Sample records for acid synthesis pathway

  1. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams


    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  2. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.


    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams


    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  3. Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

    SciTech Connect

    Chander, A.; Gullo, J.; Reicherter, J.; Fisher, A.


    Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased only by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.

  4. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.


    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  5. Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.

  6. Bacterial Fatty Acid Synthesis and its Relationships with Polyketide Synthetic Pathways

    PubMed Central

    Cronan, John E.; Thomas, Jacob


    This review presents the most thoroughly studied bacterial fatty acid synthetic pathway, that of Escherichia coli and then discusses the exceptions to the E. coli pathway present in other bacteria. The known interrelationships between the fatty acid and polyketide synthetic pathways are also assessed, mainly in the Streptomyces group of bacteria. Finally, we present a compendium of methods for analysis of bacterial fatty acid synthetic pathways. PMID:19362649

  7. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.


    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki


    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9. PMID:24184513

  8. Maintenance of essential amino acid synthesis pathways in the Blattabacterium cuenoti symbiont of a wood-feeding cockroach

    PubMed Central

    Tokuda, Gaku; Elbourne, Liam D. H.; Kinjo, Yukihiro; Saitoh, Seikoh; Sabree, Zakee; Hojo, Masaru; Yamada, Akinori; Hayashi, Yoshinobu; Shigenobu, Shuji; Bandi, Claudio; Paulsen, Ian T.; Watanabe, Hirofumi; Lo, Nathan


    In addition to harbouring intestinal symbionts, some animal species also possess intracellular symbiotic microbes. The relative contributions of gut-resident and intracellular symbionts to host metabolism, and how they coevolve are not well understood. Cockroaches and the termite Mastotermes darwiniensis present a unique opportunity to examine the evolution of spatially separated symbionts, as they harbour gut symbionts and the intracellular symbiont Blattabacterium cuenoti. The genomes of B. cuenoti from M. darwiniensis and the social wood-feeding cockroach Cryptocercus punctulatus are each missing most of the pathways for the synthesis of essential amino acids found in the genomes of relatives from non-wood-feeding hosts. Hypotheses to explain this pathway degradation include: (i) feeding on microbes present in rotting wood by ancestral hosts; (ii) the evolution of high-fidelity transfer of gut microbes via social behaviour. To test these hypotheses, we sequenced the B. cuenoti genome of a third wood-feeding species, the phylogenetically distant and non-social Panesthia angustipennis. We show that host wood-feeding does not necessarily lead to degradation of essential amino acid synthesis pathways in B. cuenoti, and argue that ancestral high-fidelity transfer of gut microbes best explains their loss in strains from M. darwiniensis and C. punctulatus. PMID:23515978

  9. Maintenance of essential amino acid synthesis pathways in the Blattabacterium cuenoti symbiont of a wood-feeding cockroach.


    Tokuda, Gaku; Elbourne, Liam D H; Kinjo, Yukihiro; Saitoh, Seikoh; Sabree, Zakee; Hojo, Masaru; Yamada, Akinori; Hayashi, Yoshinobu; Shigenobu, Shuji; Bandi, Claudio; Paulsen, Ian T; Watanabe, Hirofumi; Lo, Nathan


    In addition to harbouring intestinal symbionts, some animal species also possess intracellular symbiotic microbes. The relative contributions of gut-resident and intracellular symbionts to host metabolism, and how they coevolve are not well understood. Cockroaches and the termite Mastotermes darwiniensis present a unique opportunity to examine the evolution of spatially separated symbionts, as they harbour gut symbionts and the intracellular symbiont Blattabacterium cuenoti. The genomes of B. cuenoti from M. darwiniensis and the social wood-feeding cockroach Cryptocercus punctulatus are each missing most of the pathways for the synthesis of essential amino acids found in the genomes of relatives from non-wood-feeding hosts. Hypotheses to explain this pathway degradation include: (i) feeding on microbes present in rotting wood by ancestral hosts; (ii) the evolution of high-fidelity transfer of gut microbes via social behaviour. To test these hypotheses, we sequenced the B. cuenoti genome of a third wood-feeding species, the phylogenetically distant and non-social Panesthia angustipennis. We show that host wood-feeding does not necessarily lead to degradation of essential amino acid synthesis pathways in B. cuenoti, and argue that ancestral high-fidelity transfer of gut microbes best explains their loss in strains from M. darwiniensis and C. punctulatus. PMID:23515978

  10. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    SciTech Connect

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.


    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease.

  11. Altering the Mitochondrial Fatty Acid Synthesis (mtFASII) Pathway Modulates Cellular Metabolic States and Bioactive Lipid Profiles as Revealed by Metabolomic Profiling

    PubMed Central

    Clay, Hayley B.; Parl, Angelika K.; Mitchell, Sabrina L.; Singh, Larry; Bell, Lauren N.; Murdock, Deborah G.


    Despite the presence of a cytosolic fatty acid synthesis pathway, mitochondria have retained their own means of creating fatty acids via the mitochondrial fatty acid synthesis (mtFASII) pathway. The reason for its conservation has not yet been elucidated. Therefore, to better understand the role of mtFASII in the cell, we used thin layer chromatography to characterize the contribution of the mtFASII pathway to the fatty acid composition of selected mitochondrial lipids. Next, we performed metabolomic analysis on HeLa cells in which the mtFASII pathway was either hypofunctional (through knockdown of mitochondrial acyl carrier protein, ACP) or hyperfunctional (through overexpression of mitochondrial enoyl-CoA reductase, MECR). Our results indicate that the mtFASII pathway contributes little to the fatty acid composition of mitochondrial lipid species examined. Additionally, loss of mtFASII function results in changes in biochemical pathways suggesting alterations in glucose utilization and redox state. Interestingly, levels of bioactive lipids, including lysophospholipids and sphingolipids, directly correlate with mtFASII function, indicating that mtFASII may be involved in the regulation of bioactive lipid levels. Regulation of bioactive lipid levels by mtFASII implicates the pathway as a mediator of intracellular signaling. PMID:26963735

  12. Integrated engineering of β-oxidation reversal and ω-oxidation pathways for the synthesis of medium chain ω-functionalized carboxylic acids.


    Clomburg, James M; Blankschien, Matthew D; Vick, Jacob E; Chou, Alexander; Kim, Seohyoung; Gonzalez, Ramon


    An engineered reversal of the β-oxidation cycle was exploited to demonstrate its utility for the synthesis of medium chain (6-10-carbons) ω-hydroxyacids and dicarboxylic acids from glycerol as the only carbon source. A redesigned β-oxidation reversal facilitated the production of medium chain carboxylic acids, which were converted to ω-hydroxyacids and dicarboxylic acids by the action of an engineered ω-oxidation pathway. The selection of a key thiolase (bktB) and thioesterase (ydiI) in combination with previously established core β-oxidation reversal enzymes, as well as the development of chromosomal expression systems for the independent control of pathway enzymes, enabled the generation of C6-C10 carboxylic acids and provided a platform for vector based independent expression of ω-functionalization enzymes. Using this approach, the expression of the Pseudomonas putida alkane monooxygenase system, encoded by alkBGT, in combination with all β-oxidation reversal enzymes resulted in the production of 6-hydroxyhexanoic acid, 8-hydroxyoctanoic acid, and 10-hydroxydecanoic acid. Following identification and characterization of potential alcohol and aldehyde dehydrogenases, chnD and chnE from Acinetobacter sp. strain SE19 were expressed in conjunction with alkBGT to demonstrate the synthesis of the C6-C10 dicarboxylic acids, adipic acid, suberic acid, and sebacic acid. The potential of a β-oxidation cycle with ω-oxidation termination pathways was further demonstrated through the production of greater than 0.8 g/L C6-C10 ω-hydroxyacids or about 0.5 g/L dicarboxylic acids of the same chain lengths from glycerol (an unrelated carbon source) using minimal media. PMID:25638687

  13. Novel Insights into Seed Fatty Acid Synthesis and Modification Pathways from Genetic Diversity and Quantitative Trait Loci Analysis of the Brassica C Genome1[OA

    PubMed Central

    Barker, Guy C.; Larson, Tony R.; Graham, Ian A.; Lynn, James R.; King, Graham J.


    Natural genetic variation in fatty acid synthesis and modification pathways determine the composition of vegetable oils, which are major components of human diet and renewable products. Based on known pathways we combined diversity and genetic analysis of metabolites to infer the existence of enzymes encoded by distinct loci, and associated these with specific elongation steps or subpathways. A total of 107 lines representing different Brassica genepools revealed considerable variation for 18 seed fatty acid products. The effect of genetic variation within a single biochemical step on subsequent products was demonstrated using a correlation matrix of scatterplots, and by calculating relative step yields. Surprisingly, diploid Brassica oleracea segregating populations had a similar range of variation for individual fatty acids as across the whole genepool. This allowed identification of 22 quantitative trait loci (QTL) associated with activity in the plastid, early stages of synthesis, desaturation, and elongases. Four QTL were assigned to early stages of synthesis, seven to subpathway specific or general elongase activity, one to ketoacyl acyl-carrier protein synthetase, and two each to fatty acid desaturase and either desaturase or fatty acyl-carrier protein thioesterase. An additional 10 QTL had distinct effects but were not assigned specific functions. Where contrasting behavior in more than one subpathway was detected, we inferred QTL specificity for particular combinations of substrate and product. The assignment of enzyme function to QTL was consistent with the known position of some Brassicaeae candidate genes and collinear regions of the Arabidopsis (Arabidopsis thaliana) genome. PMID:17573542

  14. Ascorbate Synthesis Pathway

    PubMed Central

    Gabbay, Kenneth H.; Bohren, Kurt M.; Morello, Roy; Bertin, Terry; Liu, Jeff; Vogel, Peter


    Using mouse gene knock-out models, we identify aldehyde reductase (EC, Akr1a4 (GR)) and aldose reductase (EC, Akr1b3 (AR)) as the enzymes responsible for conversion of d-glucuronate to l-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) mice show that the two enzymes, GR and AR, provide ∼85 and ∼15% of l-gulonate, respectively. GRKO/ARKO double knock-out mice are unable to synthesize ASC (>95% ASC deficit) and develop scurvy. The GRKO mice (∼85% ASC deficit) develop and grow normally when fed regular mouse chow (ASC content = 0) but suffer severe osteopenia and spontaneous fractures with stresses that increase ASC requirements, such as pregnancy or castration. Castration greatly increases osteoclast numbers and activity in GRKO mice and promotes increased bone loss as compared with wild-type controls and additionally induces proliferation of immature dysplastic osteoblasts likely because of an ASC-sensitive block(s) in early differentiation. ASC and the antioxidants pycnogenol and resveratrol block osteoclast proliferation and bone loss, but only ASC feeding restores osteoblast differentiation and prevents their dysplastic proliferation. This is the first in vivo demonstration of two independent roles for ASC as an antioxidant suppressing osteoclast activity and number as well as a cofactor promoting osteoblast differentiation. Although humans have lost the ability to synthesize ASC, our mouse models suggest the mechanisms by which suboptimal ASC availability facilitates the development of osteoporosis, which has important implications for human osteoporosis. PMID:20410296

  15. Introduction of a bacterial acetyl-CoA synthesis pathway improves lactic acid production in Saccharomyces cerevisiae.


    Song, Ji-Yoon; Park, Joon-Song; Kang, Chang Duk; Cho, Hwa-Young; Yang, Dongsik; Lee, Seunghyun; Cho, Kwang Myung


    Acid-tolerant Saccharomyces cerevisiae was engineered to produce lactic acid by expressing heterologous lactate dehydrogenase (LDH) genes, while attenuating several key pathway genes, including glycerol-3-phosphate dehydrogenase1 (GPD1) and cytochrome-c oxidoreductase2 (CYB2). In order to increase the yield of lactic acid further, the ethanol production pathway was attenuated by disrupting the pyruvate decarboxylase1 (PDC1) and alcohol dehydrogenase1 (ADH1) genes. Despite an increase in lactic acid yield, severe reduction of the growth rate and glucose consumption rate owing to the absence of ADH1 caused a considerable decrease in the overall productivity. In Δadh1 cells, the levels of acetyl-CoA, a key precursor for biologically applicable components, could be insufficient for normal cell growth. To increase the cellular supply of acetyl-CoA, we introduced bacterial acetylating acetaldehyde dehydrogenase (A-ALD) enzyme (EC genes into the lactic acid-producing S. cerevisiae. Escherichia coli-derived A-ALD genes, mhpF and eutE, were expressed and effectively complemented the attenuated acetaldehyde dehydrogenase (ALD)/acetyl-CoA synthetase (ACS) pathway in the yeast. The engineered strain, possessing a heterologous acetyl-CoA synthetic pathway, showed an increased glucose consumption rate and higher productivity of lactic acid fermentation. The production of lactic acid was reached at 142g/L with production yield of 0.89g/g and productivity of 3.55gL(-1)h(-1) under fed-batch fermentation in bioreactor. This study demonstrates a novel approach that improves productivity of lactic acid by metabolic engineering of the acetyl-CoA biosynthetic pathway in yeast. PMID:26384570

  16. α-Lipoic Acids Promote the Protein Synthesis of C2C12 Myotubes by the TLR2/PI3K Signaling Pathway.


    Jing, Yuanyuan; Cai, Xingcai; Xu, Yaqiong; Zhu, Canjun; Wang, Lina; Wang, Songbo; Zhu, Xiaotong; Gao, Ping; Zhang, Yongliang; Jiang, Qingyan; Shu, Gang


    Skeletal muscle protein turnover is regulated by endocrine hormones, nutrients, and inflammation. α-Lipoic acid (ALA) plays an important role in energy homeostasis. Therefore, the aim of this study was to investigate the effects of ALA on protein synthesis in skeletal muscles and reveal the underlying mechanism. ALA (25 μM) significantly increased the protein synthesis and phosphorylation of Akt, mTOR, and S6 in C2C12 myotubes with attenuated phosphorylation of AMPK, Ikkα/β, and eIF2α. Intraperitoneal injection of 50 mg/kg ALA also produced the same results in mouse gastrocnemius. Both the PI3K (LY294002) and mTOR (rapamycin) inhibitors abolished the effects of ALA on protein synthesis in the C2C12 myotubes. However, AICAR (AMPK agonist) failed to block the activation of mTOR and S6 by ALA. ALA increased TLR2 and MyD88 mRNA expression in the C2C12 myotubes. TLR2 knockdown by siRNA almost eliminated the effects of ALA on protein synthesis and the Akt/mTOR pathway in the C2C12 myotubes. Immunoprecipitation data showed that ALA enhanced the p85 subunit of PI3K binding to MyD88. These findings indicate that ALA induces protein synthesis and the PI3K/Akt signaling pathway by TLR2. PMID:26855124

  17. Statins and the squalene synthase inhibitor zaragozic acid stimulate the non-amyloidogenic pathway of amyloid-beta protein precursor processing by suppression of cholesterol synthesis.


    Kojro, Elzbieta; Füger, Petra; Prinzen, Claudia; Kanarek, Anna Maria; Rat, Dorothea; Endres, Kristina; Fahrenholz, Falk; Postina, Rolf


    Cholesterol-lowering drugs such as statins influence the proteolytic processing of the amyloid-beta protein precursor (AbetaPP) and are reported to stimulate the activity of alpha-secretase, the major preventive secretase of Alzheimer's disease. Statins can increase the alpha-secretase activity by their cholesterol-lowering properties as well as by impairment of isoprenoids synthesis. In the present study, we elucidate the contribution of these pathways in alpha-secretase activation. We demonstrate that zaragozic acid, a potent inhibitor of squalene synthase which blocks cholesterol synthesis but allows synthesis of isoprenoids, also stimulates alpha-secretase activity. Treatment of human neuroblastoma cells with 50 microM zaragozic acid resulted in a approximately 3 fold increase of alpha-secretase activity and reduced cellular cholesterol by approximately 30%. These effects were comparable to results obtained from cells treated with a low lovastatin concentration (2 microM). Zaragozic acid-stimulated secretion of alpha-secretase-cleaved soluble AbetaPP was dose dependent and saturable. Lovastatin- or zaragozic acid-stimulated increase of alpha-secretase activity was completely abolished by a selective ADAM10 inhibitor. By targeting the alpha-secretase ADAM10 to lipid raft domains via a glycosylphosphatidylinositol anchor, we demonstrate that ADAM10 is unable to cleave AbetaPP in a cholesterol-rich environment. Our results indicate that inhibition of cholesterol biosynthesis by a low lovastatin concentration is sufficient for alpha-secretase activation. PMID:20413873

  18. Synthesis of amino acids


    Davis, J.W. Jr.


    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  19. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei


    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  20. Alternative isoleucine synthesis pathway in cyanobacterial species.


    Wu, Bing; Zhang, Baichen; Feng, Xueyang; Rubens, Jacob R; Huang, Rick; Hicks, Leslie M; Pakrasi, Himadri B; Tang, Yinjie J


    Cyanothece sp. ATCC 51142 is an aerobic N(2)-fixing and hydrogen-producing cyanobacterium. Isotopomer analysis of its amino acids revealed an identical labelling profile for leucine and isoleucine when Cyanothece 51142 was grown mixotrophically using 2-(13)C-labelled glycerol as the main carbon source. This indicated that Cyanothece 51142 employs the atypical alternative citramalate pathway for isoleucine synthesis, with pyruvate and acetyl-CoA as precursors. Utilization of the citramalate pathway was confirmed by an enzyme assay and LC-MS/MS analysis. Furthermore, the genome sequence of Cyanothece 51142 shows that the gene encoding the key enzyme (threonine ammonia-lyase) in the normal isoleucine pathway is missing. Instead, the cce_0248 gene in Cyanothece 51142 exhibits 53 % identity to the gene encoding citramalate synthase (CimA, GSU1798) from Geobacter sulfurreducens. Reverse-transcription PCR indicated that the cce_0248 gene is expressed and its transcriptional level is lower in medium with isoleucine than in isoleucine-free medium. Additionally, a blast search for citramalate synthase and threonine ammonia-lyase implies that this alternative isoleucine synthesis pathway may be present in other cyanobacteria, such as Cyanothece and Synechococcus. This suggests that the pathway is more widespread than originally thought, as previous identifications of the citramalate pathway are limited to mostly anaerobic bacteria or archaea. Furthermore, this discovery opens the possibility that such autrotrophic micro-organisms may be engineered for robust butanol and propanol production from 2-ketobutyrate, which is an intermediate in the isoleucine biosynthesis pathway. PMID:19875435

  1. Analysis of Δ12-fatty acid desaturase function revealed that two distinct pathways are active for the synthesis of PUFAs in T. aureum ATCC 34304

    PubMed Central

    Matsuda, Takanori; Sakaguchi, Keishi; Hamaguchi, Rie; Kobayashi, Takumi; Abe, Eriko; Hama, Yoichiro; Hayashi, Masahiro; Honda, Daiske; Okita, Yuji; Sugimoto, Shinichi; Okino, Nozomu; Ito, Makoto


    Thraustochytrids are known to synthesize PUFAs such as docosahexaenoic acid (DHA). Accumulating evidence suggests the presence of two synthetic pathways of PUFAs in thraustochytrids: the polyketide synthase-like (PUFA synthase) and desaturase/elongase (standard) pathways. It remains unclear whether the latter pathway functions in thraustochytrids. In this study, we report that the standard pathway produces PUFA in Thraustochytrium aureum ATCC 34304. We isolated a gene encoding a putative Δ12-fatty acid desaturase (TauΔ12des) from T. aureum. Yeasts transformed with the tauΔ12des converted endogenous oleic acid (OA) into linoleic acid (LA). The disruption of the tauΔ12des in T. aureum by homologous recombination resulted in the accumulation of OA and a decrease in the levels of LA and its downstream PUFAs. However, the DHA content was increased slightly in tauΔ12des-disruption mutants, suggesting that DHA is primarily produced in T. aureum via the PUFA synthase pathway. The transformation of the tauΔ12des-disruption mutants with a tauΔ12des expression cassette restored the wild-type fatty acid profiles. These data clearly indicate that TauΔ12des functions as Δ12-fatty acid desaturase in the standard pathway of T. aureum and demonstrate that this thraustochytrid produces PUFAs via both the PUFA synthase and the standard pathways. PMID:22368282

  2. Analysis of Δ12-fatty acid desaturase function revealed that two distinct pathways are active for the synthesis of PUFAs in T. aureum ATCC 34304.


    Matsuda, Takanori; Sakaguchi, Keishi; Hamaguchi, Rie; Kobayashi, Takumi; Abe, Eriko; Hama, Yoichiro; Hayashi, Masahiro; Honda, Daiske; Okita, Yuji; Sugimoto, Shinichi; Okino, Nozomu; Ito, Makoto


    Thraustochytrids are known to synthesize PUFAs such as docosahexaenoic acid (DHA). Accumulating evidence suggests the presence of two synthetic pathways of PUFAs in thraustochytrids: the polyketide synthase-like (PUFA synthase) and desaturase/elongase (standard) pathways. It remains unclear whether the latter pathway functions in thraustochytrids. In this study, we report that the standard pathway produces PUFA in Thraustochytrium aureum ATCC 34304. We isolated a gene encoding a putative Δ12-fatty acid desaturase (TauΔ12des) from T. aureum. Yeasts transformed with the tauΔ12des converted endogenous oleic acid (OA) into linoleic acid (LA). The disruption of the tauΔ12des in T. aureum by homologous recombination resulted in the accumulation of OA and a decrease in the levels of LA and its downstream PUFAs. However, the DHA content was increased slightly in tauΔ12des-disruption mutants, suggesting that DHA is primarily produced in T. aureum via the PUFA synthase pathway. The transformation of the tauΔ12des-disruption mutants with a tauΔ12des expression cassette restored the wild-type fatty acid profiles. These data clearly indicate that TauΔ12des functions as Δ12-fatty acid desaturase in the standard pathway of T. aureum and demonstrate that this thraustochytrid produces PUFAs via both the PUFA synthase and the standard pathways. PMID:22368282

  3. Inhibition of de novo Palmitate Synthesis by Fatty Acid Synthase Induces Apoptosis in Tumor Cells by Remodeling Cell Membranes, Inhibiting Signaling Pathways, and Reprogramming Gene Expression

    PubMed Central

    Ventura, Richard; Mordec, Kasia; Waszczuk, Joanna; Wang, Zhaoti; Lai, Julie; Fridlib, Marina; Buckley, Douglas; Kemble, George; Heuer, Timothy S.


    Inhibition of de novo palmitate synthesis via fatty acid synthase (FASN) inhibition provides an unproven approach to cancer therapy with a strong biological rationale. FASN expression increases with tumor progression and associates with chemoresistance, tumor metastasis, and diminished patient survival in numerous tumor types. TVB-3166, an orally-available, reversible, potent, and selective FASN inhibitor induces apoptosis, inhibits anchorage-independent cell growth under lipid-rich conditions, and inhibits in-vivo xenograft tumor growth. Dose-dependent effects are observed between 20–200 nM TVB-3166, which agrees with the IC50 in biochemical FASN and cellular palmitate synthesis assays. Mechanistic studies show that FASN inhibition disrupts lipid raft architecture, inhibits biological pathways such as lipid biosynthesis, PI3K–AKT–mTOR and β-catenin signal transduction, and inhibits expression of oncogenic effectors such as c-Myc; effects that are tumor-cell specific. Our results demonstrate that FASN inhibition has anti-tumor activities in biologically diverse preclinical tumor models and provide mechanistic and pharmacologic evidence that FASN inhibition presents a promising therapeutic strategy for treating a variety of cancers, including those expressing mutant K-Ras, ErbB2, c-Met, and PTEN. The reported findings inform ongoing studies to link mechanisms of action with defined tumor types and advance the discovery of biomarkers supporting development of FASN inhibitors as cancer therapeutics. Research in context Fatty acid synthase (FASN) is a vital enzyme in tumor cell biology; the over-expression of FASN is associated with diminished patient prognosis and resistance to many cancer therapies. Our data demonstrate that selective and potent FASN inhibition with TVB-3166 leads to selective death of tumor cells, without significant effect on normal cells, and inhibits in vivo xenograft tumor growth at well-tolerated doses. Candidate biomarkers for

  4. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.


    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  5. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood


    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  6. Synthesis of tertiary arylamines: Lewis acid-catalyzed direct reductive N-alkylation of secondary amines with ketones through an alternative pathway.


    Nayal, Onkar S; Thakur, Maheshwar S; Bhatt, Vinod; Kumar, Manoranjan; Kumar, Neeraj; Singh, Bikram; Sharma, Upendra


    We report herein a highly efficient, tin(ii)/PMHS catalyzed reductive N-alkylation of arylamines with ketones affording tertiary arylamines. A very wide substrate scope was observed for the current catalytic method as all six permutations of ketones/aldehydes/heterocyclic carbonyls and primary/secondary/heterocyclic amines were well tolerated, enabling access to secondary, tertiary and heterocyclic amines. The method is also convenient for the synthesis of N-substituted isoindolinones and phthalazinones via a tandem amination-amidation sequence. Mechanistic investigations revealed a carbocationic pathway instead of an ordinary direct reductive amination pathway. PMID:27363507

  7. Genetic mapping of QTLs controlling fatty acids provided insights into the genetic control of fatty acid synthesis pathway in peanut (Arachis hypogaea L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C1...

  8. Genetic Mapping of QTLs Controlling Fatty Acids Provided Insights into the Genetic Control of Fatty Acid Synthesis Pathway in Peanut (Arachis hypogaea L.)

    PubMed Central

    Wang, Hui; Qiao, Lixian; Feng, Suping; Tonnis, Brandon; Barkley, Noelle A.; Pinnow, David; Holbrook, Corley C.; Culbreath, Albert K.; Varshney, Rajeev K.; Guo, Baozhu


    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C18:1) and linoleic acid (C18:2) accounting for about 80% of peanut oil, the six other fatty acids namely palmitic acid (C16:0), stearic acid (C18:0), arachidic acid (C20:0), gadoleic acid (C20:1), behenic acid (C22:0), and lignoceric acid (C24:0) are accounted for the rest 20%. To determine the genetic basis and to improve further understanding on effect of FAD2 genes on these fatty acids, two recombinant inbred line (RIL) populations namely S-population (high oleic line ‘SunOleic 97R’ × low oleic line ‘NC94022’) and T-population (normal oleic line ‘Tifrunner’ × low oleic line ‘GT-C20’) were developed. Genetic maps with 206 and 378 marker loci for the S- and the T-population, respectively were used for quantitative trait locus (QTL) analysis. As a result, a total of 164 main-effect (M-QTLs) and 27 epistatic (E-QTLs) QTLs associated with the minor fatty acids were identified with 0.16% to 40.56% phenotypic variation explained (PVE). Thirty four major QTLs (>10% of PVE) mapped on five linkage groups and 28 clusters containing more than three QTLs were also identified. These results suggest that the major QTLs with large additive effects would play an important role in controlling composition of these minor fatty acids in addition to the oleic and linoleic acids in peanut oil. The interrelationship among these fatty acids should be considered while breeding for improved peanut genotypes with good oil quality and desired fatty acid composition. PMID:25849082

  9. Electron Transfer Pathways in Cholesterol Synthesis.


    Porter, Todd D


    Cholesterol synthesis in the endoplasmic reticulum requires electron input at multiple steps and utilizes both NADH and NADPH as the electron source. Four enzymes catalyzing five steps in the pathway require electron input: squalene monooxygenase, lanosterol demethylase, sterol 4α-methyl oxidase, and sterol C5-desaturase. The electron-donor proteins for these enzymes include cytochrome P450 reductase and the cytochrome b5 pathway. Here I review the evidence for electron donor protein requirements with these enzymes, the evidence for additional electron donor pathways, and the effect of deletion of these redox enzymes on cholesterol and lipid metabolism. PMID:26344922

  10. Vitamins and aging: pathways to NAD+ synthesis.


    Denu, John M


    Recent genetic evidence reveals additional salvage pathways for NAD(+) synthesis. In this issue, Belenky et al. (2007) report that nicotinamide riboside, a new NAD(+) precursor, regulates Sir2 deacetylase activity and life span in yeast. The ability of nicotinamide riboside to enhance life span does not depend on calorie restriction. PMID:17482537

  11. Increase of betulinic acid production in Saccharomyces cerevisiae by balancing fatty acids and betulinic acid forming pathways.


    Li, Jing; Zhang, Yansheng


    Betulinic acid is a plant-based triterpenoid that has been recognized for its antitumor and anti-HIV activities. The level of betulinic acid in its natural hosts is extremely low. In the present study, we constructed betulinic acid biosynthetic pathway in Saccharomyces cerevisiae by metabolic engineering. Given the betulinic acid forming pathways sharing the common substrate acetyl-CoA with fatty acid synthesis, the metabolic fluxes between the two pathways were varied by changing gene expressions, and their effects on betulinic acid production were investigated. We constructed nine S. cerevisiae strains representing nine combinations of the flux distributions between betulinic acid and fatty acid pathways. Our results demonstrated that it was possible to improve the betulinic acid production in S. cerevisiae while keeping a desirable growth phenotype by optimally balancing the carbon fluxes of the two pathways. Through modulating the expressions of the key genes on betulinic acid and fatty acid pathways, the difference in betulinic acid yield varied largely in the range of 0.01-1.92 mg L(-1) OD(-1). The metabolic engineering approach used in this study could be extended for synthesizing other triterpenoids in S. cerevisiae. PMID:24389702

  12. Biochemical pathways in seed oil synthesis.


    Bates, Philip D; Stymne, Sten; Ohlrogge, John


    Oil produced in plant seeds is utilized as a major source of calories for human nutrition, as feedstocks for non-food uses such as soaps and polymers, and can serve as a high-energy biofuel. The biochemical pathways leading to oil (triacylglycerol) synthesis in seeds involve multiple subcellular organelles, requiring extensive lipid trafficking. Phosphatidylcholine plays a central role in these pathways as a substrate for acyl modifications and likely as a carrier for the trafficking of acyl groups between organelles and membrane subdomains. Although much has been clarified regarding the enzymes and pathways responsible for acyl-group flux, there are still major gaps in our understanding. These include the identity of several key enzymes, how flux between alternative pathways is controlled and the specialized cell biology leading to biogenesis of oil bodies that store up to 80% of carbon in seeds. PMID:23529069

  13. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?


    Cook, Sam D; Nichols, David S; Smith, Jason; Chourey, Prem S; McAdam, Erin L; Quittenden, Laura; Ross, John J


    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  14. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.


    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  15. Orthogonal Fatty Acid Biosynthetic Pathway Improves Fatty Acid Ethyl Ester Production in Saccharomyces cerevisiae.


    Eriksen, Dawn T; HamediRad, Mohammad; Yuan, Yongbo; Zhao, Huimin


    Fatty acid ethyl esters (FAEEs) are a form of biodiesel that can be microbially produced via a transesterification reaction of fatty acids with ethanol. The titer of microbially produced FAEEs can be greatly reduced by unbalanced metabolism and an insufficient supply of fatty acids, resulting in a commercially inviable process. Here, we report on a pathway engineering strategy in Saccharomyces cerevisiae for enhancing the titer of microbially produced FAEEs by providing the cells with an orthogonal route for fatty acid synthesis. The fatty acids generated from this heterologous pathway would supply the FAEE production, safeguarding endogenous fatty acids for cellular metabolism and growth. We investigated the heterologous expression of a Type-I fatty acid synthase (FAS) from Brevibacterium ammoniagenes coupled with WS/DGAT, the wax ester synthase/acyl-coenzyme that catalyzes the transesterification reaction with ethanol. Strains harboring the orthologous fatty acid synthesis yielded a 6.3-fold increase in FAEE titer compared to strains without the heterologous FAS. Variations in fatty acid chain length and degree of saturation can affect the quality of the biodiesel; therefore, we also investigated the diversity of the fatty acid production profile of FAS enzymes from other Actinomyces organisms. PMID:25594225

  16. Metabolic Engineering of a Novel Muconic Acid Biosynthesis Pathway via 4-Hydroxybenzoic Acid in Escherichia coli

    PubMed Central

    Sengupta, Sudeshna; Goonewardena, Lakshani; Juturu, Veeresh


    cis,cis-Muconic acid (MA) is a commercially important raw material used in pharmaceuticals, functional resins, and agrochemicals. MA is also a potential platform chemical for the production of adipic acid (AA), terephthalic acid, caprolactam, and 1,6-hexanediol. A strain of Escherichia coli K-12, BW25113, was genetically modified, and a novel nonnative metabolic pathway was introduced for the synthesis of MA from glucose. The proposed pathway converted chorismate from the aromatic amino acid pathway to MA via 4-hydroxybenzoic acid (PHB). Three nonnative genes, pobA, aroY, and catA, coding for 4-hydroxybenzoate hydrolyase, protocatechuate decarboxylase, and catechol 1,2-dioxygenase, respectively, were functionally expressed in E. coli to establish the MA biosynthetic pathway. E. coli native genes ubiC, aroFFBR, aroE, and aroL were overexpressed and the genes ptsH, ptsI, crr, and pykF were deleted from the E. coli genome in order to increase the precursors of the proposed MA pathway. The final engineered E. coli strain produced nearly 170 mg/liter of MA from simple carbon sources in shake flask experiments. The proposed pathway was proved to be functionally active, and the strategy can be used for future metabolic engineering efforts for production of MA from renewable sugars. PMID:26362984

  17. Metabolic engineering of a novel muconic acid biosynthesis pathway via 4-hydroxybenzoic acid in Escherichia coli.


    Sengupta, Sudeshna; Jonnalagadda, Sudhakar; Goonewardena, Lakshani; Juturu, Veeresh


    cis,cis-Muconic acid (MA) is a commercially important raw material used in pharmaceuticals, functional resins, and agrochemicals. MA is also a potential platform chemical for the production of adipic acid (AA), terephthalic acid, caprolactam, and 1,6-hexanediol. A strain of Escherichia coli K-12, BW25113, was genetically modified, and a novel nonnative metabolic pathway was introduced for the synthesis of MA from glucose. The proposed pathway converted chorismate from the aromatic amino acid pathway to MA via 4-hydroxybenzoic acid (PHB). Three nonnative genes, pobA, aroY, and catA, coding for 4-hydroxybenzoate hydrolyase, protocatechuate decarboxylase, and catechol 1,2-dioxygenase, respectively, were functionally expressed in E. coli to establish the MA biosynthetic pathway. E. coli native genes ubiC, aroF(FBR), aroE, and aroL were overexpressed and the genes ptsH, ptsI, crr, and pykF were deleted from the E. coli genome in order to increase the precursors of the proposed MA pathway. The final engineered E. coli strain produced nearly 170 mg/liter of MA from simple carbon sources in shake flask experiments. The proposed pathway was proved to be functionally active, and the strategy can be used for future metabolic engineering efforts for production of MA from renewable sugars. PMID:26362984

  18. Genetics Home Reference: congenital bile acid synthesis defect type 1


    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  19. Genetics Home Reference: congenital bile acid synthesis defect type 2


    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  20. Hydroxamic acids in asymmetric synthesis.


    Li, Zhi; Yamamoto, Hisashi


    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  1. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi


    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  2. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages

    PubMed Central

    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A.; Yin, Yulong


    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05) gradually with increasing age. Bama mini-pigs had generally higher (P<0.05) muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but

  3. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages.


    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A; Yin, Yulong


    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05) gradually with increasing age. Bama mini-pigs had generally higher (P<0.05) muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but

  4. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.


    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  5. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.


    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko


    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  6. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth


    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  7. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John


    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  8. Development of a model describing regulation of casein synthesis by the mammalian target of rapamycin (mTOR) signaling pathway in response to insulin, amino acids, and acetate.


    Castro, J J; Arriola Apelo, S I; Appuhamy, J A D R N; Hanigan, M D


    To improve dietary protein use efficiency in lactating cows, mammary protein synthesis responses to AA, energy substrates, and hormones must be better understood. These entities exert their effects through stimulation of mRNA translation via control of initiation and elongation rates at the cellular level. A central protein kinase of this phenomenon is the mammalian target of rapamycin (mTOR), which transfers the nutritional and hormonal stimuli onto a series of proteins downstream through a cascade of phosphorylation reactions that ultimately affect protein synthesis. The objective of this work was to further develop an existing mechanistic model of mTOR phosphorylation responses to insulin and total essential AA to include the effects of specific essential AA and acetate mediated by signaling proteins including protein kinase B (Akt), adenosine monophosphate activated protein kinase (AMPK), and mTOR and to add a representation of milk protein synthesis. Data from 6 experiments in MAC-T cells and mammary tissue slices previously conducted in our laboratory were assembled and used to parameterize the dynamic system of differential equations representing Akt, AMPK, and mTOR in their phosphorylated and dephosphorylated states and the resulting regulation of milk protein synthesis. The model predicted phosphorylated Akt, mTOR, AMPK, and casein synthesis rates with root mean square prediction errors of 16.8, 28.4, 33.0, and 54.9%, respectively. All other dependent variables were free of mean and slope bias, indicating an adequate representation of the data. Whereas mTOR was not very sensitive to changes in insulin or acetate levels, it was highly sensitive to leucine and isoleucine, and this signal appeared to be effectively transduced to casein synthesis. Although prior work had observed a relationship with additional essential AA, and data supporting those conclusions were present in the data set, we were unable to derive significant relationships with any essential

  9. Synthesis of new polysialic acid derivatives.


    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke


    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  10. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.


    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G


    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  11. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji


    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  12. Flaviviruses Are Sensitive to Inhibition of Thymidine Synthesis Pathways

    PubMed Central

    Fischer, Matthew A.; Smith, Jessica L.; Shum, David; Stein, David A.; Parkins, Christopher; Bhinder, Bhavneet; Radu, Constantin; Hirsch, Alec J.; Djaballah, Hakim; Nelson, Jay A.


    Dengue virus has emerged as a global health threat to over one-third of humankind. As a positive-strand RNA virus, dengue virus relies on the host cell metabolism for its translation, replication, and egress. Therefore, a better understanding of the host cell metabolic pathways required for dengue virus infection offers the opportunity to develop new approaches for therapeutic intervention. In a recently described screen of known drugs and bioactive molecules, we observed that methotrexate and floxuridine inhibited dengue virus infections at low micromolar concentrations. Here, we demonstrate that all serotypes of dengue virus, as well as West Nile virus, are highly sensitive to both methotrexate and floxuridine, whereas other RNA viruses (Sindbis virus and vesicular stomatitis virus) are not. Interestingly, flavivirus replication was restored by folinic acid, a thymidine precursor, in the presence of methotrexate and by thymidine in the presence of floxuridine, suggesting an unexpected role for thymidine in flavivirus replication. Since thymidine is not incorporated into RNA genomes, it is likely that increased thymidine production is indirectly involved in flavivirus replication. A possible mechanism is suggested by the finding that p53 inhibition restored dengue virus replication in the presence of floxuridine, consistent with thymidine-less stress triggering p53-mediated antiflavivirus effects in infected cells. Our data reveal thymidine synthesis pathways as new and unexpected therapeutic targets for antiflaviviral drug development. PMID:23824813

  13. Total synthesis of (+)-zaragozic acid C.


    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G


    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  14. Effect of aluminum (III) on the conversion of dopachrome in the melanin synthesis pathway

    NASA Astrophysics Data System (ADS)

    Di, Junwei; Bi, Shuping


    The effect of aluminum ions on the kinetics and mode of the conversion of dopachrome (DC) in acidic environment has been studied using UV-Vis spectrophotometric and cyclic voltammetric methods. The DC conversion step is an important reaction in melanogenesis. Aluminum ions catalyze greatly the decarboxylative transformation of DC to give 5,6-dihydroxyindole (DHI) rather than 5,6-dihydroxyindole-2-carboxylic acid (DHICA) at pH 5.5, which enhance the ratio of formation DHI/DHICA in melanin synthesis pathway. The kinetics of DC conversion catalyzed by aluminum ions is dependent on the concentration of DC and aluminum ions. These results provide evidence that aluminum ions could play a role in the synthesis of melanin pathway in acidic condition through catalyzing the DC decarboxylative transformation to yield DHI and influence the melanin structure and properties.

  15. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?1[OPEN

    PubMed Central

    Nichols, David S.; Smith, Jason; Chourey, Prem S.; McAdam, Erin L.; Quittenden, Laura


    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA. However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  16. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.


    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  17. The Significance of Different Diacylgycerol Synthesis Pathways on Plant Oil Composition and Bioengineering

    PubMed Central

    Bates, Philip D.; Browse, John


    The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA) composition of triacylglycerol (TAG). Plants can use two main pathways to produce diacylglycerol (DAG), the immediate precursor molecule to TAG synthesis: (1) De novo DAG synthesis, and (2) conversion of the membrane lipid phosphatidylcholine (PC) to DAG. The FA esterified to PC are also the substrate for FA modification (e.g., desaturation, hydroxylation, etc.), such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions. PMID:22783267

  18. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John


    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  19. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  20. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  1. Expression of Vibrio harveyi Acyl-ACP Synthetase Allows Efficient Entry of Exogenous Fatty Acids into the Escherichia coli Fatty Acid and Lipid A Synthetic Pathways

    PubMed Central

    Jiang, Yanfang; Morgan-Kiss, Rachael M.; Campbell, John W.; Chan, Chi Ho; Cronan, John E.


    Although the Escherichia coli fatty acid synthesis (FAS) pathway is the best studied type II fatty acid synthesis system, a major experimental limitation has been the inability to feed intermediates into the pathway in vivo because exogenously-supplied free fatty acids are not efficiently converted to the acyl-acyl carrier protein (ACP) thioesters required by the pathway. We report that expression of Vibrio harveyi acyl-ACP synthetase (AasS), a soluble cytosolic enzyme that ligates free fatty acids to ACP to form acyl-ACPs, allows exogenous fatty acids to enter the E. coli fatty acid synthesis pathway. The free fatty acids are incorporated intact and can be elongated or directly incorporated into complex lipids by acyltransferases specific for acyl-ACPs. Moreover, expression of AasS strains and supplementation with the appropriate fatty acid restored growth to E. coli mutant strains that lack essential fatty acid synthesis enzymes. Thus, this strategy provides a new tool for circumventing the loss of enzymes essential for FAS function. PMID:20028080

  2. Pinolenic Acid Downregulates Lipid Anabolic Pathway in HepG2 Cells.


    Lee, Ah Ron; Han, Sung Nim


    Pine nut oil (PNO) was reported to reduce lipid accumulation in the liver. However, the specific effect of pinolenic acid (18:3, all-cis-Δ5,9,12), a unique component of PNO, on lipid metabolism has not been studied. We hypothesized that pinolenic acid downregulates the lipid anabolic pathway in HepG2 cells. HepG2 cells were incubated in serum-free medium supplemented with 50 μM bovine serum albumin (BSA), palmitic acid, oleic acid, γ-linolenic acid, pinolenic acid, eicosapentaenoic acid (EPA), or α-linolenic acid for 24 h. Lipid accumulation was determined by Oil Red O (ORO) staining. The mRNA levels of genes related to fatty acid biosynthesis (SREBP1c, FAS, SCD1, and ACC1), fatty acid oxidation (ACC2, PPARα, CPT1A, and ACADL), cholesterol synthesis (SREBP2 and HMGCR), and lipoprotein uptake (LDLr) and of genes that may be involved in the downregulation of the lipogenic pathway (ACSL3, ACSL4, and ACSL5) were determined by qPCR. LDLR protein levels were measured by Western blot analysis. The mRNA levels of SREBP1c, FAS, and SCD1 were significantly downregulated by pinolenic acid treatment compared to BSA control (53, 54, and 38 % lower, respectively). In addition, the mRNA levels of HMGCR, ACSL3, and LDLr were significantly lower (30, 30, and 43 % lower, respectively), and ACSL4 tended to be lower in the pinolenic acid group (20 % lower, P = 0.082) relative to the control group. In conclusion, pinolenic acid downregulated the lipid anabolic pathway in HepG2 cells by reducing expression of genes related to lipid synthesis, lipoprotein uptake, and the regulation of the lipogenic pathway. PMID:27084371

  3. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.


    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R


    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  4. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.


    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  5. Enantioselective Total Synthesis of Secalonic Acid E.


    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F


    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  6. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].


    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua


    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  7. Piperazic acid derivatives inhibit Gli1 in Hedgehog signaling pathway.


    Khatra, Harleen; Kundu, Jayanta; Khan, Pragya Paramita; Duttagupta, Indranil; Pattanayak, Sankha; Sinha, Surajit


    Piperazic acid, a non-proteinogenic amino acid, found in complex secondary metabolites and peptide natural substances, has shown down regulation of Gli1 expression in Hedgehog signaling pathway in cell based assays. Further structure activity relationship study indicated that amide derivatives of piperazic acid are more potent than piperazic acid itself, with little to no toxicity. However, other cellular components involved in the pathway were not affected. To the best of our knowledge, this is the first report on the inhibitory property of piperazic acid in this pathway. Hence, this molecule could serve as a useful tool for studying Hedgehog signaling. PMID:27528433

  8. Prolonged stimulation of muscle protein synthesis by leucine in neonates is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rise in amino acids and insulin after a meal independently stimulate protein synthesis in skeletal muscle of neonates by activating the intracellular signalling pathways that regulate mRNA translation. Leucine, in particular, is important in mediating the response to amino acids. Previously, w...

  9. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.


    Cronan, John E


    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  10. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.


    Cronan, John E


    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  11. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.


    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  12. Evolutionary algorithm for metabolic pathways synthesis.


    Gerard, Matias F; Stegmayer, Georgina; Milone, Diego H


    Metabolic pathway building is an active field of research, necessary to understand and manipulate the metabolism of organisms. There are different approaches, mainly based on classical search methods, to find linear sequences of reactions linking two compounds. However, an important limitation of these methods is the exponential increase of search trees when a large number of compounds and reactions is considered. Besides, such models do not take into account all substrates for each reaction during the search, leading to solutions that lack biological feasibility in many cases. This work proposes a new evolutionary algorithm that allows searching not only linear, but also branched metabolic pathways, formed by feasible reactions that relate multiple compounds simultaneously. Tests performed using several sets of reactions show that this algorithm is able to find feasible linear and branched metabolic pathways. PMID:27080162

  13. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  14. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  15. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.


    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  16. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.


    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  17. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H


    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  18. Cross Talk between Nucleotide Synthesis Pathways with Cellular Immunity in Constraining Hepatitis E Virus Replication.


    Wang, Yijin; Wang, Wenshi; Xu, Lei; Zhou, Xinying; Shokrollahi, Ehsan; Felczak, Krzysztof; van der Laan, Luc J W; Pankiewicz, Krzysztof W; Sprengers, Dave; Raat, Nicolaas J H; Metselaar, Herold J; Peppelenbosch, Maikel P; Pan, Qiuwei


    in HEV infection and its potential for antiviral drug development. We show that targeting the later but not the early steps of the purine synthesis pathway exerts strong anti-HEV activity. In particular, IMP dehydrogenase (IMPDH) is the most important anti-HEV target of this cascade. Importantly, the clinically used IMPDH inhibitors, including mycophenolic acid and ribavirin, have potent anti-HEV activity. Furthermore, targeting the pyrimidine synthesis pathway also exerts potent antiviral activity against HEV. Interestingly, antiviral effects of nucleotide synthesis pathway inhibitors appear to depend on the medication-induced transcription of antiviral interferon-stimulated genes. Thus, this study reveals an unconventional novel mechanism as to how nucleotide synthesis pathway inhibitors can counteract HEV replication. PMID:26926637

  19. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  20. Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus

    SciTech Connect

    Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.; Wang, Clay C.


    Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.

  1. Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus

    SciTech Connect

    Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.; Wang, Clay C.


    Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Lastly, defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.

  2. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk


    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  3. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  4. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.


    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  5. Synthesis of carbon-13-labeled tetradecanoic acids.


    Sparrow, J T; Patel, K M; Morrisett, J D


    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  6. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.


    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  7. Synthesis of alpha-amino acids


    Davis, J.W. Jr.


    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  8. Exploring De Novo metabolic pathways from pyruvate to propionic acid.


    Stine, Andrew; Zhang, Miaomin; Ro, Soo; Clendennen, Stephanie; Shelton, Michael C; Tyo, Keith E J; Broadbelt, Linda J


    Industrial biotechnology provides an efficient, sustainable solution for chemical production. However, designing biochemical pathways based solely on known reactions does not exploit its full potential. Enzymes are known to accept non-native substrates, which may allow novel, advantageous reactions. We have previously developed a computational program named Biological Network Integrated Computational Explorer (BNICE) to predict promiscuous enzyme activities and design synthetic pathways, using generalized reaction rules curated from biochemical reaction databases. Here, we use BNICE to design pathways synthesizing propionic acid from pyruvate. The currently known natural pathways produce undesirable by-products lactic acid and succinic acid, reducing their economic viability. BNICE predicted seven pathways containing four reaction steps or less, five of which avoid these by-products. Among the 16 biochemical reactions comprising these pathways, 44% were validated by literature references. More than 28% of these known reactions were not in the BNICE training dataset, showing that BNICE was able to predict novel enzyme substrates. Most of the pathways included the intermediate acrylic acid. As acrylic acid bioproduction has been well advanced, we focused on the critical step of reducing acrylic acid to propionic acid. We experimentally validated that Oye2p from Saccharomyces cerevisiae can catalyze this reaction at a slow turnover rate (10(-3) s(-1) ), which was unknown to occur with this enzyme, and is an important finding for further propionic acid metabolic engineering. These results validate BNICE as a pathway-searching tool that can predict previously unknown promiscuous enzyme activities and show that computational methods can elucidate novel biochemical pathways for industrial applications. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:303-311, 2016. PMID:26821575

  9. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu


    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  10. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.


    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu


    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  11. Cytochrome P450 epoxygenase pathway of polyunsaturated fatty acid metabolism

    PubMed Central

    Spector, Arthur A.; Kim, Hee-Yong


    Polyunsaturated fatty acids (PUFA) are oxidized by cytochrome P450 epoxygenases to PUFA epoxides which function as potent lipid mediators. The major metabolic pathways of PUFA epoxides are incorporation into phospholipids and hydrolysis to the corresponding PUFA diols by soluble epoxide hydrolase. Inhibitors of soluble epoxide hydrolase stabilize PUFA epoxides and potentiate their functional effects. The epoxyeicosatrienoic acids (EETs) synthesized from arachidonic acid produce vasodilation, stimulate angiogenesis, have anti-inflammatory actions, and protect the heart against ischemia-reperfusion injury. EETs produce these functional effects by activating receptor-mediated signaling pathways and ion channels. The epoxyeicosatetraenoic acids synthesized from eicosapentaenoic acid and epoxydocosapentaenoic acids synthesized from docosahexaenoic acid are potent inhibitors of cardiac arrhythmias. Epoxydocosapentaenoic acids also inhibit angiogenesis, decrease inflammatory and neuropathic pain, and reduce tumor metastasis. These findings indicate that a number of the beneficial functions of PUFA may be due to their conversion to PUFA epoxides. PMID:25093613

  12. Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

    NASA Astrophysics Data System (ADS)

    Fu, Qi; Socki, Richard A.; Niles, Paul B.


    Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher δ13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of δ13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ∼31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of δ13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic

  13. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central


    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  14. Ascorbate synthesis pathway, dual role of ascorbate in bone homeostasis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using mouse gene knock-out models, we identify aldehyde reductase (EC, Akr1a4 (GR)) and aldose reductase (EC, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) m...

  15. trans-Caffeic acid stearyl ester from Paeonia suffruticosa inhibits melanin synthesis by cAMP-mediating down-regulation of α-melanocyte-stimulating hormone-stimulated melanogenesis signaling pathway in B16 cells.


    Liang, Chia-Hua; Chou, Tzung-Han; Tseng, Ya-Ping; Ding, Hsiou-Yu


    trans-Caffeic acid stearyl ester (TCASE) from the root cortex of Paeonia suffruticosa ANDREWS is a traditional medicinal herb that has several beneficial properties. However, the inhibitory effect of TCASE on melanogenesis has not been explored. In the cell viability assay, TCASE did not show a cytotoxic effect at a dose of 65 µM for 48 h in B16, HaCaT and Hs68 cells. TCASE considerably inhibits melanin synthesis, and reduces intracellular cyclic adenosine monophosphate (cAMP) levels, tyrosinase activity and L-3-(3,4-dihydroxyphenyl)-alanine (DOPA) oxidase activity in a concentration-dependent manner in the presence of α-melanocyte-stimulating hormone (α-MSH) in B16 cells, and the inhibition efficiency of TCASE exceeds that of ascorbic acid and arbutin. TCASE reduces melanocortin-1 receptor (MC1R), microphthalmia transcription factor (MITF), tyrosinase, tyrosinase-related protein-2 (TRP-2) and TRP-1 mRNA and protein levels in B16 cells. Based on the findings, TCASE is posited to inhibit melanogenesis signaling while suppressing cAMP levels and, subsequently, MC1R, MITF, tyrosinase, TRP-2 and TRP-1 down-regulation, resulting in the suppression of tyrosinase activity, DOPA oxidase activity and melanin synthesis. PMID:23207771

  16. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen


    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  17. Modified branched-chain amino acid pathways give rise to acyl acids of sucrose esters exuded from tobacco leaf trichomes.


    Kandra, G; Severson, R; Wagner, G J


    A major diversion of carbon from branched-chain amino acid biosynthesis/catabolism to form acyl moieties of sucrose esters (6-O-acetyl-2,3,4-tri-O-acyl-alpha-D-glucopyranosyl-beta-D- fructofuranosides) was observed to be associated with specialized trichome head cells which secrete large amounts of sucrose esters. Surface chemistry and acetyl and acyl substituent groups of tobacco (T.I. 1068) sucrose esters were identified and quantified by gas chromatography/mass spectrometry. Sucrose esters were prominent surface constituents and 3-methylvaleric acid, 2- and 3-methylbutyric acid, and methylpropionic acid accounted for 60%, 25% and 9%, respectively, of total C3--C7 acyl substituents. Radiolabeled Thr, Ile, Val, Leu, pyruvate and Asp, metabolites of branched-chain amino acid pathways, were compared with radioactively labeled acetate and sucrose as donors of carbon to sucrose, acetyl and acyl components of sucrose esters using epidermal peels with undisturbed trichomes. Preparations of biosynthetically competent trichome heads (site of sucrose ester formation) were also examined. Results indicate that 3-methylvaleryl and 2-methylbutyryl groups are derived from the Thr pathway of branched-chain amino acid metabolism, 3-methylbutyryl and methylpropionyl groups are formed via the pyruvate pathway, and that acetyl groups are principally formed directly via acetyl-CoA. Arguments are presented which rule out participation of fatty acid synthase in the formation of prominent acyl acids. Results suggest that the shunting of carbon away from the biosynthesis of Val, Leu and Ile may be due to a low level of amino acid utilization in protein synthesis in specialized glandular head cells of trichomes. This would result in the availability of corresponding oxo acids for CoA activation and esterification to form sucrose esters. Preliminary evidence was found for the involvement of cycling reactions in oxo-acid-chain lengthening and for utilization of pyruvate-derived 2

  18. New approaches to target the mycolic acid biosynthesis pathway for the development of tuberculosis therapeutics.


    North, E Jeffrey; Jackson, Mary; Lee, Richard E


    Mycolic acids are the major lipid components of the unique mycobacterial cell wall responsible for the protection of the tuberculosis bacilli from many outside threats. Mycolic acids are synthesized in the cytoplasm and transported to the outer membrane as trehalose- containing glycolipids before being esterified to the arabinogalactan portion of the cell wall and outer membrane glycolipids. The large size of these unique fatty acids is a result of a huge metabolic investment that has been evolutionarily conserved, indicating the importance of these lipids to the mycobacterial cellular survival. There are many key enzymes involved in the mycolic acid biosynthetic pathway, including fatty acid synthesis (KasA, KasB, MabA, InhA, HadABC), mycolic acid modifying enzymes (SAM-dependent methyltransferases, aNAT), fatty acid activating and condensing enzymes (FadD32, Acc, Pks13), transporters (MmpL3) and tranferases (Antigen 85A-C) all of which are excellent potential drug targets. Not surprisingly, in recent years many new compounds have been reported to inhibit specific portions of this pathway, discovered through both phenotypic screening and target enzyme screening. In this review, we analyze the new and emerging inhibitors of this pathway discovered in the post-genomic era of tuberculosis drug discovery, several of which show great promise as selective tuberculosis therapeutics. PMID:24245756

  19. New Approaches to Target the Mycolic Acid Biosynthesis Pathway for the Development of Tuberculosis Therapeutics

    PubMed Central

    North, E. Jeffrey; Jackson, Mary; Lee, Richard E.


    Mycolic acids are the major lipid component of the unique mycobacterial cell wall responsible for the protection of the tuberculosis bacilli from many outside threats. Mycolic acids are synthesized in the cytoplasm and transported to the outer membrane as trehalose-containing glycolipids before being esterified to the arabinogalactan portion of the cell wall and outer membrane glycolipids. The large size of these unique fatty acids is a result of a huge metabolic investment that has been evolutionarily conserved, indicating the importance of these lipids to the mycobacterial cellular survival. There are many key enzymes involved in the mycolic acid biosynthetic pathway, including fatty acid synthesis (KasA, KasB, MabA, InhA, HadABC), mycolic acid modifying enzymes (SAM-dependent methyltransferases, aNAT), fatty acid activating and condensing enzymes (FadD32, Acc, Pks13), transporters (MmpL3) and tranferases (Antigen 85A-C) all of which are excellent potential drug targets. Not surprisingly, in recent years many new compounds have been reported to inhibit specific portions of this pathway, discovered through both phenotypic screening and target enzyme screening. In this review, we analyze the new and emerging inhibitors of this pathway discovered in the post-genomic era of tuberculosis drug discovery, several of which show great promise as selective tuberculosis therapeutics. PMID:24245756

  20. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis

    PubMed Central

    Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula


    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography–mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography–tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos. PMID:25711705

  1. Pathways of retinoid synthesis in mouse macrophages and bone marrow cells.


    Niu, Haixia; Hadwiger, Gayla; Fujiwara, Hideji; Welch, John S


    In vivo pathways of natural retinoid metabolism and elimination have not been well characterized in primary myeloid cells, even though retinoids and retinoid receptors have been strongly implicated in regulating myeloid maturation. With the use of a upstream activation sequence-GFP reporter transgene and retrovirally expressed Gal4-retinoic acid receptor α in primary mouse bone marrow cells, we identified 2 distinct enzymatic pathways used by mouse myeloid cells ex vivo to synthesize retinoic acid receptor α ligands from free vitamin A metabolites (retinyl acetate, retinol, and retinal). Bulk Kit(+) bone marrow progenitor cells use diethylaminobenzaldehyde-sensitive enzymes, whereas bone marrow-derived macrophages use diethylaminobenzaldehyde-insensitive enzymes to synthesize natural retinoic acid receptor α-activating retinoids (all-trans retinoic acid). Bone marrow-derived macrophages do not express the diethylaminobenzaldehyde-sensitive enzymes Aldh1a1, Aldh1a2, or Aldh1a3 but instead, express Aldh3b1, which we found is capable of diethylaminobenzaldehyde-insensitive synthesis of all trans-retinoic acid. However, under steady-state and stimulated conditions in vivo, diverse bone marrow cells and peritoneal macrophages showed no evidence of intracellular retinoic acid receptor α-activating retinoids, despite expression of these enzymes and a vitamin A-sufficient diet, suggesting that the enzymatic conversion of retinal is not the rate-limiting step in the synthesis of intracellular retinoic acid receptor α-activating retinoids in myeloid bone marrow cells and that retinoic acid receptor α remains in an unliganded configuration during adult hematopoiesis. PMID:26768478

  2. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis.


    Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula


    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography-mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos. PMID:25711705

  3. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.


    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea


    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  4. Akt phosphorylation and regulation of transketolase is a nodal point for amino acid control of purine synthesis.


    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T; Phan, Tony; Pilz, Renate B; Boss, Gerry R


    The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mammalian target of rapamycin 2 and IκB kinase regulate Akt activity and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the nonoxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the nonoxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for 2 days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  5. A mutation affecting the synthesis of 4-chloroindole-3-acetic acid.


    Ross, John J; Tivendale, Nathan D; Davidson, Sandra E; Reid, James B; Davies, Noel W; Quittenden, Laura J; Smith, Jason A


    Traditionally, schemes depicting auxin biosynthesis in plants have been notoriously complex. They have involved up to four possible pathways by which the amino acid tryptophan might be converted to the main active auxin, indole-3-acetic acid (IAA), while another pathway was suggested to bypass tryptophan altogether. It was also postulated that different plants use different pathways, further adding to the complexity. In 2011, however, it was suggested that one of the four tryptophan-dependent pathways, via indole-3-pyruvic acid (IPyA), is the main pathway in Arabidopsis thaliana, although concurrent operation of one or more other pathways has not been excluded. We recently showed that, for seeds of Pisum sativum (pea), it is possible to go one step further. Our new evidence indicates that the IPyA pathway is the only tryptophan-dependent IAA synthesis pathway operating in pea seeds. We also demonstrated that the main auxin in developing pea seeds, 4-chloroindole-3-acetic acid (4-Cl-IAA), which accumulates to levels far exceeding those of IAA, is synthesized via a chlorinated version of the IPyA pathway. PMID:23073010

  6. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei


    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  7. Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis.


    Kerr, Thomas A; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W; Schwarz, Margrit


    The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  8. Hyaluronic acid lipoate: synthesis and physicochemical properties.


    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco


    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  9. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.


    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  10. Variations in metabolic pathways create challenges for automated metabolic reconstructions: Examples from the tetrahydrofolate synthesis pathway

    PubMed Central

    de Crécy-Lagard, Valérie


    The availability of thousands of sequenced genomes has revealed the diversity of biochemical solutions to similar chemical problems. Even for molecules at the heart of metabolism, such as cofactors, the pathway enzymes first discovered in model organisms like Escherichia coli or Saccharomyces cerevisiae are often not universally conserved. Tetrahydrofolate (THF) (or its close relative tetrahydromethanopterin) is a universal and essential C1-carrier that most microbes and plants synthesize de novo. The THF biosynthesis pathway and enzymes are, however, not universal and alternate solutions are found for most steps, making this pathway a challenge to annotate automatically in many genomes. Comparing THF pathway reconstructions and functional annotations of a chosen set of folate synthesis genes in specific prokaryotes revealed the strengths and weaknesses of different microbial annotation platforms. This analysis revealed that most current platforms fail in metabolic reconstruction of variant pathways. However, all the pieces are in place to quickly correct these deficiencies if the different databases were built on each other's strengths. PMID:25210598

  11. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.


    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D


    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective. PMID:25055961

  12. Ambient pressure synthesis of MIL-100(Fe) MOF from homogeneous solution using a redox pathway.


    Jeremias, Felix; Henninger, Stefan K; Janiak, Christoph


    Micro- to mesoporous iron(iii) trimesate MIL-100(Fe) is a MOF of high interest for numerous applications. With regard to large-scale synthesis, e.g., by continuous flow or the in situ deposition of coatings, a replacement for the conventional, hydrothermal low-yield fluoride-containing synthesis is desirable. In this contribution, we present a method to synthesize crystalline fluoride-free MIL-100(Fe) from iron(iii) nitrate and trimesic acid in zeotropic DMSO/water solution at normal ambient pressure involving a DMSO-nitrate redox pathway. Yields of 72%, surface areas of SBET = 1791 m(2) g(-1) and pore volumes of Vpore = 0.82 cm(3) g(-1) were achieved. PMID:27143562

  13. Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha.


    Eklund, D Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L


    The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. PMID:26036256

  14. Rapid synthesis of the 7-deoxy zaragozic acid core.


    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J


    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  15. First total synthesis of prasinic acid and its anticancer activity.


    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt


    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  16. Extending shikimate pathway for the production of muconic acid and its precursor salicylic acid in Escherichia coli.


    Lin, Yuheng; Sun, Xinxiao; Yuan, Qipeng; Yan, Yajun


    cis,cis-Muconic acid (MA) and salicylic acid (SA) are naturally-occurring organic acids having great commercial value. MA is a potential platform chemical for the manufacture of several widely-used consumer plastics; while SA is mainly used for producing pharmaceuticals (for example, aspirin and lamivudine) and skincare and haircare products. At present, MA and SA are commercially produced by organic chemical synthesis using petro-derived aromatic chemicals, such as benzene, as starting materials, which is not environmentally friendly. Here, we report a novel approach for efficient microbial production of MA via extending shikimate pathway by introducing the hybrid of an SA biosynthetic pathway with its partial degradation pathway. First, we engineered a well-developed phenylalanine producing Escherichia coli strain into an SA overproducer by introducing isochorismate synthase and isochorismate pyruvate lyase. The engineered strain is able to produce 1.2g/L of SA from simple carbon sources, which is the highest titer reported so far. Further, the partial SA degradation pathway involving salicylate 1-monoxygenase and catechol 1,2-dioxygenase is established to achieve the conversion of SA to MA. Finally, a de novo MA biosynthetic pathway is assembled by integrating the established SA biosynthesis and degradation modules. Modular optimization enables the production of up to 1.5g/L MA within 48h in shake flasks. This study not only establishes an efficient microbial platform for the production of SA and MA, but also demonstrates a generalizable pathway design strategy for the de novo biosynthesis of valuable degradation metabolites. PMID:24583236

  17. The general amino acid control pathway regulates mTOR and autophagy during serum/glutamine starvation

    PubMed Central

    Chen, Rui; Zou, Yilong; Mao, Dongxue; Sun, Daxiao; Gao, Guanguang; Shi, Jingwen; Liu, Xiaoqing; Zhu, Chen; Yang, Mingyu; Ye, Wanlu; Hao, Qianqian


    Organisms have evolved elaborate mechanisms to adjust intracellular nutrient levels in response to fluctuating availability of exogenous nutrients. During starvation, cells can enhance amino acid uptake and synthesis through the general amino acid control (GAAC) pathway, whereas nonessential cellular contents are recycled by autophagy. How these two pathways are coordinated in response to starvation is currently unknown. Here we show that the GAAC pathway couples exogenous amino acid availability with autophagy. Starvation caused deactivation of mTOR, which then activated autophagy. In parallel, serum/glutamine starvation activated the GAAC pathway, which up-regulated amino acid transporters, leading to increased amino acid uptake. This elevated the intracellular amino acid level, which in turn reactivated mTOR and suppressed autophagy. Knockdown of activating transcription factor 4, the major transcription factor in the GAAC pathway, or of SLC7A5, a leucine transporter, caused impaired mTOR reactivation and much higher levels of autophagy. Thus, the GAAC pathway modulates autophagy by regulating amino acid uptake and mTOR reactivation during serum/glutamine starvation. PMID:25049270

  18. Characterization of polyamine synthesis pathway in Bacillus subtilis 168.


    Sekowska, A; Bertin, P; Danchin, A


    The ubiquitous polyamines fulfil a variety of functions in all three kingdoms of life. However, little is known about the biosynthesis of these compounds in Gram-positive bacteria. We show that, in Bacillus subtilis, there is a single pathway to polyamines, starting from arginine, with agmatine as an intermediate. We first identified the structural gene of arginine decarboxylase, speA (formerly cad), and then described the speE speB operon, directing synthesis of spermidine synthase and agmatinase. This operon is transcribed into two messenger RNAs, a major one for the speE gene and a minor one for both speEand speB. The promoter of the operon was identified upstream from the speE gene by primer extension analysis. Transcription of this operon indicated that the level of agmatinase synthesis is very low, thus allowing a stringent control on the synthesis of putrescine and, therefore, of all polyamines. This is consistent with the level of polyamines measured in the cell. PMID:9723923

  19. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.


    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  20. Induction of Arabidopsis tryptophan pathway enzymes and camalexin by amino acid starvation, oxidative stress, and an abiotic elicitor.

    PubMed Central

    Zhao, J; Williams, C C; Last, R L


    The tryptophan (Trp) biosynthetic pathway leads to the production of many secondary metabolites with diverse functions, and its regulation is predicted to respond to the needs for both protein synthesis and secondary metabolism. We have tested the response of the Trp pathway enzymes and three other amino acid biosynthetic enzymes to starvation for aromatic amino acids, branched-chain amino acids, or methionine. The Trp pathway enzymes and cytosolic glutamine synthetase were induced under all of the amino acid starvation test conditions, whereas methionine synthase and acetolactate synthase were not. The mRNAs for two stress-inducible enzymes unrelated to amino acid biosynthesis and accumulation of the indolic phytoalexin camalexin were also induced by amino acid starvation. These results suggest that regulation of the Trp pathway enzymes under amino acid deprivation conditions is largely a stress response to allow for increased biosynthesis of secondary metabolites. Consistent with this hypothesis, treatments with the oxidative stress-inducing herbicide acifluorfen and the abiotic elicitor alpha-amino butyric acid induced responses similar to those induced by the amino acid starvation treatments. The role of salicylic acid in herbicide-mediated Trp and camalexin induction was investigated. PMID:9501110

  1. Role of the fatty acid breakdown pathway in the leaf

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Components of the lipid breakdown pathway including beta-oxidation enzymes and fatty acid transport mechanisms are essential for mobilizing storage lipid in germinating seeds of many plants. Comparatively little is known about their role during the rest of the plant’s life-time, however. We are cur...



    Brightman, V; Martin, W R


    Brightman, Vernon (The University of Chicago, Chicago), and William R. Martin. Pathway for the dissimilation of itaconic and mesaconic acids. J. Bacteriol. 82:376-382. 1961.-Studies on the oxidation of itaconic and mesaconic acids by a Pseudomonas sp., adapted to utilize either of these acids as a sole carbon source, have provided evidence for a pathway converting both itaconate and mesaconate to succinate. A metabolic interconversion of itaconate, mesaconate, and citramalate has also been demonstrated by whole cell and cell-free enzyme studies. Succinate derived from methylene-labeled itaconate was found to be labeled in the inside carbon atoms, a fact which indicates that the branched chain compound was converted into a straight chain molecule by a shift of the methylene carbon (C-5) from the side chain of itaconate to a position between C-2 and C-3 in an, as yet, unknown straight chain intermediate prior to its conversion to succinate. PMID:16561921

  3. Identification of an itaconic acid degrading pathway in itaconic acid producing Aspergillus terreus.


    Chen, Mei; Huang, Xuenian; Zhong, Chengwei; Li, Jianjun; Lu, Xuefeng


    Itaconic acid, one of the most promising and flexible bio-based chemicals, is mainly produced by Aspergillus terreus. Previous studies to improve itaconic acid production in A. terreus through metabolic engineering were mainly focused on its biosynthesis pathway, while the itaconic acid-degrading pathway has largely been ignored. In this study, we used transcriptomic, proteomic, bioinformatic, and in vitro enzymatic analyses to identify three key enzymes, itaconyl-CoA transferase (IctA), itaconyl-CoA hydratase (IchA), and citramalyl-CoA lyase (CclA), that are involved in the catabolic pathway of itaconic acid in A. terreus. In the itaconic acid catabolic pathway in A. terreus, itaconic acid is first converted by IctA into itaconyl-CoA with succinyl-CoA as the CoA donor, and then itaconyl-CoA is hydrated into citramalyl-CoA by IchA. Finally, citramalyl-CoA is cleaved into acetyl-CoA and pyruvate by CclA. Moreover, IctA can also catalyze the reaction between citramalyl-CoA and succinate to generate succinyl-CoA and citramalate. These results, for the first time, identify the three key enzymes, IctA, IchA, and CclA, involved in the itaconic acid degrading pathway in itaconic acid producing A. terreus. The results will facilitate the improvement of itaconic acid production by metabolically engineering the catabolic pathway of itaconic acid in A. terreus. PMID:27102125

  4. Flux Balance Analysis of Mycolic Acid Pathway: Targets for Anti-Tubercular Drugs

    PubMed Central

    Raman, Karthik; Rajagopalan, Preethi; Chandra, Nagasuma


    Mycobacterium tuberculosis is the focus of several investigations for design of newer drugs, as tuberculosis remains a major epidemic despite the availability of several drugs and a vaccine. Mycobacteria owe many of their unique qualities to mycolic acids, which are known to be important for their growth, survival, and pathogenicity. Mycolic acid biosynthesis has therefore been the focus of a number of biochemical and genetic studies. It also turns out to be the pathway inhibited by front-line anti-tubercular drugs such as isoniazid and ethionamide. Recent years have seen the emergence of systems-based methodologies that can be used to study microbial metabolism. Here, we seek to apply insights from flux balance analyses of the mycolic acid pathway (MAP) for the identification of anti-tubercular drug targets. We present a comprehensive model of mycolic acid synthesis in the pathogen M. tuberculosis involving 197 metabolites participating in 219 reactions catalysed by 28 proteins. Flux balance analysis (FBA) has been performed on the MAP model, which has provided insights into the metabolic capabilities of the pathway. In silico systematic gene deletions and inhibition of InhA by isoniazid, studied here, provide clues about proteins essential for the pathway and hence lead to a rational identification of possible drug targets. Feasibility studies using sequence analysis of the M. tuberculosis H37Rv and human proteomes indicate that, apart from the known InhA, potential targets for anti-tubercular drug design are AccD3, Fas, FabH, Pks13, DesA1/2, and DesA3. Proteins identified as essential by FBA correlate well with those previously identified experimentally through transposon site hybridisation mutagenesis. This study demonstrates the application of FBA for rational identification of potential anti-tubercular drug targets, which can indeed be a general strategy in drug design. The targets, chosen based on the critical points in the pathway, form a ready shortlist

  5. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål)

    PubMed Central

    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang


    The “target of rapamycin” (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527

  6. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål).


    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang


    The "target of rapamycin" (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527

  7. Ascorbic acid intake and oxalate synthesis.


    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P


    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  8. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa


    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  9. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.


    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  10. Oleic acid-enhanced transdermal delivery pathways of fluorescent nanoparticles

    NASA Astrophysics Data System (ADS)

    Lo, Wen; Ghazaryan, Ara; Tso, Chien-Hsin; Hu, Po-Sheng; Chen, Wei-Liang; Kuo, Tsung-Rong; Lin, Sung-Jan; Chen, Shean-Jen; Chen, Chia-Chun; Dong, Chen-Yuan


    Transdermal delivery of nanocarriers provides an alternative pathway to transport therapeutic agents, alleviating pain, improving compliance of patients, and increasing overall effectiveness of delivery. In this work, enhancement of transdermal delivery of fluorescent nanoparticles and sulforhodamine B with assistance of oleic acid was visualized utilizing multiphoton microscopy (MPM) and analyzed quantitatively using multi-photon excitation-induced fluorescent signals. Results of MPM imaging and MPM intensity-based spatial depth-dependent analysis showed that oleic acid is effective in facilitating transdermal delivery of nanoparticles.

  11. Enhanced production of fatty alcohols by engineering the TAGs synthesis pathway in Saccharomyces cerevisiae.


    Tang, Xiaoling; Chen, Wei Ning


    The production of fatty acid-derived chemicals has received a great deal of attention in recent years. In yeast cells, the main storage forms of fatty acids are TAGs. However, the conversion of TAGs into fatty acid derivatives suffers from a practical standpoint. Herein, a more direct strategy was applied to accumulate cellular fatty acyl-CoAs in Saccharomyces cerevisiae, which are the activated forms of fatty acids and used as important precursors for various converting enzymes. The dga1 gene was deleted to block the fatty acyl-CoAs dependent pathway of TAGs synthesis and a significant decrease in lipid content was observed. The FAR gene was cloned and overexpressed in the wild type strain and gene disrupted strain, to convert the fatty acyl-CoAs to the corresponding fatty acid derivatives. The metabolic engineered pathway resulted in enhanced production of fatty alcohols. Compared with the wild type strain with overexpressed FAR gene, the yield of fatty alcohols in the Δdga1 strain with FAR was dramatically increased: the intracellular fatty alcohols increased from 26 mg/L to 45 mg/L, while the extracellular fatty alcohols increased from 2.2 mg/L to 4.3 mg/L. By optimizing the culture medium with increased carbon concentration and limited nitrogen concentration, the fatty alcohols yield in the Δdga1 strain with FAR was further increased to 84 mg/L in cells and 14 mg/L secreted in broth. The results in this study demonstrated the feasibility of using the designed strategy to solve the bottleneck in utilizing TAGs for fatty acid derivatives production. PMID:25116045

  12. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.


    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim


    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases. PMID:25282359

  13. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.


    Napoli, J L


    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  14. Total synthesis and complete stereostructure of gambieric acid A.


    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto


    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  15. Synthesis of fatty acids in the perused mouse liver.


    Salmon, D M; Bowen, N L; Hems, D A


    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  16. Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

    PubMed Central

    Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence


    In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

  17. Dissecting Abscisic Acid Signaling Pathways Involved in Cuticle Formation.


    Cui, Fuqiang; Brosché, Mikael; Lehtonen, Mikko T; Amiryousefi, Ali; Xu, Enjun; Punkkinen, Matleena; Valkonen, Jari P T; Fujii, Hiroaki; Overmyer, Kirk


    The cuticle is the outer physical barrier of aerial plant surfaces and an important interaction point between plants and the environment. Many environmental stresses affect cuticle formation, yet the regulatory pathways involved remain undefined. We used a genetics and gene expression analysis in Arabidopsis thaliana to define an abscisic acid (ABA) signaling loop that positively regulates cuticle formation via the core ABA signaling pathway, including the PYR/PYL receptors, PP2C phosphatase, and SNF1-Related Protein Kinase (SnRK) 2.2/SnRK2.3/SnRK2.6. Downstream of the SnRK2 kinases, cuticle formation was not regulated by the ABA-responsive element-binding transcription factors but rather by DEWAX, MYB16, MYB94, and MYB96. Additionally, low air humidity increased cuticle formation independent of the core ABA pathway and cell death/reactive oxygen species signaling attenuated expression of cuticle-biosynthesis genes. In Physcomitrella patens, exogenous ABA suppressed expression of cuticle-related genes, whose Arabidopsis orthologs were ABA-induced. Hence, the mechanisms regulating cuticle formation are conserved but sophisticated in land plants. Signaling specifically related to cuticle deficiency was identified to play a major role in the adaptation of ABA signaling pathway mutants to increased humidity and in modulating their immunity to Botrytis cinerea in Arabidopsis. These results define a cuticle-specific downstream branch in the ABA signaling pathway that regulates responses to the external environment. PMID:27060495

  18. A symmetry-based formal synthesis of zaragozic acid A.


    Freeman-Cook, K D; Halcomb, R L


    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  19. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.


    Papadopoulos, Giorgos N; Kokotos, Christoforos G


    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  20. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  1. Synthesis of the Enzymes of the Mandelate Pathway by Pseudomonas putida I. Synthesis of Enzymes by the Wild Type

    PubMed Central

    Hegeman, G. D.


    Hegeman, G. D. (University of California, Berkeley). Synthesis of the enzymes of the mandelate pathway by Pseudomonas putida. I. Synthesis of enzymes by the wild type. J. Bacteriol. 91:1140–1154. 1966.—The control of synthesis of the five enzymes responsible for the conversion of d(−)-mandelate to benzoate by Pseudomonas putida was investigated. The first three compounds occurring in the pathway, d(−)-mandelate, l(+)-mandelate, and benzoylformate, are equipotent inducers of all five enzymes. A nonmetabolizable inducer, phenoxyacetate, also induces synthesis of these enzymes; but, unlike the metabolizable inducer-substrates, it does not elicit synthesis of enzymes that mediate steps in the pathway beyond benzoate. Under conditions of semigratuity, dl-mandelate elicits immediate synthesis at a steady rate of the first two enzymes of the pathway, but two enzymes which act below the level of benzoate are synthesized only after a considerable lag. Succinate and asparagine do not significantly repress the synthesis of the enzymes responsible for mandelate oxidation. PMID:5929747

  2. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.


    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  3. The prokaryotic pathway of lipid synthesis in oat leaf plastids

    SciTech Connect

    Gillanders, B.; Mackender, R. )


    Evidence for the operation of the prokaryotic pathway of acyl lipid synthesis is an 18:3 plant was sought by incubating plastids from 6 sequential segments from oat seedling leaves as described previously except that {sup 14}C-G3P was used. Proplastids were the most biosynthetically active plastids (x2-3) and DAG and PA were the most heavily labelled acyl lipids (>75% of label). Analysis of MGDG and DGDG molecular species (MS) following pre-incubation with {sup 14}C-G3P (40 mins) and subsequently with UDP{sup 3}H-gal (30 mins), showed that only MS 16:0/18:0 and MS 16:0/18:1 were significantly labelled with {sup 14}C whereas all 5 MS were labelled with {sup 3}H-gal. However most of the {sup 3}H label was in the same MS as the {sup 14}C except when 18:2/18:2 DAG or PC was added with the {sup 3}H-gal, in which case considerably additional {sup 3}H-gal (up to 100%) appeared in the 18:2/18:2 MS of both these lipids.

  4. Aldehyde Dehydrogenase 1a1 Mediates a GABA Synthesis Pathway in Midbrain Dopaminergic Neurons

    PubMed Central

    Kim, Jae-Ick; Ganesan, Subhashree; Luo, Sarah X.; Wu, Yu-Wei; Park, Esther; Huang, Eric J.; Chen, Lu; Ding, Jun B.


    Midbrain dopamine neurons are an essential component of the basal ganglia circuitry, playing key roles in the control of fine movement and reward. Recently, it has been demonstrated that γ-aminobutyric acid (GABA), the chief inhibitory neurotransmitter, is co-released by dopamine neurons. Here we show that GABA corelease in dopamine neurons does not utilize the conventional GABA synthesizing enzymes, glutamate decarboxylases GAD65 and GAD67. Our experiments reveal an evolutionarily conserved GABA synthesis pathway mediated by aldehyde dehydrogenase 1a1 (ALDH1a1). Moreover, GABA co-release is modulated by ethanol at binge drinking blood alcohol concentrations and diminished ALDH1a1 leads to enhanced alcohol consumption and preference. These findings provide insights into the functional role of GABA co-release in midbrain dopamine neurons, which may be essential for reward-based behavior and addiction. PMID:26430123

  5. Synthesis and characterization of anaerobic degradation biomarkers of n-alkanes via hydroxylation/carboxylation pathways.


    Zhou, Jing; Bian, Xin-Yu; Zhou, Lei; Mbadinga, Serge Maurice; Yang, Shi-Zhong; Liu, Jin-Feng; Gu, Ji-Dong; Mu, Bo-Zhong


    Metabolite profiling is a powerful method in research on anaerobic biodegradation of hydrocarbons. Hydroxylation and carboxylation are proposed pathways in anaerobic degradation but very little direct evidence is available about metabolites and signature biomarkers. 2-Acetylalkanoic acid is a potential signature metabolite because of its unique and specific structure among possible intermediates. A procedure for the synthesis of four homologues with various carbon chain lengths was proposed and the characteristics of 2-acetyl- alkanoic acid esters were investigated using four derivatization processes, namely methyl, ethyl, n-butyl and trimethylsilyl esterification. Four intermediate fragments observed were at m/z 73 + 14n, 87 + 14n, 102 + 14n (n = 1, 2 and 4 for methyl, ethyl and n-butyl ester, respectively) and [M - 42]+ for three of the derivatization methods. For silylation, characteristic ions were observed at m/z 73, 117, [M - 42](+) and [M - 55](+). These are basic and significant data for the future identification of potential intermediates of the hydroxylation and carboxylation pathways in hydrocarbon degradation. PMID:26863073

  6. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease.


    Lake, April D; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D; Lu, Zhenqiang; Lehman-McKeeman, Lois D; Cherrington, Nathan J


    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the 'classical' (neutral) and 'alternative' (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. PMID:23391614

  7. Life in hot acid: pathway analyses in extremely thermoacidophilic archaea.


    Auernik, Kathryne S; Cooper, Charlotte R; Kelly, Robert M


    The extremely thermoacidophilic archaea are a particularly intriguing group of microorganisms that must simultaneously cope with biologically extreme pHs (< or = 4) and temperatures (Topt > or = 60 degrees C) in their natural environments. Their expanding biotechnological significance relates to their role in biomining of base and precious metals and their unique mechanisms of survival in hot acid, at both the cellular and biomolecular levels. Recent developments, such as advances in understanding of heavy metal tolerance mechanisms, implementation of a genetic system, and discovery of a new carbon fixation pathway, have been facilitated by the availability of genome sequence data and molecular genetic systems. As a result, new insights into the metabolic pathways and physiological features that define extreme thermoacidophily have been obtained, in some cases suggesting prospects for biotechnological opportunities. PMID:18760359

  8. Hepatic alpha-oxidation of phytanic acid. A revised pathway.


    Van Veldhoven, P P; Mannaerts, G P; Casteels, M; Croes, K


    Synthetic 3-methyl-branched chain fatty acids were used to decipher the breakdown of phytanic acid. Based on results obtained in intact or permeabilized rat hepatocytes, rat liver homogenates or subcellular fractions, a revised alpha-oxidation pathway is proposed which appears to be functioning in man as well. In a first step, the 3-methyl-branched chain fatty acid is activated by an acyl-CoA synthetase. This reaction requires CoA, ATP and Mg2+. Subsequently, the acyl-CoA ester is hydroxylated at position 2 by a peroxisomal dioxygenase. This step is dependent on alpha-oxoglutarate, ascorbate (or glutathione), Fe2+ and O2. The 2-hydroxy-3-methylacyl-CoA intermediate is cleaved by a peroxisomal lyase to formyl-CoA and a 2-methyl-branched fatty aldehyde. Formyl-CoA is (partly enzymically) hydrolyzed to formate, which is then converted, most likely in the cytosol, to CO2. In the presence of NAD+, the aldehyde is dehydrogenated to a 2-methyl-branched fatty acid, presumably by a peroxisomal aldehyde dehydrogenase. This acid can--after activation--be degraded via a D-specific peroxisomal beta-oxidation system. PMID:10709654

  9. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  10. Nucleic acid arrays and methods of synthesis


    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles


    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  11. Increased fatty acid synthesis inhibits nitrogen starvation-induced autophagy in lipid droplet-deficient yeast.


    Régnacq, Matthieu; Voisin, Pierre; Sere, Yves Y; Wan, Bin; Soeroso, Venty M S; Bernard, Marianne; Camougrand, Nadine; Bernard, François-Xavier; Barrault, Christine; Bergès, Thierry


    Macroautophagy is a degradative pathway whereby cells encapsulate and degrade cytoplasmic material within endogenously-built membranes. Previous studies have suggested that autophagosome membranes originate from lipid droplets. However, it was recently shown that rapamycin could induce autophagy in cells lacking these organelles. Here we show that lipid droplet-deprived cells are unable to perform autophagy in response to nitrogen-starvation because of an accelerated lipid synthesis that is not observed with rapamycin. Using cerulenin, a potent inhibitor of fatty acid synthase, and exogenous addition of palmitic acid we could restore nitrogen-starvation induced autophagy in the absence of lipid droplets. PMID:27270031

  12. Quantitative importance of the 25-hydroxylation pathway for bile acid biosynthesis in the rat

    SciTech Connect

    Duane, W.C.; Bjoerkhem, I.H.; Hamilton, J.N.; Mueller, S.M.


    During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. In the present study, we have quantitated the relative importance of these two pathways in vivo by measuring production of (14C) acetone from (14C)-26-cholesterol. Four days after intraperitoneal injection of 20 to 40 muCi (14C)-26-cholesterol and 1 day after beginning a constant intravenous infusion of unlabeled acetone at 25 mumoles per kg per min, 6 male and 2 female Sprague-Dawley rats underwent breath collections. Expired acetone was trapped and purified as the 2,4-dinitrophenylhydrazine derivative. 14CO2 was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied times the acetone infusion rate to calculate production of (14C)acetone. (14C) Acetone production averaged 1.7% of total release of 14C from (14C)-26-cholesterol, estimated by 14CO2 output. The method was validated by showing that (14C) acetone production from (14C)isopropanol averaged 111% of the (14C)isopropanol infusion rate. We conclude that, in the normal rat, the 25-hydroxylation pathway accounts for less than 2% of bile acid synthesis.

  13. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.


    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  14. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.


    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  15. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.


    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D


    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  16. Regulation of Primary Metabolic Pathways in Oyster Mushroom Mycelia Induced by Blue Light Stimulation: Accumulation of Shikimic Acid

    PubMed Central

    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei


    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis. PMID:25721093

  17. Regulation of primary metabolic pathways in oyster mushroom mycelia induced by blue light stimulation: accumulation of shikimic acid.


    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei


    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis. PMID:25721093

  18. Pathway engineering of Propionibacterium jensenii for improved production of propionic acid.


    Liu, Long; Guan, Ningzi; Zhu, Gexin; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian


    Propionic acid (PA) is an important chemical building block widely used in the food, pharmaceutical, and chemical industries. In our previous study, a shuttle vector was developed as a useful tool for engineering Propionibacterium jensenii, and two key enzymes-glycerol dehydrogenase and malate dehydrogenase-were overexpressed to improve PA titer. Here, we aimed to improve PA production further via the pathway engineering of P. jensenii. First, the phosphoenolpyruvate carboxylase gene (ppc) from Klebsiella pneumoniae was overexpressed to access the one-step synthesis of oxaloacetate directly from phosphoenolpyruvate without pyruvate as intermediate. Next, genes encoding lactate dehydrogenase (ldh) and pyruvate oxidase (poxB) were deleted to block the synthesis of the by-products lactic acid and acetic acid, respectively. Overexpression of ppc and deleting ldh improved PA titer from 26.95 ± 1.21 g·L(-1) to 33.21 ± 1.92 g·L(-1) and 30.50 ± 1.63 g·L(-1), whereas poxB deletion decreased it. The influence of this pathway engineering on gene transcription, enzyme expression, NADH/NAD(+) ratio, and metabolite concentration was also investigated. Finally, PA production in P. jensenii with ppc overexpression as well as ldh deletion was investigated, which resulted in further increases in PA titer to 34.93 ± 2.99 g·L(-1) in a fed-batch culture. PMID:26814976

  19. Pathway engineering of Propionibacterium jensenii for improved production of propionic acid

    PubMed Central

    Liu, Long; Guan, Ningzi; Zhu, Gexin; Li, Jianghua; Shin, Hyun-dong; Du, Guocheng; Chen, Jian


    Propionic acid (PA) is an important chemical building block widely used in the food, pharmaceutical, and chemical industries. In our previous study, a shuttle vector was developed as a useful tool for engineering Propionibacterium jensenii, and two key enzymes—glycerol dehydrogenase and malate dehydrogenase—were overexpressed to improve PA titer. Here, we aimed to improve PA production further via the pathway engineering of P. jensenii. First, the phosphoenolpyruvate carboxylase gene (ppc) from Klebsiella pneumoniae was overexpressed to access the one-step synthesis of oxaloacetate directly from phosphoenolpyruvate without pyruvate as intermediate. Next, genes encoding lactate dehydrogenase (ldh) and pyruvate oxidase (poxB) were deleted to block the synthesis of the by-products lactic acid and acetic acid, respectively. Overexpression of ppc and deleting ldh improved PA titer from 26.95 ± 1.21 g·L−1 to 33.21 ± 1.92 g·L−1 and 30.50 ± 1.63 g·L−1, whereas poxB deletion decreased it. The influence of this pathway engineering on gene transcription, enzyme expression, NADH/NAD+ ratio, and metabolite concentration was also investigated. Finally, PA production in P. jensenii with ppc overexpression as well as ldh deletion was investigated, which resulted in further increases in PA titer to 34.93 ± 2.99 g·L−1 in a fed-batch culture. PMID:26814976

  20. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.


    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  1. Substrate specificity of the sialic acid biosynthetic pathway

    SciTech Connect

    Jacobs, Christina L.; Goon, Scarlett; Yarema, Kevin J.; Hinderlich, Stephan; Hang, Howard C.; Chai, Diana H.; Bertozzi, Carolyn R.


    Unnatural analogs of sialic acid can be delivered to mammalian cell surfaces through the metabolic transformation of unnatural N-acetylmannosamine (ManNAc) derivatives. In previous studies, mannosamine analogs bearing simple N-acyl groups up to five carbon atoms in length were recognized as substrates by the biosynthetic machinery and transformed into cell-surface sialoglycoconjugates [Keppler, O. T., et al. (2001) Glycobiology 11, 11R-18R]. Such structural alterations to cell surface glycans can be used to probe carbohydrate-dependent phenomena. This report describes our investigation into the extent of tolerance of the pathway toward additional structural alterations of the N-acyl substituent of ManNAc. A panel of analogs with ketone-containing N-acyl groups that varied in the lengthor steric bulk was chemically synthesized and tested for metabolic conversion to cell-surface glycans. We found that extension of the N-acyl chain to six, seven, or eight carbon atoms dramatically reduced utilization by the biosynthetic machinery. Likewise, branching from the linear chain reduced metabolic conversion. Quantitation of metabolic intermediates suggested that cellular metabolism is limited by the phosphorylation of the N-acylmannosamines by ManNAc 6-kinase in the first step of the pathway. This was confirmed by enzymatic assay of the partially purified enzyme with unnatural substrates. Identification of ManNAc 6-kinase as a bottleneck for unnatural sialic acid biosynthesis provides a target for expanding the metabolic promiscuity of mammalian cells.

  2. Proteolytic Pathways Induced by Herbicides That Inhibit Amino Acid Biosynthesis

    PubMed Central

    Zulet, Amaia; Gil-Monreal, Miriam; Villamor, Joji Grace; Zabalza, Ana; van der Hoorn, Renier A. L.; Royuela, Mercedes


    Background The herbicides glyphosate (Gly) and imazamox (Imx) inhibit the biosynthesis of aromatic and branched-chain amino acids, respectively. Although these herbicides inhibit different pathways, they have been reported to show several common physiological effects in their modes of action, such as increasing free amino acid contents and decreasing soluble protein contents. To investigate proteolytic activities upon treatment with Gly and Imx, pea plants grown in hydroponic culture were treated with Imx or Gly, and the proteolytic profile of the roots was evaluated through fluorogenic kinetic assays and activity-based protein profiling. Results Several common changes in proteolytic activity were detected following Gly and Imx treatment. Both herbicides induced the ubiquitin-26 S proteasome system and papain-like cysteine proteases. In contrast, the activities of vacuolar processing enzymes, cysteine proteases and metacaspase 9 were reduced following treatment with both herbicides. Moreover, the activities of several putative serine protease were similarly increased or decreased following treatment with both herbicides. In contrast, an increase in YVADase activity was observed under Imx treatment versus a decrease under Gly treatment. Conclusion These results suggest that several proteolytic pathways are responsible for protein degradation upon herbicide treatment, although the specific role of each proteolytic activity remains to be determined. PMID:24040092

  3. Ascorbate synthesis pathway: dual role of ascorbate in bone homeostasis.


    Gabbay, Kenneth H; Bohren, Kurt M; Morello, Roy; Bertin, Terry; Liu, Jeff; Vogel, Peter


    Using mouse gene knock-out models, we identify aldehyde reductase (EC, Akr1a4 (GR)) and aldose reductase (EC, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) mice show that the two enzymes, GR and AR, provide approximately 85 and approximately 15% of L-gulonate, respectively. GRKO/ARKO double knock-out mice are unable to synthesize ASC (>95% ASC deficit) and develop scurvy. The GRKO mice ( approximately 85% ASC deficit) develop and grow normally when fed regular mouse chow (ASC content = 0) but suffer severe osteopenia and spontaneous fractures with stresses that increase ASC requirements, such as pregnancy or castration. Castration greatly increases osteoclast numbers and activity in GRKO mice and promotes increased bone loss as compared with wild-type controls and additionally induces proliferation of immature dysplastic osteoblasts likely because of an ASC-sensitive block(s) in early differentiation. ASC and the antioxidants pycnogenol and resveratrol block osteoclast proliferation and bone loss, but only ASC feeding restores osteoblast differentiation and prevents their dysplastic proliferation. This is the first in vivo demonstration of two independent roles for ASC as an antioxidant suppressing osteoclast activity and number as well as a cofactor promoting osteoblast differentiation. Although humans have lost the ability to synthesize ASC, our mouse models suggest the mechanisms by which suboptimal ASC availability facilitates the development of osteoporosis, which has important implications for human osteoporosis. PMID:20410296

  4. Pathways for abiotic organic synthesis at submarine hydrothermal fields

    PubMed Central

    McDermott, Jill M.; Seewald, Jeffrey S.; German, Christopher R.; Sylva, Sean P.


    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond. PMID:26056279

  5. Pathways for abiotic organic synthesis at submarine hydrothermal fields.


    McDermott, Jill M; Seewald, Jeffrey S; German, Christopher R; Sylva, Sean P


    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond. PMID:26056279

  6. Folic acid promotes the myogenic differentiation of C2C12 murine myoblasts through the Akt signaling pathway.


    Hwang, Seong Yeon; Kang, Yong Jung; Sung, Bokyung; Kim, Minjung; Kim, Dong Hwan; Lee, Yujin; Yoo, Mi-Ae; Kim, Cheol Min; Chung, Hae Young; Kim, Nam Deuk


    Folic acid is a water-soluble vitamin in the B-complex group, and an exogenous intake is required for health, growth and development. As a precursor to co-factors, folic acid is required for one-carbon donors in the synthesis of DNA bases and other essential biomolecules. A lack of dietary folic acid can lead to folic acid deficiency and can therefore result in several health problems, including macrocytic anemia, elevated plasma homocysteine levels, cardiovascular disease, birth defects, carcinogenesis, muscle weakness and difficulty in walking. Previous studies have indicated that folic acid exerts a positive effect on skeletal muscle functions. However, the precise role of folic acid in skeletal muscle cell differentiation remains poorly understood. Thus, in the present study, we examined the effects of folic acid on neo-myotube maturation and differentiation using C2C12 murine myoblasts. We found that folic acid promoted the formation of multinucleated myotubes, and increased the fusion index and creatine kinase (CK) activity in a concentration-dependent manner. In addition, western blot analysis revealed that the expression levels of the muscle-specific marker, myosin heavy chain (MyHC), as well as those of the myogenic regulatory factors (MRFs), MyoD and myogenin, were increased in the folic acid-treated myotubes during myogenic differentiation. Folic acid also promoted the activation of the Akt pathway, and this effect was inhibited by treatment of the C2C12 cells with LY294002 (Akt inhibitor). Blocking of the Akt pathway with a specific inhibitor revealed that it was necessary for mediating the stimulatory effects of folic acid on muscle cell differentiation and fusion. Taken together, our data suggest that folic acid promotes the differentiation of C2C12 cells through the activation of the Akt pathway. PMID:26310574

  7. Total synthesis of legionaminic acid as basis for serological studies.


    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H


    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  8. Synthesis of α-aminoboronic acids.


    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos


    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  9. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger


    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  10. Redundant pathways for Cdc2 activation in Xenopus oocyte: either cyclin B or Mos synthesis

    PubMed Central

    Haccard, Olivier; Jessus, Catherine


    Xenopus oocytes are arrested in meiotic prophase I. Progesterone induces the resumption of meiotic maturation, which requires continuous protein synthesis to bring about Cdc2 activation. The identification of the newly synthesized proteins has long been a goal. Two plausible candidates have received extensive study. The synthesis of cyclin B and of c-Mos, a kinase that activates the mitogen-activated protein kinase pathway in oocytes, is clearly upregulated by translational control in response to progesterone. Recent studies suggest that ablation of either c-Mos or cyclin B synthesis by antisense oligonucleotides does not block meiotic maturation. Here, however, we show that when both pathways are simultaneously inhibited, progesterone no longer triggers maturation; adding back either c-Mos or cyclin B restores meiotic maturation. We conclude that the specific synthesis of either B-type cyclins or c-Mos, induced by progesterone, is required to induce meiotic maturation. The two pathways seem to be functionally redundant. PMID:16374506

  11. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.


    Awasthi, Neeraj Praphulla; Singh, R P


    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  12. Organochlorines inhibit acetaminophen glucuronidation by redirecting UDP-glucuronic acid towards the D-glucuronate pathway

    SciTech Connect

    Chan, Tom S. Wilson, John X.; Selliah, Subajini; Bilodeau, Marc; Zwingmann, Claudia; Poon, Raymond; O'Brien, Peter J.


    Industry-derived organochlorines are persistent environmental pollutants that are a continuing health concern. The effects of these compounds on drug metabolism are not well understood. In the current study we present evidence that the inhibition of acetaminophen (APAP) glucuronidation by minute concentrations of organochlorines correlates well with their ability to stimulate the D-glucuronate pathway leading to ascorbate synthesis. A set of 6 arylated organochlorines, including 5 PCB (polychlorinated biphenyl) congeners, were assessed for their effects on APAP glucuronidation in isolated hepatocytes from male Sprague-Dawley rats. The capacity of each organochlorine to inhibit APAP glucuronidation was found to be directly proportional to its capacity to stimulate ascorbate synthesis. PCB153, PCB28 and bis-(4-chlorophenyl sulfone) (BCPS) in increasing order were the most effective organochlorines for inhibiting APAP glucuronidation and stimulating the D-glucuronate pathway. None of the 3 inhibitors of APAP glucuronidation were able to alter the expression of UGT1A6, UGT1A7 and UGT1A8 (the major isoforms responsible for APAP glucuronidation in the rat), however, their efficacy at inhibiting APAP glucuronidation was proportional to their capacity to deplete UDP-glucuronic acid (UDPGA). BCPS-mediated inhibition of APAP glucuronidation in isolated hepatocytes had non-competitive characteristics and was insensitive to the inactivation of cytochrome P450. The effective organochlorines were also able to selectively stimulate the hydrolysis of UDPGA to UDP and glucuronate in isolated microsomes, but could not inhibit APAP glucuronidation in microsomes when UDPGA was in excess. We conclude that organochlorines are able to inhibit APAP glucuronidation in hepatocytes by depleting UDPGA via redirecting UDPGA towards the D-glucuronate pathway. Because the inhibition is non-competitive, low concentrations of these compounds could have long term inhibitory effects on the

  13. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.


    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  14. Synthesis of biobased succinonitrile from glutamic acid and glutamine.


    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M


    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  15. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.


    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  16. Stereoselective synthesis of unsaturated α-amino acids.


    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine


    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  17. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.


    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  18. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.


    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  19. Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

    PubMed Central


    Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

  20. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  1. Enantioselective synthesis of isotopically labeled homocitric acid lactone.


    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T


    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  2. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.


    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  3. Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha[OPEN

    PubMed Central

    Eklund, D. Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P.; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L.


    The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. PMID:26036256

  4. Arachidonic acid stimulates DNA synthesis in brown preadipocytes through the activation of protein kinase C and MAPK.


    Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus


    Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. PMID:22766489

  5. The intracellular parasite Toxoplasma gondii depends on the synthesis of long chain and very long-chain unsaturated fatty acids not supplied by the host cell

    PubMed Central

    Ramakrishnan, Srinivasan; Docampo, Melissa D.; MacRae, James I.; Ralton, Julie E.; Rupasinghe, Thusitha; McConville, Malcolm J.; Striepen, Boris


    SUMMARY Apicomplexa are parasitic protozoa that cause important human diseases including malaria, cryptosporidiosis and toxoplasmosis. The replication of these parasites within their target host cell is dependent on both salvage as well as de novo synthesis of fatty acids. In T. gondii, fatty acid synthesis via the apicoplast-localized FASII is essential for pathogenesis, while the role of two other fatty acid biosynthetic complexes remains unclear. Here we demonstrate that the ER-localized fatty acid elongation (ELO) is essential for parasite growth. Conditional knock-down of the non-redundant hydroxyacyl-CoA dehydratase and enoyl-CoA reductase enzymes in the ELO pathway severely repressed intracellular parasite growth. 13C-glucose and 13C-acetate labeling and comprehensive lipidomic analyses of these mutants showed a selective defect in synthesis of unsaturated long and very long chain fatty acids (LCFAs and VLCFAs) and depletion of phosphatidylinositol and phosphatidylethanolamine species containing unsaturated LCFAs and VLCFAs. This requirement for ELO pathway was by-passed by supplementing the media with specific fatty acids, indicating active, but inefficient import of host fatty acids. Our experiments highlight a gap between the fatty acid needs of the parasite and availability of specific fatty acids in the host cell that the parasite has to close using a dedicated synthesis and modification pathway. PMID:25825226

  6. Shock synthesis of amino acids from impacting cometary and icy planet surface analogues

    NASA Astrophysics Data System (ADS)

    Martins, Zita; Price, Mark C.; Goldman, Nir; Sephton, Mark A.; Burchell, Mark J.


    Comets are known to harbour simple ices and the organic precursors of the building blocks of proteins--amino acids--that are essential to life. Indeed, glycine, the simplest amino acid, was recently confirmed to be present on comet 81P/Wild-2 from samples returned by NASA's Stardust spacecraft. Impacts of icy bodies (such as comets) onto rocky surfaces, and, equally, impacts of rocky bodies onto icy surfaces (such as the jovian and saturnian satellites), could have been responsible for the manufacture of these complex organic molecules through a process of shock synthesis. Here we present laboratory experiments in which we shocked ice mixtures analogous to those found in a comet with a steel projectile fired at high velocities in a light gas gun to test whether amino acids could be produced. We found that the hypervelocity impact shock of a typical comet ice mixture produced several amino acids after hydrolysis. These include equal amounts of D- and L-alanine, and the non-protein amino acids α-aminoisobutyric acid and isovaline as well as their precursors. Our findings suggest a pathway for the synthetic production of the components of proteins within our Solar System, and thus a potential pathway towards life through icy impacts.

  7. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.


    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  8. Abscisic-acid-induced cellular apoptosis and differentiation in glioma via the retinoid acid signaling pathway.


    Zhou, Nan; Yao, Yu; Ye, Hongxing; Zhu, Wei; Chen, Liang; Mao, Ying


    Retinoid acid (RA) plays critical roles in regulating differentiation and apoptosis in a variety of cancer cells. Abscisic acid (ABA) and RA are direct derivatives of carotenoids and share structural similarities. Here we proposed that ABA may also play a role in cellular differentiation and apoptosis by sharing a similar signaling pathway with RA that may be involved in glioma pathogenesis. We reported for the first time that the ABA levels were twofold higher in low-grade gliomas compared with high-grade gliomas. In glioma tissues, there was a positive correlation between the ABA levels and the transcription of cellular retinoic acid-binding protein 2 (CRABP2) and a negative correlation between the ABA levels and transcription of fatty acid-binding protein 5 (FABP5). ABA treatment induced a significant increase in the expression of CRABP2 and a decrease in the expression of peroxisome proliferator-activated receptor (PPAR) in glioblastoma cells. Remarkably, both cellular apoptosis and differentiation were increased in the glioblastoma cells after ABA treatment. ABA-induced cellular apoptosis and differentiation were significantly reduced by selectively silencing RAR-α, while RAR-α overexpression exaggerated the ABA-induced effects. These results suggest that ABA may play a role in the pathogenesis of glioma by promoting cellular apoptosis and differentiation through the RA signaling pathway. PMID:26594836

  9. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.


    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu


    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  10. Synthesis and chirality of amino acids under interstellar conditions.


    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J


    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  11. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.


    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  12. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.


    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  13. Physiology and molecular genetics of poly(beta-hydroxy-alkanoic acid) synthesis in Alcaligenes eutrophus.


    Steinbüchel, A; Schlegel, H G


    The Alcaligenes eutrophus genes for beta-ketothiolase, NADPH-dependent acetoacetyl-CoA reductase and poly(beta-hydroxybutyric acid) synthase (PHB synthase) which comprise the three-step PHB-biosynthetic pathway, were cloned. Molecular studies revealed that these genes are organized in a single operon. The A. eutrophus PHB-biosynthetic genes are readily expressed in other bacteria, and DNA fragments harbouring the operon can be used as a cartridge to confer to other bacteria the ability to synthesize PHB from acetyl-CoA. The biochemical and physiological capabilities of A. eutrophus for the synthesis of a wide variety of polyhydroxyalkanoates are discussed. PMID:2046547

  14. Leucine alleviates dexamethasone-induced suppression of muscle protein synthesis via synergy involvement of mTOR and AMPK pathways.


    Wang, Xiao J; Yang, Xin; Wang, Ru X; Jiao, Hong C; Zhao, Jing P; Song, Zhi G; Lin, Hai


    Glucocorticoids (GCs) are negative muscle protein regulators that contribute to the whole-body catabolic state during stress. Mammalian target of rapamycin (mTOR)-signalling pathway, which acts as a central regulator of protein metabolism, can be activated by branched-chain amino acids (BCAA). In the present study, the effect of leucine on the suppression of protein synthesis induced by GCs and the pathway involved were investigated. In vitro experiments were conducted using cultured C2C12 myoblasts to study the effect of GCs on protein synthesis, and the involvement of mTOR pathway was investigated as well. After exposure to dexamethasone (DEX, 100 μmol/l) for 24 h, protein synthesis in muscle cells was significantly suppressed (P<0.05), the phosphorylations of mTOR, ribosomal protein S6 protein kinase 1 (p70s6k1) and eukaryotic initiation factor 4E binding protein 1 (4EBP1) were significantly reduced (P<0.05). Leucine supplementation (5 mmol/l, 10 mmol/l and 15 mmol/l) for 1 h alleviated the suppression of protein synthesis induced by DEX (P<0.05) and was accompanied with the increased phosphorylation of mTOR and decreased phosphorylation of AMPK (P<0.05). Branched-chain amino transferase 2 (BCAT2) mRNA level was not influenced by DEX (P>0.05) but was increased by leucine supplementation at a dose of 5 mmol/l (P<0.05). PMID:27129299

  15. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.


    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  16. Lactide Synthesis and Chirality Control for Polylactic acid Production.


    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert


    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  17. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.


    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  18. The regulation of triglyceride synthesis and fatty acid synthesis in rat epididymal adipose tissue. Effects of altered dietary and hormonal conditions

    PubMed Central

    Saggerson, E. D.; Greenbaum, A. L.


    1. Epididymal adipose tissues obtained from rats that had been previously starved, starved and refed a high fat diet for 72h, starved and refed bread for 144h or fed a normal diet were incubated in the presence of insulin+glucose or insulin+glucose+acetate. 2. Measurements were made of the whole-tissue concentrations of hexose phosphates, triose phosphates, glycerol 1-phosphate, 3-phosphoglycerate, 6-phosphogluconate, adenine nucleotides, acid-soluble CoA, long-chain fatty acyl-CoA, malate and citrate after 1h of incubation. The release of lactate, pyruvate and glycerol into the incubation medium during this period was also determined. 3. The rates of metabolism of glucose in the hexose monophosphate pathway, the glycolytic pathway, the citric acid cycle and into glyceride glycerol, fatty acids and lactate+pyruvate were also determined over a 2h period in similarly treated tissues. The metabolism of acetate to CO2 and fatty acids in the presence of glucose was also measured. 4. The activities of acetyl-CoA carboxylase, fatty acid synthetase and isocitrate dehydrogenase were determined in adipose tissues from starved, starved and fat-refed, and alloxan-diabetic animals and also in tissues from animals that had been starved and refed bread for up to 96h. Changes in these activities were compared with the ability of similar tissues to incorporate [14C]glucose into fatty acids in vitro. 5. The activities of acetyl-CoA carboxylase and fatty acid synthetase roughly paralleled the ability of tissues to incorporate glucose into fatty acids. 6. Rates of triglyceride synthesis and fatty acid synthesis could not be correlated with tissue concentrations of long-chain fatty acyl-CoA, citrate or glycerol 1-phosphate. In some cases changes in phosphofructokinase flux rates could be correlated with changes in citrate concentration. 7. The main lesion in fatty acid synthesis in tissues from starved, starved and fat-refed, and alloxan-diabetic rats appeared to reside at the level of

  19. New pathways for organic synthesis. Practical applications of transition metals

    SciTech Connect

    Colquhoun, H.M.; Holton, J.; Thompson, D.J.; Twigg, M.V.


    This book contains a considerable number of transition-metal-based procedures that have genuine applications in synthesis, and which are arranged according to the nature of the organic product or synthetic transformation being carried out. The objective is to provide those engaged in the preparation of pharmaceuticals, natural products, herbicides, dyestuffs, and other organic chemicals with a practical guide to the application of transition metals in organic synthesis. Topics considered include the formation of carbon-carbon bonds, the formation of carbocyclic compounds, the formation of heterocyclic compounds, the isomerization of alkenes, the direct introduction and removal of carbonyl groups, reduction, oxidation, and preparing and handling transition metal catalysts.

  20. Dual Role for Phospholipid:Diacylglycerol Acyltransferase: Enhancing Fatty Acid Synthesis and Diverting Fatty Acids from Membrane Lipids to Triacylglycerol in Arabidopsis Leaves[C][W

    PubMed Central

    Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng


    There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979

  1. Evolution of a Genome-Encoded Bias in Amino Acid Biosynthetic Pathways Is a Potential Indicator of Amino Acid Dynamics in the Environment

    PubMed Central

    Fasani, Rick A.; Savageau, Michael A.


    Overcoming the stress of starvation is one of an organism’s most challenging phenotypic responses. Those organisms that frequently survive the challenge, by virtue of their fitness, will have evolved genomes that are shaped by their specific environments. Understanding this genotype–environment–phenotype relationship at a deep level will require quantitative predictive models of the complex molecular systems that link these aspects of an organism’s existence. Here, we treat one of the most fundamental molecular systems, protein synthesis, and the amino acid biosynthetic pathways involved in the stringent response to starvation. These systems face an inherent logical dilemma: Building an amino acid biosynthetic pathway to synthesize its product—the cognate amino acid of the pathway—may require that very amino acid when it is no longer available. To study this potential “catch-22,” we have created a generic model of amino acid biosynthesis in response to sudden starvation. Our mathematical analysis and computational results indicate that there are two distinctly different outcomes: Partial recovery to a new steady state, or full system failure. Moreover, the cell’s fate is dictated by the cognate bias, the number of cognate amino acids in the corresponding biosynthetic pathway relative to the average number of that amino acid in the proteome. We test these implications by analyzing the proteomes of over 1,800 sequenced microbes, which reveals statistically significant evidence of low cognate bias, a genetic trait that would avoid the biosynthetic quandary. Furthermore, these results suggest that the pattern of cognate bias, which is readily derived by genome sequencing, may provide evolutionary clues to an organism’s natural environment. PMID:25118252

  2. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.


    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi


    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  3. The cockroach Blattella germanica obtains nitrogen from uric acid through a metabolic pathway shared with its bacterial endosymbiont.


    Patiño-Navarrete, Rafael; Piulachs, Maria-Dolors; Belles, Xavier; Moya, Andrés; Latorre, Amparo; Peretó, Juli


    Uric acid stored in the fat body of cockroaches is a nitrogen reservoir mobilized in times of scarcity. The discovery of urease in Blattabacterium cuenoti, the primary endosymbiont of cockroaches, suggests that the endosymbiont may participate in cockroach nitrogen economy. However, bacterial urease may only be one piece in the entire nitrogen recycling process from insect uric acid. Thus, in addition to the uricolytic pathway to urea, there must be glutamine synthetase assimilating the released ammonia by the urease reaction to enable the stored nitrogen to be metabolically usable. None of the Blattabacterium genomes sequenced to date possess genes encoding for those enzymes. To test the host's contribution to the process, we have sequenced and analysed Blattella germanica transcriptomes from the fat body. We identified transcripts corresponding to all genes necessary for the synthesis of uric acid and its catabolism to urea, as well as for the synthesis of glutamine, asparagine, proline and glycine, i.e. the amino acids required by the endosymbiont. We also explored the changes in gene expression with different dietary protein levels. It appears that the ability to use uric acid as a nitrogen reservoir emerged in cockroaches after its age-old symbiotic association with bacteria. PMID:25079497

  4. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  5. Ursolic Acid Inhibits Adipogenesis in 3T3-L1 Adipocytes through LKB1/AMPK Pathway

    PubMed Central

    He, Yonghan; Li, Ying; Zhao, Tiantian; Wang, Yanwen; Sun, Changhao


    Background Ursolic acid (UA) is a triterpenoid compound with multiple biological functions. This compound has recently been reported to possess an anti-obesity effect; however, the mechanisms are less understood. Objective As adipogenesis plays a critical role in obesity, the present study was conducted to investigate the effect of UA on adipogenesis and mechanisms of action in 3T3-L1 preadipocytes. Methods and Results The 3T3-L1 preadipocytes were induced to differentiate in the presence or absence of UA for 6 days. The cells were determined for proliferation, differentiation, fat accumulation as well as the protein expressions of molecular targets that regulate or are involved in fatty acid synthesis and oxidation. The results demonstrated that ursolic acid at concentrations ranging from 2.5 µM to 10 µM dose-dependently attenuated adipogenesis, accompanied by reduced protein expression of CCAAT element binding protein β (C/EBPβ), peroxisome proliferator-activated receptor γ (PPARγ), CCAAT element binding protein α (C/EBPα) and sterol regulatory element binding protein 1c (SREBP-1c), respectively. Ursolic acid increased the phosphorylation of acetyl-CoA carboxylase (ACC) and protein expression of carnitine palmitoyltransferase 1 (CPT1), but decreased protein expression of fatty acid synthase (FAS) and fatty acid-binding protein 4 (FABP4). Ursolic acid increased the phosphorylation of AMP-activated protein kinase (AMPK) and protein expression of (silent mating type information regulation 2, homolog) 1 (Sirt1). Further studies demonstrated that the anti-adipogenic effect of UA was reversed by the AMPK siRNA, but not by the Sirt1 inhibitor nicotinamide. Liver kinase B1 (LKB1), the upstream kinase of AMPK, was upregulated by UA. When LKB1 was silenced with siRNA or the inhibitor radicicol, the effect of UA on AMPK activation was diminished. Conclusions Ursolic acid inhibited 3T3-L1 preadipocyte differentiation and adipogenesis through the LKB1/AMPK pathway

  6. Regulation of protein degradation pathways by amino acids and insulin in skeletal muscle of neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rapid gain in lean mass in neonates requires greater rates of protein synthesis than degradation. We previously delineated the molecular mechanisms by which insulin and amino acids, especially leucine, modulate skeletal muscle protein synthesis and how this changes with development. In the curre...

  7. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.


    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  8. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.


    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip


    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  9. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  10. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  11. Synthesis of methylphosphonic acid by marine microbes: a source for methane in the aerobic ocean

    PubMed Central

    Metcalf, William W.; Griffin, Benjamin M.; Cicchillo, Robert M.; Gao, Jiangtao; Janga, Sarath Chandra; Cooke, Heather A.; Circello, Benjamin T.; Evans, Bradley S.; Martens-Habbena, Willm; Stahl, David A.; van der Donk, Wilfred A.


    Relative to the atmosphere, much of the aerobic ocean is supersaturated with methane; however, the source of this important greenhouse gas remains enigmatic. Catabolism of methylphosphonic acid by phosphorus-starved marine microbes, with concomitant release of methane, has been suggested to explain this phenomenon, yet methylphosphonate is not a known natural product, nor has it been detected in natural systems. Further, its synthesis from known natural products would require unknown biochemistry. Here we show that the marine archaeon Nitrosopumilus maritimus encodes a pathway for methylphosphonate biosynthesis and that it produces cell-associated methylphosphonate esters. The abundance of a key gene in this pathway in metagenomic datasets suggests that methylphosphonate biosynthesis is relatively common in marine microbes, providing a plausible explanation for the methane paradox. PMID:22936780

  12. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper.


    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo


    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  13. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo


    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  14. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.


    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie


    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  15. Amino acids trigger down-regulation of superoxide via TORC pathway in the midgut of Rhodnius prolixus.


    Gandara, Ana Caroline P; Oliveira, José Henrique M; Nunes, Rodrigo D; Goncalves, Renata L S; Dias, Felipe A; Hecht, Fabio; Fernandes, Denise C; Genta, Fernando A; Laurindo, Francisco R M; Oliveira, Marcus F; Oliveira, Pedro L


    Sensing incoming nutrients is an important and critical event for intestinal cells to sustain life of the whole organism. The TORC is a major protein complex involved in monitoring the nutritional status and is activated by elevated amino acid concentrations. An important feature of haematophagy is that huge amounts of blood are ingested in a single meal, which results in the release of large quantities of amino acids, together with the haemoglobin prosthetic group, haem, which decomposes hydroperoxides and propagates oxygen-derived free radicals. Our previous studies demonstrated that reactive oxygen species (ROS) levels were diminished in the mitochondria and midgut of the Dengue fever mosquito, Aedes aegypti, immediately after a blood meal. We proposed that this mechanism serves to avoid oxidative damage that would otherwise be induced by haem following a blood meal. Studies also performed in mosquitoes have shown that blood or amino acids controls protein synthesis through TORC activation. It was already proposed, in different models, a link between ROS and TOR, however, little is known about TOR signalling in insect midgut nor about the involvement of ROS in this pathway. Here, we studied the effect of a blood meal on ROS production in the midgut of Rhodnius prolixus We observed that blood meal amino acids decreased ROS levels in the R. prolixus midgut immediately after feeding, via lowering mitochondrial superoxide production and involving the amino acid-sensing TORC pathway. PMID:26945025

  16. Amino acids trigger down-regulation of superoxide via TORC pathway in the midgut of Rhodnius prolixus

    PubMed Central

    Gandara, Ana Caroline P.; Oliveira, José Henrique M.; Nunes, Rodrigo D.; Goncalves, Renata L.S.; Dias, Felipe A.; Hecht, Fabio; Fernandes, Denise C.; Genta, Fernando A.; Laurindo, Francisco R.M.; Oliveira, Marcus F.; Oliveira, Pedro L.


    Sensing incoming nutrients is an important and critical event for intestinal cells to sustain life of the whole organism. The TORC is a major protein complex involved in monitoring the nutritional status and is activated by elevated amino acid concentrations. An important feature of haematophagy is that huge amounts of blood are ingested in a single meal, which results in the release of large quantities of amino acids, together with the haemoglobin prosthetic group, haem, which decomposes hydroperoxides and propagates oxygen-derived free radicals. Our previous studies demonstrated that reactive oxygen species (ROS) levels were diminished in the mitochondria and midgut of the Dengue fever mosquito, Aedes aegypti, immediately after a blood meal. We proposed that this mechanism serves to avoid oxidative damage that would otherwise be induced by haem following a blood meal. Studies also performed in mosquitoes have shown that blood or amino acids controls protein synthesis through TORC activation. It was already proposed, in different models, a link between ROS and TOR, however, little is known about TOR signalling in insect midgut nor about the involvement of ROS in this pathway. Here, we studied the effect of a blood meal on ROS production in the midgut of Rhodnius prolixus. We observed that blood meal amino acids decreased ROS levels in the R. prolixus midgut immediately after feeding, via lowering mitochondrial superoxide production and involving the amino acid-sensing TORC pathway. PMID:26945025

  17. Synthesis of classical pathway complement components by chondrocytes.

    PubMed Central

    Bradley, K; North, J; Saunders, D; Schwaeble, W; Jeziorska, M; Woolley, D E; Whaley, K


    Using immunohistochemical studies, C1q, C1s, C4 and C2 were detected in chondrocytes in normal human articular cartilage and macroscopically normal articular cartilage from the inferior surfaces of hip joints of patients with osteoarthritis. Using reverse-transcribed polymerase chain reaction (RT-PCR), mRNA for C1q, C1s, C4 and C2 was also detected in RNA extracted from articular cartilage. C1r, C3, C1-inhibitor, C4-binding protein and factor I were not detected by either technique. Articular chondrocytes cultured in vitro synthesized C1r, C1s, C4, C2, C3 and C1-inhibitor but not C1q, C4-binding protein or factor I, as assessed by enzyme-linked immunosorbent assay (ELISA) and Northern blot analysis. Thus cultured articular chondrocytes have a complement profile that is similar to that of cultured human fibroblasts rather than that of articular chondrocytes in vivo. Complement synthesis in cultured chondrocytes was modulated by the cytokines interleukin-1 beta (IL-1 beta), tumour necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma), showing that cytokines can probably regulate complement synthesis in intact cartilage. The possible roles of local synthesis of complement components by chondrocytes in matrix turnover and the regulation chondrocyte function are discussed. Images Figure 1 Figure 2 Figure 4 PMID:8881771

  18. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.


    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei


    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  19. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )


    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  20. Strategies for the Total Synthesis of Clavicipitic Acid.


    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori


    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  1. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.


    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  2. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin


    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  3. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others


    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  4. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.


    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda


    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress. PMID:25113613

  5. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.


    Lem, N W; Stumpf, P K


    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  6. Amino acid biosynthesis in the spirochete Leptospira: evidence for a novel pathway of isoleucine biosynthesis.


    Charon, N W; Johnson, R C; Peterson, D


    Radioactive carbon dioxide was incubated with growing cells of Leptospira interrogans serotypes semaranga and tarassovi, and the specific activities and distribution of the label within the cellular amino acids were determined. The origins of the carbon skeletons of all the acid-stable amino acids except isoleucine were found to be consistent with known biosynthetic pathways for these amino acids. Experiments using radioactive carbon dioxide and other tracers indicated that most of the isoleucine was synthesized by a pathway not involving threonine. The origin of the carbon skeleton of isoleucine consisted of two residues of pyruvate (carbons 2 and 3) and acetate of acetyl-coenzyme A by this pathway. Isotope competition studies indicated that the pathway was regulated by isoleucine. The results are discussed in relation to two proposed pathways of isoleucine biosynthesis involving citramalate as an intermediate. PMID:4808901

  7. Hepatic long-chain acyl-CoA synthetase 5 mediates fatty acid channeling between anabolic and catabolic pathways.


    Bu, So Young; Mashek, Douglas G


    Long-chain acyl-CoA synthetases (ACSLs) and fatty acid transport proteins (FATPs) activate fatty acids (FAs) to acyl-CoAs prior to their downstream metabolism. Of numerous ACSL and FATP isoforms, ACSL5 is expressed predominantly in tissues with high rates of triacylglycerol (TAG) synthesis, suggesting it may have an anabolic role in lipid metabolism. To characterize the role of ACSL5 in hepatic energy metabolism, we used small interference RNA (siRNA) to knock down ACSL5 in rat primary hepatocytes. Compared with cells transfected with control siRNA, suppression of ACSL5 expression significantly decreased FA-induced lipid droplet formation. These findings were further extended with metabolic labeling studies showing that ACSL5 knockdown resulted in decreased [1-(14)C]oleic acid or acetic acid incorporation into intracellular TAG, phospholipids, and cholesterol esters without altering FA uptake or lipogenic gene expression. ACSL5 knockdown also decreased hepatic TAG secretion proportionate to the observed decrease in neutral lipid synthesis. ACSL5 knockdown did not alter lipid turnover or mediate the effects of insulin on lipid metabolism. Hepatocytes treated with ACSL5 siRNA had increased rates of FA oxidation without changing PPAR-α activity and target gene expression. These results suggest that ACSL5 activates and channels FAs toward anabolic pathways and, therefore, is an important branch point in hepatic FA metabolism. PMID:20798351

  8. Evidence for transport intermediates in aromatic amino acid synthesis of non-green tissues

    SciTech Connect

    Leuschner, C.; Schultz, G. )


    Quinate (QA) is the predominant pre-aromatic compound formed at high rates in leaves of many plants at the early vegetation stage and transported through the phloem. The transfer of 3-dehydroquinate, 3-dehydroshikimate and (SkA) across the plastidial membranes has been evidenced. The question was whether the rate of QA uptake is comparable to that of the 3 SkA-pathway intermediates. To demonstrate this, /U-{sup 14}C/QA and /U-{sup 14}C/SkA were applied to Brassica rapa roots. Both compounds were uptaken at considerable rates and incorporated into aromatic amino acids (Phe + Tyr + Trp formation, in nmol/g fresh wt x h: applying 145 {mu}mol QA: 21.2; applying 156 {mu}mol Ska: 31.8). Thus, QA is a possible candidate for transport into non-green tissues for aromatic amino acid synthesis.

  9. Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives

    PubMed Central

    Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A


    Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513

  10. Differential involvement of indole-3-acetic acid biosynthetic pathways in pathogenicity and epiphytic fitness of Erwinia herbicola pv. gypsophilae.


    Manulis, S; Haviv-Chesner, A; Brandl, M T; Lindow, S E; Barash, I


    Erwinia herbicola pv. gypsophilae (Ehg), which induces galls on Gypsophila paniculata, harbors two major pathways for indole-3-acetic acid (IAA) synthesis, the indole-3-acetamide (IAM) and indole-3-pyruvate (IPyA) routes, as well as cytokinin biosynthetic genes. Mutants were generated in which the various biosynthetic routes were disrupted separately or jointly in order to assess the contribution of IAA of various origins and cytokinins to pathogenicity and epiphytic fitness. Inactivation of the IAM pathway or cytokinin biosynthesis caused the largest reduction in gall size. Inactivation of the IPyA pathway caused a minor, nonsignificant decrease in pathogenicity. No further reduction in gall size was observed by the simultaneous inactivation of both IAA pathways only or in combination with that of cytokinin production. However, inactivation of the IPyA pathway caused a 14-fold reduction in the population of Ehg on bean plants. Inactivation of the IAM pathway or cytokinin production did not affect epiphytic fitness. While the apparent transcriptional activity of iaaM-inaZ fusion increased slightly in cells of Ehg on bean and gypsophila leaves, compared with that in culture, very high levels of induction were observed in cells injected into gypsophila stems. In contrast, moderate levels of induction of ipdC-inaZ in Ehg were observed on leaves of these plants and in gypsophila stems, when compared with that in culture. These results suggest that the IAM pathway is involved primarily in gall formation and support the main contribution of the IpyA pathway to the epiphytic fitness of this bacterial species. PMID:9650296

  11. A distinct pathway for tetrahymanol synthesis in bacteria.


    Banta, Amy B; Wei, Jeremy H; Welander, Paula V


    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol. PMID:26483502

  12. A distinct pathway for tetrahymanol synthesis in bacteria

    NASA Astrophysics Data System (ADS)

    Banta, Amy B.; Wei, Jeremy H.; Welander, Paula V.


    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol.

  13. A distinct pathway for tetrahymanol synthesis in bacteria

    PubMed Central

    Banta, Amy B.; Wei, Jeremy H.; Welander, Paula V.


    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol. PMID:26483502

  14. A heteromeric membrane-bound prenyltransferase complex from hop catalyzes three sequential aromatic prenylations in the bitter acid pathway.


    Li, Haoxun; Ban, Zhaonan; Qin, Hao; Ma, Liya; King, Andrew J; Wang, Guodong


    Bitter acids (α and β types) account for more than 30% of the fresh weight of hop (Humulus lupulus) glandular trichomes and are well known for their contribution to the bitter taste of beer. These multiprenylated chemicals also show diverse biological activities, some of which have potential benefits to human health. The bitter acid biosynthetic pathway has been investigated extensively, and the genes for the early steps of bitter acid synthesis have been cloned and functionally characterized. However, little is known about the enzyme(s) that catalyze three sequential prenylation steps in the β-bitter acid pathway. Here, we employed a yeast (Saccharomyces cerevisiae) system for the functional identification of aromatic prenyltransferase (PT) genes. Two PT genes (HlPT1L and HlPT2) obtained from a hop trichome-specific complementary DNA library were functionally characterized using this yeast system. Coexpression of codon-optimized PT1L and PT2 in yeast, together with upstream genes, led to the production of bitter acids, but no bitter acids were detected when either of the PT genes was expressed by itself. Stepwise mutation of the aspartate-rich motifs in PT1L and PT2 further revealed the prenylation sequence of these two enzymes in β-bitter acid biosynthesis: PT1L catalyzed only the first prenylation step, and PT2 catalyzed the two subsequent prenylation steps. A metabolon formed through interactions between PT1L and PT2 was demonstrated using a yeast two-hybrid system, reciprocal coimmunoprecipitation, and in vitro biochemical assays. These results provide direct evidence of the involvement of a functional metabolon of membrane-bound prenyltransferases in bitter acid biosynthesis in hop. PMID:25564559

  15. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.


    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  16. The effect of eicosapentaenoic and docosahexaenoic acid on protein synthesis and breakdown in murine C2C12 myotubes

    SciTech Connect

    Kamolrat, Torkamol; Gray, Stuart R.


    Highlights: ► EPA can enhance protein synthesis and retard protein breakdown in muscle cells. ► These effects were concurrent with increases in p70s6k and FOXO3a phosphorylation. ► EPA may be a useful tool in the treatment of muscle wasting conditions. -- Abstract: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been found to stimulate protein synthesis with little information regarding their effects on protein breakdown. Furthermore whether there are distinct effects of EPA and DHA remains to be established. The aim of the current study was to determine the distinct effects of EPA and DHA on protein synthesis, protein breakdown and signalling pathways in C2C12 myotubes. Fully differentiated C2C12 cells were incubated for 24 h with 0.1% ethanol (control), 50 μM EPA or 50 μM DHA prior to experimentation. After serum (4 h) and amino acid (1 h) starvation cells were stimulated with 2 mM L-leucine and protein synthesis measured using {sup 3}H-labelled phenylalanine. Protein breakdown was measured using {sup 3}H-labelled phenylalanine and signalling pathways (Akt, mTOR, p70S6k, 4EBP1, rps6 and FOXO3a) via Western blots. Data revealed that after incubation with EPA protein synthesis was 25% greater (P < 0.05) compared to control cells, with no effect of DHA. Protein breakdown was 22% (P < 0.05) lower, compared to control cells, after incubation with EPA, with no effect of DHA. Analysis of signalling pathways revealed that both EPA and DHA incubation increased (P < 0.05) p70s6k phosphorylation, EPA increased (P < 0.05) FOXO3a phosphorylation, with no alteration in other signalling proteins. The current study has demonstrated distinct effects of EPA and DHA on protein metabolism with EPA showing a greater ability to result in skeletal muscle protein accretion.

  17. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.


    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  18. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.


    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A


    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  19. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  20. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.

    PubMed Central

    Brandl, M T; Lindow, S E


    Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cultures supplemented with L-tryptophan. The deduced amino acid sequence of the gene product has high similarity to that of the indolepyruvate decarboxylase of Enterobacter cloacae. Regions within pyruvate decarboxylases of various fungal and plant species also exhibited considerable homology to portions of this gene. This gene therefore presumably encodes an indolepyruvate decarboxylase (IpdC) which catalyzes the conversion of indole-3-pyruvic acid to indole-3-acetaldehyde. Insertions of Tn3-spice within ipdC abolished the ability of strain 299R to synthesize indole-3-acetaldehyde and tryptophol and reduced its IAA production in tryptophan-supplemented minimal medium by approximately 10-fold, thus providing genetic evidence for the role of the indolepyruvate pathway in IAA synthesis in this strain. An ipdC probe hybridized strongly with the genomic DNA of all E. herbicola strains tested in Southern hybridization studies, suggesting that the indolepyruvate pathway is common in this species. Maximum parsimony analysis revealed that the ipdC gene is highly conserved within this group and that strains of diverse geographic origin were very similar with respect to ipdC. PMID:8900003

  1. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W


    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  2. Early increase in phosphatidyl choline synthesis by choline and transmethylation pathways in spreading fibroblasts

    SciTech Connect

    Maziere, C.; Maziere, J.C.; Mora, L.; Polonovski, J.


    Phosphatidyl choline (PC) synthesis in trypsinized and reattaching fibroblasts during the spreading state was studied by incorporation of (/sup 14/C)choline and (methyl-/sup 14/C)methionine. The choline and phosphatidyl-ethanolamine (PE) transmethylation pathways were both transiently increased about 2-fold during the first 2 h after replating. Maximum increase appeared to be simultaneous with maximum spreading. Incorporation of (/sup 32/P)orthophosphate showed that the increase in PC synthesis was specific and most probably related to establishment of cell-substrate adhesion sites.

  3. Enhancement of arachidonic acid signaling pathway by nicotinic acid receptor HM74A

    SciTech Connect

    Tang, Yuting . E-mail:; Zhou, Lubing; Gunnet, Joseph W.; Wines, Pamela G.; Cryan, Ellen V.; Demarest, Keith T.


    HM74A is a G protein-coupled receptor for nicotinic acid (niacin), which has been used clinically to treat dyslipidemia for decades. The molecular mechanisms whereby niacin exerts its pleiotropic effects on lipid metabolism remain largely unknown. In addition, the most common side effect in niacin therapy is skin flushing that is caused by prostaglandin release, suggesting that the phospholipase A{sub 2} (PLA{sub 2})/arachidonic acid (AA) pathway is involved. Various eicosanoids have been shown to activate peroxisome-proliferator activated receptors (PPAR) that play a diverse array of roles in lipid metabolism. To further elucidate the potential roles of HM74A in mediating the therapeutic effects and/or side effects of niacin, we sought to explore the signaling events upon HM74A activation. Here we demonstrated that HM74A synergistically enhanced UTP- and bradykinin-mediated AA release in a pertussis toxin-sensitive manner in A431 cells. Activation of HM74A also led to Ca{sup 2+}-mobilization and enhanced bradykinin-promoted Ca{sup 2+}-mobilization through Gi protein. While HM74A increased ERK1/2 activation by the bradykinin receptor, it had no effects on UTP-promoted ERK1/2 activation.Furthermore, UTP- and bradykinin-mediated AA release was significantly decreased in the presence of both MAPK kinase inhibitor PD 098059 and PKC inhibitor GF 109203X. However, the synergistic effects of HM74A were not dramatically affected by co-treatment with both inhibitors, indicating the cross-talk occurred at the receptor level. Finally, stimulation of A431 cells transiently transfected with PPRE-luciferase with AA significantly induced luciferase activity, mimicking the effects of PPAR{gamma} agonist rosiglitazone, suggesting that alteration of AA signaling pathway can regulate gene expression via endogenous PPARs.

  4. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.


    van den Broek, Lambertus A M; Boeriu, Carmen G


    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  5. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco


    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  6. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.


    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian


    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  7. Synthesis and evaluation of colletoic acid core derivatives.


    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima


    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  8. The Suf Iron-Sulfur Cluster Synthesis Pathway Is Required for Apicoplast Maintenance in Malaria Parasites

    PubMed Central

    Gisselberg, Jolyn E.; Dellibovi-Ragheb, Teegan A.; Matthews, Krista A.; Bosch, Gundula; Prigge, Sean T.


    The apicoplast organelle of the malaria parasite Plasmodium falciparum contains metabolic pathways critical for liver-stage and blood-stage development. During the blood stages, parasites lacking an apicoplast can grow in the presence of isopentenyl pyrophosphate (IPP), demonstrating that isoprenoids are the only metabolites produced in the apicoplast which are needed outside of the organelle. Two of the isoprenoid biosynthesis enzymes are predicted to rely on iron-sulfur (FeS) cluster cofactors, however, little is known about FeS cluster synthesis in the parasite or the roles that FeS cluster proteins play in parasite biology. We investigated two putative FeS cluster synthesis pathways (Isc and Suf) focusing on the initial step of sulfur acquisition. In other eukaryotes, these proteins can be located in multiple subcellular compartments, raising the possibility of cross-talk between the pathways or redundant functions. In P. falciparum, SufS and its partner SufE were found exclusively the apicoplast and SufS was shown to have cysteine desulfurase activity in a complementation assay. IscS and its effector Isd11 were solely mitochondrial, suggesting that the Isc pathway cannot contribute to apicoplast FeS cluster synthesis. The Suf pathway was disrupted with a dominant negative mutant resulting in parasites that were only viable when supplemented with IPP. These parasites lacked the apicoplast organelle and its organellar genome – a phenotype not observed when isoprenoid biosynthesis was specifically inhibited with fosmidomycin. Taken together, these results demonstrate that the Suf pathway is essential for parasite survival and has a fundamental role in maintaining the apicoplast organelle in addition to any role in isoprenoid biosynthesis. PMID:24086138

  9. Biological function of the dTDP-rhamnose synthesis pathway in Streptococcus mutans.

    PubMed Central

    Tsukioka, Y; Yamashita, Y; Oho, T; Nakano, Y; Koga, T


    We have cloned a new gene locus that comprises three genes concerned with the biosynthesis of the serotype c-specific polysaccharide antigen in Streptococcus mutans. The genes encode proteins exhibiting significant homology to the rfbA, rfbB, and rfbD gene products that are involved in the anabolism of dTDP-L-rhamnose from D-glucose-1-phosphate. This anabolism pathway pertains to biosynthesis of the O antigen of lipopolysaccharide in gram-negative bacteria. The cell extract of Escherichia coli expressing each of the cloned genes of S. mutans exhibited enzymatic activity corresponding to the homologous counterpart of the rfb gene products. Rhamnose was not detected in the cell wall preparation purified from the mutant in which each of the three cloned genes was insertionally inactivated. Rabbit antiserum against S. mutans serotype c-specific antigen did not react with the autoclaved extracts from these mutants. These results indicate that the gene products identified in the present study are involved in the dTDP-L-rhamnose synthesis pathway and that the pathway relates to the biosynthesis of the serotype-specific polysaccharide antigen of S. mutans. Southern hybridization analysis revealed that genes homologous to the cloned genes involved in the dTDP-L-rhamnose synthesis pathway were widely distributed in a variety of streptococci. This is the first report of the biological function of the dTDP-rhamnose pathway in streptococci. PMID:9023194

  10. Synthesis and evaluation of novel benzylphthalazine derivatives as hedgehog signaling pathway inhibitors.


    Bao, Xiaolong; Peng, Yuanqiu; Lu, Xiuhong; Yang, Jun; Zhao, Weili; Tan, Wenfu; Dong, Xiaochun


    We report herein the design and synthesis of a series of novel benzylphthalazine derivatives as hedgehog signaling pathway inhibitors. Gli-luciferase assay demonstrated that changing piperazine ring of Anta XV to different four, five or six-membered heterocyclic building blocks afforded significant influences on Hh pathway inhibition. In particular, compound 10e with piperidin-4-amine moiety was found to possess 12-fold higher Hh inhibitory activities comparing to the lead compound in vitro. In vivo efficacy of 10e in a ptch(+/-)p53(-/-) mouse medulloblastoma allograft model also indicated encouraging results. PMID:27180012

  11. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio


    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  12. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.


    Kitadai, Norio


    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids. PMID:25796392

  13. Metabolic effects of inhibitors of two enzymes of the branched-chain amino acid pathway in Salmonella typhimurium.

    PubMed Central

    Epelbaum, S; Chipman, D M; Barak, Z


    The metabolic effects of inhibitors of two enzymes in the pathway for biosynthesis of branched-chain amino acids were examined in Salmonella typhimurium mutant strain TV105, expressing a single isozyme of acetohydroxy acid synthase (AHAS), AHAS isozyme II. One inhibitor was the sulfonylurea herbicide sulfometuron methyl (SMM), which inhibits this isozyme and AHAS of other organisms, and the other was N-isopropyl oxalylhydroxamate (IpOHA), which inhibits ketol-acid reductoisomerase (KARI). The effects of the inhibitors on growth, levels of several enzymes of the pathway, and levels of intermediates of the pathway were measured. The intracellular concentration of the AHAS substrate 2-ketobutyrate increased on addition of SMM, but a lack of correlation between increased ketobutyrate and growth inhibition suggests that the former is not the immediate cause of the latter. The levels of the keto acid precursor of valine, but not of the precursor of isoleucine, were drastically decreased by SMM, and valine, but not isoleucine, partially overcame SMM inhibition. This apparent stronger effect of SMM on the flux into the valine arm, as opposed to the isoleucine arm, of the branched-chain amino acid pathway is explained by the kinetics of the AHAS reaction, as well as by the different roles of pyruvate, ketobutyrate, and the valine precursor in metabolism. The organization of the pathway thus potentiates the inhibitory effect of SMM. IpOHA has strong initial effects at lower concentrations than does SMM and leads to increases both in the acetohydroxy acid substrates of KARI and, surprisingly, in ketobutyrate. Valine completely protected strain TV105 from IpOHA at the MIC. A number of explanations for this effect can be ruled out, so that some unknown arrangement of the enzymes involved must be suggested. IpOHA led to initial cessation of growth, with partial recovery after a time whose duration increased with the inhibitor concentration. The recovery is apparently due to

  14. Metabolic effects of inhibitors of two enzymes of the branched-chain amino acid pathway in Salmonella typhimurium.


    Epelbaum, S; Chipman, D M; Barak, Z


    The metabolic effects of inhibitors of two enzymes in the pathway for biosynthesis of branched-chain amino acids were examined in Salmonella typhimurium mutant strain TV105, expressing a single isozyme of acetohydroxy acid synthase (AHAS), AHAS isozyme II. One inhibitor was the sulfonylurea herbicide sulfometuron methyl (SMM), which inhibits this isozyme and AHAS of other organisms, and the other was N-isopropyl oxalylhydroxamate (IpOHA), which inhibits ketol-acid reductoisomerase (KARI). The effects of the inhibitors on growth, levels of several enzymes of the pathway, and levels of intermediates of the pathway were measured. The intracellular concentration of the AHAS substrate 2-ketobutyrate increased on addition of SMM, but a lack of correlation between increased ketobutyrate and growth inhibition suggests that the former is not the immediate cause of the latter. The levels of the keto acid precursor of valine, but not of the precursor of isoleucine, were drastically decreased by SMM, and valine, but not isoleucine, partially overcame SMM inhibition. This apparent stronger effect of SMM on the flux into the valine arm, as opposed to the isoleucine arm, of the branched-chain amino acid pathway is explained by the kinetics of the AHAS reaction, as well as by the different roles of pyruvate, ketobutyrate, and the valine precursor in metabolism. The organization of the pathway thus potentiates the inhibitory effect of SMM. IpOHA has strong initial effects at lower concentrations than does SMM and leads to increases both in the acetohydroxy acid substrates of KARI and, surprisingly, in ketobutyrate. Valine completely protected strain TV105 from IpOHA at the MIC. A number of explanations for this effect can be ruled out, so that some unknown arrangement of the enzymes involved must be suggested. IpOHA led to initial cessation of growth, with partial recovery after a time whose duration increased with the inhibitor concentration. The recovery is apparently due to

  15. Design and synthesis of boronic acid inhibitors of endothelial lipase.


    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W


    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  16. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.


    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  17. Synthesis and biological activity of novel deoxycholic acid derivatives.


    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F


    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  18. Biosynthetic Pathway Analysis for Improving the Cordycepin and Cordycepic Acid Production in Hirsutella sinensis.


    Lin, Shan; Liu, Zhi-Qiang; Xue, Ya-Ping; Baker, Peter James; Wu, Hui; Xu, Feng; Teng, Yi; Brathwaite, Mgavi Elombe; Zheng, Yu-Guo


    Hirsutella sinensis is considered as the only correct anamorph of Ophiocordyceps sinensis. To improve cordycepin and cordycepic acid production in H. sinensis, the biosynthetic pathways of cordycepin and cordycepic acid were predicted, and verified by cloning and expressing genes involved in these pathways, respectively. Then, 5'-nucleotidase participating in biosynthetic pathway of cordycepin, hexokinase, and glucose phosphate isomerase involved in biosynthetic pathway of cordycepic acid, were demonstrated playing important roles in the corresponding biosynthetic pathway by real-time PCR, accompanying with significantly up-regulated 15.03-, 5.27-, and 3.94-fold, respectively. Moreover, the metabolic regulation of H. sinensis was performed. As expected, cordycepin production reached 1.09 mg/g when additional substrate of 5'-nucleotidase was 4 mg/mL, resulting in an increase of 201.1 % compared with the control. In the same way, cordycepic acid production reached 26.6 and 23.4 % by adding substrate of hexokinase or glucose phosphate isomerase, leading to a rise of 77.3 and 55.1 %, respectively. To date, this is the first time to improve cordycepin and cordycepic acid production through metabolic regulation based on biosynthetic pathway analysis, and metabolic regulation is proved as a simple and effective way to enhance the output of cordycepin and cordycepic acid in submerged cultivation of H. sinensis. PMID:26922724

  19. An Oral Load of [13C3]Glycerol and Blood NMR Analysis Detect Fatty Acid Esterification, Pentose Phosphate Pathway, and Glycerol Metabolism through the Tricarboxylic Acid Cycle in Human Liver.


    Jin, Eunsook S; Sherry, A Dean; Malloy, Craig R


    Drugs and other interventions for high impact hepatic diseases often target biochemical pathways such as gluconeogenesis, lipogenesis, or the metabolic response to oxidative stress. However, traditional liver function tests do not provide quantitative data about these pathways. In this study, we developed a simple method to evaluate these processes by NMR analysis of plasma metabolites. Healthy subjects ingested [U-(13)C3]glycerol, and blood was drawn at multiple times. Each subject completed three visits under differing nutritional states. High resolution (13)C NMR spectra of plasma triacylglycerols and glucose provided new insights into a number of hepatic processes including fatty acid esterification, the pentose phosphate pathway, and gluconeogenesis through the tricarboxylic acid cycle. Fasting stimulated pentose phosphate pathway activity and metabolism of [U-(13)C3]glycerol in the tricarboxylic acid cycle prior to gluconeogenesis or glyceroneogenesis. Fatty acid esterification was transient in the fasted state but continuous under fed conditions. We conclude that a simple NMR analysis of blood metabolites provides an important biomarker of pentose phosphate pathway activity, triacylglycerol synthesis, and flux through anaplerotic pathways in mitochondria of human liver. PMID:27432878

  20. Synthesis of all nineteen appropriately protected chiral alpha-hydroxy acid equivalents of the alpha-amino acids for Boc solid-phase depsi-peptide synthesis.


    Deechongkit, Songpon; You, Shu-Li; Kelly, Jeffery W


    [reaction: see text] The preparation of depsi-peptides, amide-to-ester-substituted peptides used to probe the role of hydrogen bonding in protein folding energetics, is accomplished by replacing specific l-alpha-amino acid residues by their alpha-hydroxy acid counterparts in a solid-phase synthesis employing a t-Boc strategy. Herein we describe the efficient stereoselective synthesis of all 19 appropriately protected alpha-hydroxy acid equivalents of the l-alpha-amino acids, employing commercially available materials, expanding the number of available alpha-hydroxy acids from 9 to 19. PMID:14961607

  1. Arginine-dependent acid-resistance pathway in Shigella boydii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ability to survive the low pH of the human stomach is considered be an important virulent determinant. Acid tolerance of Shigella boydii 18 CDPH, the strain implicated in an outbreak may have played an important role in surviving the acidic food (bean salad). The strain was capable of inducing arg...

  2. A biosynthetic pathway for a prominent class of microbiota-derived bile acids

    PubMed Central

    Devlin, A. Sloan; Fischbach, Michael A.


    The gut bile acid pool is millimolar in concentration, varies widely in composition among individuals, and is linked to metabolic disease and cancer. Although these molecules derive almost exclusively from the microbiota, remarkably little is known about which bacterial species and genes are responsible for their biosynthesis. Here, we report a biosynthetic pathway for the second most abundant class in the gut, iso (3β-hydroxy) bile acids, whose levels exceed 300 µM in some humans and are absent in others. We show, for the first time, that iso bile acids are produced by Ruminococcus gnavus, a far more abundant commensal than previously known producers; and that the iso bile acid pathway detoxifies deoxycholic acid, favoring the growth of the keystone genus Bacteroides. By revealing the biosynthetic genes for an abundant class of bile acids, our work sets the stage for predicting and rationally altering the composition of the bile acid pool. PMID:26192599

  3. Indole-3-acetic acid biosynthetic pathways in the basidiomycetous yeast Rhodosporidium paludigenum.


    Nutaratat, Pumin; Srisuk, Nantana; Arunrattiyakorn, Panarat; Limtong, Savitree


    Microorganisms produce plant growth regulators, such as auxins, cytokinins and gibberellins, to promote plant growth. Auxins are a group of compounds with an indole ring that have a positive effect on plant growth. Indole-3-acetic acid (IAA) is a plant growth hormone classified as an indole derivative of the auxin family. IAA biosynthesis pathways have been reported and widely studied in several groups of bacteria. Only a few studies on IAA biosynthesis pathways have been conducted in yeast. This study aimed to investigate IAA biosynthesis pathways in a basidiomycetous yeast (Rhodosporidium paludigenum DMKU-RP301). Investigations were performed both with and without a tryptophan supplement. Indole compound intermediates were detected by gas chromatography-mass spectrometry. Indole-3-lactic acid and indole-3-ethanol were found as a result of the enzymatic reduction of indole-3-pyruvic acid and indole-3-acetaldehyde, in IAA biosynthesis via an indole-3-pyruvic acid pathway. In addition, we also found indole-3-pyruvic acid in culture supernatants determined by high-performance liquid chromatography. Identification of tryptophan aminotransferase activity supports indole-3-pyruvic acid-routed IAA biosynthesis in R. paludigenum DMKU-RP301. We hence concluded that R. paludigenum DMKU-RP301 produces IAA through an indole-3-pyruvic acid pathway. PMID:26899734

  4. Synthesis and characterization of acidic mesoporous borosilicate thin films.


    Xiu, Tongping; Liu, Qian; Wang, Jiacheng


    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc. PMID:19441565

  5. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.


    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G


    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  6. Opposing effects of bile acids deoxycholic acid and ursodeoxycholic acid on signal transduction pathways in oesophageal cancer cells.


    Abdel-Latif, Mohamed M; Inoue, Hiroyasu; Reynolds, John V


    Ursodeoxycholic acid (UDCA) was reported to reduce bile acid toxicity, but the mechanisms underlying its cytoprotective effects are not fully understood. The aim of the present study was to examine the effects of UDCA on the modulation of deoxycholic acid (DCA)-induced signal transduction in oesophageal cancer cells. Nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) activity was assessed using a gel shift assay. NF-κB activation and translocation was performed using an ELISA-based assay and immunofluorescence analysis. COX-2 expression was analysed by western blotting and COX-2 promoter activity was assessed by luciferase assay. DCA induced NF-κB and AP-1 DNA-binding activities in SKGT-4 and OE33 cells. UDCA pretreatment inhibited DCA-induced NF-κB and AP-1 activation and NF-κB translocation. This inhibitory effect was coupled with a blockade of IκB-α degradation and inhibition of phosphorylation of IKK-α/β and ERK1/2. Moreover, UDCA pretreatment inhibited COX-2 upregulation. Using transient transfection of the COX-2 promoter, UDCA pretreatment abrogated DCA-induced COX-2 promoter activation. In addition, UDCA protected oesophageal cells from the apoptotic effects of deoxycholate. Our findings indicate that UDCA inhibits DCA-induced signalling pathways in oesophageal cancer cells. These data indicate a possible mechanistic role for the chemopreventive actions of UDCA in oesophageal carcinogenesis. PMID:26378497

  7. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.


    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  8. Blockade of arachidonic acid pathway induces sprouting in the adult but not in the neonatal uncrossed retinotectal projection.


    Campello-Costa, P; Fosse-Júnior, A M; Oliveira-Silva, P; Serfaty, C A


    The uncrossed retinotectal projection of rats undergoes extensive axonal elimination and subsequent growth of axonal arbors in topographically appropriate territories within the first two/three postnatal weeks. Nitric oxide has been implicated in development and stabilization of synapses in the retinotectal pathway since blockade of nitric oxide synthesis disrupts the normal pattern of retinal innervation in subcortical nuclei. The present work investigated the role of arachidonic acid pathway in the development and maintenance of ipsilateral retinotectal axons. We also investigated the role of this retrograde messenger in the modulation of plasticity that follows retinal lesions in the opposite eye. Pigmented rats received systemic treatment with quinacrine, a phospholipase A2 inhibitor, indomethacin, a cyclooxygenase inhibitor, nordihydroguaiaretic acid, a 5-lipoxygenase inhibitor or vehicle during 4-8 days at various postnatal ages. Rats given a unilateral temporal retinal lesion were treated with either quinacrine or vehicle during the same period. For anterograde tracing of ipsilateral retinal projections, animals received intraocular injections of horseradish peroxidase. Before the third postnatal week no difference was observed in the laminar or topographic organization of the ipsilateral retinotectal projection between vehicle and treated rats in either normal or lesion conditions. After the third postnatal week, however, systemic blockade of phospholipase A2 or 5-lipoxygenase, but not cyclooxygenase induced sprouting of uncrossed axons throughout the collicular visual layers in unoperated rats. In retinal lesion groups, phospholipase A2 blockade increased the sprouting of uncrossed intact axons to the collicular surface in the same period. The results suggest that arachidonic acid or lipoxygenase metabolites play a role in the maintenance of the retinotectal synapses after the critical period and that the blockade of the arachidonic acid pathway induces

  9. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica


    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  10. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.


    Cervantes-Madrid, Diana; Dueñas-González, Alfonso


    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors. PMID:26134042

  11. Effect of mevalonic acid on cholesterol synthesis in bovine intramuscular and subcutaneous adipocytes.


    Liu, Xiaomu; You, Wei; Cheng, Haijian; Zhang, Qingfeng; Song, Enliang; Wan, Fachun; Han, Hong; Liu, Guifen


    Mevalonic acid (MVA) is a key material in the synthesis of cholesterol; indeed, intracellular cholesterol synthesis is also called the mevalonic acid pathway. 3-Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is an essential enzyme in cholesterol biosynthesis. This study suggests that MVA may play an important role in the differentiation of bovine adipose tissue in vivo. We investigated differential mRNA expression in bovine intramuscular preadipocytes (BIPs) and bovine subcutaneous preadipocytes (BSPs) by culturing cells from the longissimus dorsi muscle and subcutaneous fat tissues of Luxi yellow cattle. The morphology of lipid accumulation of bovine preadipocytes was detected by Oil Red O staining, and total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), and high-density lipoprotein cholesterol (HDLC) levels were measured. Temporospatial expression of HMGR was investigated by real-time quantitative polymerase chain reaction (PCR). The TC, LDLC, and HDLC content did not significantly differ over time but increased slowly with increasing MVA concentration. HMGR expression increased over time and with increasing concentrations of MVA. MVA increased adipose cell proliferation in a dose-dependent and time-dependent manner. MVA stimulated HMGR expression in two cell types and its influence on adipocyte differentiation. PMID:26122311


    Technology Transfer Automated Retrieval System (TEKTRAN)

    In adults, sepsis reduces protein synthesis in skeletal muscle by restraining translation. The effect of sepsis on amino acid-stimulated muscle protein synthesis has not been determined in neonates, a population who is highly anabolic and whose muscle protein synthesis rates are uniquely sensitive ...

  13. Improved production of fatty acid ethyl esters in Saccharomyces cerevisiae through up-regulation of the ethanol degradation pathway and expression of the heterologous phosphoketolase pathway

    PubMed Central


    Background Due to an increasing demand of transportation fuels, a lower availability of cheap crude oil and a lack of sustainability of fossil fuels, a gradual shift from petroleum based fuels towards alternative and renewable fuel resources will be required in the near future. Fatty acid ethyl esters (FAEEs) have properties similar to current crude diesel and could therefore form an important contribution to the development of sustainable transportation fuels in future. It is important to develop novel cell factories for efficient production of FAEEs and their precursors. Results Here, a Saccharomyces cerevisiae cell factory expressing a heterologous wax ester synthase (ws2) from Marinobacter hydrocarbonoclasticus was used to produce FAEEs from ethanol and acyl-coenzyme A (acyl-CoA). The production of acyl-CoA requires large amounts of NADPH and acetyl-CoA. Therefore, two metabolic engineering strategies for improved provision of NADPH and acetyl-CoA were evaluated. First, the ethanol degradation pathway was employed to re-channel carbon flow towards the synthesis of acetyl-CoA. Therefore, ADH2 and ALD6 encoding, respectively, alcohol dehydrogenase and acetaldehyde dehydrogenase were overexpressed together with the heterologous gene acsSEL641P encoding acetyl-CoA synthetase. The co-overexpression of ADH2, ALD6 and acsSEL641P with ws2 resulted in 408 ± 270 μg FAEE gCDW−1, a 3-fold improvement. Secondly, for the expression of the PHK pathway two genes, xpkA and ack, both descending from Aspergillus nidulans, were co-expressed together with ws2 to catalyze, respectively, the conversion of xylulose-5-phosphate to acetyl phosphate and glyceraldehyde-3-phosphate and acetyl phosphate to acetate. Alternatively, ack was substituted with pta from Bacillus subtilis, encoding phosphotransacetylase for the conversion of acetyl phosphate to acetyl-CoA. Both PHK pathways were additionally expressed in a strain with multiple chromosomally integrated ws2 gene, which

  14. Total synthesis of the squalene synthase inhibitor zaragozic acid C.


    Nakamura, Seiichi


    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219

  15. Synthesis and scavenging role of furan fatty acids

    PubMed Central

    Lemke, Rachelle A. S.; Peterson, Amelia C.; Ziegelhoffer, Eva C.; Westphall, Michael S.; Tjellström, Henrik; Coon, Joshua J.; Donohue, Timothy J.


    Fatty acids play important functional and protective roles in living systems. This paper reports on the synthesis of a previously unidentified 19 carbon furan-containing fatty acid, 10,13-epoxy-11-methyl-octadecadienoate (9-(3-methyl-5-pentylfuran-2-yl)nonanoic acid) (19Fu-FA), in phospholipids from Rhodobacter sphaeroides. We show that 19Fu-FA accumulation is increased in cells containing mutations that increase the transcriptional response of this bacterium to singlet oxygen (1O2), a reactive oxygen species generated by energy transfer from one or more light-excited donors to molecular oxygen. We identify a previously undescribed class of S-adenosylmethionine-dependent methylases that convert a phospholipid 18 carbon cis unsaturated fatty acyl chain to a 19 carbon methylated trans unsaturated fatty acyl chain (19M-UFA). We also identify genes required for the O2-dependent conversion of this 19M-UFA to 19Fu-FA. Finally, we show that the presence of 1O2 leads to turnover of 19Fu-Fa in vivo. We propose that furan-containing fatty acids like 19Fu-FA can act as a membrane-bound scavenger of 1O2, which is naturally produced by integral membrane enzymes of the R. sphaeroides photosynthetic apparatus. PMID:25092314

  16. Hybrubins: Bipyrrole Tetramic Acids Obtained by Crosstalk between a Truncated Undecylprodigiosin Pathway and Heterologous Tetramic Acid Biosynthetic Genes.


    Zhao, Zhilong; Shi, Ting; Xu, Min; Brock, Nelson L; Zhao, Yi-Lei; Wang, Yemin; Deng, Zixin; Pang, Xiuhua; Tao, Meifeng


    Heterologous expression of bacterial artificial chromosome (BAC) clones from the genomic library of Streptomyces variabilis Snt24 in Streptomyces lividans SBT5 which carried a truncated undecylprodigiosin biosynthetic gene cluster led to the identification of hybrubins A-C. The hybrubins represent a new carbon skeleton in which a tetramic acid moiety is fused to a 2,2'-dipyrrole building block. Gene knockout experiments confirmed that hybrubins are derived from two convergent biosynthetic pathways including the remaining genomic red genes of S. lividans SBT5 as well as the BAC encoded hbn genes for the production of 5-ethylidenetetramic acid. A possible biosynthetic pathway was also proposed. PMID:26800378

  17. Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways

    NASA Astrophysics Data System (ADS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.


    Stable hydrogen, carbon, and nitrogen isotopic ratios (δD, δ13C, and δ15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing δ13C and increasing δD with increasing carbon number in the α-H, α-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light δ13C signatures for β-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ω-amino acids). Higher deuterium enrichments are observed in α-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

  18. Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways

    NASA Technical Reports Server (NTRS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.


    Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

  19. Reassembled biosynthetic pathway for large-scale carbohydrate synthesis: alpha-Gal epitope producing "superbug".


    Chen, Xi; Liu, Ziye; Zhang, Jianbo; Zhang, Wei; Kowal, Przemyslaw; Wang, Peng George


    A metabolic pathway engineered Escherichia coli strain (superbug) containing one plasmid harboring an artificial gene cluster encoding all the five enzymes in the biosynthetic pathway of Galalpha l,3Lac through galactose metabolism has been developed. The plasmid contains a lambda promoter, a c1857 repressor gene, an ampicillin resistance gene, and a T7 terminator. Each gene was preceded by a Shine - Dalgarno sequence for ribosome binding. In a reaction catalyzed by the recombinant E. coli strain, Galalpha 1,3Lac trisaccharide accumulated at concentrations of 14.2 mM (7.2 gL(-1)) in a reaction mixture containing galactose, glucose, lactose, and a catalytic amount of uridine 5'-diphosphoglucose. This work demonstrates that large-scale synthesis of complex oligosaccharides can be achieved economically and efficiently through a single, biosynthetic pathway engineered microorganism. PMID:17590953

  20. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.


    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P


    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. PMID:27012633

  1. Constructing de novo biosynthetic pathways for chemical synthesis inside living cells†

    PubMed Central

    Weeks, Amy M.; Chang, Michelle C. Y.


    Living organisms have evolved a vast array of catalytic functions that make them ideally suited for the production of medicinally and industrially relevant small-molecule targets. Indeed, native metabolic pathways in microbial hosts have long been exploited and optimized for the scalable production of both fine and commodity chemicals. Our increasing capacity for DNA sequencing and synthesis has revealed the molecular basis for the biosynthesis of a variety of complex and useful metabolites and enables the de novo construction of novel metabolic pathways for the production of new and exotic molecular targets in genetically tractable microbes. However, the development of commercially viable processes for these engineered pathways is currently limited by our ability to quickly identify or engineer enzymes with the correct reaction and substrate selectivity as well as the speed by which metabolic bottlenecks can be determined and corrected. Efforts in understanding the relationship between sequence, structure, and function in the basic biochemical sciences can advance these goals for synthetic biology applications while also serving as an experimental platform to elucidate the in vivo specificity and function of enzymes and to reconstitute complex biochemical traits for study in a living model organism. Furthermore, the continuing discovery of natural mechanisms for the regulation of metabolic pathways has revealed new principles for the design of high-flux pathways with minimized metabolic burden and has inspired the development of new tools and approaches to engineer synthetic pathways in microbial hosts for chemical production. PMID:21591680

  2. Decreased bile-acid synthesis in livers of hepatocyte-conditional NADPH-cytochrome P450 reductase-null mice results in increased bile acids in serum.


    Cheng, Xingguo; Zhang, Youcai; Klaassen, Curtis D


    NADPH-cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH-cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance-associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice. PMID:25034404

  3. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters


    Moens, Luc


    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  4. Circadian control of bile acid synthesis by a KLF15-Fgf15 axis

    PubMed Central

    Han, Sean (Shuxin); Zhang, Rongli; Jain, Rajan; Shi, Hong; Zhang, Lilei; Zhou, Guangjin; Sangwung, Panjamaporn; Tugal, Derin; Atkins, G. Brandon; Prosdocimo, Domenick A.; Lu, Yuan; Han, Xiaonan; Tso, Patrick; Liao, Xudong; Epstein, Jonathan A.; Jain, Mukesh K.


    Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15 signalling axis that regulates circadian BA production. Systemic Klf15 deficiency disrupted circadian expression of key BA synthetic enzymes, tissue BA levels and triglyceride/cholesterol absorption. Studies in liver-specific Klf15-knockout mice suggested a non-hepatic basis for regulation of BA production. Ileal Fgf15 is a potent inhibitor of BA synthesis. Using a combination of biochemical, molecular and functional assays (including ileectomy and bile duct catheterization), we identify KLF15 as the first endogenous negative regulator of circadian Fgf15 expression. Elucidation of this novel pathway controlling circadian BA production has important implications for physiologic control of nutrient availability and metabolic homeostasis. PMID:26040986

  5. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.


    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki


    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved. PMID:17511507

  6. Omega-6 and omega-3 fatty acids metabolism pathways in the body of pigs fed diets with different sources of fatty acids.


    Skiba, Grzegorz; Poławska, Ewa; Sobol, Monika; Raj, Stanisława; Weremko, Dagmara


    This study was carried out on 24 gilts (♀ Polish Large White × ♂ Danish Landrace) grown with body weight (BW) of 60 to 105 kg. The pigs were fed diets designed on the basis of a standard diet (appropriate for age and BW of pigs) where a part of the energy content was replaced by different fat supplements: linseed oil in Diet L, rapeseed oil in Diet R and fish oil in Diet F (6 gilts per dietary treatment). The fat supplements were sources of specific fatty acids (FA): in Diet L α-linolenic acid (C18:3 n-3, ALA); in Diet R linoleic acid (C18:2 n-6, LA) and in Diet F eicosapentaenoic acid (C20:5 n-3, EPA), docosapentaenoic acid (C22:5 n-3, DPA) and docosahexaenoic acid (C22:6 n-3, DHA). The protein, fat and total FA contents in the body did not differ among groups of pigs. The enhanced total intake of LA and ALA by pigs caused an increased deposition of these FA in the body (p < 0.01) and an increased potential body pool of these acids for further metabolism/conversions. The conversion efficiency of LA and ALA from the feed to the pig's body differed among groups (p < 0.01) and ranged from 64.4% to 67.2% and from 69.4% to 81.7%, respectively. In Groups L and R, the level of de novo synthesis of long-chain polyunsaturated FA was higher than in Group F. From the results, it can be concluded that the efficiency of deposition is greater for omega-3 FA than for omega-6 FA and depends on their dietary amount. The level of LA and ALA intake influences not only their deposition in the body but also the end products of the omega-3 and omega-6 pathways. PMID:25530317

  7. Mutations in the Prokaryotic Pathway Rescue the fatty acid biosynthesis1 Mutant in the Cold1[OPEN

    PubMed Central

    Gao, Jinpeng; Wallis, James G.; Browse, John


    The Arabidopsis (Arabidopsis thaliana) fatty acid biosynthesis1 (fab1) mutant has increased levels of the saturated fatty acid 16:0 due to decreased activity of 3-ketoacyl-acyl carrier protein (ACP) synthase II. In fab1 leaves, phosphatidylglycerol, the major chloroplast phospholipid, contains up to 45% high-melting-point molecular species (molecules that contain only 16:0, 16:1-trans, and 18:0), a trait associated with chilling-sensitive plants, compared with less than 10% in wild-type Arabidopsis. Although they do not exhibit typical chilling sensitivity, when exposed to low temperatures (2°C–6°C) for long periods, fab1 plants do suffer collapse of photosynthesis, degradation of chloroplasts, and eventually death. A screen for suppressors of this low-temperature phenotype has identified 11 lines, some of which contain additional alterations in leaf-lipid composition relative to fab1. Here, we report the identification of two suppressor mutations, one in act1, which encodes the chloroplast acyl-ACP:glycerol-3-phosphate acyltransferase, and one in lpat1, which encodes the chloroplast acyl-ACP:lysophosphatidic acid acyltransferase. These enzymes catalyze the first two steps of the prokaryotic pathway for glycerolipid synthesis, so we investigated whether other mutations in this pathway would rescue the fab1 phenotype. Both the gly1 mutation, which reduces glycerol-3-phosphate supply to the prokaryotic pathway, and fad6, which is deficient in the chloroplast 16:1/18:1 fatty acyl desaturase, were discovered to be suppressors. Analyses of leaf-lipid compositions revealed that mutations at all four of the suppressor loci result in reductions in the proportion of high-melting-point molecular species of phosphatidylglycerol relative to fab1. We conclude that these reductions are likely the basis for the suppressor phenotypes. PMID:26224803

  8. Novel Hydroxycinnamoyl-Coenzyme A Quinate Transferase Genes from Artichoke Are Involved in the Synthesis of Chlorogenic Acid1[W

    PubMed Central

    Sonnante, Gabriella; D'Amore, Rosalinda; Blanco, Emanuela; Pierri, Ciro L.; De Palma, Monica; Luo, Jie; Tucci, Marina; Martin, Cathie


    Artichoke (Cynara cardunculus subsp. scolymus) extracts have high antioxidant capacity, due primarily to flavonoids and phenolic acids, particularly chlorogenic acid (5-caffeoylquinic acid [CGA]), dicaffeoylquinic acids, and caffeic acid, which are abundant in flower bracts and bioavailable to humans in the diet. The synthesis of CGA can occur following different routes in plant species, and hydroxycinnamoyl-coenzyme A transferases are important enzymes in these pathways. Here, we report on the isolation and characterization of two novel genes both encoding hydroxycinnamoyl-coenzyme A quinate transferases (HQT) from artichoke. The recombinant proteins (HQT1 and HQT2) were assayed after expression in Escherichia coli, and both showed higher affinity for quinate over shikimate. Their preferences for acyl donors, caffeoyl-coenzyme A or p-coumaroyl-coenzyme A, were examined. Modeling and docking analyses were used to propose possible pockets and residues involved in determining substrate specificities in the HQT enzyme family. Quantitative real-time polymerase chain reaction analysis of gene expression indicated that HQT1 might be more directly associated with CGA content. Transient and stable expression of HQT1 in Nicotiana resulted in a higher production of CGA and cynarin (1,3-dicaffeoylquinic acid). These findings suggest that several isoforms of HQT contribute to the synthesis of CGA in artichoke according to physiological needs and possibly following various metabolic routes. PMID:20431089

  9. Fructose utilization for nucleic acid synthesis in the fetal pig.


    White, C E; Piper, E L; Noland, P R; Daniels, L B


    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  10. Regulation of the cholesterol biosynthetic pathway and its integration with fatty acid biosynthesis in the oleaginous microalga Nannochloropsis oceanica

    PubMed Central


    Background Sterols are vital structural and regulatory components in eukaryotic cells; however, their biosynthetic pathways and functional roles in microalgae remain poorly understood. Results In the oleaginous microalga Nannochloropsis oceanica, the sterol biosynthetic pathway produces phytosterols as minor products and cholesterol as the major product. The evidence together with their deduced biosynthetic pathways suggests that N. oceanica exhibits features of both higher plants and mammals. Temporal tracking of sterol profiles and sterol-biosynthetic transcripts in response to changes in light intensity and nitrogen supply reveal that sterols play roles in cell proliferation, chloroplast differentiation, and photosynthesis. Furthermore, the dynamics of fatty acid (FA) and FA-biosynthetic transcripts upon chemical inhibitor-induced sterol depletion reveal possible co-regulation of sterol production and FA synthesis, in that the squalene epoxidase inhibitor terbinafine reduces sterol content yet significantly elevates free FA production. Thus, a feedback regulation of sterol and FA homeostasis is proposed, with the 1-deoxy-D-xylulose 5-phosphate synthase (DXS, the committed enzyme in isoprenoid and sterol biosynthesis) gene potentially subject to feedback regulation by sterols. Conclusion These findings reveal features of sterol function and biosynthesis in microalgae and suggest new genetic engineering or chemical biology approaches for enhanced oil production in microalgae. PMID:24920959

  11. The effects of centrally injected arachidonic acid on respiratory system: Involvement of cyclooxygenase to thromboxane signaling pathway.


    Erkan, Leman Gizem; Guvenc, Gokcen; Altinbas, Burcin; Niaz, Nasir; Yalcin, Murat


    Arachidonic acid (AA) is a polyunsaturated fatty acid that is present in the phospholipids of the cell membranes of the body and is abundant in the brain. Exogenously administered AA has been shown to affect brain metabolism and to exhibit cardiovascular and neuroendocrine actions. However, little is known regarding its respiratory actions and/or central mechanism of its respiratory effects. Therefore, the present study was designed to investigate the possible effects of centrally injected AA on respiratory system and the mediation of the central cyclooxygenase (COX) to thromboxane A2 (TXA2) signaling pathway on AA-induced respiratory effects in anaesthetized rats. Intracerebroventricular (i.c.v.) administration of AA induced dose- and time-dependent increase in tidal volume, respiratory rates and respiratory minute ventilation and also caused an increase in partial oxygen pressure (pO2) and decrease in partial carbon dioxide pressure (pCO2) in male anaesthetized Spraque Dawley rats. I.c.v. pretreatment with ibuprofen, a non-selective COX inhibitor, completely blocked the hyperventilation and blood gases changes induced by AA. In addition, central pretreatment with different doses of furegrelate, a TXA2 synthesis inhibitor, also partially prevented AA-evoked hyperventilation and blood gases effects. These data explicitly show that centrally administered AA induces hyperventilation with increasing pO2 and decreasing pCO2 levels which are mediated by the activation of central COX to TXA2 signaling pathway. PMID:26767978

  12. Metabolic Pathway Confirmation and Discovery Through 13C-labeling of Proteinogenic Amino Acids

    PubMed Central

    You, Le; Page, Lawrence; Feng, Xueyang; Berla, Bert; Pakrasi, Himadri B.; Tang, Yinjie J.


    Microbes have complex metabolic pathways that can be investigated using biochemistry and functional genomics methods. One important technique to examine cell central metabolism and discover new enzymes is 13C-assisted metabolism analysis 1. This technique is based on isotopic labeling, whereby microbes are fed with a 13C labeled substrates. By tracing the atom transition paths between metabolites in the biochemical network, we can determine functional pathways and discover new enzymes. As a complementary method to transcriptomics and proteomics, approaches for isotopomer-assisted analysis of metabolic pathways contain three major steps 2. First, we grow cells with 13C labeled substrates. In this step, the composition of the medium and the selection of labeled substrates are two key factors. To avoid measurement noises from non-labeled carbon in nutrient supplements, a minimal medium with a sole carbon source is required. Further, the choice of a labeled substrate is based on how effectively it will elucidate the pathway being analyzed. Because novel enzymes often involve different reaction stereochemistry or intermediate products, in general, singly labeled carbon substrates are more informative for detection of novel pathways than uniformly labeled ones for detection of novel pathways3, 4. Second, we analyze amino acid labeling patterns using GC-MS. Amino acids are abundant in protein and thus can be obtained from biomass hydrolysis. Amino acids can be derivatized by N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide (TBDMS) before GC separation. TBDMS derivatized amino acids can be fragmented by MS and result in different arrays of fragments. Based on the mass to charge (m/z) ratio of fragmented and unfragmented amino acids, we can deduce the possible labeled patterns of the central metabolites that are precursors of the amino acids. Third, we trace 13C carbon transitions in the proposed pathways and, based on the isotopomer data, confirm whether these

  13. 5-Aminolevulinic acid production in engineered Corynebacterium glutamicum via C5 biosynthesis pathway.


    Ramzi, Ahmad Bazli; Hyeon, Jeong Eun; Kim, Seung Wook; Park, Chulhwan; Han, Sung Ok


    ALA (5-aminolevulinic acid) is an important intermediate in the synthesis of tetrapyrroles and the use of ALA has been gradually increasing in many fields, including medicine and agriculture. In this study, improved biological production of ALA in Corynebacterium glutamicum was achieved by overexpressing glutamate-initiated C5 pathway. For this purpose, copies of the glutamyl t-RNA reductase HemA from several bacteria were mutated by site-directed mutagenesis of which a HemA version from Salmonella typhimurium exhibited the highest ALA production. Cultivation of the HemA-expressing strain produced approximately 204 mg/L of ALA, while co-expression with HemL (glutamate-1-semialdehyde aminotransferase) increased ALA concentration to 457 mg/L, representing 11.6- and 25.9-fold increases over the control strain (17 mg/L of ALA). Further effects of metabolic perturbation were investigated, leading to penicillin addition that further improves ALA production to 584 mg/L. In an optimized flask fermentation, engineered C. glutamicum strains expressing the HemA and hemAL operon produced up to 1.1 and 2.2g/L ALA, respectively, under glutamate-producing conditions. The final yields represent 10.7- and 22.0-fold increases over the control strain (0.1g/L of ALA). From these findings, ALA biosynthesis from glucose was successfully demonstrated and this study is the first to report ALA overproduction in C. glutamicum via metabolic engineering. PMID:26453466

  14. Hydrogen Peroxide Elicits Constriction of Skeletal Muscle Arterioles by Activating the Arachidonic Acid Pathway

    PubMed Central

    Csató, Viktória; Pető, Attila; Koller, Ákos; Édes, István


    Aims The molecular mechanisms of the vasoconstrictor responses evoked by hydrogen peroxide (H2O2) have not been clearly elucidated in skeletal muscle arterioles. Methods and Results Changes in diameter of isolated, cannulated and pressurized gracilis muscle arterioles (GAs) of Wistar-Kyoto rats were determined under various test conditions. H2O2 (10–100 µM) evoked concentration-dependent constrictions in the GAs, which were inhibited by endothelium removal, or by antagonists of phospholipase A (PLA; 100 µM 7,7-dimethyl-(5Z,8Z)-eicosadienoic acid), protein kinase C (PKC; 10 µM chelerythrine), phospholipase C (PLC; 10 µM U-73122), or Src family tyrosine kinase (Src kinase; 1 µM Src Inhibitor-1). Antagonists of thromboxane A2 (TXA2; 1 µM SQ-29548) or the non-specific cyclooxygenase (COX) inhibitor indomethacin (10 µM) converted constrictions to dilations. The COX-1 inhibitor (SC-560, 1 µM) demonstrated a greater reduction in constriction and conversion to dilation than that of COX-2 (celecoxib, 3 µM). H2O2 did not elicit significant changes in arteriolar Ca2+ levels measured with Fura-2. Conclusions These data suggest that H2O2 activates the endothelial Src kinase/PLC/PKC/PLA pathway, ultimately leading to the synthesis and release of TXA2 by COX-1, thereby increasing the Ca2+ sensitivity of the vascular smooth muscle cells and eliciting constriction in rat skeletal muscle arterioles. PMID:25093847

  15. Synthesis of E. faecium wall teichoic acid fragments.


    van der Es, Daan; Groenia, Nadia A; Laverde, Diana; Overkleeft, Herman S; Huebner, Johannes; van der Marel, Gijsbert A; Codée, Jeroen D C


    The first synthesis of different Enterococcus faecium wall teichoic acid (WTA) fragments is presented. The structure of these major cell wall components was elucidated recently and it was shown that these glycerolphosphate (GroP) based polymers are built up from -6-(GalNAc-α(1-3)-GalNAc-β(1-2)-GroP)- repeating units. We assembled WTA fragments up to three repeating units in length, in two series that differ in the stereochemistry of the glycerolphosphate moiety. The key GalNAc-GalNAc-GroP synthons, required for the synthesis, were generated from galactosazide building blocks that were employed in highly stereoselective glycosylation reactions to furnish both the α- and β-configured linkages. By comparing the NMR spectra of the synthesized fragments with the isolated material it appears that the hereto undefined stereochemistry of the glycerol phosphate moiety is sn-glycerol-3-phosphate. The generated fragments will be valuable tools to study their immunological activity at the molecular level. PMID:26993744

  16. [Effect of gibberellic acid on RNA synthesis in dwarf peas].


    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P


    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  17. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.


    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  18. Intermediates in the Synthesis of Type 2 Adenovirus Deoxyribonucleic Acid

    PubMed Central

    Horwitz, Marshall S.


    Intermediates in the synthesis of adenovirus type 2 deoxyribonucleic acid (DNA) were studied in HeLa cells. Pieces of DNA smaller than the viral genome were demonstrated after labeling with 3H-thymidine for 10 to 240 sec. Intermediates as small as the Okazaki fragments (8 to 10S) do not predominate at any of the above times. No detectable addition of nucleotides to parental genome could be shown, nor was there any breakdown of recently synthesized viral DNA. The DNA intermediates were of viral origin for they hybridized to viral DNA and were made at a stage of the cell cycle (G2) when host DNA is not synthesized. PMID:5132696

  19. Apigenin Induces Dermal Collagen Synthesis Via smad2/3 Signaling Pathway

    PubMed Central

    Zhang, Y.; Wang, J.; Cheng, X.; Yi, B.; Zhang, X.; Li, Q.


    Decrease in fibroblast-produced collagen has been proven to be the pivotal cause of skin aging, but there is no satisfactory drug which directly increases dermal thickness and collage density. Here we found that a flavonoid natural product, apigenin, could significantly increase collagen synthesis. NIH/3T3 and primary human dermal fibroblasts (HDFs) were incubated with various concentrations of apigenin, with dimethyl sulfoxide (DMSO) serving as the negative control. Real-time reverse-transcription polymerase chain reaction (PCR), Western Blot, and Toluidine blue staining demonstrated that apigenin stimulated type-I and type-III collagen synthesis of fibroblasts on the mRNA and protein levels. Meanwhile, apigenin did not induce expression of alpha smooth muscle actin (α-SMA) in vitro and in vivo, a fibrotic marker in living tissues. Then the production of collagen was confirmed by Masson’s trichrome stain, Picrosirius red stain and immunohistochemistry in mouse models. We also clarified that this compound induced collagen synthesis by activating smad2/3 signaling pathway. Taken together, without obvious influence on fibroblasts’ apoptosis and viability, apigenin could promote the type-I and type-III collagen synthesis of dermal fibroblasts in vitro and in vivo, thus suggesting that apigenin may serve as a potential agent for esthetic and reconstructive skin rejuvenation. PMID:26150153

  20. Stimulation of MC38 tumor growth by insulin analog X10 involves the serine synthesis pathway.


    Hvid, Henning; Fendt, Sarah-Maria; Blouin, Marie-José; Birman, Elena; Voisin, Gregory; Svendsen, Angela Manegold; Frank, Russell; Vander Heiden, Matthew G; Stephanopoulos, Gregory; Hansen, Bo Falck; Pollak, Michael


    Recent evidence suggests that type II diabetes is associated with increased risk and/or aggressive behavior of several cancers, including those arising from the colon. Concerns have been raised that endogenous hyperinsulinemia and/or exogenous insulin and insulin analogs might stimulate proliferation of neoplastic cells. However, the mechanisms underlying possible growth-promoting effects of insulin and insulin analogs in cancer cells in vivo, such as changes in gene expression, are incompletely described. We observed that administration of the insulin analog X10 significantly increased tumor growth and proliferation in a murine colon cancer model (MC38 cell allografts). Insulin and X10 altered gene expression in MC38 tumors in a similar fashion, but X10 was more potent in terms of the number of genes influenced and the magnitude of changes in gene expression. Many of the affected genes were annotated to metabolism, nutrient uptake, and protein synthesis. Strikingly, expression of genes encoding enzymes in the serine synthesis pathway, recently shown to be critical for neoplastic proliferation, was increased following treatment with insulin and X10. Using stable isotopic tracers and mass spectrometry, we confirmed that insulin and X10 increased glucose contribution to serine synthesis in MC38 cells. The data demonstrate that the tumor growth-promoting effects of insulin and X10 are associated with changes in expression of genes involved in cellular energy metabolism and reveal previously unrecognized effects of insulin and X10 on serine synthesis. PMID:22685267

  1. Identification of a conserved protein involved in anaerobic unsaturated fatty acid synthesis in Neiserria gonorrhoeae: implications for facultative and obligate anaerobes that lack FabA.


    Isabella, Vincent M; Clark, Virginia L


    Transcriptome analysis of the facultative anaerobe, Neisseria gonorrhoeae, revealed that many genes of unknown function were induced under anaerobic conditions. Mutation of one such gene, NGO1024, encoding a protein belonging to the 2-nitropropane dioxygenase-like superfamily of proteins, was found to result in an inability of gonococci to grow anaerobically. Anaerobic growth of an NG1024 mutant was restored upon supplementation with unsaturated fatty acids (UFA), but not with the saturated fatty acid palmitate. Gonococcal fatty acid profiles confirmed that NGO1024 was involved in UFA synthesis anaerobically, but not aerobically, demonstrating that gonococci contain two distinct pathways for the production of UFAs, with a yet unidentified aerobic mechanism, and an anaerobic mechanism involving NGO1024. Expression of genes involved in classical anaerobic UFA synthesis, fabA, fabM and fabB, was toxic in gonococci and unable to complement a NGO1024 mutation, suggesting that the chemistry involved in gonococcal anaerobic UFA synthesis is distinct from that of the classical pathway. NGO1024 homologues, which we suggest naming UfaA, form a distinct lineage within the 2-nitropropane dioxygenase-like superfamily, and are found in many facultative and obligate anaerobes that produce UFAs but lack fabA, suggesting that UfaA is part of a widespread pathway involved in UFA synthesis. PMID:21895795

  2. Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway.


    Cronan, John E


    Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

  3. Differential regulation of protein synthesis in skeletal muscle and liver of neonatal pigs by leucine through an mTORC1-dependent pathway.


    Suryawan, Agus; Nguyen, Hanh V; Almonaci, Rosemarie D; Davis, Teresa A


    Neonatal growth is characterized by a high protein synthesis rate that is largely due to an enhanced sensitivity to the postprandial rise in insulin and amino acids, especially leucine. The mechanism of leucine's action in vivo is not well understood. In this study, we investigated the effect of leucine infusion on protein synthesis in skeletal muscle and liver of neonatal pigs. To evaluate the mode of action of leucine, we used rapamycin, an inhibitor of mammalian target of rapamycin (mTOR) complex-1 (mTORC1). Overnight-fasted 7-day-old piglets were treated with rapamycin for 1 hour and then infused with leucine (400 μmol·kg(-1)·h(-1)) for 1 hour. Leucine infusion increased the rate of protein synthesis, and ribosomal protein S6 kinase 1 (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein-1 (4E-BP1) phosphorylation in gastrocnemius and masseter muscles (P < 0.05), but not in the liver. The leucine-induced stimulation of protein synthesis and S6K1 and 4E-BP1 phosphorylation were completely blocked by rapamycin, suggesting that leucine action is by an mTORC1-dependent mechanism. Neither leucine nor rapamycin had any effect on the activation of the upstream mTORC1 regulators, AMP-activated protein kinase and protein kinase B, in skeletal muscle or liver. The activation of eIF2α and elongation factor 2 was not affected by leucine or rapamycin, indicating that these two pathways are not limiting steps of leucine-induced protein synthesis. These results suggest that leucine stimulates muscle protein synthesis in neonatal pigs by inducing the activation of mTORC1 and its downstream pathway leading to mRNA translation. PMID:22675606

  4. Role of bile acids in the regulation of the metabolic pathways

    PubMed Central

    Taoka, Hiroki; Yokoyama, Yoko; Morimoto, Kohkichi; Kitamura, Naho; Tanigaki, Tatsuya; Takashina, Yoko; Tsubota, Kazuo; Watanabe, Mitsuhiro


    Recent studies have revealed that bile acids (BAs) are not only facilitators of dietary lipid absorption but also important signaling molecules exerting multiple physiological functions. Some major signaling pathways involving the nuclear BAs receptor farnesoid X receptor and the G protein-coupled BAs receptor TGR5/M-BAR have been identified to be the targets of BAs. BAs regulate their own homeostasis via signaling pathways. BAs also affect diverse metabolic pathways including glucose metabolism, lipid metabolism and energy expenditure. This paper suggests the mechanism of controlling metabolism via BA signaling and demonstrates that BA signaling is an attractive therapeutic target of the metabolic syndrome. PMID:27433295

  5. Role of bile acids in the regulation of the metabolic pathways.


    Taoka, Hiroki; Yokoyama, Yoko; Morimoto, Kohkichi; Kitamura, Naho; Tanigaki, Tatsuya; Takashina, Yoko; Tsubota, Kazuo; Watanabe, Mitsuhiro


    Recent studies have revealed that bile acids (BAs) are not only facilitators of dietary lipid absorption but also important signaling molecules exerting multiple physiological functions. Some major signaling pathways involving the nuclear BAs receptor farnesoid X receptor and the G protein-coupled BAs receptor TGR5/M-BAR have been identified to be the targets of BAs. BAs regulate their own homeostasis via signaling pathways. BAs also affect diverse metabolic pathways including glucose metabolism, lipid metabolism and energy expenditure. This paper suggests the mechanism of controlling metabolism via BA signaling and demonstrates that BA signaling is an attractive therapeutic target of the metabolic syndrome. PMID:27433295

  6. Precipitation pathways for ferrihydrite formation in acidic solutions


    Zhu, Mengqiang; Khalid, Syed; Frandsen, Cathrine; Wallace, Adam F.; Legg, Benjamin; Zhang, Hengzhong; Morup, Steen; Banfield, Jillian F.; Waychunas, Glenn A.


    In this study, iron oxides and oxyhydroxides form via Fe3+ hydrolysis and polymerization in many aqueous environments, but the pathway from Fe3+ monomers to oligomers and then to solid phase nuclei is unknown. In this work, using combined X-ray, UV–vis, and Mössbauer spectroscopic approaches, we were able to identify and quantify the long-time sought ferric speciation over time during ferric oxyhydroxide formation in partially-neutralized ferric nitrate solutions ([Fe3+] = 0.2 M, 1.8 < pH < 3). Results demonstrate that Fe exists mainly as Fe(H2O)63+, μ-oxo aquo dimers and ferrihydrite, and that with time, the μ-oxo dimer decreases while the othermore » two species increase in their concentrations. No larger Fe oligomers were detected. Given that the structure of the μ-oxo dimer is incompatible with those of all Fe oxides and oxyhydroxides, our results suggest that reconfiguration of the μ-oxo dimer structure occurs prior to further condensation leading up to the nucleation of ferrihydrite. The structural reconfiguration is likely the rate-limiting step involved in the nucleation process.« less

  7. Precipitation pathways for ferrihydrite formation in acidic solutions

    SciTech Connect

    Zhu, Mengqiang; Khalid, Syed; Frandsen, Cathrine; Wallace, Adam F.; Legg, Benjamin; Zhang, Hengzhong; Morup, Steen; Banfield, Jillian F.; Waychunas, Glenn A.


    In this study, iron oxides and oxyhydroxides form via Fe3+ hydrolysis and polymerization in many aqueous environments, but the pathway from Fe3+ monomers to oligomers and then to solid phase nuclei is unknown. In this work, using combined X-ray, UV–vis, and Mössbauer spectroscopic approaches, we were able to identify and quantify the long-time sought ferric speciation over time during ferric oxyhydroxide formation in partially-neutralized ferric nitrate solutions ([Fe3+] = 0.2 M, 1.8 < pH < 3). Results demonstrate that Fe exists mainly as Fe(H2O)63+, μ-oxo aquo dimers and ferrihydrite, and that with time, the μ-oxo dimer decreases while the other two species increase in their concentrations. No larger Fe oligomers were detected. Given that the structure of the μ-oxo dimer is incompatible with those of all Fe oxides and oxyhydroxides, our results suggest that reconfiguration of the μ-oxo dimer structure occurs prior to further condensation leading up to the nucleation of ferrihydrite. The structural reconfiguration is likely the rate-limiting step involved in the nucleation process.

  8. Precipitation pathways for ferrihydrite formation in acidic solutions

    NASA Astrophysics Data System (ADS)

    Zhu, Mengqiang; Frandsen, Cathrine; Wallace, Adam F.; Legg, Benjamin; Khalid, Syed; Zhang, Hengzhong; Mørup, Steen; Banfield, Jillian F.; Waychunas, Glenn A.


    Iron oxides and oxyhydroxides form via Fe3+ hydrolysis and polymerization in many aqueous environments, but the pathway from Fe3+ monomers to oligomers and then to solid phase nuclei is unknown. In this work, using combined X-ray, UV-vis, and Mössbauer spectroscopic approaches, we were able to identify and quantify the long-time sought ferric speciation over time during ferric oxyhydroxide formation in partially-neutralized ferric nitrate solutions ([Fe3+] = 0.2 M, 1.8 < pH < 3). Results demonstrate that Fe exists mainly as Fe(H2O)63+, μ-oxo aquo dimers and ferrihydrite, and that with time, the μ-oxo dimer decreases while the other two species increase in their concentrations. No larger Fe oligomers were detected. Given that the structure of the μ-oxo dimer is incompatible with those of all Fe oxides and oxyhydroxides, our results suggest that reconfiguration of the μ-oxo dimer structure occurs prior to further condensation leading up to the nucleation of ferrihydrite. The structural reconfiguration is likely the rate-limiting step involved in the nucleation process.

  9. Cytoplasmic Tyrosine Phosphatase Shp2 Coordinates Hepatic Regulation of Bile Acid and FGF15/19 Signaling to Repress Bile Acid Synthesis

    PubMed Central

    Li, Shuangwei; Hsu, Diane D.F.; Li, Bing; Luo, Xiaolin; Alderson, Nazilla; Qiao, Liping; Ma, Lina; Zhu, Helen H.; He, Zhao; Suino-Powell, Kelly; Ji, Kaihong; Li, Jiefu; Shao, Jianhua; Xu, H. Eric; Li, Tiangang; Feng, Gen-Sheng


    Summary Bile acid (BA) biosynthesis is tightly controlled by intrahepatic negative feedback signaling elicited by BA binding to farnesoid X receptor (FXR), and also by enterohepatic communication involving ileal BA reabsorption and FGF15/19 secretion. However, how these pathways are coordinated is poorly understood. We show here that non-receptor tyrosine phosphatase Shp2 is a critical player that couples and regulates the intrahepatic and enterohepatic signals for repression of BA synthesis. Ablating Shp2 in hepatocytes suppressed signal relay from FGFR4, receptor for FGF15/19, and attenuated BA activation of FXR signaling, resulting in elevation of systemic BA levels and chronic hepatobiliary disorders in mice. Acting immediately downstream of FGFR4, Shp2 associates with FRS2α and promotes the receptor activation and signal relay to several pathways. These results elucidate a molecular mechanism for the control of BA homeostasis by Shp2 through orchestration of multiple signals in hepatocytes. PMID:24981838

  10. EIMS Fragmentation Pathways and MRM Quantification of 7α/β-Hydroxy-Dehydroabietic Acid TMS Derivatives.


    Rontani, Jean-François; Aubert, Claude; Belt, Simon T


    EI mass fragmentation pathways of TMS derivatives οf 7α/β-hydroxy-dehydroabietic acids resulting from NaBH(4)-reduction of oxidation products of dehydroabietic acid (a component of conifers) were investigated and deduced by a combination of (1) low energy CID-GC-MS/MS, (2) deuterium labeling, (3) different derivatization methods, and (4) GC-QTOF accurate mass measurements. Having identified the main fragmentation pathways, the TMS-derivatized 7α/β-hydroxy-dehydroabietic acids could be quantified in multiple reaction monitoring (MRM) mode in sea ice and sediment samples collected from the Arctic. These newly characterized transformation products of dehydroabietic acid constitute potential tracers of biotic and abiotic degradation of terrestrial higher plants in the environment. PMID:26138887

  11. EIMS Fragmentation Pathways and MRM Quantification of 7α/β-Hydroxy-Dehydroabietic Acid TMS Derivatives

    NASA Astrophysics Data System (ADS)

    Rontani, Jean-François; Aubert, Claude; Belt, Simon T.


    EI mass fragmentation pathways of TMS derivatives οf 7α/β-hydroxy-dehydroabietic acids resulting from NaBH4-reduction of oxidation products of dehydroabietic acid (a component of conifers) were investigated and deduced by a combination of (1) low energy CID-GC-MS/MS, (2) deuterium labeling, (3) different derivatization methods, and (4) GC-QTOF accurate mass measurements. Having identified the main fragmentation pathways, the TMS-derivatized 7α/β-hydroxy-dehydroabietic acids could be quantified in multiple reaction monitoring (MRM) mode in sea ice and sediment samples collected from the Arctic. These newly characterized transformation products of dehydroabietic acid constitute potential tracers of biotic and abiotic degradation of terrestrial higher plants in the environment.

  12. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet


    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  13. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.


    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc


    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica. PMID:25959598

  14. An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

    PubMed Central

    Carballeira, Néstor M.; Sanabria, David; Oyola, Delise


    An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

  15. From thiol to sulfonic acid: modeling the oxidation pathway of protein thiols by hydrogen peroxide.


    van Bergen, Laura A H; Roos, Goedele; De Proft, Frank


    Hydrogen peroxide is a natural oxidant that can oxidize protein thiols (RSH) via sulfenic acid (RSOH) and sulfinic acid (RSO2H) to sulfonic acid (RSO3H). In this paper, we study the complete anionic and neutral oxidation pathway from thiol to sulfonic acid. Reaction barriers and reaction free energies for all three oxidation steps are computed, both for the isolated substrates and for the substrates in the presence of different model ligands (CH4, H2O, NH3) mimicking the enzymatic environment. We found for all three barriers that the anionic thiolate is more reactive than the neutral thiol. However, the assistance of the environment in the neutral pathway in a solvent-assisted proton-exchange (SAPE) mechanism can lower the reaction barrier noticeably. Polar ligands can decrease the reaction barriers, whereas apolar ligands do not influence the barrier heights. The same holds for the reaction energies: they decrease (become more negative) in the presence of polar ligands whereas apolar ligands do not have an influence. The consistently negative consecutive reaction energies for the oxidation in the anionic pathway when going from thiolate over sulfenic and sulfinic acid to sulfonic acid are in agreement with biological reversibility. PMID:25036614

  16. Synthesis of novel acid electrolytes for phosphoric acid fuel cells. Final report, May 1985-October 1988

    SciTech Connect

    Adcock, J.L.


    Construction of a 40-millimole-per-hour-scale aerosol direct-fluorination reactor was completed June 26, 1986. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4-methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy-1-propene, 18 grams of F-3-(2-methoxy.ethoxy)-1-propene, and 37 grams of F-3,3-dimethyl-1-butene. Eighteen grams of F-2,2-dimethyl-1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy-1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy)-1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other GRI contractors for synthesis of perfluorinated sulfur(VI) and phosphorous(V) acids.

  17. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA


    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  18. The sequence diversity and expression among genes of the folic acid biosynthesis pathway in industrial Saccharomyces strains.


    Goncerzewicz, Anna; Misiewicz, Anna


    Folic acid is an important vitamin in human nutrition and its deficiency in pregnant women's diets results in neural tube defects and other neurological damage to the fetus. Additionally, DNA synthesis, cell division and intestinal absorption are inhibited in case of adults. Since this discovery, governments and health organizations worldwide have made recommendations concerning folic acid supplementation of food for women planning to become pregnant. In many countries this has led to the introduction of fortifications, where synthetic folic acid is added to flour. It is known that Saccharomyces strains (brewing and bakers' yeast) are one of the main producers of folic acid and they can be used as a natural source of this vitamin. Proper selection of the most efficient strains may enhance the folate content in bread, fermented vegetables, dairy products and beer by 100% and may be used in the food industry. The objective of this study was to select the optimal producing yeast strain by determining the differences in nucleotide sequences in the FOL2, FOL3 and DFR1 genes of folic acid biosynthesis pathway. The Multitemperature Single Strand Conformation Polymorphism (MSSCP) method and further nucleotide sequencing for selected strains were applied to indicate SNPs in selected gene fragments. The RT qPCR technique was also applied to examine relative expression of the FOL3 gene. Furthermore, this is the first time ever that industrial yeast strains were analysed regarding genes of the folic acid biosynthesis pathway. It was observed that a correlation exists between the folic acid amount produced by industrial yeast strains and changes in the nucleotide sequence of adequate genes. The most significant changes occur in the DFR1 gene, mostly in the first part, which causes major protein structure modifications in KKP 232, KKP 222 and KKP 277 strains. Our study shows that the large amount of SNP contributes to impairment of the selected enzymes and S. cerevisiae and S

  19. Synthesis of hyaluronic acid oligosaccharides and exploration of a fluorous-assisted approach.


    Macchione, Giuseppe; de Paz, José L; Nieto, Pedro M


    The synthesis of hyaluronic acid oligomers (tri- and tetrasaccharide) is described. We have followed a pre-glycosylation oxidation strategy. Glucuronic acid units were directly employed in coupling reactions with suitably protected glucosamine derivatives. In order to simplify the purification of synthetic intermediates, a fluorous-assisted strategy has been also explored. Using this approach, a hyaluronic acid trisaccharide was prepared. PMID:24930061

  20. Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.


    Dacquin, J P; Lee, A F; Pirez, C; Wilson, K


    Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. PMID:22089025

  1. The Notch pathway mediates the angiotensin II-induced synthesis of extracellular matrix components in podocytes.


    Yao, Min; Wang, Xiaomei; Wang, Xiaomeng; Zhang, Tao; Chi, Yanqing; Gao, Feng


    The Notch pathway is known to contribute to the development of glomerular disease. Angiotensin II (Ang II), an important member of the renin-angiotensin system, stimulates the accumulation of extracellular matrix components in glomerular disease; however, the exact mechanisms involved remain to be elucidated. In the present study, we aimed to investigate the effects of the Notch pathway on the synthesis of extracellular matrix components in Ang II-stimulated podocytes. Mouse podocytes were stimulated with Ang II (10-6 mol/l). The activation of the Notch pathway was inhibited by a vector carrying short hairpin RNA (shRNA) targeting Notch1 (sh-Notch1) or by γ-secretase inhibitor (GSI). The protein levels of Notch1, Notch intracellular domain 1 (NICD1), hairy and enhancer of split-1 (Hes1), matrix metalloproteinase (MMP)-2, MMP-9, transforming growth factor-β1 (TGF-β1), type IV collagen and laminin were determined by western blot analysis. The Notch1, Hes1, MMP-2, MMP-9, TGF-β1, type IV collagen and laminin mRNA levels were detected by RT-PCR. The MMP-2 and MMP-9 activity was measured using a cell active fluorescence assay kit. The levels of TGF-β1, type IV collagen and laminin were determined in the culture medium of the podocytes by enzyme-linked immunosorbent assay (ELISA). Our results revealed that Ang II upregulated Notch1, NICD1, Hes1, TGF-β1, type IV collagen and laminin expression and downregulated MMP-2 and MMP-9 expression in the cultured podocytes. The inhibition of the Notch pathway by sh-Notch1 or GSI increased MMP-2 and MMP-9 expression, decreased the TGF-β1 level and suppressed type IV collagen and laminin expression. The inhibition of the Notch pathway by sh-Notch1 or GSI also increased MMP-2 and MMP-9 activity, and decreased TGF-β1 levels, type IV collagen levels and laminin secretion. These findings indicate that the Notch pathway potentially mediates the Ang II-induced synthesis of extracellular matrix components in podocytes through the

  2. Reassessment of the Genetic Regulation of Fatty Acid Synthesis in Escherichia coli: Global Positive Control by the Dual Functional Regulator FadR

    PubMed Central

    My, L.; Ghandour Achkar, N.; Viala, J. P.


    ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator

  3. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.


    Szostak, Michal; Spain, Malcolm; Procter, David J


    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  4. The rabbit pulmonary cytochrome P450 arachidonic acid metabolic pathway: characterization and significance.

    PubMed Central

    Zeldin, D C; Plitman, J D; Kobayashi, J; Miller, R F; Snapper, J R; Falck, J R; Szarek, J L; Philpot, R M; Capdevila, J H


    Cytochrome P450 metabolizes arachidonic acid to several unique and biologically active compounds in rabbit liver and kidney. Microsomal fractions prepared from rabbit lung homogenates metabolized arachidonic acid through cytochrome P450 pathways, yielding cis-epoxyeicosatrienoic acids (EETs) and their hydration products, vic-dihydroxyeicosatrienoic acids, mid-chain cis-trans conjugated dienols, and 19- and 20-hydroxyeicosatetraenoic acids. Inhibition studies using polyclonal antibodies prepared against purified CYP2B4 demonstrated 100% inhibition of arachidonic acid epoxide formation. Purified CYP2B4, reconstituted in the presence of NADPH-cytochrome P450 reductase and cytochrome b5, metabolized arachidonic acid, producing primarily EETs. EETs were detected in lung homogenate using gas chromatography/mass spectroscopy, providing evidence for the in vivo pulmonary cytochrome P450 epoxidation of arachidonic acid. Chiral analysis of these lung EETs demonstrated a preference for the 14(R),15(S)-, 11(S),12(R)-, and 8(S),9(R)-EET enantiomers. Both EETs and vic-dihydroxyeicosatrienoic acids were detected in bronchoalveolar lavage fluid. At micromolar concentrations, methylated 5,6-EET and 8,9-EET significantly relaxed histamine-contracted guinea pig hilar bronchi in vitro. In contrast, 20-hydroxyeicosatetraenoic acid caused contraction to near maximal tension. We conclude that CYP2B4, an abundant rabbit lung cytochrome P450 enzyme, is the primary constitutive pulmonary arachidonic acid epoxygenase and that these locally produced, biologically active eicosanoids may be involved in maintaining homeostasis within the lung. Images PMID:7738183

  5. Meristem maintenance, auxin, jasmonic and abscisic acid pathways as a mechanism for phenotypic plasticity in Antirrhinum majus.


    Weiss, Julia; Alcantud-Rodriguez, Raquel; Toksöz, Tugba; Egea-Cortines, Marcos


    Plants grow under climatic changing conditions that cause modifications in vegetative and reproductive development. The degree of changes in organ development i.e. its phenotypic plasticity seems to be determined by the organ identity and the type of environmental cue. We used intraspecific competition and found that Antirrhinum majus behaves as a decoupled species for lateral organ size and number. Crowding causes decreases in leaf size and increased leaf number whereas floral size is robust and floral number is reduced. Genes involved in shoot apical meristem maintenance like ROA and HIRZ, cell cycle (CYCD3a; CYCD3b, HISTONE H4) or organ polarity (GRAM) were not significantly downregulated under crowding conditions. A transcriptomic analysis of inflorescence meristems showed Gene Ontology enriched pathways upregulated including Jasmonic and Abscisic acid synthesis and or signalling. Genes involved in auxin synthesis such as AmTAR2 and signalling AmANT were not affected by crowding. In contrast, AmJAZ1, AmMYB21, AmOPCL1 and AmABA2 were significantly upregulated. Our work provides a mechanistic working hypothesis where a robust SAM and stable auxin signalling enables a homogeneous floral size while changes in JA and ABA signalling maybe responsible for the decreased leaf size and floral number. PMID:26804132

  6. Meristem maintenance, auxin, jasmonic and abscisic acid pathways as a mechanism for phenotypic plasticity in Antirrhinum majus

    PubMed Central

    Weiss, Julia; Alcantud-Rodriguez, Raquel; Toksöz, Tugba; Egea-Cortines, Marcos


    Plants grow under climatic changing conditions that cause modifications in vegetative and reproductive development. The degree of changes in organ development i.e. its phenotypic plasticity seems to be determined by the organ identity and the type of environmental cue. We used intraspecific competition and found that Antirrhinum majus behaves as a decoupled species for lateral organ size and number. Crowding causes decreases in leaf size and increased leaf number whereas floral size is robust and floral number is reduced. Genes involved in shoot apical meristem maintenance like ROA and HIRZ, cell cycle (CYCD3a; CYCD3b, HISTONE H4) or organ polarity (GRAM) were not significantly downregulated under crowding conditions. A transcriptomic analysis of inflorescence meristems showed Gene Ontology enriched pathways upregulated including Jasmonic and Abscisic acid synthesis and or signalling. Genes involved in auxin synthesis such as AmTAR2 and signalling AmANT were not affected by crowding. In contrast, AmJAZ1, AmMYB21, AmOPCL1 and AmABA2 were significantly upregulated. Our work provides a mechanistic working hypothesis where a robust SAM and stable auxin signalling enables a homogeneous floral size while changes in JA and ABA signalling maybe responsible for the decreased leaf size and floral number. PMID:26804132

  7. The role of cholinergic anti-inflammatory pathway in acetic acid-induced colonic inflammation in the rat.


    Kolgazi, Meltem; Uslu, Unal; Yuksel, Meral; Velioglu-Ogunc, Ayliz; Ercan, Feriha; Alican, Inci


    The "cholinergic anti-inflammatory pathway" provides neurological modulation of cytokine synthesis to limit the magnitude of the immune response. This study aimed to evaluate the impact of the cholinergic anti-inflammatory pathway on the extent of tissue integrity, oxidant-antioxidant status and neutrophil infiltration to the inflamed organ in a rat model of acetic acid-induced colitis. Colitis was induced by intrarectal administration of 5% acetic acid (1ml) to Sprague-Dawley rats (200-250g; n=7-8 per group). Control group received an equal volume of saline intrarectally. The rats were treated with either nicotine (1mg/kg/day) or huperzine A (0.1mg/kg/day) intraperitoneally for 3 days. After decapitation, the distal colon was scored macroscopically and microscopically. Tissue samples were used for the measurement of malondialdehyde (MDA) and glutathione (GSH) levels, and myeloperoxidase (MPO) activity. Formation of reactive oxygen species was monitored by using chemiluminescence (CL). Nuclear factor (NF)-κB expression was evaluated in colonic samples via immunohistochemical analysis. Trunk blood was collected for the assessment of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-10, resistin and visfatin levels. Both nicotine and huperzine A reduced the extent of colonic lesions, increased colonic MDA level, high MPO activity and NF-κB expression in the colitis group. Elevation of serum IL-1β level due to colitis was also attenuated by both treatments. Additionally, huperzine A was effective to reverse colitis-induced high lucigenin-enhanced CL values and serum TNF-α levels. Colitis group revealed decreased serum visfatin levels compared to control group which was completely reversed by nicotine. In conclusion, modulation of the cholinergic system either by nicotine or ACh esterase inhibition improved acetic acid-induced colonic inflammation as confirmed by macroscopic and microscopic examination and biochemical assays. PMID:23810507

  8. Microalgae Synthesize Hydrocarbons from Long-Chain Fatty Acids via a Light-Dependent Pathway.


    Sorigué, Damien; Légeret, Bertrand; Cuiné, Stéphan; Morales, Pablo; Mirabella, Boris; Guédeney, Geneviève; Li-Beisson, Yonghua; Jetter, Reinhard; Peltier, Gilles; Beisson, Fred


    Microalgae are considered a promising platform for the production of lipid-based biofuels. While oil accumulation pathways are intensively researched, the possible existence of a microalgal pathways converting fatty acids into alka(e)nes has received little attention. Here, we provide evidence that such a pathway occurs in several microalgal species from the green and the red lineages. In Chlamydomonas reinhardtii (Chlorophyceae), a C17 alkene, n-heptadecene, was detected in the cell pellet and the headspace of liquid cultures. The Chlamydomonas alkene was identified as 7-heptadecene, an isomer likely formed by decarboxylation of cis-vaccenic acid. Accordingly, incubation of intact Chlamydomonas cells with per-deuterated D31-16:0 (palmitic) acid yielded D31-18:0 (stearic) acid, D29-18:1 (oleic and cis-vaccenic) acids, and D29-heptadecene. These findings showed that loss of the carboxyl group of a C18 monounsaturated fatty acid lead to heptadecene formation. Amount of 7-heptadecene varied with growth phase and temperature and was strictly dependent on light but was not affected by an inhibitor of photosystem II. Cell fractionation showed that approximately 80% of the alkene is localized in the chloroplast. Heptadecane, pentadecane, as well as 7- and 8-heptadecene were detected in Chlorella variabilis NC64A (Trebouxiophyceae) and several Nannochloropsis species (Eustigmatophyceae). In contrast, Ostreococcus tauri (Mamiellophyceae) and the diatom Phaeodactylum tricornutum produced C21 hexaene, without detectable C15-C19 hydrocarbons. Interestingly, no homologs of known hydrocarbon biosynthesis genes were found in the Nannochloropsis, Chlorella, or Chlamydomonas genomes. This work thus demonstrates that microalgae have the ability to convert C16 and C18 fatty acids into alka(e)nes by a new, light-dependent pathway. PMID:27288359

  9. White-to-brite conversion in human adipocytes promotes metabolic reprogramming towards fatty acid anabolic and catabolic pathways

    PubMed Central

    Barquissau, V.; Beuzelin, D.; Pisani, D.F.; Beranger, G.E.; Mairal, A.; Montagner, A.; Roussel, B.; Tavernier, G.; Marques, M.-A.; Moro, C.; Guillou, H.; Amri, E.-Z.; Langin, D.


    in PPARα-null mice displaying an impaired britening response. Conclusions Conversion of human white fat cells into brite adipocytes results in a major metabolic reprogramming inducing fatty acid anabolic and catabolic pathways. PDK4 redirects glucose from oxidation towards triglyceride synthesis and favors the use of fatty acids as energy source for uncoupling mitochondria. PMID:27110487

  10. Two Alternative Pathways for the Synthesis of the Rare Compatible Solute Mannosylglucosylglycerate in Petrotoga mobilis▿

    PubMed Central

    Fernandes, Chantal; Mendes, Vitor; Costa, Joana; Empadinhas, Nuno; Jorge, Carla; Lamosa, Pedro; Santos, Helena; da Costa, Milton S.


    The compatible solute mannosylglucosylglycerate (MGG), recently identified in Petrotoga miotherma, also accumulates in Petrotoga mobilis in response to hyperosmotic conditions and supraoptimal growth temperatures. Two functionally connected genes encoding a glucosyl-3-phosphoglycerate synthase (GpgS) and an unknown glycosyltransferase (gene Pmob_1143), which we functionally characterized as a mannosylglucosyl-3-phosphoglycerate synthase and designated MggA, were identified in the genome of Ptg. mobilis. This enzyme used the product of GpgS, glucosyl-3-phosphoglycerate (GPG), as well as GDP-mannose to produce mannosylglucosyl-3-phosphoglycerate (MGPG), the phosphorylated precursor of MGG. The MGPG dephosphorylation was determined in cell extracts, and the native enzyme was partially purified and characterized. Surprisingly, a gene encoding a putative glucosylglycerate synthase (Ggs) was also identified in the genome of Ptg. mobilis, and an active Ggs capable of producing glucosylglycerate (GG) from ADP-glucose and d-glycerate was detected in cell extracts and the recombinant enzyme was characterized, as well. Since GG has never been identified in this organism nor was it a substrate for the MggA, we anticipated the existence of a nonphosphorylating pathway for MGG synthesis. We putatively identified the corresponding gene, whose product had some sequence homology with MggA, but it was not possible to recombinantly express a functional enzyme from Ptg. mobilis, which we named mannosylglucosylglycerate synthase (MggS). In turn, a homologous gene from Thermotoga maritima was successfully expressed, and the synthesis of MGG was confirmed from GDP-mannose and GG. Based on the measurements of the relevant enzyme activities in cell extracts and on the functional characterization of the key enzymes, we propose two alternative pathways for the synthesis of the rare compatible solute MGG in Ptg. mobilis. PMID:20061481

  11. Upregulation of capacity for glutathione synthesis in response to amino acid deprivation: regulation of glutamate-cysteine ligase subunits.


    Sikalidis, Angelos K; Mazor, Kevin M; Lee, Jeong-In; Roman, Heather B; Hirschberger, Lawrence L; Stipanuk, Martha H


    Using HepG2/C3A cells and MEFs, we investigated whether induction of GSH synthesis in response to sulfur amino acid deficiency is mediated by the decrease in cysteine levels or whether it requires a decrease in GSH levels per se. Both the glutamate-cysteine ligase catalytic (GCLC) and modifier (GCLM) subunit mRNA levels were upregulated in response to a lack of cysteine or other essential amino acids, independent of GSH levels. This upregulation did not occur in MEFs lacking GCN2 (general control non-derepressible 2, also known as eIF2α kinase 4) or in cells expressing mutant eIF2α lacking the eIF2α kinase Ser(51) phosphorylation site, indicating that expression of both GCLC and GCLM was mediated by the GCN2/ATF4 stress response pathway. Only the increase in GCLM mRNA level, however, was accompanied by a parallel increase in protein expression, suggesting that the enhanced capacity for GSH synthesis depended largely on increased association of GCLC with its regulatory subunit. Upregulation of both GCLC and GLCM mRNA levels in response to cysteine deprivation was dependent on new protein synthesis, which is consistent with expression of GCLC and GCLM being mediated by proteins whose synthesis depends on activation of the GCN2/ATF4 pathway. Our data suggest that the regulation of GCLC expression may be mediated by changes in the abundance of transcriptional regulators, whereas the regulation of GCLM expression may be mediated by changes in the abundance of mRNA stabilizing or destabilizing proteins. Upregulation of GCLM levels in response to low cysteine levels may serve to protect the cell in the face of a future stress requiring GSH as an antioxidant or conjugating/detoxifying agent. PMID:24557597

  12. Upregulation of capacity for glutathione synthesis in response to amino acid deprivation: regulation of glutamate-cysteine ligase subunits

    PubMed Central

    Sikalidis, Angelos K.; Mazor, Kevin M.; Lee, Jeong-In; Roman, Heather B.; Hirschberger, Lawrence L.; Stipanuk, Martha H.


    Using HepG2/C3A cells and MEFs, we investigated whether induction of GSH synthesis in response to sulfur amino acid deficiency is mediated by the decrease in cysteine levels or whether it requires a decrease in GSH levels per se. Both the glutamate-cysteine ligase catalytic (GCLC) and modifier (GCLM) subunit mRNA levels were upregulated in response to a lack of cysteine or other essential amino acids, independent of GSH levels. This upregulation did not occur in MEFs lacking GCN2 (general control non-derepressible 2, also known as eIF2α kinase 4) or in cells expressing mutant eIF2α lacking the eIF2α kinase Ser51 phosphorylation site, indicating that expression of both GCLC and GCLM was mediated by the GCN2/ATF4 stress response pathway. Only the increase in GCLM mRNA level, however, was accompanied by a parallel increase in protein expression, suggesting that the enhanced capacity for GSH synthesis depended largely on increased association of GCLC with its regulatory subunit. Upregulation of both GCLC and GLCM mRNA levels in response to cysteine deprivation was dependent on new protein synthesis, which is consistent with expression of GCLC and GCLM being mediated by proteins whose synthesis depends on activation of the GCN2/ATF4 pathway. Our data suggest that the regulation of GCLC expression may be mediated by changes in the abundance of transcriptional regulators, whereas the regulation of GCLM expression may be mediated by changes in the abundance of mRNA stabilizing or destabilizing proteins. Upregulation of GCLM levels in response to low cysteine levels may serve to protect the cell in the face of a future stress requiring GSH as an antioxidant or conjugating/detoxifying agent. PMID:24557597

  13. Taurolithocholic acid promotes intrahepatic cholangiocarcinoma cell growth via muscarinic acetylcholine receptor and EGFR/ERK1/2 signaling pathway

    PubMed Central



    Cholangiocarcinoma (CCA) is a malignant cancer of the biliary tract and its occurrence is associated with chronic cholestasis which causes an elevation of bile acids in the liver and bile duct. The present study aimed to investigate the role and mechanistic effect of bile acids on the CCA cell growth. Intrahepatic CCA cell lines, RMCCA-1 and HuCCA-1, were treated with bile acids and their metabolites to determine the growth promoting effect. Cell viability, cell cycle analysis, EdU incorporation assays were conducted. Intracellular signaling proteins were detected by western immunoblotting. Among eleven forms of bile acids and their metabolites, only taurolithocholic acid (TLCA) concentration dependently (1–40 μM) increased the cell viability of RMCCA-1, but not HuCCA-1 cells. The cell cycle analysis showed induction of cells in the S phase and the EdU incorporation assay revealed induction of DNA synthesis in the TLCA-treated RMCCA-1 cells. Moreover, TLCA increased the phosphorylation of EGFR, ERK 1/2 and also increased the expression of cyclin D1 in RMCCA-1 cells. Furthermore, TLCA-induced RMCCA-1 cell growth could be inhibited by atropine, a non-selective muscarinic acetylcholine receptor (mAChR) antagonist, AG 1478, a specific EGFR inhibitor, or U 0126, a specific MEK 1/2 inhibitor. These results suggest that TLCA induces CCA cell growth via mAChR and EGFR/EKR1/2 signaling pathway. Moreover, the functional presence of cholinergic system plays a certain role in TLCA-induced CCA cell growth. PMID:25815516

  14. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress.


    Simón, María Victoria; Agnolazza, Daniela L; German, Olga Lorena; Garelli, Andrés; Politi, Luis E; Agbaga, Martin-Paul; Anderson, Robert E; Rotstein, Nora P


    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here, we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat and hydrogen peroxide (H2 O2 ). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in retina photoreceptors, and its precursor, eicosapentaenoic acid (EPA) have multiple beneficial effects. Here, we show that retina neurons in vitro express the desaturase FADS2 and can synthesize DHA from EPA. Moreover, addition of EPA to these cultures protects photoreceptors from oxidative stress and promotes their differentiation through its metabolization to DHA. PMID:26662863

  15. Analysis of porcine adipose tissue transcriptome reveals differences in de novo fatty acid synthesis in pigs with divergent muscle fatty acid composition

    PubMed Central


    Background In pigs, adipose tissue is one of the principal organs involved in the regulation of lipid metabolism. It is particularly involved in the overall fatty acid synthesis with consequences in other lipid-target organs such as muscles and the liver. With this in mind, we have used massive, parallel high-throughput sequencing technologies to characterize the porcine adipose tissue transcriptome architecture in six Iberian x Landrace crossbred pigs showing extreme phenotypes for intramuscular fatty acid composition (three per group). Results High-throughput RNA sequencing was used to generate a whole characterization of adipose tissue (backfat) transcriptome. A total of 4,130 putative unannotated protein-coding sequences were identified in the 20% of reads which mapped in intergenic regions. Furthermore, 36% of the unmapped reads were represented by interspersed repeats, SINEs being the most abundant elements. Differential expression analyses identified 396 candidate genes among divergent animals for intramuscular fatty acid composition. Sixty-two percent of these genes (247/396) presented higher expression in the group of pigs with higher content of intramuscular SFA and MUFA, while the remaining 149 showed higher expression in the group with higher content of PUFA. Pathway analysis related these genes to biological functions and canonical pathways controlling lipid and fatty acid metabolisms. In concordance with the phenotypic classification of animals, the major metabolic pathway differentially modulated between groups was de novo lipogenesis, the group with more PUFA being the one that showed lower expression of lipogenic genes. Conclusions These results will help in the identification of genetic variants at loci that affect fatty acid composition traits. The implications of these results range from the improvement of porcine meat quality traits to the application of the pig as an animal model of human metabolic diseases. PMID:24289474

  16. Bile acid promotes liver regeneration via farnesoid X receptor signaling pathways in rats.


    Ding, Long; Yang, Yu; Qu, Yikun; Yang, Ting; Wang, Kaifeng; Liu, Weixin; Xia, Weibin


    Bile acids, which are synthesized from cholesterol in the hepatocytes of the liver, are amphipathic molecules with a steroid backbone. Studies have shown that bile acid exhibits important effects on liver regeneration. However, the mechanism underlying these effects remains unclear. The aim of the present study was to investigate the effect of bile acid and the farnesoid X receptor (FXR) on hepatic regeneration and lipid metabolism. Rats were fed with 0.2% bile acid or glucose for 7 days and then subjected to a 50 or 70% hepatectomy. Hepatic regeneration rate, serum and liver levels of bile acid, and expression of FXR and Caveolin‑1, were detected at 24, 48 or 72 h following hepatectomy. The expression of proliferating cell nuclear antigen (PCNA) in the liver was measured using immunohistochemistry at the end of the study. Hepatocytes isolated from rats were treated with bile acid, glucose, FXR agonist and FXR antagonist, separately or in combination. Lipid metabolism, the expression of members of the FXR signaling pathway and energy metabolism‑related factors were measured using ELISA kits or western blotting. Bile acid significantly increased the hepatic regeneration rate and the expression of FXR, Caveolin‑1 and PCNA. Levels of total cholesterol and high density lipoprotein were increased in bile acid‑ or FXR agonist‑treated hepatocytes in vitro. Levels of triglyceride, low density lipoprotein and free fatty acid were decreased. In addition, bile acid and FXR agonists increased the expression of bile salt export pump and small heterodimer partner, and downregulated the expression of apical sodium‑dependent bile acid transporter, Na+/taurocholate cotransporting polypeptide and cholesterol 7α‑hydroxylase. These results suggested that physiological concentrations of bile acid may promote liver regeneration via FXR signaling pathways, and may be associated with energy metabolism. PMID:25634785

  17. Dihydrolipoic acid activates oligomycin-sensitive thiol groups and increases ATP synthesis in mitochondria.


    Zimmer, G; Mainka, L; Krüger, E


    Investigations with dihydrolipoic acid in rat heart mitochondria and mitoplasts reveal an activation of ATP-synthase up to 45%, whereas ATPase activities decrease by 36%. In parallel with an increase in ATP synthesis oligomycin-sensitive mitochondrial -SH groups are activated at 2-4 nmol dihydrolipoic acid/mg protein. ATPase activation by the uncouplers carbonylcyanide-p-trifluoromethoxyphenylhydrazone and oleate is diminished by dihydrolipoic acid, and ATP synthesis depressed by oleate is partially restored. No such efficiency of dihydrolipoic acid is seen with palmitate-induced ATPase activation or decrease of ATP synthesis. This indicates different interference of oleate and palmitate with mitochondria. In addition to its known coenzymatic properties dihydrolipoic acid may act as a substitute for coenzyme A, thereby diminishing the uncoupling efficiency of oleate. Furthermore, dihydrolipoic acid is a very potent antioxidant, shifting the -SH-S-S- equilibrium in mitochondria to the reduced state and improving the energetic state of cells. PMID:1832845

  18. Distribution of. delta. -aminolevulinic acid biosynthetic pathways among phototrophic and related bacteria

    SciTech Connect

    Avissar, Y.J.; Beale, S.I. ); Ormerod, J.G. )


    Two biosynthetic pathways are known for the universal tetrapyrrole precursor, {delta}-aminolevulinic acid (ALA): condensation of glycine and succinyl-CoA to form ALA with the loss of C-1 of glycine as CO{sub 2}, and conversion of the intact carbon skeleton of glutamate to ALA in a process requiring tRNA{sup Glu}, ATP, Mg{sup 2+}, NADPH, and pyridoxal phosphate. The distribution of the two ALA biosynthetic pathways among various bacterial genera was determined, using cell-free extracts obtained from representative organisms. Evidence for the operation of the glutamate pathway was obtained by the measurement of RNase-sensitive label incorporation from glutamate into ALA using 3,4-({sup 3}H)glutamate and 1-({sup 14}C)glutamate as substrate. The glycine pathway was indicated by RNase-insensitive incorporation of level from 2-({sup 14}C)glycine into ALA. The distribution of the two pathways among the bacteria tested was in general agreement with their previously phylogenetic relationships and clearly indicates that the glutamate pathway is the more ancient process, whereas the glycine pathway probably evolved much later. The glutamate pathway is the more widely utilized one among bacteria, while the glycine pathway is apparently limited to the {alpha} subgroup of purple bacteria (including Rhodobacter, Rhodospirillum, and Rhizobium). E. coli was found ALA via the glutamate pathway. The ALA-requiring hemA mutant of E. coli was determined to lack the dehydrogenase activity that utilizes glutamyl-tRNA as a substrate.

  19. Stromal uptake and transmission of acid is a pathway for venting cancer cell-generated acid.


    Hulikova, Alzbeta; Black, Nicholas; Hsia, Lin-Ting; Wilding, Jennifer; Bodmer, Walter F; Swietach, Pawel


    Proliferation and invasion of cancer cells require favorable pH, yet potentially toxic quantities of acid are produced metabolically. Membrane-bound transporters extrude acid from cancer cells, but little is known about the mechanisms that handle acid once it is released into the poorly perfused extracellular space. Here, we studied acid handling by myofibroblasts (colon cancer-derived Hs675.T, intestinal InMyoFib, embryonic colon-derived CCD-112-CoN), skin fibroblasts (NHDF-Ad), and colorectal cancer (CRC) cells (HCT116, HT29) grown in monoculture or coculture. Expression of the acid-loading transporter anion exchanger 2 (AE2) (SLC4A2 product) was detected in myofibroblasts and fibroblasts, but not in CRC cells. Compared with CRC cells, Hs675.T and InMyoFib myofibroblasts had very high capacity to absorb extracellular acid. Acid uptake into CCD-112-CoN and NHDF-Ad cells was slower and comparable to levels in CRC cells, but increased alongside SLC4A2 expression under stimulation with transforming growth factor β1 (TGFβ1), a cytokine involved in cancer-stroma interplay. Myofibroblasts and fibroblasts are connected by gap junctions formed by proteins such as connexin-43, which allows the absorbed acid load to be transmitted across the stromal syncytium. To match the stimulatory effect on acid uptake, cell-to-cell coupling in NHDF-Ad and CCD-112-CoN cells was strengthened with TGFβ1. In contrast, acid transmission was absent between CRC cells, even after treatment with TGFβ1. Thus, stromal cells have the necessary molecular apparatus for assembling an acid-venting route that can improve the flow of metabolic acid through tumors. Importantly, the activities of stromal AE2 and connexin-43 do not place an energetic burden on cancer cells, allowing resources to be diverted for other activities. PMID:27543333

  20. Ulvan, a sulfated polysaccharide from green algae, activates plant immunity through the jasmonic acid signaling pathway.


    Jaulneau, Valérie; Lafitte, Claude; Jacquet, Christophe; Fournier, Sylvie; Salamagne, Sylvie; Briand, Xavier; Esquerré-Tugayé, Marie-Thérèse; Dumas, Bernard


    The industrial use of elicitors as alternative tools for disease control needs the identification of abundant sources of them. We report on an elicitor obtained from the green algae Ulva spp. A fraction containing most exclusively the sulfated polysaccharide known as ulvan-induced expression of a GUS gene placed under the control of a lipoxygenase gene promoter. Gene expression profiling was performed upon ulvan treatments on Medicago truncatula and compared to phytohormone effects. Ulvan induced a gene expression signature similar to that observed upon methyl jasmonate treatment (MeJA). Involvement of jasmonic acid (JA) in ulvan response was confirmed by detecting induction of protease inhibitory activity and by hormonal profiling of JA, salicylic acid (SA) and abscisic acid (ABA). Ulvan activity on the hormonal pathway was further consolidated by using Arabidopsis hormonal mutants. Altogether, our results demonstrate that green algae are a potential reservoir of ulvan elicitor which acts through the JA pathway. PMID:20445752

  1. Biosynthetic pathway for acrylic acid from glycerol in recombinant Escherichia coli.


    Tong, Wenhua; Xu, Ying; Xian, Mo; Niu, Wei; Guo, Jiantao; Liu, Huizhou; Zhao, Guang


    Acrylic acid is an important industrial feedstock. In this study, a de novo acrylate biosynthetic pathway from inexpensive carbon source glycerol was constructed in Escherichia coli. The acrylic acid was produced from glycerol via 3-hydroxypropionaldehyde, 3-hydroxypropionyl-CoA, and acrylyl-CoA. The acrylate production was improved by screening and site-directed mutagenesis of key enzyme enoyl-CoA hydratase and chromosomal integration of some exogenous genes. Finally, our recombinant strain produced 37.7 mg/L acrylic acid under shaking flask conditions. Although the acrylate production is low, our study shows feasibility of engineering an acrylate biosynthetic pathway from inexpensive carbon source. Furthermore, the reasons for limited acrylate production and further strain optimization that should be performed in the future were also discussed. PMID:26782744

  2. Ulvan, a Sulfated Polysaccharide from Green Algae, Activates Plant Immunity through the Jasmonic Acid Signaling Pathway

    PubMed Central

    Jaulneau, Valérie; Lafitte, Claude; Jacquet, Christophe; Fournier, Sylvie; Salamagne, Sylvie; Briand, Xavier; Esquerré-Tugayé, Marie-Thérèse; Dumas, Bernard


    The industrial use of elicitors as alternative tools for disease control needs the identification of abundant sources of them. We report on an elicitor obtained from the green algae Ulva spp. A fraction containing most exclusively the sulfated polysaccharide known as ulvan-induced expression of a GUS gene placed under the control of a lipoxygenase gene promoter. Gene expression profiling was performed upon ulvan treatments on Medicago truncatula and compared to phytohormone effects. Ulvan induced a gene expression signature similar to that observed upon methyl jasmonate treatment (MeJA). Involvement of jasmonic acid (JA) in ulvan response was confirmed by detecting induction of protease inhibitory activity and by hormonal profiling of JA, salicylic acid (SA) and abscisic acid (ABA). Ulvan activity on the hormonal pathway was further consolidated by using Arabidopsis hormonal mutants. Altogether, our results demonstrate that green algae are a potential reservoir of ulvan elicitor which acts through the JA pathway. PMID:20445752

  3. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong


    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  4. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  5. An Alkyne Diboration/6π-Electrocyclization Strategy for the Synthesis of Pyridine Boronic Acid Derivatives.


    Mora-Radó, Helena; Bialy, Laurent; Czechtizky, Werngard; Méndez, María; Harrity, Joseph P A


    A new and efficient synthesis of pyridine-based heteroaromatic boronic acid derivatives is reported through a novel diboration/6π-electrocyclization strategy. This method delivers a range of functionalized heterocycles from readily available starting materials. PMID:27059895

  6. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.


    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  7. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.


    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  8. Protein Analysis of Sapienic Acid-Treated Porphyromonas gingivalis Suggests Differential Regulation of Multiple Metabolic Pathways

    PubMed Central

    Dawson, Deborah V.; Blanchette, Derek R.; Drake, David R.; Wertz, Philip W.; Brogden, Kim A.


    ABSTRACT Lipids endogenous to skin and mucosal surfaces exhibit potent antimicrobial activity against Porphyromonas gingivalis, an important colonizer of the oral cavity implicated in periodontitis. Our previous work demonstrated the antimicrobial activity of the fatty acid sapienic acid (C16:1Δ6) against P. gingivalis and found that sapienic acid treatment alters both protein and lipid composition from those in controls. In this study, we further examined whole-cell protein differences between sapienic acid-treated bacteria and untreated controls, and we utilized open-source functional association and annotation programs to explore potential mechanisms for the antimicrobial activity of sapienic acid. Our analyses indicated that sapienic acid treatment induces a unique stress response in P. gingivalis resulting in differential expression of proteins involved in a variety of metabolic pathways. This network of differentially regulated proteins was enriched in protein-protein interactions (P = 2.98 × 10−8), including six KEGG pathways (P value ranges, 2.30 × 10−5 to 0.05) and four Gene Ontology (GO) molecular functions (P value ranges, 0.02 to 0.04), with multiple suggestive enriched relationships in KEGG pathways and GO molecular functions. Upregulated metabolic pathways suggest increases in energy production, lipid metabolism, iron acquisition and processing, and respiration. Combined with a suggested preferential metabolism of serine, which is necessary for fatty acid biosynthesis, these data support our previous findings that the site of sapienic acid antimicrobial activity is likely at the bacterial membrane. IMPORTANCE P. gingivalis is an important opportunistic pathogen implicated in periodontitis. Affecting nearly 50% of the population, periodontitis is treatable, but the resulting damage is irreversible and eventually progresses to tooth loss. There is a great need for natural products that can be used to treat and/or prevent the overgrowth of

  9. An ancient pathway combining carbon dioxide fixation with the generation and utilization of a sodium ion gradient for ATP synthesis.


    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K; Gottschalk, Gerhard; Müller, Volker


    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  10. An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis

    PubMed Central

    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker


    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  11. Periexercise coingestion of branched-chain amino acids and carbohydrate in men does not preferentially augment resistance exercise-induced increases in phosphatidylinositol 3 kinase/protein kinase B-mammalian target of rapamycin pathway markers indicative of muscle protein synthesis.


    Ferreira, Maria Pontes; Li, Rui; Cooke, Matthew; Kreider, Richard B; Willoughby, Darryn S


    The effects of a single bout of resistance exercise (RE) in conjunction with periexercise branched-chain amino acid (BCAA) and carbohydrate (CHO) ingestion on skeletal muscle signaling markers indicative of muscle protein synthesis were determined. It was hypothesized that CHO + BCAA would elicit a more profound effect on these signaling markers compared with CHO. Twenty-seven males were randomly assigned to CHO, CHO + BCAA, or placebo (PLC) groups. Four sets of leg presses and leg extensions were performed at 80% 1 repetition maximum. Supplements were ingested 30 minutes and immediately before and after RE. Venous blood and muscle biopsy samples were obtained immediately before supplement ingestion and 0.5, 2, and 6 hours after RE. Serum insulin and glucose and phosphorylated levels of muscle insulin receptor substrate 1 (IRS-1), protein kinase B, mammalian target of rapamycin, phosphorylated 70S6 kinase, and 4E binding protein 1 were assessed. Data were analyzed by 2-way repeated-measures analysis of variance. Significant group × time interactions were observed for glucose and insulin (P < .05) showing that CHO and CHO + BCAA were significantly greater than PLC. Significant time main effects were observed for IRS-1 (P = .001), protein kinase B (P = .031), mammalian target of rapamycin (P = .003), and phosphorylated 70S6 kinase (P = .001). Carbohydrate and CHO + BCAA supplementation significantly increased IRS-1 compared with PLC (P = .002). However, periexercise coingestion of CHO and BCAA did not augment RE-induced increases in skeletal muscle signaling markers indicative of muscle protein synthesis when compared with CHO. PMID:24655485

  12. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.


    Snowden, Roger L


    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed. PMID:18618391

  13. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.


    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  14. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  15. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.


    Adhikari, Neil D; Bates, Philip D; Browse, John


    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  16. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John


    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  17. Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.


    Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang


    Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. PMID:25605585

  18. The Aldo-Keto Reductase AKR1B10 Is Up-Regulated in Keloid Epidermis, Implicating Retinoic Acid Pathway Dysregulation in the Pathogenesis of Keloid Disease.


    Jumper, Natalie; Hodgkinson, Tom; Arscott, Guyan; Har-Shai, Yaron; Paus, Ralf; Bayat, Ardeshir


    Keloid disease is a recurrent fibroproliferative cutaneous tumor of unknown pathogenesis for which clinical management remains unsatisfactory. To obtain new insights into hitherto underappreciated aspects of keloid pathobiology, we took a laser capture microdissection-based, whole-genome microarray analysis approach to identify distinct keloid disease-associated gene expression patterns within defined keloid regions. Identification of the aldo-keto reductase enzyme AKR1B10 as highly up-regulated in keloid epidermis suggested that an imbalance of retinoic acid metabolism is likely associated with keloid disease. Here, we show that AKR1B10 transfection into normal human keratinocytes reproduced the abnormal retinoic acid pathway expression pattern we had identified in keloid epidermis. Cotransfection of AKR1B10 with a luciferase reporter plasmid showed reduced retinoic acid response element activity, supporting the hypothesis of retinoic acid synthesis deficiency in keloid epidermis. Paracrine signals released by AKR1B10-overexpressing keratinocytes into conditioned medium resulted in up-regulation of transforming growth factor-β1, transforming growth factor-β2, and collagens I and III in both keloid and normal skin fibroblasts, mimicking the typical profibrotic keloid profile. Our study results suggest that insufficient retinoic acid synthesis by keloid epidermal keratinocytes may contribute to the pathogenesis of keloid disease. We refocus attention on the role of injured epithelium in keloid disease and identify AKR1B10 as a potential new target in future management of keloid disease. PMID:27025872

  19. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa


    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  20. Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

    SciTech Connect

    Standaert, Robert F; Park, Dr Seung Bum


    Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

  1. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng


    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  2. Respiratory CO(2) as Carbon Source for Nocturnal Acid Synthesis at High Temperatures in Three Species Exhibiting Crassulacean Acid Metabolism.


    Winter, K; Schröppel-Meier, G; Caldwell, M M


    TEMPERATURE EFFECTS ON NOCTURNAL CARBON GAIN AND NOCTURNAL ACID ACCUMULATION WERE STUDIED IN THREE SPECIES OF PLANTS EXHIBITING CRASSULACEAN ACID METABOLISM: Mamillaria woodsii, Opuntia vulgaris, and Kalanchoë daigremontiana. Under conditions of high soil moisture, nocturnal CO(2) gain and acid accumulation had temperature optima at 15 to 20 degrees C. Between 5 and 15 degrees C, uptake of atmospheric CO(2) largely accounted for acid accumulation. At higher tissue temperatures, acid accumulation exceeded net carbon gain indicating that acid synthesis was partly due to recycling of respiratory CO(2). When plants were kept in CO(2)-free air, acid accumulation based on respiratory CO(2) was highest at 25 to 35 degrees C. Net acid synthesis occurred up to 45 degrees C, although the nocturnal carbon balance became largely negative above 25 to 35 degrees C. Under conditions of water stress, net CO(2) exchange and nocturnal acid accumulation were reduced. Acid accumulation was proportionally more decreased at low than at high temperatures. Acid accumulation was either similar over the whole temperature range (5-45 degrees C) or showed an optimum at high temperatures, although net carbon balance became very negative with increasing tissue temperatures. Conservation of carbon by recycling respiratory CO(2) was temperature dependent. At 30 degrees C, about 80% of the dark respiratory CO(2) was conserved by dark CO(2) fixation, in both well irrigated and water stressed plants. PMID:16664827

  3. BDNF-mediated regulation of ethanol consumption requires the activation of the MAP kinase pathway and protein synthesis

    PubMed Central

    Jeanblanc, Jerome; Logrip, Marian L.; Janak, Patricia H.; Ron, Dorit


    We previously found that the brain-derived neurotrophic factor (BDNF) in the dorsolateral striatum (DLS) is part of a homeostatic pathway that gates ethanol self-administration [Jeanblanc et al. (2009). J Neurosci, 29, 13494–13502)]. Specifically, we showed that moderate levels (10%) of ethanol consumption increase BDNF expression within the DLS, and that direct infusion of BDNF into the DLS decreases operant self-administration of a 10% ethanol solution. BDNF binding to its receptor, TrkB, activates the mitogen-activated protein kinase (MAPK), phospholipase C-γ (PLC-γ) and phosphatidylinositol 3-kinase (PI3K) pathways. Thus, here, we set out to identify which of these intracellular pathway(s) plays a role in the regulation of ethanol consumption by BDNF. We found that inhibition of the MAPK, but not PLC-γ or PI3K, activity blocks the BDNF-mediated reduction of ethanol consumption. As activation of the MAPK pathway leads to the initiation of transcription and/or translation events, we tested whether the BDNF-mediated reduction of ethanol self-administration requires de novo protein synthesis. We found that the inhibitory effect of BDNF on ethanol intake is blocked by the protein synthesis inhibitor cycloheximide. Together, our results show that BDNF attenuates ethanol drinking via activation of the MAPK pathway in a protein synthesis-dependent manner within the DLS. PMID:23189980

  4. Distinct amino acid-sensing mTOR pathways regulate skeletal myogenesis.


    Yoon, Mee-Sup; Chen, Jie


    Signaling through the mammalian target of rapamycin (mTOR) in response to amino acid availability controls many cellular and developmental processes. mTOR is a master regulator of myogenic differentiation, but the pathways mediating amino acid signals in this process are not known. Here we examine the Rag GTPases and the class III phosphoinositide 3-kinase (PI3K) Vps34, two mediators of amino acid signals upstream of mTOR complex 1 (mTORC1) in cell growth regulation, for their potential involvement in myogenesis. We find that, although both Rag and Vps34 mediate amino acid activation of mTORC1 in C2C12 myoblasts, they have opposing functions in myogenic differentiation. Knockdown of RagA/B enhances, whereas overexpression of active RagB/C mutants impairs, differentiation, and this inhibitory function of Rag is mediated by mTORC1 suppression of the IRS1-PI3K-Akt pathway. On the other hand, Vps34 is required for myogenic differentiation. Amino acids activate a Vps34-phospholipase D1 (PLD1) pathway that controls the production of insulin-like growth factor II, an autocrine inducer of differentiation, through the Igf2 muscle enhancer. The product of PLD, phosphatidic acid, activates the enhancer in a rapamycin-sensitive but mTOR kinase-independent manner. Our results uncover amino acid-sensing mechanisms controlling the homeostasis of myogenesis and underline the versatility and context dependence of mTOR signaling. PMID:24068326

  5. Specific action of the lipoxygenase pathway in mediating angiotensin II-induced aldosterone synthesis in isolated adrenal glomerulosa cells.

    PubMed Central

    Nadler, J L; Natarajan, R; Stern, N


    Angiotensin II (AII) in adrenal glomerulosa cells activates phospholipase C resulting in the formation of inositol phosphates and diacylglycerol rich in arachidonic acid (AA). Although glomerulosa cells can metabolize AA via cyclooxygenase (CO), this pathway plays little role in aldosterone synthesis. Recent evidence suggests that the lipoxygenase (LO) pathway may be important for hormonal secretion in endocrine tissues such as the islet of Langerhans. However, the capacity of the glomerulosa cell to synthesize LO products and their role in aldosterone secretion is not known. To study this, the effect of nonselective and selective LO inhibitors on AII, ACTH, and potassium-induced aldosterone secretion and LO product formation was evaluated in isolated rat glomerulosa cells. BW755c, a nonselective LO inhibitor dose dependently reduced the AII-stimulated level of aldosterone without altering AII binding (91 +/- 6 to 36 +/- 4 ng/10(6) cells/h 10(-4) M, P less than 0.001). The same effect was observed with another nonselective LO blocker, phenidone, and a more selective 12-LO inhibitor, Baicalein. In contrast U-60257, a selective 5-LO inhibitor did not change the AII-stimulated levels of aldosterone (208 +/- 11% control, AII 10(-9) M vs. 222 +/- 38%, AII + U-60257). The LO blockers action was specific for AII since neither BW755c nor phenidone altered ACTH or K+-induced aldosterone secretion. AII stimulated the formation of the 12-LO product 12-hydroxyeicosatetraenoic acid (12-HETE) as measured by ultraviolet detection and HPLC in AA loaded cells and by a specific RIA in unlabeled cells (501 +/- 50 to 990 +/- 10 pg/10(5) cells, P less than 0.02). BW755c prevented the AII-mediated rise in 12-HETE formation. In contrast, neither ACTH nor K+ increased 12-HETE levels. The addition of 12-HETE or its unstable precursor 12-HPETE (10(-9) or 10(-8) M) completely restored AII action during LO blockade. AII also produced an increase in 15-HETE formation, but the 15-LO products

  6. A diet-sensitive BAF60a-mediated pathway links hepatic bile acid metabolism to cholesterol absorption and atherosclerosis

    PubMed Central

    Meng, Zhuo-Xian; Wang, Lin; Chang, Lin; Sun, Jingxia; Bao, Jiangyin; Li, Yaqiang; Chen, Y. Eugene; Lin, Jiandie D.


    Summary Dietary nutrients interact with gene networks to orchestrate adaptive responses during metabolic stress. Here we identify Baf60a as a diet-sensitive subunit of the SWI/SNF chromatin-remodeling complexes in the mouse liver that links the consumption of fat- and cholesterol-rich diet to elevated plasma cholesterol levels. Baf60a expression was elevated in the liver following feeding with a western diet. Hepatocyte-specific inactivation of Baf60a reduced bile acid production and cholesterol absorption, and attenuated diet-induced hypercholesterolemia and atherosclerosis in mice. Baf60a stimulates expression of genes involved in bile acid synthesis, modification, and transport through a CAR/Baf60a feedforward regulatory loop. Baf60a is required for the recruitment of the SWI/SNF chromatin-remodeling complexes to facilitate an activating epigenetic switch on target genes. These studies elucidate a regulatory pathway that mediates the hyperlipidemic and atherogenic effects of western diet consumption. PMID:26586440

  7. A Diet-Sensitive BAF60a-Mediated Pathway Links Hepatic Bile Acid Metabolism to Cholesterol Absorption and Atherosclerosis.


    Meng, Zhuo-Xian; Wang, Lin; Chang, Lin; Sun, Jingxia; Bao, Jiangyin; Li, Yaqiang; Chen, Y Eugene; Lin, Jiandie D


    Dietary nutrients interact with gene networks to orchestrate adaptive responses during metabolic stress. Here, we identify Baf60a as a diet-sensitive subunit of the SWI/SNF chromatin-remodeling complexes in the mouse liver that links the consumption of fat- and cholesterol-rich diet to elevated plasma cholesterol levels. Baf60a expression was elevated in the liver following feeding with a western diet. Hepatocyte-specific inactivation of Baf60a reduced bile acid production and cholesterol absorption, and attenuated diet-induced hypercholesterolemia and atherosclerosis in mice. Baf60a stimulates expression of genes involved in bile acid synthesis, modification, and transport through a CAR/Baf60a feedforward regulatory loop. Baf60a is required for the recruitment of the SWI/SNF chromatin-remodeling complexes to facilitate an activating epigenetic switch on target genes. These studies elucidate a regulatory pathway that mediates the hyperlipidemic and atherogenic effects of western diet consumption. PMID:26586440

  8. Structure and functional characterization of a bile acid 7α dehydratase BaiE in secondary bile acid synthesis.


    Bhowmik, Shiva; Chiu, Hsien-Po; Jones, David H; Chiu, Hsiu-Ju; Miller, Mitchell D; Xu, Qingping; Farr, Carol L; Ridlon, Jason M; Wells, James E; Elsliger, Marc-André; Wilson, Ian A; Hylemon, Phillip B; Lesley, Scott A


    Conversion of the primary bile acids cholic acid (CA) and chenodeoxycholic acid (CDCA) to the secondary bile acids deoxycholic acid (DCA) and lithocholic acid (LCA) is performed by a few species of intestinal bacteria in the genus Clostridium through a multistep biochemical pathway that removes a 7α-hydroxyl group. The rate-determining enzyme in this pathway is bile acid 7α-dehydratase (baiE). In this study, crystal structures of apo-BaiE and its putative product-bound [3-oxo-Δ(4,6) -lithocholyl-Coenzyme A (CoA)] complex are reported. BaiE is a trimer with a twisted α + β barrel fold with similarity to the Nuclear Transport Factor 2 (NTF2) superfamily. Tyr30, Asp35, and His83 form a catalytic triad that is conserved across this family. Site-directed mutagenesis of BaiE from Clostridium scindens VPI 12708 confirm that these residues are essential for catalysis and also the importance of other conserved residues, Tyr54 and Arg146, which are involved in substrate binding and affect catalytic turnover. Steady-state kinetic studies reveal that the BaiE homologs are able to turn over 3-oxo-Δ(4) -bile acid and CoA-conjugated 3-oxo-Δ(4) -bile acid substrates with comparable efficiency questioning the role of CoA-conjugation in the bile acid metabolism pathway. PMID:26650892

  9. Occurrence of Arginine Deiminase Pathway Enzymes in Arginine Catabolism by Wine Lactic Acid Bacteria

    PubMed Central

    Liu, S.; Pritchard, G. G.; Hardman, M. J.; Pilone, G. J.


    l-Arginine, an amino acid found in significant quantities in grape juice and wine, is known to be catabolized by some wine lactic acid bacteria. The correlation between the occurrence of arginine deiminase pathway enzymes and the ability to catabolize arginine was examined in this study. The activities of the three arginine deiminase pathway enzymes, arginine deiminase, ornithine transcarbamylase, and carbamate kinase, were measured in cell extracts of 35 strains of wine lactic acid bacteria. These enzymes were present in all heterofermentative lactobacilli and most leuconostocs but were absent in all the homofermentative lactobacilli and pediococci examined. There was a good correlation among arginine degradation, formation of ammonia and citrulline, and the occurrence of arginine deiminase pathway enzymes. Urea was not detected during arginine degradation, suggesting that the catabolism of arginine did not proceed via the arginase-catalyzed reaction, as has been suggested in some earlier studies. Detection of ammonia with Nessler's reagent was shown to be a simple, rapid test to assess the ability of wine lactic acid bacteria to degrade arginine, although in media containing relatively high concentrations (>0.5%) of fructose, ammonia formation is inhibited. PMID:16534912

  10. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.


    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  11. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis.


    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing


    N-Acetylneuraminic acid lyase (NAL, E.C. number is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a "GRAS" (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  12. Hexanoic acid is a resistance inducer that protects tomato plants against Pseudomonas syringae by priming the jasmonic acid and salicylic acid pathways.


    Scalschi, Loredana; Vicedo, Begonya; Camañes, Gemma; Fernandez-Crespo, Emma; Lapeña, Leonor; González-Bosch, Carmen; García-Agustín, Pilar


    Hexanoic acid-induced resistance (Hx-IR) is effective against several pathogens in tomato plants. Our study of the mechanisms implicated in Hx-IR against Pseudomonas syringae pv. tomato DC3000 suggests that hexanoic acid (Hx) treatment counteracts the negative effect of coronatine (COR) and jasmonyl-isoleucine (JA-Ile) on the salicylic acid (SA) pathway. In Hx-treated plants, an increase in the expression of jasmonic acid carboxyl methyltransferase (JMT) and the SA marker genes PR1 and PR5 indicates a boost in this signalling pathway at the expense of a decrease in JA-Ile. Moreover, Hx treatment potentiates 12-oxo-phytodienoic acid accumulation, which suggests that this molecule might play a role per se in Hx-IR. These results support a positive relationship between the SA and JA pathways in Hx-primed plants. Furthermore, one of the mechanisms of virulence mediated by COR is stomatal re-opening on infection with P. syringae. In this work, we observed that Hx seems to inhibit stomatal opening in planta in the presence of COR, which suggests that, on infection in tomato, this treatment suppresses effector action to prevent bacterial entry into the mesophyll. PMID:23279078

  13. Simultaneous synthesis of 2-phenylethanol and L-homophenylalanine using aromatic transaminase with yeast Ehrlich pathway.


    Hwang, Joon-Young; Park, Jihyang; Seo, Joo-Hyun; Cha, Minho; Cho, Byung-Kwan; Kim, Juhan; Kim, Byung-Gee


    2-Phenylethanol is a widely used aroma compound with rose-like fragrance and L-homophenylalanine is a building block of angiotensin-converting enzyme (ACE) inhibitor. 2-phenylethanol and L-homophenylalanine were synthesized simultaneously with high yield from 2-oxo-4-phenylbutyric acid and L-phenylalanine, respectively. A recombinant Escherichia coli harboring a coupled reaction pathway comprising of aromatic transaminase, phenylpyruvate decarboxylase, carbonyl reductase, and glucose dehydrogenase (GDH) was constructed. In the coupled reaction pathway, the transaminase reaction was coupled with the Ehrlich pathway of yeast; (1) a phenylpyruvate decarboxylase (YDR380W) as the enzyme to generate the substrate for the carbonyl reductase from phenylpyruvate (i.e., byproduct of the transaminase reaction) and to shift the reaction equilibrium of the transaminase reaction, and (2) a carbonyl reductase (YGL157W) to produce the 2-phenylethanol. Selecting the right carbonyl reductase showing the highest activity on phenylacetaldehyde with narrow substrate specificity was the key to success of the constructing the coupling reaction. In addition, NADPH regeneration was achieved by incorporating the GDH from Bacillus subtilis in the coupled reaction pathway. Based on 40 mM of L-phenylalanine used, about 96% final product conversion yield of 2-phenylethanol was achieved using the recombinant E. coli. PMID:19016485

  14. Design, synthesis and evaluation of semi-synthetic triazole-containing caffeic acid analogues as 5-lipoxygenase inhibitors.


    De Lucia, Daniela; Lucio, Oscar Méndez; Musio, Biagia; Bender, Andreas; Listing, Monika; Dennhardt, Sophie; Koeberle, Andreas; Garscha, Ulrike; Rizzo, Roberta; Manfredini, Stefano; Werz, Oliver; Ley, Steven V


    In this work the synthesis, structure-activity relationship (SAR) and biological evaluation of a novel series of triazole-containing 5-lipoxygenase (5-LO) inhibitors are described. The use of structure-guided drug design techniques provided compounds that demonstrated excellent 5-LO inhibition with IC50 of 0.2 and 3.2 μm in cell-based and cell-free assays, respectively. Optimization of binding and functional potencies resulted in the identification of compound 13d, which showed an enhanced activity compared to the parent bioactive compound caffeic acid 5 and the clinically approved zileuton 3. Compounds 15 and 16 were identified as lead compounds in inhibiting 5-LO products formation in neutrophils. Their interference with other targets on the arachidonic acid pathway was also assessed. Cytotoxicity tests were performed to exclude a relationship between cytotoxicity and the increased activity observed after structure optimization. PMID:26197161

  15. Transcriptome analysis of bitter acid biosynthesis and precursor pathways in hop (Humulus lupulus)

    PubMed Central


    Background Bitter acids (e.g. humulone) are prenylated polyketides synthesized in lupulin glands of the hop plant (Humulus lupulus) which are important contributors to the bitter flavour and stability of beer. Bitter acids are formed from acyl-CoA precursors derived from branched-chain amino acid (BCAA) degradation and C5 prenyl diphosphates from the methyl-D-erythritol 4-phosphate (MEP) pathway. We used RNA sequencing (RNA-seq) to obtain the transcriptomes of isolated lupulin glands, cones with glands removed and leaves from high α-acid hop cultivars, and analyzed these datasets for genes involved in bitter acid biosynthesis including the supply of major precursors. We also measured the levels of BCAAs, acyl-CoA intermediates, and bitter acids in glands, cones and leaves. Results Transcripts encoding all the enzymes of BCAA metabolism were significantly more abundant in lupulin glands, indicating that BCAA biosynthesis and subsequent degradation occurs in these specialized cells. Branched-chain acyl-CoAs and bitter acids were present at higher levels in glands compared with leaves and cones. RNA-seq analysis showed the gland-specific expression of the MEP pathway, enzymes of sucrose degradation and several transcription factors that may regulate bitter acid biosynthesis in glands. Two branched-chain aminotransferase (BCAT) enzymes, HlBCAT1 and HlBCAT2, were abundant, with gene expression quantification by RNA-seq and qRT-PCR indicating that HlBCAT1 was specific to glands while HlBCAT2 was present in glands, cones and leaves. Recombinant HlBCAT1 and HlBCAT2 catalyzed forward (biosynthetic) and reverse (catabolic) reactions with similar kinetic parameters. HlBCAT1 is targeted to mitochondria where it likely plays a role in BCAA catabolism. HlBCAT2 is a plastidial enzyme likely involved in BCAA biosynthesis. Phylogenetic analysis of the hop BCATs and those from other plants showed that they group into distinct biosynthetic (plastidial) and catabolic (mitochondrial

  16. Stimulation of the Salicylic Acid Pathway Aboveground Recruits Entomopathogenic Nematodes Belowground.


    Filgueiras, Camila Cramer; Willett, Denis S; Junior, Alcides Moino; Pareja, Martin; Borai, Fahiem El; Dickson, Donald W; Stelinski, Lukasz L; Duncan, Larry W


    Plant defense pathways play a critical role in mediating tritrophic interactions between plants, herbivores, and natural enemies. While the impact of plant defense pathway stimulation on natural enemies has been extensively explored aboveground, belowground ramifications of plant defense pathway stimulation are equally important in regulating subterranean pests and still require more attention. Here we investigate the effect of aboveground stimulation of the salicylic acid pathway through foliar application of the elicitor methyl salicylate on belowground recruitment of the entomopathogenic nematode, Steinernema diaprepesi. Also, we implicate a specific root-derived volatile that attracts S. diaprepesi belowground following aboveground plant stimulation by an elicitor. In four-choice olfactometer assays, citrus plants treated with foliar applications of methyl salicylate recruited S. diaprepesi in the absence of weevil feeding as compared with negative controls. Additionally, analysis of root volatile profiles of citrus plants receiving foliar application of methyl salicylate revealed production of d-limonene, which was absent in negative controls. The entomopathogenic nematode S. diaprepesi was recruited to d-limonene in two-choice olfactometer trials. These results reinforce the critical role of plant defense pathways in mediating tritrophic interactions, suggest a broad role for plant defense pathway signaling belowground, and hint at sophisticated plant responses to pest complexes. PMID:27136916

  17. Stimulation of the Salicylic Acid Pathway Aboveground Recruits Entomopathogenic Nematodes Belowground

    PubMed Central

    Filgueiras, Camila Cramer; Willett, Denis S.; Junior, Alcides Moino; Pareja, Martin; Borai, Fahiem El; Dickson, Donald W.; Stelinski, Lukasz L.; Duncan, Larry W.


    Plant defense pathways play a critical role in mediating tritrophic interactions between plants, herbivores, and natural enemies. While the impact of plant defense pathway stimulation on natural enemies has been extensively explored aboveground, belowground ramifications of plant defense pathway stimulation are equally important in regulating subterranean pests and still require more attention. Here we investigate the effect of aboveground stimulation of the salicylic acid pathway through foliar application of the elicitor methyl salicylate on belowground recruitment of the entomopathogenic nematode, Steinernema diaprepesi. Also, we implicate a specific root-derived volatile that attracts S. diaprepesi belowground following aboveground plant stimulation by an elicitor. In four-choice olfactometer assays, citrus plants treated with foliar applications of methyl salicylate recruited S. diaprepesi in the absence of weevil feeding as compared with negative controls. Additionally, analysis of root volatile profiles of citrus plants receiving foliar application of methyl salicylate revealed production of d-limonene, which was absent in negative controls. The entomopathogenic nematode S. diaprepesi was recruited to d-limonene in two-choice olfactometer trials. These results reinforce the critical role of plant defense pathways in mediating tritrophic interactions, suggest a broad role for plant defense pathway signaling belowground, and hint at sophisticated plant responses to pest complexes. PMID:27136916

  18. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  19. Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

    PubMed Central


    Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD) 2 and fatty acid elongase (FAE) 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general development of C. sativa should

  20. Impact of high altitude on the hepatic fatty acid oxidation and synthesis in rats

    SciTech Connect

    Ni, Qian; Shao, Yuan; Wang, Ying Zhen; Jing, Yu Hong; Zhang, You Cheng


    Highlights: • Acute exposure to high altitude (HA) increased hepatic fatty acid (FA) β-oxidation. • Acute exposure of rats to HA increased hepatic FA synthesis. • PPARα and AMPK can regulate the FA metabolism. • FA may be a key energy fuel and a compensation for CHO during acute exposure to HA. • The acute changes of FA metabolism may be a mechanism of acclimatization. - Abstract: High altitude (HA) affects energy metabolism. The impact of acute and chronic HA acclimatization on the major metabolic pathways is still controversial. In this study, we aimed to unveil the impact of HA on the key enzymes involved in the fatty acid (FA) metabolism in liver. Rats were exposed to an altitude of 4300 m for 30 days and the expressions of two key proteins involved in FA β-oxidation (carnitine palmitoyl transferase I, CPT-I; and peroxisome proliferator-activated receptor alpha, PPARα), two proteins involved in FA synthesis (acetyl CoA carboxylase-1, ACC-1; and AMP-activated protein kinase, AMPK), as well as the total ketone body in the liver and the plasma FFAs were examined. Rats without HA exposure were used as controls. We observed that the acute exposure of rats to HA (3 days) led to a significant increase in the expressions of CPT-I and PPARα and in the total hepatic ketone body. Longer exposure (15 days) caused a marked decrease in the expression of CPT-I and PPARα. By 30 days after HA exposure, the expression levels of CPT-I and PPARα returned to the control level. The hepatic ACC-1 level showed a significant increase in rats exposed to HA for 1 and 3 days. In contrast, the hepatic level of AMPK showed a significant reduction throughout the experimental period. Plasma FFA concentrations did not show any significant changes following HA exposure. Thus, increased hepatic FA oxidation and synthesis in the early phase of HA exposure may be among the important mechanisms for the rats to respond to the hypoxic stress in order to acclimatize themselves to the

  1. Inhibition of sterol but not fatty acid synthesis by valproate in developing rat brain in vivo.

    PubMed Central

    Bolaños, J P; Medina, J M; Williamson, D H


    The effect of administration of valproate on lipogenesis in the developing rat brain in vivo was studied. Valproate inhibited by 21-38% the rate of 3H2O incorporation into brain sterols, without significantly affecting fatty acid synthesis. Similarly, R-[2-14C]mevalonate incorporation into sterols was inhibited by 33-54%; the low rate of fatty acid synthesis under these conditions was not affected by valproate. Plasma ketone bodies decreased after treatment with valproate. Valproate inhibited (about 50%) both sterol and fatty acid synthesis in livers of weanling rats. It is concluded that valproate can specifically inhibit sterol synthesis in the brain during development, in part at a stage after mevalonate formation, and also by decreased exogenous precursor supply. PMID:2264830

  2. Chlamydia trachomatis Scavenges Host Fatty Acids for Phospholipid Synthesis via an Acyl-Acyl Carrier Protein Synthetase.


    Yao, Jiangwei; Dodson, V Joshua; Frank, Matthew W; Rock, Charles O


    The obligate intracellular parasite Chlamydia trachomatis has a reduced genome but relies on de novo fatty acid and phospholipid biosynthesis to produce its membrane phospholipids. Lipidomic analyses showed that 8% of the phospholipid molecular species synthesized by C. trachomatis contained oleic acid, an abundant host fatty acid that cannot be made by the bacterium. Mass tracing experiments showed that isotopically labeled palmitic, myristic, and lauric acids added to the medium were incorporated into C. trachomatis-derived phospholipid molecular species. HeLa cells did not elongate lauric acid, but infected HeLa cell cultures elongated laurate to myristate and palmitate. The elongated fatty acids were incorporated exclusively into C. trachomatis-produced phospholipid molecular species. C. trachomatis has adjacent genes encoding the separate domains of the bifunctional acyl-acyl carrier protein (ACP) synthetase/2-acylglycerolphosphoethanolamine acyltransferase gene (aas) of Escherichia coli. The CT775 gene encodes an acyltransferase (LpaT) that selectively transfers fatty acids from acyl-ACP to the 1-position of 2-acyl-glycerophospholipids. The CT776 gene encodes an acyl-ACP synthetase (AasC) with a substrate preference for palmitic compared with oleic acid in vitro. Exogenous fatty acids were elongated and incorporated into phospholipids by Escherichia coli-expressing AasC, illustrating its function as an acyl-ACP synthetase in vivo. These data point to an AasC-dependent pathway in C. trachomatis that selectively scavenges host saturated fatty acids to be used for the de novo synthesis of its membrane constituents. PMID:26195634

  3. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.


    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine


    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  4. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine


    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  5. Nucleic Acid-Targeting Pathways Promote Inflammation in Obesity-Related Insulin Resistance.


    Revelo, Xavier S; Ghazarian, Magar; Chng, Melissa Hui Yen; Luck, Helen; Kim, Justin H; Zeng, Kejing; Shi, Sally Y; Tsai, Sue; Lei, Helena; Kenkel, Justin; Liu, Chih Long; Tangsombatvisit, Stephanie; Tsui, Hubert; Sima, Corneliu; Xiao, Changting; Shen, Lei; Li, Xiaoying; Jin, Tianru; Lewis, Gary F; Woo, Minna; Utz, Paul J; Glogauer, Michael; Engleman, Edgar; Winer, Shawn; Winer, Daniel A


    Obesity-related inflammation of metabolic tissues, including visceral adipose tissue (VAT) and liver, are key factors in the development of insulin resistance (IR), though many of the contributing mechanisms remain unclear. We show that nucleic-acid-targeting pathways downstream of extracellular trap (ET) formation, unmethylated CpG DNA, or ribonucleic acids drive inflammation in IR. High-fat diet (HFD)-fed mice show increased release of ETs in VAT, decreased systemic clearance of ETs, and increased autoantibodies against conserved nuclear antigens. In HFD-fed mice, this excess of nucleic acids and related protein antigens worsens metabolic parameters through a number of mechanisms, including activation of VAT macrophages and expansion of plasmacytoid dendritic cells (pDCs) in the liver. Consistently, HFD-fed mice lacking critical responders of nucleic acid pathways, Toll-like receptors (TLR)7 and TLR9, show reduced metabolic inflammation and improved glucose homeostasis. Treatment of HFD-fed mice with inhibitors of ET formation or a TLR7/9 antagonist improves metabolic disease. These findings reveal a pathogenic role for nucleic acid targeting as a driver of metabolic inflammation in IR. PMID:27373163

  6. An okadaic acid-sensitive phosphatase negatively controls the cyclin degradation pathway in amphibian eggs.

    PubMed Central

    Lorca, T; Fesquet, D; Zindy, F; Le Bouffant, F; Cerruti, M; Brechot, C; Devauchelle, G; Dorée, M


    Inhibition of okadaic acid-sensitive phosphatases released the cyclin degradation pathway from its inhibited state in extracts prepared from unfertilized Xenopus eggs arrested at the second meiotic metaphase. It also switched on cyclin protease activity in a permanent fashion in interphase extracts prepared from activated eggs. Even after cdc2 kinase inactivation, microinjection of okadaic acid-treated interphase extracts pushed G2-arrested recipient oocytes into the M phase, suggesting that the phosphatase inhibitor stabilizes the activity of an unidentified factor which shares in common with cdc2 kinase the maturation-promoting factor activity. Images PMID:1846666

  7. Biochemical and Structural Characterization of a Ureidoglycine Aminotransferase in the Klebsiella pneumoniae Uric Acid Catabolic Pathway

    SciTech Connect

    French, Jarrod B.; Ealick, Steven E.


    Many plants, fungi, and bacteria catabolize allantoin as a mechanism for nitrogen assimilation. Recent reports have shown that in plants and some bacteria the product of hydrolysis of allantoin by allantoinase is the unstable intermediate ureidoglycine. While this molecule can spontaneously decay, genetic analysis of some bacterial genomes indicates that an aminotransferase may be present in the pathway. Here we present evidence that Klebsiella pneumoniae HpxJ is an aminotransferase that preferentially converts ureidoglycine and an {alpha}-keto acid into oxalurate and the corresponding amino acid. We determined the crystal structure of HpxJ, allowing us to present an explanation for substrate specificity.

  8. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.


    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  9. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.


    Smith, B A; Dworkin, M


    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  10. Enhanced fatty acid accumulation in Isochrysis galbana by inhibition of the mitochondrial alternative oxidase pathway under nitrogen deprivation.


    Zhang, Litao; Liu, Jianguo


    The purpose of this study was to clarify the interrelation between the mitochondrial alternative oxidase (AOX) pathway and fatty acid accumulation in marine microalga Isochrysis galbana. Under normal conditions, the activity of the AOX pathway was maintained at a low level in I. galbana. Compared with the normal condition, nitrogen deprivation significantly increased the AOX pathway activity and fatty acid accumulation. Under nitrogen deprivation, the inhibition of the AOX pathway by salicylhydroxamic acid caused the accumulation of reducing equivalents and the over-reduction of chloroplasts in I. galbana cells, leading to a decrease in the photosynthetic O2 evolution rate. The over-production of reducing equivalents due to the inhibition of the AOX pathway under nitrogen deprivation further enhanced the accumulation of fatty acids in I. galbana cells. PMID:27068057

  11. Increased Long Chain acyl-Coa Synthetase Activity and Fatty Acid Import Is Linked to Membrane Synthesis for Development of Picornavirus Replication Organelles

    PubMed Central

    Scott, Alison J.; Ford, Lauren A.; Pei, Zhengtong; Watkins, Paul A.; Ernst, Robert K.; Belov, George A.


    All positive strand (+RNA) viruses of eukaryotes replicate their genomes in association with membranes. The mechanisms of membrane remodeling in infected cells represent attractive targets for designing future therapeutics, but our understanding of this process is very limited. Elements of autophagy and/or the secretory pathway were proposed to be hijacked for building of picornavirus replication organelles. However, even closely related viruses differ significantly in their requirements for components of these pathways. We demonstrate here that infection with diverse picornaviruses rapidly activates import of long chain fatty acids. While in non-infected cells the imported fatty acids are channeled to lipid droplets, in infected cells the synthesis of neutral lipids is shut down and the fatty acids are utilized in highly up-regulated phosphatidylcholine synthesis. Thus the replication organelles are likely built from de novo synthesized membrane material, rather than from the remodeled pre-existing membranes. We show that activation of fatty acid import is linked to the up-regulation of cellular long chain acyl-CoA synthetase activity and identify the long chain acyl-CoA syntheatse3 (Acsl3) as a novel host factor required for polio replication. Poliovirus protein 2A is required to trigger the activation of import of fatty acids independent of its protease activity. Shift in fatty acid import preferences by infected cells results in synthesis of phosphatidylcholines different from those in uninfected cells, arguing that the viral replication organelles possess unique properties compared to the pre-existing membranes. Our data show how poliovirus can change the overall cellular membrane homeostasis by targeting one critical process. They explain earlier observations of increased phospholipid synthesis in infected cells and suggest a simple model of the structural development of the membranous scaffold of replication complexes of picorna-like viruses, that may be

  12. A second pathway to degrade pyrimidine nucleic acid precursors in eukaryotes.


    Andersen, Gorm; Björnberg, Olof; Polakova, Silvia; Pynyaha, Yuriy; Rasmussen, Anna; Møller, Kasper; Hofer, Anders; Moritz, Thomas; Sandrini, Michael Paolo Bastner; Merico, Anna-Maria; Compagno, Concetta; Akerlund, Hans-Erik; Gojković, Zoran; Piskur, Jure


    Pyrimidine bases are the central precursors for RNA and DNA, and their intracellular pools are determined by de novo, salvage and catabolic pathways. In eukaryotes, degradation of uracil has been believed to proceed only via the reduction to dihydrouracil. Using a yeast model, Saccharomyces kluyveri, we show that during degradation, uracil is not reduced to dihydrouracil. Six loci, named URC1-6 (for uracil catabolism), are involved in the novel catabolic pathway. Four of them, URC3,5, URC6, and URC2 encode urea amidolyase, uracil phosphoribosyltransferase, and a putative transcription factor, respectively. The gene products of URC1 and URC4 are highly conserved proteins with so far unknown functions and they are present in a variety of prokaryotes and fungi. In bacteria and in some fungi, URC1 and URC4 are linked on the genome together with the gene for uracil phosphoribosyltransferase (URC6). Urc1p and Urc4p are therefore likely the core components of this novel biochemical pathway. A combination of genetic and analytical chemistry methods demonstrates that uridine monophosphate and urea are intermediates, and 3-hydroxypropionic acid, ammonia and carbon dioxide the final products of degradation. The URC pathway does not require the presence of an active respiratory chain and is therefore different from the oxidative and rut pathways described in prokaryotes, although the latter also gives 3-hydroxypropionic acid as the end product. The genes of the URC pathway are not homologous to any of the eukaryotic or prokaryotic genes involved in pyrimidine degradation described to date. PMID:18550080

  13. Cross-talk between TLR4 and PPARγ pathways in the arachidonic acid-induced inflammatory response in pancreatic acini.


    Mateu, A; Ramudo, L; Manso, M A; De Dios, I


    Arachidonic acid (AA) is generally associated with inflammation in different settings. We assess the molecular mechanisms involved in the inflammatory response exerted by AA on pancreatic acini as an approach to acute pancreatitis (AP). Celecoxib (COX-2 inhibitor), TAK-242 (TLR4 inhibitor) and 15d-PGJ2 (PPARγ agonist) were used to ascertain the signaling pathways. In addition, we examine the effects of TAK-242 and 15d-PGJ2 on AP induced in rats by bile-pancreatic duct obstruction (BPDO). To carry out in vitro studies, acini were isolated from pancreas of control rats. Generation of PGE2 and TXB2, activation of pro-inflammatory pathways (MAPKs, NF-κB, and JAK/STAT3) and overexpression of CCL2 and P-selectin was found in AA-treated acini. In addition, AA up-regulated TLR4 and down-regulated PPARγ expression. Celecoxib prevented the up-regulation of CCL2 and P-selectin but did not show any effect on the AA-mediated changes in TLR4 and PPARγ expression. TAK-242, reduced the generation of AA metabolites and repressed both the cascade of pro-inflammatory events which led to CCL2 and P-selectin overexpression as well as the AA-induced PPARγ down-regulation. Thus, TLR4 acts as upstream activating pro-inflammatory and inhibiting anti-inflammatory pathways. 15d-PGJ2 down-regulated TLR4 expression and hence prevented the synthesis of AA metabolites and the inflammatory response mediated by them. Reciprocal negative cross-talk between TLR4 and PPARγ pathways is evidenced. In vivo experiments showed that TAK-242 and 15d-PGJ2 treatments reduced the inflammatory response in BPDO-induced AP. We conclude that through TLR4-dependent mechanisms, AA up-regulated CCL2 and P-selectin in pancreatic acini, partly mediated by the generation of PGE2 and TXB2, which activated pro-inflammatory pathways, but also directly by down-regulating PPARγ expression with anti-inflammatory activity. In vitro and in vivo studies support the role of TLR4 in AP and the use of TLR4 inhibitors and

  14. 11,12-Epoxyeicosatrienoic acid activates the L-arginine/nitric oxide pathway in human platelets.


    Zhang, Like; Cui, Yuying; Geng, Bing; Zeng, Xiangjun; Tang, Chaoshu


    The present study was to test the hypothesis that 11,12-epoxyeicosatrienoic acid (11,12-EET), a metabolic product of arachidonic acid by cytochrome P450 epoxygenase, regulates nitric oxide (NO) generation of the L-arginine/NO synthase (NOS) pathway in human platelets. Human platelets were incubated in the presence or absence of different concentrations of 11,12-EET for 2 h at 37 degrees C, followed by measurements of activities of the L-arginine/NOS pathway. Incubation with 11,12-EET increased the platelet NOS activity, nitrite production, cGMP content, and the platelet uptake of L-[(3)H]arginine in a concentration-dependent manner. In addition, 11,12-EET attenuated intracellular free Ca(2+) accumulation stimulated by collagen, which was at least partly mediated by EET-activated L-arginine/NOS pathway. It is suggested that 11,12-EET regulates platelet function through up-regulating the activity of the L-arginine/NOS/NO pathway. PMID:17932624

  15. Single amino acid substitutions influencing the folding pathway of the phage P22 tail spike endorhamnosidase.


    Yu, M H; King, J


    Temperature-sensitive mutations in the gene for the thermostable tail spike of phage P22 interyFere with the folding and subunit association pathway at the restrictive temperature but not with the activity or stability of the protein once matured. The local sites of these mutations and the mutant amino acid substitutions have been determined by DNA sequencing. Of 11 temperature-sensitive folding mutations, 3 were replacements of glycine residues by polar residues, and three were replacements of threonine residues by residues unable to form a side-chain H-bond. There were no proline replacements. Two of the temperature-sensitive sites in which threonine residues were replaced by isoleucine residues were homologous. These sequences probably maintain the correct local folding pathway at higher temperatures. The temperature-sensitive amino acid substitutions appear to destabilize a thermolabile intermediate in the wild-type folding pathway or to increase the rate of a competing off-pathway reaction. PMID:6387707

  16. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.


    Hansen, Alexandar L; Behrman, Edward J


    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. PMID:27258673

  17. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf


    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  18. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.


    van Ameijde, Jeroen; Liskamp, Rob M J


    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  19. Diesters from Oleic Acid: Synthesis, Low Temperature Properties, and Oxidation Stability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several diesters were prepared from commercially available oleic acid and common organic acids. The key step in the three step synthesis of oleochemical diesters entails a ring opening esterification of alkyl 9,10-epoxyoctadecanoates (alkyl: propyl, iso-propyl, octyl, 2-ethylhexyl) using propionic a...

  20. [The clinical evaluation of the hypocholesterolemic effects of an inhibitor of cholesterol synthesis: mevalonic acid].


    Del Nero, E; Aloe, N; Augeri, C; Avola, F; Carta, G; Cavagnaro, A; De Grandi, R; Gianfreda, M; Magro, G P; Mazzarello, G P


    Twenty eight patients with heterozygous familial hypercholesterolemia were treated with mevalonic acid (an inhibitor of cholesterol synthesis) for 45 days. Patients received a daily dose of 750 to 1500 mg mevalonic acid depending on plasma cholesterol levels. Results showed a significant reduction in cholesterol values whereas no significant difference was observed in HDL cholesterol and triglyceride levels. PMID:1505176

  1. A heterocyclic molecule kartogenin induces collagen synthesis of human dermal fibroblasts by activating the smad4/smad5 pathway.


    Wang, Jing; Zhou, Jia; Zhang, Ning; Zhang, Xiaoling; Li, Qingfeng


    Declined production of collagen by fibroblasts is one of the major causes of aging appearance. However, only few of compounds found in cosmetic products are able to directly increase collagen synthesis. A novel small heterocyclic compound called kartogenin (KGN) was found to stimulate collagen synthesis of mesenchymal stem cells (MSCs). So, we hypothesized and tested that if KGN could be applied to stimulate the collagen synthesis of fibroblasts. Human dermal fibroblasts in vitro were treated with various concentrations of KGN, with dimethyl sulfoxide (DMSO) serving as the negative control. Real-time reverse-transcription polymerase chain reaction, Western blot, and immunofluorescence analyses were performed to examine the expression of collagen and transforming growth factor beta (TGF-β) signaling pathway. The production of collagen was also tested in vivo by Masson's trichrome stain and immunohistochemistry in the dermis of mice administrated with KGN. Results showed that without obvious influence on fibroblasts' apoptosis and viability, KGN stimulated type-I collagen synthesis of fibroblasts at the mRNA and protein levels in a time-dependent manner, but KGN did not induce expression of α-skeletal muscle actin (α-sma) or matrix metallopeptidase1 (MMP1), MMP9 in vitro. Smad4/smad5 of the TGF-β signaling pathway was activated by KGN while MAPK signaling pathway remained unchanged. KGN also increased type-I collagen synthesis in the dermis of BALB/C mice. Our results indicated that KGN promoted the type-I collagen synthesis of dermal fibroblasts in vitro and in the dermis of mice through activation of the smad4/smad5 pathway. This molecule could be used in wound healing, tissue engineering of fibroblasts, or aesthetic and reconstructive procedures. PMID:24928394

  2. A defect in the p53 response pathway induced by de novo purine synthesis inhibition.


    Bronder, Julie L; Moran, Richard G


    p53 is believed to sense cellular ribonucleotide depletion in the absence of DNA strand breaks and to respond by imposition of a p21-dependent G1 cell cycle arrest. We now report that the p53-dependent G1 checkpoint is blocked in human carcinoma cell lines after inhibition of de novo purine synthesis by folate analogs inhibitory to glycinamide ribonucleotide formyltransferase (GART). p53 accumulated in HCT116, MCF7, or A549 carcinoma cells upon GART inhibition, but, surprisingly, transcription of several p53 targets, including p21cip1/waf1, was impaired. The mechanism of this defect was examined. The p53 accumulating in these cells was nuclear but was not phosphorylated at serines 6, 15, and 20, nor was it acetylated at lysines 373 or 382. The DDATHF-stabilized p53 bound to the p21 promoter in vitro and in vivo but did not activate histone acetylation over the p53 binding sites in the p21 promoter that is an integral part of the transcriptional response mediated by the DNA damage pathway. We concluded that the robust initial response of the p53 pathway to GART inhibitors is not transcriptionally propagated to target genes due to a defect in p53 post-translational modifications and a failure to open chromatin structure despite promoter binding of this unmodified p53. PMID:14517211

  3. Parallel evolution of Nitric Oxide signaling: Diversity of synthesis & memory pathways

    PubMed Central

    Moroz, Leonid L.; Kohn, Andrea B.


    The origin of NO signaling can be traceable back to the origin of life with the large scale of parallel evolution of NO synthases (NOSs). Inducible-like NOSs may be the most basal prototype of all NOSs and that neuronal-like NOS might have evolved several times from this prototype. Other enzymatic and non-enzymatic pathways for NO synthesis have been discovered using reduction of nitrites, an alternative source of NO. Diverse synthetic mechanisms can co-exist within the same cell providing a complex NO-oxygen microenvironment tightly coupled with cellular energetics. The dissection of multiple sources of NO formation is crucial in analysis of complex biological processes such as neuronal integration and learning mechanisms when NO can act as a volume transmitter within memory-forming circuits. In particular, the molecular analysis of learning mechanisms (most notably in insects and gastropod molluscs) opens conceptually different perspectives to understand the logic of recruiting evolutionarily conserved pathways for novel functions. Giant uniquely identified cells from Aplysia and related species precent unuque opportunities for integrative analysis of NO signaling at the single cell level. PMID:21622160

  4. Phospholipase D Signaling Pathways and Phosphatidic Acid as Therapeutic Targets in Cancer

    PubMed Central

    Bruntz, Ronald C.; Lindsley, Craig W.


    Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein–coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions. PMID:25244928

  5. Regulation of protein degradation pathways by amino acids and insulin in skeletal muscle of neonatal pigs

    PubMed Central


    Background The rapid gain in lean mass in neonates requires greater rates of protein synthesis than degradation. We previously delineated the molecular mechanisms by which insulin and amino acids, especially leucine, modulate skeletal muscle protein synthesis and how this changes with development. In the current study, we identified mechanisms involved in protein degradation regulation. In experiment 1, 6- and 26-d-old pigs were studied during 1) euinsulinemic-euglycemic-euaminoacidemic, 2) euinsulinemic-euglycemic-hyperaminoacidemic, and 3) hyperinsulinemic-euglycemic-euaminoacidemic clamps for 2 h. In experiment 2, 5-d-old pigs were studied during 1) euinsulinemic-euglycemic-euaminoacidemic-euleucinemic, 2) euinsulinemic-euglycemic-hypoaminoacidemic-hyperleucinemic, and 3) euinsulinemic-euglycemic-euaminoacidemic-hyperleucinemic clamps for 24 h. We determined in muscle indices of ubiquitin-proteasome, i.e., atrogin-1 (MAFbx) and muscle RING-finger protein-1 (MuRF1) and autophagy-lysosome systems, i.e., unc51-like kinase 1 (UKL1), microtubule-associated protein light chain 3 (LC3), and lysosomal-associated membrane protein 2 (Lamp-2). For comparison, we measured ribosomal protein S6 (rpS6) and eukaryotic initiation factor 4E (eIF4E) activation, components of translation initiation. Results Abundance of atrogin-1, but not MuRF1, was greater in 26- than 6-d-old pigs and was not affected by insulin, amino acids, or leucine. Abundance of ULK1 and LC3 was higher in younger pigs and not affected by treatment. The LC3-II/LC3-I ratio was reduced and ULK1 phosphorylation increased by insulin, amino acids, and leucine. These responses were more profound in younger pigs. Abundance of Lamp-2 was not affected by treatment or development. Abundance of eIF4E, but not rpS6, was higher in 6- than 26-d-old-pigs but unaffected by treatment. Phosphorylation of eIF4E was not affected by treatment, however, insulin, amino acids, and leucine stimulated rpS6 phosphorylation, and the

  6. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.


    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  7. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.


    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  8. Synthesis of zirconium carbide nanosized powders by pursed wire discharge in oleic acid

    NASA Astrophysics Data System (ADS)

    Sugashima, Kenta; Suzuki, Kazuma; Suzuki, Tsuneo; Nakayama, Tadachika; Suematsu, Hisayuki; Niihara, Koichi


    In this study, we propose novel PWD methods in inert gas mixed organic vapor and organic liquid which work as harmless carbon sources. Metal zirconium wire evaporation by PWD in organic vapor or liquid media was investigated. It was confirmed that in the PWD process using oleic acid liquid, single phase zirconium carbide nanopowders were synthesized by a reaction between Zr vapor and oleic acid. A new method for synthesis of carbide nanopowders was developed using the PWD in organic liquid. Therefore, the present result suggested that PWD method in oleic acid liquids is effective for the synthesis of carbide nanopowders.

  9. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives.


    Hayashi, N; Sugawara, T; Kato, S


    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4].Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  10. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives

    PubMed Central

    Hayashi, Nobuyoshi; Sugawara, Tohru; Kato, Shinji


    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4]. Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  11. Docosahexaenoic Acid Modulates Invasion and Metastasis of Human Ovarian Cancer via Multiple Molecular Pathways

    PubMed Central

    Wang, Ying-Chun; Wu, Yi-Nan; Wang, Su-Li; Lin, Qing-Hua; He, Ming-Fang; Liu, Qiao-lin; Wang, Jin-Hua


    Objective We investigated the effect of docosahexaenoic acid (DHA) on the invasion and metastasis of ovarian cancer cells (A2780, HO8910, and SKOV-3). Methods Cytotoxicity assay was performed to determine the optimal doses of DHA in this experiment. The effects of DHA on invasion ability were assessed by invasion assay. The expressions of messenger RNA and/or proteins associated with invasion or metastasis were detected by quantitative Real Time-Polymerase Chain Reaction or Western blot. The effect of DHA on cell metastasis was assessed in xenograft model of zebrafish. Results Docosahexaenoic acid and α-linolenic acid could reduce the cell vitalities in dose-dependent manner. However, DHA inhibited the invasion and metastasis of ovarian cancer cells, but α-linolenic acid did not (**P < 0.01). Docosahexaenoic acid could downregulate the expressions of WAVE3, vascular endothelial cell growth factor, and MMP-9, and upregulate KISS-1, TIMP-1, and PPAR-γ, which negatively correlated with cell invasion and metastasis (*P < 0.05). Docosahexaenoic acid restrained the development of subintestinal vessels and cancer cell metastasis in xenograft model of zebrafish (**P < 0.01). Conclusions Docosahexaenoic acid inhibited the invasion and metastasis of ovarian cancer cells in vitro and in vivo through the modulation of NF-κB signaling pathway, suggesting that DHA is a promising candidate for ovarian cancer therapy. PMID:27258728

  12. MNK1 pathway activity maintains protein synthesis in rapalog-treated gliomas.


    Grzmil, Michal; Huber, Roland M; Hess, Daniel; Frank, Stephan; Hynx, Debby; Moncayo, Gerald; Klein, Dominique; Merlo, Adrian; Hemmings, Brian A


    High levels of mammalian target of rapamycin complex 1 (mTORC1) activity in malignant gliomas promote tumor progression, suggesting that targeting mTORC1 has potential as a therapeutic strategy. Remarkably, clinical trials in patients with glioma revealed that rapamycin analogs (rapalogs) have limited efficacy, indicating activation of resistance mechanisms. Targeted depletion of MAPK-interacting Ser/Thr kinase 1 (MNK1) sensitizes glioma cells to the mTORC1 inhibitor rapamycin through an indistinct mechanism. Here, we analyzed how MNK1 and mTORC1 signaling pathways regulate the assembly of translation initiation complexes, using the cap analog m7GTP to enrich for initiation complexes in glioma cells followed by mass spectrometry-based quantitative proteomics. Association of eukaryotic translation initiation factor 4E (eIF4E) with eIF4E-binding protein 1 (4EBP1) was regulated by the mTORC1 pathway, whereas pharmacological blocking of MNK activity by CGP57380 or MNK1 knockdown, along with mTORC1 inhibition by RAD001, increased 4EBP1 binding to eIF4E. Furthermore, combined MNK1 and mTORC1 inhibition profoundly inhibited 4EBP1 phosphorylation at Ser65, protein synthesis and proliferation in glioma cells, and reduced tumor growth in an orthotopic glioblastoma (GBM) mouse model. Immunohistochemical analysis of GBM samples revealed increased 4EBP1 phosphorylation. Taken together, our data indicate that rapalog-activated MNK1 signaling promotes glioma growth through regulation of 4EBP1 and indicate a molecular cross-talk between the mTORC1 and MNK1 pathways that has potential to be exploited therapeutically. PMID:24401275

  13. Role of Malic Enzyme during Fatty Acid Synthesis in the Oleaginous Fungus Mortierella alpina

    PubMed Central

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao


    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi. PMID:24532075

  14. Fine-Tuning of the Fatty Acid Pathway by Synthetic Antisense RNA for Enhanced (2S)-Naringenin Production from l-Tyrosine in Escherichia coli

    PubMed Central

    Wu, Junjun; Yu, Oliver; Du, Guocheng


    Malonyl coenzyme A (malonyl-CoA) is an important precursor for the synthesis of natural products, such as polyketides and flavonoids. The majority of this cofactor often is consumed for producing fatty acids and phospholipids, leaving only a small amount of cellular malonyl-CoA available for producing the target compound. The tuning of malonyl-CoA into heterologous pathways yields significant phenotypic effects, such as growth retardation and even cell death. In this study, fine-tuning of the fatty acid pathway in Escherichia coli with antisense RNA (asRNA) to balance the demands on malonyl-CoA for target-product synthesis and cell health was proposed. To establish an efficient asRNA system, the relationship between sequence and function for asRNA was explored. It was demonstrated that the gene-silencing effect of asRNA could be tuned by directing asRNA to different positions in the 5′-UTR (untranslated region) of the target gene. Based on this principle, the activity of asRNA was quantitatively tailored to balance the need for malonyl-CoA in cell growth and the production of the main flavonoid precursor, (2S)-naringenin. Appropriate inhibitory efficiency of the anti-fabB/fabF asRNA improved the production titer by 431% (391 mg/liter). Therefore, the strategy presented in this study provided a useful tool for the fine-tuning of endogenous gene expression in bacteria. PMID:25239896

  15. Chemical Synthesis of Uncommon Natural Bile Acids: The 9α-Hydroxy Derivatives of Chenodeoxycholic and Lithocholic Acids.


    Iida, Takashi; Namegawa, Kazunari; Nakane, Naoya; Iida, Kyoko; Hofmann, Alan Frederick; Omura, Kaoru


    The chemical synthesis of the 9α-hydroxy derivatives of chenodeoxycholic and lithocholic acids is reported. For initiating the synthesis of the 9α-hydroxy derivative of chenodeoxycholic acid, cholic acid was used; for the synthesis of the 9α-hydroxy derivative of lithocholic acid, deoxycholic acid was used. The principal reactions involved were (1) decarbonylation of conjugated 12-oxo-Δ(9(11))-derivatives using in situ generated monochloroalane (AlH2Cl) prepared from LiAlH4 and AlCl3, (2) epoxidation of the deoxygenated Δ(9(11))-enes using m-chloroperbenzoic acid catalyzed by 4,4'-thiobis-(6-tert-butyl-3-methylphenol), (3) subsequent Markovnikov 9α-hydroxylation of the Δ(9(11))-enes with AlH2Cl, and (4) selective oxidation of the primary hydroxyl group at C-24 in the resulting 3α,9α,24-triol and 3α,7α,9α,24-tetrol to the corresponding C-24 carboxylic acids using sodium chlorite (NaClO2) in the presence of a catalytic amount of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical (TEMPO) and sodium hypochlorite (NaOCl). The (1)H- and (13)C-NMR spectra are reported. The 3α,7α,9α-trihydroxy-5β-cholan-24-oic acid has been reported to be present in the bile of the Asian bear, and its 7-deoxy derivative is likely to be a bacterial metabolite. These bile acids are now available as authentic reference standards, permitting their identification in vertebrate bile acids. PMID:27319285

  16. A Heteromeric Membrane-Bound Prenyltransferase Complex from Hop Catalyzes Three Sequential Aromatic Prenylations in the Bitter Acid Pathway1[OPEN

    PubMed Central

    Li, Haoxun; Ban, Zhaonan; Qin, Hao; Ma, Liya; King, Andrew J.


    Bitter acids (α and β types) account for more than 30% of the fresh weight of hop (Humulus lupulus) glandular trichomes and are well known for their contribution to the bitter taste of beer. These multiprenylated chemicals also show diverse biological activities, some of which have potential benefits to human health. The bitter acid biosynthetic pathway has been investigated extensively, and the genes for the early steps of bitter acid synthesis have been cloned and functionally characterized. However, little is known about the enzyme(s) that catalyze three sequential prenylation steps in the β-bitter acid pathway. Here, we employed a yeast (Saccharomyces cerevisiae) system for the functional identification of aromatic prenyltransferase (PT) genes. Two PT genes (HlPT1L and HlPT2) obtained from a hop trichome-specific complementary DNA library were functionally characterized using this yeast system. Coexpression of codon-optimized PT1L and PT2 in yeast, together with upstream genes, led to the production of bitter acids, but no bitter acids were detected when either of the PT genes was expressed by itself. Stepwise mutation of the aspartate-rich motifs in PT1L and PT2 further revealed the prenylation sequence of these two enzymes in β-bitter acid biosynthesis: PT1L catalyzed only the first prenylation step, and PT2 catalyzed the two subsequent prenylation steps. A metabolon formed through interactions between PT1L and PT2 was demonstrated using a yeast two-hybrid system, reciprocal coimmunoprecipitation, and in vitro biochemical assays. These results provide direct evidence of the involvement of a functional metabolon of membrane-bound prenyltransferases in bitter acid biosynthesis in hop. PMID:25564559

  17. Latency, duration and dose response relationships of amino acid effects on human muscle protein synthesis.


    Rennie, Michael J; Bohé, Julien; Wolfe, Robert R


    The components of the stimulatory effect of food on net deposition of protein are beginning to be identified and separated. One of the most important of these appears to be the effect of amino acids per se in stimulating muscle anabolism. Amino acids appear to have a linear stimulatory effect within the range of normal diurnal plasma concentrations from postabsorptive to postprandial. Within this range, muscle protein synthesis (measured by incorporation of stable isotope tracers of amino acids into biopsied muscle protein) appears to be stimulated approximately twofold; however, little further increase occurs when very high concentrations of amino acids (>2.5 times the normal postabsorptive plasma concentration) are made available. Amino acids provided in surfeit of the ability of the system to synthesize protein are disposed of by oxidation, ureagenesis and gluconeogenesis. The stimulatory effect of amino acids appears to be time dependent; a square wave increase in the availability of amino acids causes muscle protein synthesis to be stimulated and to fall back to basal values, despite continued amino acid availability. The relationship between muscle protein synthesis and insulin availability suggests that most of the stimulatory effects occur at low insulin concentrations, with large increases having no effect. These findings may have implications for our understanding of the body's requirements for protein. The maximal capacity for storage of amino acids as muscle protein probably sets an upper value on the extent to which amino acids can be stored after a single meal. PMID:12368422

  18. Delta 4-3-oxosteroid 5 beta-reductase deficiency described in identical twins with neonatal hepatitis. A new inborn error in bile acid synthesis.

    PubMed Central

    Setchell, K D; Suchy, F J; Welsh, M B; Zimmer-Nechemias, L; Heubi, J; Balistreri, W F


    A new inborn error in bile acid synthesis, manifest in identical infant twins as severe intrahepatic cholestasis, is described involving the delta 4-3-oxosteroid 5 beta-reductase catalyzed conversion of the key intermediates, 7 alpha-hydroxy-4-cholesten-3-one and 7 alpha,12 alpha-dihydroxy-4-cholesten-3-one for chenodeoxycholic and cholic acid synthesis, to the respective 3 alpha-hydroxy-5 beta (H) products. This defect was detected by fast atom bombardment ionization-mass spectrometry from an elevated excretion and predominance of taurine conjugated unsaturated hydroxy-oxo-bile acids. Gas chromatography-mass spectrometry confirmed these to be 7 alpha-hydroxy-3-oxo-4-cholenoic and 7 alpha,12 alpha-dihydroxy-3-oxo-4-cholenoic acids (75-92% of total). Fasting serum bile acid concentrations were greater than 37 mumol/liter; chenodeoxycholic acid was the major bile acid, but significant amounts of allo(5 alpha-H)-bile acids (approximately 30%) were present. Biliary bile acid concentration was less than 2 mumol/liter and consisted of chenodeoxycholic, allo-chenodeoxycholic, and allo-cholic acids. These biochemical findings, which were identical in both infants, indicate a defect in bile acid synthesis involving the conversion of the delta 4-3-oxo-C27 intermediates into the corresponding 3 alpha-hydroxy-5 beta(H)-structures, a reaction that is catalyzed by a delta 4-3-oxosteroid-5 beta reductase enzyme. This defect resulted in markedly reduced primary bile acid synthesis and concomitant accumulation of delta 4-3-oxo-and allo-bile acids. These findings indicate a pathway in bile acid synthesis whereby side chain oxidation can occur despite incomplete alterations to the steroid nucleus, and lend support for an active delta 4-3-oxosteroid 5 alpha-reductase catalyzing the conversion of the delta 4-3-oxosteroid intermediates to the respective 3 alpha-hydroxy-5 alpha(H)-structures. PMID:3198770

  19. Enzymes involved in a novel anaerobic cyclohexane carboxylic acid degradation pathway.


    Kung, Johannes W; Meier, Anne-Katrin; Mergelsberg, Mario; Boll, Matthias


    The anaerobic degradation of cyclohexane carboxylic acid (CHC) has so far been studied only in Rhodopseudomonas palustris, in which CHC is activated to cyclohexanoyl coenzyme A (cyclohexanoyl-CoA [CHCoA]) and then dehydrogenated to cyclohex-1-ene-1-carboxyl-CoA (CHeneCoA). This intermediate is further degraded by reactions of the R. palustris-specific benzoyl-CoA degradation pathway of aromatic compounds. However, CHeneCoA is not an intermediate in the degradation of aromatic compounds in all other known anaerobic bacteria; consequently, degradation of CHC was mostly unknown in anaerobic bacteria. We identified a previously unknown CHC degradation pathway in the Fe(III)-reducing Geobacter metallireducens by determining the following CHC-induced in vitro activities: (i) the activation of CHC to CHCoA by a succinyl-CoA:CHC CoA transferase, (ii) the 1,2-dehydrogenation of CHCoA to CHeneCoA by CHCoA dehydrogenase, and (iii) the unusual 1,4-dehydrogenation of CHeneCoA to cyclohex-1,5-diene-1-carboxyl-CoA. This last represents a previously unknown joint intermediate of the CHC and aromatic compound degradation pathway in bacteria other than R. palustris. The enzymes catalyzing the three reactions were purified and characterized as specific enzymes after heterologous expression of the encoding genes. Quantitative reverse transcription-PCR revealed that expression of these genes was highly induced during growth with CHC but not with benzoate. The newly identified CHC degradation pathway is suggested to be present in nearly all CHC-degrading anaerobic bacteria, including denitrifying, Fe(III)-reducing, sulfate-reducing, and fermenting bacteria. Remarkably, all three CHC degradation pathways always link CHC catabolism to the catabolic pathways of aromatic compounds. We propose that the capacity to use CHC as a carbon source evolved from already-existing aromatic compound degradation pathways. PMID:25112478

  20. Indole-3-acetic acid biosynthetic pathway and aromatic amino acid aminotransferase activities in Pantoea dispersa strain GPK.


    Kulkarni, G B; Nayak, A S; Sajjan, S S; Oblesha, A; Karegoudar, T B


    This investigation deals with the production of IAA by a bacterial isolate Pantoea dispersa strain GPK (PDG) identified by 16S rRNA gene sequence analysis. HPLC and Mass spectral analysis of metabolites from bacterial spent medium revealed that, IAA production by PDG is Trp-dependent and follows indole-3-pyruvic acid (IPyA) pathway. Substrate specificity study of aromatic amino acid aminotransferase (AAT) showed high activities, only when tryptophan (Trp) and α-ketoglutarate (α-kg) were used as substrates. AAT is highly specific for Trp and α-kg as amino group donor and acceptor, respectively. The effect of exogenous IAA on bacterial growth was established. Low concentration of exogenous IAA induced the growth, whereas high concentration decreased the growth of bacterium. PDG treatment significantly increased the root length, shoot length and dry mass of the chickpea and pigeon pea plants. PMID:23448265

  1. c9,t11-Conjugated linoleic acid ameliorates steatosis by modulating mitochondrial uncoupling and Nrf2 pathway[S

    PubMed Central

    Mollica, Maria Pina; Trinchese, Giovanna; Cavaliere, Gina; De Filippo, Chiara; Cocca, Ennio; Gaita, Marcello; Della-Gatta, Antonio; Marano, Angela; Mazzarella, Giuseppe; Bergamo, Paolo


    Oxidative stress, hepatic steatosis, and mitochondrial dysfunction are key pathophysiological features of nonalcoholic fatty liver disease. A conjugated linoleic acid (CLA) mixture of cis9,trans11 (9,11-CLA) and trans10,cis12 (10,12-CLA) isomers enhanced the antioxidant/detoxifying mechanism via the activation of nuclear factor E2-related factor-2 (Nrf2) and improved mitochondrial function, but less is known about the actions of specific isomers. The differential ability of individual CLA isomers to modulate these pathways was explored in Wistar rats fed for 4 weeks with a lard-based high-fat diet (L) or with control diet (CD), and, within each dietary treatment, two subgroups were daily administered with 9,11-CLA or 10,12-CLA (30 mg/day). The 9,11-CLA, but not 10,12-CLA, supplementation to CD rats improves the GSH/GSSG ratio in the liver, mitochondrial functions, and Nrf2 activity. Histological examination reveals a reduction of steatosis in L-fed rats supplemented with both CLA isomers, but 9,11-CLA downregulated plasma concentrations of proinflammatory markers, mitochondrial dysfunction, and oxidative stress markers in liver more efficiently than in 10,12-CLA treatment. The present study demonstrates the higher protective effect of 9,11-CLA against diet-induced pro-oxidant and proinflammatory signs and suggests that these effects are determined, at least in part, by its ability to activate the Nrf2 pathway and to improve the mitochondrial functioning and biogenesis. PMID:24634500

  2. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan


    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  3. Proteome alteration of U251 human astrocytoma cell after inhibiting retinoic acid synthesis.


    Zhang, Ming; Wan, Chunling; Ji, Baohu; Zhang, Zhao; Zhu, Hui; Tian, Nan; La, Yujuan; Huang, Ke; Jiang, Lei; He, Guang; Gao, Linhan; Zhao, Xinzhi; Shi, Yongyong; Huang, Gang; Feng, Guoyin; He, Lin


    Retinoic acid (Ra) is crucial for the patterning and neuronal differentiation in the central nervous system (CNS). Ra deficiency in animals disrupts the motor activities and memory abilities. The molecular mechanisms underlying these behavior abnormalities remain largely unknown. In the current study, we treated the astrocytoma cells with citral, an inhibitor of Ra synthesis. We analyzed the differences in the protein concentrations between the treated and untreated astrocytoma cells by two-dimensional gel electrophoresis (2-DE), Imagemaster software, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). In total, 39 of 46 altered protein spots with significant mascot scores were identified representing 36 proteins, that were involved in significantly altered glutamate metabolism, lipid metabolism, mitochondrial function, and oxidative stress response by Ingenuity Pathway Analysis (IPA). Altered 3-phosphoglycerate dehydrogenase (PHGDH) was also observed in western blot. These data provide some clues for explaining the behavioral changes caused by Ra deficiency, and support the hypothesis that Ra signaling is associated with some symptoms of neurodegenerative disorders and schizophrenia. PMID:19089318

  4. Identification of a critical determinant that enables efficient fatty acid synthesis in oleaginous fungi

    PubMed Central

    Chen, Haiqin; Hao, Guangfei; Wang, Lei; Wang, Hongchao; Gu, Zhennan; Liu, Liming; Zhang, Hao; Chen, Wei; Chen, Yong Q.


    Microorganisms are valuable resources for lipid production. What makes one microbe but not the other able to efficiently synthesize and accumulate lipids is poorly understood. In the present study, global gene expression prior to and after the onset of lipogenesis was determined by transcriptomics using the oleaginous fungus Mortierella alpina as a model system. A core of 23 lipogenesis associated genes was identified and their expression patterns shared a high similarity among oleaginous microbes Chlamydomonas reinhardtii, Mucor circinelloides and Rhizopus oryzae but was dissimilar to the non-oleaginous Aspergillus nidulans. Unexpectedly, Glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) in the pentose phosphate pathway (PPP) were found to be the NADPH producers responding to lipogenesis in the oleaginous microbes. Their role in lipogenesis was confirmed by a knockdown experiment. Our results demonstrate, for the first time, that the PPP plays a significant role during fungal lipogenesis. Up-regulation of NADPH production by the PPP, especially G6PD, may be one of the critical determinants that enables efficiently fatty acid synthesis in oleaginous microbes. PMID:26059272

  5. Identification of a critical determinant that enables efficient fatty acid synthesis in oleaginous fungi.


    Chen, Haiqin; Hao, Guangfei; Wang, Lei; Wang, Hongchao; Gu, Zhennan; Liu, Liming; Zhang, Hao; Chen, Wei; Chen, Yong Q


    Microorganisms are valuable resources for lipid production. What makes one microbe but not the other able to efficiently synthesize and accumulate lipids is poorly understood. In the present study, global gene expression prior to and after the onset of lipogenesis was determined by transcriptomics using the oleaginous fungus Mortierella alpina as a model system. A core of 23 lipogenesis associated genes was identified and their expression patterns shared a high similarity among oleaginous microbes Chlamydomonas reinhardtii, Mucor circinelloides and Rhizopus oryzae but was dissimilar to the non-oleaginous Aspergillus nidulans. Unexpectedly, Glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) in the pentose phosphate pathway (PPP) were found to be the NADPH producers responding to lipogenesis in the oleaginous microbes. Their role in lipogenesis was confirmed by a knockdown experiment. Our results demonstrate, for the first time, that the PPP plays a significant role during fungal lipogenesis. Up-regulation of NADPH production by the PPP, especially G6PD, may be one of the critical determinants that enables efficiently fatty acid synthesis in oleaginous microbes. PMID:26059272

  6. Effect of Poliovirus on Deoxyribonucleic Acid Synthesis in HeLa Cells

    PubMed Central

    Ackermann, W. W.; Cox, D. C.; Kurtz, H.; Powers, C. D.; Davies, S. J.


    Ackermann, W. W. (University of Michigan, Ann Arbor), D. C. Cox, H. Kurtz, C. D. Powers, and S. J. Davies. Effect of poliovirus on deoxyribonucleic acid synthesis in HeLa cells. J. Bacteriol. 91:1943–1952. 1966.—Both poliovirus and arginine stimulated deoxyribonucleic acid (DNA) synthesis in cultures of HeLa cells which were preconditioned by incubation in a medium deficient in arginine. However, the number of cells producing DNA was unaffected. DNA synthesis in such preconditioned cells was 10 to 20% of the maximal value obtained with a full complement of amino acids. Inhibition of DNA synthesis was produced in these cultures either by increasing the multiplicity of exposure above 40 plaque-forming units of virus per cell or by increasing the concentration of the deficient amino acid at the time of virus addition. Inhibition of DNA synthesis resulted from a reduction in the fraction of cells producing DNA. The concentration of arginine required for viral inhibition of DNA synthesis is greater than that for viral multiplication. PMID:4287076

  7. Synthesis and anticancer activity of novel fluorinated asiatic acid derivatives.


    Gonçalves, Bruno M F; Salvador, Jorge A R; Marín, Silvia; Cascante, Marta


    A series of novel fluorinated Asiatic Acid (AA) derivatives were successfully synthesized, tested for their antiproliferative activity against HeLa and HT-29 cell lines, and their structure activity relationships were evaluated. The great majority of fluorinated derivatives showed stronger antiproliferative activity than AA in a concentration dependent manner. The most active compounds have a pentameric A-ring containing an α,β-unsaturated carbonyl group. The compounds with better cytotoxic activity were then evaluated against MCF-7, Jurkat, PC-3, A375, MIA PaCa-2 and BJ cell lines. Derivative 14 proved to be the most active compound among all tested derivatives and its mechanism of action was further investigated in HeLa cell line. The results showed that compound 14 induced cell cycle arrest in G0/G1 stage as a consequence of up-regulation of p21(cip1/waf1) and p27(kip1) and down-regulation of cyclin D3 and Cyclin E. Furthermore, compound 14 was found to induce caspase driven-apoptosis with activation of caspases-8 and caspase-3 and the cleavage of PARP. The cleavage of Bid into t-Bid, the up-regulation of Bax and the down-regulation of Bcl-2 were also observed after treatment of HeLa cells with compound 14. Taken together, these mechanistic studies revealed the involvement of extrinsic and intrinsic pathways in the apoptotic process induced by compound 14. Importantly, the antiproliferative activity of this compound on the non-tumor BJ human fibroblast cell line is weaker than in the tested cancer cell lines. The enhanced potency (between 45 and 90-fold more active than AA in a panel of cancer cell lines) and selectivity of this new AA derivative warrant further preclinical evaluation. PMID:26974379

  8. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The reaction between epoxidized methyl oleate and the multifunctional carboxylic acid, levulinic acid, is shown to give two products of differing chemical reactivity. A branched alpha-hydroxy ester product which is acid stable, and a ketal product, which shows acid cleavability can be formed. The ...

  9. Genetic analysis of pathway regulation for enhancing branched-chain amino acid biosynthesis in plants.


    Chen, Hao; Saksa, Kristen; Zhao, Feiyi; Qiu, Joyce; Xiong, Liming


    The branched-chain amino acids (BCAAs) valine, leucine and isoleucine are essential amino acids that play critical roles in animal growth and development. Animals cannot synthesize these amino acids and must obtain them from their diet. Plants are the ultimate source of these essential nutrients, and they synthesize BCAAs through a conserved pathway that is inhibited by its end products. This feedback inhibition has prevented scientists from engineering plants that accumulate high levels of BCAAs by simply over-expressing the respective biosynthetic genes. To identify components critical for this feedback regulation, we performed a genetic screen for Arabidopsis mutants that exhibit enhanced resistance to BCAAs. Multiple dominant allelic mutations in the VALINE-TOLERANT 1 (VAT1) gene were identified that conferred plant resistance to valine inhibition. Map-based cloning revealed that VAT1 encodes a regulatory subunit of acetohydroxy acid synthase (AHAS), the first committed enzyme in the BCAA biosynthesis pathway. The VAT1 gene is highly expressed in young, rapidly growing tissues. When reconstituted with the catalytic subunit in vitro, the vat1 mutant-containing AHAS holoenzyme exhibits increased resistance to valine. Importantly, transgenic plants expressing the mutated vat1 gene exhibit valine tolerance and accumulate higher levels of BCAAs. Our studies not only uncovered regulatory characteristics of plant AHAS, but also identified a method to enhance BCAA accumulation in crop plants that will significantly enhance the nutritional value of food and feed. PMID:20497381

  10. Identification of the phytosphingosine metabolic pathway leading to odd-numbered fatty acids.


    Kondo, Natsuki; Ohno, Yusuke; Yamagata, Maki; Obara, Takashi; Seki, Naoya; Kitamura, Takuya; Naganuma, Tatsuro; Kihara, Akio


    The long-chain base phytosphingosine is a component of sphingolipids and exists in yeast, plants and some mammalian tissues. Phytosphingosine is unique in that it possesses an additional hydroxyl group compared with other long-chain bases. However, its metabolism is unknown. Here we show that phytosphingosine is metabolized to odd-numbered fatty acids and is incorporated into glycerophospholipids both in yeast and mammalian cells. Disruption of the yeast gene encoding long-chain base 1-phosphate lyase, which catalyzes the committed step in the metabolism of phytosphingosine to glycerophospholipids, causes an ~40% reduction in the level of phosphatidylcholines that contain a C15 fatty acid. We also find that 2-hydroxypalmitic acid is an intermediate of the phytosphingosine metabolic pathway. Furthermore, we show that the yeast MPO1 gene, whose product belongs to a large, conserved protein family of unknown function, is involved in phytosphingosine metabolism. Our findings provide insights into fatty acid diversity and identify a pathway by which hydroxyl group-containing lipids are metabolized. PMID:25345524

  11. An Abscisic Acid-Independent Oxylipin Pathway Controls Stomatal Closure and Immune Defense in Arabidopsis

    PubMed Central

    Mondy, Samuel; Tranchimand, Sylvain; Rumeau, Dominique; Boudsocq, Marie; Garcia, Ana Victoria; Douki, Thierry; Bigeard, Jean; Laurière, Christiane; Chevalier, Anne; Castresana, Carmen; Hirt, Heribert


    Plant stomata function in innate immunity against bacterial invasion and abscisic acid (ABA) has been suggested to regulate this process. Using genetic, biochemical, and pharmacological approaches, we demonstrate that (i) the Arabidopsis thaliana nine-specific-lipoxygenase encoding gene, LOX1, which is expressed in guard cells, is required to trigger stomatal closure in response to both bacteria and the pathogen-associated molecular pattern flagellin peptide flg22; (ii) LOX1 participates in stomatal defense; (iii) polyunsaturated fatty acids, the LOX substrates, trigger stomatal closure; (iv) the LOX products, fatty acid hydroperoxides, or reactive electrophile oxylipins induce stomatal closure; and (v) the flg22-mediated stomatal closure is conveyed by both LOX1 and the mitogen-activated protein kinases MPK3 and MPK6 and involves salicylic acid whereas the ABA-induced process depends on the protein kinases OST1, MPK9, or MPK12. Finally, we show that the oxylipin and the ABA pathways converge at the level of the anion channel SLAC1 to regulate stomatal closure. Collectively, our results demonstrate that early biotic signaling in guard cells is an ABA-independent process revealing a novel function of LOX1-dependent stomatal pathway in plant immunity. PMID:23526882

  12. Growth kinetics, nutrient uptake, and expression of the Alcaligenes eutrophus poly(beta-hydroxybutyrate) synthesis pathway in transgenic maize cell suspension cultures.


    Hahn, J J; Eschenlauer, A C; Narrol, M H; Somers, D A; Srienc, F


    Transgenic suspension cultures of Black Mexican Sweet maize (Zea mays L.) expressing the Alcaligenes eutrophus genes encoding enzymes of the pathway for biosynthesis of the biodegradable polymer poly(beta-hydroxybutyrate) (PHB) were established as a tool for investigating metabolic regulation of the PHB pathway in plant cells. Cultures were grown in a 2 L modified mammalian cell bioreactor and in shake flasks. Biomass doubling times for transgenic bioreactor cultures (3.42 +/- 0.76 days) were significantly higher than those for untransformed cultures (2.01 +/- 0.33 days). Transgenic expression of the bacterial enzymes beta-ketothiolase (0.140 units/mg protein) and acetoacetyl-CoA reductase (0.636 units/mg protein) was detected by enzyme assays and immunoblots. However, over the first 2 years of cultivation, reductase activity decreased to 0.120 units/mg proteins. Furthermore, the PHB synthase gene, although initially present, was not detectable after 1.5 years of cultivation in suspension culture. These facts suggest that transgenic expression of PHB pathway genes in plant cells may not be stable. A hydroxybutyrate derivative was detected via gas chromatography even after 4 years of cultivation. Although the method used to prepare samples for gas chromatography cannot directly distinguish among PHB polymer, hydroxybutyryl-CoA (HB-CoA), and hydroxybutyric acid, solvent washing experiments indicated that most or all of the signal was non-polymeric, presumably H-CoA. The synthesis of HB-CoA appeared to be linked to substrate growth limitation, with HB-CoA accumulation increasing dramatically and cell growth ceasing upon depletion of ammonium. This suggests that the PHB synthesis pathway in plants is subject to regulatory mechanisms similar to those in prokaryotic cells. PMID:9265773

  13. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi


    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  14. Stable isotope studies reveal pathways for the incorporation of non-essential amino acids in Acyrthosiphon pisum (pea aphids).


    Haribal, Meena; Jander, Georg


    Plant roots incorporate inorganic nitrogen into the amino acids glutamine, glutamic acid, asparagine and aspartic acid, which together serve as the primary metabolites of nitrogen transport to other tissues. Given the preponderance of these four amino acids, phloem sap is a nutritionally unbalanced diet for phloem-feeding insects. Therefore, aphids and other phloem feeders typically rely on microbial symbionts for the synthesis of essential amino acids. To investigate the metabolism of the four main transport amino acids by the pea aphid (Acyrthosiphon pisum), and its Buchnera aphidicola endosymbionts, aphids were fed defined diets with stable isotope-labeled glutamine, glutamic acid, asparagine or aspartic acid (U-(13)C, U-(15)N; U-(15)N; α-(15)N; or γ-(15)N). The metabolic fate of the dietary (15)N and (13)C was traced using gas chromatography-mass spectrometry (GC-MS). Nitrogen was the major contributor to the observed amino acid isotopomers with one additional unit mass (M+1). However, there was differential incorporation, with the amine nitrogen of asparagine being incorporated into other amino acids more efficiently than the amide nitrogen. Higher isotopomers (M+2, M+3 and M+4) indicated the incorporation of varying numbers of (13)C atoms into essential amino acids. GC-MS assays also showed that, even with an excess of dietary labeled glutamine, glutamic acid, asparagine or aspartic acid, the overall content of these amino acids in aphid bodies was mostly the product of catabolism of dietary amino acids and subsequent re-synthesis within the aphids. Thus, these predominant dietary amino acids are not passed directly to Buchnera endosymbionts for synthesis of essential amino acids, but are rather are produced de novo, most likely by endogenous aphid enzymes. PMID:26632455

  15. Visible-light photoredox synthesis of unnatural chiral α-amino acids.


    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua


    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  16. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua


    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  17. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.


    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  18. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.


    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  19. Cell Division During Inhibition of Deoxyribonucleic Acid Synthesis in Escherichia coli

    PubMed Central

    Helmstetter, Charles E.; Pierucci, Olga


    When cultures of Escherichia coli B/r growing at various rates were exposed to ultraviolet light, mitomycin C, or nalidixic acid, deoxyribonucleic acid (DNA) synthesis stopped but cell division continued for at least 20 min. The chromosome configurations in the cells which divided were estimated by determining the rate of DNA synthesis during the division cycle. The cultures were pulse-labeled with 14C-thymidine, and the amount of label incorporated into cells of different ages was found by measuring the radioactivity in cells born subsequent to the labeling period. The cells which divided in the absence of DNA synthesis were those which had completed a round of chromosome replication prior to the treatments. It was concluded that completion of a round of replication is a necessary and sufficient condition of DNA synthesis for cell division. PMID:4870278

  20. The orphan GPCR, Gpr161, regulates the retinoic acid and canonical Wnt pathways during neurulation.


    Li, Bo I; Matteson, Paul G; Ababon, Myka F; Nato, Alejandro Q; Lin, Yong; Nanda, Vikas; Matise, Tara C; Millonig, James H


    The vacuolated lens (vl) mouse mutation arose on the C3H/HeSnJ background and results in lethality, neural tube defects (NTDs) and cataracts. The vl phenotypes are due to a deletion/frameshift mutation in the orphan GPCR, Gpr161. A recent study using a null allele demonstrated that Gpr161 functions in primary cilia and represses the Shh pathway. We show the hypomorphic Gpr161(vl) allele does not severely affect the Shh pathway. To identify additional pathways regulated by Gpr161 during neurulation, we took advantage of naturally occurring genetic variation in the mouse. Previously Gpr161(vl-C3H) was crossed to different inbred backgrounds including MOLF/EiJ and the Gpr161(vl) mutant phenotypes were rescued. Five modifiers were mapped (Modvl: Modifier of vl) including Modvl5(MOLF). In this study we demonstrate the Modvl5(MOLF) congenic rescues the Gpr161(vl)-associated lethality and NTDs but not cataracts. Bioinformatics determined the transcription factor, Cdx1, is the only annotated gene within the Modvl5 95% CI co-expressed with Gpr161 during neurulation and not expressed in the eye. Using Cdx1 as an entry point, we identified the retinoid acid (RA) and canonical Wnt pathways as downstream targets of Gpr161. QRT-PCR, ISH and IHC determined that expression of RA and Wnt genes are down-regulated in Gpr161(vl/vl) but rescued by the Modvl5(MOLF) congenic during neurulation. Intraperitoneal RA injection restores expression of canonical Wnt markers and rescues Gpr161(vl/vl) NTDs. These results establish the RA and canonical Wnt as pathways downstream of Gpr161 during neurulation, and suggest that Modvl5(MOLF) bypasses the Gpr161(vl) mutation by restoring the activity of these pathways. PMID:25753732

  1. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra


    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  2. Synthesis and proteinase inhibitory properties of diphenyl phosphonate analogues of aspartic and glutamic acids.


    Hamilton, R; Walker, B; Walker, B J


    The synthesis of diphenyl phosphonate analogues of aspartic and glutamic acid, and their inhibitory activity against S. aureus V8 protease and granzyme B, is described. The study has revealed difficulties with protecting group compatibility in the synthesis of these analogues. Two analogues, Acetyl. AspP (OPh)2 and Acetyl.GluP (OPh)2 were found to function as irreversible inactivators of V8 proteinase, yet exhibit no activity against granzyme B. PMID:9873408

  3. Putrescine production via the ornithine decarboxylation pathway improves the acid stress survival of Lactobacillus brevis and is part of a horizontally transferred acid resistance locus.


    Romano, Andrea; Ladero, Victor; Alvarez, Miguel A; Lucas, Patrick M


    Decarboxylation pathways are widespread among lactic acid bacteria; their physiological role is related to acid resistance through the regulation of the intracellular pH and to the production of metabolic energy via the generation of a proton motive force and its conversion into ATP. These pathways include, among others, biogenic amine (BA) production pathways. BA accumulation in foodstuffs is a health risk; thus, the study of the factors involved in their production is of major concern. The analysis of several lactic acid bacterial strains isolated from different environments, including fermented foods and beverages, revealed that the genes encoding these pathways are clustered on the chromosome, which suggests that these genes are part of a genetic hotspot related to acid stress resistance. Further attention was devoted to the ornithine decarboxylase pathway, which affords putrescine from ornithine. Studies were performed on three lactic acid bacteria belonging to different species. The ODC pathway was always shown to be involved in cytosolic pH alkalinisation and acid shock survival, which were observed to occur with a concomitant increase in putrescine production. PMID:24495587

  4. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.


    Klisch, M; Häder, D-P


    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption. PMID:11849984

  5. Mechanism of Shope Fibroma Virus-Induced Suppression of Host Deoxyribonucleic Acid Synthesis

    PubMed Central

    Chan, James C.; Hodes, M. E.


    The effects of treatment with live or inactivated Shope fibroma virus on host cell deoxyribonucleic acid (DNA) synthesis were determined. The incorporation of 3H-thymidine into nuclear DNA was suppressed by both active and inactivated virus, although live virus was more effective. During the early phase of infection, stimulation of host nuclear DNA synthesis of up to 240% of control value was observed in cells infected with active virus. Inhibition of DNA synthesis began at about the 8th h and was maximal by 12 h postinfection. Virus inactivated by ultraviolet-irradiation or heat treatment did not induce viral DNA synthesis but was, nevertheless, able to suppress host DNA synthesis. PMID:4202660

  6. Taxol induces paraptosis independent of both protein synthesis and MAPK pathway.


    Sun, Qingrui; Chen, Tongsheng; Wang, Xiaoping; Wei, Xunbin


    Our recent studies have shown that high concentration of taxol induced a caspase-independent paraptosis-like cell death and cytoplasmic vacuolization derived predominantly from endoplasmic reticulum (ER) swelling in human lung carcinoma cell lines (ASTC-a-1). In this report, we further explored the relationship between taxol-induced cell death and vacuolization, and the roles of protein synthesis, mitogen-activated protein kinase kinases (MEK), c-jun N-terminal kinase (JNK) and P38 in taxol-induced paraptosis. Enhanced green fluorescent protein (EGFP) was used to probe the cell morphological change, while ER-targeted red fluorescent protein (er-RFP) was used to probe ER spatial distribution. Real-time monitoring of the ER swelling dynamics during the formation of vacuolization inside single living cells co-expressing EGFP and er-RFP further demonstrated that taxol-induced cytoplasmic vacuolization was from the ER restructuring due to fusion and swelling. PI staining showed that taxol-induced vacuolization was not necrosis. These results further demonstrated that the taxol-induced cell death was neither apoptosis nor necrosis, and fitted the criteria of paraptosis characterized by cytoplasmic vacuolization, caspase-independence, lack of apoptotic morphology and insensitivity to broad caspase inhibitor. Our data further indicated that taxol-induced paraptosis required neither protein synthesis nor the participation of MEK, JNK, and P38, which was different from the insulin-like growth factor I receptor (IGFIR)-induced paraptosis. These results suggest that high concentration of taxol activates an alternative paraptotic cell death pathway. PMID:19918793

  7. Nitric oxide regulates K+ and Cl- channels in guard cells through a subset of abscisic acid-evoked signaling pathways

    PubMed Central

    Garcia-Mata, Carlos; Gay, Robert; Sokolovski, Sergei; Hills, Adrian; Lamattina, Lorenzo; Blatt, Michael R.


    Abscisic acid (ABA) triggers a complex sequence of signaling events that lead to concerted modulation of ion channels at the plasma membrane of guard cells and solute efflux to drive stomatal closure in plant leaves. Recent work has indicated that nitric oxide (NO) and its synthesis are a prerequisite for ABA signal transduction in Arabidopsis and Vicia guard cells. Its mechanism(s) of action is not well defined in guard cells and, generally, in higher plants. Here we show directly that NO selectively regulates Ca2+-sensitive ion channels of Vicia guard cells by promoting Ca2+ release from intracellular stores to raise cytosolic-free [Ca2+]. NO-sensitive Ca2+ release was blocked by antagonists of guanylate cyclase and cyclic ADP ribose-dependent endomembrane Ca2+ channels, implying an action mediated via a cGMP-dependent cascade. NO did not recapitulate ABA-evoked control of plasma membrane Ca2+ channels and Ca2+-insensitive K+ channels, and NO scavengers failed to block the activation of these K+ channels evoked by ABA. These results place NO action firmly within one branch of the Ca2+-signaling pathways engaged by ABA and define the boundaries of parallel signaling events in the control of guard cell movements. PMID:12949257

  8. Molecular modeling and simulation of FabG, an enzyme involved in the fatty acid pathway of Streptococcus pyogenes.


    Shafreen, Rajamohmed Beema; Pandian, Shunmugiah Karutha


    Streptococcus pyogenes (SP) is the major cause of pharyngitis accompanied by strep throat infections in humans. 3-keto acyl reductase (FabG), an important enzyme involved in the elongation cycle of the fatty acid pathway of S. pyogenes, is essential for synthesis of the cell-membrane, virulence factors and quorum sensing-related mechanisms. Targeting SPFabG may provide an important aid for the development of drugs against S. pyogenes. However, the absence of a crystal structure for FabG of S. pyogenes limits the development of structure-based drug designs. Hence, in the present study, a homology model of FabG was generated using the X-ray crystallographic structure of Aquifex aeolicus (PDB ID: 2PNF). The modeled structure was refined using energy minimization. Furthermore, active sites were predicted, and a large dataset of compounds was screened against SPFabG. The ligands were docked using the LigandFit module that is available from Discovery Studio version 2.5. From this list, 13 best hit ligands were chosen based on the docking score and binding energy. All of the 13 ligands were screened for Absorption, Distribution, Metabolism, Excretion and Toxicity (ADMET) properties. From this, the two best descriptors, along with one descriptor that lay outside the ADMET plot, were selected for molecular dynamic (MD) simulation. In vitro testing of the ligands using biological assays further substantiated the efficacy of the ligands that were screened based on the in silico methods. PMID:23988477

  9. Induction of DREB2A pathway with repression of E2F, jasmonic acid biosynthetic and photosynthesis pathways in cold acclimation-specific freeze-resistant wheat crown.


    Karki, Amrit; Horvath, David P; Sutton, Fedora


    Winter wheat lines can achieve cold acclimation (development of tolerance to freezing temperatures) and vernalization (delay in transition from vegetative to reproductive phase) in response to low non-freezing temperatures. To describe cold-acclimation-specific processes and pathways, we utilized cold acclimation transcriptomic data from two lines varying in freeze survival but not vernalization. These lines, designated freeze-resistant (FR) and freeze-susceptible (FS), were the source of crown tissue RNA. Well-annotated differentially expressed genes (p ≤ 0.005 and fold change ≥ 2 in response to 4 weeks cold acclimation) were used for gene ontology and pathway analysis. "Abiotic stimuli" was identified as the most enriched and unique for FR. Unique to FS was "cytoplasmic components." Pathway analysis revealed the "triacylglycerol degradation" pathway as significantly downregulated and common to both FR and FS. The most enriched of FR pathways was "neighbors of DREB2A," with the highest positive median fold change. The "13-LOX and 13-HPL" and the "E2F" pathways were enriched in FR only with a negative median fold change. The "jasmonic acid biosynthesis" pathway and four "photosynthetic-associated" pathways were enriched in both FR and FS but with a more negative median fold change in FR than in FS. A pathway unique to FS was "binding partners of LHCA1," which was enriched only in FS with a significant negative median fold change. We propose that the DREB2A, E2F, jasmonic acid biosynthesis, and photosynthetic pathways are critical for discrimination between cold-acclimated lines varying in freeze survival. PMID:23262780

  10. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )


    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  11. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.


    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  12. Design, Synthesis, and Biological Evaluation of a Series of Anthracene-9,10-dione Dioxime β-Catenin Pathway Inhibitors.


    Soldi, Raffaella; Horrigan, Stephen K; Cholody, Marek W; Padia, Janak; Sorna, Venkataswamy; Bearss, Jared; Gilcrease, Glynn; Bhalla, Kapil; Verma, Anupam; Vankayalapati, Hariprasad; Sharma, Sunil


    The Wnt/β-catenin signaling pathway plays a vital role in cell growth, the regulation, cell development, and the differentiation of normal stem cells. Constitutive activation of the Wnt/β-catenin signaling pathway is found in many human cancers, and thus, it is an attractive target for anticancer therapy. Specific inhibitors of this pathway have been keenly researched and developed. Cell based screening of compounds library, hit-to-lead optimization, computational and structure-based design strategies resulted in the design and synthesis of a series of anthracene-9,10-dione dioxime series of compounds demonstrated potent inhibition of β-catenin in vitro (IC50 < 10 nM, 14) and the growth of several cancer cell lines. This article discusses the potential of inhibiting the Wnt/β-catenin signaling pathway as a therapeutic approach for cancer along with an overview of the development of specific inhibitors. PMID:26182238

  13. Investigation of follicular and non-follicular pathways for polyarginine and oleic acid modified nanoparticles

    PubMed Central

    Hayden, Patrick; Singh, Mandip


    Purpose The aim of the current study was to investigate the percutaneous permeation pathways of cell penetrating peptide modified lipid nanoparticles and oleic acid modified polymeric nanoparticles. Methods Confocal microscopy was performed on skin cultures (EpiDermFT™) for modified and un-modified nanoparticles. Differential stripping was performed following in vitro skin permeation of Ibuprofen (Ibu) encapsulated nanoparticles to estimate Ibu levels in different skin layers and receiver compartment. The hair follicles (HF) were blocked and in vitro skin permeation of nanoparticles was then compared with unblocked HF. The surface modified nanoparticles were investigated for response on allergic contact dermatitis (ACD). Results Surface modified nanoparticles showed a significant higher (p < 0.05) in fluorescence in EpiDermFT™ cultures compared to controls. The HF play less than 5% role in total nanoparticle permeation into the skin. The Ibu levels were significantly high (p<0.05) for surface modified nanoparticles compared to controls. The Ibu levels in skin and receiver compartment were not significantly different when HF were open or closed. Modified nanoparticles showed significant improvement in treatment of ACD compared to solution. Conclusions Our studies demonstrate that increased skin permeation of surface modified nanoparticles is not only dependent on a follicular pathway but also occur through non-follicular pathway(s). PMID:23187866

  14. Improving fatty acids production by engineering dynamic pathway regulation and metabolic control

    PubMed Central

    Xu, Peng; Li, Lingyun; Zhang, Fuming; Stephanopoulos, Gregory; Koffas, Mattheos


    Global energy demand and environmental concerns have stimulated increasing efforts to produce carbon-neutral fuels directly from renewable resources. Microbially derived aliphatic hydrocarbons, the petroleum-replica fuels, have emerged as promising alternatives to meet this goal. However, engineering metabolic pathways with high productivity and yield requires dynamic redistribution of cellular resources and optimal control of pathway expression. Here we report a genetically encoded metabolic switch that enables dynamic regulation of fatty acids (FA) biosynthesis in Escherichia coli. The engineered strains were able to dynamically compensate the critical enzymes involved in the supply and consumption of malonyl-CoA and efficiently redirect carbon flux toward FA biosynthesis. Implementation of this metabolic control resulted in an oscillatory malonyl-CoA pattern and a balanced metabolism between cell growth and product formation, yielding 15.7- and 2.1-fold improvement in FA titer compared with the wild-type strain and the strain carrying the uncontrolled metabolic pathway. This study provides a new paradigm in metabolic engineering to control and optimize metabolic pathways facilitating the high-yield production of other malonyl-CoA–derived compounds. PMID:25049420

  15. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.


    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György


    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  16. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen


    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  17. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines


    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  18. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  19. Ca2+- and PKC-dependent stimulation of PGE2 synthesis by deoxycholic acid in human colonic fibroblasts.


    Zhu, Yingting; Hua, Ping; Rafiq, Shazia; Waffner, Eric J; Duffey, Michael E; Lance, Peter


    We investigated prostanoid biogenesis by human colonic fibroblasts (CCD-18Co cells and nine primary fibroblast cultures) exposed to a primary (cholic, CA) or a secondary (deoxycholic, DCA) bile acid. Basal PGE2 levels in CCD-18Co cultures and fibroblast strains initiated from normal and adenocarcinomatous colon, respectively, were 1.7 +/- 0.3, 4.0 +/- 2.0, and 15.0 +/- 4.8 ng/mg protein. Peak levels 24 h after exposure to DCA (300 microM) rose, respectively, seven-, six- and sevenfold, but CA elicited no such responses. Increases in PGE2 synthesis were preceded by sequential increases in PGH synthase-2 mRNA and protein expression and were fully prevented by a nonselective (indomethacin) or a selective (celecoxib) nonsteroidal anti-inflammatory drug. DCA, but not CA, caused abrupt, transient increases in fibroblast intracellular Ca2+ concentration ([Ca2+]i) approximately 1 min after exposure. Increased [Ca2+]i was required for DCA-mediated induction of PGE2 synthesis, and protein kinase C was a further essential component of this signaling pathway. Colonic fibroblasts may be a major target for prostanoid biogenesis induced by fecal bile acids and, potentially, other noxious actions of these agents. PMID:12181161

  20. Comparative biochemical and immunological studies of the glycine betaine synthesis pathway in diverse families of dicotyledons.


    Weretilnyk, E A; Bednarek, S; McCue, K F; Rhodes, D; Hanson, A D


    Members of the Chenopodiaceae can accumulate high levels (>100 μmol·(g DW)(-1)) of glycine betaine (betaine) in leaves when salinized. Chenopodiaceae synthesize betaine by a two-step oxidation of choline (choline→betaine aldehyde→ betaine), with the second step catalyzed by betaine aldehyde dehydrogenase (BADH, EC High betaine levels have also been reported in leaves of species from several distantly-related families of dicotyledons, raising the question of whether the same betaine-synthesis pathway is used in all cases.Fast atom bombardment mass spectrometry showed that betaine levels of >100 μmol·(g DW)(-1) are present in Lycium ferocissimum Miers (Solanaceae), Helianthus annuus L. (Asteraceae), Convolvulus arvensis L. (Convolvulaceae), and Amaranthus caudatus L. (Amaranthaceae), that salinization promotes betaine accumulation in these plants, and that they can convert supplied choline to betaine aldehyde and betaine. Nicotiana tabacum L. and Lycopersicon lycopersicum (L.) Karst. ex Farw. (Solanaceae), Lactuca sativa L. (Asteraceae) and Ipomoea purpurea L. (Convolvulaceae) also contained betaine, but at a low level (0.1-0.5 μmol·(g DW)(-1). Betaine aldehyde dehydrogenase activity assays, immunotitration and immunoblotting demonstrated that the betaine-accumulating species have a BADH enzyme recognized by antibodies raised against BADH from Spinacia oleracea L. (Chenopodiaceae), and that the Mr of the BADH monomer is in all cases close to 63 000. These data indicate that the choline→betaine aldehyde→betaine pathway may have evolved by vertical descent from an early angiosperm ancestor, and might be widespread (albeit not always strongly expressed) among flowering plants. Consistent with these suggestions, Magnolia x soulangiana was found to have a low level of betaine, and to express a protein of Mr 63 000 which cross-reacted with antibodies to BADH from Spinacia oleracea. PMID:24212901

  1. Functional convergence of oxylipin and abscisic acid pathways controls stomatal closure in response to drought.


    Savchenko, Tatyana; Kolla, Venkat A; Wang, Chang-Quan; Nasafi, Zainab; Hicks, Derrick R; Phadungchob, Bpantamars; Chehab, Wassim E; Brandizzi, Federica; Froehlich, John; Dehesh, Katayoon


    Membranes are primary sites of perception of environmental stimuli. Polyunsaturated fatty acids are major structural constituents of membranes that also function as modulators of a multitude of signal transduction pathways evoked by environmental stimuli. Different stresses induce production of a distinct blend of oxygenated polyunsaturated fatty acids, "oxylipins." We employed three Arabidopsis (Arabidopsis thaliana) ecotypes to examine the oxylipin signature in response to specific stresses and determined that wounding and drought differentially alter oxylipin profiles, particularly the allene oxide synthase branch of the oxylipin pathway, responsible for production of jasmonic acid (JA) and its precursor 12-oxo-phytodienoic acid (12-OPDA). Specifically, wounding induced both 12-OPDA and JA levels, whereas drought induced only the precursor 12-OPDA. Levels of the classical stress phytohormone abscisic acid (ABA) were also mainly enhanced by drought and little by wounding. To explore the role of 12-OPDA in plant drought responses, we generated a range of transgenic lines and exploited the existing mutant plants that differ in their levels of stress-inducible 12-OPDA but display similar ABA levels. The plants producing higher 12-OPDA levels exhibited enhanced drought tolerance and reduced stomatal aperture. Furthermore, exogenously applied ABA and 12-OPDA, individually or combined, promote stomatal closure of ABA and allene oxide synthase biosynthetic mutants, albeit most effectively when combined. Using tomato (Solanum lycopersicum) and Brassica napus verified the potency of this combination in inducing stomatal closure in plants other than Arabidopsis. These data have identified drought as a stress signal that uncouples the conversion of 12-OPDA to JA and have revealed 12-OPDA as a drought-responsive regulator of stomatal closure functioning most effectively together with ABA. PMID:24429214

  2. Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...

  3. Characterization of the Kynurenine Pathway and Quinolinic Acid Production in Macaque Macrophages

    PubMed Central

    Lim, Chai K.; Yap, Margaret M.C.; Kent, Stephen J.; Gras, Gabriel; Samah, Boubekeur; Batten, Jane C.; De Rose, Robert; Heng, Benjamin; Brew, Bruce J.; Guillemin, Gilles J.


    The kynurenine pathway (KP) and one of its end-products, the excitotoxin quinolinic acid (QUIN), are involved in the pathogenesis of several major neuroinflammatory brain diseases. A relevant animal model to study KP metabolism is now needed to assess whether intervention in this pathway may improve the outcome of such diseases. Humans and macaques share a very similar genetic makeup. In this study, we characterized the KP metabolism in macaque primary macrophages of three different species in comparison to human cells. We found that the KP profiles in simian macrophages were very similar to those in humans when challenged with inflammatory cytokines. Further, we found that macaque macrophages are capable of producing a pathophysiological concentration of QUIN. Our data validate the simian model as a relevant model to study the human cellular KP metabolism in the context of inflammation. PMID:23761975

  4. The autotaxin-lysophosphatidic acid pathway in pathogenesis of rheumatoid arthritis.


    Orosa, Beatriz; García, Samuel; Conde, Carmen


    Lysophosphatidic acid (LPA) is a phospholipid that is mainly produced by the hydrolysis of lysophosphatidylcholine (LPC) by lysophospholipase D, which is also called autotaxin (ATX). LPA interacts with specific G-protein coupled receptors and is involved in the regulation of cellular survival, proliferation, differentiation and motility. LPA also has roles in several pathological disorders, such as cancer and pulmonary, dermal and renal fibrosis. The involvement of the ATX-LPA pathway has recently been demonstrated in inflammatory responses and apoptosis of fibroblast-like synoviocytes (FLS) from patients with rheumatoid arthritis and during the development of experimental arthritis. This review summarises the current literature of the ATX-LPA pathway in rheumatoid arthritis. PMID:26297977

  5. Changes in actin dynamics are involved in salicylic acid signaling pathway.


    Matoušková, Jindřiška; Janda, Martin; Fišer, Radovan; Sašek, Vladimír; Kocourková, Daniela; Burketová, Lenka; Dušková, Jiřina; Martinec, Jan; Valentová, Olga


    Changes in actin cytoskeleton dynamics are one of the crucial players in many physiological as well as non-physiological processes in plant cells. Positioning of actin filament arrays is necessary for successful establishment of primary lines of defense toward pathogen attack, depolymerization leads very often to the enhanced susceptibility to the invading pathogen. On the other hand it was also shown that the disruption of actin cytoskeleton leads to the induction of defense response leading to the expression of PATHOGENESIS RELATED proteins (PR). In this study we show that pharmacological actin depolymerization leads to the specific induction of genes in salicylic acid pathway but not that involved in jasmonic acid signaling. Life imaging of leafs of Arabidopsis thaliana with GFP-tagged fimbrin (GFP-fABD2) treated with 1 mM salicylic acid revealed rapid disruption of actin filaments resembling the pattern viewed after treatment with 200 nM latrunculin B. The effect of salicylic acid on actin filament fragmentation was prevented by exogenous addition of phosphatidic acid, which binds to the capping protein and thus promotes actin polymerization. The quantitative evaluation of actin filament dynamics is also presented. PMID:24767113

  6. The prebiotic synthesis of amino acids - interstellar vs. atmospheric mechanisms

    NASA Astrophysics Data System (ADS)

    Meierhenrich, U. J.; Muñoz Caro, G. M.; Schutte, W. A.; Barbier, B.; Arcones Segovia, A.; Rosenbauer, H.; Thiemann, W. H.-P.; Brack, A.


    Until very recently, prebiotic amino acids were believed to have been generated in the atmosphere of the early Earth, as successfully simulated by the Urey-Miller experiments. Two independent studies now identified ice photochemistry in the interstellar medium as a possible source of prebiotic amino acids. Ultraviolet irradiation of ice mixtures containing identified interstellar molecules (such as H2O, CO2, CO, CH3OH, and NH3) in the conditions of vacuum and low temperature found in the interstellar medium generated amino acid structures including glycine, alanine, serine, valine, proline, and aspartic acid. After warmup, hydrolysis and derivatization, our team was able to identify 16 amino acids as well as furans and pyrroles. Enantioselective analyses of the amino acids showed racemic mixtures. A prebiotic interstellar origin of amino acid structures is now discussed to be a plausible alternative to the Urey-Miller mechanism.

  7. Synthesis of new optically active propargylic fluorides and application to the enantioselective synthesis of monofluorinated analogues of fatty acid metabolites.


    Prakesch, M; Grée, D; Grée, R


    A new approach to obtain optically active unsaturated or polyunsaturated systems with a single fluorine atom in an allylic or propargylic position is reported. Central to this strategy is the high regio- and stereocontrol observed during the fluorination of propargylic alcohols allowing a short and efficient synthesis of 1. Further, simple functional group transformations gave the enals 2 and 3. These three key intermediates were used for the preparation of optically active monofluorinated analogues of fatty acid metabolites. PMID:11325281

  8. Effect of the “Ribonucleic Acid Control” Locus in Escherichia coli on T4 Bacteriophage-Specific Ribonucleic Acid Synthesis

    PubMed Central

    Sköld, Ola


    Amino acid control of ribonucleic acid (RNA) synthesis in bacteria is known to be governed genetically by the rel locus. We investigated whether the rel gene of the host would also exert its effect on the regulation of phage-specific RNA synthesis in T4 phage-infected Escherichia coli cells. Since T-even phage infection completely shuts off host macromolecular synthesis, phage RNA synthesis could be followed specifically by the cumulative incorporation of radioactivity from labeled precursors into RNA of infected cells. Labeled uracil was shown to accumulate in phage-specific RNA for 30 to 35 min after infection, a phenomenon which probably reflects an expansion of the labile phage-RNA pool. Amino acid starvation was effected by the use of auxotrophic bacterial strains or thienylalanine. The latter substance is an amino acid analogue which induces a chemical auxotrophy by inhibiting the biosynthesis of phenylalanine, tyrosine, and tryptophan. Phage RNA synthesis was strictly dependent on the presence of amino acids, whereas phage deoxyribonucleic acid synthesis was not. By the use of several pairs of bacterial strains which were isogenic except for the rel gene, it was demonstrated that amino acid dependence was related to the allelic state of this gene. If the rel gene was mutated, amino acid starvation did not restrict phage RNA synthesis. PMID:4914097

  9. Synthesis of bio-based methacrylic acid by decarboxylation of itaconic acid and citric acid catalyzed by solid transition-metal catalysts.


    Le Nôtre, Jérôme; Witte-van Dijk, Susan C M; van Haveren, Jacco; Scott, Elinor L; Sanders, Johan P M


    Methacrylic acid, an important monomer for the plastics industry, was obtained in high selectivity (up to 84%) by the decarboxylation of itaconic acid using heterogeneous catalysts based on Pd, Pt and Ru. The reaction takes place in water at 200-250 °C without any external added pressure, conditions significantly milder than those described previously for the same conversion with better yield and selectivity. A comprehensive study of the reaction parameters has been performed, and the isolation of methacrylic acid was achieved in 50% yield. The decarboxylation procedure is also applicable to citric acid, a more widely available bio-based feedstock, and leads to the production of methacrylic acid in one pot in 41% selectivity. Aconitic acid, the intermediate compound in the pathway from citric acid to itaconic acid was also used successfully as a substrate. PMID:25045161

  10. Platelet 12-lipoxygenase activation via glycoprotein VI: involvement of multiple signaling pathways in agonist control of H(P)ETE synthesis.


    Coffey, Marcus J; Jarvis, Gavin E; Gibbins, Jonathan M; Coles, Barbara; Barrett, Natasha E; Wylie, Oliver R E; O'Donnell, Valerie B


    Lipoxygenases (LOX) contribute to vascular disease and inflammation through generation of bioactive lipids, including 12-hydro(pero)xyeicosatetraenoic acid (12-H(P)ETE). The physiological mechanisms that acutely control LOX product generation in mammalian cells are uncharacterized. Human platelets that contain a 12-LOX isoform (p12-LOX) were used to define pathways that activate H(P)ETE synthesis in the vasculature. Collagen and collagen-related peptide (CRP) (1 to 10 microg/mL) acutely induced platelet 12-H(P)ETE synthesis. This implicated the collagen receptor glycoprotein VI (GPVI), which signals via the immunoreceptor-based activatory motif (ITAM)-containing FcRgamma chain. Conversely, thrombin only activated at high concentrations (> 0.2 U/mL), whereas U46619 and ADP alone were ineffective. Collagen or CRP-stimulated 12-H(P)ETE generation was inhibited by staurosporine, PP2, wortmannin, BAPTA/AM, EGTA, and L-655238, implicating src-tyrosine kinases, PI3-kinase, Ca2+ mobilization, and p12-LOX translocation. In contrast, protein kinase C (PKC) inhibition potentiated 12-H(P)ETE generation. Finally, activation of the immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing platelet endothelial cell adhesion molecule (PECAM-1) inhibited p12-LOX product generation. This study characterizes a receptor-dependent pathway for 12-H(P)ETE synthesis via the collagen receptor GPVI, which is negatively regulated by PECAM-1 and PKC, and demonstrates a novel link between immune receptor signaling and lipid mediator generation in the vasculature. PMID:15142951


    PubMed Central

    Metz, Stewart; VanRollins, Michael; Strife, Robert; Fujimoto, Wilfred; Robertson, R. Paul


    Metabolism of arachidonic acid (AA) via the cyclooxygenase pathway reduces glucose-stimulated insulin release. However, metabolism of AA by the lipoxygenase pathway and the consequent effects on insulin secretion have not been simultaneously assessed in the endocrine islet. Both dispersed endocrine cell-enriched pancreatic cells of the neonatal rat, as well as intact islets of the adult rat, metabolized [3H]AA not only to cyclooxygenase products (prostaglandins E2, F2α, and prostacyclin) but also to the lipoxygenase product 12-hydroxyeicosatetraenoic acid (12-HETE). 12-HETE was identified by coelution with authentic tritiated or unlabeled 12-HETE using four high performance liquid chromatographic systems under eight mobile-phase conditions and its identity was confirmed by gas chromatography/mass spectrometry using selected ion monitoring. The predominant effect of exogenous AA (5 μg/ml) was to stimulate insulin release from pancreatic cells grown in monolayer. This effect was concentration- and time-dependent, and reversible. The effect of AA upon insulin release was potentiated by a cyclooxygenase inhibitor (indomethacin) and was prevented by either of two lipoxygenase inhibitors (5,8,11,14-eicosatetraynoic acid [ETYA] and BW755c). In addition, glucose, as well as two structurally dissimilar agents (the calcium ionophore A23187 and bradykinin), which activate phospholipase(s) and thereby release endogenous AA in several cell systems, also stimulated insulin secretion. The effects of glucose, glucagon, bradykinin and high concentrations of A23187 (5 μg/ml) to augment insulin release were blocked or considerably reduced by lipoxygenase inhibitors. However, a lower concentration of the ionophore (0.25 μg/ml), which did not appear to activate phospholipase, was resistant to blockade. Exogenous 12-HETE (up to 2,000 ng/ml) did not alter glucose-induced insulin release. However, the labile intermediate 12-hydroperoxy-ETE increased insulin release. Furthermore

  12. Delineating the pathways for the site-directed synthesis of individual nanoparticles on surfaces

    PubMed Central

    Liu, Guoliang; Eichelsdoerfer, Daniel J.; Rasin, Boris; Zhou, Yu; Brown, Keith A.; Liao, Xing; Mirkin, Chad A.


    Although nanoparticles with exquisite properties have been synthesized for a variety of applications, their incorporation into functional devices is challenging owing to the difficulty in positioning them at specified sites on surfaces. In contrast with the conventional synthesis-then-assembly paradigm, scanning probe block copolymer lithography can pattern precursor materials embedded in a polymer matrix and synthesize desired nanoparticles on site, offering great promise for incorporating nanoparticles into devices. This technique, however, is extremely limited from a materials standpoint. To develop a materials-general method for synthesizing nanoparticles on surfaces for broader applications, a mechanistic understanding of polymer-mediated nanoparticle formation is crucial. Here, we design a four-step synthetic process that enables independent study of the two most critical steps for synthesizing single nanoparticles on surfaces: phase separation of precursors and particle formation. Using this process, we elucidate the importance of the polymer matrix in the diffusion of metal precursors to form a single nanoparticle and the three pathways that the precursors undergo to form nanoparticles. Based on this mechanistic understanding, the synthetic process is generalized to create metal (Au, Ag, Pt, and Pd), metal oxide (Fe2O3, Co2O3, NiO, and CuO), and alloy (AuAg) nanoparticles. This mechanistic understanding and resulting process represent a major advance in scanning probe lithography as a tool to generate patterns of tailored nanoparticles for integration with solid-state devices. PMID:23277538

  13. Towards direct synthesis of alane: A predicted defect-mediated pathway confirmed experimentally


    Wang, Lin -Lin; Herwadkar, Aditi; Reich, Jason M.; Johnson, Duane D.; House, Stephen D.; Pena-Martin, Pamela; Rockett, Angus A.; Robertson, Ian M.; Gupta, Shalabh; Pecharsky, Vitalij K.


    Here, alane (AlH3) is a unique energetic material that has not found a broad practical use for over 70 years because it is difficult to synthesize directly from its elements. Using density functional theory, we examine the defect-mediated formation of alane monomers on Al(111) in a two-step process: (1) dissociative adsorption of H2 and (2) alane formation, which are both endothermic on a clean surface. Only with Ti dopant to facilitate H2 dissociation and vacancies to provide Al adatoms, both processes become exothermic. In agreement, in situ scanning tunneling microscopy showed that during H2 exposure, alane monomers and clusters formmore » primarily in the vicinity of Al vacancies and Ti atoms. Moreover, ball milling of the Al samples with Ti (providing necessary defects) showed a 10 % conversion of Al into AlH3 or closely related species at 344 bar H2, indicating that the predicted pathway may lead to the direct synthesis of alane from elements at pressures much lower than the 104 bar expected from bulk thermodynamics.« less

  14. Towards Direct Synthesis of Alane: A Predicted Defect-Mediated Pathway Confirmed Experimentally.


    Wang, Lin-Lin; Herwadkar, Aditi; Reich, Jason M; Johnson, Duane D; House, Stephen D; Peña-Martin, Pamela; Rockett, Angus A; Robertson, Ian M; Gupta, Shalabh; Pecharsky, Vitalij K


    Alane (AlH3 ) is a unique energetic material that has not found a broad practical use for over 70 years because it is difficult to synthesize directly from its elements. Using density functional theory, we examine the defect-mediated formation of alane monomers on Al(111) in a two-step process: (1) dissociative adsorption of H2 and (2) alane formation, which are both endothermic on a clean surface. Only with Ti dopant to facilitate H2 dissociation and vacancies to provide Al adatoms, both processes become exothermic. In agreement, in situ scanning tunneling microscopy showed that during H2 exposure, alane monomers and clusters form primarily in the vicinity of Al vacancies and Ti atoms. Moreover, ball milling of the Al samples with Ti (providing necessary defects) showed a 10 % conversion of Al into AlH3 or closely related species at 344 bar H2 , indicating that the predicted pathway may lead to the direct synthesis of alane from elements at pressures much lower than the 10(4)  bar expected from bulk thermodynamics. PMID:27535100

  15. CAR and PXR agonists stimulate hepatic bile acid and bilirubin detoxification and elimination pathways in mice.


    Wagner, Martin; Halilbasic, Emina; Marschall, Hanns-Ulrich; Zollner, Gernot; Fickert, Peter; Langner, Cord; Zatloukal, Kurt; Denk, Helmut; Trauner, Michael


    Induction of hepatic phase I/II detoxification enzymes and alternative excretory pumps may limit hepatocellular accumulation of toxic biliary compounds in cholestasis. Because the nuclear xenobiotic receptors constitutive androstane receptor (CAR) and pregnane X receptor (PXR) regulate involved enzymes and transporters, we aimed to induce adaptive alternative pathways with different CAR and PXR agonists in vivo. Mice were treated with the CAR agonists phenobarbital and 1,4-bis-[2-(3,5-dichlorpyridyloxy)]benzene, as well as the PXR agonists atorvastatin and pregnenolone-16alpha-carbonitrile. Hepatic bile acid and bilirubin-metabolizing/detoxifying enzymes (Cyp2b10, Cyp3a11, Ugt1a1, Sult2a1), their regulatory nuclear receptors (CAR, PXR, farnesoid X receptor), and bile acid/organic anion and lipid transporters (Ntcp, Oatp1,2,4, Bsep, Mrp2-4, Mdr2, Abcg5/8, Asbt) in the liver and kidney were analyzed via reverse-transcriptase polymerase chain reaction and Western blotting. Potential functional relevance was tested in common bile duct ligation (CBDL). CAR agonists induced Mrp2-4 and Oatp2; PXR agonists induced only Mrp3 and Oatp2. Both PXR and CAR agonists profoundly stimulated bile acid-hydroxylating/detoxifying enzymes Cyp3a11 and Cyp2b10. In addition, CAR agonists upregulated bile acid-sulfating Sult2a1 and bilirubin-glucuronidating Ugt1a1. These changes were accompanied by reduced serum levels of bilirubin and bile acids in healthy and CBDL mice and by increased levels of polyhydroxylated bile acids in serum and urine of cholestatic mice. Atorvastatin significantly increased Oatp2, Mdr2, and Asbt, while other transporters and enzymes were moderately affected. In conclusion, administration of specific CAR or PXR ligands results in coordinated stimulation of major hepatic bile acid/bilirubin metabolizing and detoxifying enzymes and hepatic key alternative efflux systems, effects that are predicted to counteract cholestasis. PMID:15986414

  16. Expression of lauroyl-acyl carrier protein thioesterase in brassica napus seeds induces pathways for both fatty acid oxidation and biosynthesis and implies a set point for triacylglycerol accumulation

    PubMed Central

    Eccleston, VS; Ohlrogge, JB


    Expression of a California bay lauroyl-acyl carrier protein thioesterase (MCTE) in developing seeds of transgenic oilseed rape alters the fatty acid composition of the mature seed, resulting in up to 60 mol% of laurate in triacylglycerols. In this study, we examined the metabolism of lauric acid and 14C-acetate in developing seeds of oilseed rape that express high levels of MCTE. Lauroyl-CoA oxidase activity but not palmitoyl-CoA oxidase activity was increased several-fold in developing seeds expressing MCTE. In addition, isocitrate lyase and malate synthase activities were six- and 30-fold higher, respectively, in high-laurate developing seeds. Control seeds incorporated 14C-acetate almost entirely into fatty acids, whereas in seeds expressing MCTE, only 50% of the label was recovered in lipids and the remainder was in a range of water-soluble components, including sucrose and malate. Together, these results indicate that the pathways for beta-oxidation and the glyoxylate cycle have been induced in seeds expressing high levels of MCTE. Although a substantial portion of the fatty acid produced in these seeds is recycled to acetyl-CoA and sucrose through the beta-oxidation and glyoxylate cycle pathways, total seed oil is not reduced. How is oil content maintained if lauric acid is inefficiently converted to triacylglycerol? The levels of acyl carrier protein and several enzymes of fatty acid synthesis were increased two- to threefold at midstage development in high-laurate seeds. These results indicate that a coordinate induction of the fatty acid synthesis pathway occurs, presumably to compensate for the lauric acid lost through beta-oxidation or for a shortage of long-chain fatty acids. PMID:9548986

  17. Inhibition of Melanogenesis by Gallic Acid: Possible Involvement of the PI3K/Akt, MEK/ERK and Wnt/β-Catenin Signaling Pathways in B16F10 Cells

    PubMed Central

    Su, Tzu-Rong; Lin, Jen-Jie; Tsai, Chi-Chu; Huang, Tsu-Kei; Yang, Zih-Yan; Wu, Ming-O; Zheng, Yu-Qing; Su, Ching-Chyuan; Wu, Yu-Jen


    Gallic acid is one of the major flavonoids found in plants. It acts as an antioxidant, and seems to have anti-inflammatory, anti-viral, and anti-cancer properties. In this study, we investigated the effects of gallic acid on melanogenesis, including the activation of melanogenesis signaling pathways. Gallic acid significantly inhibited both melanin synthesis and tyrosinase activity in a dose- and time-dependent manner, and decreased the expression of melanogenesis-related proteins, such as microphthalmia-associated transcription factor (MITF), tyrosinase, tyrosinase-related protein-1 (TRP1), and dopachrome tautomerase (Dct). In addition, gallic acid also acts by phosphorylating and activating melanogenesis inhibitory proteins such as Akt and mitogen-activated protein kinase (MEK)/extracellular signal-regulated kinase (ERK). Using inhibitors against PI3K/Akt (LY294002) or MEK/ERK-specific (PD98059), the hypopigmentation effect was suppressed, and the gallic acid-initiated activation of MEK/ERK and PI3K/Akt was also revoked. Gallic acid also increased GSK3β and p-β-catenin expression but down-regulated p-GSK3β. Moreover, GSK3β-specific inhibitor (SB216763) restored gallic acid-induced melanin reduction. These results suggest that activation of the MEK/ERK, PI3K/Akt, and inhibition of Wnt/β-catenin signaling pathways is involved in the melanogenesis signaling cascade, and that activation by gallic acid reduces melanin synthesis via down-regulation of MITF and its downstream signaling pathway. In conclusion, gallic acid may be a potentially agent for the treatment of certain skin conditions. PMID:24129178

  18. NO synthesis from arginine is favored by α-linolenic acid in mice fed a high-fat diet.


    Hermier, Dominique; Guelzim, Najoua; Martin, Pascal G P; Huneau, Jean-François; Mathé, Véronique; Quignard-Boulangé, Annie; Lasserre, Frédéric; Mariotti, François


    Alterations in NO availability and signaling play a pivotal role at early stages of the metabolic syndrome (MetSynd). We hypothesized that dietary α-linolenic acid (ALA, 18:3 n-3) favors NO availability by modulating amino acid metabolism, with a specific impact on the arginine-NO pathway. Mice were fed a hyperlipidic diet (285 g lipid/kg, 51.1 % energy), rich in either saturated fatty acids (SFA, provided by palm oil, PALM group) or ALA (provided by linseed oil, LIN group). We measured whole-body NO synthesis and systemic arginine hydrolysis with a tracer-based method, plasma concentration of related metabolites, and hepatic mRNA level of related enzymes, and the study was completed by a transcriptomic analysis in the liver. As expected with this model, hyperlipidic diets resulted in increased adiposity and glycemia after 5 weeks. As compared to PALM mice, LIN mice had a higher plasma nitrite and nitrate concentration, a higher whole-body conversion of arginine into NO vs urea, and a similar plasma concentration of asymmetric dimethylarginine (ADMA), despite a higher expression of the liver dimethylargininase-1. In LIN mice, there was a higher expression of genes involved in PPARα signaling, but a little impact on gene expression related to amino acids and arginine metabolism. This effect cannot be directly ascribed to changes in arginase activity in the liver or ADMA metabolism, nor to direct regulation of the related target genes. In conclusion, dietary ALA favors NO synthesis, which could contribute to rescue NO availability when jeopardized by the nutritional conditions in relation with the initiation of the MetSynd. PMID:27178023

  19. Synthesis and antimycobacterial evaluation of new trans-cinnamic acid hydrazide derivatives.


    Carvalho, Samir A; da Silva, Edson F; de Souza, Marcus V N; Lourenço, Maria C S; Vicente, Felipe R


    In this work, we report the synthesis and the antimycobacterial evaluation of new trans-cinnamic acid derivatives of isonicotinic acid series (5) and benzoic acid series (6), designed by exploring the molecular hybridization approach between isoniazid (1) and trans-cinnamic acid derivative (3). The minimum inhibitory concentration (MIC) of the compounds 5a-d and 6c exhibited activity between 3.12 and 12.5 microg/mL and could be a good start point to find new lead compounds against multi-drug resistant tuberculosis. PMID:18068364

  20. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.


    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  1. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

  2. Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

  3. Identification of a novel operon in Lactococcus lactis encoding three enzymes for lactic acid synthesis: phosphofructokinase, pyruvate kinase, and lactate dehydrogenase.

    PubMed Central

    Llanos, R M; Harris, C J; Hillier, A J; Davidson, B E


    The discovery of a novel multicistronic operon that encodes phosphofructokinase, pyruvate kinase, and lactate dehydrogenase in the lactic acid bacterium Lactococcus lactis is reported. The three genes in the operon, designated pfk, pyk, and ldh, contain 340, 502, and 325 codons, respectively. The intergenic distances are 87 bp between pfk and pyk and 117 bp between pyk and ldh. Plasmids containing pfk and pyk conferred phosphofructokinase and pyruvate kinase activity, respectively, on their host. The identity of ldh was established previously by the same approach (R. M. Llanos, A. J. Hillier, and B. E. Davidson, J. Bacteriol. 174:6956-6964, 1992). Each of the genes is preceded by a potential ribosome binding site. The operon is expressed in a 4.1-kb transcript. The 5' end of the transcript was determined to be a G nucleotide positioned 81 bp upstream from the pfk start codon. The pattern of codon usage within the operon is highly biased, with 11 unused amino acid codons. This degree of bias suggests that the operon is highly expressed. The three proteins encoded on the operon are key enzymes in the Embden-Meyerhoff pathway, the central pathway of energy production and lactic acid synthesis in L. lactis. For this reason, we have called the operon the las (lactic acid synthesis) operon. Images PMID:8478320

  4. Regulation of fibrinogen synthesis by plasmin-derived fragments of fibrinogen and fibrin: an indirect feedback pathway.

    PubMed Central

    Ritchie, D G; Levy, B A; Adams, M A; Fuller, G M


    The effect of plasmin-derived fibrinogen fragments on the biosynthesis of fibrinogen was investigated in cultured monolayers of rat hepatocytes. Incubating the cells with several concentrations of either fibrinogen or fibrin fragment D or E had no effect on the synthesis and secretion of fibrinogen by these cells. However, if the fragments were incubated with isolated peripheral blood leukocytes, they caused these cells to secrete a factor that when added to the hepatocytes caused an increase in fibrinogen synthesis 4- to 6-fold over controls. Moreover, the hepatocyte-stimulating factor also affected the production of several other proteins produced by the hepatocyte. These results demonstrate that both fragments D and E can stimulate hepatic fibrinogen synthesis via an indirect leukocyte-mediated pathway. Images PMID:6461860

  5. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei


    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  6. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.


    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  7. Transfer of the cytochrome P450-dependent dhurrin pathway from Sorghum bicolor into Nicotiana tabacum chloroplasts for light-driven synthesis

    PubMed Central

    Gnanasekaran, Thiyagarajan; Karcher, Daniel; Nielsen, Agnieszka Zygadlo; Martens, Helle Juel; Ruf, Stephanie; Kroop, Xenia; Olsen, Carl Erik; Motawie, Mohammed Saddik; Pribil, Mathias; Møller, Birger Lindberg; Bock, Ralph; Jensen, Poul Erik


    Plant chloroplasts are light-driven cell factories that have great potential to act as a chassis for metabolic engineering applications. Using plant chloroplasts, we demonstrate how photosynthetic reducing power can drive a metabolic pathway to synthesise a bio-active natural product. For this purpose, we stably engineered the dhurrin pathway from Sorghum bicolor into the chloroplasts of Nicotiana tabacum (tobacco). Dhurrin is a cyanogenic glucoside and its synthesis from the amino acid tyrosine is catalysed by two membrane-bound cytochrome P450 enzymes (CYP79A1 and CYP71E1) and a soluble glucosyltransferase (UGT85B1), and is dependent on electron transfer from a P450 oxidoreductase. The entire pathway was introduced into the chloroplast by integrating CYP79A1, CYP71E1, and UGT85B1 into a neutral site of the N. tabacum chloroplast genome. The two P450s and the UGT85B1 were functional when expressed in the chloroplasts and converted endogenous tyrosine into dhurrin using electrons derived directly from the photosynthetic electron transport chain, witho