archaea-derived proteins. The cobinamide salvage gene cluster has a patchy distribution among Thermotogales species, and ancestral state reconstruction suggests that this pathway was present in the common Thermotogales ancestor. We show that Thermosipho africanus can grow in the absence of vitamin B12, so its de novo pathway is functional. We detected vitamin B12 in the extracts of T. africanus cells to verify the synthetic pathway. Genes in T. africanus with apparent B12 riboswitches were found to be down-regulated in the presence of vitamin B12 consistent with their roles in B12 synthesis and cobinamide salvage. PMID:22798452

  17. Optimization of UDP-N-acetylmuramic acid synthesis.

    PubMed

    Humljan, J; Starcević, S; Car, V; Stefanic Anderluh, P; Kocjan, D; Jenko, B; Urleb, U

    2008-02-01

    UDP-N-acetylmuramic acid (UDP-MurNAc) is a substrate of MurC, an important enzyme in the intracellular pathway of bacterial peptidoglycan biosynthesis. Various approaches towards preparation of UDP-MurNAc have been published but these synthetic preparations were shown to include many problematic steps. An optimization study with the focus on muramyl phosphate and UMP-morpholidate coupling was performed, resulting in a synthetic procedure enabling robust and easily reproducible production on a multi-gram scale.

  18. Synthesis of a conformationally constrained δ-amino acid building block.

    PubMed

    O'Reilly, Elaine; Pes, Lara; Ortin, Yannick; Müller-Bunz, Helge; Paradisi, Francesca

    2013-02-01

    Conformationally restricted amino acids are important components in peptidomimetics and drug design. Herein, we describe the synthesis of a novel, non-proteinogenic constrained delta amino acid containing a cyclobutane ring, cis-3(aminomethyl)cyclobutane carboxylic acid (ACCA). The synthesis of the target amino acid was achieved in seven steps, with the key reaction being a base induced intramolecular nucleophilic substitution. A small library of dipeptides was prepared through the coupling of ACCA with proteinogenic amino acids.

  19. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  20. Evidence of selection at melanin synthesis pathway loci during silkworm domestication.

    PubMed

    Yu, Hong-Song; Shen, Yi-Hong; Yuan, Gang-Xiang; Hu, Yong-Gang; Xu, Hong-En; Xiang, Zhong-Huai; Zhang, Ze

    2011-06-01

    The domesticated silkworm (Bombyx mori) was domesticated from wild silkworm (Bombyx mandarina) more than 5,000 years ago. During domestication, body color between B. mandarina and B. mori changed dramatically. However, the molecular mechanism of the silkworm body color transition is not known. In the present study, we examined within- and between-species nucleotide diversity for eight silkworm melanin synthesis pathway genes, which play a key role in cuticular pigmentation of insects. Our results showed that the genetic diversity of B. mori was significantly lower than that of B. mandarina and 40.7% of the genetic diversity of wild silkworm was lost in domesticated silkworm. We also examined whether position effect exists among melanin synthesis pathway genes in B. mandarina and B. mori. We found that the upstream genes have significantly lower levels of genetic diversity than the downstream genes, supporting a functional constraint hypothesis (FCH) of metabolic pathway, that is, upstream enzymes are under greater selective constraint than downstream enzymes because upstream enzymes participate in biosynthesis of a number of metabolites. We also investigated whether some of the melanin synthesis pathway genes experienced selection during domestication. Neutrality test, coalescent simulation, as well as network and phylogenetic analyses showed that tyrosine hydroxylase (TH) gene was a domestication locus. Sequence analysis further suggested that a putative expression enhancer (Abd-B-binding site) in the intron of TH gene might be disrupted during domestication. TH is the rate-limiting enzyme of melanin synthesis pathway in insects. Real-time polymerase chain reaction assay did show that the relative expression levels of TH gene in B. mori were significantly lower than that in B. mandarina at three different developmental stages, which is consistent with light body color of domesticated silkworm relative to wild silkworm. Therefore, we speculated that expression

  1. Liver glyconeogenesis: a pathway to cope with postprandial amino acid excess in high-protein fed rats?

    PubMed

    Azzout-Marniche, Dalila; Gaudichon, Claire; Blouet, Clémence; Bos, Cécile; Mathé, Véronique; Huneau, Jean-François; Tomé, Daniel

    2007-04-01

    This paper provides molecular evidence for a liver glyconeogenic pathway, that is, a concomitant activation of hepatic gluconeogenesis and glycogenesis, which could participate in the mechanisms that cope with amino acid excess in high-protein (HP) fed rats. This evidence is based on the concomitant upregulation of phosphoenolpyruvate carboxykinase (PEPCK) gene expression, downregulation of glucose 6-phosphatase catalytic subunit (G6PC1) gene expression, an absence of glucose release from isolated hepatocytes and restored hepatic glycogen stores in the fed state in HP fed rats. These effects are mainly due to the ability of high physiological concentrations of portal blood amino acids to counteract glucagon-induced liver G6PC1 but not PEPCK gene expression. These results agree with the idea that the metabolic pathway involved in glycogen synthesis is dependent upon the pattern of nutrient availability. This nonoxidative glyconeogenic disposal pathway of gluconeogenic substrates copes with amino excess and participates in adjusting both amino acid and glucose homeostasis. In addition, the pattern of PEPCK and G6PC1 gene expression provides evidence that neither the kidney nor the small intestine participated in gluconeogenic glucose production under our experimental conditions. Moreover, the main glucose-6-phosphatase (G6Pase) isoform expressed in the small intestine is the ubiquitous isoform of G6Pase (G6PC3) rather than the G6PC1 isoform expressed in gluconeogenic organs.

  2. The shikimate pathway: review of amino acid sequence, function and three-dimensional structures of the enzymes.

    PubMed

    Mir, Rafia; Jallu, Shais; Singh, T P

    2015-06-01

    The aromatic compounds such as aromatic amino acids, vitamin K and ubiquinone are important prerequisites for the metabolism of an organism. All organisms can synthesize these aromatic metabolites through shikimate pathway, except for mammals which are dependent on their diet for these compounds. The pathway converts phosphoenolpyruvate and erythrose 4-phosphate to chorismate through seven enzymatically catalyzed steps and chorismate serves as a precursor for the synthesis of variety of aromatic compounds. These enzymes have shown to play a vital role for the viability of microorganisms and thus are suggested to present attractive molecular targets for the design of novel antimicrobial drugs. This review focuses on the seven enzymes of the shikimate pathway, highlighting their primary sequences, functions and three-dimensional structures. The understanding of their active site amino acid maps, functions and three-dimensional structures will provide a framework on which the rational design of antimicrobial drugs would be based. Comparing the full length amino acid sequences and the X-ray crystal structures of these enzymes from bacteria, fungi and plant sources would contribute in designing a specific drug and/or in developing broad-spectrum compounds with efficacy against a variety of pathogens.

  3. Tartaric acid pathways in Vitis vinifera L. (cv. Ugni blanc): a comparative study of two vintages with contrasted climatic conditions.

    PubMed

    Cholet, Céline; Claverol, Stéphane; Claisse, Olivier; Rabot, Amélie; Osowsky, Audrey; Dumot, Vincent; Ferrari, Gerald; Gény, Laurence

    2016-06-28

    The acid component of grape berries, originating in the metabolism of malate and tartrate, the latter being less well-known than the former, is a key factor at play in the microbiological stability of wines destined for distillation. Grape acidity is increasingly affected by climate changes. The ability to compare two vintages with contrasted climatic conditions may contribute to a global understanding of the regulation of acid metabolism and the future consequences for berry composition. The results of the analyses (molecular, protein, enzymatic) of tartrate biosynthesis pathways were compared with the developmental accumulation of tartrate in Ugni blanc grape berries, from floral bud to maturity. The existence of two distinct steps during this pathway was confirmed: one prior to ascorbate, with phases of VvGME, VvVTC2, VvVTC4, VvL-GalDH, VvGLDH gene expression and abundant protein, different for each vintage; the other downstream of ascorbate, leading to the synthesis of tartrate with maximum VvL-IdnDH genetic and protein expression towards the beginning of the growth process, and in correlation with enzyme activity regardless of the vintage. Overall results suggest that the two steps of this pathway do not appear to be regulated in the same way and could both be activated very early on during berry development.

  4. Synthesis and properties of fatty acid starch esters.

    PubMed

    Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik

    2013-10-15

    Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Stereoselective synthesis of uridine-derived nucleosyl amino acids.

    PubMed

    Spork, Anatol P; Wiegmann, Daniel; Granitzka, Markus; Stalke, Dietmar; Ducho, Christian

    2011-12-16

    Novel hybrid structures of 5'-deoxyuridine and glycine were conceived and synthesized. Such nucleosyl amino acids (NAAs) represent simplified analogues of the core structure of muraymycin nucleoside antibiotics, making them useful synthetic building blocks for structure-activity relationship (SAR) studies. The key step of the developed synthetic route was the efficient and highly diastereoselective asymmetric hydrogenation of didehydro amino acid precursors toward protected NAAs. It was anticipated that the synthesis of unprotected muraymycin derivatives via this route would require a suitable intermediate protecting group at the N-3 of the uracil base. After initial attempts using PMB- and BOM-N-3 protection, both of which resulted in problematic deprotection steps, an N-3 protecting group-free route was envisaged. In spite of the pronounced acidity of the uracil-3-NH, this route worked equally efficient and with identical stereoselectivities as the initial strategies involving N-3 protection. The obtained NAA building blocks were employed for the synthesis of truncated 5'-deoxymuraymycin analogues.

  6. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.

    PubMed Central

    Brandl, M T; Lindow, S E

    1996-01-01

    Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cultures supplemented with L-tryptophan. The deduced amino acid sequence of the gene product has high similarity to that of the indolepyruvate decarboxylase of Enterobacter cloacae. Regions within pyruvate decarboxylases of various fungal and plant species also exhibited considerable homology to portions of this gene. This gene therefore presumably encodes an indolepyruvate decarboxylase (IpdC) which catalyzes the conversion of indole-3-pyruvic acid to indole-3-acetaldehyde. Insertions of Tn3-spice within ipdC abolished the ability of strain 299R to synthesize indole-3-acetaldehyde and tryptophol and reduced its IAA production in tryptophan-supplemented minimal medium by approximately 10-fold, thus providing genetic evidence for the role of the indolepyruvate pathway in IAA synthesis in this strain. An ipdC probe hybridized strongly with the genomic DNA of all E. herbicola strains tested in Southern hybridization studies, suggesting that the indolepyruvate pathway is common in this species. Maximum parsimony analysis revealed that the ipdC gene is highly conserved within this group and that strains of diverse geographic origin were very similar with respect to ipdC. PMID:8900003

  7. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    USDA-ARS?s Scientific Manuscript database

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  8. Fatty acid synthesis and generation of glycerol-3-phosphate in brown adipose tissue from rats fed a cafeteria diet.

    PubMed

    Chaves, Valéria E; Frasson, Danúbia; Martins-Santos, Maria E S; Navegantes, Luiz C C; Galban, Victor D; Garófalo, Maria A R; Kettelhut, Isis C; Migliorini, Renato H

    2008-07-01

    In vivo fatty acid synthesis and the pathways of glycerol-3-phosphate (G3P) production were investigated in brown adipose tissue (BAT) from rats fed a cafeteria diet for 3 weeks. In spite of BAT activation, the diet promoted an increase in the carcass fatty acid content. Plasma insulin levels were markedly increased in cafeteria diet-fed rats. Two insulin-sensitive processes, in vivo fatty acid synthesis and in vivo glucose uptake (which was used to evaluate G3P generation via glycolysis) were increased in BAT from rats fed the cafeteria diet. Direct glycerol phosphorylation, evaluated by glycerokinase (GyK) activity and incorporation of [U-14C]glycerol into triacylglycerol (TAG)-glycerol, was also markedly increased in BAT from these rats. In contrast, the cafeteria diet induced a marked reduction of BAT glyceroneogenesis, evaluated by phosphoenolpyruvate carboxykinase-C activity and incorporation of [1-14C]pyruvate into TAG-glycerol. BAT denervation resulted in an approximately 50% reduction of GyK activity, but did not significantly affect BAT in vivo fatty acid synthesis, in vivo glucose uptake, or glyceroneogenesis. The data suggest that the supply of G3P for BAT TAG synthesis can be adjusted independently from the sympathetic nervous system and solely by reciprocal changes in the generation of G3P via glycolysis and via glyceroneogenesis, with no participation of direct phosphorylation of glycerol by GyK.

  9. Perspective: The Potential Role of Essential Amino Acids and the Mechanistic Target of Rapamycin Complex 1 (mTORC1) Pathway in the Pathogenesis of Child Stunting123

    PubMed Central

    Semba, Richard D; Trehan, Indi; Gonzalez-Freire, Marta; Kraemer, Klaus; Moaddel, Ruin; Ordiz, M Isabel; Ferrucci, Luigi; Manary, Mark J

    2016-01-01

    Stunting is the best summary measure of chronic malnutrition in children. Approximately one-quarter of children under age 5 worldwide are stunted. Lipid-based or micronutrient supplementation has little to no impact in reducing stunting, which suggests that other critical dietary nutrients are missing. A dietary pattern of poor-quality protein is associated with stunting. Stunted children have significantly lower circulating essential amino acids than do nonstunted children. Inadequate dietary intakes of essential amino acids could adversely affect growth, because amino acids are required for synthesis of proteins. The master growth regulation pathway, the mechanistic target of rapamycin complex 1 (mTORC1) pathway, is exquisitely sensitive to amino acid availability. mTORC1 integrates cues such as nutrients, growth factors, oxygen, and energy to regulate growth of bone, skeletal muscle, nervous system, gastrointestinal tract, hematopoietic cells, immune effector cells, organ size, and whole-body energy balance. mTORC1 represses protein and lipid synthesis and cell and organismal growth when amino acids are deficient. Over the past 4 decades, the main paradigm for child nutrition in developing countries has been micronutrient malnutrition, with relatively less attention paid to protein. In this Perspective, we present the view that essential amino acids and the mTORC1 pathway play a key role in child growth. The current assumption that total dietary protein intake is adequate for growth among most children in developing countries needs re-evaluation. PMID:27633102

  10. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Muricholic bile acids are potent regulators of bile acid synthesis via a positive feedback mechanism.

    PubMed

    Hu, X; Bonde, Y; Eggertsen, G; Rudling, M

    2014-01-01

    Bile acid (BA) synthesis is regulated by negative feedback end-product inhibition, initiated by farnesoid X receptors (FXRs) in liver and gut. Studies on cholic acid (CA)-free Cyp8b1(-/-) mice have concluded that CA is a potent suppressor of BA synthesis. Cyp8b1(-/-) mice have increased BA synthesis and an enlarged BA pool, a phenotype shared with bile-duct-ligated, antibiotics-administered and with germ-free mice. Studies on such mice have concluded BA synthesis is induced due to reduced hormonal signalling by fibroblast growth factor (FGF)15 from intestine to liver. A mutual finding in these models is that potent FXR-agonistic BAs are reduced. We hypothesized that the absence of the potent FXR agonist deoxycholic acid (DCA) may be important for the induction of BA synthesis in these situations. Two of these models were investigated, antibiotic treatment and Cyp8b1(-/-) mice and their combination. Secondary BA formation was inhibited by ampicillin (AMP) given to wild-type and Cyp8b1(-/-) mice. We then administered CA, chenodeoxycholic acid (CDCA) or DCA to AMP-treated Cyp8b1(-/-) mice. Our data show that the phenotype of AMP-treated wild-type mice resembles that of Cyp8b1(-/-) mice with fourfold induced Cyp7a1 expression, increased intestinal apical sodium-dependent BA transporter expression and increased hepatic BA levels. We also show that reductions in the FXR-agonistic BAs CDCA, CA, DCA or lithocholic acid cannot explain this phenotype; instead, it is likely due to increases in levels of α- and β-muricholic BAs and ursodeoxycholic acid, three FXR-antagonistic BAs. Our findings reveal a potent positive feedback mechanism for regulation of BA synthesis in mice that appears to be sufficient without endocrine effects of FGF15 on Cyp7a1. This mechanism will be fundamental in understanding BA metabolism in both mice and humans. © 2013 The Association for the Publication of the Journal of Internal Medicine.

  12. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  13. Glycogen synthesis in liver and skeletal muscle after exercise: participation of the gluconeogenic pathway

    SciTech Connect

    Johnson, J.L.

    1986-01-01

    Hepatic glycogenesis occurs by both the uptake of plasma glucose (direct pathway) as well as from gluconeogenesis (indirect pathway). In vitro studies suggest that skeletal muscle can also synthesize glycogen from lactate. The purpose of the present studies was to assess the contribution of the indirect pathway to liver and muscle glycogen synthesis after exercise with various substrata infusions. The authors hypothesis was the contribution of the indirect pathway of hepatic glycogenesis would increase after exercise. To this end, fasted rats were depleted of glycogen by exhaustive exercise; a second group of fasted rats remained rested. Both groups were then infused intravenously with glucose containing tracer quantities of (6-/sup 3/H) and (U-/sup 14/C) glucose for 4 hrs. The ensuing hyperglycemic response was exaggerated in post-exercised rats; whereas, plasma lactate levels were lower than those of nonexercised rats. The percent of hepatic glycogen synthesized from gluconeogenic precursors did not differ between exercised (39%) and nonexercised (36%) rats.

  14. Loss of glycogen debranching enzyme AGL drives bladder tumor growth via induction of hyaluronic acid synthesis

    PubMed Central

    Guin, Sunny; Ru, Yuanbin; Agarwal, Neeraj; Lew, Carolyn R.; Owens, Charles; Comi, Giacomo P.; Theodorescu, Dan

    2015-01-01

    Purpose We demonstrated that Amylo-alpha-1-6-glucosidase-4-alpha-glucanotransferase (AGL) is a tumor growth suppressor and prognostic marker in human bladder cancer. Here we determine how AGL loss enhances tumor growth, hoping to find therapeutically tractable targets/pathways that could be used in patients with low AGL expressing tumors. Experimental Design We transcriptionally profiled bladder cell lines with different AGL expression. By focusing on transcripts overexpressed as a function of low AGL and associated with adverse clinicopathologic variables in human bladder tumors, we sought to increase the chances of discovering novel therapeutic opportunities. Results One such transcript was hyaluronic acid synthase 2 (HAS2), an enzyme responsible for hyaluronic acid (HA) synthesis. HAS2 expression was inversely proportional to that of AGL in bladder cancer cells and immortalized and normal urothelium. HAS2 driven HA synthesis was enhanced in bladder cancer cells with low AGL and this drove anchorage dependent and independent growth. siRNA mediated depletion of HAS2 or inhibition of HA synthesis by 4-Methylumbelliferone (4MU) abrogated in vitro and xenograft growth of bladder cancer cells with low AGL. AGL and HAS2 mRNA expression in human tumors was inversely correlated in patient datasets. Patients with high HAS2 and low AGL tumor mRNA expression had poor survival lending clinical support to xenograft findings that HAS2 drives growth of tumors with low AGL. Conclusion Our study establishes HAS2 mediated HA synthesis as a driver of growth of bladder cancer with low AGL and provides preclinical rationale for personalized targeting of HAS2/HA signaling in patients with low AGL expressing tumors. PMID:26490312

  15. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  16. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Molecular identification and cellular localisation of GSH synthesis, uptake, efflux and degradation pathways in the rat ciliary body.

    PubMed

    Li, Bo; Umapathy, Ankita; Tran, Loi Uyen; Donaldson, Paul J; Lim, Julie C

    2013-04-01

    The aim of this study is to determine the contribution of the ciliary epithelium to glutathione (GSH) levels in the aqueous by mapping GSH metabolism and transport pathways in the rat ciliary body. Using a combination of molecular and immunohistochemical techniques, we screened and localised enzymes and transporters involved in GSH synthesis, uptake, efflux and degradation. Our findings indicate that both the pigmented epithelial (PE) and the non-pigmented epithelial (NPE) cell layers are capable of accumulating precursor amino acids for GSH synthesis, but only the NPE cells appear to be involved in the direct uptake of precursor amino acids from the stroma. The localisation of GSH efflux transporters to the PE cell and PE-NPE interface indicates that GSH and potentially GSH-S conjugates can be removed from the ciliary epithelium into the stroma, while the location of GSH efflux transporters to the basolateral membrane of the NPE indicates that these cells can mediate GSH secretion into the aqueous. GSH secreted by the ciliary into the aqueous would remain largely intact due to the absence of the GSH degradation enzymes γ-glutamyltranspeptidase (γ-GGT) labelling at the basolateral membrane of the NPE. Therefore, it appears that the ciliary epithelium contains the molecular machinery to mediate GSH secretion into the aqueous.

  18. Deciphering ascorbic acid regulatory pathways in ripening tomato fruit using a weighted gene correlation network analysis approach.

    PubMed

    Gao, Chao; Ju, Zheng; Li, Shan; Zuo, Jinhua; Fu, Daqi; Tian, Huiqin; Luo, Yunbo; Zhu, Benzhong

    2013-11-01

    Genotype is generally determined by the co-expression of diverse genes and multiple regulatory pathways in plants. Gene co-expression analysis combining with physiological trait data provides very important information about the gene function and regulatory mechanism. L-Ascorbic acid (AsA), which is an essential nutrient component for human health and plant metabolism, plays key roles in diverse biological processes such as cell cycle, cell expansion, stress resistance, hormone synthesis, and signaling. Here, we applied a weighted gene correlation network analysis approach based on gene expression values and AsA content data in ripening tomato (Solanum lycopersicum L.) fruit with different AsA content levels, which leads to identification of AsA relevant modules and vital genes in AsA regulatory pathways. Twenty-four modules were compartmentalized according to gene expression profiling. Among these modules, one negatively related module containing genes involved in redox processes and one positively related module enriched with genes involved in AsA biosynthetic and recycling pathways were further analyzed. The present work herein indicates that redox pathways as well as hormone-signal pathways are closely correlated with AsA accumulation in ripening tomato fruit, and allowed us to prioritize candidate genes for follow-up studies to dissect this interplay at the biochemical and molecular level. © 2013 Institute of Botany, Chinese Academy of Sciences.

  19. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  20. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  1. Pivalic acid acts as a starter unit in a fatty acid and antibiotic biosynthetic pathway in Alicyclobacillus, Rhodococcus and Streptomyces.

    PubMed

    Rezanka, Tomáš; Siristova, Lucie; Schreiberová, Olga; Rezanka, Michal; Masák, Jan; Melzoch, Karel; Sigler, Karel

    2011-06-01

    A biosynthetic pathway using pivalic acid as a starter unit was found in three bacterial species, Alicyclobacillus acidoterrestris, Rhodococcus erythropolis and Streptomyces avermitilis. When deuterium-labelled pivalic acid was added to A. acidoterrestris and R. erythropolis nutrient media it was incorporated into fatty acids to give rise to tert-butyl fatty acids (t-FAs). In addition, in R. erythropolis, pivalic acid was transformed into two starter units, i.e. isobutyric and 2-methylbutyric acid, which served as precursors of corresponding iso-even FAs and anteiso-FAs. In S. avermitilis the biosynthesis also yielded all three branched FAs; apart from this pathway, both pivalic and 2-methylbutyric acids were incorporated into the antibiotic avermectin. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  2. The Suf Iron-Sulfur Cluster Synthesis Pathway Is Required for Apicoplast Maintenance in Malaria Parasites

    PubMed Central

    Gisselberg, Jolyn E.; Dellibovi-Ragheb, Teegan A.; Matthews, Krista A.; Bosch, Gundula; Prigge, Sean T.

    2013-01-01

    The apicoplast organelle of the malaria parasite Plasmodium falciparum contains metabolic pathways critical for liver-stage and blood-stage development. During the blood stages, parasites lacking an apicoplast can grow in the presence of isopentenyl pyrophosphate (IPP), demonstrating that isoprenoids are the only metabolites produced in the apicoplast which are needed outside of the organelle. Two of the isoprenoid biosynthesis enzymes are predicted to rely on iron-sulfur (FeS) cluster cofactors, however, little is known about FeS cluster synthesis in the parasite or the roles that FeS cluster proteins play in parasite biology. We investigated two putative FeS cluster synthesis pathways (Isc and Suf) focusing on the initial step of sulfur acquisition. In other eukaryotes, these proteins can be located in multiple subcellular compartments, raising the possibility of cross-talk between the pathways or redundant functions. In P. falciparum, SufS and its partner SufE were found exclusively the apicoplast and SufS was shown to have cysteine desulfurase activity in a complementation assay. IscS and its effector Isd11 were solely mitochondrial, suggesting that the Isc pathway cannot contribute to apicoplast FeS cluster synthesis. The Suf pathway was disrupted with a dominant negative mutant resulting in parasites that were only viable when supplemented with IPP. These parasites lacked the apicoplast organelle and its organellar genome – a phenotype not observed when isoprenoid biosynthesis was specifically inhibited with fosmidomycin. Taken together, these results demonstrate that the Suf pathway is essential for parasite survival and has a fundamental role in maintaining the apicoplast organelle in addition to any role in isoprenoid biosynthesis. PMID:24086138

  3. Transcriptomes of purified gastric ECL and parietal cells: identification of a novel pathway regulating acid secretion.

    PubMed

    Lambrecht, Nils W G; Yakubov, Iskandar; Zer, Cindy; Sachs, George

    2006-03-13

    The gastric entero-chromaffin-like (ECL) cell plays a key regulatory role in peripheral regulation of acid secretion due to the release of histamine that stimulates acid secretion by the parietal cell. Studies in intact animals, gastric glands, and isolated cells after short-term culture have shown expression of stimulatory CCK2 and PAC1 and inhibitory SST2 and Gal1 receptors as well as histidine decarboxylase. However, the pattern of its gene expression as a neuroendocrine cell has not been explored. Comparison of gene expression by 95% pure ECL cells obtained by density gradient, elutriation, and fluorescence-assisted cell sorting with isolates of the intact fundic gastric epithelium (i.e., "subtractive hybridization") identified a variety of additional expressed gene families characteristic of this neuroendocrine cell. These include genes 1) involved in neuropeptide synthesis and secretory vesicle exocytosis, 2) involved in control of inflammation, 3) implicated in healing of the epithelium, 4) encoding inhibitory Gi protein-coupled receptors, 5) playing a role in neuroendocrine regulation of food intake, and 6) encoding proteins likely involved in maintenance of circadian rhythm, in addition to the ECL cell-specific genes histidine decarboxylase and monoamine transporter. Particularly, the inhibitory apelin receptor gene, APJ, was highly expressed in the ECL cell preparation. Because parietal cells express apelin, immunohistochemical and functional studies showed that there is an inhibitory feed back loop between the parietal and ECL cell during gastrin stimulation, providing evidence for a novel pathway of downregulation of acid secretion due to interaction between these two cell types.

  4. Effect of cholesterol feeding and estrogen treatment on synthesis of fatty acids in liver.

    PubMed

    Srinivasan, K; Pynadath, T I

    1977-08-01

    The effect of cholesterol feeding and estrogen administration on synthesis of fatty acids in liver mitochondria, microsomes and cytoplasm of male rabbits has been investigated. The synthesis was measured by the incorporation of [1(-14)C] acetyl CoA or [2(-14)C]malonyl CoA into long chain fatty acids under optimal conditions. It was found that atherogenesis markedly decreased the fatty acid synthesis in cytoplasm. The mitochondrial fatty acid synthesis was not affected by the disease. There was a small but measurable decrease in the synthesis of fatty acids in microsomes. Estrogen had no effect on the synthesis of fatty acids in mitochondria or microsomes. But if effectively counteracted, after a short lag period, the decreased synthesis of cytoplasmic fatty acids observed in atherosclerosis. It is possible that liver fatty acid synthetase is one of the enzyme systems through which estrogens exert their atherosclerosis-retarding effect. The decreased cytoplasmic fatty acid synthesis observed in atherosclerosis might account for the low levels of saturated fatty acids reported in liver and plasma lipids of atherosclerotic animals.

  5. Biological function of the dTDP-rhamnose synthesis pathway in Streptococcus mutans.

    PubMed Central

    Tsukioka, Y; Yamashita, Y; Oho, T; Nakano, Y; Koga, T

    1997-01-01

    We have cloned a new gene locus that comprises three genes concerned with the biosynthesis of the serotype c-specific polysaccharide antigen in Streptococcus mutans. The genes encode proteins exhibiting significant homology to the rfbA, rfbB, and rfbD gene products that are involved in the anabolism of dTDP-L-rhamnose from D-glucose-1-phosphate. This anabolism pathway pertains to biosynthesis of the O antigen of lipopolysaccharide in gram-negative bacteria. The cell extract of Escherichia coli expressing each of the cloned genes of S. mutans exhibited enzymatic activity corresponding to the homologous counterpart of the rfb gene products. Rhamnose was not detected in the cell wall preparation purified from the mutant in which each of the three cloned genes was insertionally inactivated. Rabbit antiserum against S. mutans serotype c-specific antigen did not react with the autoclaved extracts from these mutants. These results indicate that the gene products identified in the present study are involved in the dTDP-L-rhamnose synthesis pathway and that the pathway relates to the biosynthesis of the serotype-specific polysaccharide antigen of S. mutans. Southern hybridization analysis revealed that genes homologous to the cloned genes involved in the dTDP-L-rhamnose synthesis pathway were widely distributed in a variety of streptococci. This is the first report of the biological function of the dTDP-rhamnose pathway in streptococci. PMID:9023194

  6. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  7. Effects of metabolic pathway precursors and polydimethylsiloxane (PDMS) on poly-(gamma)-glutamic acid production by Bacillus subtilis BL53.

    PubMed

    de Cesaro, Alessandra; da Silva, Suse Botelho; Ayub, Marco Antônio Záchia

    2014-09-01

    The aims of this study were to evaluate the effects of the addition of metabolic precursors and polydimethylsiloxane (PDMS) as an oxygen carrier to cultures of Bacillus subtilis BL53 during the production of γ-PGA. Kinetics analyses of cultivations of different media showed that B. subtilis BL53 is an exogenous glutamic acid-dependent strain. When the metabolic pathway precursors of γ-PGA synthesis, L-glutamine and a-ketoglutaric acid, were added to the culture medium, production of the biopolymer was increased by 20 % considering the medium without these precursors. The addition of 10 % of the oxygen carrier PDMS to cultures caused a two-fold increase in the volumetric oxygen mass transfer coefficient (kLa), improving γ-PGA production and productivity. Finally, bioreactor cultures of B. subtilis BL53 adopting the combination of optimized medium E, added of glutamine, α-ketoglutaric acid, and PDMS, showed a productivity of 1 g L(-1) h(-1) of g-PGA after only 24 h of cultivation. Results of this study suggest that the use of metabolic pathway precursors glutamine and a-ketolgutaric acid, combined with the addition of PDMS as an oxygen carrier in bioreactors, can improve γ-PGA production and productivity by Bacillus strains .

  8. Construction of reductive pathway in Saccharomyces cerevisiae for effective succinic acid fermentation at low pH value.

    PubMed

    Yan, Daojiang; Wang, Caixia; Zhou, Jiemin; Liu, Yilan; Yang, Maohua; Xing, Jianmin

    2014-03-01

    Succinic acid is an important precursor for the synthesis of high-value-added products. Saccharomyces cerevisiae is a suitable platform for succinic acid production because of its high tolerance towards acidity. In this study, a modified pathway for succinate production was established and investigated in S. cerevisiae. The engineered strain could produce up to 6.17±0.34g/L of succinate through the constructed pathway. The succinate titer was further improved to 8.09±0.28g/L by the deletion of GPD1 and even higher to 9.98±0.23g/L with a yield of 0.32mol/mol glucose through regulation of biotin and urea levels. Under optimal supplemental CO2 conditions in a bioreactor, the engineered strain produced 12.97±0.42g/L succinate with a yield of 0.21mol/mol glucose at pH 3.8. These results demonstrated that the proposed engineering strategy was efficient for succinic acid production at low pH value. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Down regulation of gene related sex hormone synthesis pathway in mouse testes by miroestrol and deoxymiroestrol.

    PubMed

    Udomsuk, Latiporn; Juengwatanatrakul, Thaweesak; Putalun, Waraporn; Jarukamjorn, Kanokwan

    2011-12-01

    Miroestrol and deoxymiroestrol are phytoestrogens isolated from tuberous root of Pueraria candollei var. mirifica. Modulatory effects of miroestrol and deoxymiroestrol on enzymes involved in sex-hormone synthesis pathway in male C57BL/6 mice were investigated using semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR). Miroestrol and deoxymiroestrol suppressed the expressions of 3β-HSD, 17β-HSD1, and CYP17 while CYP19 mRNA expression was slightly decreased. In addition, the expression of 17β-HSD2 was induced in correlation with those did by estradiol. These observations supported that miroestrol and deoxymiroestrol could exhibit the same effect as estradiol regarding regulation of testicular gene related sex hormone synthesis pathway.

  10. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  11. Indoleacetic Acid synthesis in soybean cotyledon callus tissue.

    PubMed

    Black, R C; Hamilton, R H

    1976-03-01

    Growth of an auxin-requiring soybean cotyledon callus tissue (Glycine max L., Merr. var. Acme) was promoted by tryptophan, tryptamine, indole, indoleacetamide and, to a very slight degree, anthranilic acid. When tryptophan-3-(14)C was supplied in the growth medium, labeled indoleacetic acid (IAA) was found in both the tissue and the medium. Medium, from which the cells had been removed, was also found to convert labeled tryptophan to IAA. Soybean callus contained 0.044 mumole/g free tryptophan, but this is apparently not available for conversion to IAA. These results suggest that while exogenously supplied trytophan could elevate a specific internal pool where IAA synthesis occurs some of the growth on a tryptophan medium can be accounted for by external conversion.

  12. Indoleacetic Acid Synthesis in Soybean Cotyledon Callus Tissue 1

    PubMed Central

    Black, Robert C.; Hamilton, Robert H.

    1976-01-01

    Growth of an auxin-requiring soybean cotyledon callus tissue (Glycine max L., Merr. var. Acme) was promoted by tryptophan, tryptamine, indole, indoleacetamide and, to a very slight degree, anthranilic acid. When tryptophan-3-14C was supplied in the growth medium, labeled indoleacetic acid (IAA) was found in both the tissue and the medium. Medium, from which the cells had been removed, was also found to convert labeled tryptophan to IAA. Soybean callus contained 0.044 μmole/g free tryptophan, but this is apparently not available for conversion to IAA. These results suggest that while exogenously supplied trytophan could elevate a specific internal pool where IAA synthesis occurs some of the growth on a tryptophan medium can be accounted for by external conversion. PMID:16659498

  13. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  14. One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.

    PubMed

    Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef

    2017-08-01

    Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ2 and PGA2, cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. The enzymic and chemical synthesis of ursodeoxycholic and chenodeoxycholic acid from cholic acid.

    PubMed

    Sutherland, J D; Macdonald, I A; Forrest, T P

    1982-01-01

    Three approaches to the synthesis of ursodeoxycholic acid (UDC) from cholic acid have been investigated: (i) oxidation of cholic acid to 3 alpha, 7 alpha-dihydroxy-12 keto-5 beta-cholanoic acid (12K-CDC) with Clostridium group P 12 alpha-hydroxysteroid dehydrogenase (HSDH), isomerization of 12K-CDC to 3 alpha, 7 beta-dihydroxy-12 keto-5 beta-cholanoic acid (12K-UDC) with Clostridium absonum 7 alpha- and 7 beta-HSDH and reduction of 12K-UDC by Wolff-Kishner to UDC; (ii) isomerization of cholic acid to ursocholic acid (UC) by C. absonum 7 alpha- and 7 beta-HSDH, oxidation of UC to 12K-UDC with Clostridium group P 12 alpha-HSDH and Wolff-Kishner reduction of 12K-UDC to UDC; (iii) oxidation of cholic acid to 12K-CDC by Clostridium group P 12 alpha-HSDH, Wolff-Kishner reduction of 12K-CDC to chenodeoxycholic acid (CDC) and isomerization of CDC to UDC using whole cell cultures of C. absonum. In the first two approaches (using cell free systems) the yields of desired product were relatively low primarily due to the formation of various side products. The third method proved the most successful giving an overall yield of 37% (UDC) whose structure was verified by mass spectroscopy of the methyl ester.

  16. Privileged substructure-based diversity-oriented synthesis pathway for diverse pyrimidine-embedded polyheterocycles.

    PubMed

    Kim, Heejun; Tung, Truong Thanh; Park, Seung Bum

    2013-11-15

    A new diversity-oriented synthesis pathway for the fabrication of a pyrimidine-embedded polyheterocycles library was developed for potential interactions with diverse biopolymers. Five different pyrimidine-embedded core skeletons were synthesized from ortho-alkynylpyrimidine carbaldehydes by a silver- or iodine-mediated tandem cyclization strategy. The resulting polyheterocycles possess diverse fused ring sizes and positions with potential functionalities for further modification.

  17. Glycogen synthesis in amphibian oocytes: evidence for an indirect pathway.

    PubMed Central

    Kessi, E; Guixé, V; Preller, A; Ureta, T

    1996-01-01

    Glycogen is the main end product of glucose metabolism in amphibian oocytes. However, in the first few minutes after [U-14C]glucose microinjection most of the label is found in lactate. The burst of lactate production and the shape of the time curves for the labelling of glucose 6-phosphate, fructose 6-phosphate, glucose 1-phosphate and glycogen suggest a precursor-product relationship of lactate with respect to glycogen and its intermediates. Expansion (by microinjection) of the pool of glycolytic intermediates, such as dihydroxyacetone phosphate, glyceraldehyde 3-phosphate, 3-phosphoglycerate or phosphoenolpyruvate, results in a marked decrease in [U-14C]glucose incorporation into glycogen. After co-injection of doubly labelled glucoses, extensive detritiation (93%) of the glucosyl units of glycogen was observed with [2-3H, U-14C]glucose and partial detritiation with [3-3H,U-14C]glucose (34%) or [5-3H,U-14C]glucose (46%). After injection of [6-3H,U-14C]glucose, a small but significant and reproducible detritiation (13%) in glycogen was observed. Co-injection of [U-14C]glucose and 3-mercaptopicolinate resulted in marked inhibition of glycogen labelling. Half-maximal inhibition was observed at 0.58 mM 3-mercaptopicolinate, which agrees with the IC50 value (0.47 mM) for the inhibition in vitro of phosphoenolpyruvate carboxykinase activity. We concluded that in frog oocytes most of the glucosyl units are incorporated into glycogen by an indirect pathway involving breakdown of glucose to lactate, which is then converted into glycogen via gluconeogenesis. Both processes, glycolytic degradation of glucose to lactate and subsequent reconversion of the latter into hexose phosphates and glycogen, occur in the same cell. PMID:8615814

  18. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  19. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  20. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  1. Regulation of the salvage pathway of deoxynucleotides synthesis in apoptosis induced by growth factor deprivation.

    PubMed Central

    Oliver, F J; Collins, M K; López-Rivas, A

    1996-01-01

    Here we describe changes in dNTP metabolism that precede DNA fragmentation in a model of apoptosis driven by deprivation of the cytokine interleukin 3 (IL-3). In haemopoietic BAF3 cells, IL-3 withdrawal leads to a rapid decrease in the size of dATP, dTTP and dGTP pools without affecting dCTP levels. This imbalance in dNTP pools precedes DNA fragmentation and is accompanied by down-regulation of enzymes controlling the de novo and salvage pathways of dNTP synthesis, ribonucleotide reductase and thymidine kinase (TK) respectively. Readdition of IL-3 results in a rapid, protein synthesis-independent restoration of normal dNTP pools, enhanced TK activity and increased precursor incorporation through the salvage pathway. Up-regulation of TK activity after IL-3 readdition is prevented by the protein kinase C (PKC) inhibitor staurosporin, but not by tyrosine kinase inhibitors. Furthermore activation of PKC by phorbol esters mimics the stimulatory effect of IL-3 on TK activity, suggesting that PKC might be involved in regulating this effect. These results indicate that regulation by IL-3 of the salvage pathway of dNTP synthesis plays a role in the maintenance of cellular dNTP pool balance and suggests that alterations in dNTP metabolism after IL-3 deprivation could be a relevant event in the commitment of haemopoietic cells to apoptosis. PMID:8687383

  2. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.

    1987-01-01

    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  3. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  4. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  5. Efficient synthesis of hydroxystyrenes via biocatalytic decarboxylation/deacetylation of substituted cinnamic acids by newly isolated Pantoea agglomerans strains.

    PubMed

    Sharma, Upendra K; Sharma, Nandini; Salwan, Richa; Kumar, Rakesh; Kasana, Ramesh C; Sinha, Arun K

    2012-02-01

    Decarboxylation of substituted cinnamic acids is a predominantly followed pathway for obtaining hydroxystyrenes-one of the most extensively explored bioactive compounds in the food and flavor industry (e.g. FEMA GRAS approved 4-vinylguaiacol). For this, mild and green strategies providing good yields with high product selectivity are needed. Two newly isolated bacterial strains, i.e. Pantoea agglomerans KJLPB4 and P. agglomerans KJPB2, are reported for mild and effective decarboxylation of substituted cinnamic acids into corresponding hydroxystyrenes. Key operational parameters for the process, such as incubation temperature, incubation time, substrate concentration and effect of co-solvent, were optimized using ferulic acid as a model substrate. With strain KJLPB4, 1.51 g L⁻¹ 4-vinyl guaiacol (98% yield) was selectively obtained from 2 g L⁻¹ ferulic acid at 28 °C after 48 h incubation. However, KJPB2 provided vanillic acid in 85% yield after 72 h following the oxidative decarboxylation pathway. In addition, KJLPB4 was effectively exploited for the deacetylation of acetylated α-phenylcinnamic acids, providing corresponding compounds in 65-95% yields. Two newly isolated microbial strains are reported for the mild and selective decarboxylation of substituted cinnamic acids into hydroxystyrenes. Preparative-scale synthesis of vinyl guaiacol and utilization of renewable feedstock (ferulic acid extracted from maize bran) have been demonstrated to enhance the practical utility of the process. Copyright © 2011 Society of Chemical Industry.

  6. Enhancement of arachidonic acid signaling pathway by nicotinic acid receptor HM74A.

    PubMed

    Tang, Yuting; Zhou, Lubing; Gunnet, Joseph W; Wines, Pamela G; Cryan, Ellen V; Demarest, Keith T

    2006-06-23

    HM74A is a G protein-coupled receptor for nicotinic acid (niacin), which has been used clinically to treat dyslipidemia for decades. The molecular mechanisms whereby niacin exerts its pleiotropic effects on lipid metabolism remain largely unknown. In addition, the most common side effect in niacin therapy is skin flushing that is caused by prostaglandin release, suggesting that the phospholipase A(2) (PLA(2))/arachidonic acid (AA) pathway is involved. Various eicosanoids have been shown to activate peroxisome-proliferator activated receptors (PPAR) that play a diverse array of roles in lipid metabolism. To further elucidate the potential roles of HM74A in mediating the therapeutic effects and/or side effects of niacin, we sought to explore the signaling events upon HM74A activation. Here we demonstrated that HM74A synergistically enhanced UTP- and bradykinin-mediated AA release in a pertussis toxin-sensitive manner in A431 cells. Activation of HM74A also led to Ca(2+)-mobilization and enhanced bradykinin-promoted Ca(2+)-mobilization through Gi protein. While HM74A increased ERK1/2 activation by the bradykinin receptor, it had no effects on UTP-promoted ERK1/2 activation.Furthermore, UTP- and bradykinin-mediated AA release was significantly decreased in the presence of both MAPK kinase inhibitor PD 098059 and PKC inhibitor GF 109203X. However, the synergistic effects of HM74A were not dramatically affected by co-treatment with both inhibitors, indicating the cross-talk occurred at the receptor level. Finally, stimulation of A431 cells transiently transfected with PPRE-luciferase with AA significantly induced luciferase activity, mimicking the effects of PPARgamma agonist rosiglitazone, suggesting that alteration of AA signaling pathway can regulate gene expression via endogenous PPARs.

  7. Enhancement of arachidonic acid signaling pathway by nicotinic acid receptor HM74A

    SciTech Connect

    Tang, Yuting . E-mail: ytang@prdus.jnj.com; Zhou, Lubing; Gunnet, Joseph W.; Wines, Pamela G.; Cryan, Ellen V.; Demarest, Keith T.

    2006-06-23

    HM74A is a G protein-coupled receptor for nicotinic acid (niacin), which has been used clinically to treat dyslipidemia for decades. The molecular mechanisms whereby niacin exerts its pleiotropic effects on lipid metabolism remain largely unknown. In addition, the most common side effect in niacin therapy is skin flushing that is caused by prostaglandin release, suggesting that the phospholipase A{sub 2} (PLA{sub 2})/arachidonic acid (AA) pathway is involved. Various eicosanoids have been shown to activate peroxisome-proliferator activated receptors (PPAR) that play a diverse array of roles in lipid metabolism. To further elucidate the potential roles of HM74A in mediating the therapeutic effects and/or side effects of niacin, we sought to explore the signaling events upon HM74A activation. Here we demonstrated that HM74A synergistically enhanced UTP- and bradykinin-mediated AA release in a pertussis toxin-sensitive manner in A431 cells. Activation of HM74A also led to Ca{sup 2+}-mobilization and enhanced bradykinin-promoted Ca{sup 2+}-mobilization through Gi protein. While HM74A increased ERK1/2 activation by the bradykinin receptor, it had no effects on UTP-promoted ERK1/2 activation.Furthermore, UTP- and bradykinin-mediated AA release was significantly decreased in the presence of both MAPK kinase inhibitor PD 098059 and PKC inhibitor GF 109203X. However, the synergistic effects of HM74A were not dramatically affected by co-treatment with both inhibitors, indicating the cross-talk occurred at the receptor level. Finally, stimulation of A431 cells transiently transfected with PPRE-luciferase with AA significantly induced luciferase activity, mimicking the effects of PPAR{gamma} agonist rosiglitazone, suggesting that alteration of AA signaling pathway can regulate gene expression via endogenous PPARs.

  8. Effect of mevalonic acid on cholesterol synthesis in bovine intramuscular and subcutaneous adipocytes.

    PubMed

    Liu, Xiaomu; You, Wei; Cheng, Haijian; Zhang, Qingfeng; Song, Enliang; Wan, Fachun; Han, Hong; Liu, Guifen

    2016-02-01

    Mevalonic acid (MVA) is a key material in the synthesis of cholesterol; indeed, intracellular cholesterol synthesis is also called the mevalonic acid pathway. 3-Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is an essential enzyme in cholesterol biosynthesis. This study suggests that MVA may play an important role in the differentiation of bovine adipose tissue in vivo. We investigated differential mRNA expression in bovine intramuscular preadipocytes (BIPs) and bovine subcutaneous preadipocytes (BSPs) by culturing cells from the longissimus dorsi muscle and subcutaneous fat tissues of Luxi yellow cattle. The morphology of lipid accumulation of bovine preadipocytes was detected by Oil Red O staining, and total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), and high-density lipoprotein cholesterol (HDLC) levels were measured. Temporospatial expression of HMGR was investigated by real-time quantitative polymerase chain reaction (PCR). The TC, LDLC, and HDLC content did not significantly differ over time but increased slowly with increasing MVA concentration. HMGR expression increased over time and with increasing concentrations of MVA. MVA increased adipose cell proliferation in a dose-dependent and time-dependent manner. MVA stimulated HMGR expression in two cell types and its influence on adipocyte differentiation.

  9. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors.

  10. Cadmium stress tolerance in wheat seedlings induced by ascorbic acid was mediated by NO signaling pathways.

    PubMed

    Wang, Zhaofeng; Li, Qien; Wu, Weiguo; Guo, Jie; Yang, Yingli

    2017-01-01

    Ascorbic acid (AsA) and nitric oxide (NO) are well known and widespread antioxidants and gaseous molecules that regulate plant tolerance to several stresses. However, the relationship between them in plant response to stress, especially heavy stress, is largely unclear. This study demonstrated that both AsA and NO could enhance the tolerance of wheat seedlings to cadmium stress evidenced by root length change, which resulted from their roles in maintaining the balance in reactive oxygen species (ROS) and reducing the absorption of Cd. Furthermore, exogenous AsA led to a significant increase of NO content and endogenous AsA content in wheat roots, which could be weakened by the NO scavenger c-PTIO. In addition, c-PTIO also inhibits the NO-induced production of endogenous AsA. Although the AsA synthesis inhibitor lycorine significantly inhibited the inductive effect of exogenous AsA on endogenous AsA production, it has little effect on NO content. In addition, we found that the protective effects of NO and AsA on Cd stress were removed by c-PTIO and lycorine. These results indicated that NO accumulation could be necessary for exogenous AsA-induced cadmium tolerance and endogenous AsA production, and the exogenous AsA-induced endogenous AsA production was likely mediated by NO signaling pathways and together they induced the tolerance of wheat to cadmium stress. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  12. Engineering rTCA pathway and C4-dicarboxylate transporter for L-malic acid production.

    PubMed

    Chen, Xiulai; Wang, Yuancai; Dong, Xiaoxiang; Hu, Guipeng; Liu, Liming

    2017-02-22

    L-Malic acid is an important component of a vast array of food additives, antioxidants, disincrustants, pharmaceuticals, and cosmetics. Here, we presented a pathway optimization strategy and a transporter modification approach to reconstruct the L-malic acid biosynthesis pathway and transport system, respectively. First, pyruvate carboxylase (pyc) and malate dehydrogenase (mdh) from Aspergillus flavus and Rhizopus oryzae were combinatorially overexpressed to construct the reductive tricarboxylic acid (rTCA) pathway for L-malic acid biosynthesis. Second, the L-malic acid transporter (Spmae) from Schizosaccharomyces pombe was engineered by removing the ubiquitination motification to enhance the L-malic acid efflux system. Finally, the L-malic acid pathway was optimized by controlling gene expression levels, and the final L-malic acid concentration, yield, and productivity were up to 30.25 g L(-1), 0.30 g g(-1), and 0.32 g L(-1) h(-1) in the resulting strain W4209 with CaCO3 as a neutralizing agent, respectively. In addition, these corresponding parameters of pyruvic acid remained at 30.75 g L(-1), 0.31 g g(-1), and 0.32 g L(-1) h(-1), respectively. The metabolic engineering strategy used here will be useful for efficient production of L-malic acid and other chemicals.

  13. Sorbic acid stress activates the Candida glabrata high osmolarity glycerol MAP kinase pathway

    PubMed Central

    Jandric, Zeljkica; Gregori, Christa; Klopf, Eva; Radolf, Martin; Schüller, Christoph

    2013-01-01

    Weak organic acids such as sorbic acid are important food preservatives and powerful fungistatic agents. These compounds accumulate in the cytosol and disturb the cellular pH and energy homeostasis. Candida glabrata is in many aspects similar to Saccharomyces cerevisiae. However, with regard to confrontation to sorbic acid, two of the principal response pathways behave differently in C. glabrata. In yeast, sorbic acid stress causes activation of many genes via the transcription factors Msn2 and Msn4. The C. glabrata homologs CgMsn2 and CgMsn4 are apparently not activated by sorbic acid. In contrast, in C. glabrata the high osmolarity glycerol (HOG) pathway is activated by sorbic acid. Here we show that the MAP kinase of the HOG pathway, CgHog1, becomes phosphorylated and has a function for weak acid stress resistance. Transcript profiling of weak acid treated C. glabrata cells suggests a broad and very similar response pattern of cells lacking CgHog1 compared to wild type which is over lapping with but distinct from S. cerevisiae. The PDR12 gene was the highest induced gene in both species and it required CgHog1 for full expression. Our results support flexibility of the response cues for general stress signaling pathways, even between closely related yeasts, and functional extension of a specific response pathway. PMID:24324463

  14. Direct biosynthesis of adipic acid from a synthetic pathway in recombinant Escherichia coli.

    PubMed

    Yu, Jia-Le; Xia, Xiao-Xia; Zhong, Jian-Jiang; Qian, Zhi-Gang

    2014-12-01

    The C6 dicarboxylic acid, adipic acid, is an important platform chemical in industry. Biobased production of adipic acid is a promising alternative to the current petrochemical route. Here, we report biosynthesis of adipic acid using an artificial pathway inspired by the reversal of beta-oxidation of dicarboxylic acids. The biosynthetic pathway comprises condensation of acetyl-CoA and succinyl-CoA to form the C6 backbone and subsequent reduction, dehydration, hydrogenation, and release of adipic acid from its thioester. The pathway was first tested in vitro with reconstituted pathway enzymes and then functionally introduced into Escherichia coli for the biosynthesis and excretion of adipic acid into the culture medium. The production titer was increased by approximately 20-fold through the combination of recruiting enzymes that were more suitable to catalyze the synthetic reactions and increasing availability of the condensation substrates. This work demonstrates direct biosynthesis of adipic acid via non-natural synthetic pathway, which may enable its renewable production.

  15. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  16. Metabolic Pathways Involved in 2-Methoxyestradiol Synthesis and Their Role in Preeclampsia

    PubMed Central

    Perez-Sepulveda, Alejandra; España-Perrot, Pedro P.; Norwitz, Errol R.

    2013-01-01

    Preeclampsia (PE) remains a major cause of maternal/fetal morbidity–mortality worldwide. The first stage of PE is characterized by placental hypoxia due to a relative reduction in uteroplacental blood flow, resulting from restricted trophoblast invasion. However, hypoxia is also an essential element for the success of invasion. Under hypoxic conditions, 2-methoxyestradiol (2-ME) could induce the differentiation of cytotrophoblast cells into an invasive phenotype in culture. 2-Methoxyestradiol is generated by catechol-O-methyltransferase, an enzyme involved in the metabolic pathway of estrogens. During pregnancy, circulating 2-ME levels increase significantly when compared to the menstrual cycle. Interestingly, plasma levels of 2-ME are lower in women with PE than in controls, and these differences are apparent weeks or even months before the clinical manifestations of the disease. This article reviews the metabolic pathways involved in 2-ME synthesis and discusses the roles of these pathways in normal and abnormal pregnancies, with particular emphasis on PE. PMID:23456663

  17. Reassembled biosynthetic pathway for large-scale carbohydrate synthesis: alpha-Gal epitope producing "superbug".

    PubMed

    Chen, Xi; Liu, Ziye; Zhang, Jianbo; Zhang, Wei; Kowal, Przemyslaw; Wang, Peng George

    2002-01-04

    A metabolic pathway engineered Escherichia coli strain (superbug) containing one plasmid harboring an artificial gene cluster encoding all the five enzymes in the biosynthetic pathway of Galalpha l,3Lac through galactose metabolism has been developed. The plasmid contains a lambda promoter, a c1857 repressor gene, an ampicillin resistance gene, and a T7 terminator. Each gene was preceded by a Shine - Dalgarno sequence for ribosome binding. In a reaction catalyzed by the recombinant E. coli strain, Galalpha 1,3Lac trisaccharide accumulated at concentrations of 14.2 mM (7.2 gL(-1)) in a reaction mixture containing galactose, glucose, lactose, and a catalytic amount of uridine 5'-diphosphoglucose. This work demonstrates that large-scale synthesis of complex oligosaccharides can be achieved economically and efficiently through a single, biosynthetic pathway engineered microorganism.

  18. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  20. Circadian control of bile acid synthesis by a KLF15-Fgf15 axis

    PubMed Central

    Han, Sean (Shuxin); Zhang, Rongli; Jain, Rajan; Shi, Hong; Zhang, Lilei; Zhou, Guangjin; Sangwung, Panjamaporn; Tugal, Derin; Atkins, G. Brandon; Prosdocimo, Domenick A.; Lu, Yuan; Han, Xiaonan; Tso, Patrick; Liao, Xudong; Epstein, Jonathan A.; Jain, Mukesh K.

    2015-01-01

    Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15 signalling axis that regulates circadian BA production. Systemic Klf15 deficiency disrupted circadian expression of key BA synthetic enzymes, tissue BA levels and triglyceride/cholesterol absorption. Studies in liver-specific Klf15-knockout mice suggested a non-hepatic basis for regulation of BA production. Ileal Fgf15 is a potent inhibitor of BA synthesis. Using a combination of biochemical, molecular and functional assays (including ileectomy and bile duct catheterization), we identify KLF15 as the first endogenous negative regulator of circadian Fgf15 expression. Elucidation of this novel pathway controlling circadian BA production has important implications for physiologic control of nutrient availability and metabolic homeostasis. PMID:26040986

  1. Constructing de novo biosynthetic pathways for chemical synthesis inside living cells.

    PubMed

    Weeks, Amy M; Chang, Michelle C Y

    2011-06-21

    Living organisms have evolved a vast array of catalytic functions that make them ideally suited for the production of medicinally and industrially relevant small-molecule targets. Indeed, native metabolic pathways in microbial hosts have long been exploited and optimized for the scalable production of both fine and commodity chemicals. Our increasing capacity for DNA sequencing and synthesis has revealed the molecular basis for the biosynthesis of a variety of complex and useful metabolites and allows the de novo construction of novel metabolic pathways for the production of new and exotic molecular targets in genetically tractable microbes. However, the development of commercially viable processes for these engineered pathways is currently limited by our ability to quickly identify or engineer enzymes with the correct reaction and substrate selectivity as well as the speed by which metabolic bottlenecks can be determined and corrected. Efforts to understand the relationship among sequence, structure, and function in the basic biochemical sciences can advance these goals for synthetic biology applications while also serving as an experimental platform for elucidating the in vivo specificity and function of enzymes and reconstituting complex biochemical traits for study in a living model organism. Furthermore, the continuing discovery of natural mechanisms for the regulation of metabolic pathways has revealed new principles for the design of high-flux pathways with minimized metabolic burden and has inspired the development of new tools and approaches to engineering synthetic pathways in microbial hosts for chemical production.

  2. Constructing de novo biosynthetic pathways for chemical synthesis inside living cells†

    PubMed Central

    Weeks, Amy M.; Chang, Michelle C. Y.

    2011-01-01

    Living organisms have evolved a vast array of catalytic functions that make them ideally suited for the production of medicinally and industrially relevant small-molecule targets. Indeed, native metabolic pathways in microbial hosts have long been exploited and optimized for the scalable production of both fine and commodity chemicals. Our increasing capacity for DNA sequencing and synthesis has revealed the molecular basis for the biosynthesis of a variety of complex and useful metabolites and enables the de novo construction of novel metabolic pathways for the production of new and exotic molecular targets in genetically tractable microbes. However, the development of commercially viable processes for these engineered pathways is currently limited by our ability to quickly identify or engineer enzymes with the correct reaction and substrate selectivity as well as the speed by which metabolic bottlenecks can be determined and corrected. Efforts in understanding the relationship between sequence, structure, and function in the basic biochemical sciences can advance these goals for synthetic biology applications while also serving as an experimental platform to elucidate the in vivo specificity and function of enzymes and to reconstitute complex biochemical traits for study in a living model organism. Furthermore, the continuing discovery of natural mechanisms for the regulation of metabolic pathways has revealed new principles for the design of high-flux pathways with minimized metabolic burden and has inspired the development of new tools and approaches to engineer synthetic pathways in microbial hosts for chemical production. PMID:21591680

  3. Arginine-dependent acid-resistance pathway in Shigella boydii

    USDA-ARS?s Scientific Manuscript database

    Ability to survive the low pH of the human stomach is considered be an important virulent determinant. Acid tolerance of Shigella boydii 18 CDPH, the strain implicated in an outbreak may have played an important role in surviving the acidic food (bean salad). The strain was capable of inducing arg...

  4. Decreased bile-acid synthesis in livers of hepatocyte-conditional NADPH-cytochrome P450 reductase-null mice results in increased bile acids in serum.

    PubMed

    Cheng, Xingguo; Zhang, Youcai; Klaassen, Curtis D

    2014-10-01

    NADPH-cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH-cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance-associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice.

  5. Decreased Bile-Acid Synthesis in Livers of Hepatocyte-Conditional NADPH–Cytochrome P450 Reductase–Null Mice Results in Increased Bile Acids in Serum

    PubMed Central

    Cheng, Xingguo; Zhang, Youcai

    2014-01-01

    NADPH–cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH–cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance–associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice. PMID:25034404

  6. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  7. Effect of acetate formation pathway and long chain fatty acid CoA-ligase on the free fatty acid production in E. coli expressing acy-ACP thioesterase from Ricinus communis.

    PubMed

    Li, Mai; Zhang, Xiujun; Agrawal, Arpita; San, Ka-Yiu

    2012-07-01

    Microbial biosynthesis of fatty acid like chemicals from renewable carbon sources has attracted significant attention in recent years. Free fatty acids can be used as precursors for the production of fuels or chemicals. Wild type E. coli strains produce fatty acids mainly for the biosynthesis of lipids and cell membranes and do not accumulate free fatty acids as intermediates in lipid biosynthesis. However, free fatty acids can be produced by breaking the fatty acid elongation through the overexpression of an acyl-ACP thioesterase. Since acetyl-CoA might be an important factor for fatty acid synthesis (acetate formation pathways are the main competitive pathways in consuming acetyl-CoA or pyruvate, a precursor of acetyl-CoA), and the long chain fatty acid CoA-ligase (FadD) plays a pivotal role in the transport and activation of exogenous fatty acids prior to their subsequent degradation, we examined the composition and the secretion of the free fatty acids in four different strains including the wild type MG1655, a mutant strain with inactivation of the fatty acid beta-oxidation pathway (fadD mutant (ML103)), and mutant strains with inactivation of the two major acetate production pathways (an ack-pta (acetate kinase/phosphotransacetylase), poxB (pyruvate oxidase) double mutant (ML112)) and a fadD, ack-pta, poxB triple mutant (ML115). The engineered E. coli cells expressing acyl-ACP thioesterase with glucose yield is higher than 40% of theoretical yield. Compared to MG1655(pXZ18) and ML103(pXZ18), acetate forming pathway deletion strains such as ML112(pXZ18) and ML115(pXZ18) produced similar quantity of total free fatty acids, which indicated that acetyl-CoA availability does not appear to be limiting factor for fatty acid production in these strains. However, these strains did show significant differences in the composition of free fatty acids. Different from MG1655(pXZ18) and ML103(pXZ18), acetate formation pathway deletion strains such as ML112(pXZ18) and ML115

  8. Single-Step Pathway for Synthesis of Glucosylglycerate in Persephonella marina▿

    PubMed Central

    Fernandes, Chantal; Empadinhas, Nuno; da Costa, Milton S.

    2007-01-01

    A single-step pathway for the synthesis of the compatible solute glucosylglycerate (GG) is proposed based on the activity of a recombinant glucosylglycerate synthase (Ggs) from Persephonella marina. The corresponding gene encoded a putative glycosyltransferase that was part of an operon-like structure which also contained the genes for glucosyl-3-phosphoglycerate synthase (GpgS) and glucosyl-3-phosphoglycerate phosphatase (GpgP), the enzymes that lead to the synthesis of GG through the formation of glucosyl-3-phosphoglycerate. The putative glucosyltransferase gene was expressed in Escherichia coli, and the recombinant product catalyzed the synthesis of GG in one step from ADP-glucose and d-glycerate, with Km values at 70°C of 1.5 and 2.2 mM, respectively. This glucosylglycerate synthase (Ggs) was also able to use GDP- and UDP-glucose as donors to form GG, but the efficiencies were lower. Maximal activity was observed at temperatures between 80 and 85°C, and Mg2+ or Ca2+ was required for catalysis. Ggs activity was maximal and remained nearly constant at pH values between 5.5 and pH 8.0, and the half-lives for inactivation were 74 h at 85°C and 8 min at 100°C. This is the first report of an enzyme catalyzing the synthesis of GG in one step and of the existence of two pathways for GG synthesis in the same organism. PMID:17369297

  9. [Construction and fermentation control of reductive TCA pathway for malic acid production in Saccharomyces cerevisiae].

    PubMed

    Yan, Daojiang; Wang, Caixia; Zhou, Jiemin; Liu, Yilan; Yang, Maohua; Xing, Jianmin

    2013-10-01

    Malic acid is widely used in food, and chemical industries. Through overexpressing pyruvate carboxylase and malate dehydrogenase in pdc1-deficient Saccharomyces cerevisiae, malic acid was successfully produced through the reductive TCA pathway. No malic acid was detected in wild type Saccharomyces cerevisiae, however, 45 mmol/L malic acid was produced in engineered strain, and the concentration of byproduct ethanol also reduced by 18%. The production of malic acid enhanced 6% by increasing the concentration of Ca2+. In addition, the final concentration reached 52.5 mmol/L malic acid by addition of biotin. The increasing is almost 16% higher than that of the original strain.

  10. A biosynthetic pathway for a prominent class of microbiota-derived bile acids

    PubMed Central

    Devlin, A. Sloan; Fischbach, Michael A.

    2015-01-01

    The gut bile acid pool is millimolar in concentration, varies widely in composition among individuals, and is linked to metabolic disease and cancer. Although these molecules derive almost exclusively from the microbiota, remarkably little is known about which bacterial species and genes are responsible for their biosynthesis. Here, we report a biosynthetic pathway for the second most abundant class in the gut, iso (3β-hydroxy) bile acids, whose levels exceed 300 µM in some humans and are absent in others. We show, for the first time, that iso bile acids are produced by Ruminococcus gnavus, a far more abundant commensal than previously known producers; and that the iso bile acid pathway detoxifies deoxycholic acid, favoring the growth of the keystone genus Bacteroides. By revealing the biosynthetic genes for an abundant class of bile acids, our work sets the stage for predicting and rationally altering the composition of the bile acid pool. PMID:26192599

  11. A biosynthetic pathway for a prominent class of microbiota-derived bile acids.

    PubMed

    Devlin, A Sloan; Fischbach, Michael A

    2015-09-01

    The gut bile acid pool is millimolar in concentration, varies widely in composition among individuals and is linked to metabolic disease and cancer. Although these molecules are derived almost exclusively from the microbiota, remarkably little is known about which bacterial species and genes are responsible for their biosynthesis. Here we report a biosynthetic pathway for the second most abundant class in the gut, 3β-hydroxy(iso)-bile acids, whose levels exceed 300 μM in some humans and are absent in others. We show, for the first time, that iso-bile acids are produced by Ruminococcus gnavus, a far more abundant commensal than previously known producers, and that the iso-bile acid pathway detoxifies deoxycholic acid and thus favors the growth of the keystone genus Bacteroides. By revealing the biosynthetic genes for an abundant class of bile acids, our work sets the stage for predicting and rationally altering the composition of the bile acid pool.

  12. New insights into the regulation of plant immunity by amino acid metabolic pathways.

    PubMed

    Zeier, Jürgen

    2013-12-01

    Besides defence pathways regulated by classical stress hormones, distinct amino acid metabolic pathways constitute integral parts of the plant immune system. Mutations in several genes involved in Asp-derived amino acid biosynthetic pathways can have profound impact on plant resistance to specific pathogen types. For instance, amino acid imbalances associated with homoserine or threonine accumulation elevate plant immunity to oomycete pathogens but not to pathogenic fungi or bacteria. The catabolism of Lys produces the immune signal pipecolic acid (Pip), a cyclic, non-protein amino acid. Pip amplifies plant defence responses and acts as a critical regulator of plant systemic acquired resistance, defence priming and local resistance to bacterial pathogens. Asp-derived pyridine nucleotides influence both pre- and post-invasion immunity, and the catabolism of branched chain amino acids appears to affect plant resistance to distinct pathogen classes by modulating crosstalk of salicylic acid- and jasmonic acid-regulated defence pathways. It also emerges that, besides polyamine oxidation and NADPH oxidase, Pro metabolism is involved in the oxidative burst and the hypersensitive response associated with avirulent pathogen recognition. Moreover, the acylation of amino acids can control plant resistance to pathogens and pests by the formation of protective plant metabolites or by the modulation of plant hormone activity.

  13. Evolution of pigment synthesis pathways by gene and genome duplication in fish

    PubMed Central

    Braasch, Ingo; Schartl, Manfred; Volff, Jean-Nicolas

    2007-01-01

    Background Coloration and color patterning belong to the most diverse phenotypic traits in animals. Particularly, teleost fishes possess more pigment cell types than any other group of vertebrates. As the result of an ancient fish-specific genome duplication (FSGD), teleost genomes might contain more copies of genes involved in pigment cell development than tetrapods. No systematic genomic inventory allowing to test this hypothesis has been drawn up so far for pigmentation genes in fish, and almost nothing is known about the evolution of these genes in different fish lineages. Results Using a comparative genomic approach including phylogenetic reconstructions and synteny analyses, we have studied two major pigment synthesis pathways in teleost fish, the melanin and the pteridine pathways, with respect to different types of gene duplication. Genes encoding three of the four enzymes involved in the synthesis of melanin from tyrosine have been retained as duplicates after the FSGD. In the pteridine pathway, two cases of duplicated genes originating from the FSGD as well as several lineage-specific gene duplications were observed. In both pathways, genes encoding the rate-limiting enzymes, tyrosinase and GTP-cyclohydrolase I (GchI), have additional paralogs in teleosts compared to tetrapods, which have been generated by different modes of duplication. We have also observed a previously unrecognized diversity of gchI genes in vertebrates. In addition, we have found evidence for divergent resolution of duplicated pigmentation genes, i.e., differential gene loss in divergent teleost lineages, particularly in the tyrosinase gene family. Conclusion Mainly due to the FSGD, teleost fishes apparently have a greater repertoire of pigment synthesis genes than any other vertebrate group. Our results support an important role of the FSGD and other types of duplication in the evolution of pigmentation in fish. PMID:17498288

  14. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  15. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  16. Role of D-amino acid oxidase in the production of kynurenine pathway metabolites from D-tryptophan in mice

    PubMed Central

    Notarangelo, Francesca M.; Wang, Xiao-Dan; Horning, Kyle J.; Schwarcz, Robert

    2015-01-01

    The kynurenine pathway (KP), the major catabolic route of the essential amino acid L-tryptophan (L-TRP), contains several neuroactive compounds, including kynurenic acid (KYNA), 3-hydroxykynurenine (3-HK) and quinolinic acid (QUIN). The role of the D-enantiomer (D-TRP) in KP metabolism has received little attention so far. D-TRP can be converted to L-TRP by D-amino acid oxidase (D-AAO), and the same enzyme can produce D-kynurenine, a known bioprecursor of KYNA. To analyze these complex metabolic events systematically in vivo, we injected mice with D-TRP (300 mg/kg, i.p.) and examined KP metabolism in the absence or presence of the D-AAO inhibitor 3-methylpyrazole-5-carboxylic acid (MPC; 100 mg/kg, i.p.,). After 90 min, newly formed L-TRP was recovered in plasma, liver, forebrain and cerebellum, and MPC prevented its neosynthesis in all tissues. In the same animals, de novo production of D-kynurenine from D-TRP was also observed but was much higher in the periphery than in the brain. D-TRP administration raised KYNA, 3-HK, and QUIN levels in all tissues examined, and KYNA production from D-TRP was significantly reduced after pre-treatment with MPC. These results indicate that catabolic routes other than those classically ascribed to L-TRP and L-kynurenine can account for the synthesis of KYNA, 3-HK and QUIN in vivo. PMID:26661897

  17. Overproduction of a Functional Fatty Acid Biosynthetic Enzyme Blocks Fatty Acid Synthesis in Escherichia coli

    PubMed Central

    Subrahmanyam, Satyanarayana; Cronan, John E.

    1998-01-01

    β-Ketoacyl-acyl carrier protein (ACP) synthetase II (KAS II) is one of three Escherichia coli isozymes that catalyze the elongation of growing fatty acid chains by condensation of acyl-ACP with malonyl-ACP. Overexpression of this enzyme has been found to be extremely toxic to E. coli, much more so than overproduction of either of the other KAS isozymes, KAS I or KAS III. The immediate effect of KAS II overproduction is the cessation of phospholipid synthesis, and this inhibition is specifically due to the blockage of fatty acid synthesis. To determine the cause of this inhibition, we examined the intracellular pools of ACP, coenzyme A (CoA), and their acyl thioesters. Although no significant changes were detected in the acyl-ACP pools, the CoA pools were dramatically altered by KAS II overproduction. Malonyl-CoA increased to about 40% of the total cellular CoA pool upon KAS II overproduction from a steady-state level of around 0.5% in the absence of KAS II overproduction. This finding indicated that the conversion of malonyl-CoA to fatty acids had been blocked and could be explained if either the conversion of malonyl-CoA to malonyl-ACP and/or the elongation reactions of fatty acid synthesis had been blocked. Overproduction of malonyl-CoA:ACP transacylase, the enzyme catalyzing the conversion of malonyl-CoA to malonyl-ACP, partially relieved the toxicity of KAS II overproduction, consistent with a model in which high levels of KAS II blocks access of the other KAS isozymes to malonyl-CoA:ACP transacylase. PMID:9721301

  18. Opposing effects of bile acids deoxycholic acid and ursodeoxycholic acid on signal transduction pathways in oesophageal cancer cells.

    PubMed

    Abdel-Latif, Mohamed M; Inoue, Hiroyasu; Reynolds, John V

    2016-09-01

    Ursodeoxycholic acid (UDCA) was reported to reduce bile acid toxicity, but the mechanisms underlying its cytoprotective effects are not fully understood. The aim of the present study was to examine the effects of UDCA on the modulation of deoxycholic acid (DCA)-induced signal transduction in oesophageal cancer cells. Nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) activity was assessed using a gel shift assay. NF-κB activation and translocation was performed using an ELISA-based assay and immunofluorescence analysis. COX-2 expression was analysed by western blotting and COX-2 promoter activity was assessed by luciferase assay. DCA induced NF-κB and AP-1 DNA-binding activities in SKGT-4 and OE33 cells. UDCA pretreatment inhibited DCA-induced NF-κB and AP-1 activation and NF-κB translocation. This inhibitory effect was coupled with a blockade of IκB-α degradation and inhibition of phosphorylation of IKK-α/β and ERK1/2. Moreover, UDCA pretreatment inhibited COX-2 upregulation. Using transient transfection of the COX-2 promoter, UDCA pretreatment abrogated DCA-induced COX-2 promoter activation. In addition, UDCA protected oesophageal cells from the apoptotic effects of deoxycholate. Our findings indicate that UDCA inhibits DCA-induced signalling pathways in oesophageal cancer cells. These data indicate a possible mechanistic role for the chemopreventive actions of UDCA in oesophageal carcinogenesis.

  19. Engineering fungal de novo fatty acid synthesis for short chain fatty acid production

    PubMed Central

    Gajewski, Jan; Pavlovic, Renata; Fischer, Manuel; Boles, Eckhard; Grininger, Martin

    2017-01-01

    Fatty acids (FAs) are considered strategically important platform compounds that can be accessed by sustainable microbial approaches. Here we report the reprogramming of chain-length control of Saccharomyces cerevisiae fatty acid synthase (FAS). Aiming for short-chain FAs (SCFAs) producing baker's yeast, we perform a highly rational and minimally invasive protein engineering approach that leaves the molecular mechanisms of FASs unchanged. Finally, we identify five mutations that can turn baker's yeast into a SCFA producing system. Without any further pathway engineering, we achieve yields in extracellular concentrations of SCFAs, mainly hexanoic acid (C6-FA) and octanoic acid (C8-FA), of 464 mg l−1 in total. Furthermore, we succeed in the specific production of C6- or C8-FA in extracellular concentrations of 72 and 245 mg l−1, respectively. The presented technology is applicable far beyond baker's yeast, and can be plugged into essentially all currently available FA overproducing microorganisms. PMID:28281527

  20. Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications

    PubMed Central

    Windwarder, Markus; Maresch, Daniel; Braun, Matthias L.; Megson, Zoë A.; Vinogradov, Evgeny; Goneau, Marie-France; Sharma, Ashu; Altmann, Friedrich; Messner, Paul; Schoenhofen, Ian C.; Schäffer, Christina

    2017-01-01

    Tannerella forsythia is an anaerobic, Gram-negative periodontal pathogen. A unique O-linked oligosaccharide decorates the bacterium’s cell surface proteins and was shown to modulate the host immune response. In our study, we investigated the biosynthesis of the nonulosonic acid (NulO) present at the terminal position of this glycan. A bioinformatic analysis of T. forsythia genomes revealed a gene locus for the synthesis of pseudaminic acid (Pse) in the type strain ATCC 43037 while strains FDC 92A2 and UB4 possess a locus for the synthesis of legionaminic acid (Leg) instead. In contrast to the NulO in ATCC 43037, which has been previously identified as a Pse derivative (5-N-acetimidoyl-7-N-glyceroyl-3,5,7,9-tetradeoxy-l-glycero-l-manno-NulO), glycan analysis of strain UB4 performed in this study indicated a 350-Da, possibly N-glycolyl Leg (3,5,7,9-tetradeoxy-d-glycero-d-galacto-NulO) derivative with unknown C5,7 N-acyl moieties. We have expressed, purified and characterized enzymes of both NulO pathways to confirm these genes’ functions. Using capillary electrophoresis (CE), CE–mass spectrometry and NMR spectroscopy, our studies revealed that Pse biosynthesis in ATCC 43037 essentially follows the UDP-sugar route described in Helicobacter pylori, while the pathway in strain FDC 92A2 corresponds to Leg biosynthesis in Campylobacter jejuni involving GDP-sugar intermediates. To demonstrate that the NulO biosynthesis enzymes are functional in vivo, we created knockout mutants resulting in glycans lacking the respective NulO. Compared to the wild-type strains, the mutants exhibited significantly reduced biofilm formation on mucin-coated surfaces, suggestive of their involvement in host-pathogen interactions or host survival. This study contributes to understanding possible biological roles of bacterial NulOs. PMID:27986835

  1. Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications.

    PubMed

    Friedrich, Valentin; Janesch, Bettina; Windwarder, Markus; Maresch, Daniel; Braun, Matthias L; Megson, Zoë A; Vinogradov, Evgeny; Goneau, Marie-France; Sharma, Ashu; Altmann, Friedrich; Messner, Paul; Schoenhofen, Ian C; Schäffer, Christina

    2016-12-16

    Tannerella forsythia is an anaerobic, Gram-negative periodontal pathogen. A unique O-linked oligosaccharide decorates the bacterium's cell surface proteins and was shown to modulate the host immune response. In our study, we investigated the biosynthesis of the nonulosonic acid (NulO) present at the terminal position of this glycan. A bioinformatic analysis of T. forsythia genomes revealed a gene locus for the synthesis of pseudaminic acid (Pse) in the type strain ATCC 43037 while strains FDC 92A2 and UB4 possess a locus for the synthesis of legionaminic acid (Leg) instead. In contrast to the NulO in ATCC 43037, which has been previously identified as a Pse derivative (5-N-acetimidoyl-7-N-glyceroyl-3,5,7,9-tetradeoxy-l-glycero-l-manno-NulO), glycan analysis of strain UB4 performed in this study indicated a 350-Da, possibly N-glycolyl Leg (3,5,7,9-tetradeoxy-d-glycero-d-galacto-NulO) derivative with unknown C5,7 N-acyl moieties. We have expressed, purified and characterized enzymes of both NulO pathways to confirm these genes' functions. Using capillary electrophoresis (CE), CE-mass spectrometry and NMR spectroscopy, our studies revealed that Pse biosynthesis in ATCC 43037 essentially follows the UDP-sugar route described in Helicobacter pylori, while the pathway in strain FDC 92A2 corresponds to Leg biosynthesis in Campylobacter jejuni involving GDP-sugar intermediates. To demonstrate that the NulO biosynthesis enzymes are functional in vivo, we created knockout mutants resulting in glycans lacking the respective NulO. Compared to the wild-type strains, the mutants exhibited significantly reduced biofilm formation on mucin-coated surfaces, suggestive of their involvement in host-pathogen interactions or host survival. This study contributes to understanding possible biological roles of bacterial NulOs.

  2. PHOSPHATIDIC ACID PHOSPHOHYDROLASE1 and 2 Regulate Phospholipid Synthesis at the Endoplasmic Reticulum in Arabidopsis[W

    PubMed Central

    Eastmond, Peter J.; Quettier, Anne-Laure; Kroon, Johan T.M.; Craddock, Christian; Adams, Nicolette; Slabas, Antoni R.

    2010-01-01

    Phospholipid biosynthesis is essential for the construction of most eukaryotic cell membranes, but how this process is regulated in plants remains poorly understood. Here, we show that in Arabidopsis thaliana, two Mg2+-dependent phosphatidic acid phosphohydrolases called PAH1 and PAH2 act redundantly to repress phospholipid biosynthesis at the endoplasmic reticulum (ER). Leaves from pah1 pah2 double mutants contain ~1.8-fold more phospholipid than the wild type and exhibit gross changes in ER morphology, which are consistent with massive membrane overexpansion. The net rate of incorporation of [methyl-14C]choline into phosphatidylcholine (PC) is ~1.8-fold greater in the double mutant, and the transcript abundance of several key genes that encode enzymes involved in phospholipid synthesis is increased. In particular, we show that PHOSPHORYLETHANOLAMINE N-METHYLTRANSFERASE1 (PEAMT1) is upregulated at the level of transcription in pah1 pah2 leaves. PEAMT catalyzes the first committed step of choline synthesis in Arabidopsis and defines a variant pathway for PC synthesis not found in yeasts or mammals. Our data suggest that PAH1/2 play a regulatory role in phospholipid synthesis that is analogous to that described in Saccharomyces cerevisiae. However, the target enzymes differ, and key components of the signal transduction pathway do not appear to be conserved. PMID:20699392

  3. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.

    PubMed

    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus

    2014-10-13

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  4. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  5. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.

    PubMed

    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G

    1998-06-01

    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  6. Nuclear Factor Erythroid 2-Related Factor 2 Facilitates Neuronal Glutathione Synthesis by Upregulating Neuronal Excitatory Amino Acid Transporter 3 Expression

    PubMed Central

    Escartin, Carole; Won, Seok Joon; Malgorn, Carole; Auregan, Gwennaelle; Berman, Ari E.; Chen, Pei-Chun; Déglon, Nicole; Johnson, Jeffrey A.; Suh, Sang Won; Swanson, Raymond A.

    2012-01-01

    Astrocytes support neuronal antioxidant capacity by releasing glutathione, which is cleaved to cysteine in brain extracellular space. Free cysteine is then taken up by neurons through excitatory amino acid transporter 3 [EAAT3; also termed Slc1a1 (solute carrier family 1 member 1)] to support de novo glutathione synthesis. Activation of the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant responsive element (ARE) pathway by oxidative stress promotes astrocyte release of glutathione, but it remains unknown how this release is coupled to neuronal glutathione synthesis. Here we evaluated transcriptional regulation of the neuronal cysteine transporter EAAT3 by the Nrf2-ARE pathway. Nrf2 activators and Nrf2 overexpression both produced EAAT3 transcriptional activation in C6 cells. A conserved ARE-related sequence was found in the EAAT3 promoter of several mammalian species. This ARE-related sequence was bound by Nrf2 in mouse neurons in vivo as observed by chromatin immunoprecipitation. Chemical activation of the Nrf2-ARE pathway in mouse brain increased both neuronal EAAT3 levels and neuronal glutathione content, and these effects were abrogated in mice genetically deficient in either Nrf2 or EAAT3. Selective overexpression of Nrf2 in brain neurons by lentiviral gene transfer was sufficient to upregulate both neuronal EAAT3 protein and glutathione content. These findings identify a mechanism whereby Nrf2 activation can coordinate astrocyte glutathione release with neuronal glutathione synthesis through transcriptional upregulation of neuronal EAAT3 expression. PMID:21593323

  7. Nuclear factor erythroid 2-related factor 2 facilitates neuronal glutathione synthesis by upregulating neuronal excitatory amino acid transporter 3 expression.

    PubMed

    Escartin, Carole; Won, Seok Joon; Malgorn, Carole; Auregan, Gwennaelle; Berman, Ari E; Chen, Pei-Chun; Déglon, Nicole; Johnson, Jeffrey A; Suh, Sang Won; Swanson, Raymond A

    2011-05-18

    Astrocytes support neuronal antioxidant capacity by releasing glutathione, which is cleaved to cysteine in brain extracellular space. Free cysteine is then taken up by neurons through excitatory amino acid transporter 3 [EAAT3; also termed Slc1a1 (solute carrier family 1 member 1)] to support de novo glutathione synthesis. Activation of the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant responsive element (ARE) pathway by oxidative stress promotes astrocyte release of glutathione, but it remains unknown how this release is coupled to neuronal glutathione synthesis. Here we evaluated transcriptional regulation of the neuronal cysteine transporter EAAT3 by the Nrf2-ARE pathway. Nrf2 activators and Nrf2 overexpression both produced EAAT3 transcriptional activation in C6 cells. A conserved ARE-related sequence was found in the EAAT3 promoter of several mammalian species. This ARE-related sequence was bound by Nrf2 in mouse neurons in vivo as observed by chromatin immunoprecipitation. Chemical activation of the Nrf2-ARE pathway in mouse brain increased both neuronal EAAT3 levels and neuronal glutathione content, and these effects were abrogated in mice genetically deficient in either Nrf2 or EAAT3. Selective overexpression of Nrf2 in brain neurons by lentiviral gene transfer was sufficient to upregulate both neuronal EAAT3 protein and glutathione content. These findings identify a mechanism whereby Nrf2 activation can coordinate astrocyte glutathione release with neuronal glutathione synthesis through transcriptional upregulation of neuronal EAAT3 expression.

  8. Improved production of fatty acid ethyl esters in Saccharomyces cerevisiae through up-regulation of the ethanol degradation pathway and expression of the heterologous phosphoketolase pathway.

    PubMed

    de Jong, Bouke Wim; Shi, Shuobo; Siewers, Verena; Nielsen, Jens

    2014-03-12

    Due to an increasing demand of transportation fuels, a lower availability of cheap crude oil and a lack of sustainability of fossil fuels, a gradual shift from petroleum based fuels towards alternative and renewable fuel resources will be required in the near future. Fatty acid ethyl esters (FAEEs) have properties similar to current crude diesel and could therefore form an important contribution to the development of sustainable transportation fuels in future. It is important to develop novel cell factories for efficient production of FAEEs and their precursors. Here, a Saccharomyces cerevisiae cell factory expressing a heterologous wax ester synthase (ws2) from Marinobacter hydrocarbonoclasticus was used to produce FAEEs from ethanol and acyl-coenzyme A (acyl-CoA). The production of acyl-CoA requires large amounts of NADPH and acetyl-CoA. Therefore, two metabolic engineering strategies for improved provision of NADPH and acetyl-CoA were evaluated. First, the ethanol degradation pathway was employed to re-channel carbon flow towards the synthesis of acetyl-CoA. Therefore, ADH2 and ALD6 encoding, respectively, alcohol dehydrogenase and acetaldehyde dehydrogenase were overexpressed together with the heterologous gene acsSEL641P encoding acetyl-CoA synthetase. The co-overexpression of ADH2, ALD6 and acsSEL641P with ws2 resulted in 408 ± 270 μg FAEE gCDW-1, a 3-fold improvement. Secondly, for the expression of the PHK pathway two genes, xpkA and ack, both descending from Aspergillus nidulans, were co-expressed together with ws2 to catalyze, respectively, the conversion of xylulose-5-phosphate to acetyl phosphate and glyceraldehyde-3-phosphate and acetyl phosphate to acetate. Alternatively, ack was substituted with pta from Bacillus subtilis, encoding phosphotransacetylase for the conversion of acetyl phosphate to acetyl-CoA. Both PHK pathways were additionally expressed in a strain with multiple chromosomally integrated ws2 gene, which resulted in respectively

  9. Improved production of fatty acid ethyl esters in Saccharomyces cerevisiae through up-regulation of the ethanol degradation pathway and expression of the heterologous phosphoketolase pathway

    PubMed Central

    2014-01-01

    Background Due to an increasing demand of transportation fuels, a lower availability of cheap crude oil and a lack of sustainability of fossil fuels, a gradual shift from petroleum based fuels towards alternative and renewable fuel resources will be required in the near future. Fatty acid ethyl esters (FAEEs) have properties similar to current crude diesel and could therefore form an important contribution to the development of sustainable transportation fuels in future. It is important to develop novel cell factories for efficient production of FAEEs and their precursors. Results Here, a Saccharomyces cerevisiae cell factory expressing a heterologous wax ester synthase (ws2) from Marinobacter hydrocarbonoclasticus was used to produce FAEEs from ethanol and acyl-coenzyme A (acyl-CoA). The production of acyl-CoA requires large amounts of NADPH and acetyl-CoA. Therefore, two metabolic engineering strategies for improved provision of NADPH and acetyl-CoA were evaluated. First, the ethanol degradation pathway was employed to re-channel carbon flow towards the synthesis of acetyl-CoA. Therefore, ADH2 and ALD6 encoding, respectively, alcohol dehydrogenase and acetaldehyde dehydrogenase were overexpressed together with the heterologous gene acsSEL641P encoding acetyl-CoA synthetase. The co-overexpression of ADH2, ALD6 and acsSEL641P with ws2 resulted in 408 ± 270 μg FAEE gCDW−1, a 3-fold improvement. Secondly, for the expression of the PHK pathway two genes, xpkA and ack, both descending from Aspergillus nidulans, were co-expressed together with ws2 to catalyze, respectively, the conversion of xylulose-5-phosphate to acetyl phosphate and glyceraldehyde-3-phosphate and acetyl phosphate to acetate. Alternatively, ack was substituted with pta from Bacillus subtilis, encoding phosphotransacetylase for the conversion of acetyl phosphate to acetyl-CoA. Both PHK pathways were additionally expressed in a strain with multiple chromosomally integrated ws2 gene, which

  10. Direct vs. indirect pathway of hepatic glycogen synthesis as a function of glucose infusion rate

    SciTech Connect

    Bagby, G.J.; Lang, C.H.; Johnson, J.L.; Blakesly, H.L.; Spitzer, J.J.

    1986-03-05

    This study was initiated to determine the influence of the rate of exogenous glucose administration on liver glycogen synthesis by the direct (glucose uptake and incorporation into glycogen) vs the indirect pathway (glucose degradation to 3-carbon intermediates, e.g., lactate, prior to incorporation into glycogen). Catheterized rats were fasted 2 days prior to receiving a 3 hr infusion of glucose at rates of 0 to 230 ..mu..mol/min/kg containing tracer (6-/sup 3/H)- and (U-/sup 14/C)-glucose. Plasma glucose (r = 0.80), insulin (r = 0.90) and lactate (r = 0.84) were correlated with glucose infusion rate. The rate of liver glycogen deposition (0.46 +/- 0.03 ..mu..mol/min/g) did not differ between a glucose infusion rate of 20 and 230 ..mu..mol/min/kg. At the lowest and highest glucose infusion rates hepatic glycogenesis accounted for 87 +/- 6 and 9 +/- 1% of the total glucose load, respectively. The percent contribution of the direct pathways to glycogen deposition ((/sup 3/H) specific activity in hepatic glycogen/(/sup 3/H) specific activity in plasma glucose) increased from 16 +/- 3 to 83 +/- 5% from lowest to highest glucose infusion rates (prevailing plasma glucose concentrations: 9 +/- 1 and 21 +/- 2 mM, respectively). The results indicate that the relative contribution of the direct and indirect pathways of glucogen synthesis are dependent upon the glucose load or plasma glucose concentration.

  11. Co-opting the Fanconi anemia genomic stability pathway enables herpesvirus DNA synthesis and productive growth.

    PubMed

    Karttunen, Heidi; Savas, Jeffrey N; McKinney, Caleb; Chen, Yu-Hung; Yates, John R; Hukkanen, Veijo; Huang, Tony T; Mohr, Ian

    2014-07-03

    DNA damage associated with viral DNA synthesis can result in double-strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi anemia (FA) genomic stability pathway is exploited by herpes simplex virus 1 (HSV-1) to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV-1-infected cells resulted in monoubiquitination of FA effector proteins FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments, and FANCI-D2 interacted with a multisubunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, whereas HSV-1 productive growth was impaired in monoubiquitination-defective FA cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for nonhomologous end-joining (NHEJ). This identifies the FA-pathway as a cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral life cycle.

  12. Harnessing Intracellular Biochemical Pathways for In Vitro Synthesis of Designer Tellurium Nanorods.

    PubMed

    Xiong, Ling-Hong; Cui, Ran; Zhang, Zhi-Ling; Tu, Jia-Wei; Shi, Yun-Bo; Pang, Dai-Wen

    2015-10-28

    Synthesizing nanomaterials of desired properties is a big challenge, which requires extremely harsh conditions and/or use of toxic materials. More recently developed in vivo methods have brought a different set of problems such as separation and purification of nanomaterials made in vivo. Here, a novel approach that harnesses cellular pathways for in vitro synthesis of high-quality tellurium nanorods with tunable lengths and optical properties is reported. It is first demonstrated that in vivo biochemical pathways could be used to synthesize Te nanorods via the intracellular reduction of TeO3(2-) in living Staphylococcus aureus cells. The pathways to set up a quasi-biological system for Te precursor formation are then utilized, which could further synthesize Te nanorods in vitro. This allows to successfully synthesize in vitro, under routine laboratory conditions, Te nanorods with uniform and tunable lengths, ranging from about 10 to 200 nm, and controllable optical properties with high molar extinction coefficients. The approach here should open new avenues for controllable, facile, and efficient synthesis of designer nanomaterials for diverse industrial and biomedical applications.

  13. Co-opting the Fanconi Anemia Genomic Stability Pathway Enables Herpesvirus DNA Synthesis and Productive Growth

    PubMed Central

    Karttunen, Heidi; Savas, Jeffrey N.; McKinney, Caleb; Chen, Yu-Hung; Yates, John R.; Hukkanen, Veijo; Huang, Tony T.; Mohr, Ian

    2015-01-01

    SUMMARY DNA damage associated with viral DNA synthesis can result in double strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi Anemia (FA) genomic stability pathway is exploited by HSV1 to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV1-infected cells resulted in monoubiquitination of FA effector proteins, FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments and FANCI-D2 interacted with a multi-subunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, while HSV1 productive growth was impaired in monoubiquitination-defective FA patient cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for non-homologous end-joining (NHEJ). This identifies the FA-pathway as a new cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral lifecycle. PMID:24954902

  14. Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways

    NASA Technical Reports Server (NTRS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-01-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

  15. Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways

    NASA Astrophysics Data System (ADS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-09-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (δD, δ13C, and δ15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing δ13C and increasing δD with increasing carbon number in the α-H, α-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light δ13C signatures for β-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ω-amino acids). Higher deuterium enrichments are observed in α-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

  16. Apigenin induces dermal collagen synthesis via smad2/3 signaling pathway.

    PubMed

    Zhang, Y; Wang, J; Cheng, X; Yi, B; Zhang, X; Li, Q

    2015-04-13

    Decrease in fibroblast-produced collagen has been proven to be the pivotal cause of skin aging, but there is no satisfactory drug which directly increases dermal thickness and collage density. Here we found that a flavonoid natural product, apigenin, could significantly increase collagen synthesis. NIH/3T3 and primary human dermal fibroblasts (HDFs) were incubated with various concentrations of apigenin, with dimethyl sulfoxide (DMSO) serving as the negative control. Real-time reverse-transcription polymerase chain reaction (PCR), Western Blot, and Toluidine blue staining demonstrated that apigenin stimulated type-I and type-III collagen synthesis of fibroblasts on the mRNA and protein levels. Meanwhile, apigenin did not induce expression of alpha smooth muscle actin (α-SMA) in vitro and in vivo, a fibrotic marker in living tissues. Then the production of collagen was confirmed by Masson's trichrome stain, Picrosirius red stain and immunohistochemistry in mouse models. We also clarified that this compound induced collagen synthesis by activating smad2/3 signaling pathway. Taken together, without obvious influence on fibroblasts' apoptosis and viability, apigenin could promote the type-I and type-III collagen synthesis of dermal fibroblasts in vitro and in vivo, thus suggesting that apigenin may serve as a potential agent for esthetic and reconstructive skin rejuvenation.

  17. Apigenin Induces Dermal Collagen Synthesis Via smad2/3 Signaling Pathway

    PubMed Central

    Zhang, Y.; Wang, J.; Cheng, X.; Yi, B.; Zhang, X.; Li, Q.

    2015-01-01

    Decrease in fibroblast-produced collagen has been proven to be the pivotal cause of skin aging, but there is no satisfactory drug which directly increases dermal thickness and collage density. Here we found that a flavonoid natural product, apigenin, could significantly increase collagen synthesis. NIH/3T3 and primary human dermal fibroblasts (HDFs) were incubated with various concentrations of apigenin, with dimethyl sulfoxide (DMSO) serving as the negative control. Real-time reverse-transcription polymerase chain reaction (PCR), Western Blot, and Toluidine blue staining demonstrated that apigenin stimulated type-I and type-III collagen synthesis of fibroblasts on the mRNA and protein levels. Meanwhile, apigenin did not induce expression of alpha smooth muscle actin (α-SMA) in vitro and in vivo, a fibrotic marker in living tissues. Then the production of collagen was confirmed by Masson’s trichrome stain, Picrosirius red stain and immunohistochemistry in mouse models. We also clarified that this compound induced collagen synthesis by activating smad2/3 signaling pathway. Taken together, without obvious influence on fibroblasts’ apoptosis and viability, apigenin could promote the type-I and type-III collagen synthesis of dermal fibroblasts in vitro and in vivo, thus suggesting that apigenin may serve as a potential agent for esthetic and reconstructive skin rejuvenation. PMID:26150153

  18. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng

    2009-07-01

    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  19. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  20. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  1. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei

    2011-01-01

    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  2. Acetolactate synthase regulatory subunits play divergent and overlapping roles in branched-chain amino acid synthesis and Arabidopsis development.

    PubMed

    Dezfulian, Mohammad H; Foreman, Curtis; Jalili, Espanta; Pal, Mrinal; Dhaliwal, Rajdeep K; Roberto, Don Karl A; Imre, Kathleen M; Kohalmi, Susanne E; Crosby, William L

    2017-04-07

    Branched-chain amino acids (BCAAs) are synthesized by plants, fungi, bacteria, and archaea with plants being the major source of these amino acids in animal diets. Acetolactate synthase (ALS) is the first enzyme in the BCAA synthesis pathway. Although the functional contribution of ALS to BCAA biosynthesis has been extensively characterized, a comprehensive understanding of the regulation of this pathway at the molecular level is still lacking. To characterize the regulatory processes governing ALS activity we utilized several complementary approaches. Using the ALS catalytic protein subunit as bait we performed a yeast two-hybrid (Y2H) screen which resulted in the identification of a set of interacting proteins, two of which (denoted as ALS-INTERACTING PROTEIN1 and 3 [AIP1 and AIP3, respectively]) were found to be evolutionarily conserved orthologues of bacterial feedback-regulatory proteins and therefore implicated in the regulation of ALS activity. To investigate the molecular role AIPs might play in BCAA synthesis in Arabidopsis thaliana, we examined the functional contribution of aip1 and aip3 knockout alleles to plant patterning and development and BCAA synthesis under various growth conditions. Loss-of-function genetic backgrounds involving these two genes exhibited differential aberrant growth responses in valine-, isoleucine-, and sodium chloride-supplemented media. While BCAA synthesis is believed to be localized to the chloroplast, both AIP1 and AIP3 were found to localize to the peroxisome in addition to the chloroplast. Analysis of free amino acid pools in the mutant backgrounds revealed that they differ in the absolute amount of individual BCAAs accumulated and exhibit elevated levels of BCAAs in leaf tissues. Despite the phenotypic differences observed in aip1 and aip3 backgrounds, functional redundancy between these loci was suggested by the finding that aip1/aip3 double knockout mutants are severely developmentally compromised. Taken together the

  3. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.

    1966-01-01

    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  4. Unsaturated Fatty Acid Synthesis in the Gastric Pathogen Helicobacter pylori Proceeds via a Backtracking Mechanism.

    PubMed

    Bi, Hongkai; Zhu, Lei; Jia, Jia; Zeng, Liping; Cronan, John E

    2016-12-22

    Helicobacter pylori is a Gram-negative bacterium that inhabits the upper gastrointestinal tract in humans, and the presence of this pathogen in the gut microbiome increases the risk of peptic ulcers and stomach cancer. H. pylori depends on unsaturated fatty acid (UFA) biosynthesis for maintaining membrane structure and function. Although some of the H. pylori enzymes involved in UFA biosynthesis are functionally homologous with the enzymes found in Escherichia coli, we show here that an enzyme HP0773, now annotated as FabX, uses an unprecedented backtracking mechanism to not only dehydrogenate decanoyl-acyl carrier protein (ACP) in a reaction that parallels that of acyl-CoA dehydrogenase, the first enzyme of the fatty acid β-oxidation cycle, but also isomerizes trans-2-decenoyl-ACP to cis-3-decenoyl-ACP, the key UFA synthetic intermediate. Thus, FabX reverses the normal fatty acid synthesis cycle in H. pylori at the C10 stage. Overall, this unusual FabX activity may offer a broader explanation for how many bacteria that lack the canonical pathway enzymes produce UFA-containing phospholipids.

  5. Nucleic acid sensing and innate immunity: signaling pathways controlling viral pathogenesis and autoimmunity

    PubMed Central

    Ahlers, Laura R. H.; Goodman, Alan G.

    2016-01-01

    Innate immunity refers to the body’s initial response to curb infection upon exposure to invading organisms. While the detection of pathogen-associated molecules is an ancient form of host defense, if dysfunctional, autoimmune disease may result. The innate immune response during pathogenic infection is initiated through the activation of receptors recognizing conserved molecular patterns, such as nucleic acids from a virus’ genome or replicative cycle. Additionally, the host’s own nucleic acids are capable of activating an immune response. Therefore, it follows that the nucleic acid-sensing pathways must be tightly controlled to avoid an autoimmune response from recognition of self, yet still be unimpeded to respond to viral infections. In this review, we will describe the nucleic acid sensing pathways and how they respond to virus infection. Moreover, we will discuss autoimmune diseases that develop when these pathways fail to signal properly and identify knowledge gaps that are prime for interrogation. PMID:27857881

  6. Recent advances in targeting the fatty acid biosynthetic pathway using fatty acid synthase inhibitors.

    PubMed

    Angeles, Thelma S; Hudkins, Robert L

    2016-12-01

    Elevated lipogenesis has been associated with a variety of diseases including obesity, cancer and nonalcoholic fatty liver disease (NAFLD). Fatty acid synthase (FASN) plays a pivotal role in de novo lipogenesis, making this multi-catalytic protein an attractive target for therapeutic intervention. Recently, the first FASN inhibitor successfully advanced through the drug development process and entered clinical evaluation in oncology. Areas covered: This review discusses the biological roles of FASN in three prominent disease areas: cancer, obesity-related disorders and NAFLD. Recent advances in drug discovery strategies and design of newer FASN inhibitors are also highlighted. Expert opinion: Despite the abundance of evidence linking the lipogenic pathway to cancer, progression of FASN-targeted molecules has been rather slow and challenging and no compounds have moved past the preclinical phase. The landscape has recently changed with the recent advancement of the first FASN inhibitor into clinical evaluation for solid tumors. Needless to say, the successful translation into the clinical setting will open opportunities for expanding the therapeutic utility of FASN inhibitors not just in oncology but in other diseases associated with elevated lipogenesis such as obesity, type 2 diabetes, and NAFLD.

  7. Identification of a conserved protein involved in anaerobic unsaturated fatty acid synthesis in Neiserria gonorrhoeae: implications for facultative and obligate anaerobes that lack FabA.

    PubMed

    Isabella, Vincent M; Clark, Virginia L

    2011-10-01

    Transcriptome analysis of the facultative anaerobe, Neisseria gonorrhoeae, revealed that many genes of unknown function were induced under anaerobic conditions. Mutation of one such gene, NGO1024, encoding a protein belonging to the 2-nitropropane dioxygenase-like superfamily of proteins, was found to result in an inability of gonococci to grow anaerobically. Anaerobic growth of an NG1024 mutant was restored upon supplementation with unsaturated fatty acids (UFA), but not with the saturated fatty acid palmitate. Gonococcal fatty acid profiles confirmed that NGO1024 was involved in UFA synthesis anaerobically, but not aerobically, demonstrating that gonococci contain two distinct pathways for the production of UFAs, with a yet unidentified aerobic mechanism, and an anaerobic mechanism involving NGO1024. Expression of genes involved in classical anaerobic UFA synthesis, fabA, fabM and fabB, was toxic in gonococci and unable to complement a NGO1024 mutation, suggesting that the chemistry involved in gonococcal anaerobic UFA synthesis is distinct from that of the classical pathway. NGO1024 homologues, which we suggest naming UfaA, form a distinct lineage within the 2-nitropropane dioxygenase-like superfamily, and are found in many facultative and obligate anaerobes that produce UFAs but lack fabA, suggesting that UfaA is part of a widespread pathway involved in UFA synthesis.

  8. Effect of the quality of dietary amino acids composition on the urea synthesis in rats.

    PubMed

    Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko

    2011-01-01

    We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.

  9. Omega-6 and omega-3 fatty acids metabolism pathways in the body of pigs fed diets with different sources of fatty acids.

    PubMed

    Skiba, Grzegorz; Poławska, Ewa; Sobol, Monika; Raj, Stanisława; Weremko, Dagmara

    2015-01-01

    This study was carried out on 24 gilts (♀ Polish Large White × ♂ Danish Landrace) grown with body weight (BW) of 60 to 105 kg. The pigs were fed diets designed on the basis of a standard diet (appropriate for age and BW of pigs) where a part of the energy content was replaced by different fat supplements: linseed oil in Diet L, rapeseed oil in Diet R and fish oil in Diet F (6 gilts per dietary treatment). The fat supplements were sources of specific fatty acids (FA): in Diet L α-linolenic acid (C18:3 n-3, ALA); in Diet R linoleic acid (C18:2 n-6, LA) and in Diet F eicosapentaenoic acid (C20:5 n-3, EPA), docosapentaenoic acid (C22:5 n-3, DPA) and docosahexaenoic acid (C22:6 n-3, DHA). The protein, fat and total FA contents in the body did not differ among groups of pigs. The enhanced total intake of LA and ALA by pigs caused an increased deposition of these FA in the body (p < 0.01) and an increased potential body pool of these acids for further metabolism/conversions. The conversion efficiency of LA and ALA from the feed to the pig's body differed among groups (p < 0.01) and ranged from 64.4% to 67.2% and from 69.4% to 81.7%, respectively. In Groups L and R, the level of de novo synthesis of long-chain polyunsaturated FA was higher than in Group F. From the results, it can be concluded that the efficiency of deposition is greater for omega-3 FA than for omega-6 FA and depends on their dietary amount. The level of LA and ALA intake influences not only their deposition in the body but also the end products of the omega-3 and omega-6 pathways.

  10. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  11. Saturated fatty acids activate TLR-mediated proinflammatory signaling pathways.

    PubMed

    Huang, Shurong; Rutkowsky, Jennifer M; Snodgrass, Ryan G; Ono-Moore, Kikumi D; Schneider, Dina A; Newman, John W; Adams, Sean H; Hwang, Daniel H

    2012-09-01

    Toll-like receptor 4 (TLR4) and TLR2 were shown to be activated by saturated fatty acids (SFAs) but inhibited by docosahexaenoic acid (DHA). However, one report suggested that SFA-induced TLR activation in cell culture systems is due to contaminants in BSA used for solubilizing fatty acids. This report raised doubt about proinflammatory effects of SFAs. Our studies herein demonstrate that sodium palmitate (C16:0) or laurate (C12:0) without BSA solubilization induced phosphorylation of inhibitor of nuclear factor-κB α, c-Jun N-terminal kinase (JNK), p44/42 mitogen-activated-kinase (ERK), and nuclear factor-κB subunit p65, and TLR target gene expression in THP1 monocytes or RAW264.7 macrophages, respectively, when cultured in low FBS (0.25%) medium. C12:0 induced NFκB activation through TLR2 dimerized with TLR1 or TLR6, and through TLR4. Because BSA was not used in these experiments, contaminants in BSA have no relevance. Unlike in suspension cells (THP-1), BSA-solubilized C16:0 instead of sodium C16:0 is required to induce TLR target gene expression in adherent cells (RAW264.7). C16:0-BSA transactivated TLR2 dimerized with TLR1 or TLR6 and through TLR4 as seen with C12:0. These results and additional studies with the LPS sequester polymixin B and in MyD88(-/-) macrophages indicated that SFA-induced activation of TLR2 or TLR4 is a fatty acid-specific effect, but not due to contaminants in BSA or fatty acid preparations.

  12. Lysophosphatidic Acid Synthesis and its Receptors' Expression in the Bovine Oviduct During the Oestrous Cycle.

    PubMed

    Sinderewicz, E; Grycmacher, K; Boruszewska, D; Kowalczyk-Zięba, I; Yamamoto, Y; Yoshimoto, Y; Woclawek-Potocka, I

    2016-08-01

    Lysophosphatidic acid (LPA) is a naturally occurring simple phospholipid which in the bovine reproductive system can be produced in the endometrium, corpus luteum, ovarian follicle and embryo. In this study, we examined the possibility that LPA receptors are expressed, and LPA synthesized, in the bovine oviduct. We found that the concentration of LPA was highest in infundibulum in the follicular phase of the oestrous cycle and was relatively high during the early-luteal phase in all examined parts of the oviduct. We also documented that LPA synthesis engages both available pathways for LPA production. The autotaxin (ATX) protein expression was significantly higher in the infundibulum compared to the isthmus during the follicular phase of the oestrous cycle. During the early-luteal phase of the oestrous cycle, ATX and phospholipase A2 (PLA2) protein expression was highest in ampulla, although the expression of LPARs was not as dynamic as LPA concentration in the oviduct tissue, and we presume that in the bovine oviduct, the most abundantly expressed receptor is LPAR2. In conclusion, our results indicate that the bovine oviduct is a site of LPA synthesis and a target for LPA action in the bovine reproductive tract. We documented that LPAR2 is the most abundantly expressed in the bovine oviduct. We hypothesize that in the bovine oviduct, LPA may be involved in the transport of gametes, fertilization and cellular signalling between the oviduct and cumulus-oocyte complex. © 2016 Blackwell Verlag GmbH.

  13. Suppression of brain cholesterol synthesis in male Mecp2-deficient mice is age dependent and not accompanied by a concurrent change in the rate of fatty acid synthesis.

    PubMed

    Lopez, Adam M; Chuang, Jen-Chieh; Posey, Kenneth S; Turley, Stephen D

    2017-01-01

    Mutations in the X-linked gene methyl-CpG-binding protein 2 (MECP2) are the principal cause of Rett syndrome, a progressive neurodevelopmental disorder afflicting 1 in 10,000 to 15,000 females. Studies using hemizygous Mecp2 mouse models have revealed disruptions to some aspects of their lipid metabolism including a partial suppression of cholesterol synthesis in the brains of mature Mecp2 mutants. The present studies investigated whether this suppression is evident from early neonatal life, or becomes manifest at a later stage of development. We measured the rate of cholesterol synthesis, in vivo, in the brains of male Mecp2(-)(/y) and their Mecp2(+/y) littermates at 7, 14, 21, 28, 42 and 56 days of age. Brain weight was consistently lower in the Mecp2(-/y) mice than in their Mecp2(+/y) controls except at 7 days of age. In the 7- and 14-day-old mice there was no genotypic difference in the rate of brain cholesterol synthesis but, from 21 days and later, it was always marginally lower in the Mecp2(-/y) mice than in age-matched Mecp2(+/y) littermates. At no age was a genotypic difference detected in either the rate of fatty acid synthesis or cholesterol concentration in the brain. Cholesterol synthesis rates in the liver and lungs of 56-day-old Mecp2(-/y) mice were normal. The onset of lower rates of brain cholesterol synthesis at about the time closure of the blood brain barrier purportedly occurs might signify a disruption to mechanism(s) that dictate intracellular levels of cholesterol metabolites including oxysterols known to exert a regulatory influence on the cholesterol biosynthetic pathway. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  15. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  16. Metabolic intervention on lipid synthesis converging pathways abrogates prostate cancer growth.

    PubMed

    Fritz, V; Benfodda, Z; Henriquet, C; Hure, S; Cristol, J-P; Michel, F; Carbonneau, M-A; Casas, F; Fajas, L

    2013-10-17

    One of the most conserved features of all cancers is a profound reprogramming of cellular metabolism, favoring biosynthetic processes and limiting catalytic processes. With the acquired knowledge of some of these important changes, we have designed a combination therapy in order to force cancer cells to use a particular metabolic pathway that ultimately results in the accumulation of toxic products. This innovative approach consists of blocking lipid synthesis, at the same time that we force the cell, through the inhibition of AMP-activated kinase, to accumulate toxic intermediates, such as malonyl-coenzyme A (malonyl-CoA) or nicotinamide adenine dinucleotide phosphate. This results in excess of oxidative stress and cancer cell death. Our new therapeutic strategy, based on the manipulation of metabolic pathways, will certainly set up the basis for new upcoming studies defining a new paradigm of cancer treatment.

  17. Metabolic pathways for lipid synthesis under nitrogen stress in Chlamydomonas and Nannochloropsis.

    PubMed

    Banerjee, Avik; Maiti, Subodh K; Guria, Chandan; Banerjee, Chiranjib

    2017-01-01

    Microalgae are currently being considered as a clean, sustainable and renewable energy source. Enzymes that catalyse the metabolic pathways for biofuel production are specific and require strict regulation and co-ordination. Thorough knowledge of these key enzymes along with their regulatory molecules is essential to enable rational metabolic engineering, to drive the metabolic flux towards the desired metabolites of importance. This paper reviews two key enzymes that play their role in production of bio-oil: DGAT (acyl-CoA:diacylglycerol acyltransferase) and PDAT (phospholipid:diacylglycerol acyltransferase). It also deals with the transcription factors that control the enzymes while cell undergoes a metabolic shift under stress. The paper also discusses the association of other enzymes and pathways that provide substrates and precursors for oil accumulation. Finally a futuristic solution has been proposed about a synthetic algal cell platform that would be committed towards biofuel synthesis.

  18. Nuclear Fraction of Bacillus subtilis as a Template for Ribonucleic Acid Synthesis

    PubMed Central

    Mizuno, S.; Whiteley, H. R.

    1968-01-01

    A “nuclear fraction” prepared from Bacillus subtilis was a more efficient template than purified deoxyribonucleic acid for the synthesis of ribonucleic acid by exogenously added ribonucleic acid polymerase isolated from B. subtilis. The initial rate of synthesis with the nuclear fraction was higher and synthesis continued for several hours, yielding an amount of ribonucleic acid greater than the amount of deoxyribonucleic acid used as the template. The product was heterogenous in size, with a large portion exceeding 23S. When purified deoxyribonucleic acid was the template, a more limited synthesis was observed with a predominantly 7S product. However, the ribonucleic acids produced in vitro from these templates were very similar to each other and to in vivo synthesized ribonucleic acid as determined by the competition of ribonucleic acid from whole cells in the annealing of in vitro synthesized ribonucleic acids to deoxyribonucleic acid. Treatment of the nuclear fraction with heat (60 C for 15 min) or trypsin reduced the capacity of the nuclear fraction to synthesize ribonucleic acid to the level observed with purified deoxyribonucleic acid. PMID:4296512

  19. Mutations in the Prokaryotic Pathway Rescue the fatty acid biosynthesis1 Mutant in the Cold1[OPEN

    PubMed Central

    Gao, Jinpeng; Wallis, James G.; Browse, John

    2015-01-01

    The Arabidopsis (Arabidopsis thaliana) fatty acid biosynthesis1 (fab1) mutant has increased levels of the saturated fatty acid 16:0 due to decreased activity of 3-ketoacyl-acyl carrier protein (ACP) synthase II. In fab1 leaves, phosphatidylglycerol, the major chloroplast phospholipid, contains up to 45% high-melting-point molecular species (molecules that contain only 16:0, 16:1-trans, and 18:0), a trait associated with chilling-sensitive plants, compared with less than 10% in wild-type Arabidopsis. Although they do not exhibit typical chilling sensitivity, when exposed to low temperatures (2°C–6°C) for long periods, fab1 plants do suffer collapse of photosynthesis, degradation of chloroplasts, and eventually death. A screen for suppressors of this low-temperature phenotype has identified 11 lines, some of which contain additional alterations in leaf-lipid composition relative to fab1. Here, we report the identification of two suppressor mutations, one in act1, which encodes the chloroplast acyl-ACP:glycerol-3-phosphate acyltransferase, and one in lpat1, which encodes the chloroplast acyl-ACP:lysophosphatidic acid acyltransferase. These enzymes catalyze the first two steps of the prokaryotic pathway for glycerolipid synthesis, so we investigated whether other mutations in this pathway would rescue the fab1 phenotype. Both the gly1 mutation, which reduces glycerol-3-phosphate supply to the prokaryotic pathway, and fad6, which is deficient in the chloroplast 16:1/18:1 fatty acyl desaturase, were discovered to be suppressors. Analyses of leaf-lipid compositions revealed that mutations at all four of the suppressor loci result in reductions in the proportion of high-melting-point molecular species of phosphatidylglycerol relative to fab1. We conclude that these reductions are likely the basis for the suppressor phenotypes. PMID:26224803

  20. Synthesis of different deuterated carboxylic acids from unsaturated acids promoted by samarium diiodide and D2O.

    PubMed

    Concellón, José M; Rodríguez-Solla, Humberto

    2002-10-04

    An easy, and rapid reduction of the Cdbond;C bond of alpha,beta-unsaturated acids by means of samarium diiodide in the presence of D(2)O provides an efficient method for synthesizing 2,3-dideuterio acids. Starting from alka-2,4-dienoic acids, (E)-alpha,delta-dideuterio-betagamma-unsaturated acids are obtained, the new Cdbond;C bond being generated with complete diastereoselectivity. When H(2)O is used instead of D(2)O, saturated carboxylic acids and (E)-beta,gamma-unsaturated acids are isolated. A mechanism to explain each synthesis has been proposed.

  1. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  2. Metabolic engineering of Escherichia coli for production of salvianic acid A via an artificial biosynthetic pathway.

    PubMed

    Yao, Yuan-Feng; Wang, Chang-Song; Qiao, Jianjun; Zhao, Guang-Rong

    2013-09-01

    Salvianic acid A, a valuable derivative from L-tyrosine biosynthetic pathway of the herbal plant Salvia miltiorrhiza, is well known for its antioxidant activities and efficacious therapeutic potential on cardiovascular diseases. Salvianic acid A was traditionally isolated from plant root or synthesized by chemical methods, both of which had low efficiency. Herein, we developed an unprecedented artificial biosynthetic pathway of salvianic acid A in E. coli, enabling its production from glucose directly. In this pathway, 4-hydroxyphenylpyruvate was converted to salvianic acid A via D-lactate dehydrogenase (encoding by d-ldh from Lactobacillus pentosus) and hydroxylase complex (encoding by hpaBC from E. coli). Furthermore, we optimized the pathway by a modular engineering approach and deleting genes involved in the regulatory and competing pathways. The metabolically engineered E. coli strain achieved high productivity of salvianic acid A (7.1g/L) with a yield of 0.47mol/mol glucose. © 2013 Elsevier Inc. All rights reserved.

  3. The effects of centrally injected arachidonic acid on respiratory system: Involvement of cyclooxygenase to thromboxane signaling pathway.

    PubMed

    Erkan, Leman Gizem; Guvenc, Gokcen; Altinbas, Burcin; Niaz, Nasir; Yalcin, Murat

    2016-05-01

    Arachidonic acid (AA) is a polyunsaturated fatty acid that is present in the phospholipids of the cell membranes of the body and is abundant in the brain. Exogenously administered AA has been shown to affect brain metabolism and to exhibit cardiovascular and neuroendocrine actions. However, little is known regarding its respiratory actions and/or central mechanism of its respiratory effects. Therefore, the present study was designed to investigate the possible effects of centrally injected AA on respiratory system and the mediation of the central cyclooxygenase (COX) to thromboxane A2 (TXA2) signaling pathway on AA-induced respiratory effects in anaesthetized rats. Intracerebroventricular (i.c.v.) administration of AA induced dose- and time-dependent increase in tidal volume, respiratory rates and respiratory minute ventilation and also caused an increase in partial oxygen pressure (pO2) and decrease in partial carbon dioxide pressure (pCO2) in male anaesthetized Spraque Dawley rats. I.c.v. pretreatment with ibuprofen, a non-selective COX inhibitor, completely blocked the hyperventilation and blood gases changes induced by AA. In addition, central pretreatment with different doses of furegrelate, a TXA2 synthesis inhibitor, also partially prevented AA-evoked hyperventilation and blood gases effects. These data explicitly show that centrally administered AA induces hyperventilation with increasing pO2 and decreasing pCO2 levels which are mediated by the activation of central COX to TXA2 signaling pathway.

  4. Transcript profile analysis reveals important roles of jasmonic acid signalling pathway in the response of sweet potato to salt stress

    PubMed Central

    Zhang, Huan; Zhang, Qian; Zhai, Hong; Li, Yan; Wang, Xiangfeng; Liu, Qingchang; He, Shaozhen

    2017-01-01

    Sweet potato is an important food and bio-energy crop, and investigating the mechanisms underlying salt tolerance will provide information for salt-tolerant breeding of this crop. Here, the root transcriptomes of the salt-sensitive variety Lizixiang and the salt-tolerant line ND98 were compared to identify the genes and pathways involved in salt stress responses. In total, 8,744 and 10,413 differentially expressed genes (DEGs) in Lizixiang and ND98, respectively, were involved in salt responses. A lower DNA methylation level was detected in ND98 than in Lizixiang. In both genotypes, the DEGs, which function in phytohormone synthesis and signalling and ion homeostasis, may underlie the different degrees of salt tolerance. Significant up-regulations of the genes involved in the jasmonic acid (JA) biosynthesis and signalling pathways and ion transport, more accumulation of JA, a higher degree of stomatal closure and a lower level of Na+ were found in ND98 compared to Lizixiang. This is the first report on transcriptome responses to salt tolerance in sweet potato. These results reveal that the JA signalling pathway plays important roles in the response of sweet potato to salt stress. This study provides insights into the mechanisms and genes involved in the salt tolerance of sweet potato. PMID:28084460

  5. Transcript profile analysis reveals important roles of jasmonic acid signalling pathway in the response of sweet potato to salt stress.

    PubMed

    Zhang, Huan; Zhang, Qian; Zhai, Hong; Li, Yan; Wang, Xiangfeng; Liu, Qingchang; He, Shaozhen

    2017-01-13

    Sweet potato is an important food and bio-energy crop, and investigating the mechanisms underlying salt tolerance will provide information for salt-tolerant breeding of this crop. Here, the root transcriptomes of the salt-sensitive variety Lizixiang and the salt-tolerant line ND98 were compared to identify the genes and pathways involved in salt stress responses. In total, 8,744 and 10,413 differentially expressed genes (DEGs) in Lizixiang and ND98, respectively, were involved in salt responses. A lower DNA methylation level was detected in ND98 than in Lizixiang. In both genotypes, the DEGs, which function in phytohormone synthesis and signalling and ion homeostasis, may underlie the different degrees of salt tolerance. Significant up-regulations of the genes involved in the jasmonic acid (JA) biosynthesis and signalling pathways and ion transport, more accumulation of JA, a higher degree of stomatal closure and a lower level of Na(+) were found in ND98 compared to Lizixiang. This is the first report on transcriptome responses to salt tolerance in sweet potato. These results reveal that the JA signalling pathway plays important roles in the response of sweet potato to salt stress. This study provides insights into the mechanisms and genes involved in the salt tolerance of sweet potato.

  6. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.

    PubMed

    Suć, Josipa; Jerić, Ivanka

    2015-01-01

    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  7. Synthesis of Fatty Acid Esters of Selected Higher Polyols Over Homogeneous Metallic Catalysts.

    PubMed

    Nowicki, Janusz; Stańczyk, Dorota; Drabik, Jolanta; Mosio-Mosiewski, Jan; Woszczyński, Piotr; Warzała, Marek

    Studies on the synthesis of esters of natural origin fatty acids (oleic acid) and a branched synthetic isostearic acid derived from oleic acid with commercially available selected higher polyols in the presence of homogeneous metallic catalysts have been carried out. The effects of the synthesis temperature, molar ratio and the catalysts amount have also been studied. It was shown that higher fatty acid conversion and selectivity to tri- and tetraesters were obtained for organotin catalyst Fascat 2003, which was used as the esterification catalyst. Anti-wear test confirmed good tribological properties of the obtained esters.