Science.gov

Sample records for acid synthesis pathway

  1. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  2. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  3. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  4. Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1991-01-01

    The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.

  5. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    PubMed

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism.

  6. Fatty acid synthesis and pyruvate metabolism pathways remain active in dihydroartemisinin-induced dormant ring stages of Plasmodium falciparum.

    PubMed

    Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin

    2014-08-01

    Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment.

  7. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  8. Pathway to synthesis and processing of mycolic acids in Mycobacterium tuberculosis.

    PubMed

    Takayama, Kuni; Wang, Cindy; Besra, Gurdyal S

    2005-01-01

    Mycobacterium tuberculosis is known to synthesize alpha-, methoxy-, and keto-mycolic acids. We propose a detailed pathway to the biosynthesis of all mycolic acids in M. tuberculosis. Fatty acid synthetase I provides C(20)-S-coenzyme A to the fatty acid synthetase II system (FAS-IIA). Modules of FAS-IIA and FAS-IIB introduce cis unsaturation at two locations on a growing meroacid chain to yield three different forms of cis,cis-diunsaturated fatty acids (intermediates to alpha-, methoxy-, and keto-meroacids). These are methylated, and the mature meroacids and carboxylated C(26)-S-acyl carrier protein enter into the final Claisen-type condensation with polyketide synthase-13 (Pks13) to yield mycolyl-S-Pks13. We list candidate genes in the genome encoding the proposed dehydrase and isomerase in the FAS-IIA and FAS-IIB modules. We propose that the processing of mycolic acids begins by transfer of mycolic acids from mycolyl-S-Pks13 to d-mannopyranosyl-1-phosphoheptaprenol to yield 6-O-mycolyl-beta-d-mannopyranosyl-1-phosphoheptaprenol and then to trehalose 6-phosphate to yield phosphorylated trehalose monomycolate (TMM-P). Phosphatase releases the phosphate group to yield TMM, which is immediately transported outside the cell by the ABC transporter. Antigen 85 then catalyzes the transfer of a mycolyl group from TMM to the cell wall arabinogalactan and to other TMMs to produce arabinogalactan-mycolate and trehalose dimycolate, respectively. We list candidate genes in the genome that encode the proposed mycolyltransferases I and II, phosphatase, and ABC transporter. The enzymes within this total pathway are targets for new drug discovery.

  9. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    SciTech Connect

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.

    2013-11-15

    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease.

  10. Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures.

    PubMed

    Rodas-Junco, Beatriz A; Cab-Guillén, Yahaira; Muñoz-Sánchez, J Armando; Vázquez-Flota, Felipe; Monforte-González, Miriam; Hernández-Sotomayor, S M Teresa

    2013-10-01

    Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.

  11. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  12. Altering the Mitochondrial Fatty Acid Synthesis (mtFASII) Pathway Modulates Cellular Metabolic States and Bioactive Lipid Profiles as Revealed by Metabolomic Profiling

    PubMed Central

    Clay, Hayley B.; Parl, Angelika K.; Mitchell, Sabrina L.; Singh, Larry; Bell, Lauren N.; Murdock, Deborah G.

    2016-01-01

    Despite the presence of a cytosolic fatty acid synthesis pathway, mitochondria have retained their own means of creating fatty acids via the mitochondrial fatty acid synthesis (mtFASII) pathway. The reason for its conservation has not yet been elucidated. Therefore, to better understand the role of mtFASII in the cell, we used thin layer chromatography to characterize the contribution of the mtFASII pathway to the fatty acid composition of selected mitochondrial lipids. Next, we performed metabolomic analysis on HeLa cells in which the mtFASII pathway was either hypofunctional (through knockdown of mitochondrial acyl carrier protein, ACP) or hyperfunctional (through overexpression of mitochondrial enoyl-CoA reductase, MECR). Our results indicate that the mtFASII pathway contributes little to the fatty acid composition of mitochondrial lipid species examined. Additionally, loss of mtFASII function results in changes in biochemical pathways suggesting alterations in glucose utilization and redox state. Interestingly, levels of bioactive lipids, including lysophospholipids and sphingolipids, directly correlate with mtFASII function, indicating that mtFASII may be involved in the regulation of bioactive lipid levels. Regulation of bioactive lipid levels by mtFASII implicates the pathway as a mediator of intracellular signaling. PMID:26963735

  13. Integrated engineering of β-oxidation reversal and ω-oxidation pathways for the synthesis of medium chain ω-functionalized carboxylic acids.

    PubMed

    Clomburg, James M; Blankschien, Matthew D; Vick, Jacob E; Chou, Alexander; Kim, Seohyoung; Gonzalez, Ramon

    2015-03-01

    An engineered reversal of the β-oxidation cycle was exploited to demonstrate its utility for the synthesis of medium chain (6-10-carbons) ω-hydroxyacids and dicarboxylic acids from glycerol as the only carbon source. A redesigned β-oxidation reversal facilitated the production of medium chain carboxylic acids, which were converted to ω-hydroxyacids and dicarboxylic acids by the action of an engineered ω-oxidation pathway. The selection of a key thiolase (bktB) and thioesterase (ydiI) in combination with previously established core β-oxidation reversal enzymes, as well as the development of chromosomal expression systems for the independent control of pathway enzymes, enabled the generation of C6-C10 carboxylic acids and provided a platform for vector based independent expression of ω-functionalization enzymes. Using this approach, the expression of the Pseudomonas putida alkane monooxygenase system, encoded by alkBGT, in combination with all β-oxidation reversal enzymes resulted in the production of 6-hydroxyhexanoic acid, 8-hydroxyoctanoic acid, and 10-hydroxydecanoic acid. Following identification and characterization of potential alcohol and aldehyde dehydrogenases, chnD and chnE from Acinetobacter sp. strain SE19 were expressed in conjunction with alkBGT to demonstrate the synthesis of the C6-C10 dicarboxylic acids, adipic acid, suberic acid, and sebacic acid. The potential of a β-oxidation cycle with ω-oxidation termination pathways was further demonstrated through the production of greater than 0.8 g/L C6-C10 ω-hydroxyacids or about 0.5 g/L dicarboxylic acids of the same chain lengths from glycerol (an unrelated carbon source) using minimal media.

  14. Ascorbate Synthesis Pathway

    PubMed Central

    Gabbay, Kenneth H.; Bohren, Kurt M.; Morello, Roy; Bertin, Terry; Liu, Jeff; Vogel, Peter

    2010-01-01

    Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of d-glucuronate to l-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) mice show that the two enzymes, GR and AR, provide ∼85 and ∼15% of l-gulonate, respectively. GRKO/ARKO double knock-out mice are unable to synthesize ASC (>95% ASC deficit) and develop scurvy. The GRKO mice (∼85% ASC deficit) develop and grow normally when fed regular mouse chow (ASC content = 0) but suffer severe osteopenia and spontaneous fractures with stresses that increase ASC requirements, such as pregnancy or castration. Castration greatly increases osteoclast numbers and activity in GRKO mice and promotes increased bone loss as compared with wild-type controls and additionally induces proliferation of immature dysplastic osteoblasts likely because of an ASC-sensitive block(s) in early differentiation. ASC and the antioxidants pycnogenol and resveratrol block osteoclast proliferation and bone loss, but only ASC feeding restores osteoblast differentiation and prevents their dysplastic proliferation. This is the first in vivo demonstration of two independent roles for ASC as an antioxidant suppressing osteoclast activity and number as well as a cofactor promoting osteoblast differentiation. Although humans have lost the ability to synthesize ASC, our mouse models suggest the mechanisms by which suboptimal ASC availability facilitates the development of osteoporosis, which has important implications for human osteoporosis. PMID:20410296

  15. α-Lipoic Acids Promote the Protein Synthesis of C2C12 Myotubes by the TLR2/PI3K Signaling Pathway.

    PubMed

    Jing, Yuanyuan; Cai, Xingcai; Xu, Yaqiong; Zhu, Canjun; Wang, Lina; Wang, Songbo; Zhu, Xiaotong; Gao, Ping; Zhang, Yongliang; Jiang, Qingyan; Shu, Gang

    2016-03-01

    Skeletal muscle protein turnover is regulated by endocrine hormones, nutrients, and inflammation. α-Lipoic acid (ALA) plays an important role in energy homeostasis. Therefore, the aim of this study was to investigate the effects of ALA on protein synthesis in skeletal muscles and reveal the underlying mechanism. ALA (25 μM) significantly increased the protein synthesis and phosphorylation of Akt, mTOR, and S6 in C2C12 myotubes with attenuated phosphorylation of AMPK, Ikkα/β, and eIF2α. Intraperitoneal injection of 50 mg/kg ALA also produced the same results in mouse gastrocnemius. Both the PI3K (LY294002) and mTOR (rapamycin) inhibitors abolished the effects of ALA on protein synthesis in the C2C12 myotubes. However, AICAR (AMPK agonist) failed to block the activation of mTOR and S6 by ALA. ALA increased TLR2 and MyD88 mRNA expression in the C2C12 myotubes. TLR2 knockdown by siRNA almost eliminated the effects of ALA on protein synthesis and the Akt/mTOR pathway in the C2C12 myotubes. Immunoprecipitation data showed that ALA enhanced the p85 subunit of PI3K binding to MyD88. These findings indicate that ALA induces protein synthesis and the PI3K/Akt signaling pathway by TLR2.

  16. Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures

    PubMed Central

    Rodas-Junco, Beatriz A; Cab-Guillen, Yahaira; Muñoz-Sanchez, J Armando; Vázquez-Flota, Felipe; Monforte-Gonzalez, Miriam; Hérnandez-Sotomayor, S M Teresa

    2013-01-01

    Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.

  17. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  18. Alpha-2-glycoprotein 1(AZGP1) regulates biological behaviors of LoVo cells by down-regulating mTOR signaling pathway and endogenous fatty acid synthesis.

    PubMed

    Chang, Ligong; Tian, Xiaoqiang; Lu, Yinghui; Jia, Min; Wu, Peng; Huang, Peilin

    2014-01-01

    AZGP1 is a multifaceted protein associated with lipid mobilization, a process that is regulated by FASN and other metabolic pathways such as mTOR signaling. The active mTOR signaling pathway has been found to be involved in a variety of tumors. However, it remains unclear whether it is involved in the regulation of AZGP1 and FASN. An AZGP1-expressing plasmid was transfected into a human colorectal cancer cell line (LoVo) with a low expression of AZGP1. The expression of AZGP1, FASN, eIF4E, p-mTOR, p-S6,and S6K1 were measured by Western blot analysis, and target genes were detected by RT-PCR. Cell proliferation was studied using the MTT and colony formation assays. The analysis of apoptosis and the cell cycle phase were assessed by flow cytometry. The capacity of cell migration was investigated using the transwell migration assay. We found that the expression of AZGP1 was up-regulated while the expression of FASN, eIF4E, p-mTOR, p-S6, and S6K1 were down-regulated in LoVo cells after AZGP1 was expressed. The proliferation of malignant cells was reduced in AZGP1-overexpression cells, which is consistent with an increased in the G2-arrest and apoptosis rate. Furthermore, the migration of AZGP1-overexpression cells was decreased. The overexpression of AZGP1 suppressed the activation of the mTOR pathway and endogenous FASN-regulated fatty acid synthesis, mitigating the malignant phenotype of LoVo cells. Herein, we provide evidence that AZGP1 may constitute a novel tumor suppressor for LoVo colorectal cancer cells.

  19. Effects of leucine and citrulline versus non-essential amino acids on muscle protein synthesis in fasted rat: a common activation pathway?

    PubMed

    Le Plénier, Servane; Walrand, Stéphane; Noirt, Richard; Cynober, Luc; Moinard, Christophe

    2012-09-01

    Leucine (LEU) is recognized as a major regulator of muscle protein synthesis (MPS). Citrulline (CIT) is emerging as a potent new regulator. The aim of our study was to compare MPS modulation by CIT and LEU in food-deprived rats and to determine whether their action was driven by similar mechanisms. Rats were either freely fed (F, n = 10) or food deprived for 18 h. Food-deprived rats were randomly assigned to one of four groups and received per os, i.e., gavage, saline (S, n = 10), L: -leucine (1.35 g/kg, LEU, n = 10), L: -citrulline (1.80 g/kg CIT, n = 10) or isonitrogenous non-essential amino acids (NEAA, n = 10). After gavage, the rats were injected with a flooding dose of [(13)C] valine to determine MPS. The rats were killed 50 min after the injection of the flooding dose. Blood was collected for amino acid, glucose and insulin determinations. Tibialis anterior muscles were excised for determination of MPS and for Western blot analyses of the PI3K/Akt, mTORC1, ERK1/2/MAPK pathways and AMP kinase component. MPS was depressed by 61% in starved rats (Saline vs. Fed, P < 0.05). Administration of amino acids (NEAA, LEU or CIT) completely abolished this decrease (NEAA, CIT, LEU vs. Fed, NS). Food deprivation affected the phosphorylation status of the mTORC1 pathway and AMP kinase (Saline vs. Fed, P < 0.05). LEU and CIT administration differently stimulated the mTORC1 pathway (LEU > CIT). LEU but not CIT increased the phosphorylation of rpS6 at serine 235/236. Our findings clearly demonstrated that both CIT and LEU were able to stimulate MPS, but this effect was likely related to the nitrogen load. LEU, CIT and NEAA may have different actions on MPS in this model as they share different mTORC1 regulation capacities.

  20. Inhibition of de novo Palmitate Synthesis by Fatty Acid Synthase Induces Apoptosis in Tumor Cells by Remodeling Cell Membranes, Inhibiting Signaling Pathways, and Reprogramming Gene Expression

    PubMed Central

    Ventura, Richard; Mordec, Kasia; Waszczuk, Joanna; Wang, Zhaoti; Lai, Julie; Fridlib, Marina; Buckley, Douglas; Kemble, George; Heuer, Timothy S.

    2015-01-01

    Inhibition of de novo palmitate synthesis via fatty acid synthase (FASN) inhibition provides an unproven approach to cancer therapy with a strong biological rationale. FASN expression increases with tumor progression and associates with chemoresistance, tumor metastasis, and diminished patient survival in numerous tumor types. TVB-3166, an orally-available, reversible, potent, and selective FASN inhibitor induces apoptosis, inhibits anchorage-independent cell growth under lipid-rich conditions, and inhibits in-vivo xenograft tumor growth. Dose-dependent effects are observed between 20–200 nM TVB-3166, which agrees with the IC50 in biochemical FASN and cellular palmitate synthesis assays. Mechanistic studies show that FASN inhibition disrupts lipid raft architecture, inhibits biological pathways such as lipid biosynthesis, PI3K–AKT–mTOR and β-catenin signal transduction, and inhibits expression of oncogenic effectors such as c-Myc; effects that are tumor-cell specific. Our results demonstrate that FASN inhibition has anti-tumor activities in biologically diverse preclinical tumor models and provide mechanistic and pharmacologic evidence that FASN inhibition presents a promising therapeutic strategy for treating a variety of cancers, including those expressing mutant K-Ras, ErbB2, c-Met, and PTEN. The reported findings inform ongoing studies to link mechanisms of action with defined tumor types and advance the discovery of biomarkers supporting development of FASN inhibitors as cancer therapeutics. Research in context Fatty acid synthase (FASN) is a vital enzyme in tumor cell biology; the over-expression of FASN is associated with diminished patient prognosis and resistance to many cancer therapies. Our data demonstrate that selective and potent FASN inhibition with TVB-3166 leads to selective death of tumor cells, without significant effect on normal cells, and inhibits in vivo xenograft tumor growth at well-tolerated doses. Candidate biomarkers for

  1. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  2. Genetic mapping of QTLs controlling fatty acids provided insights into the genetic control of fatty acid synthesis pathway in peanut (Arachis hypogaea L.).

    PubMed

    Wang, Ming Li; Khera, Pawan; Pandey, Manish K; Wang, Hui; Qiao, Lixian; Feng, Suping; Tonnis, Brandon; Barkley, Noelle A; Pinnow, David; Holbrook, Corley C; Culbreath, Albert K; Varshney, Rajeev K; Guo, Baozhu

    2015-01-01

    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C18:1) and linoleic acid (C18:2) accounting for about 80% of peanut oil, the six other fatty acids namely palmitic acid (C16:0), stearic acid (C18:0), arachidic acid (C20:0), gadoleic acid (C20:1), behenic acid (C22:0), and lignoceric acid (C24:0) are accounted for the rest 20%. To determine the genetic basis and to improve further understanding on effect of FAD2 genes on these fatty acids, two recombinant inbred line (RIL) populations namely S-population (high oleic line 'SunOleic 97R' × low oleic line 'NC94022') and T-population (normal oleic line 'Tifrunner' × low oleic line 'GT-C20') were developed. Genetic maps with 206 and 378 marker loci for the S- and the T-population, respectively were used for quantitative trait locus (QTL) analysis. As a result, a total of 164 main-effect (M-QTLs) and 27 epistatic (E-QTLs) QTLs associated with the minor fatty acids were identified with 0.16% to 40.56% phenotypic variation explained (PVE). Thirty four major QTLs (>10% of PVE) mapped on five linkage groups and 28 clusters containing more than three QTLs were also identified. These results suggest that the major QTLs with large additive effects would play an important role in controlling composition of these minor fatty acids in addition to the oleic and linoleic acids in peanut oil. The interrelationship among these fatty acids should be considered while breeding for improved peanut genotypes with good oil quality and desired fatty acid composition.

  3. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  4. Genetic mapping of QTLs controlling fatty acids provided insights into the genetic control of fatty acid synthesis pathway in peanut (Arachis hypogaea L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C1...

  5. Genetic Mapping of QTLs Controlling Fatty Acids Provided Insights into the Genetic Control of Fatty Acid Synthesis Pathway in Peanut (Arachis hypogaea L.)

    PubMed Central

    Wang, Hui; Qiao, Lixian; Feng, Suping; Tonnis, Brandon; Barkley, Noelle A.; Pinnow, David; Holbrook, Corley C.; Culbreath, Albert K.; Varshney, Rajeev K.; Guo, Baozhu

    2015-01-01

    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C18:1) and linoleic acid (C18:2) accounting for about 80% of peanut oil, the six other fatty acids namely palmitic acid (C16:0), stearic acid (C18:0), arachidic acid (C20:0), gadoleic acid (C20:1), behenic acid (C22:0), and lignoceric acid (C24:0) are accounted for the rest 20%. To determine the genetic basis and to improve further understanding on effect of FAD2 genes on these fatty acids, two recombinant inbred line (RIL) populations namely S-population (high oleic line ‘SunOleic 97R’ × low oleic line ‘NC94022’) and T-population (normal oleic line ‘Tifrunner’ × low oleic line ‘GT-C20’) were developed. Genetic maps with 206 and 378 marker loci for the S- and the T-population, respectively were used for quantitative trait locus (QTL) analysis. As a result, a total of 164 main-effect (M-QTLs) and 27 epistatic (E-QTLs) QTLs associated with the minor fatty acids were identified with 0.16% to 40.56% phenotypic variation explained (PVE). Thirty four major QTLs (>10% of PVE) mapped on five linkage groups and 28 clusters containing more than three QTLs were also identified. These results suggest that the major QTLs with large additive effects would play an important role in controlling composition of these minor fatty acids in addition to the oleic and linoleic acids in peanut oil. The interrelationship among these fatty acids should be considered while breeding for improved peanut genotypes with good oil quality and desired fatty acid composition. PMID:25849082

  6. Vitamins and aging: pathways to NAD+ synthesis.

    PubMed

    Denu, John M

    2007-05-01

    Recent genetic evidence reveals additional salvage pathways for NAD(+) synthesis. In this issue, Belenky et al. (2007) report that nicotinamide riboside, a new NAD(+) precursor, regulates Sir2 deacetylase activity and life span in yeast. The ability of nicotinamide riboside to enhance life span does not depend on calorie restriction. PMID:17482537

  7. Biochemical pathways in seed oil synthesis.

    PubMed

    Bates, Philip D; Stymne, Sten; Ohlrogge, John

    2013-06-01

    Oil produced in plant seeds is utilized as a major source of calories for human nutrition, as feedstocks for non-food uses such as soaps and polymers, and can serve as a high-energy biofuel. The biochemical pathways leading to oil (triacylglycerol) synthesis in seeds involve multiple subcellular organelles, requiring extensive lipid trafficking. Phosphatidylcholine plays a central role in these pathways as a substrate for acyl modifications and likely as a carrier for the trafficking of acyl groups between organelles and membrane subdomains. Although much has been clarified regarding the enzymes and pathways responsible for acyl-group flux, there are still major gaps in our understanding. These include the identity of several key enzymes, how flux between alternative pathways is controlled and the specialized cell biology leading to biogenesis of oil bodies that store up to 80% of carbon in seeds.

  8. Dietary cholesterol supplementation to a plant-based diet suppresses the complete pathway of cholesterol synthesis and induces bile acid production in Atlantic salmon (Salmo salar L.).

    PubMed

    Kortner, Trond M; Björkhem, Ingemar; Krasnov, Aleksei; Timmerhaus, Gerrit; Krogdahl, Åshild

    2014-06-28

    Plants now supply more than 50 % of protein in Norwegian salmon aquafeeds. The inclusion of plant protein in aquafeeds may be associated with decreased lipid digestibility and cholesterol and bile salt levels, indicating that the replacement of fishmeal with plant protein could result in inadequate supplies of cholesterol in fish. A reduction in feed efficiency, fish growth and pathogen resistance is often observed in parallel to alterations in sterol metabolism. Previous studies have indicated that the negative effects induced by plant components can be attenuated when diets are supplemented with cholesterol. The present study evaluated the effects of dietary cholesterol supplementation (1·5 %) in Atlantic salmon fed a plant-based diet for 77 d. The weights of body, intestines and liver were recorded and blood, tissues, faeces, chyme and bile were sampled for the evaluation of effects on growth, nutrient utilisation and metabolism, and transcriptome and metabolite levels, with particular emphasis on sterol metabolism and organ structure and function. Cholesterol supplementation did not affect the growth or organ weights of Atlantic salmon, but seemed to promote the induction of cholesterol and plant sterol efflux in the intestine while suppressing sterol uptake. Cholesterol biosynthesis decreased correspondingly and conversion into bile acids increased. The marked effect of cholesterol supplementation on bile acid synthesis suggests that dietary cholesterol can be used to increase bile acid synthesis in fish. The present study clearly demonstrated how Atlantic salmon adjusted their metabolic functions in response to the dietary load of cholesterol. It has also expanded our understanding of sterol metabolism and turnover, adding to the existing, rather sparse, knowledge of these processes in fish.

  9. Dietary cholesterol supplementation to a plant-based diet suppresses the complete pathway of cholesterol synthesis and induces bile acid production in Atlantic salmon (Salmo salar L.).

    PubMed

    Kortner, Trond M; Björkhem, Ingemar; Krasnov, Aleksei; Timmerhaus, Gerrit; Krogdahl, Åshild

    2014-06-28

    Plants now supply more than 50 % of protein in Norwegian salmon aquafeeds. The inclusion of plant protein in aquafeeds may be associated with decreased lipid digestibility and cholesterol and bile salt levels, indicating that the replacement of fishmeal with plant protein could result in inadequate supplies of cholesterol in fish. A reduction in feed efficiency, fish growth and pathogen resistance is often observed in parallel to alterations in sterol metabolism. Previous studies have indicated that the negative effects induced by plant components can be attenuated when diets are supplemented with cholesterol. The present study evaluated the effects of dietary cholesterol supplementation (1·5 %) in Atlantic salmon fed a plant-based diet for 77 d. The weights of body, intestines and liver were recorded and blood, tissues, faeces, chyme and bile were sampled for the evaluation of effects on growth, nutrient utilisation and metabolism, and transcriptome and metabolite levels, with particular emphasis on sterol metabolism and organ structure and function. Cholesterol supplementation did not affect the growth or organ weights of Atlantic salmon, but seemed to promote the induction of cholesterol and plant sterol efflux in the intestine while suppressing sterol uptake. Cholesterol biosynthesis decreased correspondingly and conversion into bile acids increased. The marked effect of cholesterol supplementation on bile acid synthesis suggests that dietary cholesterol can be used to increase bile acid synthesis in fish. The present study clearly demonstrated how Atlantic salmon adjusted their metabolic functions in response to the dietary load of cholesterol. It has also expanded our understanding of sterol metabolism and turnover, adding to the existing, rather sparse, knowledge of these processes in fish. PMID:24635969

  10. β-Hydroxybutyric acid inhibits growth hormone-releasing hormone synthesis and secretion through the GPR109A/extracellular signal-regulated 1/2 signalling pathway in the hypothalamus.

    PubMed

    Fu, S-P; Liu, B-R; Wang, J-F; Xue, W-J; Liu, H-M; Zeng, Y-L; Huang, B-X; Li, S-N; Lv, Q-K; Wang, W; Liu, J-X

    2015-03-01

    β-Hydroxybutyric acid (BHBA) has recently been shown to regulate hormone synthesis and secretion in the hypothalamus. However, little is known about the effects of BHBA-mediated hormone regulation or the detailed mechanisms by which BHBA regulates growth hormone-releasing hormone (GHRH) synthesis and secretion. In the present study, we examined the expression of the BHBA receptor GPR109A in primary hypothalamic cell cultures. We hypothesised that BHBA regulates GHRH via GPR109A and its downstream signals. Initial in vivo studies conducted in rats demonstrated that GHRH mRNA expression in the hypothalamus was strongly inversely correlated with BHBA levels in the cerebrospinal fluid during postnatal development (r = -0.89, P < 0.01). Furthermore, i.c.v. administration of BHBA acutely decreased GHRH mRNA expression in rats. Further in vitro studies revealed a decrease in GHRH synthesis and secretion in primary hypothalamic cells after treatment with BHBA; this effect was inhibited when hypothalamic cells were pretreated with pertussis toxin (PTX). BHBA had no effect on GHRH synthesis and secretion in GT1-7 cells, which do not exhibit cell surface expression of GPR109A. Furthermore, BHBA acutely decreased the transcription of the homeobox gene for Gsh-1 in the hypothalamus in both in vivo and in vitro, and this effect was also inhibited by PTX in vitro. In primary hypothalamic cells, BHBA activated the extracellular signal-regulated kinase (ERK)1/2, p38 and c-Jun N-terminal kinase mitogen-activated protein kinase (MAPK) kinases, as shown by western blot analysis. Moreover, inhibition of ERK1/2 with U0126 attenuated the BHBA-mediated reduction in Gsh-1 expression and GHRH synthesis and secretion. These results strongly suggest that BHBA directly regulates GHRH synthesis and secretion via the GPR109A/ERK1/2 MAPK pathway, and also that Gsh-1 is essential for this function.

  11. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  12. Mitochondrial Protein Lipoylation Does Not Exclusively Depend on the mtKAS Pathway of de Novo Fatty Acid Synthesis in Arabidopsis1[W][OA

    PubMed Central

    Ewald, Ralph; Kolukisaoglu, Üner; Bauwe, Ursula; Mikkat, Stefan; Bauwe, Hermann

    2007-01-01

    The photorespiratory Arabidopsis (Arabidopsis thaliana) mutant gld1 (now designated mtkas-1) is deficient in glycine decarboxylase (GDC) activity, but the exact nature of the genetic defect was not known. We have identified the mtkas-1 locus as gene At2g04540, which encodes β-ketoacyl-[acyl carrier protein (ACP)] synthase (mtKAS), a key enzyme of the mitochondrial fatty acid synthetic system. One of its major products, octanoyl-ACP, is regarded as essential for the intramitochondrial lipoylation of several proteins including the H-protein subunit of GDC and the dihydrolipoamide acyltransferase (E2) subunits of two other essential multienzyme complexes, pyruvate dehydrogenase and α-ketoglutarate dehydrogenase. This view is in conflict with the fact that the mtkas-1 mutant and two allelic T-DNA knockout mutants grow well under nonphotorespiratory conditions. Although on a very low level, the mutants show residual lipoylation of H protein, indicating that the mutation does not lead to a full functional knockout of GDC. Lipoylation of the pyruvate dehydrogenase and α-ketoglutarate dehydrogenase E2 subunits is distinctly less reduced than that of H protein in leaves and remains unaffected from the mtKAS knockout in roots. These data suggest that mitochondrial protein lipoylation does not exclusively depend on the mtKAS pathway of lipoate biosynthesis in leaves and may occur independently of this pathway in roots. PMID:17616510

  13. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?

    PubMed

    Cook, Sam D; Nichols, David S; Smith, Jason; Chourey, Prem S; McAdam, Erin L; Quittenden, Laura; Ross, John J

    2016-06-01

    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  14. Orthogonal Fatty Acid Biosynthetic Pathway Improves Fatty Acid Ethyl Ester Production in Saccharomyces cerevisiae.

    PubMed

    Eriksen, Dawn T; HamediRad, Mohammad; Yuan, Yongbo; Zhao, Huimin

    2015-07-17

    Fatty acid ethyl esters (FAEEs) are a form of biodiesel that can be microbially produced via a transesterification reaction of fatty acids with ethanol. The titer of microbially produced FAEEs can be greatly reduced by unbalanced metabolism and an insufficient supply of fatty acids, resulting in a commercially inviable process. Here, we report on a pathway engineering strategy in Saccharomyces cerevisiae for enhancing the titer of microbially produced FAEEs by providing the cells with an orthogonal route for fatty acid synthesis. The fatty acids generated from this heterologous pathway would supply the FAEE production, safeguarding endogenous fatty acids for cellular metabolism and growth. We investigated the heterologous expression of a Type-I fatty acid synthase (FAS) from Brevibacterium ammoniagenes coupled with WS/DGAT, the wax ester synthase/acyl-coenzyme that catalyzes the transesterification reaction with ethanol. Strains harboring the orthologous fatty acid synthesis yielded a 6.3-fold increase in FAEE titer compared to strains without the heterologous FAS. Variations in fatty acid chain length and degree of saturation can affect the quality of the biodiesel; therefore, we also investigated the diversity of the fatty acid production profile of FAS enzymes from other Actinomyces organisms. PMID:25594225

  15. Metabolic Engineering of a Novel Muconic Acid Biosynthesis Pathway via 4-Hydroxybenzoic Acid in Escherichia coli

    PubMed Central

    Sengupta, Sudeshna; Goonewardena, Lakshani; Juturu, Veeresh

    2015-01-01

    cis,cis-Muconic acid (MA) is a commercially important raw material used in pharmaceuticals, functional resins, and agrochemicals. MA is also a potential platform chemical for the production of adipic acid (AA), terephthalic acid, caprolactam, and 1,6-hexanediol. A strain of Escherichia coli K-12, BW25113, was genetically modified, and a novel nonnative metabolic pathway was introduced for the synthesis of MA from glucose. The proposed pathway converted chorismate from the aromatic amino acid pathway to MA via 4-hydroxybenzoic acid (PHB). Three nonnative genes, pobA, aroY, and catA, coding for 4-hydroxybenzoate hydrolyase, protocatechuate decarboxylase, and catechol 1,2-dioxygenase, respectively, were functionally expressed in E. coli to establish the MA biosynthetic pathway. E. coli native genes ubiC, aroFFBR, aroE, and aroL were overexpressed and the genes ptsH, ptsI, crr, and pykF were deleted from the E. coli genome in order to increase the precursors of the proposed MA pathway. The final engineered E. coli strain produced nearly 170 mg/liter of MA from simple carbon sources in shake flask experiments. The proposed pathway was proved to be functionally active, and the strategy can be used for future metabolic engineering efforts for production of MA from renewable sugars. PMID:26362984

  16. Metabolic engineering of a novel muconic acid biosynthesis pathway via 4-hydroxybenzoic acid in Escherichia coli.

    PubMed

    Sengupta, Sudeshna; Jonnalagadda, Sudhakar; Goonewardena, Lakshani; Juturu, Veeresh

    2015-12-01

    cis,cis-Muconic acid (MA) is a commercially important raw material used in pharmaceuticals, functional resins, and agrochemicals. MA is also a potential platform chemical for the production of adipic acid (AA), terephthalic acid, caprolactam, and 1,6-hexanediol. A strain of Escherichia coli K-12, BW25113, was genetically modified, and a novel nonnative metabolic pathway was introduced for the synthesis of MA from glucose. The proposed pathway converted chorismate from the aromatic amino acid pathway to MA via 4-hydroxybenzoic acid (PHB). Three nonnative genes, pobA, aroY, and catA, coding for 4-hydroxybenzoate hydrolyase, protocatechuate decarboxylase, and catechol 1,2-dioxygenase, respectively, were functionally expressed in E. coli to establish the MA biosynthetic pathway. E. coli native genes ubiC, aroF(FBR), aroE, and aroL were overexpressed and the genes ptsH, ptsI, crr, and pykF were deleted from the E. coli genome in order to increase the precursors of the proposed MA pathway. The final engineered E. coli strain produced nearly 170 mg/liter of MA from simple carbon sources in shake flask experiments. The proposed pathway was proved to be functionally active, and the strategy can be used for future metabolic engineering efforts for production of MA from renewable sugars. PMID:26362984

  17. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages.

    PubMed

    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A; Yin, Yulong

    2015-01-01

    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05) gradually with increasing age. Bama mini-pigs had generally higher (P<0.05) muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but

  18. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  19. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  20. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  1. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages

    PubMed Central

    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A.; Yin, Yulong

    2015-01-01

    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05) gradually with increasing age. Bama mini-pigs had generally higher (P<0.05) muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but

  2. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  3. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  4. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  5. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly.

    PubMed

    Bates, Philip D; Johnson, Sean R; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G; Ohlrogge, John B; Browse, John

    2014-01-21

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [(14)C]acetate and [(3)H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [(14)C]acetate and [(14)C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl-CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl-CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid.

  6. Role of Fatty Acid De Novo Biosynthesis in Polyhydroxyalkanoic Acid (PHA) and Rhamnolipid Synthesis by Pseudomonads: Establishment of the Transacylase (PhaG)-Mediated Pathway for PHA Biosynthesis in Escherichia coli

    PubMed Central

    Rehm, Bernd H. A.; Mitsky, Timothy A.; Steinbüchel, Alexander

    2001-01-01

    Since Pseudomonas aeruginosa is capable of biosynthesis of polyhydroxyalkanoic acid (PHA) and rhamnolipids, which contain lipid moieties that are derived from fatty acid biosynthesis, we investigated various fab mutants from P. aeruginosa with respect to biosynthesis of PHAs and rhamnolipids. All isogenic fabA, fabB, fabI, rhlG, and phaG mutants from P. aeruginosa showed decreased PHA accumulation and rhamnolipid production. In the phaG (encoding transacylase) mutant rhamnolipid production was only slightly decreased. Expression of phaG from Pseudomonas putida and expression of the β-ketoacyl reductase gene rhlG from P. aeruginosa in these mutants indicated that PhaG catalyzes diversion of intermediates of fatty acid de novo biosynthesis towards PHA biosynthesis, whereas RhlG catalyzes diversion towards rhamnolipid biosynthesis. These data suggested that both biosynthesis pathways are competitive. In order to investigate whether PhaG is the only linking enzyme between fatty acid de novo biosynthesis and PHA biosynthesis, we generated five Tn5 mutants of P. putida strongly impaired in PHA production from gluconate. All mutants were complemented by the phaG gene from P. putida, indicating that the transacylase-mediated PHA biosynthesis route represents the only metabolic link between fatty acid de novo biosynthesis and PHA biosynthesis in this bacterium. The transacylase-mediated PHA biosynthesis route from gluconate was established in recombinant E. coli, coexpressing the class II PHA synthase gene phaC1 together with the phaG gene from P. putida, only when fatty acid de novo biosynthesis was partially inhibited by triclosan. The accumulated PHA contributed to 2 to 3% of cellular dry weight. PMID:11425728

  7. Synthesis and Isolation of Chelidonic Acid

    ERIC Educational Resources Information Center

    Gagan, J. M. F.; Herbert, R. B.

    1976-01-01

    Described is an undergraduate laboratory experiment involving synthesis of chelidonic acid and its identification in plants. The experiment is offered as an ancillary topic for biology or chemistry classes. (SL)

  8. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  9. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  10. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  11. The Significance of Different Diacylgycerol Synthesis Pathways on Plant Oil Composition and Bioengineering

    PubMed Central

    Bates, Philip D.; Browse, John

    2012-01-01

    The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA) composition of triacylglycerol (TAG). Plants can use two main pathways to produce diacylglycerol (DAG), the immediate precursor molecule to TAG synthesis: (1) De novo DAG synthesis, and (2) conversion of the membrane lipid phosphatidylcholine (PC) to DAG. The FA esterified to PC are also the substrate for FA modification (e.g., desaturation, hydroxylation, etc.), such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions. PMID:22783267

  12. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?1[OPEN

    PubMed Central

    Nichols, David S.; Smith, Jason; Chourey, Prem S.; McAdam, Erin L.; Quittenden, Laura

    2016-01-01

    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA. However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  13. Activation of PPARα by Fatty Acid Accumulation Enhances Fatty Acid Degradation and Sulfatide Synthesis.

    PubMed

    Yang, Yang; Feng, Yuyao; Zhang, Xiaowei; Nakajima, Takero; Tanaka, Naoki; Sugiyama, Eiko; Kamijo, Yuji; Aoyama, Toshifumi

    2016-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) catalyzes the first reaction in the mitochondrial fatty acid β-oxidation pathway. VLCAD deficiency is associated with the accumulation of fat in multiple organs and tissues, which results in specific clinical features including cardiomyopathy, cardiomegaly, muscle weakness, and hepatic dysfunction in infants. We speculated that the abnormal fatty acid metabolism in VLCAD-deficient individuals might cause cell necrosis by fatty acid toxicity. The accumulation of fatty acids may activate peroxisome proliferator-activated receptor (PPAR), a master regulator of fatty acid metabolism and a potent nuclear receptor for free fatty acids. We examined six skin fibroblast lines, derived from VLCAD-deficient patients and identified fatty acid accumulation and PPARα activation in these cell lines. We then found that the expression levels of three enzymes involved in fatty acid degradation, including long-chain acyl-CoA synthetase (LACS), were increased in a PPARα-dependent manner. This increased expression of LACS might enhance the fatty acyl-CoA supply to fatty acid degradation and sulfatide synthesis pathways. In fact, the first and last reactions in the sulfatide synthesis pathway are regulated by PPARα. Therefore, we also measured the expression levels of enzymes involved in sulfatide metabolism and the regulation of cellular sulfatide content. The levels of these enzymes and cellular sulfatide content both increased in a PPARα-dependent manner. These results indicate that PPARα activation plays defensive and compensative roles by reducing cellular toxicity associated with fatty acids and sulfuric acid. PMID:27644403

  14. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  15. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  16. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  17. Discovery of an alternate metabolic pathway for urea synthesis in adult Aedes aegypti mosquitoes.

    PubMed

    Scaraffia, Patricia Y; Tan, Guanhong; Isoe, Jun; Wysocki, Vicki H; Wells, Michael A; Miesfeld, Roger L

    2008-01-15

    We demonstrate the presence of an alternate metabolic pathway for urea synthesis in Aedes aegypti mosquitoes that converts uric acid to urea via an amphibian-like uricolytic pathway. For these studies, female mosquitoes were fed a sucrose solution containing (15)NH4Cl, [5-(15)N]-glutamine, [(15)N]-proline, allantoin, or allantoic acid. At 24 h after feeding, the feces were collected and analyzed in a mass spectrometer. Specific enzyme inhibitors confirmed that mosquitoes incorporate (15)N from (15)NH4Cl into [5-(15)N]-glutamine and use the (15)N of the amide group of glutamine to produce labeled uric acid. More importantly, we found that [(15)N2]-uric acid can be metabolized to [(15)N]-urea and be excreted as nitrogenous waste through an uricolytic pathway. Ae. aegypti express all three genes in this pathway, namely, urate oxidase, allantoinase, and allantoicase. The functional relevance of these genes in mosquitoes was shown by feeding allantoin or allantoic acid, which significantly increased unlabeled urea levels in the feces. Moreover, knockdown of urate oxidase expression by RNA interference demonstrated that this pathway is active in females fed blood or (15)NH4Cl based on a significant increase in uric acid levels in whole-body extracts and a reduction in [(15)N]-urea excretion, respectively. These unexpected findings could lead to the development of metabolism-based strategies for mosquito control.

  18. Fatty acid synthesis: from CO2 to functional genomics.

    PubMed

    Ohlrogge, J; Pollard, M; Bao, X; Focke, M; Girke, T; Ruuska, S; Mekhedov, S; Benning, C

    2000-12-01

    For over 25 years there has been uncertainty over the pathway from CO(2) to acetyl-CoA in chloroplasts. On the one hand, free acetate is the most effective substrate for fatty acid synthesis by isolated chloroplasts, and free acetate concentrations reported in leaf tissue (0.1-1 mM) appear adequate to saturate fatty acid synthase. On the other hand, a clear mechanism to generate sufficient free acetate for fatty acid synthesis is not established and direct production of acetyl-CoA from pyruvate by a plastid pyruvate dehydrogenase seems a more simple and direct path. We have re-examined this question and attempted to distinguish between the alternatives. The kinetics of (13)CO(2) and (14)CO(2) movement into fatty acids and the absolute rate of fatty acid synthesis in leaves was determined in light and dark. Because administered (14)C appears in fatty acids within < 2-3 min our results are inconsistent with a large pool of free acetate as an intermediate in leaf fatty acid synthesis. In addition, these studies provide an estimate of the turnover rate of fatty acid in leaves. Studies similar to the above are more complex in seeds, and some questions about the regulation of plant lipid metabolism seem difficult to solve using conventional biochemical or molecular approaches. For example, we have little understanding of why or how some seeds produce >50% oil whereas other seeds store largely carbohydrate or protein. Major control over complex plant biochemical pathways may only become possible by understanding regulatory networks which provide 'global' control over these pathways. To begin to discover such networks and provide a broad analysis of gene expression in developing oilseeds, we have produced microarrays that display approx. 5000 seed-expressed Arabidopsis genes. Sensitivity of the arrays was 1-2 copies of mRNA/cell. The arrays have been hybridized with probes derived from seeds, leaves and roots, and analysis of expression ratios between the different tissues

  19. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  20. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  1. Metabolic engineering of Escherichia coli for production of fatty acid short-chain esters through combination of the fatty acid and 2-keto acid pathways.

    PubMed

    Guo, Daoyi; Zhu, Jing; Deng, Zixin; Liu, Tiangang

    2014-03-01

    Fatty acid short-chain esters (FASEs) are biodiesels that are renewable, nontoxic, and biodegradable biofuels. A novel approach for the biosynthesis of FASEs has been developed using metabolically-engineered E. coli through combination of the fatty acid and 2-keto acid pathways. Several genetic engineering strategies were also developed to increase fatty acyl-CoA availability to improve FASEs production. Fed-batch cultivation of the engineered E. coli resulted in a titer of 1008 mg/L FASEs. Since the fatty acid and 2-keto acid pathways are native microbial synthesis pathways, this strategy can be implemented in a variety of microorganisms to produce various FASEs from cheap and readily-available, renewable, raw materials such as sugars and cellulose in the future.

  2. Piperazic acid derivatives inhibit Gli1 in Hedgehog signaling pathway.

    PubMed

    Khatra, Harleen; Kundu, Jayanta; Khan, Pragya Paramita; Duttagupta, Indranil; Pattanayak, Sankha; Sinha, Surajit

    2016-09-15

    Piperazic acid, a non-proteinogenic amino acid, found in complex secondary metabolites and peptide natural substances, has shown down regulation of Gli1 expression in Hedgehog signaling pathway in cell based assays. Further structure activity relationship study indicated that amide derivatives of piperazic acid are more potent than piperazic acid itself, with little to no toxicity. However, other cellular components involved in the pathway were not affected. To the best of our knowledge, this is the first report on the inhibitory property of piperazic acid in this pathway. Hence, this molecule could serve as a useful tool for studying Hedgehog signaling. PMID:27528433

  3. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  4. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  5. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  6. Alternative fermentation pathway of cinnamic acid production via phenyllactic acid.

    PubMed

    Masuo, Shunsuke; Kobayashi, Yuta; Oinuma, Ken-Ichi; Takaya, Naoki

    2016-10-01

    Cinnamic acid (CA) is the chemical basis for bulk production of flavoring reagents and chemical intermediates, and it can be fermented from biomass. Phenylalanine ammonia lyase (PAL) has been used exclusively in the bacterial fermentation of sugar biomass in which the fermentation intermediate phenylalanine is deaminated to CA. Here, we designed an alternative metabolic pathway for fermenting glucose to CA. An Escherichia coli strain that generates phenylalanine in this pathway also produces Wickerhamia fluorescens phenylpyruvate reductase and ferments glucose to D-phenyllactate (D-PhLA) (Fujita et al. Appl Microbiol Biotechnol 97: 8887-8894, 2013). Thereafter, phenyllactate dehydratase encoded by fldABCI genes in Clostridium sporogenes converts the resulting D-PhLA into CA. The phenyllactate dehydratase expressed by fldABCI in the D-PhLA-producing bacterium fermented glucose to CA, but D-PhLA fermentation and phenyllactate dehydration were aerobic and anaerobic processes, respectively, which disrupted high-yield CA fermentation in single batch cultures. We overcame this disruption by sequentially culturing the two strains under aerobic and anaerobic conditions. We optimized the incubation periods of the respective aeration steps to produce 1.7 g/L CA from glucose, which exceeded the yield from PAL-dependent glucose fermentation to CA 11-fold. This process is a novel, efficient alternative to conventional PAL-dependent CA production.

  7. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  8. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  9. Glycerolipid synthesis in Chlorella kessleri 11h. I. Existence of a eukaryotic pathway.

    PubMed

    Sato, Norihiro; Tsuzuki, Mikio; Kawaguchi, Akihiko

    2003-07-01

    The fatty acid distributions at the sn-1 and sn-2 positions in major chloroplast lipids of Chlorella kessleri 11h, monogalactosyl diacylglycerol (MGDG) and digalactosyl diacylglycerol (DGDG), were determined to show the coexistence of both C16 and C18 acids at the sn-2 position, i.e. of prokaryotic and eukaryotic types in these galactolipids. For investigation of the biosynthetic pathway for glycerolipids in C. kessleri 11h, cells were fed with [14C]acetate for 30 min, and then the distribution of the radioactivity among glycerolipids and their constituent fatty acids during the subsequent chase period was determined. MGDG and DGDG were labeled predominantly as the sn-1-C18-sn-2-C16 (C18/C16) species as early as by the start of the chase, which suggested the synthesis of these lipids within chloroplasts via a prokaryotic pathway. On the other hand, the sn-1-C18-sn-2-C18 (C18/C18) species of these galactolipids gradually gained radioactivity at later times, concomitant with a decrease in the radioactivity of the C18/C18 species of phosphatidylcholine (PC). The change at later times can be explained by the conversion of the C18/C18 species of PC into galactolipids through a eukaryotic pathway. The results showed that C. kessleri 11h, distinct from most of other green algal species that were postulated mainly to use a prokaryotic pathway for the synthesis of chloroplast lipids, is similar to a group of higher plants designated as 16:3 plants in terms of the cooperation of prokaryotic and eukaryotic pathways to synthesize chloroplast lipids. We propose that the physiological function of the eukaryotic pathway in C. kessleri 11h is to supply chloroplast membranes with 18:3/18:3-MGDG for their functioning, and that the acquisition of a eukaryotic pathway by green algae was favorable for evolution into land plants.

  10. Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus

    DOE PAGESBeta

    Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.; Wang, Clay C.

    2014-09-29

    Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Lastly, defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.

  11. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  12. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  13. Ascorbate synthesis pathway, dual role of ascorbate in bone homeostasis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) m...

  14. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  15. Pathways for virus assembly around nucleic acids

    PubMed Central

    Perlmutter, Jason D; Perkett, Matthew R

    2014-01-01

    Understanding the pathways by which viral capsid proteins assemble around their genomes could identify key intermediates as potential drug targets. In this work we use computer simulations to characterize assembly over a wide range of capsid protein-protein interaction strengths and solution ionic strengths. We find that assembly pathways can be categorized into two classes, in which intermediates are either predominantly ordered or disordered. Our results suggest that estimating the protein-protein and the protein-genome binding affinities may be sufficient to predict which pathway occurs. Furthermore, the calculated phase diagrams suggest that knowledge of the dominant assembly pathway and its relationship to control parameters could identify optimal strategies to thwart or redirect assembly to block infection. Finally, analysis of simulation trajectories suggests that the two classes of assembly pathways can be distinguished in single molecule fluorescence correlation spectroscopy or bulk time resolved small angle x-ray scattering experiments. PMID:25036288

  16. Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

    NASA Astrophysics Data System (ADS)

    Fu, Qi; Socki, Richard A.; Niles, Paul B.

    2015-04-01

    Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher δ13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of δ13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ∼31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of δ13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic

  17. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  18. Exploring De Novo metabolic pathways from pyruvate to propionic acid.

    PubMed

    Stine, Andrew; Zhang, Miaomin; Ro, Soo; Clendennen, Stephanie; Shelton, Michael C; Tyo, Keith E J; Broadbelt, Linda J

    2016-03-01

    Industrial biotechnology provides an efficient, sustainable solution for chemical production. However, designing biochemical pathways based solely on known reactions does not exploit its full potential. Enzymes are known to accept non-native substrates, which may allow novel, advantageous reactions. We have previously developed a computational program named Biological Network Integrated Computational Explorer (BNICE) to predict promiscuous enzyme activities and design synthetic pathways, using generalized reaction rules curated from biochemical reaction databases. Here, we use BNICE to design pathways synthesizing propionic acid from pyruvate. The currently known natural pathways produce undesirable by-products lactic acid and succinic acid, reducing their economic viability. BNICE predicted seven pathways containing four reaction steps or less, five of which avoid these by-products. Among the 16 biochemical reactions comprising these pathways, 44% were validated by literature references. More than 28% of these known reactions were not in the BNICE training dataset, showing that BNICE was able to predict novel enzyme substrates. Most of the pathways included the intermediate acrylic acid. As acrylic acid bioproduction has been well advanced, we focused on the critical step of reducing acrylic acid to propionic acid. We experimentally validated that Oye2p from Saccharomyces cerevisiae can catalyze this reaction at a slow turnover rate (10(-3) s(-1) ), which was unknown to occur with this enzyme, and is an important finding for further propionic acid metabolic engineering. These results validate BNICE as a pathway-searching tool that can predict previously unknown promiscuous enzyme activities and show that computational methods can elucidate novel biochemical pathways for industrial applications. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:303-311, 2016. PMID:26821575

  19. Regulation of protein synthesis by amino acids in muscle of neonates.

    PubMed

    Suryawan, Agus; Davis, Teresa A

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed.

  20. Cytochrome P450 epoxygenase pathway of polyunsaturated fatty acid metabolism

    PubMed Central

    Spector, Arthur A.; Kim, Hee-Yong

    2014-01-01

    Polyunsaturated fatty acids (PUFA) are oxidized by cytochrome P450 epoxygenases to PUFA epoxides which function as potent lipid mediators. The major metabolic pathways of PUFA epoxides are incorporation into phospholipids and hydrolysis to the corresponding PUFA diols by soluble epoxide hydrolase. Inhibitors of soluble epoxide hydrolase stabilize PUFA epoxides and potentiate their functional effects. The epoxyeicosatrienoic acids (EETs) synthesized from arachidonic acid produce vasodilation, stimulate angiogenesis, have anti-inflammatory actions, and protect the heart against ischemia-reperfusion injury. EETs produce these functional effects by activating receptor-mediated signaling pathways and ion channels. The epoxyeicosatetraenoic acids synthesized from eicosapentaenoic acid and epoxydocosapentaenoic acids synthesized from docosahexaenoic acid are potent inhibitors of cardiac arrhythmias. Epoxydocosapentaenoic acids also inhibit angiogenesis, decrease inflammatory and neuropathic pain, and reduce tumor metastasis. These findings indicate that a number of the beneficial functions of PUFA may be due to their conversion to PUFA epoxides. PMID:25093613

  1. Bile Acids as Hormones: The FXR-FGF15/19 Pathway

    PubMed Central

    Kliewer, Steven A.; Mangelsdorf, David J.

    2015-01-01

    While it has long been recognized that bile acids are essential for solubilizing lipophilic nutrients in the small intestine, the discovery in 1999 that bile acids serve as ligands for the nuclear receptor FXR opened the floodgates in terms of characterizing their actions as selective signaling molecules. Bile acids act on FXR in ileal enterocytes to induce the expression of fibroblast growth factor (FGF) 15/19, an atypical FGF that functions as a hormone. FGF15/19 subsequently acts on a cell surface receptor complex in hepatocytes to repress bile acid synthesis and gluconeogenesis and to stimulate glycogen and protein synthesis. FGF15/19 also stimulates gallbladder filling. Thus, the bile acid-FXR-FGF15/19 signaling pathway regulates diverse aspects of the postprandial enterohepatic response. Pharmacologically, this endocrine pathway provides exciting new opportunities for treating metabolic disease and bile acid-related disorders such as primary biliary cirrhosis and bile acid diarrhea. Both FXR agonists and FGF19 analogs are currently in clinical trials. PMID:26045265

  2. Bile Acids as Hormones: The FXR-FGF15/19 Pathway.

    PubMed

    Kliewer, Steven A; Mangelsdorf, David J

    2015-01-01

    While it has long been recognized that bile acids are essential for solubilizing lipophilic nutrients in the small intestine, the discovery in 1999 that bile acids serve as ligands for the nuclear receptor farnesoid X receptor (FXR) opened the floodgates in terms of characterizing their actions as selective signaling molecules. Bile acids act on FXR in ileal enterocytes to induce the expression of fibroblast growth factor (FGF)15/19, an atypical FGF that functions as a hormone. FGF15/19 subsequently acts on a cell surface receptor complex in hepatocytes to repress bile acid synthesis and gluconeogenesis, and to stimulate glycogen and protein synthesis. FGF15/19 also stimulates gallbladder filling. Thus, the bile acid-FXR-FGF15/19 signaling pathway regulates diverse aspects of the postprandial enterohepatic response. Pharmacologically, this endocrine pathway provides exciting new opportunities for treating metabolic disease and bile acid-related disorders such as primary biliary cirrhosis and bile acid diarrhea. Both FXR agonists and FGF19 analogs are currently in clinical trials. PMID:26045265

  3. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  4. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis

    PubMed Central

    Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula

    2015-01-01

    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography–mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography–tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos. PMID:25711705

  5. Biosynthesis of indole-3-acetic acid via the indole-3-acetamide pathway in Streptomyces spp.

    PubMed

    Manulis, S; Shafrir, H; Epstein, E; Lichter, A; Barash, I

    1994-05-01

    Various Streptomyces spp. including S. violaceus, S. scabies, S. griseus, S. exfoliatus, S. coelicolor and S. lividans secrete indole-3-acetic acid (IAA) when fed with L-tryptophan (Trp). Production of IAA was detected in Streptomyces strains causing potato scab as well as in non-pathogenic strains. The pathways for IAA synthesis from Trp were investigated in S. violaceus and S. exfoliatus. Indole-3-acetamide (IAM), indole-3-lactic acid (ILA), indole-3-ethanol (IEt) and IAA were identified by HPLC and GC-MS. Streptomyces cells were capable of catabolizing IAM, ILA, IEt and indole-3-acetaldehyde (IAAId) into IAA. Incorporation of radioactivity into IAM, IAA and ILA but not IEt was detected when cells were fed with L-[3-14C]tryptophan. Results indicate the presence of the IAM pathway (Trp-->IAM-->IAA) and the possible presence of additional pathways for IAA biosynthesis in Streptomyces. PMID:8025670

  6. Modified branched-chain amino acid pathways give rise to acyl acids of sucrose esters exuded from tobacco leaf trichomes.

    PubMed

    Kandra, G; Severson, R; Wagner, G J

    1990-03-10

    A major diversion of carbon from branched-chain amino acid biosynthesis/catabolism to form acyl moieties of sucrose esters (6-O-acetyl-2,3,4-tri-O-acyl-alpha-D-glucopyranosyl-beta-D- fructofuranosides) was observed to be associated with specialized trichome head cells which secrete large amounts of sucrose esters. Surface chemistry and acetyl and acyl substituent groups of tobacco (T.I. 1068) sucrose esters were identified and quantified by gas chromatography/mass spectrometry. Sucrose esters were prominent surface constituents and 3-methylvaleric acid, 2- and 3-methylbutyric acid, and methylpropionic acid accounted for 60%, 25% and 9%, respectively, of total C3--C7 acyl substituents. Radiolabeled Thr, Ile, Val, Leu, pyruvate and Asp, metabolites of branched-chain amino acid pathways, were compared with radioactively labeled acetate and sucrose as donors of carbon to sucrose, acetyl and acyl components of sucrose esters using epidermal peels with undisturbed trichomes. Preparations of biosynthetically competent trichome heads (site of sucrose ester formation) were also examined. Results indicate that 3-methylvaleryl and 2-methylbutyryl groups are derived from the Thr pathway of branched-chain amino acid metabolism, 3-methylbutyryl and methylpropionyl groups are formed via the pyruvate pathway, and that acetyl groups are principally formed directly via acetyl-CoA. Arguments are presented which rule out participation of fatty acid synthase in the formation of prominent acyl acids. Results suggest that the shunting of carbon away from the biosynthesis of Val, Leu and Ile may be due to a low level of amino acid utilization in protein synthesis in specialized glandular head cells of trichomes. This would result in the availability of corresponding oxo acids for CoA activation and esterification to form sucrose esters. Preliminary evidence was found for the involvement of cycling reactions in oxo-acid-chain lengthening and for utilization of pyruvate-derived 2

  7. Pathway Engineered Enzymatic de novo Purine Nucleotide Synthesis

    PubMed Central

    Schultheisz, Heather L.; Szymczyna, Blair R.; Scott, Lincoln G.; Williamson, James R.

    2009-01-01

    A general method for isotopic labeling of the purine base moiety of nucleotides and RNA has been developed through biochemical pathway engineering in vitro. A synthetic scheme was designed and implemented utilizing recombinant enzymes from the pentose phosphate and de novo purine synthesis pathways, with regeneration of folate, aspartate, glutamine, ATP, and NADPH cofactors, in a single-pot reaction. Syntheses proceeded quickly and efficiently in comparison to chemical methods with isolated yields up to 66% for 13C, 15N enriched ATP and GTP. The scheme is robust and flexible, requiring only serine, NH4+, glucose and CO2 as stoichiometric precursors in labeled form. Using this approach, U-13C- GTP, U-13C,15N- GTP, 13C2,8- ATP and U-15N- GTP were synthesized on a millimole scale, and the utility of the isotope labeling is illustrated in NMR spectra of HIV-2 transactivation region (TAR) RNA containing 13C 2,8-adenosine and 15N-1,3,7,9,2-guanosine. Pathway engineering in vitro permits complex synthetic cascades to be effected expanding the applicability of enzymatic synthesis. PMID:18707057

  8. Docosahexaenoic acid and signaling pathways in rabbit colon.

    PubMed

    Calderaro, V; Parrillo, C; Balestrieri, M L; Giovane, A; Filippelli, A; Rossi, F

    1994-04-01

    The effects of one of the main components of fish oil, docosahexaenoic acid (DHA), on prostaglandin (PG) and Ca2+ signaling pathways were examined in intact mucosa and freshly isolated crypt cells of rabbit descending colon. Preincubation of serosal mucosa for 20 min with 1 microM DHA fully suppressed the short-circuit and transepithelial conductance increase induced by serosal addition of 10 microM arachidonic acid (AA). DHA at 1 microM also prevented the Cl- secretion promoted by 10 microM AA, as estimated by unidirectional 36Cl flux measurements (net flux = 0.68 +/- 0.30 versus -1.91 +/- 0.20 microEq/hr/cm2, four experiments, p < 0.001), whereas it did not affect the electrophysiological and ion flux responses to PGE2. Addition of 1 microM DHA to the serosal side of the mucosa also inhibited the PG cascade activation elicited by AA (PG synthesis and second messenger cAMP increase). In vitro assays of colonic cyclooxygenase activity showed that 1 microM DHA inhibited (with a 20-min lag) cyclooxygenase activity to the same extent as 5 microM indomethacin (approximately 82% and 80%, respectively). DHA also affected the Ca2+ signaling pathway; in isolated crypt cells, the cytosolic free Ca2+ concentration ([Ca2+]i) dropped by 49 +/- 7.6% (mean +/- standard error, six experiments) after incubation with 1 microM DHA. The sustained phase of the [Ca2+]i response to 500 nM concentrations of the intracellular Ca(2+)-ATPase inhibitor thapsigargin was also inhibited within 150 sec upon 1 microM DHA addition (141 +/- 5.8 versus 243 +/- 8.2 nM [Ca2+]i mean +/- standard error, eight experiments, p < 0.01). The [Ca2+]i-lowering effect of DHA, which was not achieved by incubation with other free fatty acids, was not prevented by removal of Na+ from the incubation medium (-46 +/- 4.3% versus -47 +/- 3.8%, mean +/- standard error, four experiments), nor it was mediated by cAMP-, protein kinase C-, or calmodulin-dependent mechanisms. The incubation of highly purified basolateral

  9. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  10. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition.

  11. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  12. The Pseudomonas siderophore quinolobactin is synthesized from xanthurenic acid, an intermediate of the kynurenine pathway.

    PubMed

    Matthijs, Sandra; Baysse, Christine; Koedam, Nico; Tehrani, Kourosh Abbaspour; Verheyden, Lieve; Budzikiewicz, Herbert; Schäfer, Mathias; Hoorelbeke, Bart; Meyer, Jean-Marie; De Greve, Henri; Cornelis, Pierre

    2004-04-01

    To cope with iron deficiency fluorescent pseudomonads produce pyoverdines which are complex peptidic siderophores that very efficiently scavenge iron. In addition to pyoverdine some species also produce other siderophores. Recently, it was shown that Pseudomonas fluorescens ATCC 17400 produces the siderophore quinolobactin, an 8-hydroxy-4-methoxy-2-quinoline carboxylic acid (Mossialos, D., Meyer, J.M., Budzikiewicz, H., Wolff, U., Koedam, N., Baysse, C., Anjaiah, V., and Cornelis, P. (2000) Appl Environ Microbiol 66: 487-492). The entire quinolobactin biosynthetic, transport and uptake gene cluster, consisting out of two operons comprising 12 open reading frames, was cloned and sequenced. Based on the genes present and physiological complementation assays a biosynthetic pathway for quinolobactin is proposed. Surprisingly, this pathway turned out to combine genes derived from the eukaryotic tryptophan-xanthurenic acid branch of the kynurenine pathway and from the pathway for the biosynthesis of pyridine-2,6-bis(thiocarboxylic acid) from P. stutzeri, PDTC. These results clearly show the involvement of the tryptophan-kynurenine-xanthurenic acid pathway in the synthesis of an authentic quinoline siderophore. PMID:15066027

  13. New approaches to target the mycolic acid biosynthesis pathway for the development of tuberculosis therapeutics.

    PubMed

    North, E Jeffrey; Jackson, Mary; Lee, Richard E

    2014-01-01

    Mycolic acids are the major lipid components of the unique mycobacterial cell wall responsible for the protection of the tuberculosis bacilli from many outside threats. Mycolic acids are synthesized in the cytoplasm and transported to the outer membrane as trehalose- containing glycolipids before being esterified to the arabinogalactan portion of the cell wall and outer membrane glycolipids. The large size of these unique fatty acids is a result of a huge metabolic investment that has been evolutionarily conserved, indicating the importance of these lipids to the mycobacterial cellular survival. There are many key enzymes involved in the mycolic acid biosynthetic pathway, including fatty acid synthesis (KasA, KasB, MabA, InhA, HadABC), mycolic acid modifying enzymes (SAM-dependent methyltransferases, aNAT), fatty acid activating and condensing enzymes (FadD32, Acc, Pks13), transporters (MmpL3) and tranferases (Antigen 85A-C) all of which are excellent potential drug targets. Not surprisingly, in recent years many new compounds have been reported to inhibit specific portions of this pathway, discovered through both phenotypic screening and target enzyme screening. In this review, we analyze the new and emerging inhibitors of this pathway discovered in the post-genomic era of tuberculosis drug discovery, several of which show great promise as selective tuberculosis therapeutics. PMID:24245756

  14. New Approaches to Target the Mycolic Acid Biosynthesis Pathway for the Development of Tuberculosis Therapeutics

    PubMed Central

    North, E. Jeffrey; Jackson, Mary; Lee, Richard E.

    2015-01-01

    Mycolic acids are the major lipid component of the unique mycobacterial cell wall responsible for the protection of the tuberculosis bacilli from many outside threats. Mycolic acids are synthesized in the cytoplasm and transported to the outer membrane as trehalose-containing glycolipids before being esterified to the arabinogalactan portion of the cell wall and outer membrane glycolipids. The large size of these unique fatty acids is a result of a huge metabolic investment that has been evolutionarily conserved, indicating the importance of these lipids to the mycobacterial cellular survival. There are many key enzymes involved in the mycolic acid biosynthetic pathway, including fatty acid synthesis (KasA, KasB, MabA, InhA, HadABC), mycolic acid modifying enzymes (SAM-dependent methyltransferases, aNAT), fatty acid activating and condensing enzymes (FadD32, Acc, Pks13), transporters (MmpL3) and tranferases (Antigen 85A-C) all of which are excellent potential drug targets. Not surprisingly, in recent years many new compounds have been reported to inhibit specific portions of this pathway, discovered through both phenotypic screening and target enzyme screening. In this review, we analyze the new and emerging inhibitors of this pathway discovered in the post-genomic era of tuberculosis drug discovery, several of which show great promise as selective tuberculosis therapeutics. PMID:24245756

  15. MAFG is a transcriptional repressor of bile acid synthesis and metabolism.

    PubMed

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Ahn, Hannah; Hagey, Lee R; Romanoski, Casey E; Lee, Richard G; Graham, Mark J; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A

    2015-02-01

    Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis, and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG(+/-) mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR.

  16. MAFG Is a Transcriptional Repressor of Bile Acid Synthesis and Metabolism

    PubMed Central

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Ahn, Hannah; Hagey, Lee R.; Romanoski, Casey E.; Lee, Richard G.; Graham, Mark J.; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A.

    2015-01-01

    Summary Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway, and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG+/− mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-Seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR. PMID:25651182

  17. Bimolecular decomposition pathways for carboxylic acids of relevance to biofuels.

    PubMed

    Clark, Jared M; Nimlos, Mark R; Robichaud, David J

    2015-01-22

    The bimolecular thermal reactions of carboxylic acids were studied using quantum mechanical molecular modeling. Previous work1 investigated the unimolecular decomposition of a variety of organic acids, including saturated, α,β-unsaturated, and β,γ-unsaturated acids, and showed that the type and position of the unsaturation resulted in unique branching ratios between dehydration and decarboxylation, [H2O]/[CO2]. In this work, the effect of bimolecular chemistry (water-acid and acid-acid) is considered with a representative of each acid class. In both cases, the strained 4-centered, unimolecular transition state, typical of most organic acids, is opened up to 6- or 8-centered bimolecular geometries. These larger structures lead to a reduction in the barrier heights (20-45%) of the thermal decomposition pathways for organic acids and an increase in the decomposition kinetics. In some cases, they even cause a shift in the branching ratio of the corresponding product slates.

  18. Synthesis of Lipoteichoic Acids in Bacillus anthracis

    PubMed Central

    Garufi, Gabriella; Hendrickx, Antoni P.; Beeri, Karen; Kern, Justin W.; Sharma, Anshika; Richter, Stefan G.; Schneewind, Olaf

    2012-01-01

    Lipoteichoic acid (LTA), a glycerol phosphate polymer, is a component of the envelope of Gram-positive bacteria that has hitherto not been identified in Bacillus anthracis, the causative agent of anthrax. LTA synthesis in Staphylococcus aureus and other microbes is catalyzed by the product of the ltaS gene, a membrane protein that polymerizes polyglycerol phosphate from phosphatidyl glycerol. Here we identified four ltaS homologues, designated ltaS1 to -4, in the genome of Bacillus anthracis. Polyglycerol phosphate-specific monoclonal antibodies were used to detect LTA in the envelope of B. anthracis strain Sterne (pXO1+ pXO2−) vegetative forms. B. anthracis mutants lacking ltaS1, ltaS2, ltaS3, or ltaS4 did not display defects in growth or LTA synthesis. In contrast, B. anthracis strains lacking both ltaS1 and ltaS2 were unable to synthesize LTA and exhibited reduced viability, altered envelope morphology, aberrant separation of vegetative forms, and decreased sporulation efficiency. Expression of ltaS1 or ltaS2 alone in B. anthracis as well as in other microbes was sufficient for polyglycerol phosphate synthesis. Thus, similar to S. aureus, B. anthracis employs LtaS enzymes to synthesize LTA, an envelope component that promotes bacterial growth and cell division. PMID:22685279

  19. A mutation affecting the synthesis of 4-chloroindole-3-acetic acid.

    PubMed

    Ross, John J; Tivendale, Nathan D; Davidson, Sandra E; Reid, James B; Davies, Noel W; Quittenden, Laura J; Smith, Jason A

    2012-12-01

    Traditionally, schemes depicting auxin biosynthesis in plants have been notoriously complex. They have involved up to four possible pathways by which the amino acid tryptophan might be converted to the main active auxin, indole-3-acetic acid (IAA), while another pathway was suggested to bypass tryptophan altogether. It was also postulated that different plants use different pathways, further adding to the complexity. In 2011, however, it was suggested that one of the four tryptophan-dependent pathways, via indole-3-pyruvic acid (IPyA), is the main pathway in Arabidopsis thaliana, although concurrent operation of one or more other pathways has not been excluded. We recently showed that, for seeds of Pisum sativum (pea), it is possible to go one step further. Our new evidence indicates that the IPyA pathway is the only tryptophan-dependent IAA synthesis pathway operating in pea seeds. We also demonstrated that the main auxin in developing pea seeds, 4-chloroindole-3-acetic acid (4-Cl-IAA), which accumulates to levels far exceeding those of IAA, is synthesized via a chlorinated version of the IPyA pathway. PMID:23073010

  20. Ambient pressure synthesis of MIL-100(Fe) MOF from homogeneous solution using a redox pathway.

    PubMed

    Jeremias, Felix; Henninger, Stefan K; Janiak, Christoph

    2016-05-17

    Micro- to mesoporous iron(iii) trimesate MIL-100(Fe) is a MOF of high interest for numerous applications. With regard to large-scale synthesis, e.g., by continuous flow or the in situ deposition of coatings, a replacement for the conventional, hydrothermal low-yield fluoride-containing synthesis is desirable. In this contribution, we present a method to synthesize crystalline fluoride-free MIL-100(Fe) from iron(iii) nitrate and trimesic acid in zeotropic DMSO/water solution at normal ambient pressure involving a DMSO-nitrate redox pathway. Yields of 72%, surface areas of SBET = 1791 m(2) g(-1) and pore volumes of Vpore = 0.82 cm(3) g(-1) were achieved. PMID:27143562

  1. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  2. Genomic and biochemical analysis of lipid biosynthesis in the unicellular rhodophyte Cyanidioschyzon merolae: lack of a plastidic desaturation pathway results in the coupled pathway of galactolipid synthesis.

    PubMed

    Sato, Naoki; Moriyama, Takashi

    2007-06-01

    The acyl lipids making up the plastid membranes in plants and algae are highly enriched in polyunsaturated fatty acids and are synthesized by two distinct pathways, known as the prokaryotic and eukaryotic pathways, which are located within the plastids and the endoplasmic reticulum, respectively. Here we report the results of biochemical as well as genomic analyses of lipids and fatty acids in the unicellular rhodophyte Cyanidioschyzon merolae. All of the glycerolipids usually found in photosynthetic algae were found, such as mono- and digalactosyl diacylglycerol, sulfolipid, phosphatidylglycerol, phosphatidylcholine, phosphatidylethanolamine, and phosphatidylinositol. However, the fatty acid composition was extremely simple. Only palmitic, stearic, oleic, and linoleic acids were found as major acids. In addition, 3-trans-hexadecanoic acid was found as a very minor component in phosphatidylglycerol. Unlike the case for most other photosynthetic eukaryotes, polyenoic fatty acids having three or more double bonds were not detected. These results suggest that polyunsaturated fatty acids are not necessary for photosynthesis in eukaryotes. Genomic analysis suggested that C. merolae lacks acyl lipid desaturases of cyanobacterial origin as well as stearoyl acyl carrier protein desaturase, both of which are major desaturases in plants and green algae. The results of labeling experiments with radioactive acetate showed that the desaturation leading to linoleic acid synthesis occurs on phosphatidylcholine located outside the plastids. Monogalactosyl diacylglycerol is therefore synthesized by the coupled pathway, using plastid-derived palmitic acid and endoplasmic reticulum-derived linoleic acid. These results highlight essential differences in lipid biosynthetic pathways between the red algae and the green lineage, which includes plants and green algae.

  3. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective.

  4. Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha.

    PubMed

    Eklund, D Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L

    2015-06-01

    The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. PMID:26036256

  5. Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha.

    PubMed

    Eklund, D Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L

    2015-06-01

    The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha.

  6. Classical dendritic cells mediate fibrosis directly via the retinoic acid pathway in severe eye allergy

    PubMed Central

    Ahadome, Sarah D.; Mathew, Rose; Reyes, Nancy J.; Mettu, Priyatham S.; Cousins, Scott W.; Calder, Virginia L.; Saban, Daniel R.

    2016-01-01

    Fibrosis is a shared end-stage pathway to lung, liver, and heart failure. In the ocular mucosa (conjunctiva), fibrosis leads to blindness in trachoma, pemphigoid, and allergy. The indirect fibrogenic role of DCs via T cell activation and inflammatory cell recruitment is well documented. However, here we demonstrate that DCs can directly induce fibrosis. In the mouse model of allergic eye disease (AED), classical CD11b+ DCs in the ocular mucosa showed increased activity of aldehyde dehydrogenase (ALDH), the enzyme required for retinoic acid synthesis. In vitro, CD11b+ DC–derived ALDH was associated with 9-cis-retinoic acid ligation to retinoid x receptor (RXR), which induced conjunctival fibroblast activation. In vivo, stimulating RXR led to rapid onset of ocular mucosal fibrosis, whereas inhibiting ALDH activity in DCs or selectively depleting DCs markedly reduced fibrosis. Collectively, these data reveal a profibrotic ALDH-dependent pathway by DCs and uncover a role for DC retinoid metabolism. PMID:27595139

  7. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  8. Metabolomics Analysis Reveals that AICAR Affects Glycerolipid, Ceramide and Nucleotide Synthesis Pathways in INS-1 Cells.

    PubMed

    ElAzzouny, Mahmoud A; Evans, Charles R; Burant, Charles F; Kennedy, Robert T

    2015-01-01

    AMPK regulates many metabolic pathways including fatty acid and glucose metabolism, both of which are closely associated with insulin secretion in pancreatic β-cells. Insulin secretion is regulated by metabolic coupling factors such as ATP/ADP ratio and other metabolites generated by the metabolism of nutrients such as glucose, fatty acid and amino acids. However, the connection between AMPK activation and insulin secretion in β-cells has not yet been fully elucidated at a metabolic level. To study the effect of AMPK activation on glucose stimulated insulin secretion, we applied the pharmacological activator 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) to an INS-1 (832/13) β-cell line. We measured the change in 66 metabolites in the presence or absence of AICAR using different stable isotopic labeled nutrients to probe selected pathways. AMPK activation by AICAR increased basal insulin secretion and reduced the glucose stimulation index. Although ATP/ADP ratios were not strongly affected by AICAR, several other metabolites and pathways important for insulin secretion were affected by AICAR treatment including long-chain CoAs, malonyl-CoA, 3-hydroxy-3 methylglutaryl CoA, diacylglycerol, and farnesyl pyrophosphate. Tracer studies using 13C-glucose revealed lower glucose flux in the purine and pyrimidine pathway and in the glycerolipid synthesis pathway. Untargeted metabolomics revealed reduction in ceramides caused by AICAR that may explain the beneficial role of AMPK in protecting β-cells from lipotoxicity. Taken together, the results provide an overall picture of the metabolic changes associated with AICAR treatment and how it modulates insulin secretion and β-cell survival.

  9. Extending shikimate pathway for the production of muconic acid and its precursor salicylic acid in Escherichia coli.

    PubMed

    Lin, Yuheng; Sun, Xinxiao; Yuan, Qipeng; Yan, Yajun

    2014-05-01

    cis,cis-Muconic acid (MA) and salicylic acid (SA) are naturally-occurring organic acids having great commercial value. MA is a potential platform chemical for the manufacture of several widely-used consumer plastics; while SA is mainly used for producing pharmaceuticals (for example, aspirin and lamivudine) and skincare and haircare products. At present, MA and SA are commercially produced by organic chemical synthesis using petro-derived aromatic chemicals, such as benzene, as starting materials, which is not environmentally friendly. Here, we report a novel approach for efficient microbial production of MA via extending shikimate pathway by introducing the hybrid of an SA biosynthetic pathway with its partial degradation pathway. First, we engineered a well-developed phenylalanine producing Escherichia coli strain into an SA overproducer by introducing isochorismate synthase and isochorismate pyruvate lyase. The engineered strain is able to produce 1.2g/L of SA from simple carbon sources, which is the highest titer reported so far. Further, the partial SA degradation pathway involving salicylate 1-monoxygenase and catechol 1,2-dioxygenase is established to achieve the conversion of SA to MA. Finally, a de novo MA biosynthetic pathway is assembled by integrating the established SA biosynthesis and degradation modules. Modular optimization enables the production of up to 1.5g/L MA within 48h in shake flasks. This study not only establishes an efficient microbial platform for the production of SA and MA, but also demonstrates a generalizable pathway design strategy for the de novo biosynthesis of valuable degradation metabolites.

  10. Extending shikimate pathway for the production of muconic acid and its precursor salicylic acid in Escherichia coli.

    PubMed

    Lin, Yuheng; Sun, Xinxiao; Yuan, Qipeng; Yan, Yajun

    2014-05-01

    cis,cis-Muconic acid (MA) and salicylic acid (SA) are naturally-occurring organic acids having great commercial value. MA is a potential platform chemical for the manufacture of several widely-used consumer plastics; while SA is mainly used for producing pharmaceuticals (for example, aspirin and lamivudine) and skincare and haircare products. At present, MA and SA are commercially produced by organic chemical synthesis using petro-derived aromatic chemicals, such as benzene, as starting materials, which is not environmentally friendly. Here, we report a novel approach for efficient microbial production of MA via extending shikimate pathway by introducing the hybrid of an SA biosynthetic pathway with its partial degradation pathway. First, we engineered a well-developed phenylalanine producing Escherichia coli strain into an SA overproducer by introducing isochorismate synthase and isochorismate pyruvate lyase. The engineered strain is able to produce 1.2g/L of SA from simple carbon sources, which is the highest titer reported so far. Further, the partial SA degradation pathway involving salicylate 1-monoxygenase and catechol 1,2-dioxygenase is established to achieve the conversion of SA to MA. Finally, a de novo MA biosynthetic pathway is assembled by integrating the established SA biosynthesis and degradation modules. Modular optimization enables the production of up to 1.5g/L MA within 48h in shake flasks. This study not only establishes an efficient microbial platform for the production of SA and MA, but also demonstrates a generalizable pathway design strategy for the de novo biosynthesis of valuable degradation metabolites. PMID:24583236

  11. The general amino acid control pathway regulates mTOR and autophagy during serum/glutamine starvation.

    PubMed

    Chen, Rui; Zou, Yilong; Mao, Dongxue; Sun, Daxiao; Gao, Guanguang; Shi, Jingwen; Liu, Xiaoqing; Zhu, Chen; Yang, Mingyu; Ye, Wanlu; Hao, Qianqian; Li, Ruiqiang; Yu, Li

    2014-07-21

    Organisms have evolved elaborate mechanisms to adjust intracellular nutrient levels in response to fluctuating availability of exogenous nutrients. During starvation, cells can enhance amino acid uptake and synthesis through the general amino acid control (GAAC) pathway, whereas nonessential cellular contents are recycled by autophagy. How these two pathways are coordinated in response to starvation is currently unknown. Here we show that the GAAC pathway couples exogenous amino acid availability with autophagy. Starvation caused deactivation of mTOR, which then activated autophagy. In parallel, serum/glutamine starvation activated the GAAC pathway, which up-regulated amino acid transporters, leading to increased amino acid uptake. This elevated the intracellular amino acid level, which in turn reactivated mTOR and suppressed autophagy. Knockdown of activating transcription factor 4, the major transcription factor in the GAAC pathway, or of SLC7A5, a leucine transporter, caused impaired mTOR reactivation and much higher levels of autophagy. Thus, the GAAC pathway modulates autophagy by regulating amino acid uptake and mTOR reactivation during serum/glutamine starvation.

  12. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  13. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity. PMID:23230650

  14. [Protein synthesis by the ribosome: a pathway full of pitfalls].

    PubMed

    Macé, Kevin; Giudice, Emmanuel; Gillet, Reynald

    2015-03-01

    Protein synthesis is accomplished through a process known as translation and is carried out by the ribosome, a large macromolecular complex found in every living organism. Given the huge amount of biological data that must be deciphered, it is not uncommon for ribosomes to regularly stall during the process of translation. Any disruption of this finely tuned process will jeopardize the viability of the cell. In bacteria, the main quality-control mechanism for rescuing ribosomes that undergo arrest during translation is trans-translation, which is performed by transfer-messenger RNA (tmRNA) in association with small protein B (SmPB). However, other rescue systems have been discovered recently, revealing a far more complicated network of factors dedicated to ribosome rescue. These discoveries make it possible to consider inhibition of these pathways as a very promising target for the discovery of new antibiotics.

  15. Induction of Arabidopsis tryptophan pathway enzymes and camalexin by amino acid starvation, oxidative stress, and an abiotic elicitor.

    PubMed Central

    Zhao, J; Williams, C C; Last, R L

    1998-01-01

    The tryptophan (Trp) biosynthetic pathway leads to the production of many secondary metabolites with diverse functions, and its regulation is predicted to respond to the needs for both protein synthesis and secondary metabolism. We have tested the response of the Trp pathway enzymes and three other amino acid biosynthetic enzymes to starvation for aromatic amino acids, branched-chain amino acids, or methionine. The Trp pathway enzymes and cytosolic glutamine synthetase were induced under all of the amino acid starvation test conditions, whereas methionine synthase and acetolactate synthase were not. The mRNAs for two stress-inducible enzymes unrelated to amino acid biosynthesis and accumulation of the indolic phytoalexin camalexin were also induced by amino acid starvation. These results suggest that regulation of the Trp pathway enzymes under amino acid deprivation conditions is largely a stress response to allow for increased biosynthesis of secondary metabolites. Consistent with this hypothesis, treatments with the oxidative stress-inducing herbicide acifluorfen and the abiotic elicitor alpha-amino butyric acid induced responses similar to those induced by the amino acid starvation treatments. The role of salicylic acid in herbicide-mediated Trp and camalexin induction was investigated. PMID:9501110

  16. Arabidopsis leaf necrosis caused by simulated acid rain is related to the salicylic acid signaling pathway.

    PubMed

    Lee, Youngmi; Park, Jongbum; Im, Kyunghoan; Kim, Kiyoon; Lee, Jungwoo; Lee, Kyungyeoll; Park, Jung-An; Lee, Taek-Kyun; Park, Dae-Sup; Yang, Joo-Sung; Kim, Donggiun; Lee, Sukchan

    2006-01-01

    Arabidopsis leaves treated with simulated acid rain (SiAR) showed phenotypes similar to necrotic lesions caused by biotic stresses like Pseudomonad infiltration. Exposure of Arabidopsis to SiAR resulted in the up-regulation of genes known to be induced by the salicylic acid (SA)-mediated pathogen resistance response. The expression of enhanced disease susceptibility (EDS), nonexpressor of PR (NPR) and pathogen-related 1 (PR1), all of which are involved in the salicylic acid signaling pathway, were increased after SiAR exposure. However, vegetative storage protein (VSP), a member of the jasmonic acid pathway did not show a significant change in transcript level. SiAR treatment of transgenic plants expressing salicylate hydroxylase (Nah-G), which prevents the accumulation of salicylic acid, underwent more extensive necrosis than wild-type plants, indicating that the signaling pathway activated by SiAR may overlap with the SA-dependent, systemic acquired resistance pathway. Both Col-0 and Nah-G plants showed sensitivity to SiAR and sulfuric SiAR (S-SiAR) by developing necrotic lesions. Neither Col-0 plants nor Nah-G plants showed sensitivity to nitric SiAR (N-SiAR). These results suggest that SiAR activates at least the salicylic acid pathway and activation of this pathway is sensitive to sulfuric acid.

  17. [Analysis of oil synthesis metabolism pathways based on transcriptome changes in tung oil tree's seeds during three different development stages].

    PubMed

    Chen, Hao; Jiang, Gui-Xiong; Long, Hong-Xu; Tan, Xiao-Feng

    2013-12-01

    Tung oil tree (Verniciafordii) is one of the important woody oil plants in China. Past researches on tung oil tree mainly focu on the cultivation and conventional breeding while the molecular mechanisms related to tung oil synthesis are still uncovered. We compared transcriptome of tung oil tree's seeds at three different oil synthesis stages using RNA-seq technology and then obtained a lot of differentially expressed Unigenes. Through GO classification and pathway enrichment analysis, all of these differentially expressed Unigenes were classified into 128 metabolism pathways including fatty acid biosynthesis and glycerophospholipid metabolism which are involved in oil synthesis. Some homologous proteins of key enzymes were obtained when the sequences of the Unigenes within these two pathways were aligned against KEGG database. Through analysis of expression profiles of these key enzyme genes during seed's oil synthesis stage, this research not only shed light on elucidation of plant oil synthesis but also provides candidate genes for genetic improvement of tung oil tree thereby increasing the yield per unit area of tung oil tree.

  18. Analysis of putative nonulosonic acid biosynthesis pathways in Archaea reveals a complex evolutionary history.

    PubMed

    Kandiba, Lina; Eichler, Jerry

    2013-08-01

    Sialic acids and the other nonulosonic acid sugars, legionaminic acid and pseudaminic acid, are nine carbon-containing sugars that can be detected as components of the glycans decorating proteins and other molecules in Eukarya and Bacteria. Yet, despite the prevalence of N-glycosylation in Archaea and the variety of sugars recruited for the archaeal version of this post-translational modification, only a single report of a nonulosonic acid sugar in an archaeal N-linked glycan has appeared. Hence, to obtain a clearer picture of nonulosonic acid sugar biosynthesis capability in Archaea, 122 sequenced genomes were scanned for the presence of genes involved in the biogenesis of these sugars. The results reveal that while Archaea and Bacteria share a common route of sialic acid biosynthesis, numerous archaeal nonulosonic acid sugar biosynthesis pathway components were acquired from elsewhere via various routes. Still, the limited number of Archaea encoding components involved in the synthesis of nonulosonic acid sugars implies that such saccharides are not major components of glycans in this domain.

  19. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål).

    PubMed

    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

    2016-01-01

    The "target of rapamycin" (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527

  20. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål)

    PubMed Central

    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

    2016-01-01

    The “target of rapamycin” (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527

  1. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål).

    PubMed

    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

    2016-03-28

    The "target of rapamycin" (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens.

  2. A Peroxygenase Pathway Involved in the Biosynthesis of Epoxy Fatty Acids in Oat[W][OA

    PubMed Central

    Meesapyodsuk, Dauenpen; Qiu, Xiao

    2011-01-01

    While oat (Avena sativa) has long been known to produce epoxy fatty acids in seeds, synthesized by a peroxygenase pathway, the gene encoding the peroxygenase remains to be determined. Here we report identification of a peroxygenase cDNA AsPXG1 from developing seeds of oat. AsPXG1 is a small protein with 249 amino acids in length and contains conserved heme-binding residues and a calcium-binding motif. When expressed in Pichia pastoris and Escherichia coli, AsPXG1 catalyzes the strictly hydroperoxide-dependent epoxidation of unsaturated fatty acids. It prefers hydroperoxy-trienoic acids over hydroperoxy-dienoic acids as oxygen donors to oxidize a wide range of unsaturated fatty acids with cis double bonds. Oleic acid is the most preferred substrate. The acyl carrier substrate specificity assay showed phospholipid and acyl-CoA were not effective substrate forms for AsPXG1 and it could only use free fatty acid or fatty acid methyl esters as substrates. A second gene, AsLOX2, cloned from oat codes for a 9-lipoxygenase catalyzing the synthesis of 9-hydroperoxy-dienoic and 9-hydroperoxy-trienoic acids, respectively, when linoleic (18:2-9c,12c) and linolenic (18:3-9c,12c,15c) acids were used as substrates. The peroxygenase pathway was reconstituted in vitro using a mixture of AsPXG1 and AsLOX2 extracts from E. coli. Incubation of methyl oleate and linoleic acid or linolenic acid with the enzyme mixture produced methyl 9,10-epoxy stearate. Incubation of linoleic acid alone with a mixture of AsPXG1 and AsLOX2 produced two major epoxy fatty acids, 9,10-epoxy-12-cis-octadecenoic acid and 12,13-epoxy-9-cis-octadecenoic acid, and a minor epoxy fatty acid, probably 12,13-epoxy-9-hydroxy-10-transoctadecenoic acid. AsPXG1 predominately catalyzes intermolecular peroxygenation. PMID:21784965

  3. Synthesis of L-ascorbic acid in the phloem

    PubMed Central

    Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto

    2003-01-01

    Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288

  4. Transcriptome survey of the lipid metabolic pathways involved in energy production and ecdysteroid synthesis in the salmon louse Caligus rogercresseyi (Crustacea: Copepoda).

    PubMed

    Gonçalves, Ana Teresa; Farlora, Rodolfo; Gallardo-Escárate, Cristian

    2014-10-01

    The goal of this study was to identify and analyze the lipid metabolic pathways involved in energy production and ecdysteroid synthesis in the ectoparasite copepod Caligus rogercresseyi. Massive transcriptome sequencing analysis was performed during the infectious copepodid larval stage, during the attached chalimus larval stage, and also in female and male adults. Thirty genes were selected for describing the pathways, and these were annotated for proteins or enzymes involved in lipid digestion, absorption, and transport; fatty acid degradation; the synthesis and degradation of ketone bodies; and steroid and ecdysteroid syntheses. Differential expression of these genes was analyzed by ontogenic stage and discussed considering each stage's feeding habits and energetic needs. Copepodids showed a low expression of fatty acid digestion genes, reflected by a non-feeding behavior, and the upregulation of genes involved in steroid biosynthesis, which was consistent with a pathway for cholesterol synthesis during ecdysis. The chalimus stage showed an upregulation of genes related to fatty acid digestion, absorption, and transport, as well as to fatty acid degradation and the synthesis of ketone bodies, therefore suggesting that lipids ingested from the mucus and skin of the host fish are metabolized as important sources of energy. Adult females also showed a pattern of high lipid metabolism for energy supply and mobilization in relation to reproduction and vitellogenesis. Adult females and males revealed different lipid metabolism patterns that reflected different energetic needs. This study reports for the first time the probable lipid metabolic pathways involved in the energy production and ecdysteroid synthesis of C. rogercresseyi.

  5. DOPA and DHN pathway orchestrate melanin synthesis in Aspergillus species.

    PubMed

    Pal, Anuradha K; Gajjar, Devarshi U; Vasavada, Abhay R

    2014-01-01

    Melanins are high molecular weight hydrophobic pigments that have been studied for their role in the virulence of fungal pathogens. We investigated the amount and type of melanin in 20 isolates of Aspergillus spp.; A. niger (n = 3), A. flavus (n = 5), A. tamarii (n = 3), A. terreus (n = 3), A. tubingensis (n = 3), A. sydowii (n = 3). Aspergillus spp. were identified by sequencing the internal transcribed spacer (ITS) region. Extraction of melanin from culture filtrate and fungal biomass was done and followed by qualitative and quantitative analysis of melanin pigment. Ultraviolet (UV), Fourier transformed infrared (FT-IR), and electron paramagnetic resonance (EPR) spectra analyses confirmed the presence of melanin. The melanin pathway was studied by analyzing the effects of inhibitors; kojic acid, tropolone, phthalide, and tricyclazole. The results indicate that in A. niger and A. tubingensis melanin was found in both culture filtrate and fungal biomass. For A. tamarii and A. flavus melanin was extracted from biomass only, whereas melanin was found only in culture filtrate for A. terreus. A negligible amount of melanin was found in A. sydowii. The maximum amount of melanin from culture filtrate and fungal biomass was found in A. niger and A. tamarrii, respectively. The DOPA (3,4-dihydroxyphenylalanine) pathway produces melanin in A. niger, A. tamarii and A. flavus, whereas the DHN (1,8-dihydroxynaphthalene) pathway produces melanin in A. tubingensis and A. terreus. It can be concluded that the amount and type of melanin in aspergilli largely differ from species to species.

  6. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  7. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  8. Inhibition of plant fatty acid synthesis by nitroimidazoles.

    PubMed Central

    Jones, A V; Harwood, J L; Stratford, M R; Stumpf, P K

    1981-01-01

    1. The effect of the addition of a number of nitroimidazoles was tested on fatty acid synthesis by germinating pea seeds, isolated lettuce chloroplasts and a soluble fraction from pea seeds. 2. All the compounds tested had a marked inhibition on stearate desaturation by lettuce chloroplasts and on the synthesis of very-long-chain fatty acids by pea seeds. 3. In contrast, the effect of the drugs on total fatty acid synthesis from [14C]acetate in chloroplasts was related to the compound's electron reduction potentials. 4. Of the compounds used, only metronidazole had a marked inhibition on palmitate elongation in the systems tested. 5. The mechanism of inhibition of plant fatty acid synthesis by nitroimidazoles is discussed and the possible relevance of these findings to their neurotoxicity is suggested. PMID:7325993

  9. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  10. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  11. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  12. Retinoic acid response element in the human alcohol dehydrogenase gene ADH3: implications for regulation of retinoic acid synthesis.

    PubMed Central

    Duester, G; Shean, M L; McBride, M S; Stewart, M J

    1991-01-01

    Retinoic acid regulation of one member of the human class I alcohol dehydrogenase (ADH) gene family was demonstrated, suggesting that the retinol dehydrogenase function of ADH may play a regulatory role in the biosynthetic pathway for retinoic acid. Promoter activity of human ADH3, but not ADH1 or ADH2, was shown to be activated by retinoic acid in transient transfection assays of Hep3B human hepatoma cells. Deletion mapping experiments identified a region in the ADH3 promoter located between -328 and -272 bp which confers retinoic acid activation. This region was also demonstrated to confer retinoic acid responsiveness on the ADH1 and ADH2 genes in heterologous promoter fusions. Within a 34-bp stretch, the ADH3 retinoic acid response element (RARE) contains two TGACC motifs and one TGAAC motif, both of which exist in RAREs controlling other genes. A block mutation of the TGACC sequence located at -289 to -285 bp eliminated the retinoic acid response. As assayed by gel shift DNA binding studies, the RARE region (-328 to -272 bp) of ADH3 bound the human retinoic acid receptor beta (RAR beta) and was competed for by DNA containing a RARE present in the gene encoding RAR beta. Since ADH catalyzes the conversion of retinol to retinal, which can be further converted to retinoic acid by aldehyde dehydrogenase, these results suggest that retinoic acid activation of ADH3 constitutes a positive feedback loop regulating retinoic acid synthesis. Images PMID:1996113

  13. The role of alpha-methylacyl-CoA racemase in bile acid synthesis.

    PubMed

    Cuebas, Dean A; Phillips, Christopher; Schmitz, Werner; Conzelmann, Ernst; Novikov, Dmitry K

    2002-05-01

    According to current views, the second peroxisomal beta-oxidation pathway is responsible for the degradation of the side chain of bile acid intermediates. Peroxisomal multifunctional enzyme type 2 [peroxisomal multifunctional 2-enoyl-CoA hydratase/(R)-3-hydroxyacyl-CoA dehydrogenase; MFE-2] catalyses the second (hydration) and third (dehydrogenation) reactions of the pathway. Deficiency of MFE-2 leads to accumulation of very-long-chain fatty acids, 2-methyl-branched fatty acids and C(27) bile acid intermediates in plasma, but bile acid synthesis is not blocked completely. In this study we describe an alternative pathway, which allows MFE-2 deficiency to be overcome. The alternative pathway consists of alpha-methylacyl-CoA racemase and peroxisomal multifunctional enzyme type 1 [peroxisomal multifunctional 2-enoyl-CoA hydratase/(S)-3-hydroxyacyl-CoA dehydrogenase; MFE-1]. (24E)-3alpha,7alpha,12alpha-Trihydroxy-5beta-cholest-24-enoyl-CoA, the presumed physiological isomer, is hydrated by MFE-1 with the formation of (24S,25S)-3alpha,7alpha,12alpha,24-tetrahydroxy-5beta-cholestanoyl-CoA [(24S,25S)-24-OH-THCA-CoA], which after conversion by a alpha-methylacyl-CoA racemase into the (24S,25R) isomer can again be dehydrogenated by MFE-1 to 24-keto-3alpha,7alpha,12alpha-trihydroxycholestanoyl-CoA, a physiological intermediate in cholic acid synthesis. The discovery of the alternative pathway of cholesterol side-chain oxidation will improve diagnosis of peroxisomal deficiencies by identification of serum 24-OH-THCA-CoA diastereomer profiles.

  14. Aldehyde dehydrogenase 1a1 mediates a GABA synthesis pathway in midbrain dopaminergic neurons.

    PubMed

    Kim, Jae-Ick; Ganesan, Subhashree; Luo, Sarah X; Wu, Yu-Wei; Park, Esther; Huang, Eric J; Chen, Lu; Ding, Jun B

    2015-10-01

    Midbrain dopamine neurons are an essential component of the basal ganglia circuitry, playing key roles in the control of fine movement and reward. Recently, it has been demonstrated that γ-aminobutyric acid (GABA), the chief inhibitory neurotransmitter, is co-released by dopamine neurons. Here, we show that GABA co-release in dopamine neurons does not use the conventional GABA-synthesizing enzymes, glutamate decarboxylases GAD65 and GAD67. Our experiments reveal an evolutionarily conserved GABA synthesis pathway mediated by aldehyde dehydrogenase 1a1 (ALDH1a1). Moreover, GABA co-release is modulated by ethanol (EtOH) at concentrations seen in blood alcohol after binge drinking, and diminished ALDH1a1 leads to enhanced alcohol consumption and preference. These findings provide insights into the functional role of GABA co-release in midbrain dopamine neurons, which may be essential for reward-based behavior and addiction.

  15. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  16. Orthogonal selectivity with cinnamic acids in 3-substituted benzofuran synthesis through C-H olefination of phenols.

    PubMed

    Agasti, Soumitra; Sharma, Upendra; Naveen, Togati; Maiti, Debabrata

    2015-03-28

    A palladium catalyzed intermolecular annulation of cinnamic acids and phenols has been achieved for the selective synthesis of 3-substituted benzofurans. Isotope labeling, competition experiments, kinetic studies, and intermediate trapping have supported a sequence of C-C bond formation and decarboxylation followed by the C-O cyclization pathway.

  17. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  18. A New Pathway to Aspartic Acid from Urea and Maleic Acid Affected by Ultraviolet Light

    NASA Astrophysics Data System (ADS)

    Terasaki, Masanori; Nomoto, Shinya; Mita, Hajime; Shimoyama, Akira

    2002-04-01

    The photochemistry of a mixture of urea and maleic acid, which are thought to have been widely present on the primitive Earth, was studied in order to examine a possibility of the formation of amino acids. When an aqueous solution of urea and maleic acid was irradiated with an ultraviolet light of wavelength 172 nm, urea was revealed to be rather resistant to photochemical decomposition. In contrast, maleic acid was completely decomposed within 4 h, reflecting the reactivity of a C-C double bond in the molecule. In the reaction mixture, 2-isoureidosuccinic acid was detected. The acid was considered to be formed by addition of an isoureido radical which had been produced from urea by the action of a hydroxyl radical, to a C-C double bond of maleic acid. The isoureido group of the product was revealed to undergo thermal rearrangement to afford 2-ureidosuccinic acid (N-carbamoylaspartic acid). The result suggested a novel pathway leading to the formation of aspartic acid from non-amino acid precursors, possibly effected by UV-light on the primitive Earth. The formation of ureidocarboxylic acids is of another significance, since they are capable of undergoing thermal polymerization, resulting in formation of polyamino acids.

  19. Pathways for abiotic organic synthesis at submarine hydrothermal fields

    PubMed Central

    McDermott, Jill M.; Seewald, Jeffrey S.; German, Christopher R.; Sylva, Sean P.

    2015-01-01

    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond. PMID:26056279

  20. Pathways for abiotic organic synthesis at submarine hydrothermal fields.

    PubMed

    McDermott, Jill M; Seewald, Jeffrey S; German, Christopher R; Sylva, Sean P

    2015-06-23

    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond. PMID:26056279

  1. Pathways for abiotic organic synthesis at submarine hydrothermal fields.

    PubMed

    McDermott, Jill M; Seewald, Jeffrey S; German, Christopher R; Sylva, Sean P

    2015-06-23

    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond.

  2. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  3. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  4. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  5. Metabolic switch during adipogenesis: From branched chain amino acid catabolism to lipid synthesis.

    PubMed

    Halama, Anna; Horsch, Marion; Kastenmüller, Gabriele; Möller, Gabriele; Kumar, Pankaj; Prehn, Cornelia; Laumen, Helmut; Hauner, Hans; Hrabĕ de Angelis, Martin; Beckers, Johannes; Suhre, Karsten; Adamski, Jerzy

    2016-01-01

    Fat cell metabolism has an impact on body homeostasis and its proper function. Nevertheless, the knowledge about simultaneous metabolic processes, which occur during adipogenesis and in mature adipocytes, is limited. Identification of key metabolic events associated with fat cell metabolism could be beneficial in the field of novel drug development, drug repurposing, as well as for the discovery of patterns predicting obesity risk. The main objective of our work was to provide comprehensive characterization of metabolic processes occurring during adipogenesis and in mature adipocytes. In order to globally determine crucial metabolic pathways involved in fat cell metabolism, metabolomics and transcriptomics approaches were applied. We observed significantly regulated metabolites correlating with significantly regulated genes at different stages of adipogenesis. We identified the synthesis of phosphatidylcholines, the metabolism of even and odd chain fatty acids, as well as the catabolism of branched chain amino acids (BCAA; leucine, isoleucine and valine) as key regulated pathways. Our further analysis led to identification of an enzymatic switch comprising the enzymes Hmgcs2 (3-hydroxy-3-methylglutaryl-CoA synthase) and Auh (AU RNA binding protein/enoyl-CoA hydratase) which connects leucine degradation with cholesterol synthesis. In addition, propionyl-CoA, a product of isoleucine degradation, was identified as a putative substrate for odd chain fatty acid synthesis. The uncovered crosstalks between BCAA and lipid metabolism during adipogenesis might contribute to the understanding of molecular mechanisms of obesity and have potential implications in obesity prediction. PMID:26408941

  6. Pathway engineering of Propionibacterium jensenii for improved production of propionic acid

    PubMed Central

    Liu, Long; Guan, Ningzi; Zhu, Gexin; Li, Jianghua; Shin, Hyun-dong; Du, Guocheng; Chen, Jian

    2016-01-01

    Propionic acid (PA) is an important chemical building block widely used in the food, pharmaceutical, and chemical industries. In our previous study, a shuttle vector was developed as a useful tool for engineering Propionibacterium jensenii, and two key enzymes—glycerol dehydrogenase and malate dehydrogenase—were overexpressed to improve PA titer. Here, we aimed to improve PA production further via the pathway engineering of P. jensenii. First, the phosphoenolpyruvate carboxylase gene (ppc) from Klebsiella pneumoniae was overexpressed to access the one-step synthesis of oxaloacetate directly from phosphoenolpyruvate without pyruvate as intermediate. Next, genes encoding lactate dehydrogenase (ldh) and pyruvate oxidase (poxB) were deleted to block the synthesis of the by-products lactic acid and acetic acid, respectively. Overexpression of ppc and deleting ldh improved PA titer from 26.95 ± 1.21 g·L−1 to 33.21 ± 1.92 g·L−1 and 30.50 ± 1.63 g·L−1, whereas poxB deletion decreased it. The influence of this pathway engineering on gene transcription, enzyme expression, NADH/NAD+ ratio, and metabolite concentration was also investigated. Finally, PA production in P. jensenii with ppc overexpression as well as ldh deletion was investigated, which resulted in further increases in PA titer to 34.93 ± 2.99 g·L−1 in a fed-batch culture. PMID:26814976

  7. Regulation of primary metabolic pathways in oyster mushroom mycelia induced by blue light stimulation: accumulation of shikimic acid.

    PubMed

    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei

    2015-02-27

    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis.

  8. Regulation of primary metabolic pathways in oyster mushroom mycelia induced by blue light stimulation: accumulation of shikimic acid.

    PubMed

    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei

    2015-01-01

    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis. PMID:25721093

  9. Regulation of Primary Metabolic Pathways in Oyster Mushroom Mycelia Induced by Blue Light Stimulation: Accumulation of Shikimic Acid

    PubMed Central

    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei

    2015-01-01

    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis. PMID:25721093

  10. Kinetic investigation of erucamide synthesis using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Upadhayay, Santosh K; Singh, R P

    2008-01-01

    Fatty acid amides like erucamide are mainly used for lubrication and as slip agent to decrease friction in polymer and plastic industry. Erucamide is normally synthesized by ammonolysis of triglycerides or fatty acids at 200 degrees C and at high pressure (345-690 kPa.). However using urea in place of ammonia the economic synthesis of erucamide is possible at atmospheric pressure at approx 190 degrees C. In present investigation, the kinetics of synthesis of erucamide by ammonolysis of erucic acid has been investigated. The optimum conditions for the synthesis of erucamide have also been determined. 1:4 molar ratio of erucic acid to urea, 190 degrees C temperature and catalyst [P2O5 with (NH4)2H PO4, {(1:1) w/w }] concentration 3% (by wt. of erucic acid) were the optimum condition for synthesis of erucamide from erucic acid and can obtain a maximum yield of 92% of pure erucamide. Some other catalysts as titanium-iso -propoxide, phosphorus pent oxide were also tried but these catalysts were not economical. PMID:18685229

  11. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  12. Substrate specificity of the sialic acid biosynthetic pathway

    SciTech Connect

    Jacobs, Christina L.; Goon, Scarlett; Yarema, Kevin J.; Hinderlich, Stephan; Hang, Howard C.; Chai, Diana H.; Bertozzi, Carolyn R.

    2001-07-18

    Unnatural analogs of sialic acid can be delivered to mammalian cell surfaces through the metabolic transformation of unnatural N-acetylmannosamine (ManNAc) derivatives. In previous studies, mannosamine analogs bearing simple N-acyl groups up to five carbon atoms in length were recognized as substrates by the biosynthetic machinery and transformed into cell-surface sialoglycoconjugates [Keppler, O. T., et al. (2001) Glycobiology 11, 11R-18R]. Such structural alterations to cell surface glycans can be used to probe carbohydrate-dependent phenomena. This report describes our investigation into the extent of tolerance of the pathway toward additional structural alterations of the N-acyl substituent of ManNAc. A panel of analogs with ketone-containing N-acyl groups that varied in the lengthor steric bulk was chemically synthesized and tested for metabolic conversion to cell-surface glycans. We found that extension of the N-acyl chain to six, seven, or eight carbon atoms dramatically reduced utilization by the biosynthetic machinery. Likewise, branching from the linear chain reduced metabolic conversion. Quantitation of metabolic intermediates suggested that cellular metabolism is limited by the phosphorylation of the N-acylmannosamines by ManNAc 6-kinase in the first step of the pathway. This was confirmed by enzymatic assay of the partially purified enzyme with unnatural substrates. Identification of ManNAc 6-kinase as a bottleneck for unnatural sialic acid biosynthesis provides a target for expanding the metabolic promiscuity of mammalian cells.

  13. Cannabinoids influence lipid-arachidonic acid pathways in schizophrenia.

    PubMed

    Smesny, Stefan; Rosburg, Timm; Baur, Kati; Rudolph, Nicole; Sauer, Heinrich

    2007-10-01

    Increasing evidence suggests modulating effects of cannabinoids on time of onset, severity, and outcome of schizophrenia. Efforts to discover the underlying pathomechanism have led to the assumption of gene x environment interactions, including premorbid genetical vulnerability and worsening effects of continuing cannabis use. The objective of this cross-sectional study is to investigate the relationship between delta-9-tetrahydrocannabinol intake and niacin sensitivity in schizophrenia patients and healthy controls. Intensity of niacin skin flushing, indicating disturbed prostaglandin-mediated processes, was used as peripheral marker of lipid-arachidonic acid pathways and investigated in cannabis-consuming and nonconsuming schizophrenia patients and in healthy controls. Methylnicotinate was applied in three concentrations onto the forearm skin. Flush response was assessed in 3-min intervals over 15 min using optical reflection spectroscopy. In controls, skin flushing was significantly decreased in cannabis-consuming as compared to nonconsuming individuals. When comparing the nonconsuming subgroups, patients showed significantly decreased flush response. The populations as a whole (patients and controls) showed an inverse association between skin flushing and sum scores of Symptom Check List 90-R. Results demonstrate an impact of long-term cannabis use on lipid-arachidonic acid pathways. Considering pre-existing vulnerability of lipid metabolism in schizophrenia, observed effects of cannabis use support the notion of a gene x environment interaction.

  14. Regulation of collagen synthesis by ascorbic acid.

    PubMed Central

    Murad, S; Grove, D; Lindberg, K A; Reynolds, G; Sivarajah, A; Pinnell, S R

    1981-01-01

    After prolonged exposure to ascorbate, collagen synthesis in cultured human skin fibroblasts increased approximately 8-fold with no significant change in synthesis of noncollagen protein. This effect of ascorbate appears to be unrelated to its cofactor function in collagen hydroxylation. The collagenous protein secreted in the absence of added ascorbate was normal in hydroxylysine but was mildly deficient in hydroxyproline. In parallel experiments, lysine hydroxylase (peptidyllysine, 2-oxoglutarate:oxygen 5-oxidoreductase, EC 1.14.11.4) activity increased 3-fold in response to ascorbate administration whereas proline hydroxylase (prolyl-glycyl-peptide, 2-oxoglutarate:oxygen oxidoreductase, EC 1.14.11.2) activity decreased considerably. These results suggest that collage polypeptide synthesis, posttranslational hydroxylations, and activities of the two hydroxylases are independently regulated by ascorbate. PMID:6265920

  15. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  16. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  17. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  18. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains.

  19. Mutations in the Prokaryotic Pathway Rescue the fatty acid biosynthesis1 Mutant in the Cold.

    PubMed

    Gao, Jinpeng; Wallis, James G; Browse, John

    2015-09-01

    The Arabidopsis (Arabidopsis thaliana) fatty acid biosynthesis1 (fab1) mutant has increased levels of the saturated fatty acid 16:0 due to decreased activity of 3-ketoacyl-acyl carrier protein (ACP) synthase II. In fab1 leaves, phosphatidylglycerol, the major chloroplast phospholipid, contains up to 45% high-melting-point molecular species (molecules that contain only 16:0, 16:1-trans, and 18:0), a trait associated with chilling-sensitive plants, compared with less than 10% in wild-type Arabidopsis. Although they do not exhibit typical chilling sensitivity, when exposed to low temperatures (2°C-6°C) for long periods, fab1 plants do suffer collapse of photosynthesis, degradation of chloroplasts, and eventually death. A screen for suppressors of this low-temperature phenotype has identified 11 lines, some of which contain additional alterations in leaf-lipid composition relative to fab1. Here, we report the identification of two suppressor mutations, one in act1, which encodes the chloroplast acyl-ACP:glycerol-3-phosphate acyltransferase, and one in lpat1, which encodes the chloroplast acyl-ACP:lysophosphatidic acid acyltransferase. These enzymes catalyze the first two steps of the prokaryotic pathway for glycerolipid synthesis, so we investigated whether other mutations in this pathway would rescue the fab1 phenotype. Both the gly1 mutation, which reduces glycerol-3-phosphate supply to the prokaryotic pathway, and fad6, which is deficient in the chloroplast 16:1/18:1 fatty acyl desaturase, were discovered to be suppressors. Analyses of leaf-lipid compositions revealed that mutations at all four of the suppressor loci result in reductions in the proportion of high-melting-point molecular species of phosphatidylglycerol relative to fab1. We conclude that these reductions are likely the basis for the suppressor phenotypes.

  20. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  1. Organochlorines inhibit acetaminophen glucuronidation by redirecting UDP-glucuronic acid towards the D-glucuronate pathway

    SciTech Connect

    Chan, Tom S. Wilson, John X.; Selliah, Subajini; Bilodeau, Marc; Zwingmann, Claudia; Poon, Raymond; O'Brien, Peter J.

    2008-11-01

    Industry-derived organochlorines are persistent environmental pollutants that are a continuing health concern. The effects of these compounds on drug metabolism are not well understood. In the current study we present evidence that the inhibition of acetaminophen (APAP) glucuronidation by minute concentrations of organochlorines correlates well with their ability to stimulate the D-glucuronate pathway leading to ascorbate synthesis. A set of 6 arylated organochlorines, including 5 PCB (polychlorinated biphenyl) congeners, were assessed for their effects on APAP glucuronidation in isolated hepatocytes from male Sprague-Dawley rats. The capacity of each organochlorine to inhibit APAP glucuronidation was found to be directly proportional to its capacity to stimulate ascorbate synthesis. PCB153, PCB28 and bis-(4-chlorophenyl sulfone) (BCPS) in increasing order were the most effective organochlorines for inhibiting APAP glucuronidation and stimulating the D-glucuronate pathway. None of the 3 inhibitors of APAP glucuronidation were able to alter the expression of UGT1A6, UGT1A7 and UGT1A8 (the major isoforms responsible for APAP glucuronidation in the rat), however, their efficacy at inhibiting APAP glucuronidation was proportional to their capacity to deplete UDP-glucuronic acid (UDPGA). BCPS-mediated inhibition of APAP glucuronidation in isolated hepatocytes had non-competitive characteristics and was insensitive to the inactivation of cytochrome P450. The effective organochlorines were also able to selectively stimulate the hydrolysis of UDPGA to UDP and glucuronate in isolated microsomes, but could not inhibit APAP glucuronidation in microsomes when UDPGA was in excess. We conclude that organochlorines are able to inhibit APAP glucuronidation in hepatocytes by depleting UDPGA via redirecting UDPGA towards the D-glucuronate pathway. Because the inhibition is non-competitive, low concentrations of these compounds could have long term inhibitory effects on the

  2. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  3. Taurine homeostasis requires de novo synthesis via cysteine sulfinic acid decarboxylase during zebrafish early embryogenesis.

    PubMed

    Chang, Yen-Chia; Ding, Shih-Torng; Lee, Yen-Hua; Wang, Ya-Ching; Huang, Ming-Feng; Liu, I-Hsuan

    2013-02-01

    Cysteine sulfinic acid decarboxylase (Csad) is the rate-limiting enzyme in the de novo biosynthesis of taurine. There are a number of physiological roles of taurine, such as bile salt synthesis, osmoregulation, lipid metabolism, and oxidative stress inhibition. To investigate the role of de novo synthesis of taurine during embryonic development, zebrafish csad was cloned and functionally analyzed. Semi-quantitative RT-PCR showed that csad transcripts are maternally deposited, while whole-mount in situ hybridization demonstrated that csad is expressed in yolk syncytial layer and various embryonic tissues such as notochord, brain, retina, pronephric duct, liver, and pancreas. Knockdown of csad significantly reduced the embryonic taurine level, and the affected embryos had increased early mortality and cardiac anomalies. mRNA coinjection and taurine supplementation rescued the cardiac phenotypes suggesting that taurine originating from the de novo synthesis pathway plays a role in cardiac development. Our findings indicated that the de novo synthesis pathway via Csad plays a critical role in taurine homeostasis and cardiac development in zebrafish early embryos. PMID:22907836

  4. Synthesis of lyso(bis)phosphatidic acid in rabbit alveolar macrophages

    SciTech Connect

    Thornburg, T.; Roddick, V.; Wykle, R.L.; Waite, M.

    1987-05-01

    Reported here are studies on the biosynthetic pathway used by normal and BCG elicited alveolar macrophages for the synthesis of lyso(bis)phosphatidic acid (L(bis)PA). Earlier observations by this laboratory have shown that although L(bis)PA is abundant in these cells, there is little de novo synthesis of this lipid. Diaceyl phosphatidylglycerol (PG) labeled with either (1,2,3-/sup 3/H) glycerol or /sup 32/P demonstrated that PG is used as an exogenous substrate for L(bis)PA formation; both glycerol moieties are incorporated. Other phospholipids do not have this capacity. BCG-elicited macrophages are capable of only one-quarter the synthesis of L(bis)PA seen with normal cells, and also show a decreased amount of cell associated substrate. In addition, (/sup 3/H) 1-0-alkyl PG was used as a substrate to test the importance of the sn-1 acyl linkage in the synthetic pathway. This substrate produced less L(bis)PA while dramatically increasing the amounts of labelled phosphatidylethanolamine and phosphatidylcholine within the cell. The alkyl substrate also showed increased uptake by the cell. They conclude that the hydrolysis of the acyl group at the sn-1 position of PG is essential in the synthetic pathway leading to the production of L(bis)PA. They further suggest that the PG used by these cells as an exogenous substrate in vitro is obtained from the PG-rich surfactant surrounding the alveolar macrophage.

  5. Synthesis of sulfonate analogs of bile acids.

    PubMed

    Kihira, K; Mikami, T; Ikawa, S; Okamoto, A; Yoshii, M; Miki, S; Mosbach, E H; Hoshita, T

    1992-04-01

    Sulfonate analogs of C23 and C24 bile acids were synthesized from norcholic, norchenodeoxycholic, norursodeoxycholic, nordeoxycholic, norhyodeoxycholic, cholic, deoxycholic, hyodeoxycholic, and lithocholic acids. The principal reactions used were (1) reduction of the bile acids with NaBH4 to the corresponding bile alcohols, (2) selective tosylation of the terminal hydroxyl group, (3) iodination of the tosyl esters with NaI, and (4) treatment of the iodides with Na2SO3 to form the sulfonate analogs of the bile acids. The sulfonate analogs showed polarity similar to that of taurine-conjugated bile acids on thin-layer chromatography. The carbon 13 nuclear magnetic resonance spectral data for the sulfonate analogs were tabulated.

  6. Alginic acid synthesis in Pseudomonas aeruginosa mutants defective in carbohydrate metabolism.

    PubMed Central

    Banerjee, P C; Vanags, R I; Chakrabarty, A M; Maitra, P K

    1983-01-01

    Mutant cells of mucoid Pseudomonas aeruginosa isolated from cystic fibrosis patients were examined for their ability to synthesize alginic acid in resting cell suspensions. Unlike the wild-type strain which synthesizes alginic acid from glycerol, fructose, mannitol, glucose, gluconate, glutamate, or succinate, mutants lacking specific enzymes of carbohydrate metabolism are uniquely impaired. A phosphoglucose isomerase mutant did not synthesize the polysaccharide from mannitol, nor did a glucose 6-phosphate dehydrogenase mutant synthesize the polysaccharide from mannitol or glucose. Mutants lacking the Entner-Doudoroff pathway dehydrase or aldolase failed to produce alginate from mannitol, glucose, or gluconate, as a 3-phosphoglycerate kinase or glyceraldehyde 3-phosphate dehydrogenase mutant failed to produce from glutamate or succinate. These results demonstrate the primary role of the Entner-Doudoroff pathway enzymes in the synthesis of alginate from glucose, mannitol, or gluconate and the role of glyceraldehyde 3-phosphate dehydrogenase reaction for the synthesis from gluconeogenic precursors such as glutamate. The virtual absence of any activity of phosphomannose isomerase in cell extracts of several independent mucoid bacteria and the impairment of alginate synthesis from mannitol in mutants lacking phosphoglucose isomerase or glucose 6-phosphate dehydrogenase rule out free mannose 6-phosphate as an intermediate in alginate biosynthesis. PMID:6408061

  7. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.

    1986-01-01

    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  8. Microbial chemical factories: recent advances in pathway engineering for synthesis of value added chemicals.

    PubMed

    Dhamankar, Himanshu; Prather, Kristala L J

    2011-08-01

    The dwindling nature of petroleum and other fossil reserves has provided impetus towards microbial synthesis of fuels and value added chemicals from biomass-derived sugars as a renewable resource. Microbes have naturally evolved enzymes and pathways that can convert biomass into hundreds of unique chemical structures, a property that can be effectively exploited for their engineering into Microbial Chemical Factories (MCFs). De novo pathway engineering facilitates expansion of the repertoire of microbially synthesized compounds beyond natural products. In this review, we visit some recent successes in such novel pathway engineering and optimization, with particular emphasis on the selection and engineering of pathway enzymes and balancing of their accessory cofactors.

  9. Fatty Acid Phytyl Ester Synthesis in Chloroplasts of Arabidopsis[W

    PubMed Central

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-01-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. PMID:22623494

  10. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  11. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  12. The intracellular parasite Toxoplasma gondii depends on the synthesis of long chain and very long-chain unsaturated fatty acids not supplied by the host cell

    PubMed Central

    Ramakrishnan, Srinivasan; Docampo, Melissa D.; MacRae, James I.; Ralton, Julie E.; Rupasinghe, Thusitha; McConville, Malcolm J.; Striepen, Boris

    2015-01-01

    SUMMARY Apicomplexa are parasitic protozoa that cause important human diseases including malaria, cryptosporidiosis and toxoplasmosis. The replication of these parasites within their target host cell is dependent on both salvage as well as de novo synthesis of fatty acids. In T. gondii, fatty acid synthesis via the apicoplast-localized FASII is essential for pathogenesis, while the role of two other fatty acid biosynthetic complexes remains unclear. Here we demonstrate that the ER-localized fatty acid elongation (ELO) is essential for parasite growth. Conditional knock-down of the non-redundant hydroxyacyl-CoA dehydratase and enoyl-CoA reductase enzymes in the ELO pathway severely repressed intracellular parasite growth. 13C-glucose and 13C-acetate labeling and comprehensive lipidomic analyses of these mutants showed a selective defect in synthesis of unsaturated long and very long chain fatty acids (LCFAs and VLCFAs) and depletion of phosphatidylinositol and phosphatidylethanolamine species containing unsaturated LCFAs and VLCFAs. This requirement for ELO pathway was by-passed by supplementing the media with specific fatty acids, indicating active, but inefficient import of host fatty acids. Our experiments highlight a gap between the fatty acid needs of the parasite and availability of specific fatty acids in the host cell that the parasite has to close using a dedicated synthesis and modification pathway. PMID:25825226

  13. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  14. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  15. Shock synthesis of amino acids from impacting cometary and icy planet surface analogues

    NASA Astrophysics Data System (ADS)

    Martins, Zita; Price, Mark C.; Goldman, Nir; Sephton, Mark A.; Burchell, Mark J.

    2013-12-01

    Comets are known to harbour simple ices and the organic precursors of the building blocks of proteins--amino acids--that are essential to life. Indeed, glycine, the simplest amino acid, was recently confirmed to be present on comet 81P/Wild-2 from samples returned by NASA's Stardust spacecraft. Impacts of icy bodies (such as comets) onto rocky surfaces, and, equally, impacts of rocky bodies onto icy surfaces (such as the jovian and saturnian satellites), could have been responsible for the manufacture of these complex organic molecules through a process of shock synthesis. Here we present laboratory experiments in which we shocked ice mixtures analogous to those found in a comet with a steel projectile fired at high velocities in a light gas gun to test whether amino acids could be produced. We found that the hypervelocity impact shock of a typical comet ice mixture produced several amino acids after hydrolysis. These include equal amounts of D- and L-alanine, and the non-protein amino acids α-aminoisobutyric acid and isovaline as well as their precursors. Our findings suggest a pathway for the synthetic production of the components of proteins within our Solar System, and thus a potential pathway towards life through icy impacts.

  16. Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha[OPEN

    PubMed Central

    Eklund, D. Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P.; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L.

    2015-01-01

    The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. PMID:26036256

  17. New pathways for organic synthesis. Practical applications of transition metals

    SciTech Connect

    Colquhoun, H.M.; Holton, J.; Thompson, D.J.; Twigg, M.V.

    1984-01-01

    This book contains a considerable number of transition-metal-based procedures that have genuine applications in synthesis, and which are arranged according to the nature of the organic product or synthetic transformation being carried out. The objective is to provide those engaged in the preparation of pharmaceuticals, natural products, herbicides, dyestuffs, and other organic chemicals with a practical guide to the application of transition metals in organic synthesis. Topics considered include the formation of carbon-carbon bonds, the formation of carbocyclic compounds, the formation of heterocyclic compounds, the isomerization of alkenes, the direct introduction and removal of carbonyl groups, reduction, oxidation, and preparing and handling transition metal catalysts.

  18. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  19. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  20. Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

    PubMed Central

    2012-01-01

    Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

  1. Upregulated mRNA expression of desaturase and elongase, two enzymes involved in highly unsaturated fatty acids biosynthesis pathways during follicle maturation in zebrafish

    PubMed Central

    Ishak, Sairatul D; Tan, Sze-Huey; Khong, Hou-Keat; Jaya-Ram, Annette; Enyu, Yee-Ling; Kuah, Meng-Kiat; Shu-Chien, Alexander Chong

    2008-01-01

    Background Although unsaturated fatty acids such as eicosapentaenoic acid (EPA, C20:5n-3), docosahexaenoic acid (DHA, C22:6n-3) and arachidonic acid (ARA, C20:4n-6), collectively known as the highly unsaturated fatty acids (HUFA), play pivotal roles in vertebrate reproduction, very little is known about their synthesis in the ovary. The zebrafish (Danio rerio) display capability to synthesize all three HUFA via pathways involving desaturation and elongation of two precursors, the linoleic acid (LA, C18:2n-6) and linolenic acid (LNA, C18:3n-3). As a prerequisite to gain full understanding on the importance and regulation of ovarian HUFA synthesis, we described here the mRNA expression pattern of two enzymes; desaturase (fadsd6) and elongase (elovl5), involved in HUFA biosynthesis pathway, in different zebrafish ovarian follicle stages. Concurrently, the fatty acid profile of each follicle stage was also analyzed. Methods mRNA levels of fadsd6 and elovl5 in different ovarian follicle stages were determined by semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) assays. For analysis of the ovarian follicular fatty acid composition, gas chromatography was used. Results Our results have shown that desaturase displayed significant upregulation in expression during the oocyte maturation stage. Expression of elongase was significantly highest in pre-vitellogenic follicles, followed by maturation stage. Fatty acid composition analysis of different ovarian follicle stages also showed that ARA level was significantly highest in pre-vitellogenic and matured follicles. DHA level was highest in both late vitellogenic and maturation stage. Conclusion Collectively, our findings seem to suggest the existence of a HUFA synthesis system, which could be responsible for the synthesis of HUFA to promote oocyte maturation and possibly ovulation processes. The many advantages of zebrafish as model system to understand folliculogenesis will be useful platform to

  2. α-linolenic acid concentration and not wounding per se is the key regulator of octadecanoid (oxylipin) pathway activity in rice (Oryza sativa L.) leaves.

    PubMed

    Christeller, John T; Galis, Ivan

    2014-10-01

    Using an in vitro system composed of crushed leaf tissues to simulate the wounding response in rice leaves, we established that synthesis of jasmonic acid (JA) and jasmonic acid-isoleucine (JA-Ile) can only occur in unwounded tissue and, in wounded tissue, that only the chloroplast-located section of the octadecanoid pathway is active, resulting in the accumulation of 12-oxo-phytodienoic acid (OPDA). We further showed that OPDA accumulation in vitro was inhibited by 90% using the general lipase inhibitor, tetrahydrolipstatin, indicating that production of α-linolenic acid was the rate-limiting step in octadecanoid pathway activity in rice following wounding and the enzyme capacity for an active pathway was already present. We confirmed this result by showing that added α-linolenic acid stimulated OPDA synthesis in vitro and stimulated OPDA, JA and JA-Ile synthesis in vivo in unwounded tissue. Thus, the response to wounding can be mimicked by the provision of free α-linolenic acid. Our results draw attention to the key importance of lipase activity in initiation of JA and JA-Ile biosynthesis and our lack of knowledge of the cognate lipase(s), lipase substrate identity and mechanism(s) of activation in wounded and unwounded tissue.

  3. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  4. Irreversible steps in the ferritin synthesis induction pathway.

    PubMed

    Goessling, L S; Mascotti, D P; Bhattacharyya-Pakrasi, M; Gang, H; Thach, R E

    1994-02-11

    The ability of cells to re-repress ferritin synthesis after removal of an inducing agent (iron or heme) was investigated. Re-repression was found to be a slow process, requiring approximately 4 (after iron removal) to 10 h (after heme removal) for completion. Desferrioxamine mesylate (Desferal) had only a slight effect on the rate of re-repression, whereas cycloheximide was strongly inhibitory, indicating that new protein synthesis is required for re-repression. Re-repression occurred at a slow but significant rate in the presence of both Desferal and cycloheximide. These results indicate that, in the absence of an iron chelator, the induction of ferritin synthesis is essentially irreversible. The kinetics of the previously reported covalent modification of IRE-binding protein (IRE-BP) were then examined, to see whether this phenomenon might account (at least in part) for the irreversibility of induction. It was found that the heme- or iron-dependent disappearance of 98-kDa IRE-BP occurred rapidly (within 1 h), and was equally rapidly reversed upon removal of heme after a 1-h exposure. By contrast, after a 4-h exposure to heme, little 98-kDa IRE-BP could be regenerated after heme removal. These results suggest that the slow, irreversible covalent modification of IRE-BP correlates closely over time with the induction of ferritin synthesis. The covalent modification of IRE-BP depends on cell growth rate, and is most readily detected in rapidly growing cells.

  5. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  6. Transcription factors FabR and FadR regulate both aerobic and anaerobic pathways for unsaturated fatty acid biosynthesis in Shewanella oneidensis

    PubMed Central

    Luo, Qixia; Shi, Miaomiao; Ren, Yedan; Gao, Haichun

    2014-01-01

    As genes for type II fatty acid synthesis are essential to the growth of Escherichia coli, its sole (anaerobic) pathway has significant potential as a target for novel antibacterial drug, and has been extensively studied. Despite this, we still know surprisingly little about fatty acid synthesis in bacteria because this anaerobic pathway in fact is not widely distributed. In this study, we show a novel model of unsaturated fatty acid (UFA) synthesis in Shewanella, emerging human pathogens in addition to well-known metal reducers. We identify both anaerobic and aerobic UFA biosynthesis pathways in the representative species, S. oneidensis. Uniquely, the bacterium also contains two regulators FabR and FadR, whose counterparts in other bacteria control the anaerobic pathway. However, we show that in S. oneidensis these two regulators are involved in regulation of both pathways, in either direct or indirect manner. Overall, our results indicate that the UFA biosynthesis and its regulation are far more complex than previously expected, and S. oneidensis serves as a good research model for further work. PMID:25566241

  7. Arginine decarboxylase (ADC) and agmatinase (AGMAT): an alternative pathway for synthesis of polyamines in pig conceptuses and uteri

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Arginine, a precursor for the synthesis of nitric oxide (NO) and polyamines, is critical for implantation and development of the conceptus. We first reported that the arginine decarboxylase (ADC)/agmatinase(AGMAT) pathway as an alternative pathway for synthesis of polyamines in the ovine conceptuses...

  8. A new general pathway for synthesis of reference compounds of N-terminal valine-isocyanate adducts.

    PubMed

    Davies, Ronnie; Rydberg, Per; Westberg, Emelie; Motwani, Hitesh V; Johnstone, Erik; Törnqvist, Margareta

    2010-03-15

    Adducts to Hb could be used as biomarkers to monitor exposure to isocyanates. Particularly useful is the measurement of carbamoylation of N-terminal valines in Hb, after detachment as hydantoins. The synthesis of references from the reactive isocyanates, especially diisocyanates, has been problematic due to side reactions and polymerization of the isocyanate starting material. A simpler, safer, and more general method for the synthesis of valine adducts of isocyanates has been developed using N-[(4-nitrophenyl)carbamate]valine methylamide (NPCVMA) as the key precursor to adducts of various mono- and diisocyanates of interest. By reacting NPCVMA with a range of isocyanate-related amines, carbamoylated valines are formed without the use of the reactive isocyanates. The carbamoylated products synthesized here were cyclized with good yields of the formed hydantoins. The carbamoylated derivative from phenyl isocyanate also showed quantitative yield in a test with cyclization under the conditions used in blood. This new pathway for the preparation of N-carbamoylated model compounds overcomes the above-mentioned problems in the synthesis and is a general and simplified approach, which could make such reference compounds of adducts to N-terminal valine from isocyanates accessible for biomonitoring purposes. The synthesized hydantoins corresponding to adducts from isocyanic acid, methyl isocyanate, phenyl isocyanate, and 2,6-toluene diisocyanate were characterized by LC-MS analysis. The background level of the hydantoin from isocyanic acid in human blood was analyzed with the LC-MS conditions developed.

  9. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  10. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats.

  11. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  12. Novel synthesis of steryl esters from phytosterols and amino Acid.

    PubMed

    Pang, Min; Jiang, Shaotong; Cao, Lili; Pan, Lijun

    2011-10-12

    The feasibility of esterification of phytosterol with the amino acid l-glutamic acid was established. The influence of various organic solvents was investigated, and n-butanol was selected as an ideal solvent for phytosteryl esters synthesis with l-glutamic acid. The reaction conditions were further optimized by orthogonal experiments, and a 92.3% degree of esterification was obtained when optimum conditions were used. FT-IR spectral, GC-MS, and NMR analyses were adopted to determine the steryl esters of l-glutamic acid. The FT-IR spectrum indicated the presence of ester bonds in the phytosteryl esters with l-glutamic acid, and on the basis of the detailed mass spectrography analysis, GC-MS and NMR offered an efficient and reliable way to confirm the steryl esters. This novel synthesis approach of phytosteryl esters with amino acid supplied a promising alternative to the substrate on esterification of phytosterols and thus can be readily applied to further studies of functional food ingredients of phytosteryl esters.

  13. Engineering of an N-acetylneuraminic acid synthetic pathway in Escherichia coli.

    PubMed

    Kang, Junhua; Gu, Pengfei; Wang, Yang; Li, Yikui; Yang, Fan; Wang, Qian; Qi, Qingsheng

    2012-11-01

    N-acetylneuraminic acid (NeuAc) has recently drawn much attention owing to its wide applications in many aspects. Besides extraction from natural materials, production of NeuAc was recently focused on enzymatic synthesis and whole-cell biocatalysis. In this study, we designed an artificial NeuAc biosynthetic pathway through intermediate N-acetylglucosamine 6-phosphate in Escherichia coli. In this pathway, N-acetylglucosamine 2-epimerase (slr1975) and glucosamine-6-phosphate acetyltransferase (GNA1) were heterologously introduced into E. coli from Synechocystis sp. PCC6803 and Saccharomyces cerevisiae EBY100, respectively. By derepressing the feedback inhibition of glucosamine-6-phosphate synthase, increasing the accumulation of N-acetylglucosamine and pyruvate, and blocking the catabolism of NeuAc, we were able to produce 1.62 g l⁻¹ NeuAc in recombinant E. coli directly from glucose. The NeuAc yield reached 7.85g l⁻¹ in fed-batch fermentation. This process offered an efficient fermentative method to produce NeuAc in microorganisms using glucose as carbon source and can be optimized for further improvement.

  14. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  15. De novo synthesis of pyrimidine nucleotides; emerging interfaces with signal transduction pathways.

    PubMed

    Huang, M; Graves, L M

    2003-02-01

    The de novo biosynthesis of pyrimidine nucleotides provides essential precursors for multiple growth-related events in higher eukaryotes. Assembled from ATP, bicarbonate and glutamine, the uracil and cytosine nucleotides are fuel for the synthesis of RNA, DNA, phospholipids, UDP sugars and glycogen. Over the past 2 decades considerable progress has been made in elucidating the mechanisms by which cellular pyrimidines are modulated to meet the needs of the cell. Recent studies demonstrate that CAD, a rate-limiting enzyme in the de novo synthesis of pyrimidines, is regulated through reversible phosphorylation, Myc-dependent transcriptional changes and caspase-mediated degradation. These studies point to increasing evidence for cooperation between key cell signaling pathways and basic elements of cellular metabolism, and suggest that these events have the potential to determine distinct cellular fates, including growth, differentiation and death. This review highlights some of the recent advances in the regulation of pyrimidine synthesis by growth-factor-stimulated signaling pathways. PMID:12678497

  16. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  17. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  18. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  19. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  20. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  1. The cockroach Blattella germanica obtains nitrogen from uric acid through a metabolic pathway shared with its bacterial endosymbiont.

    PubMed

    Patiño-Navarrete, Rafael; Piulachs, Maria-Dolors; Belles, Xavier; Moya, Andrés; Latorre, Amparo; Peretó, Juli

    2014-07-01

    Uric acid stored in the fat body of cockroaches is a nitrogen reservoir mobilized in times of scarcity. The discovery of urease in Blattabacterium cuenoti, the primary endosymbiont of cockroaches, suggests that the endosymbiont may participate in cockroach nitrogen economy. However, bacterial urease may only be one piece in the entire nitrogen recycling process from insect uric acid. Thus, in addition to the uricolytic pathway to urea, there must be glutamine synthetase assimilating the released ammonia by the urease reaction to enable the stored nitrogen to be metabolically usable. None of the Blattabacterium genomes sequenced to date possess genes encoding for those enzymes. To test the host's contribution to the process, we have sequenced and analysed Blattella germanica transcriptomes from the fat body. We identified transcripts corresponding to all genes necessary for the synthesis of uric acid and its catabolism to urea, as well as for the synthesis of glutamine, asparagine, proline and glycine, i.e. the amino acids required by the endosymbiont. We also explored the changes in gene expression with different dietary protein levels. It appears that the ability to use uric acid as a nitrogen reservoir emerged in cockroaches after its age-old symbiotic association with bacteria.

  2. Metabolic Interactions between the Lands Cycle and the Kennedy Pathway of Glycerolipid Synthesis in Arabidopsis Developing Seeds[W

    PubMed Central

    Wang, Liping; Shen, Wenyun; Kazachkov, Michael; Chen, Guanqun; Chen, Qilin; Carlsson, Anders S.; Stymne, Sten; Weselake, Randall J.; Zou, Jitao

    2012-01-01

    It has been widely accepted that the primary function of the Lands cycle is to provide a route for acyl remodeling to modify fatty acid (FA) composition of phospholipids derived from the Kennedy pathway. Lysophosphatidylcholine acyltransferase (LPCAT) is an evolutionarily conserved key enzyme in the Lands cycle. In this study, we provide direct evidence that the Arabidopsis thaliana LPCATs, LPCAT1 and LPCAT2, participate in the Lands cycle in developing seeds. In spite of a substantially reduced initial rate of nascent FA incorporation into phosphatidylcholine (PC), the PC level in the double mutant lpcat1 lpcat2-2 remained unchanged. LPCAT deficiency triggered a compensatory response of de novo PC synthesis and a concomitant acceleration of PC turnover that were attributable at least in part to PC deacylation. Acyl-CoA profile analysis revealed complicated metabolic alterations rather than merely reduced acyl group shuffling from PC in the mutant. Shifts in FA stereo-specific distribution in triacylglycerol of the mutant seed suggested a preferential retention of saturated acyl chains at the stereospecific numbering (sn)-1 position from PC and likely a channeling of lysophosphatidic acid, derived from PC, into the Kennedy pathway. Our study thus illustrates an intricate relationship between the Lands cycle and the Kennedy pathway. PMID:23150634

  3. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  4. Is Acetylcarnitine a Substrate for Fatty Acid Synthesis in Plants?

    PubMed

    Roughan, G.; Post-Beittenmiller, D.; Ohlrogge, J.; Browse, J.

    1993-04-01

    Long-chain fatty acid synthesis from [1-14C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-14C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-14C]-Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-14C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-14C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-14C]acetylcarnitine and 47 to 57% of the [1-14C]acetate taken up was incorporated into lipids. Most (78-82%) of the [1-14C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants.

  5. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  6. Synthesis of l-(+)-Tartaric Acid from l-Ascorbic Acid via 5-Keto-d-Gluconic Acid in Grapes

    PubMed Central

    Saito, Kazumi; Kasai, Zenzaburo

    1984-01-01

    5-Keto-l-idionic acid (≡5-keto-d-gluconic acid, d-xylo-5-hexulosonic acid) was found as a metabolic product of l-ascorbic acid in slices of immature grapes, Vitis labrusca L. cv `Delaware'. Specifically labeled compounds, recognized as metabolic products of l-ascorbic acid in grapes, were fed to young grape tissues to investigate the metabolic pathway from l-ascorbic acid to l-(+)-tartaric acid. Label from dehydro-l-[1-14C]ascorbic acid, 2-keto-l-[1-14C]idonic acid (l-xylo-2-hexulosonic acid), l-[1-14C]idonic acid, or 5-keto-l-[1-14C] idonic acid was incorporated into l-(+)-tartaric acid in high yields as it was in the l-[1-14C]ascorbic acid experiment. In a double label experiment involving a mixture of l-[1-14C]idonic acid and l-[2-3H]idonic acid, the 3H/14C ratios of 5-keto-l-idonic acid and l-(+)-tartaric acid synthesized in young grape leaves were almost the same as the value of the l-idonic acid fed. Label from 5-keto-l-[6-14C]idonic acid was incorporated into sugars and insoluble residue in the same way as l-[6-14C]ascorbic acid was metabolized in grapes. These results provide strong evidence that in grapes l-(+)-tartaric acid is synthesized from the C4 fragment that corresponds to the C1 to C4 group of the 5-keto-l-idonic acid derived from l-ascorbic acid via 2-keto-l-idonic acid and l-idonic acid. PMID:16663792

  7. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  8. Synthesis of rosin acid starch catalyzed by lipase.

    PubMed

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2:1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch.

  9. Pterandric acid--its isolation, synthesis and stereochemistry.

    PubMed

    Haleem, Muhammad A; Capellari, Simone C; Sympson, Beryl B; Marsaioli, Anita J

    2015-01-01

    Some plant families have a specialized type of pollination system, with floral lipid rewards for pollinators, which is common. In neotropical Malpighiaceae species like Pterandra pyroidea, this specialized type of pollination system is apparently shifting from floral oils/lipids to pollen reward. Mass spectrometric analysis (GC/MS-EI) indicated that P. pyroidea floral oil has a unique chemical composition, i.e., few fatty acid constituents possessing acetoxy groups at positions 5 and 7, which is distinct from the other floral oils of sympatric Malpighiaceae species. The structure of the major floral oil constituent, a novel fatty acid, anti-5,7-diacetoxydocosanoic acid, was confirmed based on synthesis, mass fragmentation, and 1H and 13C NMR analyses; the compound is herein named pterandric acid.

  10. Very long chain fatty acid synthesis in sunflower kernels.

    PubMed

    Salas, Joaquín J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Most common seed oils contain small amounts of very long chain fatty acids (VLCFAs), the main components of oils from species such as Brassica napus or Lunnaria annua. These fatty acids are synthesized from acyl-CoA precursors in the endoplasmic reticulum through the activity of a dissociated enzyme complex known as fatty acid elongase. We studied the synthesis of the arachidic, behenic, and lignoceric VLCFAs in sunflower kernels, in which they account for 1-3% of the saturated fatty acids. These VLCFAs are synthesized from 18:0-CoA by membrane-bound fatty acid elongases, and their biosynthesis is mainly dependent on NADPH equivalents. Two condensing enzymes appear to be responsible for the synthesis of VLCFAs in sunflower kernels, beta-ketoacyl-CoA synthase-I (KCS-I) and beta-ketoacyl-CoA synthase-II (KCS-II). Both of these enzymes were resolved by ion exchange chromatography and display different substrate specificities. While KCS-I displays a preference for 20:0-CoA, 18:0-CoA was more efficiently elongated by KCS-II. Both enzymes have different sensitivities to pH and Triton X-100, and their kinetic properties indicate that both are strongly inhibited by the presence of their substrates. In light of these results, the VLCFA composition of sunflower oil is considered in relation to that in other commercially exploited oils.

  11. A distinct pathway for tetrahymanol synthesis in bacteria

    NASA Astrophysics Data System (ADS)

    Banta, Amy B.; Wei, Jeremy H.; Welander, Paula V.

    2015-11-01

    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol.

  12. A distinct pathway for tetrahymanol synthesis in bacteria

    PubMed Central

    Banta, Amy B.; Wei, Jeremy H.; Welander, Paula V.

    2015-01-01

    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol. PMID:26483502

  13. A distinct pathway for tetrahymanol synthesis in bacteria.

    PubMed

    Banta, Amy B; Wei, Jeremy H; Welander, Paula V

    2015-11-01

    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol. PMID:26483502

  14. Type II fatty acid synthesis is essential only for malaria parasite late liver stage development

    PubMed Central

    Vaughan, Ashley M; O'Neill, Matthew T; Tarun, Alice S; Camargo, Nelly; Phuong, Thuan M; Aly, Ahmed S I; Cowman, Alan F; Kappe, Stefan H I

    2009-01-01

    Intracellular malaria parasites require lipids for growth and replication. They possess a prokaryotic type II fatty acid synthesis (FAS II) pathway that localizes to the apicoplast plastid organelle and is assumed to be necessary for pathogenic blood stage replication. However, the importance of FAS II throughout the complex parasite life cycle remains unknown. We show in a rodent malaria model that FAS II enzymes localize to the sporozoite and liver stage apicoplast. Targeted deletion of FabB/F, a critical enzyme in fatty acid synthesis, did not affect parasite blood stage replication, mosquito stage development and initial infection in the liver. This was confirmed by knockout of FabZ, another critical FAS II enzyme. However, FAS II-deficient Plasmodium yoelii liver stages failed to form exo-erythrocytic merozoites, the invasive stage that first initiates blood stage infection. Furthermore, deletion of FabI in the human malaria parasite Plasmodium falciparum did not show a reduction in asexual blood stage replication in vitro. Malaria parasites therefore depend on the intrinsic FAS II pathway only at one specific life cycle transition point, from liver to blood. PMID:19068099

  15. Ursolic Acid Inhibits Adipogenesis in 3T3-L1 Adipocytes through LKB1/AMPK Pathway

    PubMed Central

    He, Yonghan; Li, Ying; Zhao, Tiantian; Wang, Yanwen; Sun, Changhao

    2013-01-01

    Background Ursolic acid (UA) is a triterpenoid compound with multiple biological functions. This compound has recently been reported to possess an anti-obesity effect; however, the mechanisms are less understood. Objective As adipogenesis plays a critical role in obesity, the present study was conducted to investigate the effect of UA on adipogenesis and mechanisms of action in 3T3-L1 preadipocytes. Methods and Results The 3T3-L1 preadipocytes were induced to differentiate in the presence or absence of UA for 6 days. The cells were determined for proliferation, differentiation, fat accumulation as well as the protein expressions of molecular targets that regulate or are involved in fatty acid synthesis and oxidation. The results demonstrated that ursolic acid at concentrations ranging from 2.5 µM to 10 µM dose-dependently attenuated adipogenesis, accompanied by reduced protein expression of CCAAT element binding protein β (C/EBPβ), peroxisome proliferator-activated receptor γ (PPARγ), CCAAT element binding protein α (C/EBPα) and sterol regulatory element binding protein 1c (SREBP-1c), respectively. Ursolic acid increased the phosphorylation of acetyl-CoA carboxylase (ACC) and protein expression of carnitine palmitoyltransferase 1 (CPT1), but decreased protein expression of fatty acid synthase (FAS) and fatty acid-binding protein 4 (FABP4). Ursolic acid increased the phosphorylation of AMP-activated protein kinase (AMPK) and protein expression of (silent mating type information regulation 2, homolog) 1 (Sirt1). Further studies demonstrated that the anti-adipogenic effect of UA was reversed by the AMPK siRNA, but not by the Sirt1 inhibitor nicotinamide. Liver kinase B1 (LKB1), the upstream kinase of AMPK, was upregulated by UA. When LKB1 was silenced with siRNA or the inhibitor radicicol, the effect of UA on AMPK activation was diminished. Conclusions Ursolic acid inhibited 3T3-L1 preadipocyte differentiation and adipogenesis through the LKB1/AMPK pathway

  16. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress. PMID:25113613

  17. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress.

  18. Amino acids trigger down-regulation of superoxide via TORC pathway in the midgut of Rhodnius prolixus

    PubMed Central

    Gandara, Ana Caroline P.; Oliveira, José Henrique M.; Nunes, Rodrigo D.; Goncalves, Renata L.S.; Dias, Felipe A.; Hecht, Fabio; Fernandes, Denise C.; Genta, Fernando A.; Laurindo, Francisco R.M.; Oliveira, Marcus F.; Oliveira, Pedro L.

    2016-01-01

    Sensing incoming nutrients is an important and critical event for intestinal cells to sustain life of the whole organism. The TORC is a major protein complex involved in monitoring the nutritional status and is activated by elevated amino acid concentrations. An important feature of haematophagy is that huge amounts of blood are ingested in a single meal, which results in the release of large quantities of amino acids, together with the haemoglobin prosthetic group, haem, which decomposes hydroperoxides and propagates oxygen-derived free radicals. Our previous studies demonstrated that reactive oxygen species (ROS) levels were diminished in the mitochondria and midgut of the Dengue fever mosquito, Aedes aegypti, immediately after a blood meal. We proposed that this mechanism serves to avoid oxidative damage that would otherwise be induced by haem following a blood meal. Studies also performed in mosquitoes have shown that blood or amino acids controls protein synthesis through TORC activation. It was already proposed, in different models, a link between ROS and TOR, however, little is known about TOR signalling in insect midgut nor about the involvement of ROS in this pathway. Here, we studied the effect of a blood meal on ROS production in the midgut of Rhodnius prolixus. We observed that blood meal amino acids decreased ROS levels in the R. prolixus midgut immediately after feeding, via lowering mitochondrial superoxide production and involving the amino acid-sensing TORC pathway. PMID:26945025

  19. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  20. 2-Keto acids based biosynthesis pathways for renewable fuels and chemicals.

    PubMed

    Tashiro, Yohei; Rodriguez, Gabriel M; Atsumi, Shota

    2015-03-01

    Global energy and environmental concerns have driven the development of biological chemical production from renewable sources. Biological processes using microorganisms are efficient and have been traditionally utilized to convert biomass (i.e., glucose) to useful chemicals such as amino acids. To produce desired fuels and chemicals with high yield and rate, metabolic pathways have been enhanced and expanded with metabolic engineering and synthetic biology approaches. 2-Keto acids, which are key intermediates in amino acid biosynthesis, can be converted to a wide range of chemicals. 2-Keto acid pathways were engineered in previous research efforts and these studies demonstrated that 2-keto acid pathways have high potential for novel metabolic routes with high productivity. In this review, we discuss recently developed 2-keto acid-based pathways.

  1. Presynaptic H3 autoreceptors modulate histamine synthesis through cAMP pathway.

    PubMed

    Gomez-Ramirez, Jordi; Ortiz, Jordi; Blanco, Isaac

    2002-01-01

    Histamine H3 receptors modulate histamine synthesis, although little is known about the transduction mechanisms involved. To investigate this issue, we have used a preparation of rat brain cortical miniprisms in which histamine synthesis can be modulated by depolarization and by H3 receptor ligands. When the miniprisms were incubated in presence of forskolin, dibutyryl-cAMP, or 3-isobutyl-1-methylxanthine (IBMX), histamine synthesis was stimulated in 34, 29, and 47%, respectively. These stimulations could be prevented by the selective cAMP protein kinase blocker Rp-adenosine 3',5'-cyclic monophosphothioate triethylamine (Rp-cAMPs). Preincubation with the H3 receptor agonist imetit prevented IBMX- (100% blockade) and forskolin- (70% blockade) induced stimulation of histamine synthesis. The H3 inverse agonist thioperamide enhanced histamine synthesis in the presence of 1 mM IBMX or 30 mM potassium (+47 and +45%, respectively). Similarly, the H3 antagonist clobenpropit enhanced histamine synthesis in the presence of 30 mM potassium (+ 59%). The cAMP-dependent protein kinase blockers Rp-cAMPs and PKI14-22 could impair the effects of thioperamide and clobenpropit, respectively. These results indicate that the adenylate cyclase-protein kinase A pathway is involved in the modulation of histamine synthesis by H3 autoreceptors present in histaminergic nerve terminals.

  2. Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives

    PubMed Central

    Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A

    2011-01-01

    Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513

  3. Evidence for transport intermediates in aromatic amino acid synthesis of non-green tissues

    SciTech Connect

    Leuschner, C.; Schultz, G. )

    1990-05-01

    Quinate (QA) is the predominant pre-aromatic compound formed at high rates in leaves of many plants at the early vegetation stage and transported through the phloem. The transfer of 3-dehydroquinate, 3-dehydroshikimate and (SkA) across the plastidial membranes has been evidenced. The question was whether the rate of QA uptake is comparable to that of the 3 SkA-pathway intermediates. To demonstrate this, /U-{sup 14}C/QA and /U-{sup 14}C/SkA were applied to Brassica rapa roots. Both compounds were uptaken at considerable rates and incorporated into aromatic amino acids (Phe + Tyr + Trp formation, in nmol/g fresh wt x h: applying 145 {mu}mol QA: 21.2; applying 156 {mu}mol Ska: 31.8). Thus, QA is a possible candidate for transport into non-green tissues for aromatic amino acid synthesis.

  4. The shikimate pathway: review of amino acid sequence, function and three-dimensional structures of the enzymes.

    PubMed

    Mir, Rafia; Jallu, Shais; Singh, T P

    2015-06-01

    The aromatic compounds such as aromatic amino acids, vitamin K and ubiquinone are important prerequisites for the metabolism of an organism. All organisms can synthesize these aromatic metabolites through shikimate pathway, except for mammals which are dependent on their diet for these compounds. The pathway converts phosphoenolpyruvate and erythrose 4-phosphate to chorismate through seven enzymatically catalyzed steps and chorismate serves as a precursor for the synthesis of variety of aromatic compounds. These enzymes have shown to play a vital role for the viability of microorganisms and thus are suggested to present attractive molecular targets for the design of novel antimicrobial drugs. This review focuses on the seven enzymes of the shikimate pathway, highlighting their primary sequences, functions and three-dimensional structures. The understanding of their active site amino acid maps, functions and three-dimensional structures will provide a framework on which the rational design of antimicrobial drugs would be based. Comparing the full length amino acid sequences and the X-ray crystal structures of these enzymes from bacteria, fungi and plant sources would contribute in designing a specific drug and/or in developing broad-spectrum compounds with efficacy against a variety of pathogens.

  5. Continued functioning of the secretory pathway is essential for ribosome synthesis.

    PubMed Central

    Mizuta, K; Warner, J R

    1994-01-01

    To explore the regulatory elements that maintain the balanced synthesis of the components of the ribosome, we isolated a temperature-sensitive (ts) mutant of Saccharomyces cerevisiae in which transcription both of rRNA and of ribosomal protein genes is defective at the nonpermissive temperature. Temperature sensitivity for growth is recessive and segregates 2:2. A gene that complements the ts phenotype was cloned from a genomic DNA library. Sequence analysis revealed that this gene is SLY1, encoding a protein essential for protein and vesicle transport between the endoplasmic reticulum and the Golgi apparatus. In the strain carrying our ts allele of SLY1, accumulation of the carboxypeptidase Y precursor was detected at the nonpermissive temperature, indicating that the secretory pathway is defective. To ask whether the effect of the ts allele on ribosome synthesis was specific for sly1 or was a general result of the inactivation of the secretion pathway, we assayed the levels of mRNA for several ribosomal proteins in cells carrying ts alleles of sec1, sec7, sec11, sec14, sec18, sec53, or sec63, representing all stages of secretion. In each case, the mRNA levels were severely depressed, suggesting that this is a common feature in mutants of protein secretion. For the mutants tested, transcription of rRNA was also substantially reduced. Furthermore, treatment of a sensitive strain with brefeldin A at a concentration sufficient to block the secretion pathway also led to a decrease of the level of ribosomal protein mRNA, with kinetics suggesting that the effect of a secretion defect is manifest within 15 to 30 min. We conclude that the continued function of the entire secretion pathway is essential for the maintenance of ribosome synthesis. The apparent coupling of membrane synthesis and ribosome synthesis suggest the existence of a regulatory network that connects the production of the various structural elements of the cell. Images PMID:8139552

  6. Vitamin B12 Synthesis and Salvage Pathways Were Acquired by Horizontal Gene Transfer to the Thermotogales

    PubMed Central

    Swithers, Kristen S.; Petrus, Amanda K.; Secinaro, Michael A.; Nesbø, Camilla L.; Gogarten, J. Peter; Noll, Kenneth M.; Butzin, Nicholas C.

    2012-01-01

    The availability of genome sequences of Thermotogales species from across the order allows an examination of the evolutionary origins of phenotypic characteristics in this lineage. Several studies have shown that the Thermotogales have acquired large numbers of genes from distantly related lineages, particularly Firmicutes and Archaea. Here, we report the finding that some Thermotogales acquired the ability to synthesize vitamin B12 by acquiring the requisite genes from these distant lineages. Thermosipho species, uniquely among the Thermotogales, contain genes that encode the means to synthesize vitamin B12 de novo from glutamate. These genes are split into two gene clusters: the corrinoid synthesis gene cluster, that is unique to the Thermosipho and the cobinamide salvage gene cluster. The corrinoid synthesis cluster was acquired from the Firmicutes lineage, whereas the salvage pathway is an amalgam of bacteria- and archaea-derived proteins. The cobinamide salvage gene cluster has a patchy distribution among Thermotogales species, and ancestral state reconstruction suggests that this pathway was present in the common Thermotogales ancestor. We show that Thermosipho africanus can grow in the absence of vitamin B12, so its de novo pathway is functional. We detected vitamin B12 in the extracts of T. africanus cells to verify the synthetic pathway. Genes in T. africanus with apparent B12 riboswitches were found to be down-regulated in the presence of vitamin B12 consistent with their roles in B12 synthesis and cobinamide salvage. PMID:22798452

  7. Urea-acetylene dicarboxylic acid reaction: A likely pathway for prebiotic uracil formation

    NASA Astrophysics Data System (ADS)

    Subbaraman, A. S.; Kazi, Z. A.; Choughuley, A. S. U.; Chadha, M. S.

    1980-12-01

    A number of routes have been suggested for the prebiotic synthesis of uracil involving the reaction of urea with malic acid, propiolic acid, cyanoacetylene and others. Cyanoacetylene has been detected in the interstellar medium as well as simulated prebiotic experiments. It is therefore plausible that dicyanoacetylene and its hydrolytic product acetylene dicarboxylic acid, (ADCA) may have played a role in chemical evolution. This aspect has been examined in the present work for the synthesis of uracil from ADCA and urea reaction. It was found that when ADCA reacted with urea, uracil was formed only in the presence of phosphoric acid and phosphates. Ammonium phosphates gave higher yields of uracil than other phosphates. In the absence of phosphoric acid or phosphates no uracil formation took place. This type of synthesis could have taken place in prebiotic oceans which contained ammonium phosphates and other salts.

  8. The role of pyruvate ferredoxin oxidoreductase in pyruvate synthesis during autotrophic growth by the Wood-Ljungdahl pathway.

    PubMed

    Furdui, C; Ragsdale, S W

    2000-09-15

    Pyruvate:ferredoxin oxidoreductase (PFOR) catalyzes the oxidative decarboxylation of pyruvate to acetyl-CoA and CO(2). The catalytic proficiency of this enzyme for the reverse reaction, pyruvate synthase, is poorly understood. Conversion of acetyl-CoA to pyruvate links the Wood-Ljungdahl pathway of autotrophic CO(2) fixation to the reductive tricarboxylic acid cycle, which in these autotrophic anaerobes is the stage for biosynthesis of all cellular macromolecules. The results described here demonstrate that the Clostridium thermoaceticum PFOR is a highly efficient pyruvate synthase. The Michaelis-Menten parameters for pyruvate synthesis by PFOR are: V(max) = 1.6 unit/mg (k(cat) = 3.2 s(-1)), K(m)(Acetyl-CoA) = 9 micrometer, and K(m)(CO(2)) = 2 mm. The intracellular concentrations of acetyl-CoA, CoASH, and pyruvate have been measured. The predicted rate of pyruvate synthesis at physiological concentrations of substrates clearly is sufficient to support the role of PFOR as a pyruvate synthase in vivo. Measurements of its k(cat)/K(m) values demonstrate that ferredoxin is a highly efficient electron carrier in both the oxidative and reductive reactions. On the other hand, rubredoxin is a poor substitute in the oxidative direction and is inept in donating electrons for pyruvate synthesis. PMID:10878009

  9. The effect of eicosapentaenoic and docosahexaenoic acid on protein synthesis and breakdown in murine C2C12 myotubes

    SciTech Connect

    Kamolrat, Torkamol; Gray, Stuart R.

    2013-03-22

    Highlights: ► EPA can enhance protein synthesis and retard protein breakdown in muscle cells. ► These effects were concurrent with increases in p70s6k and FOXO3a phosphorylation. ► EPA may be a useful tool in the treatment of muscle wasting conditions. -- Abstract: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been found to stimulate protein synthesis with little information regarding their effects on protein breakdown. Furthermore whether there are distinct effects of EPA and DHA remains to be established. The aim of the current study was to determine the distinct effects of EPA and DHA on protein synthesis, protein breakdown and signalling pathways in C2C12 myotubes. Fully differentiated C2C12 cells were incubated for 24 h with 0.1% ethanol (control), 50 μM EPA or 50 μM DHA prior to experimentation. After serum (4 h) and amino acid (1 h) starvation cells were stimulated with 2 mM L-leucine and protein synthesis measured using {sup 3}H-labelled phenylalanine. Protein breakdown was measured using {sup 3}H-labelled phenylalanine and signalling pathways (Akt, mTOR, p70S6k, 4EBP1, rps6 and FOXO3a) via Western blots. Data revealed that after incubation with EPA protein synthesis was 25% greater (P < 0.05) compared to control cells, with no effect of DHA. Protein breakdown was 22% (P < 0.05) lower, compared to control cells, after incubation with EPA, with no effect of DHA. Analysis of signalling pathways revealed that both EPA and DHA incubation increased (P < 0.05) p70s6k phosphorylation, EPA increased (P < 0.05) FOXO3a phosphorylation, with no alteration in other signalling proteins. The current study has demonstrated distinct effects of EPA and DHA on protein metabolism with EPA showing a greater ability to result in skeletal muscle protein accretion.

  10. Perspective: The Potential Role of Essential Amino Acids and the Mechanistic Target of Rapamycin Complex 1 (mTORC1) Pathway in the Pathogenesis of Child Stunting.

    PubMed

    Semba, Richard D; Trehan, Indi; Gonzalez-Freire, Marta; Kraemer, Klaus; Moaddel, Ruin; Ordiz, M Isabel; Ferrucci, Luigi; Manary, Mark J

    2016-09-01

    Stunting is the best summary measure of chronic malnutrition in children. Approximately one-quarter of children under age 5 worldwide are stunted. Lipid-based or micronutrient supplementation has little to no impact in reducing stunting, which suggests that other critical dietary nutrients are missing. A dietary pattern of poor-quality protein is associated with stunting. Stunted children have significantly lower circulating essential amino acids than do nonstunted children. Inadequate dietary intakes of essential amino acids could adversely affect growth, because amino acids are required for synthesis of proteins. The master growth regulation pathway, the mechanistic target of rapamycin complex 1 (mTORC1) pathway, is exquisitely sensitive to amino acid availability. mTORC1 integrates cues such as nutrients, growth factors, oxygen, and energy to regulate growth of bone, skeletal muscle, nervous system, gastrointestinal tract, hematopoietic cells, immune effector cells, organ size, and whole-body energy balance. mTORC1 represses protein and lipid synthesis and cell and organismal growth when amino acids are deficient. Over the past 4 decades, the main paradigm for child nutrition in developing countries has been micronutrient malnutrition, with relatively less attention paid to protein. In this Perspective, we present the view that essential amino acids and the mTORC1 pathway play a key role in child growth. The current assumption that total dietary protein intake is adequate for growth among most children in developing countries needs re-evaluation. PMID:27633102

  11. Perspective: The Potential Role of Essential Amino Acids and the Mechanistic Target of Rapamycin Complex 1 (mTORC1) Pathway in the Pathogenesis of Child Stunting.

    PubMed

    Semba, Richard D; Trehan, Indi; Gonzalez-Freire, Marta; Kraemer, Klaus; Moaddel, Ruin; Ordiz, M Isabel; Ferrucci, Luigi; Manary, Mark J

    2016-09-01

    Stunting is the best summary measure of chronic malnutrition in children. Approximately one-quarter of children under age 5 worldwide are stunted. Lipid-based or micronutrient supplementation has little to no impact in reducing stunting, which suggests that other critical dietary nutrients are missing. A dietary pattern of poor-quality protein is associated with stunting. Stunted children have significantly lower circulating essential amino acids than do nonstunted children. Inadequate dietary intakes of essential amino acids could adversely affect growth, because amino acids are required for synthesis of proteins. The master growth regulation pathway, the mechanistic target of rapamycin complex 1 (mTORC1) pathway, is exquisitely sensitive to amino acid availability. mTORC1 integrates cues such as nutrients, growth factors, oxygen, and energy to regulate growth of bone, skeletal muscle, nervous system, gastrointestinal tract, hematopoietic cells, immune effector cells, organ size, and whole-body energy balance. mTORC1 represses protein and lipid synthesis and cell and organismal growth when amino acids are deficient. Over the past 4 decades, the main paradigm for child nutrition in developing countries has been micronutrient malnutrition, with relatively less attention paid to protein. In this Perspective, we present the view that essential amino acids and the mTORC1 pathway play a key role in child growth. The current assumption that total dietary protein intake is adequate for growth among most children in developing countries needs re-evaluation.

  12. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  13. Role of AMACR (α-methylacyl-CoA racemase) and MFE-1 (peroxisomal multifunctional enzyme-1) in bile acid synthesis in mice.

    PubMed

    Autio, Kaija J; Schmitz, Werner; Nair, Remya R; Selkälä, Eija M; Sormunen, Raija T; Miinalainen, Ilkka J; Crick, Peter J; Wang, Yuqin; Griffiths, William J; Reddy, Janardan K; Baes, Myriam; Hiltunen, J Kalervo

    2014-07-01

    Cholesterol is catabolized to bile acids by peroxisomal β-oxidation in which the side chain of C27-bile acid intermediates is shortened by three carbon atoms to form mature C24-bile acids. Knockout mouse models deficient in AMACR (α-methylacyl-CoA racemase) or MFE-2 (peroxisomal multifunctional enzyme type 2), in which this β-oxidation pathway is prevented, display a residual C24-bile acid pool which, although greatly reduced, implies the existence of alternative pathways of bile acid synthesis. One alternative pathway could involve Mfe-1 (peroxisomal multifunctional enzyme type 1) either with or without Amacr. To test this hypothesis, we generated a double knockout mouse model lacking both Amacr and Mfe-1 activities and studied the bile acid profiles in wild-type, Mfe-1 and Amacr single knockout mouse line and Mfe-1 and Amacr double knockout mouse lines. The total bile acid pool was decreased in Mfe-1-/- mice compared with wild-type and the levels of mature C24-bile acids were reduced in the double knockout mice when compared with Amacr-deficient mice. These results indicate that Mfe-1 can contribute to the synthesis of mature bile acids in both Amacr-dependent and Amacr-independent pathways.

  14. Deciphering ascorbic acid regulatory pathways in ripening tomato fruit using a weighted gene correlation network analysis approach.

    PubMed

    Gao, Chao; Ju, Zheng; Li, Shan; Zuo, Jinhua; Fu, Daqi; Tian, Huiqin; Luo, Yunbo; Zhu, Benzhong

    2013-11-01

    Genotype is generally determined by the co-expression of diverse genes and multiple regulatory pathways in plants. Gene co-expression analysis combining with physiological trait data provides very important information about the gene function and regulatory mechanism. L-Ascorbic acid (AsA), which is an essential nutrient component for human health and plant metabolism, plays key roles in diverse biological processes such as cell cycle, cell expansion, stress resistance, hormone synthesis, and signaling. Here, we applied a weighted gene correlation network analysis approach based on gene expression values and AsA content data in ripening tomato (Solanum lycopersicum L.) fruit with different AsA content levels, which leads to identification of AsA relevant modules and vital genes in AsA regulatory pathways. Twenty-four modules were compartmentalized according to gene expression profiling. Among these modules, one negatively related module containing genes involved in redox processes and one positively related module enriched with genes involved in AsA biosynthetic and recycling pathways were further analyzed. The present work herein indicates that redox pathways as well as hormone-signal pathways are closely correlated with AsA accumulation in ripening tomato fruit, and allowed us to prioritize candidate genes for follow-up studies to dissect this interplay at the biochemical and molecular level.

  15. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  16. Retinoic acid suppresses the canonical Wnt signaling pathway in embryonic stem cells and activates the noncanonical Wnt signaling pathway

    PubMed Central

    Osei-Sarfo, Kwame; Gudas, Lorraine J.

    2014-01-01

    Embryonic stem cells (ESCs) have both the ability to self-renew and to differentiate into various cell lineages. Retinoic acid (RA), a metabolite of Vitamin A, has a critical function in initiating lineage differentiation of ESCs through binding to the retinoic acid receptors (RARs). Additionally, the Wnt signaling pathway plays a role in pluripotency and differentiation, depending on the activation status of the canonical and noncanonical pathways. The activation of the canonical Wnt signaling pathway, which requires the nuclear accumulation of β-catenin and its interaction with Tcf1/Lef at Wnt response elements, is involved in ESC stemness maintenance. The noncanonical Wnt signaling pathway, through actions of Tcf3, can antagonize the canonical pathway. We show that RA activates the noncanonical Wnt signaling pathway, while concomitantly inhibiting the canonical pathway. RA increases the expression of ligands and receptors of the noncanonical Wnt pathway (Wnt 5a, 7a, Fzd2 and Fzd6), downstream signaling, and Tcf3 expression. RA reduces the phosphorylated β-catenin level by 4-fold, though total β-catenin levels don't change. We show that RA signaling increases the dissociation of Tcf1 and the association of Tcf3 at promoters of genes that regulate stemness (e.g. NR5A2,Lrh-1) or differentiation (eg. Cyr61, Zic5). Knockdown of Tcf3 increases Lrh-1 transcript levels in mESCs and prevents the RA-associated, ∼4-fold increase in Zic5, indicating that RA requires Tcf3 to effect changes in Zic5 levels. We demonstrate a novel role for RA in altering the activation of these two Wnt signaling pathways and show that Tcf3 mediates some actions of RA during differentiation. PMID:24648413

  17. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1). PMID:27519121

  18. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  19. A heteromeric membrane-bound prenyltransferase complex from hop catalyzes three sequential aromatic prenylations in the bitter acid pathway.

    PubMed

    Li, Haoxun; Ban, Zhaonan; Qin, Hao; Ma, Liya; King, Andrew J; Wang, Guodong

    2015-03-01

    Bitter acids (α and β types) account for more than 30% of the fresh weight of hop (Humulus lupulus) glandular trichomes and are well known for their contribution to the bitter taste of beer. These multiprenylated chemicals also show diverse biological activities, some of which have potential benefits to human health. The bitter acid biosynthetic pathway has been investigated extensively, and the genes for the early steps of bitter acid synthesis have been cloned and functionally characterized. However, little is known about the enzyme(s) that catalyze three sequential prenylation steps in the β-bitter acid pathway. Here, we employed a yeast (Saccharomyces cerevisiae) system for the functional identification of aromatic prenyltransferase (PT) genes. Two PT genes (HlPT1L and HlPT2) obtained from a hop trichome-specific complementary DNA library were functionally characterized using this yeast system. Coexpression of codon-optimized PT1L and PT2 in yeast, together with upstream genes, led to the production of bitter acids, but no bitter acids were detected when either of the PT genes was expressed by itself. Stepwise mutation of the aspartate-rich motifs in PT1L and PT2 further revealed the prenylation sequence of these two enzymes in β-bitter acid biosynthesis: PT1L catalyzed only the first prenylation step, and PT2 catalyzed the two subsequent prenylation steps. A metabolon formed through interactions between PT1L and PT2 was demonstrated using a yeast two-hybrid system, reciprocal coimmunoprecipitation, and in vitro biochemical assays. These results provide direct evidence of the involvement of a functional metabolon of membrane-bound prenyltransferases in bitter acid biosynthesis in hop. PMID:25564559

  20. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  1. Biological function of the dTDP-rhamnose synthesis pathway in Streptococcus mutans.

    PubMed Central

    Tsukioka, Y; Yamashita, Y; Oho, T; Nakano, Y; Koga, T

    1997-01-01

    We have cloned a new gene locus that comprises three genes concerned with the biosynthesis of the serotype c-specific polysaccharide antigen in Streptococcus mutans. The genes encode proteins exhibiting significant homology to the rfbA, rfbB, and rfbD gene products that are involved in the anabolism of dTDP-L-rhamnose from D-glucose-1-phosphate. This anabolism pathway pertains to biosynthesis of the O antigen of lipopolysaccharide in gram-negative bacteria. The cell extract of Escherichia coli expressing each of the cloned genes of S. mutans exhibited enzymatic activity corresponding to the homologous counterpart of the rfb gene products. Rhamnose was not detected in the cell wall preparation purified from the mutant in which each of the three cloned genes was insertionally inactivated. Rabbit antiserum against S. mutans serotype c-specific antigen did not react with the autoclaved extracts from these mutants. These results indicate that the gene products identified in the present study are involved in the dTDP-L-rhamnose synthesis pathway and that the pathway relates to the biosynthesis of the serotype-specific polysaccharide antigen of S. mutans. Southern hybridization analysis revealed that genes homologous to the cloned genes involved in the dTDP-L-rhamnose synthesis pathway were widely distributed in a variety of streptococci. This is the first report of the biological function of the dTDP-rhamnose pathway in streptococci. PMID:9023194

  2. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described.

  3. Effects of metabolic pathway precursors and polydimethylsiloxane (PDMS) on poly-(gamma)-glutamic acid production by Bacillus subtilis BL53.

    PubMed

    de Cesaro, Alessandra; da Silva, Suse Botelho; Ayub, Marco Antônio Záchia

    2014-09-01

    The aims of this study were to evaluate the effects of the addition of metabolic precursors and polydimethylsiloxane (PDMS) as an oxygen carrier to cultures of Bacillus subtilis BL53 during the production of γ-PGA. Kinetics analyses of cultivations of different media showed that B. subtilis BL53 is an exogenous glutamic acid-dependent strain. When the metabolic pathway precursors of γ-PGA synthesis, L-glutamine and a-ketoglutaric acid, were added to the culture medium, production of the biopolymer was increased by 20 % considering the medium without these precursors. The addition of 10 % of the oxygen carrier PDMS to cultures caused a two-fold increase in the volumetric oxygen mass transfer coefficient (kLa), improving γ-PGA production and productivity. Finally, bioreactor cultures of B. subtilis BL53 adopting the combination of optimized medium E, added of glutamine, α-ketoglutaric acid, and PDMS, showed a productivity of 1 g L(-1) h(-1) of g-PGA after only 24 h of cultivation. Results of this study suggest that the use of metabolic pathway precursors glutamine and a-ketolgutaric acid, combined with the addition of PDMS as an oxygen carrier in bioreactors, can improve γ-PGA production and productivity by Bacillus strains .

  4. [Synthesis of new mandelic acid derivatives with preservative action. Synthesis and acute toxicity study].

    PubMed

    Stan, Cătălina; Năstase, V; Pavelescu, M; Vasile, Cornelia; Dumitrache, M; Gherase, Florenţa; Năstasă, Veronica

    2004-01-01

    Starting from the antiseptic action of DL mandelic acid, there were synthesized a series of esters of the mandelic acid, esters which could have preservative action. This study present the synthesis, structure validation and the acute toxicity study, for the new synthesized compounds. The esters were obtained by acylating 4-hydroxybenzoic acid propyl, ethyl, methyl esters and salicylic acid with the DL mandelic chloride (that was protected initially by the hydroxylic group). The structure of the synthesized compounds was confirmed by quantitative elemental analysis and RMN 1H spectral measurements. The acute toxicity was determined for two of the esters, who proved to had a preservative action (previously studied) and indicated that these esters have a small toxicity.

  5. Use of deuterium labelled glucose in evaluating the pathway of hepatic glycogen synthesis

    SciTech Connect

    Goodman, M.N.; Masuoka, L.K.; deRopp, J.S.; Jones, A.D.

    1989-03-15

    Deuterium labelled glucose has been used to study the pathway of hepatic glycogen synthesis during the fasted-refed transition in rats. Deuterium enrichment of liver glycogen was determined using nuclear magnetic resonance as well as mass spectroscopy. Sixty minutes after oral administration of deuterated glucose to fasted rats, the portal vein blood was fully enriched with deuterated glucose. Despite this, less than half of the glucose molecules incorporated into liver glycogen contained deuterium. The loss of deuterium label from glucose is consistent with hepatic glycogen synthesis by an indirect pathway requiring prior metabolism of glucose. The use of deuterium labelled glucose may prove to be a useful probe to study hepatic glycogen metabolism. Its use may also find application in the study of liver glycogen metabolism in humans by a noninvasive means.

  6. Limiting amino acid for protein synthesis with mammary cells in tissue culture.

    PubMed

    Park, C S; Chandler, P T; Norman, A W

    1976-05-01

    To identify the limiting amino acid in the minimal essential medium as published by Eagle (Science 130:432, 1959) for milk protein synthesis in rat mammary cells in tissue culture, two different experimental approaches were used. The first study involved the reduction of amino acids singly from the total amino acid complement of the medium for milk protein synthesis. The second study was to investigate the effect on milk protein synthesis of single amino acid addition to the basic complement of amino acids. Order of limiting amino acids was lysine (first) and possible methionine, valine, or arginine (second).

  7. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  8. Glucocorticoid metabolism in the developing lung: adrenal-like synthesis pathway.

    PubMed

    Provost, Pierre R; Boucher, Eric; Tremblay, Yves

    2013-11-01

    Glucocorticoids (GCs) are essential to normal lung development. They participate in the regulation of important developmental events including morphological changes, and lung maturation leading to the surge of surfactant synthesis by type II epithelial cells. Antenatal GC is administered to mothers at risk of premature delivery to reduce the risk of respiratory distress syndrome (RDS). Sex differences were reported in RDS, in the efficiency of antenatal GC treatment independently of surfactant levels, and in surfactant lipid synthesis. Type II epithelial cell maturation is regulated by epithelial-fibroblast cell-cell communication and involves paracrine factors secreted by fibroblasts under the stimulatory effect of GC. This positive action of GC can be inhibited by androgens through the androgen receptor (AR) present in fibroblasts. In fact, lung development is regulated not only by GC and androgens but also by GC and androgen metabolisms within the developing lung. We recently reviewed the metabolism of androgens in the fetal lung [45]. Here, we review multiple aspects of GC metabolism in the developing lung including inactivation and re-activation by 11β-HSDs, synthesis from the adrenal-like synthesis pathway expressed within the lung and the putative role of CRH and ACTH originating from lung in the regulation of this pathway. This article is part of a Special Issue entitled 'Pregnancy and Steroids'.

  9. Two distinct pathways for thymidylate (dTMP) synthesis in (hyper)thermophilic Bacteria and Archaea.

    PubMed

    Leduc, D; Graziani, S; Meslet-Cladiere, L; Sodolescu, A; Liebl, U; Myllykallio, H

    2004-04-01

    The hyperthermophilic anaerobic archaeon Pyrococcus abyssi, which lacks thymidine kinase, incorporates label from extracellular uracil, but not from thymidine, into its DNA. This implies that P. abyssi must synthesize dTMP (thymidylate), an essential precursor for DNA synthesis, de novo. However, iterative similarity searches of the three completed Pyrococcus genomes fail to detect candidate genes for canonical thymidylate synthase ThyA, suggesting the presence of alternative pathways for dTMP synthesis. Indeed, by identifying a novel class of flavin-dependent thymidylate synthases, ThyX, we have recently proven that two distinct pathways for de novo synthesis of dTMP are operational in the microbial world. While both thyX and thyA can be found in hyperthermophilic micro-organisms, the phylogenetic distribution of thyX among hyperthermophiles is wider than that of thyA. In this contribution, we discuss the differences in the distinct mechanisms of dTMP synthesis, with a special emphasis on hyperthermophilic micro-organisms.

  10. Repression of Escherichia coli carbamoylphosphate synthase: relationships with enzyme synthesis in the arginine and pyrimidine pathways.

    PubMed Central

    Piérard, A; Glansdorff, N; Gigot, D; Crabeel, M; Halleux, P; Thiry, L

    1976-01-01

    Cumulative repression of Escherichia coli carbamoylphosphate synthase (CPSase; EC 2.7.2.9) by arginine and pyrimidine was analyzed in relation to control enzyme synthesis in the arginine and pyrimidine pathways. The expression of carA and carB, the adjacent genes that specify the two subunits of the enzyme, was estimated by means of an in vitro complementation assay. The synthesis of each gene product was found to be under repression control. Coordinate expression of the two genes was observed under most conditions investigated. They might thus form an operon. The preparation of strains blocked in the degradation of cytidine and harboring leaky mutations affecting several steps of pyrimidine nucleotide synthesis made it possible to distinguish between the effects of cytidine and uridine compounds in the repression of the pyrimidine pathway enzymes. The data obtained suggest that derivatives of both cytidine and uridine participate in the repression of CPSase. In addition, repression of CPSase by arginine did not appear to occur unless pyrimidines were present at a significant intracellular concentration. This observation, together with our previous report that argR mutations impair the cumulative repression of CPSase, suggests that this control is mediated through the concerted effects of regulatory elements specific for the arginine and pyrimidine pathways. PMID:179975

  11. Enzymatic lesions in methionine mutants of Aspergillus nidulans: role and regulation of an alternative pathway for cysteine and methionine synthesis.

    PubMed Central

    Paszewski, A; Grabski, J

    1975-01-01

    In Aspergillus nidulans the pathway involving cystathionine formation is the main one for homocysteine synthesis. Mutants lacking cystathionine gamma-synthase or beta-cystathionase are auxotrophs suppressible by: (i) mutations in the main pathway of cysteine synthesis (cysA1, cysB1, and cysC1), (ii) mutations causing stimulation of cysteine catabolism (su101), and (iii) mutations in a presumed regulatory gene (suAmeth). A relative shortage of cysteine in the first group of suppressors causes a derepression of homocysteine synthase, the enzyme involved in the alternative pathway of homocysteine synthesis. A similar derepression is observed in the suAmeth strain. Homocysteine synthesized by this pathway serves as precursor for cysteine and methionine synthesis. A mutant with altered homocysteine synthase is a prototroph, indicating that this enzyme is not essential for the fungus. Images PMID:1102536

  12. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  13. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  14. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  15. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  16. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  17. Enhancement of arachidonic acid signaling pathway by nicotinic acid receptor HM74A

    SciTech Connect

    Tang, Yuting . E-mail: ytang@prdus.jnj.com; Zhou, Lubing; Gunnet, Joseph W.; Wines, Pamela G.; Cryan, Ellen V.; Demarest, Keith T.

    2006-06-23

    HM74A is a G protein-coupled receptor for nicotinic acid (niacin), which has been used clinically to treat dyslipidemia for decades. The molecular mechanisms whereby niacin exerts its pleiotropic effects on lipid metabolism remain largely unknown. In addition, the most common side effect in niacin therapy is skin flushing that is caused by prostaglandin release, suggesting that the phospholipase A{sub 2} (PLA{sub 2})/arachidonic acid (AA) pathway is involved. Various eicosanoids have been shown to activate peroxisome-proliferator activated receptors (PPAR) that play a diverse array of roles in lipid metabolism. To further elucidate the potential roles of HM74A in mediating the therapeutic effects and/or side effects of niacin, we sought to explore the signaling events upon HM74A activation. Here we demonstrated that HM74A synergistically enhanced UTP- and bradykinin-mediated AA release in a pertussis toxin-sensitive manner in A431 cells. Activation of HM74A also led to Ca{sup 2+}-mobilization and enhanced bradykinin-promoted Ca{sup 2+}-mobilization through Gi protein. While HM74A increased ERK1/2 activation by the bradykinin receptor, it had no effects on UTP-promoted ERK1/2 activation.Furthermore, UTP- and bradykinin-mediated AA release was significantly decreased in the presence of both MAPK kinase inhibitor PD 098059 and PKC inhibitor GF 109203X. However, the synergistic effects of HM74A were not dramatically affected by co-treatment with both inhibitors, indicating the cross-talk occurred at the receptor level. Finally, stimulation of A431 cells transiently transfected with PPRE-luciferase with AA significantly induced luciferase activity, mimicking the effects of PPAR{gamma} agonist rosiglitazone, suggesting that alteration of AA signaling pathway can regulate gene expression via endogenous PPARs.

  18. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  19. Staphylococcus aureus and Bacillus subtilis W23 make polyribitol wall teichoic acids using different enzymatic pathways

    PubMed Central

    Brown, Stephanie; Meredith, Timothy; Swoboda, Jonathan; Walker, Suzanne

    2010-01-01

    Summary Wall teichoic acids (WTAs) are anionic polymers that play key roles in bacterial cell shape, cell division, envelope integrity, biofilm formation, and pathogenesis. B. subtilis W23 and S. aureus both make polyribitol-phosphate (RboP) WTAs and contain similar sets of biosynthetic genes. We use in vitro reconstitution combined with genetics to show the pathways for WTA biosynthesis in B. subtilis W23 and S. aureus are different. S. aureus requires a glycerol-phosphate primase called TarF in order make RboP-WTAs; B. subtilis W23 contains a TarF homolog, but this enzyme makes glycerol-phosphate polymers and is not involved RboP-WTA synthesis. Instead, B. subtilis TarK functions in place of TarF to prime the WTA intermediate for chain extension by TarL. This work highlights the enzymatic diversity of the poorly characterized family of phosphotransferases involved in WTA biosynthesis in Gram-positive organisms. PMID:21035733

  20. Regulation of Abscisic Acid Signaling by the Ethylene Response Pathway in Arabidopsis

    PubMed Central

    Ghassemian, Majid; Nambara, Eiji; Cutler, Sean; Kawaide, Hiroshi; Kamiya, Yuji; McCourt, Peter

    2000-01-01

    Although abscisic acid (ABA) is involved in a variety of plant growth and developmental processes, few genes that actually regulate the transduction of the ABA signal into a cellular response have been identified. In an attempt to determine negative regulators of ABA signaling, we identified mutants, designated enhanced response to ABA3 (era3), that increased the sensitivity of the seed to ABA. Biochemical and molecular analyses demonstrated that era3 mutants overaccumulate ABA, suggesting that era3 is a negative regulator of ABA synthesis. Subsequent genetic analysis of era3 alleles, however, showed that these are new alleles at the ETHYLENE INSENSITIVE2 locus. Other mutants defective in their response to ethylene also showed altered ABA sensitivity; from these results, we conclude that ethylene appears to be a negative regulator of ABA action during germination. In contrast, the ethylene response pathway positively regulates some aspects of ABA action that involve root growth in the absence of ethylene. We discuss the response of plants to ethylene and ABA in the context of how these two hormones could influence the same growth responses. PMID:10899978

  1. Aberrant synthesis of indole-3-acetic acid in Saccharomyces cerevisiae triggers morphogenic transition, a virulence trait of pathogenic fungi.

    PubMed

    Rao, Reeta Prusty; Hunter, Ally; Kashpur, Olga; Normanly, Jennifer

    2010-05-01

    Many plant-associated microbes synthesize the auxin indole-3-acetic acid (IAA), and several IAA biosynthetic pathways have been identified in microbes and plants. Saccharomyces cerevisiae has previously been shown to respond to IAA by inducing pseudohyphal growth. We observed that IAA also induced hyphal growth in the human pathogen Candida albicans and thus may function as a secondary metabolite signal that regulates virulence traits such as hyphal transition in pathogenic fungi. Aldehyde dehydrogenase (Ald) is required for IAA synthesis from a tryptophan (Trp) precursor in Ustilago maydis. Mutant S. cerevisiae with deletions in two ALD genes are unable to convert radiolabeled Trp to IAA, yet produce IAA in the absence of exogenous Trp and at levels higher than wild type. These data suggest that yeast may have multiple pathways for IAA synthesis, one of which is not dependent on Trp. PMID:20233857

  2. Regulation of various proteolytic pathways by insulin and amino acids in human fibroblasts.

    PubMed

    Esteban, Inmaculada; Aguado, Carmen; Sánchez, Maribel; Knecht, Erwin

    2007-07-24

    Intracellular protein degradation is a regulated process with several proteolytic pathways. Although regulation of macroautophagy has been investigated in some detail in hepatocytes and in few other cells, less is known on this regulation in other cells and proteolytic pathways. We show that in human fibroblasts insulin and amino acids reduce protein degradation by different signalling pathways and that this inhibition proceeds in part via the mammalian target of rapamycin, especially with amino acids, which probably increase lysosomal pH. Moreover, the regulatory amino acids (Phe, Arg, Met, Tyr, Trp and Cys) are partially different from other cells. Finally, and in addition to macroautophagy, insulin and amino acids modify, to different extents and sometimes in opposite directions, the activities of other proteolytic pathways.

  3. Regulation of glycolysis and fatty acid synthesis from glucose in sheep adipose tissue

    PubMed Central

    Robertson, James P.; Faulkner, Anne; Vernon, Richard G.

    1982-01-01

    1. The following were measured in adipose-tissue pieces, obtained from 7–9 month-old sheep, before or after the tissue pieces had been maintained in tissue culture for 24 h: the rates of synthesis from glucose of fatty acids, acylglycerol glycerol, pyruvate and lactate; the rate of glucose oxidation to CO2; the rate of glucose oxidation via the pentose phosphate pathway; the activities of hexokinase, glucose 6-phosphate dehydrogenase, phosphofructokinase, pyruvate kinase, pyruvate dehydrogenase and ATP citrate lyase; the intra- and extra-cellular water content; the concentration of various metabolites and ATP, ADP and AMP. 2. The proportion of glucose carbon converted into the various products in sheep adipose tissue differs markedly from that observed in rat adipose tissue. 3. There was a general increase in the rate of glucose utilization by the adipose-tissue pieces after maintenance in tissue culture; largest changes were seen in the rates of glycolysis and fatty acid synthesis from glucose. These increases are paralleled by an increase in pyruvate kinase activity. There was no change in the activities of the other enzymes as measured, although the net flux through all the enzymes increased. 4. Incubation of fresh adipose-tissue pieces for 2–6h led to an increase in the affinity of pyruvate kinase for phosphoenolpyruvate. 5. The rate of pyruvate production by glycolysis was greater than the activity of pyruvate dehydrogenase of the tissue. 6. The results suggest that both pyruvate kinase and pyruvate dehydrogenase have important roles in restricting the utilization of glucose carbon for fatty acid synthesis in sheep adipose tissue. PMID:7150263

  4. Novel pathway for degradation of protocatechuic acid in Bacillus species.

    PubMed

    Crawford, R L

    1975-02-01

    A species of Bacillus, tentatively identified as B. circulans, degrades protocatechuic acid by a novel reaction involving meta-fission between C2 and C3 of the benzene nucleus. 2-Hydroxymuconic semialdehyde is then degraded to pyruvate and acetaldehyde by enzymatic reactions described in previous work. Protocatechuate 2,3-oxygenase exhibits a rather narrow substrate specificity; the methyl and ethyl esters of protocatechuic acid are oxidized, but other substrates for ring-fission oxygenases, notably catechol, gallic acid, and homoprotocatechuic acid, are not attached.

  5. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  6. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  7. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  8. Amyloid β inhibits retinoic acid synthesis exacerbating Alzheimer disease pathology which can be attenuated by an retinoic acid receptor α agonist.

    PubMed

    Goncalves, Maria B; Clarke, Earl; Hobbs, Carl; Malmqvist, Tony; Deacon, Robert; Jack, Julian; Corcoran, Jonathan P T

    2013-04-01

    The retinoic acid receptor (RAR) α system plays a key role in the adult brain, participating in the homeostatic control of synaptic plasticity, essential for memory function. Here we show that RARα signalling is down-regulated by amyloid beta (Aβ), which inhibits the synthesis of the endogenous ligand, retinoic acid (RA). This results in the counteraction of a variety of RARα-activated pathways that are key in the aetiopathology of Alzheimer's disease (AD) but which can be reversed by an RARα agonist. RARα signalling improves cognition in the Tg2576 mice, it has an anti-inflammatory effect and promotes Aβ clearance by increasing insulin degrading enzyme and neprilysin activity in both microglia and neurons. In addition, RARα signalling prevents tau phosphorylation. Therefore, stimulation of the RARα signalling pathway using a synthetic agonist, by both clearing Aβ and counteracting some of its toxic effects, offers therapeutic potential for the treatment of AD.

  9. Amyloid β inhibits retinoic acid synthesis exacerbating Alzheimer disease pathology which can be attenuated by an retinoic acid receptor α agonist

    PubMed Central

    Goncalves, Maria B; Clarke, Earl; Hobbs, Carl; Malmqvist, Tony; Deacon, Robert; Jack, Julian; Corcoran, Jonathan P T

    2013-01-01

    The retinoic acid receptor (RAR) α system plays a key role in the adult brain, participating in the homeostatic control of synaptic plasticity, essential for memory function. Here we show that RARα signalling is down-regulated by amyloid beta (Aβ), which inhibits the synthesis of the endogenous ligand, retinoic acid (RA). This results in the counteraction of a variety of RARα-activated pathways that are key in the aetiopathology of Alzheimer's disease (AD) but which can be reversed by an RARα agonist. RARα signalling improves cognition in the Tg2576 mice, it has an anti-inflammatory effect and promotes Aβ clearance by increasing insulin degrading enzyme and neprilysin activity in both microglia and neurons. In addition, RARα signalling prevents tau phosphorylation. Therefore, stimulation of the RARα signalling pathway using a synthetic agonist, by both clearing Aβ and counteracting some of its toxic effects, offers therapeutic potential for the treatment of AD. PMID:23379615

  10. An Oral Load of [13C3]Glycerol and Blood NMR Analysis Detect Fatty Acid Esterification, Pentose Phosphate Pathway, and Glycerol Metabolism through the Tricarboxylic Acid Cycle in Human Liver.

    PubMed

    Jin, Eunsook S; Sherry, A Dean; Malloy, Craig R

    2016-09-01

    Drugs and other interventions for high impact hepatic diseases often target biochemical pathways such as gluconeogenesis, lipogenesis, or the metabolic response to oxidative stress. However, traditional liver function tests do not provide quantitative data about these pathways. In this study, we developed a simple method to evaluate these processes by NMR analysis of plasma metabolites. Healthy subjects ingested [U-(13)C3]glycerol, and blood was drawn at multiple times. Each subject completed three visits under differing nutritional states. High resolution (13)C NMR spectra of plasma triacylglycerols and glucose provided new insights into a number of hepatic processes including fatty acid esterification, the pentose phosphate pathway, and gluconeogenesis through the tricarboxylic acid cycle. Fasting stimulated pentose phosphate pathway activity and metabolism of [U-(13)C3]glycerol in the tricarboxylic acid cycle prior to gluconeogenesis or glyceroneogenesis. Fatty acid esterification was transient in the fasted state but continuous under fed conditions. We conclude that a simple NMR analysis of blood metabolites provides an important biomarker of pentose phosphate pathway activity, triacylglycerol synthesis, and flux through anaplerotic pathways in mitochondria of human liver.

  11. An Oral Load of [13C3]Glycerol and Blood NMR Analysis Detect Fatty Acid Esterification, Pentose Phosphate Pathway, and Glycerol Metabolism through the Tricarboxylic Acid Cycle in Human Liver.

    PubMed

    Jin, Eunsook S; Sherry, A Dean; Malloy, Craig R

    2016-09-01

    Drugs and other interventions for high impact hepatic diseases often target biochemical pathways such as gluconeogenesis, lipogenesis, or the metabolic response to oxidative stress. However, traditional liver function tests do not provide quantitative data about these pathways. In this study, we developed a simple method to evaluate these processes by NMR analysis of plasma metabolites. Healthy subjects ingested [U-(13)C3]glycerol, and blood was drawn at multiple times. Each subject completed three visits under differing nutritional states. High resolution (13)C NMR spectra of plasma triacylglycerols and glucose provided new insights into a number of hepatic processes including fatty acid esterification, the pentose phosphate pathway, and gluconeogenesis through the tricarboxylic acid cycle. Fasting stimulated pentose phosphate pathway activity and metabolism of [U-(13)C3]glycerol in the tricarboxylic acid cycle prior to gluconeogenesis or glyceroneogenesis. Fatty acid esterification was transient in the fasted state but continuous under fed conditions. We conclude that a simple NMR analysis of blood metabolites provides an important biomarker of pentose phosphate pathway activity, triacylglycerol synthesis, and flux through anaplerotic pathways in mitochondria of human liver. PMID:27432878

  12. Arginine-dependent acid-resistance pathway in Shigella boydii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ability to survive the low pH of the human stomach is considered be an important virulent determinant. Acid tolerance of Shigella boydii 18 CDPH, the strain implicated in an outbreak may have played an important role in surviving the acidic food (bean salad). The strain was capable of inducing arg...

  13. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  14. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  15. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  16. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    SciTech Connect

    Amikam, D.; Benziman, M. )

    1989-12-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of {sup 32}P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with ({sup 14}C)glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes.

  17. Effect of acetate formation pathway and long chain fatty acid CoA-ligase on the free fatty acid production in E. coli expressing acy-ACP thioesterase from Ricinus communis.

    PubMed

    Li, Mai; Zhang, Xiujun; Agrawal, Arpita; San, Ka-Yiu

    2012-07-01

    Microbial biosynthesis of fatty acid like chemicals from renewable carbon sources has attracted significant attention in recent years. Free fatty acids can be used as precursors for the production of fuels or chemicals. Wild type E. coli strains produce fatty acids mainly for the biosynthesis of lipids and cell membranes and do not accumulate free fatty acids as intermediates in lipid biosynthesis. However, free fatty acids can be produced by breaking the fatty acid elongation through the overexpression of an acyl-ACP thioesterase. Since acetyl-CoA might be an important factor for fatty acid synthesis (acetate formation pathways are the main competitive pathways in consuming acetyl-CoA or pyruvate, a precursor of acetyl-CoA), and the long chain fatty acid CoA-ligase (FadD) plays a pivotal role in the transport and activation of exogenous fatty acids prior to their subsequent degradation, we examined the composition and the secretion of the free fatty acids in four different strains including the wild type MG1655, a mutant strain with inactivation of the fatty acid beta-oxidation pathway (fadD mutant (ML103)), and mutant strains with inactivation of the two major acetate production pathways (an ack-pta (acetate kinase/phosphotransacetylase), poxB (pyruvate oxidase) double mutant (ML112)) and a fadD, ack-pta, poxB triple mutant (ML115). The engineered E. coli cells expressing acyl-ACP thioesterase with glucose yield is higher than 40% of theoretical yield. Compared to MG1655(pXZ18) and ML103(pXZ18), acetate forming pathway deletion strains such as ML112(pXZ18) and ML115(pXZ18) produced similar quantity of total free fatty acids, which indicated that acetyl-CoA availability does not appear to be limiting factor for fatty acid production in these strains. However, these strains did show significant differences in the composition of free fatty acids. Different from MG1655(pXZ18) and ML103(pXZ18), acetate formation pathway deletion strains such as ML112(pXZ18) and ML115

  18. New insights into the regulation of plant immunity by amino acid metabolic pathways.

    PubMed

    Zeier, Jürgen

    2013-12-01

    Besides defence pathways regulated by classical stress hormones, distinct amino acid metabolic pathways constitute integral parts of the plant immune system. Mutations in several genes involved in Asp-derived amino acid biosynthetic pathways can have profound impact on plant resistance to specific pathogen types. For instance, amino acid imbalances associated with homoserine or threonine accumulation elevate plant immunity to oomycete pathogens but not to pathogenic fungi or bacteria. The catabolism of Lys produces the immune signal pipecolic acid (Pip), a cyclic, non-protein amino acid. Pip amplifies plant defence responses and acts as a critical regulator of plant systemic acquired resistance, defence priming and local resistance to bacterial pathogens. Asp-derived pyridine nucleotides influence both pre- and post-invasion immunity, and the catabolism of branched chain amino acids appears to affect plant resistance to distinct pathogen classes by modulating crosstalk of salicylic acid- and jasmonic acid-regulated defence pathways. It also emerges that, besides polyamine oxidation and NADPH oxidase, Pro metabolism is involved in the oxidative burst and the hypersensitive response associated with avirulent pathogen recognition. Moreover, the acylation of amino acids can control plant resistance to pathogens and pests by the formation of protective plant metabolites or by the modulation of plant hormone activity.

  19. A biosynthetic pathway for a prominent class of microbiota-derived bile acids

    PubMed Central

    Devlin, A. Sloan; Fischbach, Michael A.

    2015-01-01

    The gut bile acid pool is millimolar in concentration, varies widely in composition among individuals, and is linked to metabolic disease and cancer. Although these molecules derive almost exclusively from the microbiota, remarkably little is known about which bacterial species and genes are responsible for their biosynthesis. Here, we report a biosynthetic pathway for the second most abundant class in the gut, iso (3β-hydroxy) bile acids, whose levels exceed 300 µM in some humans and are absent in others. We show, for the first time, that iso bile acids are produced by Ruminococcus gnavus, a far more abundant commensal than previously known producers; and that the iso bile acid pathway detoxifies deoxycholic acid, favoring the growth of the keystone genus Bacteroides. By revealing the biosynthetic genes for an abundant class of bile acids, our work sets the stage for predicting and rationally altering the composition of the bile acid pool. PMID:26192599

  20. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors. PMID:26134042

  1. Effect of mevalonic acid on cholesterol synthesis in bovine intramuscular and subcutaneous adipocytes.

    PubMed

    Liu, Xiaomu; You, Wei; Cheng, Haijian; Zhang, Qingfeng; Song, Enliang; Wan, Fachun; Han, Hong; Liu, Guifen

    2016-02-01

    Mevalonic acid (MVA) is a key material in the synthesis of cholesterol; indeed, intracellular cholesterol synthesis is also called the mevalonic acid pathway. 3-Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is an essential enzyme in cholesterol biosynthesis. This study suggests that MVA may play an important role in the differentiation of bovine adipose tissue in vivo. We investigated differential mRNA expression in bovine intramuscular preadipocytes (BIPs) and bovine subcutaneous preadipocytes (BSPs) by culturing cells from the longissimus dorsi muscle and subcutaneous fat tissues of Luxi yellow cattle. The morphology of lipid accumulation of bovine preadipocytes was detected by Oil Red O staining, and total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), and high-density lipoprotein cholesterol (HDLC) levels were measured. Temporospatial expression of HMGR was investigated by real-time quantitative polymerase chain reaction (PCR). The TC, LDLC, and HDLC content did not significantly differ over time but increased slowly with increasing MVA concentration. HMGR expression increased over time and with increasing concentrations of MVA. MVA increased adipose cell proliferation in a dose-dependent and time-dependent manner. MVA stimulated HMGR expression in two cell types and its influence on adipocyte differentiation.

  2. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  3. Opposing effects of bile acids deoxycholic acid and ursodeoxycholic acid on signal transduction pathways in oesophageal cancer cells.

    PubMed

    Abdel-Latif, Mohamed M; Inoue, Hiroyasu; Reynolds, John V

    2016-09-01

    Ursodeoxycholic acid (UDCA) was reported to reduce bile acid toxicity, but the mechanisms underlying its cytoprotective effects are not fully understood. The aim of the present study was to examine the effects of UDCA on the modulation of deoxycholic acid (DCA)-induced signal transduction in oesophageal cancer cells. Nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) activity was assessed using a gel shift assay. NF-κB activation and translocation was performed using an ELISA-based assay and immunofluorescence analysis. COX-2 expression was analysed by western blotting and COX-2 promoter activity was assessed by luciferase assay. DCA induced NF-κB and AP-1 DNA-binding activities in SKGT-4 and OE33 cells. UDCA pretreatment inhibited DCA-induced NF-κB and AP-1 activation and NF-κB translocation. This inhibitory effect was coupled with a blockade of IκB-α degradation and inhibition of phosphorylation of IKK-α/β and ERK1/2. Moreover, UDCA pretreatment inhibited COX-2 upregulation. Using transient transfection of the COX-2 promoter, UDCA pretreatment abrogated DCA-induced COX-2 promoter activation. In addition, UDCA protected oesophageal cells from the apoptotic effects of deoxycholate. Our findings indicate that UDCA inhibits DCA-induced signalling pathways in oesophageal cancer cells. These data indicate a possible mechanistic role for the chemopreventive actions of UDCA in oesophageal carcinogenesis.

  4. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  5. Ubiquitin/proteasome pathway regulates levels of retinoic acid receptor gamma and retinoid X receptor alpha in human keratinocytes.

    PubMed

    Boudjelal, M; Wang, Z; Voorhees, J J; Fisher, G J

    2000-04-15

    Repeated exposure of human skin to solar UV radiation leads to premature aging (photoaging) and skin cancer. UV-induced skin damage can be ameliorated by all-trans retinoic acid treatment. The actions of retinoic acid in skin keratinocytes are mediated primarily by nuclear retinoic acid receptor gamma (RARgamma) and retinoid X receptor alpha (RXRalpha). We found that exposure of cultured primary human keratinocytes to UV irradiation (30 mJ/cm2) substantially reduced (50-90%) RARgamma and RXRalpha mRNA and protein within 8 h. The rates of disappearance of RARgamma and RXRalpha proteins after UV exposure or treatment with the protein synthesis inhibitor cycloheximide were similar. UV irradiation did not increase the rate of breakdown of RARgamma or RXRalpha but rather reduced their rate of synthesis. The addition of proteasome inhibitors MG132 and LLvL, but not the lysosomal inhibitor E64, prevented loss of RARgamma and RXRalpha proteins after exposure of keratinocytes to either UV radiation or cycloheximide. Soluble extracts from nonirradiated or UV-irradiated keratinocytes possessed similar levels of proteasome activity that degraded RARgamma and RXRalpha proteins in vitro. Furthermore, RARgamma and RXRalpha were polyubiquitinated in intact cells. RXRalpha was found to contain two proline, glutamate/aspartate, serine, and threonine (PEST) motifs, which confer rapid turnover of many short-lived regulatory proteins that are degraded by the ubiquitin/proteasome pathway. However, the PEST motifs in RXRalpha did not function to regulate its stability, because deletion of the PEST motifs individually or together did not alter ubiquitination or proteasome-mediated degradation of RXRalpha. These results demonstrate that loss of RARgamma and RXRalpha proteins after UV irradiation results from degradation via the ubiquitin/proteasome pathway. Taken together, the data here indicate that ubiquitin/proteasome-mediated breakdown is an important mechanism regulating the levels of

  6. A yeast acetyl coenzyme A carboxylase mutant links very-long-chain fatty acid synthesis to the structure and function of the nuclear membrane-pore complex.

    PubMed Central

    Schneiter, R; Hitomi, M; Ivessa, A S; Fasch, E V; Kohlwein, S D; Tartakoff, A M

    1996-01-01

    The conditional mRNA transport mutant of Saccharomyces cerevisiae, acc1-7-1 (mtr7-1), displays a unique alteration of the nuclear envelope. Unlike nucleoporin mutants and other RNA transport mutants, the intermembrane space expands, protuberances extend from the inner membrane into the intermembrane space, and vesicles accumulate in the intermembrane space. MTR7 is the same gene as ACC1, encoding acetyl coenzyme A (CoA) carboxylase (Acc1p), the rate-limiting enzyme of de novo fatty acid synthesis. Genetic and biochemical analyses of fatty acid synthesis mutants and acc1-7-1 indicate that the continued synthesis of malonyl-CoA, the enzymatic product of acetyl-CoA carboxylase, is required for an essential pathway which is independent from de novo synthesis of fatty acids. We provide evidence that synthesis of very-long-chain fatty acids (C26 atoms) is inhibited in acc1-7-1, suggesting that very-long-chain fatty acid synthesis is required to maintain a functional nuclear envelope. PMID:8943372

  7. Circadian control of bile acid synthesis by a KLF15-Fgf15 axis

    PubMed Central

    Han, Sean (Shuxin); Zhang, Rongli; Jain, Rajan; Shi, Hong; Zhang, Lilei; Zhou, Guangjin; Sangwung, Panjamaporn; Tugal, Derin; Atkins, G. Brandon; Prosdocimo, Domenick A.; Lu, Yuan; Han, Xiaonan; Tso, Patrick; Liao, Xudong; Epstein, Jonathan A.; Jain, Mukesh K.

    2015-01-01

    Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15 signalling axis that regulates circadian BA production. Systemic Klf15 deficiency disrupted circadian expression of key BA synthetic enzymes, tissue BA levels and triglyceride/cholesterol absorption. Studies in liver-specific Klf15-knockout mice suggested a non-hepatic basis for regulation of BA production. Ileal Fgf15 is a potent inhibitor of BA synthesis. Using a combination of biochemical, molecular and functional assays (including ileectomy and bile duct catheterization), we identify KLF15 as the first endogenous negative regulator of circadian Fgf15 expression. Elucidation of this novel pathway controlling circadian BA production has important implications for physiologic control of nutrient availability and metabolic homeostasis. PMID:26040986

  8. Decreased bile-acid synthesis in livers of hepatocyte-conditional NADPH-cytochrome P450 reductase-null mice results in increased bile acids in serum.

    PubMed

    Cheng, Xingguo; Zhang, Youcai; Klaassen, Curtis D

    2014-10-01

    NADPH-cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH-cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance-associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice.

  9. Baker's Yeast Deficient in Storage Lipid Synthesis Uses cis-Vaccenic Acid to Reduce Unsaturated Fatty Acid Toxicity.

    PubMed

    Sec, Peter; Garaiova, Martina; Gajdos, Peter; Certik, Milan; Griac, Peter; Hapala, Ivan; Holic, Roman

    2015-07-01

    The role of cis-vaccenic acid (18:1n-7) in the reduction of unsaturated fatty acids toxicity was investigated in baker's yeast Saccharomyces cerevisiae. The quadruple mutant (QM, dga1Δ lro1Δ are1Δ are2Δ) deficient in enzymes responsible for triacylglycerol and steryl ester synthesis has been previously shown to be highly sensitive to exogenous unsaturated fatty acids. We have found that cis-vaccenic acid accumulated during cultivation in the QM cells but not in the corresponding wild type strain. This accumulation was accompanied by a reduction in palmitoleic acid (16:1n-7) content in the QM cells that is consistent with the proposed formation of cis-vaccenic acid by elongation of palmitoleic acid. Fatty acid analysis of individual lipid classes from the QM strain revealed that cis-vaccenic acid was highly enriched in the free fatty acid pool. Furthermore, production of cis-vaccenic acid was arrested if the mechanism of fatty acids release to the medium was activated. We also showed that exogenous cis-vaccenic acid did not affect viability of the QM strain at concentrations toxic for palmitoleic or oleic acids. Moreover, addition of cis-vaccenic acid to the growth medium provided partial protection against the lipotoxic effects of exogenous oleic acid. Transformation of palmitoleic acid to cis-vaccenic acid is thus a rescue mechanism enabling S. cerevisiae cells to survive in the absence of triacylglycerol synthesis as the major mechanism for unsaturated fatty acid detoxification.

  10. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life.

  11. Retention and loss of amino acid biosynthetic pathways based on analysis of whole-genome sequences.

    PubMed

    Payne, Samuel H; Loomis, William F

    2006-02-01

    Plants and fungi can synthesize each of the 20 amino acids by using biosynthetic pathways inherited from their bacterial ancestors. However, the ability to synthesize nine amino acids (Phe, Trp, Ile, Leu, Val, Lys, His, Thr, and Met) was lost in a wide variety of eukaryotes that evolved the ability to feed on other organisms. Since the biosynthetic pathways and their respective enzymes are well characterized, orthologs can be recognized in whole genomes to understand when in evolution pathways were lost. The pattern of pathway loss and retention was analyzed in the complete genomes of three early-diverging protist parasites, the amoeba Dictyostelium, and six animals. The nine pathways were lost independently in animals, Dictyostelium, Leishmania, Plasmodium, and Cryptosporidium. Seven additional pathways appear to have been lost in one or another parasite, demonstrating that they are dispensable in a nutrition-rich environment. Our predictions of pathways retained and pathways lost based on computational analyses of whole genomes are validated by minimal-medium studies with mammals, fish, worms, and Dictyostelium. The apparent selective advantages of retaining biosynthetic capabilities for amino acids available in the diet are considered.

  12. Early steps of metabolism evolution inferred by cladistic analysis of amino acid catabolic pathways.

    PubMed

    Cunchillos, Chomin; Lecointre, Guillaume

    2002-02-01

    Among abiotic molecules available in primitive environments, free amino acids are good candidates as the first source of energy and molecules for early protocells. Amino acid catabolic pathways are likely to be one of the very first metabolic pathways of life. Among them, which ones were the first to emerge? A cladistic analysis of catabolic pathways of the sixteen aliphatic amino acids and two portions of the Krebs cycle is performed using four criteria of homology. The cladogram shows that the earliest pathways to emerge are not portions of the Krebs cycle but catabolisms of aspartate, asparagine, glutamate, glutamine, proline, arginine. Earliest enzymatic catabolic functions were deaminations and transaminations. Later on appeared enzymatic decarboxylations. The consensus tree allows to propose four time spans for catabolism development and corroborates the views of Cordón in 1990 about the evolution of catabolism.

  13. YB-1 Synthesis Is Regulated by mTOR Signaling Pathway

    PubMed Central

    Lyabin, Dmitry N.; Eliseeva, Irina A.; Ovchinnikov, Lev P.

    2012-01-01

    YB-1 is a eukaryotic protein with numerous intra- and extracellular functions based on its ability to interact with RNA, DNA, and many proteins. In spite of achievements in studying its functions, regulation of YB-1 synthesis in the cell remains poorly understood. In the current study Western and Northern blotting were used to determine the amounts of YB-1 and YB-1 mRNA in rabbit organs and several cell lines. As found, in the majority of studied eukaryotic cells a considerable proportion of YB-1 mRNA was stored in free mRNPs, i.e., was poorly translated. Also, we demonstrated that YB-1 synthesis depended on conditions that determined the rate of cell division. Specific suppression of YB-1 synthesis resulted from inhibition of the mTOR signaling pathway with inhibitor PP242, but not rapamycin. Experiments on reporter constructs showed that dependence of YB-1 mRNA translation on activity of the mTOR signaling pathway was dictated by 5′ untranslated regions of this mRNA, irrelatively of the TOP-like sequences at the beginning of 5′ UTR. PMID:23285076

  14. Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways

    NASA Astrophysics Data System (ADS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-09-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (δD, δ13C, and δ15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing δ13C and increasing δD with increasing carbon number in the α-H, α-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light δ13C signatures for β-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ω-amino acids). Higher deuterium enrichments are observed in α-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

  15. Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways

    NASA Technical Reports Server (NTRS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-01-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

  16. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  17. Hybrubins: Bipyrrole Tetramic Acids Obtained by Crosstalk between a Truncated Undecylprodigiosin Pathway and Heterologous Tetramic Acid Biosynthetic Genes.

    PubMed

    Zhao, Zhilong; Shi, Ting; Xu, Min; Brock, Nelson L; Zhao, Yi-Lei; Wang, Yemin; Deng, Zixin; Pang, Xiuhua; Tao, Meifeng

    2016-02-01

    Heterologous expression of bacterial artificial chromosome (BAC) clones from the genomic library of Streptomyces variabilis Snt24 in Streptomyces lividans SBT5 which carried a truncated undecylprodigiosin biosynthetic gene cluster led to the identification of hybrubins A-C. The hybrubins represent a new carbon skeleton in which a tetramic acid moiety is fused to a 2,2'-dipyrrole building block. Gene knockout experiments confirmed that hybrubins are derived from two convergent biosynthetic pathways including the remaining genomic red genes of S. lividans SBT5 as well as the BAC encoded hbn genes for the production of 5-ethylidenetetramic acid. A possible biosynthetic pathway was also proposed.

  18. Direct vs. indirect pathway of hepatic glycogen synthesis as a function of glucose infusion rate

    SciTech Connect

    Bagby, G.J.; Lang, C.H.; Johnson, J.L.; Blakesly, H.L.; Spitzer, J.J.

    1986-03-05

    This study was initiated to determine the influence of the rate of exogenous glucose administration on liver glycogen synthesis by the direct (glucose uptake and incorporation into glycogen) vs the indirect pathway (glucose degradation to 3-carbon intermediates, e.g., lactate, prior to incorporation into glycogen). Catheterized rats were fasted 2 days prior to receiving a 3 hr infusion of glucose at rates of 0 to 230 ..mu..mol/min/kg containing tracer (6-/sup 3/H)- and (U-/sup 14/C)-glucose. Plasma glucose (r = 0.80), insulin (r = 0.90) and lactate (r = 0.84) were correlated with glucose infusion rate. The rate of liver glycogen deposition (0.46 +/- 0.03 ..mu..mol/min/g) did not differ between a glucose infusion rate of 20 and 230 ..mu..mol/min/kg. At the lowest and highest glucose infusion rates hepatic glycogenesis accounted for 87 +/- 6 and 9 +/- 1% of the total glucose load, respectively. The percent contribution of the direct pathways to glycogen deposition ((/sup 3/H) specific activity in hepatic glycogen/(/sup 3/H) specific activity in plasma glucose) increased from 16 +/- 3 to 83 +/- 5% from lowest to highest glucose infusion rates (prevailing plasma glucose concentrations: 9 +/- 1 and 21 +/- 2 mM, respectively). The results indicate that the relative contribution of the direct and indirect pathways of glucogen synthesis are dependent upon the glucose load or plasma glucose concentration.

  19. The Stimulative Effect of Yangjing Capsule on Testosterone Synthesis through Nur77 Pathway in Leydig Cells

    PubMed Central

    Gu, Yalong; Zhang, Xindong; Sun, Dalin; Zhao, Hongle; Cai, Bin; Gao, Chao; Gao, Li; Cui, Yugui; Tang, Zhian; Jin, Baofang

    2015-01-01

    Yangjing Capsule (YC), an innovative Chinese medicine based on traditional prescription, promotes testosterone synthesis by upregulating the expression of steroidogenic enzymes. Nur77 as a nuclear receptor is known to regulate the expression of many steroid synthetases. This study aimed to explore the potential mechanisms by which YC regulates testosterone synthesis in Leydig cells. Real-time PCR and Western blot analysis were employed to assess the expressions of steroidogenic enzymes and Nur77 after treating MLTC-1 cells with YC. The luciferase reporter gene assay was performed to detect the activity of Nur77 gene promoter. Also, the expressions of steroid synthases were detected after Nur77 gene was knocked down. YC significantly stimulated Nur77 production and upregulated StAR and HSD3B expression, and this agrees with the activity of Nur77 gene promoter that was significantly enhanced by YC. Interestingly, knockdown of Nur77 blocked the above YC's effects and consequently inhibited testosterone synthesis in MLTC-1 cells. YC promotes StAR and HSD3B expression and upregulates testosterone synthesis in Leydig cells, which is mediated by Nur77 pathway. PMID:26413123

  20. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  1. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  2. New stabilized FastPrep-CLEAs for sialic acid synthesis.

    PubMed

    García-García, María Inmaculada; Sola-Carvajal, Agustín; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2011-05-01

    N-acetyl-D-neuraminic acid aldolase, a key enzyme in the biotechnological production of N-acetyl-D-neuraminic acid (sialic acid) from N-acetyl-D-mannosamine and pyruvate, was immobilized as cross-linked enzyme aggregates (CLEAs) by precipitation with 90% ammonium sulfate and crosslinking with 1% glutaraldehyde. Because dispersion in a reciprocating disruptor (FastPrep) was only able to recover 40% of the activity, improved CLEAs were then prepared by co-aggregation of the enzyme with 10mg/mL bovine serum albumin followed by a sodium borohydride treatment and final disruption by FastPrep (FastPrep-CLEAs). This produced a twofold increase in activity up to 86%, which is a 30% more than that reported for this aldolase in cross-linked inclusion bodies (CLIBs). In addition, these FastPrep-CLEAs presented remarkable biotechnological features for Neu5Ac synthesis, including, good activity and stability at alkaline pHs, a high K(M) for ManNAc (lower for pyruvate) and good operational stability. These results reinforce the practicability of using FastPrep-CLEAs in biocatalysis, thus reducing production costs and favoring reusability.

  3. A general stereocontrolled, convergent synthesis of oligoprenols that parallels the biosynthetic pathway.

    PubMed

    Radetich, Branko; Corey, E J

    2002-03-20

    A solution is reported to the classic unsolved problem of stereoselective synthesis of all-E oligoprenols, such as E-farnesylfarnesol, by a cationic coupling analogous to the biosynthetic pathway. The simplicity and efficacy of the method, which is outlined in Scheme 1, are demonstrated by the synthesis of a series of all-E oligoprenols from C(20) to C(35) in uniformly excellent overall yield. The success of the approach is due not only to the highly E-stereoselective C-C coupling that forms the oligoprenyl chain but also to the development of efficient syntheses of allylic secondary silanes and E-oligoprenal acetals, and to a selective allylic demethoxylation reaction.

  4. Omega-6 and omega-3 fatty acids metabolism pathways in the body of pigs fed diets with different sources of fatty acids.

    PubMed

    Skiba, Grzegorz; Poławska, Ewa; Sobol, Monika; Raj, Stanisława; Weremko, Dagmara

    2015-01-01

    This study was carried out on 24 gilts (♀ Polish Large White × ♂ Danish Landrace) grown with body weight (BW) of 60 to 105 kg. The pigs were fed diets designed on the basis of a standard diet (appropriate for age and BW of pigs) where a part of the energy content was replaced by different fat supplements: linseed oil in Diet L, rapeseed oil in Diet R and fish oil in Diet F (6 gilts per dietary treatment). The fat supplements were sources of specific fatty acids (FA): in Diet L α-linolenic acid (C18:3 n-3, ALA); in Diet R linoleic acid (C18:2 n-6, LA) and in Diet F eicosapentaenoic acid (C20:5 n-3, EPA), docosapentaenoic acid (C22:5 n-3, DPA) and docosahexaenoic acid (C22:6 n-3, DHA). The protein, fat and total FA contents in the body did not differ among groups of pigs. The enhanced total intake of LA and ALA by pigs caused an increased deposition of these FA in the body (p < 0.01) and an increased potential body pool of these acids for further metabolism/conversions. The conversion efficiency of LA and ALA from the feed to the pig's body differed among groups (p < 0.01) and ranged from 64.4% to 67.2% and from 69.4% to 81.7%, respectively. In Groups L and R, the level of de novo synthesis of long-chain polyunsaturated FA was higher than in Group F. From the results, it can be concluded that the efficiency of deposition is greater for omega-3 FA than for omega-6 FA and depends on their dietary amount. The level of LA and ALA intake influences not only their deposition in the body but also the end products of the omega-3 and omega-6 pathways.

  5. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  6. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  7. Regulation of the cholesterol biosynthetic pathway and its integration with fatty acid biosynthesis in the oleaginous microalga Nannochloropsis oceanica

    PubMed Central

    2014-01-01

    Background Sterols are vital structural and regulatory components in eukaryotic cells; however, their biosynthetic pathways and functional roles in microalgae remain poorly understood. Results In the oleaginous microalga Nannochloropsis oceanica, the sterol biosynthetic pathway produces phytosterols as minor products and cholesterol as the major product. The evidence together with their deduced biosynthetic pathways suggests that N. oceanica exhibits features of both higher plants and mammals. Temporal tracking of sterol profiles and sterol-biosynthetic transcripts in response to changes in light intensity and nitrogen supply reveal that sterols play roles in cell proliferation, chloroplast differentiation, and photosynthesis. Furthermore, the dynamics of fatty acid (FA) and FA-biosynthetic transcripts upon chemical inhibitor-induced sterol depletion reveal possible co-regulation of sterol production and FA synthesis, in that the squalene epoxidase inhibitor terbinafine reduces sterol content yet significantly elevates free FA production. Thus, a feedback regulation of sterol and FA homeostasis is proposed, with the 1-deoxy-D-xylulose 5-phosphate synthase (DXS, the committed enzyme in isoprenoid and sterol biosynthesis) gene potentially subject to feedback regulation by sterols. Conclusion These findings reveal features of sterol function and biosynthesis in microalgae and suggest new genetic engineering or chemical biology approaches for enhanced oil production in microalgae. PMID:24920959

  8. The effects of centrally injected arachidonic acid on respiratory system: Involvement of cyclooxygenase to thromboxane signaling pathway.

    PubMed

    Erkan, Leman Gizem; Guvenc, Gokcen; Altinbas, Burcin; Niaz, Nasir; Yalcin, Murat

    2016-05-01

    Arachidonic acid (AA) is a polyunsaturated fatty acid that is present in the phospholipids of the cell membranes of the body and is abundant in the brain. Exogenously administered AA has been shown to affect brain metabolism and to exhibit cardiovascular and neuroendocrine actions. However, little is known regarding its respiratory actions and/or central mechanism of its respiratory effects. Therefore, the present study was designed to investigate the possible effects of centrally injected AA on respiratory system and the mediation of the central cyclooxygenase (COX) to thromboxane A2 (TXA2) signaling pathway on AA-induced respiratory effects in anaesthetized rats. Intracerebroventricular (i.c.v.) administration of AA induced dose- and time-dependent increase in tidal volume, respiratory rates and respiratory minute ventilation and also caused an increase in partial oxygen pressure (pO2) and decrease in partial carbon dioxide pressure (pCO2) in male anaesthetized Spraque Dawley rats. I.c.v. pretreatment with ibuprofen, a non-selective COX inhibitor, completely blocked the hyperventilation and blood gases changes induced by AA. In addition, central pretreatment with different doses of furegrelate, a TXA2 synthesis inhibitor, also partially prevented AA-evoked hyperventilation and blood gases effects. These data explicitly show that centrally administered AA induces hyperventilation with increasing pO2 and decreasing pCO2 levels which are mediated by the activation of central COX to TXA2 signaling pathway.

  9. Identification of a conserved protein involved in anaerobic unsaturated fatty acid synthesis in Neiserria gonorrhoeae: implications for facultative and obligate anaerobes that lack FabA.

    PubMed

    Isabella, Vincent M; Clark, Virginia L

    2011-10-01

    Transcriptome analysis of the facultative anaerobe, Neisseria gonorrhoeae, revealed that many genes of unknown function were induced under anaerobic conditions. Mutation of one such gene, NGO1024, encoding a protein belonging to the 2-nitropropane dioxygenase-like superfamily of proteins, was found to result in an inability of gonococci to grow anaerobically. Anaerobic growth of an NG1024 mutant was restored upon supplementation with unsaturated fatty acids (UFA), but not with the saturated fatty acid palmitate. Gonococcal fatty acid profiles confirmed that NGO1024 was involved in UFA synthesis anaerobically, but not aerobically, demonstrating that gonococci contain two distinct pathways for the production of UFAs, with a yet unidentified aerobic mechanism, and an anaerobic mechanism involving NGO1024. Expression of genes involved in classical anaerobic UFA synthesis, fabA, fabM and fabB, was toxic in gonococci and unable to complement a NGO1024 mutation, suggesting that the chemistry involved in gonococcal anaerobic UFA synthesis is distinct from that of the classical pathway. NGO1024 homologues, which we suggest naming UfaA, form a distinct lineage within the 2-nitropropane dioxygenase-like superfamily, and are found in many facultative and obligate anaerobes that produce UFAs but lack fabA, suggesting that UfaA is part of a widespread pathway involved in UFA synthesis. PMID:21895795

  10. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  11. Revealing the bacterial butyrate synthesis pathways by analyzing (meta)genomic data.

    PubMed

    Vital, Marius; Howe, Adina Chuang; Tiedje, James M

    2014-04-22

    Butyrate-producing bacteria have recently gained attention, since they are important for a healthy colon and when altered contribute to emerging diseases, such as ulcerative colitis and type II diabetes. This guild is polyphyletic and cannot be accurately detected by 16S rRNA gene sequencing. Consequently, approaches targeting the terminal genes of the main butyrate-producing pathway have been developed. However, since additional pathways exist and alternative, newly recognized enzymes catalyzing the terminal reaction have been described, previous investigations are often incomplete. We undertook a broad analysis of butyrate-producing pathways and individual genes by screening 3,184 sequenced bacterial genomes from the Integrated Microbial Genome database. Genomes of 225 bacteria with a potential to produce butyrate were identified, including many previously unknown candidates. The majority of candidates belong to distinct families within the Firmicutes, but members of nine other phyla, especially from Actinobacteria, Bacteroidetes, Fusobacteria, Proteobacteria, Spirochaetes, and Thermotogae, were also identified as potential butyrate producers. The established gene catalogue (3,055 entries) was used to screen for butyrate synthesis pathways in 15 metagenomes derived from stool samples of healthy individuals provided by the HMP (Human Microbiome Project) consortium. A high percentage of total genomes exhibited a butyrate-producing pathway (mean, 19.1%; range, 3.2% to 39.4%), where the acetyl-coenzyme A (CoA) pathway was the most prevalent (mean, 79.7% of all pathways), followed by the lysine pathway (mean, 11.2%). Diversity analysis for the acetyl-CoA pathway showed that the same few firmicute groups associated with several Lachnospiraceae and Ruminococcaceae were dominating in most individuals, whereas the other pathways were associated primarily with Bacteroidetes. IMPORTANCE Microbiome research has revealed new, important roles of our gut microbiota for

  12. Polyunsaturated fatty acids trigger apoptosis of colon cancer cells through a mitochondrial pathway

    PubMed Central

    Zhang, Chengcheng; Yu, Haining; Shen, Yuzhen; Ni, Xiaofeng; Das, Undurti N.

    2015-01-01

    Introduction Colorectal cancer is common in developed countries. Polyunsaturated fatty acids (PUFAs) have been reported to possess tumoricidal action, but the exact mechanism of their action is not clear. Material and methods In the present study, we studied the effect of various n-6 and n-3 fatty acids on the survival of the colon cancer cells LoVo and RKO and evaluated the possible involvement of a mitochondrial pathway in their ability to induce apoptosis. Results It was observed that n-3 α-linolenic acid, eicosapentaenoic acid and docosahexaenoic acid (ALA, EPA and DHA respectively) and n-6 linoleic acid, gamma-linolenic acid and arachidonic acid (LA, GLA and AA respectively) induced apoptosis of the colon cancer cells LoVo and RKO at concentrations above 120 μM (p < 0.01 compared to control). The semi-differentiated colon cancer cell line RKO was more sensitive to the cytotoxic action of PUFAs compared to the undifferentiated colon cancer cell line LoVo. PUFA-treated cells showed an increased number of lipid droplets in their cytoplasm. PUFA-induced apoptosis of LoVo and RKO cells is mediated through a mitochondria-mediated pathway as evidenced by loss of mitochondrial membrane potential, generation of ROS, accumulation of intracellular Ca2+, activation of caspase-9 and caspase-3, decreased ATP level and increase in the Bax/Bcl2 expression ratio. Conclusions PUFAs induced apoptosis of colon cancer cells through a mitochondrial dependent pathway. PMID:26528354

  13. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  14. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  15. Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway.

    PubMed

    Cronan, John E

    2016-06-01

    Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

  16. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  17. Permanganate oxidation of α-amino acids: kinetic correlations for the nonautocatalytic and autocatalytic reaction pathways.

    PubMed

    Perez-Benito, Joaquin F

    2011-09-01

    The reactions of permanganate ion with seven α-amino acids in aqueous KH(2)PO(4)/K(2)HPO(4) buffers have been followed spectrophotometrically at two different wavelengths: 526 nm (decay of MnO(4)(-)) and 418 nm (formation of colloidal MnO(2)). All of the reactions studied were autocatalyzed by colloidal MnO(2), with the contribution of the autocatalytic reaction pathway decreasing in the order glycine > l-threonine > l-alanine > l-glutamic acid > l-leucine > l-isoleucine > l-valine. The rate constants corresponding to the nonautocatalytic and autocatalytic pathways were obtained by means of either a differential rate law or an integrated one, the latter requiring the use of an iterative method for its implementation. The activation parameters for the two pathways were determined and analyzed to obtain statistically significant correlations for the series of reactions studied. The activation enthalpy of the nonautocatalytic pathway showed a strong, positive dependence on the standard Gibbs energy for the dissociation of the protonated amino group of the α-amino acid. Linear enthalpy-entropy correlations were found for both pathways, leading to isokinetic temperatures of 370 ± 21 K (nonautocatalytic) and 364 ± 28 K (autocatalytic). Mechanisms in agreement with the experimental data are proposed for the two reaction pathways.

  18. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.

    PubMed

    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc

    2015-09-01

    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica.

  19. Role of bile acids in the regulation of the metabolic pathways

    PubMed Central

    Taoka, Hiroki; Yokoyama, Yoko; Morimoto, Kohkichi; Kitamura, Naho; Tanigaki, Tatsuya; Takashina, Yoko; Tsubota, Kazuo; Watanabe, Mitsuhiro

    2016-01-01

    Recent studies have revealed that bile acids (BAs) are not only facilitators of dietary lipid absorption but also important signaling molecules exerting multiple physiological functions. Some major signaling pathways involving the nuclear BAs receptor farnesoid X receptor and the G protein-coupled BAs receptor TGR5/M-BAR have been identified to be the targets of BAs. BAs regulate their own homeostasis via signaling pathways. BAs also affect diverse metabolic pathways including glucose metabolism, lipid metabolism and energy expenditure. This paper suggests the mechanism of controlling metabolism via BA signaling and demonstrates that BA signaling is an attractive therapeutic target of the metabolic syndrome. PMID:27433295

  20. Precipitation pathways for ferrihydrite formation in acidic solutions

    DOE PAGESBeta

    Zhu, Mengqiang; Khalid, Syed; Frandsen, Cathrine; Wallace, Adam F.; Legg, Benjamin; Zhang, Hengzhong; Morup, Steen; Banfield, Jillian F.; Waychunas, Glenn A.

    2015-10-03

    In this study, iron oxides and oxyhydroxides form via Fe3+ hydrolysis and polymerization in many aqueous environments, but the pathway from Fe3+ monomers to oligomers and then to solid phase nuclei is unknown. In this work, using combined X-ray, UV–vis, and Mössbauer spectroscopic approaches, we were able to identify and quantify the long-time sought ferric speciation over time during ferric oxyhydroxide formation in partially-neutralized ferric nitrate solutions ([Fe3+] = 0.2 M, 1.8 < pH < 3). Results demonstrate that Fe exists mainly as Fe(H2O)63+, μ-oxo aquo dimers and ferrihydrite, and that with time, the μ-oxo dimer decreases while the othermore » two species increase in their concentrations. No larger Fe oligomers were detected. Given that the structure of the μ-oxo dimer is incompatible with those of all Fe oxides and oxyhydroxides, our results suggest that reconfiguration of the μ-oxo dimer structure occurs prior to further condensation leading up to the nucleation of ferrihydrite. The structural reconfiguration is likely the rate-limiting step involved in the nucleation process.« less

  1. Precipitation pathways for ferrihydrite formation in acidic solutions

    SciTech Connect

    Zhu, Mengqiang; Khalid, Syed; Frandsen, Cathrine; Wallace, Adam F.; Legg, Benjamin; Zhang, Hengzhong; Morup, Steen; Banfield, Jillian F.; Waychunas, Glenn A.

    2015-10-03

    In this study, iron oxides and oxyhydroxides form via Fe3+ hydrolysis and polymerization in many aqueous environments, but the pathway from Fe3+ monomers to oligomers and then to solid phase nuclei is unknown. In this work, using combined X-ray, UV–vis, and Mössbauer spectroscopic approaches, we were able to identify and quantify the long-time sought ferric speciation over time during ferric oxyhydroxide formation in partially-neutralized ferric nitrate solutions ([Fe3+] = 0.2 M, 1.8 < pH < 3). Results demonstrate that Fe exists mainly as Fe(H2O)63+, μ-oxo aquo dimers and ferrihydrite, and that with time, the μ-oxo dimer decreases while the other two species increase in their concentrations. No larger Fe oligomers were detected. Given that the structure of the μ-oxo dimer is incompatible with those of all Fe oxides and oxyhydroxides, our results suggest that reconfiguration of the μ-oxo dimer structure occurs prior to further condensation leading up to the nucleation of ferrihydrite. The structural reconfiguration is likely the rate-limiting step involved in the nucleation process.

  2. Precipitation pathways for ferrihydrite formation in acidic solutions

    NASA Astrophysics Data System (ADS)

    Zhu, Mengqiang; Frandsen, Cathrine; Wallace, Adam F.; Legg, Benjamin; Khalid, Syed; Zhang, Hengzhong; Mørup, Steen; Banfield, Jillian F.; Waychunas, Glenn A.

    2016-01-01

    Iron oxides and oxyhydroxides form via Fe3+ hydrolysis and polymerization in many aqueous environments, but the pathway from Fe3+ monomers to oligomers and then to solid phase nuclei is unknown. In this work, using combined X-ray, UV-vis, and Mössbauer spectroscopic approaches, we were able to identify and quantify the long-time sought ferric speciation over time during ferric oxyhydroxide formation in partially-neutralized ferric nitrate solutions ([Fe3+] = 0.2 M, 1.8 < pH < 3). Results demonstrate that Fe exists mainly as Fe(H2O)63+, μ-oxo aquo dimers and ferrihydrite, and that with time, the μ-oxo dimer decreases while the other two species increase in their concentrations. No larger Fe oligomers were detected. Given that the structure of the μ-oxo dimer is incompatible with those of all Fe oxides and oxyhydroxides, our results suggest that reconfiguration of the μ-oxo dimer structure occurs prior to further condensation leading up to the nucleation of ferrihydrite. The structural reconfiguration is likely the rate-limiting step involved in the nucleation process.

  3. Distinct amino acid-sensing mTOR pathways regulate skeletal myogenesis.

    PubMed

    Yoon, Mee-Sup; Chen, Jie

    2013-12-01

    Signaling through the mammalian target of rapamycin (mTOR) in response to amino acid availability controls many cellular and developmental processes. mTOR is a master regulator of myogenic differentiation, but the pathways mediating amino acid signals in this process are not known. Here we examine the Rag GTPases and the class III phosphoinositide 3-kinase (PI3K) Vps34, two mediators of amino acid signals upstream of mTOR complex 1 (mTORC1) in cell growth regulation, for their potential involvement in myogenesis. We find that, although both Rag and Vps34 mediate amino acid activation of mTORC1 in C2C12 myoblasts, they have opposing functions in myogenic differentiation. Knockdown of RagA/B enhances, whereas overexpression of active RagB/C mutants impairs, differentiation, and this inhibitory function of Rag is mediated by mTORC1 suppression of the IRS1-PI3K-Akt pathway. On the other hand, Vps34 is required for myogenic differentiation. Amino acids activate a Vps34-phospholipase D1 (PLD1) pathway that controls the production of insulin-like growth factor II, an autocrine inducer of differentiation, through the Igf2 muscle enhancer. The product of PLD, phosphatidic acid, activates the enhancer in a rapamycin-sensitive but mTOR kinase-independent manner. Our results uncover amino acid-sensing mechanisms controlling the homeostasis of myogenesis and underline the versatility and context dependence of mTOR signaling.

  4. Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

    PubMed

    Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

    2015-04-01

    D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

  5. Reaction pathway of tryptophanase-catalyzed L-tryptophan synthesis from D-serine.

    PubMed

    Shimada, Akihiko; Ozaki, Haruka; Saito, Takeshi; Fujii, Noriko

    2011-11-01

    Tryptophanase, L-tryptophan indole-lyase with extremely absolute stereospecificity, can change the stereospecificity in concentrated diammonium hydrogenphosphate solution. While tryptophanase is not inert to D-serine in the absence of diammonium hydrogenphosphate, it can undergo L-tryptophan synthesis from D-serine along with indole in the presence of it. It has been well known that tryptophanase synthesizes L-tryptophan from L-serine through a β-substitution mechanism of the ping-pong type. However, a metabolic pathway of L-tryptophan synthesis from D-serine has remained unclear. The present study aims to elucidate it. Diammonium hydrogenphosphate plays a role in the emergence of catalytic activity on D-serine. The salt gives tryptophanase a small conformational change, which makes it possible to catalyze D-serine. Tryptophanase-bound D-serine produces L-tryptophan synthesis by β-replacement reaction via the enzyme-bound aminoacrylate intermediate. Our result will be valuable in studying the origin of homochirality.

  6. Synthesis and application of acid labile anchor groups for the synthesis of peptide amides by Fmoc-solid-phase peptide synthesis.

    PubMed

    Breipohl, G; Knolle, J; Stüber, W

    1989-10-01

    The preparation and application of a new linker for the synthesis of peptide amides using a modified Fmoc-method is described. The new anchor group was developed based on our experience with 4,4'-dimethoxybenzhydryl (Mbh)-protecting group for amides. Lability towards acid treatment was increased dramatically and results in an easy cleavage procedure for the preparation of peptide amides. The synthesis of N-9-fluorenylmethoxycarbonyl- ([5-carboxylatoethyl-2.4-dimethoxyphenyl)- 4'-methoxyphenyl]-methylamin is reported in detail. This linker was coupled to a commercially available aminomethyl polystyrene resin. Peptide synthesis proceeded smoothly using HOOBt esters of Fmoc-amino acids. Release of the peptide amide and final cleavage of the side chain protecting groups was accomplished by treatment with trifluoroacetic acid-dichloromethane mixtures in the presence of scavengers. The synthesis of peptide amides such as LHRH and C-terminal hexapeptide of secretin are given as examples.

  7. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  8. Cellular fatty acid uptake: a pathway under construction.

    PubMed

    Su, Xiong; Abumrad, Nada A

    2009-03-01

    Membrane uptake of long-chain fatty acids (FAs) is the first step in cellular FA utilization and a point of metabolic regulation. CD36 facilitates a major fraction of FA uptake by key tissues. This review highlights the contribution of CD36 to pathophysiology in rodents and humans. Novel concepts regarding regulation of CD36-facilitated uptake are discussed (i.e. the role of membrane rafts and caveolae, CD36 recycling between intracellular depots and the membrane, and chemical modifications of the protein that impact its turnover and recruitment). Importantly, CD36 membrane levels and turnover are abnormal in diabetes, resulting in dysfunctional FA utilization. In addition, variants in the CD36 gene were shown recently to influence susceptibility for the metabolic syndrome, which greatly increases the risk of diabetes and heart disease. PMID:19185504

  9. Biodegradation and metabolic pathway of β-chlorinated aliphatic acid in Bacillus sp. CGMCC no. 4196.

    PubMed

    Lin, Chunjiao; Yang, Lirong; Xu, Gang; Wu, Jianping

    2011-04-01

    In this study, a bacterial Bacillus sp. CGMCC no. 4196 was isolated from mud. This strain exhibited the ability to degrade high concentration of 3-chloropropionate (3-CPA, 120 mM) or 3-chlorobutyrate (30 mM), but not chloroacetate or 2-chloropropionate (2-CPA). The growing cells, resting cells, and cell-free extracts from this bacterium had the capability of 3-CPA degradation. The results indicated that the optimum biocatalyst for 3-CPA biodegradation was the resting cells. The 3-CPA biodegradation pathway was further studied through the metabolites and critical enzymes analysis by HPLC, LC-MS, and colorimetric method. The results demonstrated that the metabolites of 3-CPA were 3-hydroxypropionic acid (3-HP) and malonic acid semialdehyde, and the critical enzymes were 3-CPA dehalogenase and 3-HP dehydroxygenase. Thus, the mechanism of the dehalogenase-catalyzed reaction was inferred as hydrolytic dehalogenation which was coenzyme A-independent and oxygen-independent. Finally, the pathway of β-chlorinated aliphatic acid biodegradation could be concluded as follows: the β-chlorinated acid is first hydrolytically dehalogenated to the β-hydroxyl aliphatic acid, and the hydroxyl aliphatic acid is oxidized to β-carbonyl aliphatic acid by β-hydroxy aliphatic acid dehydroxygenase. It is the first report that 3-HP was produced from 3-CPA by β-chlorinated aliphatic acid dehalogenase.

  10. Regulatory role for amino acids in mammary gland growth and milk synthesis.

    PubMed

    Kim, Sung Woo; Wu, Guoyao

    2009-05-01

    The health and growth of mammalian neonates critically depend on the yield and composition of their mothers' milk. However, impaired lactogenesis occurs in both women in response to stress and hormonal imbalance and in primiparous sows which exhibit low voluntary feed intake and underdevelopment of mammary tissues. Because of ethical concerns over lactation research with women and children, swine is often used as an animal model to study mammary gland development and the underlying regulatory mechanisms. Available evidence from work with lactating sows shows that amino acids are not only building blocks for protein but are also key regulators of metabolic pathways critical to milk production. Particularly, arginine is the common substrate for the generation of nitric oxide (NO; a major vasodilator and angiogenic factor) and polyamines (key regulators of protein synthesis). Thus, modulation of the arginine-NO pathway may provide a new strategy to enhance the growth (including vascular growth) of mammary tissue and its uptake of nutrients, therefore improving lactation performance in mammals. In support of this proposition, supplementing 0.83% L: -arginine (as 1% L: -arginine-HCl) or 50 mg/day diethylenetriamine-NO adduct (NO donor) to diets of lactating primiparous sows increased milk production and the growth of suckling piglets. Future studies with animal models (e.g., pigs, sheep, cows, and rats) are necessary to elucidate the underlying mechanisms at molecular, cellular, tissue, and whole-body levels. PMID:18683019

  11. EIMS Fragmentation Pathways and MRM Quantification of 7α/β-Hydroxy-Dehydroabietic Acid TMS Derivatives

    NASA Astrophysics Data System (ADS)

    Rontani, Jean-François; Aubert, Claude; Belt, Simon T.

    2015-09-01

    EI mass fragmentation pathways of TMS derivatives οf 7α/β-hydroxy-dehydroabietic acids resulting from NaBH4-reduction of oxidation products of dehydroabietic acid (a component of conifers) were investigated and deduced by a combination of (1) low energy CID-GC-MS/MS, (2) deuterium labeling, (3) different derivatization methods, and (4) GC-QTOF accurate mass measurements. Having identified the main fragmentation pathways, the TMS-derivatized 7α/β-hydroxy-dehydroabietic acids could be quantified in multiple reaction monitoring (MRM) mode in sea ice and sediment samples collected from the Arctic. These newly characterized transformation products of dehydroabietic acid constitute potential tracers of biotic and abiotic degradation of terrestrial higher plants in the environment.

  12. EIMS Fragmentation Pathways and MRM Quantification of 7α/β-Hydroxy-Dehydroabietic Acid TMS Derivatives.

    PubMed

    Rontani, Jean-François; Aubert, Claude; Belt, Simon T

    2015-09-01

    EI mass fragmentation pathways of TMS derivatives οf 7α/β-hydroxy-dehydroabietic acids resulting from NaBH(4)-reduction of oxidation products of dehydroabietic acid (a component of conifers) were investigated and deduced by a combination of (1) low energy CID-GC-MS/MS, (2) deuterium labeling, (3) different derivatization methods, and (4) GC-QTOF accurate mass measurements. Having identified the main fragmentation pathways, the TMS-derivatized 7α/β-hydroxy-dehydroabietic acids could be quantified in multiple reaction monitoring (MRM) mode in sea ice and sediment samples collected from the Arctic. These newly characterized transformation products of dehydroabietic acid constitute potential tracers of biotic and abiotic degradation of terrestrial higher plants in the environment.

  13. Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria1[OPEN

    PubMed Central

    Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.

    2016-01-01

    Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016

  14. Unusual coupling reactions of aldehydes and alkynes: a novel preparation of substituted phthalic acid derivatives by automated synthesis.

    PubMed

    Jacobi von Wangelin, Axel; Neumann, Helfried; Gördes, Dirk; Klaus, Stefan; Jiao, Haijun; Spannenberg, Anke; Krüger, Thomas; Wendler, Christian; Thurow, Kerstin; Stoll, Norbert; Beller, Matthias

    2003-05-23

    Based upon a highly versatile multicomponent methodology, a new one-pot synthesis of substituted phthalic acid derivatives from alpha,beta-unsaturated aldehydes was developed. The reaction involves the intermediacy of an acetamidodiene species which undergoes Diels-Alder addition to diethyl acetylenedicarboxylate. The resultant acetamidocyclohexadiene is subject to elimination of acetamide under the reaction conditions to give rise to substituted diethyl phthalates in good yields. This domino condensation-cycloaddition-elimination sequence has been applied to a variety of alpha,beta-unsaturated aldehydes. Furthermore, we demonstrated the exploitation of parallelized and automated synthesis technology for the rapid screening of reaction conditions and compositions. Detailed studies revealed the catalytic role of the employed acetamide and the occurrence of a stereoselective 1,4-syn elimination pathway under standard conditions.

  15. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  16. Tailored fatty acid synthesis via dynamic control of fatty acid elongation.

    PubMed

    Torella, Joseph P; Ford, Tyler J; Kim, Scott N; Chen, Amanda M; Way, Jeffrey C; Silver, Pamela A

    2013-07-01

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  17. Completion of the core β-oxidative pathway of benzoic acid biosynthesis in plants.

    PubMed

    Qualley, Anthony V; Widhalm, Joshua R; Adebesin, Funmilayo; Kish, Christine M; Dudareva, Natalia

    2012-10-01

    Despite the importance of benzoic acid (BA) as a precursor for a wide array of primary and secondary metabolites, its biosynthesis in plants has not been fully elucidated. BA formation from phenylalanine requires shortening of the C(3) side chain by two carbon units, which can occur by a non-β-oxidative route and/or a β-oxidative pathway analogous to the catabolism of fatty acids. Enzymes responsible for the first and last reactions of the core BA β-oxidative pathway (cinnamic acid → cinnamoyl-CoA → 3-hydroxy-3-phenylpropanoyl-CoA → 3-oxo-3-phenylpropanoyl-CoA → BA-CoA) have previously been characterized in petunia, a plant with flowers rich in phenylpropanoid/benzenoid volatile compounds. Using a functional genomics approach, we have identified a petunia gene encoding cinnamoyl-CoA hydratase-dehydrogenase (PhCHD), a bifunctional peroxisomal enzyme responsible for two consecutively occurring unexplored intermediate steps in the core BA β-oxidative pathway. PhCHD spatially, developmentally, and temporally coexpresses with known genes in the BA β-oxidative pathway, and correlates with emission of benzenoid volatiles. Kinetic analysis of recombinant PhCHD revealed it most efficiently converts cinnamoyl-CoA to 3-oxo-3-phenylpropanoyl-CoA, thus forming the substrate for the final step in the pathway. Down-regulation of PhCHD expression in petunia flowers resulted in reduced CHD enzyme activity, as well as decreased formation of BA-CoA, BA and their derived volatiles. Moreover, transgenic lines accumulated the PhCHD substrate cinnamoyl-CoA and the upstream pathway intermediate cinnamic acid. Discovery of PhCHD completes the elucidation of the core BA β-oxidative route in plants, and together with the previously characterized CoA-ligase and thiolase enzymes, provides evidence that the whole pathway occurs in peroxisomes.

  18. Thioacetic acid/NaSH-mediated synthesis of N-protected amino thioacids and their utility in peptide synthesis.

    PubMed

    Mali, Sachitanand M; Gopi, Hosahudya N

    2014-03-21

    Thioacids are recently gaining momentum due to their versatile reactivity. The reactivity of thioacids has been widely explored in the selective amide/peptide bond formation. Thioacids are generally synthesized from the reaction between activated carboxylic acids such as acid chlorides, active esters, etc., and Na2S, H2S, or NaSH. We sought to investigate whether the versatile reactivity of the thioacids can be tuned for the conversion of carboxylic acids into corresponding thioacids in the presence of NaSH. Herein, we report that thioacetic acid- and NaSH-mediated synthesis of N-protected amino thioacids from the corresponding N-protected amino acids, oxidative dimerization of thioacids, crystal conformations of thioacid oxidative dimers, and the utility of thioacids and oxidative dimers in peptide synthesis. Our results suggest that peptides can be synthesized without using standard coupling agents.

  19. Reduction of nitrobenzene with alkaline ascorbic acid: Kinetics and pathways.

    PubMed

    Liang, Chenju; Lin, Ya-Ting; Shiu, Jia-Wei

    2016-01-25

    Alkaline ascorbic acid (AA) exhibits the potential to reductively degrade nitrobenzene (NB), which is the simplest of the nitroaromatic compounds. The nitro group (NO2(-)) of NB has a +III oxidation state of the N atom and tends to gain electrons. The effect of alkaline pH ranging from 9 to 13 was initially assessed and the results demonstrated that the solution pH, when approaching or above the pKa2 of AA (11.79), would increase reductive electron transfer to NB. The rate equation for the reactions between NB and AA at pH 12 can be described as r=((0.89±0.11)×10(-4) mM(1-(a+b))h(-1))×[NB](a=1.35±0.10)[AA](b=0.89±0.01). The GC/MS analytical method identified nitrosobenzene, azoxybenzene, and azobenzene as NB reduction intermediates, and aniline (AN) as a final product. These experimental results indicate that the alkaline AA reduction of NB to AN mainly proceeds via the direct route, consisting of a series of two-electron or four-electron transfers, and the condensation reaction plays a minor route. Preliminary evaluation of the remediation of spiked NB contaminated soils revealed that maintenance of alkaline pH and a higher water to soil ratio are essential for a successful alkaline AA application.

  20. Dietary omega-3 fatty acids modulate the eicosanoid profile in man primarily via the CYP-epoxygenase pathway[S

    PubMed Central

    Fischer, Robert; Konkel, Anne; Mehling, Heidrun; Blossey, Katrin; Gapelyuk, Andrej; Wessel, Niels; von Schacky, Clemens; Dechend, Ralf; Muller, Dominik N.; Rothe, Michael; Luft, Friedrich C.; Weylandt, Karsten; Schunck, Wolf-Hagen

    2014-01-01

    Cytochrome P450 (CYP)-dependent metabolites of arachidonic acid (AA) contribute to the regulation of cardiovascular function. CYP enzymes also accept EPA and DHA to yield more potent vasodilatory and potentially anti-arrhythmic metabolites, suggesting that the endogenous CYP-eicosanoid profile can be favorably shifted by dietary omega-3 fatty acids. To test this hypothesis, 20 healthy volunteers were treated with an EPA/DHA supplement and analyzed for concomitant changes in the circulatory and urinary levels of AA-, EPA-, and DHA-derived metabolites produced by the cyclooxygenase-, lipoxygenase (LOX)-, and CYP-dependent pathways. Raising the Omega-3 Index from about four to eight primarily resulted in a large increase of EPA-derived CYP-dependent epoxy-metabolites followed by increases of EPA- and DHA-derived LOX-dependent monohydroxy-metabolites including the precursors of the resolvin E and D families; resolvins themselves were not detected. The metabolite/precursor fatty acid ratios indicated that CYP epoxygenases metabolized EPA with an 8.6-fold higher efficiency and DHA with a 2.2-fold higher efficiency than AA. Effects on leukotriene, prostaglandin E, prostacyclin, and thromboxane formation remained rather weak. We propose that CYP-dependent epoxy-metabolites of EPA and DHA may function as mediators of the vasodilatory and cardioprotective effects of omega-3 fatty acids and could serve as biomarkers in clinical studies investigating the cardiovascular effects of EPA/DHA supplementation. PMID:24634501

  1. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  2. From thiol to sulfonic acid: modeling the oxidation pathway of protein thiols by hydrogen peroxide.

    PubMed

    van Bergen, Laura A H; Roos, Goedele; De Proft, Frank

    2014-08-01

    Hydrogen peroxide is a natural oxidant that can oxidize protein thiols (RSH) via sulfenic acid (RSOH) and sulfinic acid (RSO2H) to sulfonic acid (RSO3H). In this paper, we study the complete anionic and neutral oxidation pathway from thiol to sulfonic acid. Reaction barriers and reaction free energies for all three oxidation steps are computed, both for the isolated substrates and for the substrates in the presence of different model ligands (CH4, H2O, NH3) mimicking the enzymatic environment. We found for all three barriers that the anionic thiolate is more reactive than the neutral thiol. However, the assistance of the environment in the neutral pathway in a solvent-assisted proton-exchange (SAPE) mechanism can lower the reaction barrier noticeably. Polar ligands can decrease the reaction barriers, whereas apolar ligands do not influence the barrier heights. The same holds for the reaction energies: they decrease (become more negative) in the presence of polar ligands whereas apolar ligands do not have an influence. The consistently negative consecutive reaction energies for the oxidation in the anionic pathway when going from thiolate over sulfenic and sulfinic acid to sulfonic acid are in agreement with biological reversibility.

  3. The sequence diversity and expression among genes of the folic acid biosynthesis pathway in industrial Saccharomyces strains.

    PubMed

    Goncerzewicz, Anna; Misiewicz, Anna

    2015-01-01

    Folic acid is an important vitamin in human nutrition and its deficiency in pregnant women's diets results in neural tube defects and other neurological damage to the fetus. Additionally, DNA synthesis, cell division and intestinal absorption are inhibited in case of adults. Since this discovery, governments and health organizations worldwide have made recommendations concerning folic acid supplementation of food for women planning to become pregnant. In many countries this has led to the introduction of fortifications, where synthetic folic acid is added to flour. It is known that Saccharomyces strains (brewing and bakers' yeast) are one of the main producers of folic acid and they can be used as a natural source of this vitamin. Proper selection of the most efficient strains may enhance the folate content in bread, fermented vegetables, dairy products and beer by 100% and may be used in the food industry. The objective of this study was to select the optimal producing yeast strain by determining the differences in nucleotide sequences in the FOL2, FOL3 and DFR1 genes of folic acid biosynthesis pathway. The Multitemperature Single Strand Conformation Polymorphism (MSSCP) method and further nucleotide sequencing for selected strains were applied to indicate SNPs in selected gene fragments. The RT qPCR technique was also applied to examine relative expression of the FOL3 gene. Furthermore, this is the first time ever that industrial yeast strains were analysed regarding genes of the folic acid biosynthesis pathway. It was observed that a correlation exists between the folic acid amount produced by industrial yeast strains and changes in the nucleotide sequence of adequate genes. The most significant changes occur in the DFR1 gene, mostly in the first part, which causes major protein structure modifications in KKP 232, KKP 222 and KKP 277 strains. Our study shows that the large amount of SNP contributes to impairment of the selected enzymes and S. cerevisiae and S

  4. The sequence diversity and expression among genes of the folic acid biosynthesis pathway in industrial Saccharomyces strains.

    PubMed

    Goncerzewicz, Anna; Misiewicz, Anna

    2015-01-01

    Folic acid is an important vitamin in human nutrition and its deficiency in pregnant women's diets results in neural tube defects and other neurological damage to the fetus. Additionally, DNA synthesis, cell division and intestinal absorption are inhibited in case of adults. Since this discovery, governments and health organizations worldwide have made recommendations concerning folic acid supplementation of food for women planning to become pregnant. In many countries this has led to the introduction of fortifications, where synthetic folic acid is added to flour. It is known that Saccharomyces strains (brewing and bakers' yeast) are one of the main producers of folic acid and they can be used as a natural source of this vitamin. Proper selection of the most efficient strains may enhance the folate content in bread, fermented vegetables, dairy products and beer by 100% and may be used in the food industry. The objective of this study was to select the optimal producing yeast strain by determining the differences in nucleotide sequences in the FOL2, FOL3 and DFR1 genes of folic acid biosynthesis pathway. The Multitemperature Single Strand Conformation Polymorphism (MSSCP) method and further nucleotide sequencing for selected strains were applied to indicate SNPs in selected gene fragments. The RT qPCR technique was also applied to examine relative expression of the FOL3 gene. Furthermore, this is the first time ever that industrial yeast strains were analysed regarding genes of the folic acid biosynthesis pathway. It was observed that a correlation exists between the folic acid amount produced by industrial yeast strains and changes in the nucleotide sequence of adequate genes. The most significant changes occur in the DFR1 gene, mostly in the first part, which causes major protein structure modifications in KKP 232, KKP 222 and KKP 277 strains. Our study shows that the large amount of SNP contributes to impairment of the selected enzymes and S. cerevisiae and S

  5. An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis

    PubMed Central

    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker

    2012-01-01

    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  6. Efficient synthesis of L-lactic acid from glycerol by metabolically engineered Escherichia coli

    PubMed Central

    2013-01-01

    Background Due to its abundance and low-price, glycerol has become an attractive carbon source for the industrial production of value-added fuels and chemicals. This work reports the engineering of E. coli for the efficient conversion of glycerol into L-lactic acid (L-lactate). Results Escherichia coli strains have previously been metabolically engineered for the microaerobic production of D-lactic acid from glycerol in defined media by disrupting genes that minimize the synthesis of succinate, acetate, and ethanol, and also overexpressing the respiratory route of glycerol dissimilation (GlpK/GlpD). Here, further rounds of rationale design were performed on these strains for the homofermentative production of L-lactate, not normally produced in E. coli. Specifically, L-lactate production was enabled by: 1), replacing the native D-lactate specific dehydrogenase with Streptococcus bovis L-lactate dehydrogenase (L-LDH), 2) blocking the methylglyoxal bypass pathways to avoid the synthesis of a racemic mixture of D- and L-lactate and prevent the accumulation of toxic intermediate, methylglyoxal, and 3) the native aerobic L-lactate dehydrogenase was blocked to prevent the undesired utilization of L-lactate. The engineered strain produced 50 g/L of L-lactate from 56 g/L of crude glycerol at a yield 93% of the theoretical maximum and with high optical (99.9%) and chemical (97%) purity. Conclusions This study demonstrates the efficient conversion of glycerol to L-lactate, a microbial process that had not been reported in the literature prior to our work. The engineered biocatalysts produced L-lactate from crude glycerol in defined minimal salts medium at high chemical and optical purity. PMID:23347598

  7. Meristem maintenance, auxin, jasmonic and abscisic acid pathways as a mechanism for phenotypic plasticity in Antirrhinum majus

    PubMed Central

    Weiss, Julia; Alcantud-Rodriguez, Raquel; Toksöz, Tugba; Egea-Cortines, Marcos

    2016-01-01

    Plants grow under climatic changing conditions that cause modifications in vegetative and reproductive development. The degree of changes in organ development i.e. its phenotypic plasticity seems to be determined by the organ identity and the type of environmental cue. We used intraspecific competition and found that Antirrhinum majus behaves as a decoupled species for lateral organ size and number. Crowding causes decreases in leaf size and increased leaf number whereas floral size is robust and floral number is reduced. Genes involved in shoot apical meristem maintenance like ROA and HIRZ, cell cycle (CYCD3a; CYCD3b, HISTONE H4) or organ polarity (GRAM) were not significantly downregulated under crowding conditions. A transcriptomic analysis of inflorescence meristems showed Gene Ontology enriched pathways upregulated including Jasmonic and Abscisic acid synthesis and or signalling. Genes involved in auxin synthesis such as AmTAR2 and signalling AmANT were not affected by crowding. In contrast, AmJAZ1, AmMYB21, AmOPCL1 and AmABA2 were significantly upregulated. Our work provides a mechanistic working hypothesis where a robust SAM and stable auxin signalling enables a homogeneous floral size while changes in JA and ABA signalling maybe responsible for the decreased leaf size and floral number. PMID:26804132

  8. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  9. Enzymology of the branched-chain amino acid oxidation disorders: the valine pathway.

    PubMed

    Wanders, Ronald J A; Duran, Marinus; Loupatty, Ference J

    2012-01-01

    Valine is one of the three branched-chain amino acids which undergoes oxidation within mitochondria. In this paper, we describe the current state of knowledge with respect to the enzymology of the valine oxidation pathway and the different disorders affecting oxidation.

  10. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress.

    PubMed

    Simón, María Victoria; Agnolazza, Daniela L; German, Olga Lorena; Garelli, Andrés; Politi, Luis E; Agbaga, Martin-Paul; Anderson, Robert E; Rotstein, Nora P

    2016-03-01

    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here, we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat and hydrogen peroxide (H2 O2 ). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in retina photoreceptors, and its precursor, eicosapentaenoic acid (EPA) have multiple beneficial effects. Here, we show that retina neurons in vitro express the desaturase FADS2 and can synthesize DHA from EPA. Moreover, addition of EPA to these cultures protects photoreceptors from oxidative stress and promotes their differentiation through its metabolization to DHA. PMID:26662863

  11. Versatile Multicomponent Reaction Macrocycle Synthesis Using α-Isocyano-ω-carboxylic Acids.

    PubMed

    Liao, George P; Abdelraheem, Eman M M; Neochoritis, Constantinos G; Kurpiewska, Katarzyna; Kalinowska-Tłuścik, Justyna; McGowan, David C; Dömling, Alexander

    2015-10-16

    The direct macrocycle synthesis of α-isocyano-ω-carboxylic acids via an Ugi multicomponent reaction is introduced. This multicomponent reaction (MCR) protocol differs by being especially short, convergent, and versatile, giving access to 12-22 membered rings.

  12. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  13. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  14. Microalgae Synthesize Hydrocarbons from Long-Chain Fatty Acids via a Light-Dependent Pathway.

    PubMed

    Sorigué, Damien; Légeret, Bertrand; Cuiné, Stéphan; Morales, Pablo; Mirabella, Boris; Guédeney, Geneviève; Li-Beisson, Yonghua; Jetter, Reinhard; Peltier, Gilles; Beisson, Fred

    2016-08-01

    Microalgae are considered a promising platform for the production of lipid-based biofuels. While oil accumulation pathways are intensively researched, the possible existence of a microalgal pathways converting fatty acids into alka(e)nes has received little attention. Here, we provide evidence that such a pathway occurs in several microalgal species from the green and the red lineages. In Chlamydomonas reinhardtii (Chlorophyceae), a C17 alkene, n-heptadecene, was detected in the cell pellet and the headspace of liquid cultures. The Chlamydomonas alkene was identified as 7-heptadecene, an isomer likely formed by decarboxylation of cis-vaccenic acid. Accordingly, incubation of intact Chlamydomonas cells with per-deuterated D31-16:0 (palmitic) acid yielded D31-18:0 (stearic) acid, D29-18:1 (oleic and cis-vaccenic) acids, and D29-heptadecene. These findings showed that loss of the carboxyl group of a C18 monounsaturated fatty acid lead to heptadecene formation. Amount of 7-heptadecene varied with growth phase and temperature and was strictly dependent on light but was not affected by an inhibitor of photosystem II. Cell fractionation showed that approximately 80% of the alkene is localized in the chloroplast. Heptadecane, pentadecane, as well as 7- and 8-heptadecene were detected in Chlorella variabilis NC64A (Trebouxiophyceae) and several Nannochloropsis species (Eustigmatophyceae). In contrast, Ostreococcus tauri (Mamiellophyceae) and the diatom Phaeodactylum tricornutum produced C21 hexaene, without detectable C15-C19 hydrocarbons. Interestingly, no homologs of known hydrocarbon biosynthesis genes were found in the Nannochloropsis, Chlorella, or Chlamydomonas genomes. This work thus demonstrates that microalgae have the ability to convert C16 and C18 fatty acids into alka(e)nes by a new, light-dependent pathway. PMID:27288359

  15. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing.

    PubMed

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-21

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au(+) complexes, and then a class of ∼2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ∼1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au(+) complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe(3+) with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe(3+), and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs. PMID:26391420

  16. White-to-brite conversion in human adipocytes promotes metabolic reprogramming towards fatty acid anabolic and catabolic pathways

    PubMed Central

    Barquissau, V.; Beuzelin, D.; Pisani, D.F.; Beranger, G.E.; Mairal, A.; Montagner, A.; Roussel, B.; Tavernier, G.; Marques, M.-A.; Moro, C.; Guillou, H.; Amri, E.-Z.; Langin, D.

    2016-01-01

    in PPARα-null mice displaying an impaired britening response. Conclusions Conversion of human white fat cells into brite adipocytes results in a major metabolic reprogramming inducing fatty acid anabolic and catabolic pathways. PDK4 redirects glucose from oxidation towards triglyceride synthesis and favors the use of fatty acids as energy source for uncoupling mitochondria. PMID:27110487

  17. Analysis of porcine adipose tissue transcriptome reveals differences in de novo fatty acid synthesis in pigs with divergent muscle fatty acid composition

    PubMed Central

    2013-01-01

    Background In pigs, adipose tissue is one of the principal organs involved in the regulation of lipid metabolism. It is particularly involved in the overall fatty acid synthesis with consequences in other lipid-target organs such as muscles and the liver. With this in mind, we have used massive, parallel high-throughput sequencing technologies to characterize the porcine adipose tissue transcriptome architecture in six Iberian x Landrace crossbred pigs showing extreme phenotypes for intramuscular fatty acid composition (three per group). Results High-throughput RNA sequencing was used to generate a whole characterization of adipose tissue (backfat) transcriptome. A total of 4,130 putative unannotated protein-coding sequences were identified in the 20% of reads which mapped in intergenic regions. Furthermore, 36% of the unmapped reads were represented by interspersed repeats, SINEs being the most abundant elements. Differential expression analyses identified 396 candidate genes among divergent animals for intramuscular fatty acid composition. Sixty-two percent of these genes (247/396) presented higher expression in the group of pigs with higher content of intramuscular SFA and MUFA, while the remaining 149 showed higher expression in the group with higher content of PUFA. Pathway analysis related these genes to biological functions and canonical pathways controlling lipid and fatty acid metabolisms. In concordance with the phenotypic classification of animals, the major metabolic pathway differentially modulated between groups was de novo lipogenesis, the group with more PUFA being the one that showed lower expression of lipogenic genes. Conclusions These results will help in the identification of genetic variants at loci that affect fatty acid composition traits. The implications of these results range from the improvement of porcine meat quality traits to the application of the pig as an animal model of human metabolic diseases. PMID:24289474

  18. Periexercise coingestion of branched-chain amino acids and carbohydrate in men does not preferentially augment resistance exercise-induced increases in phosphatidylinositol 3 kinase/protein kinase B-mammalian target of rapamycin pathway markers indicative of muscle protein synthesis.

    PubMed

    Ferreira, Maria Pontes; Li, Rui; Cooke, Matthew; Kreider, Richard B; Willoughby, Darryn S

    2014-03-01

    The effects of a single bout of resistance exercise (RE) in conjunction with periexercise branched-chain amino acid (BCAA) and carbohydrate (CHO) ingestion on skeletal muscle signaling markers indicative of muscle protein synthesis were determined. It was hypothesized that CHO + BCAA would elicit a more profound effect on these signaling markers compared with CHO. Twenty-seven males were randomly assigned to CHO, CHO + BCAA, or placebo (PLC) groups. Four sets of leg presses and leg extensions were performed at 80% 1 repetition maximum. Supplements were ingested 30 minutes and immediately before and after RE. Venous blood and muscle biopsy samples were obtained immediately before supplement ingestion and 0.5, 2, and 6 hours after RE. Serum insulin and glucose and phosphorylated levels of muscle insulin receptor substrate 1 (IRS-1), protein kinase B, mammalian target of rapamycin, phosphorylated 70S6 kinase, and 4E binding protein 1 were assessed. Data were analyzed by 2-way repeated-measures analysis of variance. Significant group × time interactions were observed for glucose and insulin (P < .05) showing that CHO and CHO + BCAA were significantly greater than PLC. Significant time main effects were observed for IRS-1 (P = .001), protein kinase B (P = .031), mammalian target of rapamycin (P = .003), and phosphorylated 70S6 kinase (P = .001). Carbohydrate and CHO + BCAA supplementation significantly increased IRS-1 compared with PLC (P = .002). However, periexercise coingestion of CHO and BCAA did not augment RE-induced increases in skeletal muscle signaling markers indicative of muscle protein synthesis when compared with CHO.

  19. Taurolithocholic acid promotes intrahepatic cholangiocarcinoma cell growth via muscarinic acetylcholine receptor and EGFR/ERK1/2 signaling pathway.

    PubMed

    Amonyingcharoen, Sumet; Suriyo, Tawit; Thiantanawat, Apinya; Watcharasit, Piyajit; Satayavivad, Jutamaad

    2015-01-01

    Cholangiocarcinoma (CCA) is a malignant cancer of the biliary tract and its occurrence is associated with chronic cholestasis which causes an elevation of bile acids in the liver and bile duct. The present study aimed to investigate the role and mechanistic effect of bile acids on the CCA cell growth. Intrahepatic CCA cell lines, RMCCA-1 and HuCCA-1, were treated with bile acids and their metabolites to determine the growth promoting effect. Cell viability, cell cycle analysis, EdU incorporation assays were conducted. Intracellular signaling proteins were detected by western immunoblotting. Among eleven forms of bile acids and their metabolites, only taurolithocholic acid (TLCA) concentration dependently (1-40 µM) increased the cell viability of RMCCA-1, but not HuCCA-1 cells. The cell cycle analysis showed induction of cells in the S phase and the EdU incorporation assay revealed induction of DNA synthesis in the TLCA-treated RMCCA-1 cells. Moreover, TLCA increased the phosphorylation of EGFR, ERK 1/2 and also increased the expression of cyclin D1 in RMCCA-1 cells. Furthermore, TLCA-induced RMCCA-1 cell growth could be inhibited by atropine, a non-selective muscarinic acetylcholine receptor (mAChR) antagonist, AG 1478, a specific EGFR inhibitor, or U 0126, a specific MEK 1/2 inhibitor. These results suggest that TLCA induces CCA cell growth via mAChR and EGFR/EKR1/2 signaling pathway. Moreover, the functional presence of cholinergic system plays a certain role in TLCA-induced CCA cell growth.

  20. BDNF-mediated regulation of ethanol consumption requires the activation of the MAP kinase pathway and protein synthesis.

    PubMed

    Jeanblanc, Jerome; Logrip, Marian L; Janak, Patricia H; Ron, Dorit

    2013-02-01

    We previously found that the brain-derived neurotrophic factor (BDNF) in the dorsolateral striatum (DLS) is part of a homeostatic pathway that gates ethanol self-administration [Jeanblanc et al. (2009). J Neurosci, 29, 13494-13502)]. Specifically, we showed that moderate levels (10%) of ethanol consumption increase BDNF expression within the DLS, and that direct infusion of BDNF into the DLS decreases operant self-administration of a 10% ethanol solution. BDNF binding to its receptor, TrkB, activates the mitogen-activated protein kinase (MAPK), phospholipase C-γ (PLC-γ) and phosphatidylinositol 3-kinase (PI3K) pathways. Thus, here, we set out to identify which of these intracellular pathway(s) plays a role in the regulation of ethanol consumption by BDNF. We found that inhibition of the MAPK, but not PLC-γ or PI3K, activity blocks the BDNF-mediated reduction of ethanol consumption. As activation of the MAPK pathway leads to the initiation of transcription and/or translation events, we tested whether the BDNF-mediated reduction of ethanol self-administration requires de novo protein synthesis. We found that the inhibitory effect of BDNF on ethanol intake is blocked by the protein synthesis inhibitor cycloheximide. Together, our results show that BDNF attenuates ethanol drinking via activation of the MAPK pathway in a protein synthesis-dependent manner within the DLS.

  1. BDNF-mediated regulation of ethanol consumption requires the activation of the MAP kinase pathway and protein synthesis

    PubMed Central

    Jeanblanc, Jerome; Logrip, Marian L.; Janak, Patricia H.; Ron, Dorit

    2013-01-01

    We previously found that the brain-derived neurotrophic factor (BDNF) in the dorsolateral striatum (DLS) is part of a homeostatic pathway that gates ethanol self-administration [Jeanblanc et al. (2009). J Neurosci, 29, 13494–13502)]. Specifically, we showed that moderate levels (10%) of ethanol consumption increase BDNF expression within the DLS, and that direct infusion of BDNF into the DLS decreases operant self-administration of a 10% ethanol solution. BDNF binding to its receptor, TrkB, activates the mitogen-activated protein kinase (MAPK), phospholipase C-γ (PLC-γ) and phosphatidylinositol 3-kinase (PI3K) pathways. Thus, here, we set out to identify which of these intracellular pathway(s) plays a role in the regulation of ethanol consumption by BDNF. We found that inhibition of the MAPK, but not PLC-γ or PI3K, activity blocks the BDNF-mediated reduction of ethanol consumption. As activation of the MAPK pathway leads to the initiation of transcription and/or translation events, we tested whether the BDNF-mediated reduction of ethanol self-administration requires de novo protein synthesis. We found that the inhibitory effect of BDNF on ethanol intake is blocked by the protein synthesis inhibitor cycloheximide. Together, our results show that BDNF attenuates ethanol drinking via activation of the MAPK pathway in a protein synthesis-dependent manner within the DLS. PMID:23189980

  2. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  3. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement. PMID:21157681

  4. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed.

  5. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  6. Fluorine containing amino acids: synthesis and peptide coupling of amino acids containing the all-cis tetrafluorocyclohexyl motif.

    PubMed

    Ayoup, Mohammed Salah; Cordes, David B; Slawin, Alexandra M Z; O'Hagan, David

    2015-05-28

    A synthesis of two (S)-phenylalanine derivatives is described which have the all-cis, 2,3,5,6-tetrafluorocyclohexyl motif attached to the aromatic ring at the meta and para positions; the para substituted isomer is elaborated into illustrative dipeptides via the free amine and carboxylate respectively demonstrating its utility as a novel amino acid for peptide synthesis and offering a vehicle for incorporation of this unique and facially polarized ring system into bioactive compounds.

  7. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  8. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  9. Highly efficient procedure for the synthesis of fructone fragrance using a novel carbon based acid.

    PubMed

    Hu, Baowei; Li, Chunqing; Zhao, Sheng-Xian; Rong, Lin-Mei; Lv, Shao-Qin; Liang, Xuezheng; Qi, Chenze

    2010-08-01

    The novel carbon based acid has been synthesized via one-step hydrothermal carbonization of furaldehyde and hydroxyethylsulfonic acid. A highly efficient procedure for the synthesis of fructone has been developed using the novel carbon based acid. The results showed that the catalyst possessed high activity for the reaction, giving a yield of over 95%. The advantages of high activity, stability, reusability and low cost for a simple synthesis procedure and wide applicability to various diols and beta-keto esters make this novel carbon based acid one of the best choices for the reaction.

  10. Distribution of. delta. -aminolevulinic acid biosynthetic pathways among phototrophic and related bacteria

    SciTech Connect

    Avissar, Y.J.; Beale, S.I. ); Ormerod, J.G. )

    1989-04-01

    Two biosynthetic pathways are known for the universal tetrapyrrole precursor, {delta}-aminolevulinic acid (ALA): condensation of glycine and succinyl-CoA to form ALA with the loss of C-1 of glycine as CO{sub 2}, and conversion of the intact carbon skeleton of glutamate to ALA in a process requiring tRNA{sup Glu}, ATP, Mg{sup 2+}, NADPH, and pyridoxal phosphate. The distribution of the two ALA biosynthetic pathways among various bacterial genera was determined, using cell-free extracts obtained from representative organisms. Evidence for the operation of the glutamate pathway was obtained by the measurement of RNase-sensitive label incorporation from glutamate into ALA using 3,4-({sup 3}H)glutamate and 1-({sup 14}C)glutamate as substrate. The glycine pathway was indicated by RNase-insensitive incorporation of level from 2-({sup 14}C)glycine into ALA. The distribution of the two pathways among the bacteria tested was in general agreement with their previously phylogenetic relationships and clearly indicates that the glutamate pathway is the more ancient process, whereas the glycine pathway probably evolved much later. The glutamate pathway is the more widely utilized one among bacteria, while the glycine pathway is apparently limited to the {alpha} subgroup of purple bacteria (including Rhodobacter, Rhodospirillum, and Rhizobium). E. coli was found ALA via the glutamate pathway. The ALA-requiring hemA mutant of E. coli was determined to lack the dehydrogenase activity that utilizes glutamyl-tRNA as a substrate.

  11. The role of submarine hydrothermal systems in the synthesis of amino acids.

    PubMed

    Aubrey, A D; Cleaves, H J; Bada, Jeffrey L

    2009-04-01

    There is little consensus regarding the plausibility of organic synthesis in submarine hydrothermal systems (SHSs) and its possible relevance to the origin of life. The primary reason for the persistence of this debate is that most experimental high temperature and high-pressure organic synthesis studies have neglected important geochemical constraints with respect to source material composition. We report here the results of experiments exploring the potential for amino acid synthesis at high temperature from synthetic seawater solutions of varying composition. The synthesis of amino acids was examined as a function of temperature, heating time, starting material composition and concentration. Using very favorable reactant conditions (high concentrations of reactive, reduced species), small amounts of a limited set of amino acids are generated at moderate temperature conditions ( approximately 125-175 degrees C) over short heating times of a few days, but even these products are significantly decomposed after exposure times of approximately 1 week. The high concentration dependence observed for these synthetic reactions are demonstrated by the fact that a 10-fold drop in concentration results in orders of magnitude lower yields of amino acids. There may be other synthetic mechanisms not studied herein that merit investigation, but the results are likely to be similar. We conclude that although amino acids can be generated from simple likely environmentally available precursors under SHS conditions, the equilibrium at high temperatures characteristic of SHSs favors net amino acid degradation rather than synthesis, and that synthesis at lower temperatures may be more favorable. PMID:19034685

  12. Ulvan, a Sulfated Polysaccharide from Green Algae, Activates Plant Immunity through the Jasmonic Acid Signaling Pathway

    PubMed Central

    Jaulneau, Valérie; Lafitte, Claude; Jacquet, Christophe; Fournier, Sylvie; Salamagne, Sylvie; Briand, Xavier; Esquerré-Tugayé, Marie-Thérèse; Dumas, Bernard

    2010-01-01

    The industrial use of elicitors as alternative tools for disease control needs the identification of abundant sources of them. We report on an elicitor obtained from the green algae Ulva spp. A fraction containing most exclusively the sulfated polysaccharide known as ulvan-induced expression of a GUS gene placed under the control of a lipoxygenase gene promoter. Gene expression profiling was performed upon ulvan treatments on Medicago truncatula and compared to phytohormone effects. Ulvan induced a gene expression signature similar to that observed upon methyl jasmonate treatment (MeJA). Involvement of jasmonic acid (JA) in ulvan response was confirmed by detecting induction of protease inhibitory activity and by hormonal profiling of JA, salicylic acid (SA) and abscisic acid (ABA). Ulvan activity on the hormonal pathway was further consolidated by using Arabidopsis hormonal mutants. Altogether, our results demonstrate that green algae are a potential reservoir of ulvan elicitor which acts through the JA pathway. PMID:20445752

  13. Biosynthetic pathway for acrylic acid from glycerol in recombinant Escherichia coli.

    PubMed

    Tong, Wenhua; Xu, Ying; Xian, Mo; Niu, Wei; Guo, Jiantao; Liu, Huizhou; Zhao, Guang

    2016-06-01

    Acrylic acid is an important industrial feedstock. In this study, a de novo acrylate biosynthetic pathway from inexpensive carbon source glycerol was constructed in Escherichia coli. The acrylic acid was produced from glycerol via 3-hydroxypropionaldehyde, 3-hydroxypropionyl-CoA, and acrylyl-CoA. The acrylate production was improved by screening and site-directed mutagenesis of key enzyme enoyl-CoA hydratase and chromosomal integration of some exogenous genes. Finally, our recombinant strain produced 37.7 mg/L acrylic acid under shaking flask conditions. Although the acrylate production is low, our study shows feasibility of engineering an acrylate biosynthetic pathway from inexpensive carbon source. Furthermore, the reasons for limited acrylate production and further strain optimization that should be performed in the future were also discussed. PMID:26782744

  14. Stromal uptake and transmission of acid is a pathway for venting cancer cell-generated acid.

    PubMed

    Hulikova, Alzbeta; Black, Nicholas; Hsia, Lin-Ting; Wilding, Jennifer; Bodmer, Walter F; Swietach, Pawel

    2016-09-01

    Proliferation and invasion of cancer cells require favorable pH, yet potentially toxic quantities of acid are produced metabolically. Membrane-bound transporters extrude acid from cancer cells, but little is known about the mechanisms that handle acid once it is released into the poorly perfused extracellular space. Here, we studied acid handling by myofibroblasts (colon cancer-derived Hs675.T, intestinal InMyoFib, embryonic colon-derived CCD-112-CoN), skin fibroblasts (NHDF-Ad), and colorectal cancer (CRC) cells (HCT116, HT29) grown in monoculture or coculture. Expression of the acid-loading transporter anion exchanger 2 (AE2) (SLC4A2 product) was detected in myofibroblasts and fibroblasts, but not in CRC cells. Compared with CRC cells, Hs675.T and InMyoFib myofibroblasts had very high capacity to absorb extracellular acid. Acid uptake into CCD-112-CoN and NHDF-Ad cells was slower and comparable to levels in CRC cells, but increased alongside SLC4A2 expression under stimulation with transforming growth factor β1 (TGFβ1), a cytokine involved in cancer-stroma interplay. Myofibroblasts and fibroblasts are connected by gap junctions formed by proteins such as connexin-43, which allows the absorbed acid load to be transmitted across the stromal syncytium. To match the stimulatory effect on acid uptake, cell-to-cell coupling in NHDF-Ad and CCD-112-CoN cells was strengthened with TGFβ1. In contrast, acid transmission was absent between CRC cells, even after treatment with TGFβ1. Thus, stromal cells have the necessary molecular apparatus for assembling an acid-venting route that can improve the flow of metabolic acid through tumors. Importantly, the activities of stromal AE2 and connexin-43 do not place an energetic burden on cancer cells, allowing resources to be diverted for other activities. PMID:27543333

  15. Stromal uptake and transmission of acid is a pathway for venting cancer cell-generated acid

    PubMed Central

    Hulikova, Alzbeta; Black, Nicholas; Hsia, Lin-Ting; Wilding, Jennifer; Bodmer, Walter F.; Swietach, Pawel

    2016-01-01

    Proliferation and invasion of cancer cells require favorable pH, yet potentially toxic quantities of acid are produced metabolically. Membrane-bound transporters extrude acid from cancer cells, but little is known about the mechanisms that handle acid once it is released into the poorly perfused extracellular space. Here, we studied acid handling by myofibroblasts (colon cancer-derived Hs675.T, intestinal InMyoFib, embryonic colon-derived CCD-112-CoN), skin fibroblasts (NHDF-Ad), and colorectal cancer (CRC) cells (HCT116, HT29) grown in monoculture or coculture. Expression of the acid-loading transporter anion exchanger 2 (AE2) (SLC4A2 product) was detected in myofibroblasts and fibroblasts, but not in CRC cells. Compared with CRC cells, Hs675.T and InMyoFib myofibroblasts had very high capacity to absorb extracellular acid. Acid uptake into CCD-112-CoN and NHDF-Ad cells was slower and comparable to levels in CRC cells, but increased alongside SLC4A2 expression under stimulation with transforming growth factor β1 (TGFβ1), a cytokine involved in cancer–stroma interplay. Myofibroblasts and fibroblasts are connected by gap junctions formed by proteins such as connexin-43, which allows the absorbed acid load to be transmitted across the stromal syncytium. To match the stimulatory effect on acid uptake, cell-to-cell coupling in NHDF-Ad and CCD-112-CoN cells was strengthened with TGFβ1. In contrast, acid transmission was absent between CRC cells, even after treatment with TGFβ1. Thus, stromal cells have the necessary molecular apparatus for assembling an acid-venting route that can improve the flow of metabolic acid through tumors. Importantly, the activities of stromal AE2 and connexin-43 do not place an energetic burden on cancer cells, allowing resources to be diverted for other activities. PMID:27543333

  16. Synthesis and characterization of Fatty acid/amino Acid self-assemblies.

    PubMed

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; Fray, Miroslawa El

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as "R" (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196-239 nm and critical micelle concentration (CMC) of 0.125-0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  17. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  18. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  19. Protein Analysis of Sapienic Acid-Treated Porphyromonas gingivalis Suggests Differential Regulation of Multiple Metabolic Pathways

    PubMed Central

    Dawson, Deborah V.; Blanchette, Derek R.; Drake, David R.; Wertz, Philip W.; Brogden, Kim A.

    2015-01-01

    ABSTRACT Lipids endogenous to skin and mucosal surfaces exhibit potent antimicrobial activity against Porphyromonas gingivalis, an important colonizer of the oral cavity implicated in periodontitis. Our previous work demonstrated the antimicrobial activity of the fatty acid sapienic acid (C16:1Δ6) against P. gingivalis and found that sapienic acid treatment alters both protein and lipid composition from those in controls. In this study, we further examined whole-cell protein differences between sapienic acid-treated bacteria and untreated controls, and we utilized open-source functional association and annotation programs to explore potential mechanisms for the antimicrobial activity of sapienic acid. Our analyses indicated that sapienic acid treatment induces a unique stress response in P. gingivalis resulting in differential expression of proteins involved in a variety of metabolic pathways. This network of differentially regulated proteins was enriched in protein-protein interactions (P = 2.98 × 10−8), including six KEGG pathways (P value ranges, 2.30 × 10−5 to 0.05) and four Gene Ontology (GO) molecular functions (P value ranges, 0.02 to 0.04), with multiple suggestive enriched relationships in KEGG pathways and GO molecular functions. Upregulated metabolic pathways suggest increases in energy production, lipid metabolism, iron acquisition and processing, and respiration. Combined with a suggested preferential metabolism of serine, which is necessary for fatty acid biosynthesis, these data support our previous findings that the site of sapienic acid antimicrobial activity is likely at the bacterial membrane. IMPORTANCE P. gingivalis is an important opportunistic pathogen implicated in periodontitis. Affecting nearly 50% of the population, periodontitis is treatable, but the resulting damage is irreversible and eventually progresses to tooth loss. There is a great need for natural products that can be used to treat and/or prevent the overgrowth of

  20. Synthesis and antiplasmodial activity of betulinic acid and ursolic acid analogues.

    PubMed

    Innocente, Adrine M; Silva, Gloria N S; Cruz, Laura Nogueira; Moraes, Miriam S; Nakabashi, Myna; Sonnet, Pascal; Gosmann, Grace; Garcia, Célia R S; Gnoatto, Simone C B

    2012-10-12

    More than 40% of the World population is at risk of contracting malaria, which affects primarily poor populations in tropical and subtropical areas. Antimalarial pharmacotherapy has utilised plant-derived products such as quinine and artemisinin as well as their derivatives. However, worldwide use of these antimalarials has caused the spread of resistant parasites, resulting in increased malaria morbidity and mortality. Considering that the literature has demonstrated the antimalarial potential of triterpenes, specially betulinic acid (1) and ursolic acid (2), this study investigated the antimalarial activity against P. falciparum chloroquine-sensitive 3D7 strain of some new derivatives of 1 and 2 with modifications at C-3 and C-28. The antiplasmodial study employed flow cytometry and spectrofluorimetric analyses using YOYO-1, dihydroethidium and Fluo4/AM for staining. Among the six analogues obtained, compounds 1c and 2c showed excellent activity (IC₅₀ = 220 and 175 nM, respectively) while 1a and b demonstrated good activity (IC₅₀ = 4 and 5 μM, respectively). After cytotoxicity evaluation against HEK293T cells, 1a was not toxic, while 1c and 2c showed IC₅₀ of 4 μM and a selectivity index (SI) value of 18 and 23, respectively. Moreover, compound 2c, which presents the best antiplasmodial activity, is involved in the calcium-regulated pathway(s).

  1. The Aldo-Keto Reductase AKR1B10 Is Up-Regulated in Keloid Epidermis, Implicating Retinoic Acid Pathway Dysregulation in the Pathogenesis of Keloid Disease.

    PubMed

    Jumper, Natalie; Hodgkinson, Tom; Arscott, Guyan; Har-Shai, Yaron; Paus, Ralf; Bayat, Ardeshir

    2016-07-01

    Keloid disease is a recurrent fibroproliferative cutaneous tumor of unknown pathogenesis for which clinical management remains unsatisfactory. To obtain new insights into hitherto underappreciated aspects of keloid pathobiology, we took a laser capture microdissection-based, whole-genome microarray analysis approach to identify distinct keloid disease-associated gene expression patterns within defined keloid regions. Identification of the aldo-keto reductase enzyme AKR1B10 as highly up-regulated in keloid epidermis suggested that an imbalance of retinoic acid metabolism is likely associated with keloid disease. Here, we show that AKR1B10 transfection into normal human keratinocytes reproduced the abnormal retinoic acid pathway expression pattern we had identified in keloid epidermis. Cotransfection of AKR1B10 with a luciferase reporter plasmid showed reduced retinoic acid response element activity, supporting the hypothesis of retinoic acid synthesis deficiency in keloid epidermis. Paracrine signals released by AKR1B10-overexpressing keratinocytes into conditioned medium resulted in up-regulation of transforming growth factor-β1, transforming growth factor-β2, and collagens I and III in both keloid and normal skin fibroblasts, mimicking the typical profibrotic keloid profile. Our study results suggest that insufficient retinoic acid synthesis by keloid epidermal keratinocytes may contribute to the pathogenesis of keloid disease. We refocus attention on the role of injured epithelium in keloid disease and identify AKR1B10 as a potential new target in future management of keloid disease. PMID:27025872

  2. Synthesis of amino-acid derivatives and dipeptides with an original peptidase enzyme.

    PubMed

    Auriol, D; Paul, F; Yoshpe, I; Gripon, J C; Monsan, P

    1991-01-01

    A peptidase from the non pathogenic Staphylococcus sp. strain BEC 299 was purified to a final specific activity of 84,400 U/mg protein. Its molecular weight is 450 kDa and optimum pH 10.0. This enzyme catalyzes the synthesis of dipeptides (aspartame) and alpha-amino acid derivatives (N-L-malyl-L-tyrosine ethyl ester). The influence of cosolvents and pH on dipeptides and alpha-amino acid derivative synthesis is described. Finally, we detail the use of the peptidase as a reagent in protease-catalyzed peptide synthesis.

  3. Design, synthesis and evaluation of semi-synthetic triazole-containing caffeic acid analogues as 5-lipoxygenase inhibitors.

    PubMed

    De Lucia, Daniela; Lucio, Oscar Méndez; Musio, Biagia; Bender, Andreas; Listing, Monika; Dennhardt, Sophie; Koeberle, Andreas; Garscha, Ulrike; Rizzo, Roberta; Manfredini, Stefano; Werz, Oliver; Ley, Steven V

    2015-08-28

    In this work the synthesis, structure-activity relationship (SAR) and biological evaluation of a novel series of triazole-containing 5-lipoxygenase (5-LO) inhibitors are described. The use of structure-guided drug design techniques provided compounds that demonstrated excellent 5-LO inhibition with IC50 of 0.2 and 3.2 μm in cell-based and cell-free assays, respectively. Optimization of binding and functional potencies resulted in the identification of compound 13d, which showed an enhanced activity compared to the parent bioactive compound caffeic acid 5 and the clinically approved zileuton 3. Compounds 15 and 16 were identified as lead compounds in inhibiting 5-LO products formation in neutrophils. Their interference with other targets on the arachidonic acid pathway was also assessed. Cytotoxicity tests were performed to exclude a relationship between cytotoxicity and the increased activity observed after structure optimization.

  4. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    NASA Astrophysics Data System (ADS)

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-01

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

  5. Impact of high altitude on the hepatic fatty acid oxidation and synthesis in rats

    SciTech Connect

    Ni, Qian; Shao, Yuan; Wang, Ying Zhen; Jing, Yu Hong; Zhang, You Cheng

    2014-04-04

    Highlights: • Acute exposure to high altitude (HA) increased hepatic fatty acid (FA) β-oxidation. • Acute exposure of rats to HA increased hepatic FA synthesis. • PPARα and AMPK can regulate the FA metabolism. • FA may be a key energy fuel and a compensation for CHO during acute exposure to HA. • The acute changes of FA metabolism may be a mechanism of acclimatization. - Abstract: High altitude (HA) affects energy metabolism. The impact of acute and chronic HA acclimatization on the major metabolic pathways is still controversial. In this study, we aimed to unveil the impact of HA on the key enzymes involved in the fatty acid (FA) metabolism in liver. Rats were exposed to an altitude of 4300 m for 30 days and the expressions of two key proteins involved in FA β-oxidation (carnitine palmitoyl transferase I, CPT-I; and peroxisome proliferator-activated receptor alpha, PPARα), two proteins involved in FA synthesis (acetyl CoA carboxylase-1, ACC-1; and AMP-activated protein kinase, AMPK), as well as the total ketone body in the liver and the plasma FFAs were examined. Rats without HA exposure were used as controls. We observed that the acute exposure of rats to HA (3 days) led to a significant increase in the expressions of CPT-I and PPARα and in the total hepatic ketone body. Longer exposure (15 days) caused a marked decrease in the expression of CPT-I and PPARα. By 30 days after HA exposure, the expression levels of CPT-I and PPARα returned to the control level. The hepatic ACC-1 level showed a significant increase in rats exposed to HA for 1 and 3 days. In contrast, the hepatic level of AMPK showed a significant reduction throughout the experimental period. Plasma FFA concentrations did not show any significant changes following HA exposure. Thus, increased hepatic FA oxidation and synthesis in the early phase of HA exposure may be among the important mechanisms for the rats to respond to the hypoxic stress in order to acclimatize themselves to the

  6. Conservation of the 2-keto-3-deoxymanno-octulosonic acid (Kdo) biosynthesis pathway between plants and bacteria.

    PubMed

    Smyth, Kevin M; Marchant, Alan

    2013-10-18

    The increasing prevalence of multi-drug resistant bacteria is driving efforts in the development of new antibacterial agents. This includes a resurgence of interest in the Gram-negative bacteria lipopolysaccharide (LPS) biosynthesis enzymes as drug targets. The six carbon acidic sugar 2-keto-3-deoxymanno-octulosonic acid (Kdo) is a component of the lipid A moiety of the LPS in Gram-negative bacteria. In most cases the lipid A substituted by Kdo is the minimum requirement for cell growth, thus presenting the possibility of targeting either the synthesis or incorporation of Kdo for the development of antibacterial agents. Indeed, potent in vitro inhibitors of Kdo biosynthesis enzymes have been reported but have so far failed to show sufficient in vivo action against Gram-negative bacteria. As part of an effort to design more potent antibacterial agents targeting Kdo biosynthesis, the crystal structures of the key Kdo biosynthesis enzymes from Escherichia coli have been solved and their structure based mechanisms characterized. In eukaryotes, Kdo is found as a component of the pectic polysaccharide rhamnogalacturonan II in the plant primary cell wall. Interestingly, despite incorporating Kdo into very different macromolecules the Kdo biosynthesis and activation pathway is almost completely conserved between plants and bacteria. This raises the possibility for plant research to exploit the increasingly detailed knowledge and resources being generated by the microbiology community. Likewise, insights into Kdo biosynthesis in plants will be potentially useful in efforts to produce new antimicrobial compounds.

  7. A diet-sensitive BAF60a-mediated pathway links hepatic bile acid metabolism to cholesterol absorption and atherosclerosis

    PubMed Central

    Meng, Zhuo-Xian; Wang, Lin; Chang, Lin; Sun, Jingxia; Bao, Jiangyin; Li, Yaqiang; Chen, Y. Eugene; Lin, Jiandie D.

    2015-01-01

    Summary Dietary nutrients interact with gene networks to orchestrate adaptive responses during metabolic stress. Here we identify Baf60a as a diet-sensitive subunit of the SWI/SNF chromatin-remodeling complexes in the mouse liver that links the consumption of fat- and cholesterol-rich diet to elevated plasma cholesterol levels. Baf60a expression was elevated in the liver following feeding with a western diet. Hepatocyte-specific inactivation of Baf60a reduced bile acid production and cholesterol absorption, and attenuated diet-induced hypercholesterolemia and atherosclerosis in mice. Baf60a stimulates expression of genes involved in bile acid synthesis, modification, and transport through a CAR/Baf60a feedforward regulatory loop. Baf60a is required for the recruitment of the SWI/SNF chromatin-remodeling complexes to facilitate an activating epigenetic switch on target genes. These studies elucidate a regulatory pathway that mediates the hyperlipidemic and atherogenic effects of western diet consumption. PMID:26586440

  8. Structure and functional characterization of a bile acid 7α dehydratase BaiE in secondary bile acid synthesis.

    PubMed

    Bhowmik, Shiva; Chiu, Hsien-Po; Jones, David H; Chiu, Hsiu-Ju; Miller, Mitchell D; Xu, Qingping; Farr, Carol L; Ridlon, Jason M; Wells, James E; Elsliger, Marc-André; Wilson, Ian A; Hylemon, Phillip B; Lesley, Scott A

    2016-03-01

    Conversion of the primary bile acids cholic acid (CA) and chenodeoxycholic acid (CDCA) to the secondary bile acids deoxycholic acid (DCA) and lithocholic acid (LCA) is performed by a few species of intestinal bacteria in the genus Clostridium through a multistep biochemical pathway that removes a 7α-hydroxyl group. The rate-determining enzyme in this pathway is bile acid 7α-dehydratase (baiE). In this study, crystal structures of apo-BaiE and its putative product-bound [3-oxo-Δ(4,6) -lithocholyl-Coenzyme A (CoA)] complex are reported. BaiE is a trimer with a twisted α + β barrel fold with similarity to the Nuclear Transport Factor 2 (NTF2) superfamily. Tyr30, Asp35, and His83 form a catalytic triad that is conserved across this family. Site-directed mutagenesis of BaiE from Clostridium scindens VPI 12708 confirm that these residues are essential for catalysis and also the importance of other conserved residues, Tyr54 and Arg146, which are involved in substrate binding and affect catalytic turnover. Steady-state kinetic studies reveal that the BaiE homologs are able to turn over 3-oxo-Δ(4) -bile acid and CoA-conjugated 3-oxo-Δ(4) -bile acid substrates with comparable efficiency questioning the role of CoA-conjugation in the bile acid metabolism pathway. PMID:26650892

  9. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  10. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  11. Distinct amino acid-sensing mTOR pathways regulate skeletal myogenesis.

    PubMed

    Yoon, Mee-Sup; Chen, Jie

    2013-12-01

    Signaling through the mammalian target of rapamycin (mTOR) in response to amino acid availability controls many cellular and developmental processes. mTOR is a master regulator of myogenic differentiation, but the pathways mediating amino acid signals in this process are not known. Here we examine the Rag GTPases and the class III phosphoinositide 3-kinase (PI3K) Vps34, two mediators of amino acid signals upstream of mTOR complex 1 (mTORC1) in cell growth regulation, for their potential involvement in myogenesis. We find that, although both Rag and Vps34 mediate amino acid activation of mTORC1 in C2C12 myoblasts, they have opposing functions in myogenic differentiation. Knockdown of RagA/B enhances, whereas overexpression of active RagB/C mutants impairs, differentiation, and this inhibitory function of Rag is mediated by mTORC1 suppression of the IRS1-PI3K-Akt pathway. On the other hand, Vps34 is required for myogenic differentiation. Amino acids activate a Vps34-phospholipase D1 (PLD1) pathway that controls the production of insulin-like growth factor II, an autocrine inducer of differentiation, through the Igf2 muscle enhancer. The product of PLD, phosphatidic acid, activates the enhancer in a rapamycin-sensitive but mTOR kinase-independent manner. Our results uncover amino acid-sensing mechanisms controlling the homeostasis of myogenesis and underline the versatility and context dependence of mTOR signaling. PMID:24068326

  12. Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

    PubMed Central

    2010-01-01

    Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD) 2 and fatty acid elongase (FAE) 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general development of C. sativa should

  13. The alternative respiratory pathway mediates carboxylate synthesis in white lupin cluster roots under phosphorus deprivation.

    PubMed

    Florez-Sarasa, Igor; Lambers, Hans; Wang, Xing; Finnegan, Patrick M; Ribas-Carbo, Miquel

    2014-04-01

    Plant adaptations associated with a high efficiency of phosphorus (P) acquisition can be used to increase productivity and sustainability in a world with a growing population and decreasing rock phosphate reserves. White lupin (Lupinus albus) produces cluster roots that release carboxylates to efficiently mobilize P from P-sorbing soils. It has been hypothesized that an increase in the activity of the alternative oxidase (AOX) would allow for the mitochondrial oxidation of NAD(P)H produced during citrate synthesis in cluster roots at a developmental stage when there is a low demand for ATP. We used the oxygen-isotope fractionation technique to study the in vivo respiratory activities of the cytochrome oxidase pathway (COP) and the alternative oxidase pathway (AOP) in different root sections of white lupins grown hydroponically with and without P. In parallel, AOX protein levels and internal carboxylate concentrations were determined in cluster and non-cluster roots. Higher in vivo AOP activity was measured in cluster roots when malate and citrate concentrations were also high, thus confirming our hypothesis. AOX protein levels were not always correlated with in vivo AOP activity, suggesting post-translational regulation of AOX. PMID:24118034

  14. A defect in the p53 response pathway induced by de novo purine synthesis inhibition.

    PubMed

    Bronder, Julie L; Moran, Richard G

    2003-12-01

    p53 is believed to sense cellular ribonucleotide depletion in the absence of DNA strand breaks and to respond by imposition of a p21-dependent G1 cell cycle arrest. We now report that the p53-dependent G1 checkpoint is blocked in human carcinoma cell lines after inhibition of de novo purine synthesis by folate analogs inhibitory to glycinamide ribonucleotide formyltransferase (GART). p53 accumulated in HCT116, MCF7, or A549 carcinoma cells upon GART inhibition, but, surprisingly, transcription of several p53 targets, including p21cip1/waf1, was impaired. The mechanism of this defect was examined. The p53 accumulating in these cells was nuclear but was not phosphorylated at serines 6, 15, and 20, nor was it acetylated at lysines 373 or 382. The DDATHF-stabilized p53 bound to the p21 promoter in vitro and in vivo but did not activate histone acetylation over the p53 binding sites in the p21 promoter that is an integral part of the transcriptional response mediated by the DNA damage pathway. We concluded that the robust initial response of the p53 pathway to GART inhibitors is not transcriptionally propagated to target genes due to a defect in p53 post-translational modifications and a failure to open chromatin structure despite promoter binding of this unmodified p53. PMID:14517211

  15. Parallel evolution of Nitric Oxide signaling: Diversity of synthesis & memory pathways

    PubMed Central

    Moroz, Leonid L.; Kohn, Andrea B.

    2014-01-01

    The origin of NO signaling can be traceable back to the origin of life with the large scale of parallel evolution of NO synthases (NOSs). Inducible-like NOSs may be the most basal prototype of all NOSs and that neuronal-like NOS might have evolved several times from this prototype. Other enzymatic and non-enzymatic pathways for NO synthesis have been discovered using reduction of nitrites, an alternative source of NO. Diverse synthetic mechanisms can co-exist within the same cell providing a complex NO-oxygen microenvironment tightly coupled with cellular energetics. The dissection of multiple sources of NO formation is crucial in analysis of complex biological processes such as neuronal integration and learning mechanisms when NO can act as a volume transmitter within memory-forming circuits. In particular, the molecular analysis of learning mechanisms (most notably in insects and gastropod molluscs) opens conceptually different perspectives to understand the logic of recruiting evolutionarily conserved pathways for novel functions. Giant uniquely identified cells from Aplysia and related species precent unuque opportunities for integrative analysis of NO signaling at the single cell level. PMID:21622160

  16. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  17. The Biosynthetic Pathways of Tanshinones and Phenolic Acids in Salvia miltiorrhiza.

    PubMed

    Ma, Xiao-Hui; Ma, Ying; Tang, Jin-Fu; He, Ya-Li; Liu, Yu-Chen; Ma, Xiao-Jing; Shen, Ye; Cui, Guang-Hong; Lin, Hui-Xin; Rong, Qi-Xian; Guo, Juan; Huang, Lu-Qi

    2015-01-01

    Secondary metabolites from plants play key roles in human medicine and chemical industries. Due to limited accumulation of secondary metabolites in plants and their important roles, characterization of key enzymes involved in biosynthetic pathway will enable metabolic engineering or synthetic biology to improve or produce the compounds in plants or microorganisms, which provides an alternative for production of these valuable compounds. Salvia miltiorrhiza, containing tanshinones and phenolic acids as its active compounds, has been widely used for the treatment of cardiovascular and cerebrovascular diseases. The biosynthetic analysis of secondary metabolites in S. miltiorrhiza has made great progress due to the successful genetic transformation system, simplified hairy roots system, and high-throughput sequencing. The cloned genes in S. miltiorrhiza had provided references for functional characterization of the post-modification steps involved in biosynthesis of tanshinones and phenolic acids, and further utilization of these steps in metabolic engineering. The strategies used in these studies could provide solid foundation for elucidation of biosynthetic pathways of diterpenoids and phenolic acids in other species. The present review systematically summarizes recent advances in biosynthetic pathway analysis of tanshinones and phenolic acids as well as synthetic biology and metabolic engineering applications of the rate-limiting genes involved in the secondary metabolism in S. miltiorrhiza. PMID:26370949

  18. Occurrence of Arginine Deiminase Pathway Enzymes in Arginine Catabolism by Wine Lactic Acid Bacteria

    PubMed Central

    Liu, S.; Pritchard, G. G.; Hardman, M. J.; Pilone, G. J.

    1995-01-01

    l-Arginine, an amino acid found in significant quantities in grape juice and wine, is known to be catabolized by some wine lactic acid bacteria. The correlation between the occurrence of arginine deiminase pathway enzymes and the ability to catabolize arginine was examined in this study. The activities of the three arginine deiminase pathway enzymes, arginine deiminase, ornithine transcarbamylase, and carbamate kinase, were measured in cell extracts of 35 strains of wine lactic acid bacteria. These enzymes were present in all heterofermentative lactobacilli and most leuconostocs but were absent in all the homofermentative lactobacilli and pediococci examined. There was a good correlation among arginine degradation, formation of ammonia and citrulline, and the occurrence of arginine deiminase pathway enzymes. Urea was not detected during arginine degradation, suggesting that the catabolism of arginine did not proceed via the arginase-catalyzed reaction, as has been suggested in some earlier studies. Detection of ammonia with Nessler's reagent was shown to be a simple, rapid test to assess the ability of wine lactic acid bacteria to degrade arginine, although in media containing relatively high concentrations (>0.5%) of fructose, ammonia formation is inhibited. PMID:16534912

  19. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  20. Stimulation of the Salicylic Acid Pathway Aboveground Recruits Entomopathogenic Nematodes Belowground.

    PubMed

    Filgueiras, Camila Cramer; Willett, Denis S; Junior, Alcides Moino; Pareja, Martin; Borai, Fahiem El; Dickson, Donald W; Stelinski, Lukasz L; Duncan, Larry W

    2016-01-01

    Plant defense pathways play a critical role in mediating tritrophic interactions between plants, herbivores, and natural enemies. While the impact of plant defense pathway stimulation on natural enemies has been extensively explored aboveground, belowground ramifications of plant defense pathway stimulation are equally important in regulating subterranean pests and still require more attention. Here we investigate the effect of aboveground stimulation of the salicylic acid pathway through foliar application of the elicitor methyl salicylate on belowground recruitment of the entomopathogenic nematode, Steinernema diaprepesi. Also, we implicate a specific root-derived volatile that attracts S. diaprepesi belowground following aboveground plant stimulation by an elicitor. In four-choice olfactometer assays, citrus plants treated with foliar applications of methyl salicylate recruited S. diaprepesi in the absence of weevil feeding as compared with negative controls. Additionally, analysis of root volatile profiles of citrus plants receiving foliar application of methyl salicylate revealed production of d-limonene, which was absent in negative controls. The entomopathogenic nematode S. diaprepesi was recruited to d-limonene in two-choice olfactometer trials. These results reinforce the critical role of plant defense pathways in mediating tritrophic interactions, suggest a broad role for plant defense pathway signaling belowground, and hint at sophisticated plant responses to pest complexes. PMID:27136916

  1. Stimulation of the Salicylic Acid Pathway Aboveground Recruits Entomopathogenic Nematodes Belowground

    PubMed Central

    Filgueiras, Camila Cramer; Willett, Denis S.; Junior, Alcides Moino; Pareja, Martin; Borai, Fahiem El; Dickson, Donald W.; Stelinski, Lukasz L.; Duncan, Larry W.

    2016-01-01

    Plant defense pathways play a critical role in mediating tritrophic interactions between plants, herbivores, and natural enemies. While the impact of plant defense pathway stimulation on natural enemies has been extensively explored aboveground, belowground ramifications of plant defense pathway stimulation are equally important in regulating subterranean pests and still require more attention. Here we investigate the effect of aboveground stimulation of the salicylic acid pathway through foliar application of the elicitor methyl salicylate on belowground recruitment of the entomopathogenic nematode, Steinernema diaprepesi. Also, we implicate a specific root-derived volatile that attracts S. diaprepesi belowground following aboveground plant stimulation by an elicitor. In four-choice olfactometer assays, citrus plants treated with foliar applications of methyl salicylate recruited S. diaprepesi in the absence of weevil feeding as compared with negative controls. Additionally, analysis of root volatile profiles of citrus plants receiving foliar application of methyl salicylate revealed production of d-limonene, which was absent in negative controls. The entomopathogenic nematode S. diaprepesi was recruited to d-limonene in two-choice olfactometer trials. These results reinforce the critical role of plant defense pathways in mediating tritrophic interactions, suggest a broad role for plant defense pathway signaling belowground, and hint at sophisticated plant responses to pest complexes. PMID:27136916

  2. Chlamydia trachomatis Scavenges Host Fatty Acids for Phospholipid Synthesis via an Acyl-Acyl Carrier Protein Synthetase*

    PubMed Central

    Yao, Jiangwei; Dodson, V. Joshua; Frank, Matthew W.; Rock, Charles O.

    2015-01-01

    The obligate intracellular parasite Chlamydia trachomatis has a reduced genome but relies on de novo fatty acid and phospholipid biosynthesis to produce its membrane phospholipids. Lipidomic analyses showed that 8% of the phospholipid molecular species synthesized by C. trachomatis contained oleic acid, an abundant host fatty acid that cannot be made by the bacterium. Mass tracing experiments showed that isotopically labeled palmitic, myristic, and lauric acids added to the medium were incorporated into C. trachomatis-derived phospholipid molecular species. HeLa cells did not elongate lauric acid, but infected HeLa cell cultures elongated laurate to myristate and palmitate. The elongated fatty acids were incorporated exclusively into C. trachomatis-produced phospholipid molecular species. C. trachomatis has adjacent genes encoding the separate domains of the bifunctional acyl-acyl carrier protein (ACP) synthetase/2-acylglycerolphosphoethanolamine acyltransferase gene (aas) of Escherichia coli. The CT775 gene encodes an acyltransferase (LpaT) that selectively transfers fatty acids from acyl-ACP to the 1-position of 2-acyl-glycerophospholipids. The CT776 gene encodes an acyl-ACP synthetase (AasC) with a substrate preference for palmitic compared with oleic acid in vitro. Exogenous fatty acids were elongated and incorporated into phospholipids by Escherichia coli-expressing AasC, illustrating its function as an acyl-ACP synthetase in vivo. These data point to an AasC-dependent pathway in C. trachomatis that selectively scavenges host saturated fatty acids to be used for the de novo synthesis of its membrane constituents. PMID:26195634

  3. Chlamydia trachomatis Scavenges Host Fatty Acids for Phospholipid Synthesis via an Acyl-Acyl Carrier Protein Synthetase.

    PubMed

    Yao, Jiangwei; Dodson, V Joshua; Frank, Matthew W; Rock, Charles O

    2015-09-01

    The obligate intracellular parasite Chlamydia trachomatis has a reduced genome but relies on de novo fatty acid and phospholipid biosynthesis to produce its membrane phospholipids. Lipidomic analyses showed that 8% of the phospholipid molecular species synthesized by C. trachomatis contained oleic acid, an abundant host fatty acid that cannot be made by the bacterium. Mass tracing experiments showed that isotopically labeled palmitic, myristic, and lauric acids added to the medium were incorporated into C. trachomatis-derived phospholipid molecular species. HeLa cells did not elongate lauric acid, but infected HeLa cell cultures elongated laurate to myristate and palmitate. The elongated fatty acids were incorporated exclusively into C. trachomatis-produced phospholipid molecular species. C. trachomatis has adjacent genes encoding the separate domains of the bifunctional acyl-acyl carrier protein (ACP) synthetase/2-acylglycerolphosphoethanolamine acyltransferase gene (aas) of Escherichia coli. The CT775 gene encodes an acyltransferase (LpaT) that selectively transfers fatty acids from acyl-ACP to the 1-position of 2-acyl-glycerophospholipids. The CT776 gene encodes an acyl-ACP synthetase (AasC) with a substrate preference for palmitic compared with oleic acid in vitro. Exogenous fatty acids were elongated and incorporated into phospholipids by Escherichia coli-expressing AasC, illustrating its function as an acyl-ACP synthetase in vivo. These data point to an AasC-dependent pathway in C. trachomatis that selectively scavenges host saturated fatty acids to be used for the de novo synthesis of its membrane constituents. PMID:26195634

  4. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  5. Synthesis of Long Chain Unsaturated-alpha,omega-Dicarboxylic Acids from Renewable Materials via Olefin Metathesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The self-metathesis reaction of soy, rapeseed, tall, and linseed oil fatty acids was investigated for the synthesis of symmetrical long-chain unsaturated-alpha,omega-dicarboxylic acids. The metathesis reactions were carried out in the presence of a Grubbs catalyst under solvent-free conditions at a...

  6. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.

    PubMed

    van Ameijde, Jeroen; Liskamp, Rob M J

    2003-08-01

    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  7. Synthesis and antibacterial evaluation of anziaic acid and analogues as topoisomerase I inhibitors

    PubMed Central

    Lin, Hao; Annamalai, Thirunavukkarasu; Bansod, Priyanka; Tse-Dinh, Yuk-Ching

    2013-01-01

    Naturally occurring anziaic acid was very recently reported as a topoisomerase I inhibitor with antibacterial activity. Herein total synthesis of anziaic acid and structural analogues is described and the preliminary structure-activity relationship (SAR) has been developed based on topoisomerase inhibition and whole cell antibacterial activity. PMID:24363888

  8. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  9. Parthenolide and abscisic acid synthesis in feverfew are associated but environmental factors affect them dissimilarly.

    PubMed

    Fonseca, Jorge M; Rushing, James W; Rajapakse, Nihal C; Thomas, Ronald L; Riley, Melissa B

    2005-05-01

    The effect of harvest time, shading prior to harvest and water stress on parthenolide (PRT) concentration in feverfew and its possible connection with the abscisic acid (ABA) pathway were investigated. In plants harvested at different times of the day, acetumar the PRT levels were highest during late afternoon while ABA levels were greatest during morning hours. Shading plants during the afternoon prior to harvest caused a two-fold increase in ABA and no significant difference in PRT levels. ABA was higher in water-stressed plants while PRTcontent increased in plants following recovery from a water stress event. ABA inhibitors, norflurazon, sodium tungstate, naproxen and sodium bisulfite, were used to determine the connection between the biosynthesis of PRTand ABA. Norflurazon and naproxen reduced PRT concentration in cut flowers and in 2-month old plants. Sodium bisulfite and sodium tungstate reduced PRT only in cut flowers. Application of 2,4-D, a promoter of ABA synthesis, to potted plants resulted in a 2.5 fold increase in PRT levels. The inhibition of PRT formation in response to ABA inhibitors and the increase in PRT concentration observed with 2,4-D application indicated that PRT is derived from carotenoid synthesis similarly to ABA and not directly from farnesyl pyrosphosphate (FPP) as suggested for other sesquiterpene Lactones. However, PRT and ABA levels are affected dissimilarly by environmental conditions. The overall results of the study indicated that simple agricultural practices, such as harvesting during afternoon and subjecting plants to a single water stress event, can increase PRT concentration in the final feverfew product with no additional costs of production prior to harvest.

  10. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  11. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  12. Biochemical and Structural Characterization of a Ureidoglycine Aminotransferase in the Klebsiella pneumoniae Uric Acid Catabolic Pathway

    SciTech Connect

    French, Jarrod B.; Ealick, Steven E.

    2010-09-03

    Many plants, fungi, and bacteria catabolize allantoin as a mechanism for nitrogen assimilation. Recent reports have shown that in plants and some bacteria the product of hydrolysis of allantoin by allantoinase is the unstable intermediate ureidoglycine. While this molecule can spontaneously decay, genetic analysis of some bacterial genomes indicates that an aminotransferase may be present in the pathway. Here we present evidence that Klebsiella pneumoniae HpxJ is an aminotransferase that preferentially converts ureidoglycine and an {alpha}-keto acid into oxalurate and the corresponding amino acid. We determined the crystal structure of HpxJ, allowing us to present an explanation for substrate specificity.

  13. The regulation of triglyceride synthesis and fatty acid synthesis in rat epididymal adipose tissue. Effects of insulin, adrenaline and some metabolites in vitro

    PubMed Central

    Saggerson, E. D.; Greenbaum, A. L.

    1970-01-01

    satisfactory correlations could be drawn between the whole-tissue concentrations of long-chain fatty acyl-CoA, citrate and glycerol 1-phosphate and the observed rates of triglyceride and fatty acid synthesis. Under the conditions employed, the concentration of glycerol 1-phosphate appeared to depend mainly on the cytoplasmic [NAD+]/[NADH] ratios. 9. Calculated hexose monophosphate pathway flux rates roughly correlated with fatty acid synthesis rates and with whole tissue [6-phosphogluconate]/[glucose 6-phosphate] ratios. The relative rates of production of NADPH for fatty acid synthesis by the hexose monophosphate pathway and by the `malic enzyme' are discussed. It is suggested that all NADH produced in the cytoplasm may be used in that compartment for reductive synthesis of fatty acids, lactate or glycerol 1-phosphate. PMID:4395181

  14. Retroconversion of docosapentaenoic acid (n-6): an alternative pathway for biosynthesis of arachidonic acid in Daphnia magna.

    PubMed

    Strandberg, Ursula; Taipale, Sami J; Kainz, Martin J; Brett, Michael T

    2014-06-01

    The aim of this study was to assess metabolic pathways for arachidonic acid (20:4n-6) biosynthesis in Daphnia magna. Neonates of D. magna were maintained on [(13)C] enriched Scenedesmus obliquus and supplemented with liposomes that contained separate treatments of unlabeled docosapentaenoic acid (22:5n-6), 20:4n-6, linoleic acid (18:2n-6) or oleic acid (18:1n-9). Daphnia in the control treatment, without any supplementary fatty acids (FA) containing only trace amounts of 20:4n-6 (~0.3% of all FA). As expected, the highest proportion of 20:4n-6 (~6.3%) was detected in Daphnia that received liposomes supplemented with this FA. Higher availability of 18:2n-6 in the diet increased the proportion of 18:2n-6 in Daphnia, but the proportion of 20:4n-6 was not affected. Daphnia supplemented with 22:5n-6 contained ~3.5% 20:4n-6 in the lipids and FA specific stable isotope analyses validated that the increase in the proportion of 20:4n-6 was due to retroconversion of unlabeled 22:5n-6. These results suggest that chain shortening of 22:5n-6 is a more efficient pathway to synthesize 20:4n-6 in D. magna than elongation and desaturation of 18:2n-6. These results may at least partially explain the discrepancies noticed between phytoplankton FA composition and the expected FA composition in freshwater cladocerans. Finally, retroconversion of dietary 22:5n-6 to 20:4n-6 indicates Daphnia efficiently retain long chain n-6 FA in lake food webs, which might be important for the nutritional ecology of fish.

  15. Enhanced fatty acid accumulation in Isochrysis galbana by inhibition of the mitochondrial alternative oxidase pathway under nitrogen deprivation.

    PubMed

    Zhang, Litao; Liu, Jianguo

    2016-07-01

    The purpose of this study was to clarify the interrelation between the mitochondrial alternative oxidase (AOX) pathway and fatty acid accumulation in marine microalga Isochrysis galbana. Under normal conditions, the activity of the AOX pathway was maintained at a low level in I. galbana. Compared with the normal condition, nitrogen deprivation significantly increased the AOX pathway activity and fatty acid accumulation. Under nitrogen deprivation, the inhibition of the AOX pathway by salicylhydroxamic acid caused the accumulation of reducing equivalents and the over-reduction of chloroplasts in I. galbana cells, leading to a decrease in the photosynthetic O2 evolution rate. The over-production of reducing equivalents due to the inhibition of the AOX pathway under nitrogen deprivation further enhanced the accumulation of fatty acids in I. galbana cells.

  16. Characterization of the Complete Uric Acid Degradation Pathway in the Fungal Pathogen Cryptococcus neoformans

    PubMed Central

    Lee, I. Russel; Yang, Liting; Sebetso, Gaseene; Allen, Rebecca; Doan, Thi H. N.; Blundell, Ross; Lui, Edmund Y. L.; Morrow, Carl A.; Fraser, James A.

    2013-01-01

    Degradation of purines to uric acid is generally conserved among organisms, however, the end product of uric acid degradation varies from species to species depending on the presence of active catabolic enzymes. In humans, most higher primates and birds, the urate oxidase gene is non-functional and hence uric acid is not further broken down. Uric acid in human blood plasma serves as an antioxidant and an immune enhancer; conversely, excessive amounts cause the common affliction gout. In contrast, uric acid is completely degraded to ammonia in most fungi. Currently, relatively little is known about uric acid catabolism in the fungal pathogen Cryptococcus neoformans even though this yeast is commonly isolated from uric acid-rich pigeon guano. In addition, uric acid utilization enhances the production of the cryptococcal virulence factors capsule and urease, and may potentially modulate the host immune response during infection. Based on these important observations, we employed both Agrobacterium-mediated insertional mutagenesis and bioinformatics to predict all the uric acid catabolic enzyme-encoding genes in the H99 genome. The candidate C. neoformans uric acid catabolic genes identified were named: URO1 (urate oxidase), URO2 (HIU hydrolase), URO3 (OHCU decarboxylase), DAL1 (allantoinase), DAL2,3,3 (allantoicase-ureidoglycolate hydrolase fusion protein), and URE1 (urease). All six ORFs were then deleted via homologous recombination; assaying of the deletion mutants' ability to assimilate uric acid and its pathway intermediates as the sole nitrogen source validated their enzymatic functions. While Uro1, Uro2, Uro3, Dal1 and Dal2,3,3 were demonstrated to be dispensable for virulence, the significance of using a modified animal model system of cryptococcosis for improved mimicking of human pathogenicity is discussed. PMID:23667704

  17. Identification of a critical determinant that enables efficient fatty acid synthesis in oleaginous fungi.

    PubMed

    Chen, Haiqin; Hao, Guangfei; Wang, Lei; Wang, Hongchao; Gu, Zhennan; Liu, Liming; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2015-06-10

    Microorganisms are valuable resources for lipid production. What makes one microbe but not the other able to efficiently synthesize and accumulate lipids is poorly understood. In the present study, global gene expression prior to and after the onset of lipogenesis was determined by transcriptomics using the oleaginous fungus Mortierella alpina as a model system. A core of 23 lipogenesis associated genes was identified and their expression patterns shared a high similarity among oleaginous microbes Chlamydomonas reinhardtii, Mucor circinelloides and Rhizopus oryzae but was dissimilar to the non-oleaginous Aspergillus nidulans. Unexpectedly, Glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) in the pentose phosphate pathway (PPP) were found to be the NADPH producers responding to lipogenesis in the oleaginous microbes. Their role in lipogenesis was confirmed by a knockdown experiment. Our results demonstrate, for the first time, that the PPP plays a significant role during fungal lipogenesis. Up-regulation of NADPH production by the PPP, especially G6PD, may be one of the critical determinants that enables efficiently fatty acid synthesis in oleaginous microbes.

  18. Identification of a critical determinant that enables efficient fatty acid synthesis in oleaginous fungi

    PubMed Central

    Chen, Haiqin; Hao, Guangfei; Wang, Lei; Wang, Hongchao; Gu, Zhennan; Liu, Liming; Zhang, Hao; Chen, Wei; Chen, Yong Q.

    2015-01-01

    Microorganisms are valuable resources for lipid production. What makes one microbe but not the other able to efficiently synthesize and accumulate lipids is poorly understood. In the present study, global gene expression prior to and after the onset of lipogenesis was determined by transcriptomics using the oleaginous fungus Mortierella alpina as a model system. A core of 23 lipogenesis associated genes was identified and their expression patterns shared a high similarity among oleaginous microbes Chlamydomonas reinhardtii, Mucor circinelloides and Rhizopus oryzae but was dissimilar to the non-oleaginous Aspergillus nidulans. Unexpectedly, Glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) in the pentose phosphate pathway (PPP) were found to be the NADPH producers responding to lipogenesis in the oleaginous microbes. Their role in lipogenesis was confirmed by a knockdown experiment. Our results demonstrate, for the first time, that the PPP plays a significant role during fungal lipogenesis. Up-regulation of NADPH production by the PPP, especially G6PD, may be one of the critical determinants that enables efficiently fatty acid synthesis in oleaginous microbes. PMID:26059272

  19. Proteome alteration of U251 human astrocytoma cell after inhibiting retinoic acid synthesis.

    PubMed

    Zhang, Ming; Wan, Chunling; Ji, Baohu; Zhang, Zhao; Zhu, Hui; Tian, Nan; La, Yujuan; Huang, Ke; Jiang, Lei; He, Guang; Gao, Linhan; Zhao, Xinzhi; Shi, Yongyong; Huang, Gang; Feng, Guoyin; He, Lin

    2009-03-01

    Retinoic acid (Ra) is crucial for the patterning and neuronal differentiation in the central nervous system (CNS). Ra deficiency in animals disrupts the motor activities and memory abilities. The molecular mechanisms underlying these behavior abnormalities remain largely unknown. In the current study, we treated the astrocytoma cells with citral, an inhibitor of Ra synthesis. We analyzed the differences in the protein concentrations between the treated and untreated astrocytoma cells by two-dimensional gel electrophoresis (2-DE), Imagemaster software, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). In total, 39 of 46 altered protein spots with significant mascot scores were identified representing 36 proteins, that were involved in significantly altered glutamate metabolism, lipid metabolism, mitochondrial function, and oxidative stress response by Ingenuity Pathway Analysis (IPA). Altered 3-phosphoglycerate dehydrogenase (PHGDH) was also observed in western blot. These data provide some clues for explaining the behavioral changes caused by Ra deficiency, and support the hypothesis that Ra signaling is associated with some symptoms of neurodegenerative disorders and schizophrenia. PMID:19089318

  20. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  1. RNAi-based biosynthetic pathway screens to identify in vivo functions of non-nucleic acid-based metabolites such as lipids.

    PubMed

    Zhang, Hongjie; Abraham, Nessy; Khan, Liakot A; Gobel, Verena

    2015-05-01

    The field of metabolomics continues to catalog new compounds, but their functional analysis remains technically challenging, and roles beyond metabolism are largely unknown. Unbiased genetic/RNAi screens are powerful tools to identify the in vivo functions of protein-encoding genes, but not of nonproteinaceous compounds such as lipids. They can, however, identify the biosynthetic enzymes of these compounds-findings that are usually dismissed, as these typically synthesize multiple products. Here, we provide a method using follow-on biosynthetic pathway screens to identify the endpoint biosynthetic enzyme and thus the compound through which they act. The approach is based on the principle that all subsequently identified downstream biosynthetic enzymes contribute to the synthesis of at least this one end product. We describe how to systematically target lipid biosynthetic pathways; optimize targeting conditions; take advantage of pathway branchpoints; and validate results by genetic assays and biochemical analyses. This approach extends the power of unbiased genetic/RNAi screens to identify in vivo functions of non-nucleic acid-based metabolites beyond their metabolic roles. It will typically require several months to identify a metabolic end product by biosynthetic pathway screens, but this time will vary widely depending, among other factors, on the end product's location in the pathway, which determines the number of screens required for its identification.

  2. Phospholipase D Signaling Pathways and Phosphatidic Acid as Therapeutic Targets in Cancer

    PubMed Central

    Bruntz, Ronald C.; Lindsley, Craig W.

    2014-01-01

    Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein–coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions. PMID:25244928

  3. Leucine-enriched essential amino acids attenuate muscle soreness and improve muscle protein synthesis after eccentric contractions in rats.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Mimura, Masako; Inoue, Yoshiko; Sugita, Mayu; Suzuki, Katsuya; Kobayashi, Hisamine

    2015-06-01

    Eccentric exercise results in prolonged muscle weakness and muscle soreness, which are typical symptoms of muscle damage. Recovery from muscle damage is related to mammalian target of rapamycin (mTOR) activity. Leucine-enriched essential amino acids (LEAAs) stimulate muscle protein synthesis via activation of the mTOR pathway. Therefore, we investigated the effect of LEAAs on muscle protein synthesis and muscle soreness after eccentric contractions (EC). Male Sprague-Dawley rats (9-11 weeks old) were administered an LEAA solution (AminoL40; containing 40 % leucine and 60 % other essential amino acids) at 1 g/kg body weight or distilled water (control) 30 min before and 10 min after EC. Tibialis anterior (TA) muscle was exposed to 500 EC by electrical stimulation under anesthesia. The fractional synthesis rate (FSR; %/h) in the TA muscle was measured by incorporating L-[ring-(2)H5] phenylalanine into skeletal muscle protein. Muscle soreness was evaluated by the paw withdrawal threshold using the Randal-Selitto test with some modifications from 1 to 3 days after EC. The FSR in the EC-control group (0.147 ± 0.016 %/h) was significantly lower than in the sedentary group (0.188 ± 0.016 %/h, p < 0.05). AminoL40 administration significantly mitigated the EC-induced impairment of the FSR (0.172 ± 0.018 %/h). EC decreased the paw withdrawal threshold at 1 and 2 days after EC, which indicated that EC induced muscle soreness. Furthermore, AminoL40 administration alleviated the decreased paw withdrawal threshold. These findings suggest that LEAA supplementation improves the rate of muscle protein synthesis and ameliorates muscle soreness after eccentric exercise. PMID:25772815

  4. Quantifying hepatic glycogen synthesis by direct and indirect pathways in rats under normal ad libitum feeding conditions.

    PubMed

    Soares, Ana F; Viega, Francisco J; Carvalho, Rui A; Jones, John G

    2009-01-01

    Hepatic glycogen synthesis from intact hexose (direct pathway) relative to that from gluconeogenic precursors (indirect pathway) was quantified in ad libitum-fed rats. Following (2)H(2)O administration and overnight feeding, the livers were removed and glycogen (2)H-enrichment was measured by (2)H NMR. Six controls and six rats rendered hyperglycemic by streptozotocin (STZ; fasting blood glucose = 385 +/- 31 mg/dl) were studied. The indirect pathway contribution, estimated as glycogen hydrogen 5 relative to hydrogen 2 enrichment, was 54% +/- 4% for control rats-similar to values from healthy, meal-fed humans. In STZ-treated rats, the indirect pathway contribution was significantly higher (68% +/- 4%, P < 0.05 vs. controls), similar to that of Type 1 diabetic (T1D) patients. In conclusion, sources of hepatic glycogen synthesis in rats during ad libitum nocturnal feeding were quantified by analysis of glycogen enrichment from (2)H(2)O. STZ caused alterations resembling the pathophysiology of hepatic glycogen synthesis in T1D patients.

  5. Prebiotic Synthesis of Amino Acids from Formaldehyde and Hydroxylamine in a Modified Sea Medium

    NASA Astrophysics Data System (ADS)

    Sakurai, Michiharu; Yanagawa, Hiroshi

    1984-12-01

    In the course of a study of a possible mechanism for chemical evolution in the primeval sea, we have found a novel reaction for peptide formation from glycine and urea in an aqueous solution. Glycine reacted with urea to give N-carbamylglycine, N-carbamylglycylglycine and glycylglycine. This reaction provides a new pathway for the prebiotic synthesis of peptides.

  6. De novo synthesis of amino acids by the ruminal anaerobic fungi, Piromyces communis and Neocallimastix frontalis.

    PubMed

    Atasoglu, Cengiz; Wallace, R John

    2002-07-01

    Anaerobic fungi are an important component of the cellulolytic ruminal microflora. Ammonia alone as N source supports growth, but amino acid mixtures are stimulatory. In order to evaluate the extent of de novo synthesis of individual amino acids in Piromyces communis and Neocallimastix frontalis, isotope enrichment in amino acids was determined during growth on (15)NH(4)Cl in different media. Most cell N (0.78 and 0.63 for P. communis and N. frontalis, respectively) and amino acid N (0.73 and 0.59) continued to be formed de novo from ammonia when 1 g l(-1) trypticase was added to the medium; this concentration approximates the peak concentration of peptides in the rumen after feeding. Higher peptide/amino acid concentrations decreased de novo synthesis. Lysine was exceptional, in that its synthesis decreased much more than other amino acids when Trypticase or amino acids were added to the medium, suggesting that lysine synthesis might limit fungal growth in the rumen.

  7. Synthesis and optical resolution of an allenoic acid by diastereomeric salt formation induced by chiral alkaloids.

    PubMed

    Nyhlén, Jonas; Eriksson, Lars; Bäckvall, Jan-E

    2008-01-01

    A synthetic procedure for the preparation of 4-cyclohexyl-2-methyl-buta-2,3-dienoic acid in the two optically active forms has been developed. Synthesis of the racemic allenoic acid was made by an efficient route with good overall yield. Resolution of the enantiomers was achieved by forming the cinchonidine and cinchonine diastereomeric salt, respectively, and the enantiomers were isolated in up to 95% enantiomeric excess. The absolute configuration of the allenoic acid was determined by X-ray crystallography.

  8. Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

    PubMed

    Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

    2016-09-01

    α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

  9. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  10. A Heteromeric Membrane-Bound Prenyltransferase Complex from Hop Catalyzes Three Sequential Aromatic Prenylations in the Bitter Acid Pathway1[OPEN

    PubMed Central

    Li, Haoxun; Ban, Zhaonan; Qin, Hao; Ma, Liya; King, Andrew J.

    2015-01-01

    Bitter acids (α and β types) account for more than 30% of the fresh weight of hop (Humulus lupulus) glandular trichomes and are well known for their contribution to the bitter taste of beer. These multiprenylated chemicals also show diverse biological activities, some of which have potential benefits to human health. The bitter acid biosynthetic pathway has been investigated extensively, and the genes for the early steps of bitter acid synthesis have been cloned and functionally characterized. However, little is known about the enzyme(s) that catalyze three sequential prenylation steps in the β-bitter acid pathway. Here, we employed a yeast (Saccharomyces cerevisiae) system for the functional identification of aromatic prenyltransferase (PT) genes. Two PT genes (HlPT1L and HlPT2) obtained from a hop trichome-specific complementary DNA library were functionally characterized using this yeast system. Coexpression of codon-optimized PT1L and PT2 in yeast, together with upstream genes, led to the production of bitter acids, but no bitter acids were detected when either of the PT genes was expressed by itself. Stepwise mutation of the aspartate-rich motifs in PT1L and PT2 further revealed the prenylation sequence of these two enzymes in β-bitter acid biosynthesis: PT1L catalyzed only the first prenylation step, and PT2 catalyzed the two subsequent prenylation steps. A metabolon formed through interactions between PT1L and PT2 was demonstrated using a yeast two-hybrid system, reciprocal coimmunoprecipitation, and in vitro biochemical assays. These results provide direct evidence of the involvement of a functional metabolon of membrane-bound prenyltransferases in bitter acid biosynthesis in hop. PMID:25564559

  11. L-Tryptophan catabolism by Rubrivivax benzoatilyticus JA2 occurs through indole 3-pyruvic acid pathway.

    PubMed

    Kumavath, Ranjith N; Ramana, Ch V; Sasikala, Ch

    2010-09-01

    Rubrivivax benzoatilyticus JA2 utilizes L: -tryptophan as the sole source of nitrogen for growth, and it has a doubling time of approximately 11 h (compared to 8 h with ammonium chloride). With cell free extracts in the presence of 2-oxoglutarate, indole-3-pyruvic acid, indole-3-acetaldehyde, indole-3-acetic acid, isatin, benzaldehyde, gallic acid and pyrogallol were identified using high performance liquid chromatography (HPLC) and liquid chromatography-mass spectroscopy (LC-MS) analysis. The conversion of L: -tryptophan into indole 3-pyruvic acid and glutamate by an enzyme aminotransferase was confirmed and the catabolism of indole-3-pyruvic acid via side chain oxidation followed by ring oxidation, gallic acid and pyrogallol were confirmed as metabolites. In addition, the proposed pathway sequential conversion of indole-3-pyruvic acid to the end product of pyrogallol was identified, including an enzymatic step that would convert isatin to benzaldehyde by an enzyme yet to be identified. At this stage of the study, the enzyme tryptophan aminotransferase in R. benzoatilyticus JA2 was demonstrated.

  12. Docosahexaenoic Acid Modulates Invasion and Metastasis of Human Ovarian Cancer via Multiple Molecular Pathways

    PubMed Central

    Wang, Ying-Chun; Wu, Yi-Nan; Wang, Su-Li; Lin, Qing-Hua; He, Ming-Fang; Liu, Qiao-lin; Wang, Jin-Hua

    2016-01-01

    Objective We investigated the effect of docosahexaenoic acid (DHA) on the invasion and metastasis of ovarian cancer cells (A2780, HO8910, and SKOV-3). Methods Cytotoxicity assay was performed to determine the optimal doses of DHA in this experiment. The effects of DHA on invasion ability were assessed by invasion assay. The expressions of messenger RNA and/or proteins associated with invasion or metastasis were detected by quantitative Real Time-Polymerase Chain Reaction or Western blot. The effect of DHA on cell metastasis was assessed in xenograft model of zebrafish. Results Docosahexaenoic acid and α-linolenic acid could reduce the cell vitalities in dose-dependent manner. However, DHA inhibited the invasion and metastasis of ovarian cancer cells, but α-linolenic acid did not (**P < 0.01). Docosahexaenoic acid could downregulate the expressions of WAVE3, vascular endothelial cell growth factor, and MMP-9, and upregulate KISS-1, TIMP-1, and PPAR-γ, which negatively correlated with cell invasion and metastasis (*P < 0.05). Docosahexaenoic acid restrained the development of subintestinal vessels and cancer cell metastasis in xenograft model of zebrafish (**P < 0.01). Conclusions Docosahexaenoic acid inhibited the invasion and metastasis of ovarian cancer cells in vitro and in vivo through the modulation of NF-κB signaling pathway, suggesting that DHA is a promising candidate for ovarian cancer therapy. PMID:27258728

  13. c9,t11-Conjugated linoleic acid ameliorates steatosis by modulating mitochondrial uncoupling and Nrf2 pathway[S

    PubMed Central

    Mollica, Maria Pina; Trinchese, Giovanna; Cavaliere, Gina; De Filippo, Chiara; Cocca, Ennio; Gaita, Marcello; Della-Gatta, Antonio; Marano, Angela; Mazzarella, Giuseppe; Bergamo, Paolo

    2014-01-01

    Oxidative stress, hepatic steatosis, and mitochondrial dysfunction are key pathophysiological features of nonalcoholic fatty liver disease. A conjugated linoleic acid (CLA) mixture of cis9,trans11 (9,11-CLA) and trans10,cis12 (10,12-CLA) isomers enhanced the antioxidant/detoxifying mechanism via the activation of nuclear factor E2-related factor-2 (Nrf2) and improved mitochondrial function, but less is known about the actions of specific isomers. The differential ability of individual CLA isomers to modulate these pathways was explored in Wistar rats fed for 4 weeks with a lard-based high-fat diet (L) or with control diet (CD), and, within each dietary treatment, two subgroups were daily administered with 9,11-CLA or 10,12-CLA (30 mg/day). The 9,11-CLA, but not 10,12-CLA, supplementation to CD rats improves the GSH/GSSG ratio in the liver, mitochondrial functions, and Nrf2 activity. Histological examination reveals a reduction of steatosis in L-fed rats supplemented with both CLA isomers, but 9,11-CLA downregulated plasma concentrations of proinflammatory markers, mitochondrial dysfunction, and oxidative stress markers in liver more efficiently than in 10,12-CLA treatment. The present study demonstrates the higher protective effect of 9,11-CLA against diet-induced pro-oxidant and proinflammatory signs and suggests that these effects are determined, at least in part, by its ability to activate the Nrf2 pathway and to improve the mitochondrial functioning and biogenesis. PMID:24634500

  14. The sources of carbon and reducing power for fatty acid synthesis in the heterotrophic plastids of developing sunflower (Helianthus annuus L.) embryos.

    PubMed

    Pleite, Rafael; Pike, Marilyn J; Garcés, Rafael; Martínez-Force, Enrique; Rawsthorne, Stephen

    2005-05-01

    The provision of carbon substrates and reducing power for fatty acid synthesis in the heterotrophic plastids of developing embryos of sunflower (Helianthus annuus L.) has been investigated. Profiles of oil and storage protein accumulation were determined and embryos at 17 and 24 days after anthesis (DAA) were selected to represent early and late periods of oil accumulation. Plastids isolated from either 17 or 24 DAA embryos did not incorporate label from [1-(14)C]glucose 6-phosphate (Glc6P) into fatty acids. Malate, when supplied alone, supported the highest rates of fatty acid synthesis by the isolated plastids at both stages. Pyruvate supported rates of fatty acid synthesis at 17 DAA that were comparable to those supported by malate, but only when incubations also included Glc6P. The stimulatory effect of Glc6P on pyruvate utilization at 17 DAA was related to the rapid utilization of Glc6P through the oxidative pentose phosphate pathway (OPPP) at this stage. Addition of pyruvate to incubations containing [1-(14)C]Glc6P increased OPPP activity (measured as (14)CO(2) release), while the addition of malate suppressed it. Observations of the interactions between the rate of metabolite utilization for fatty acid synthesis and the rate of the OPPP are consistent with regulation of the OPPP by redox control of the plastidial glucose 6-phosphate dehydrogenase activity through the demand for NADPH. During pyruvate utilization for fatty acid synthesis, flux through the OPPP increases as NADPH is consumed, whereas during malate utilization, in which NADPH is produced by NADP-malic enzyme, flux through the OPPP is decreased.

  15. Direct microwave-assisted amino acid synthesis by reaction of succinic acid and ammonia in the presence of magnetite

    NASA Astrophysics Data System (ADS)

    Jiang, Nan; Liu, Dandan; Shi, Weiguang; Hua, Yingjie; Wang, Chongtai; Liu, Xiaoyang

    2013-10-01

    Since the discovery of submarine hot vents in the late 1970s, it has been postulated that submarine hydrothermal environments would be suitable for emergence of life on Earth. To simulate warm spring conditions, we designed a series of microwave-assisted amino acid synthesis involving direct reactions between succinic acid and ammonia in the presence of the magnetite catalyst. These reactions which generated aspartic acid and glycine were carried out under mild temperatures and pressures (90-180 °C, 4-19 bar). We studied this specific reaction inasmuch as succinic acid and ammonia were traditionally identified as prebiotic compounds in primitive deep-sea hydrothermal systems on Earth. The experimental results were discussed in both biochemical and geochemical context to offer a possible route for abiotic amino acid synthesis. With extremely diluted starting materials (0.002 M carboxylic acid and 0.002 M ammonia) and catalyst loading, an obvious temperature dependency was observed in both cases [neither product was detected at 90 °C in comparison with 21.08 μmol L-1 (aspartic acid) and 70.25 umol L-1 (glycine) in 180 °C]. However, an opposite trend presented for reaction time factor, namely a positive correlation for glycine, but a negative one for aspartic acid.

  16. Ketoconazole blocks bile acid synthesis in hepatocyte monolayer cultures and in vivo in rat by inhibiting cholesterol 7 alpha-hydroxylase.

    PubMed Central

    Princen, H M; Huijsmans, C M; Kuipers, F; Vonk, R J; Kempen, H J

    1986-01-01

    In cultured hepatocytes conversion of [4-14C]cholesterol into bile acids was dose dependently reduced by the antimycotic drug ketoconazole, giving half-maximal inhibition at 10 microM ketoconazole in rat hepatocytes and at 1 microM in human hepatocytes. No change was observed in the ratio of produced cholic, beta-muricholic, and chenodeoxycholic acid with increasing amounts of the drug. Conversion of [4-14C]7 alpha-hydroxycholesterol, an intermediate of bile acid pathway, to bile acids was not affected by ketoconazole. These results together with kinetic studies with rat liver microsomes, demonstrating noncompetitive inhibition (Ki = 0.4 microM), indicate that cholesterol 7 alpha-hydroxylase is the main site of inhibition. In bile-diverted rats a single dose of ketoconazole (50 mg/kg) dramatically impaired bile flow and biliary bile acid output (92% inhibition). A similar blockade was observed using [4-14C]cholesterol as precursor for bile acid synthesis. Therefore, treatment of patients with this drug may inhibit bile acid synthesis, resulting in a reduction of the bile acid pool size after long-term ketoconazole therapy. PMID:3760182

  17. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.

    2008-01-01

    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  18. Enzymes involved in a novel anaerobic cyclohexane carboxylic acid degradation pathway.

    PubMed

    Kung, Johannes W; Meier, Anne-Katrin; Mergelsberg, Mario; Boll, Matthias

    2014-10-01

    The anaerobic degradation of cyclohexane carboxylic acid (CHC) has so far been studied only in Rhodopseudomonas palustris, in which CHC is activated to cyclohexanoyl coenzyme A (cyclohexanoyl-CoA [CHCoA]) and then dehydrogenated to cyclohex-1-ene-1-carboxyl-CoA (CHeneCoA). This intermediate is further degraded by reactions of the R. palustris-specific benzoyl-CoA degradation pathway of aromatic compounds. However, CHeneCoA is not an intermediate in the degradation of aromatic compounds in all other known anaerobic bacteria; consequently, degradation of CHC was mostly unknown in anaerobic bacteria. We identified a previously unknown CHC degradation pathway in the Fe(III)-reducing Geobacter metallireducens by determining the following CHC-induced in vitro activities: (i) the activation of CHC to CHCoA by a succinyl-CoA:CHC CoA transferase, (ii) the 1,2-dehydrogenation of CHCoA to CHeneCoA by CHCoA dehydrogenase, and (iii) the unusual 1,4-dehydrogenation of CHeneCoA to cyclohex-1,5-diene-1-carboxyl-CoA. This last represents a previously unknown joint intermediate of the CHC and aromatic compound degradation pathway in bacteria other than R. palustris. The enzymes catalyzing the three reactions were purified and characterized as specific enzymes after heterologous expression of the encoding genes. Quantitative reverse transcription-PCR revealed that expression of these genes was highly induced during growth with CHC but not with benzoate. The newly identified CHC degradation pathway is suggested to be present in nearly all CHC-degrading anaerobic bacteria, including denitrifying, Fe(III)-reducing, sulfate-reducing, and fermenting bacteria. Remarkably, all three CHC degradation pathways always link CHC catabolism to the catabolic pathways of aromatic compounds. We propose that the capacity to use CHC as a carbon source evolved from already-existing aromatic compound degradation pathways. PMID:25112478

  19. Heterologous expression of the mevalonic acid pathway in cyanobacteria enhances endogenous carbon partitioning to isoprene.

    PubMed

    Bentley, Fiona K; Zurbriggen, Andreas; Melis, Anastasios

    2014-01-01

    Heterologous expression of the isoprene synthase gene in the cyanobacterium Synechocystis PCC 6803 conferred upon these microorganisms the property of photosynthetic isoprene (C₅H₈) hydrocarbons production. Continuous production of isoprene from CO₂ and H₂O was achieved in the light, occurring via the endogenous methylerythritol-phosphate (MEP) pathway, in tandem with the growth of Synechocystis. This work addressed the issue of photosynthetic carbon partitioning between isoprene and biomass in Synechocystis. Evidence is presented to show heterologous genomic integration and cellular expression of the mevalonic acid (MVA) pathway genes in Synechocystis endowing a non-native pathway for carbon flux amplification to isopentenyl-diphosphate (IPP) and dimethylallyl-diphosphate (DMAPP) precursors of isoprene. Heterologous expression of the isoprene synthase in combination with the MVA pathway enzymes resulted in photosynthetic isoprene yield improvement by approximately 2.5-fold, compared with that measured in cyanobacteria transformed with the isoprene synthase gene only. These results suggest that the MVA pathway introduces a bypass in the flux of endogenous cellular substrate in Synechocystis to IPP and DMAPP, overcoming flux limitations of the native MEP pathway. The work employed a novel chromosomal integration and expression of synthetic gene operons in Synechocystis, comprising up to four genes under the control of a single promoter, and expressing three operons simultaneously. This is the first time an entire biosynthetic pathway with seven recombinant enzymes has been heterologously expressed in a photosynthetic microorganism. It constitutes contribution to the genetic engineering toolkit of photosynthetic microorganisms and a paradigm in the pursuit of photosynthetic approaches for the renewable generation of high-impact products.

  20. Cinnabarinic acid, an endogenous metabolite of the kynurenine pathway, activates type 4 metabotropic glutamate receptors.

    PubMed

    Fazio, F; Lionetto, L; Molinaro, G; Bertrand, H O; Acher, F; Ngomba, R T; Notartomaso, S; Curini, M; Rosati, O; Scarselli, P; Di Marco, R; Battaglia, G; Bruno, V; Simmaco, M; Pin, J P; Nicoletti, F; Goudet, C

    2012-05-01

    Cinnabarinic acid is an endogenous metabolite of the kynurenine pathway that meets the structural requirements to interact with glutamate receptors. We found that cinnabarinic acid acts as a partial agonist of type 4 metabotropic glutamate (mGlu4) receptors, with no activity at other mGlu receptor subtypes. We also tested the activity of cinnabarinic acid on native mGlu4 receptors by examining 1) the inhibition of cAMP formation in cultured cerebellar granule cells; 2) protection against excitotoxic neuronal death in mixed cultures of cortical cells; and 3) protection against 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine toxicity in mice after local infusion into the external globus pallidus. In all these models, cinnabarinic acid behaved similarly to conventional mGlu4 receptor agonists, and, at least in cultured neurons, the action of low concentrations of cinnabarinic acid was largely attenuated by genetic deletion of mGlu4 receptors. However, high concentrations of cinnabarinic acid were still active in the absence of mGlu4 receptors, suggesting that the compound may have off-target effects. Mutagenesis and molecular modeling experiments showed that cinnabarinic acid acts as an orthosteric agonist interacting with residues of the glutamate binding pocket of mGlu4. Accordingly, cinnabarinic acid did not activate truncated mGlu4 receptors lacking the N-terminal Venus-flytrap domain, as opposed to the mGlu4 receptor enhancer, N-phenyl-7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxamide (PHCCC). Finally, we could detect endogenous cinnabarinic acid in brain tissue and peripheral organs by high-performance liquid chromatography-tandem mass spectrometry analysis. Levels increased substantially during inflammation induced by lipopolysaccharide. We conclude that cinnabarinic acid is a novel endogenous orthosteric agonist of mGlu4 receptors endowed with neuroprotective activity. PMID:22311707

  1. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-05-17

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids.

  2. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  3. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  4. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  5. Design, Synthesis, and Biological Evaluation of a Series of Anthracene-9,10-dione Dioxime β-Catenin Pathway Inhibitors.

    PubMed

    Soldi, Raffaella; Horrigan, Stephen K; Cholody, Marek W; Padia, Janak; Sorna, Venkataswamy; Bearss, Jared; Gilcrease, Glynn; Bhalla, Kapil; Verma, Anupam; Vankayalapati, Hariprasad; Sharma, Sunil

    2015-08-13

    The Wnt/β-catenin signaling pathway plays a vital role in cell growth, the regulation, cell development, and the differentiation of normal stem cells. Constitutive activation of the Wnt/β-catenin signaling pathway is found in many human cancers, and thus, it is an attractive target for anticancer therapy. Specific inhibitors of this pathway have been keenly researched and developed. Cell based screening of compounds library, hit-to-lead optimization, computational and structure-based design strategies resulted in the design and synthesis of a series of anthracene-9,10-dione dioxime series of compounds demonstrated potent inhibition of β-catenin in vitro (IC50 < 10 nM, 14) and the growth of several cancer cell lines. This article discusses the potential of inhibiting the Wnt/β-catenin signaling pathway as a therapeutic approach for cancer along with an overview of the development of specific inhibitors. PMID:26182238

  6. Indole-3-acetic acid biosynthetic pathway and aromatic amino acid aminotransferase activities in Pantoea dispersa strain GPK.

    PubMed

    Kulkarni, G B; Nayak, A S; Sajjan, S S; Oblesha, A; Karegoudar, T B

    2013-05-01

    This investigation deals with the production of IAA by a bacterial isolate Pantoea dispersa strain GPK (PDG) identified by 16S rRNA gene sequence analysis. HPLC and Mass spectral analysis of metabolites from bacterial spent medium revealed that, IAA production by PDG is Trp-dependent and follows indole-3-pyruvic acid (IPyA) pathway. Substrate specificity study of aromatic amino acid aminotransferase (AAT) showed high activities, only when tryptophan (Trp) and α-ketoglutarate (α-kg) were used as substrates. AAT is highly specific for Trp and α-kg as amino group donor and acceptor, respectively. The effect of exogenous IAA on bacterial growth was established. Low concentration of exogenous IAA induced the growth, whereas high concentration decreased the growth of bacterium. PDG treatment significantly increased the root length, shoot length and dry mass of the chickpea and pigeon pea plants. PMID:23448265

  7. Comparative biochemical and immunological studies of the glycine betaine synthesis pathway in diverse families of dicotyledons.

    PubMed

    Weretilnyk, E A; Bednarek, S; McCue, K F; Rhodes, D; Hanson, A D

    1989-06-01

    Members of the Chenopodiaceae can accumulate high levels (>100 μmol·(g DW)(-1)) of glycine betaine (betaine) in leaves when salinized. Chenopodiaceae synthesize betaine by a two-step oxidation of choline (choline→betaine aldehyde→ betaine), with the second step catalyzed by betaine aldehyde dehydrogenase (BADH, EC 1.2.1.8). High betaine levels have also been reported in leaves of species from several distantly-related families of dicotyledons, raising the question of whether the same betaine-synthesis pathway is used in all cases.Fast atom bombardment mass spectrometry showed that betaine levels of >100 μmol·(g DW)(-1) are present in Lycium ferocissimum Miers (Solanaceae), Helianthus annuus L. (Asteraceae), Convolvulus arvensis L. (Convolvulaceae), and Amaranthus caudatus L. (Amaranthaceae), that salinization promotes betaine accumulation in these plants, and that they can convert supplied choline to betaine aldehyde and betaine. Nicotiana tabacum L. and Lycopersicon lycopersicum (L.) Karst. ex Farw. (Solanaceae), Lactuca sativa L. (Asteraceae) and Ipomoea purpurea L. (Convolvulaceae) also contained betaine, but at a low level (0.1-0.5 μmol·(g DW)(-1). Betaine aldehyde dehydrogenase activity assays, immunotitration and immunoblotting demonstrated that the betaine-accumulating species have a BADH enzyme recognized by antibodies raised against BADH from Spinacia oleracea L. (Chenopodiaceae), and that the Mr of the BADH monomer is in all cases close to 63 000. These data indicate that the choline→betaine aldehyde→betaine pathway may have evolved by vertical descent from an early angiosperm ancestor, and might be widespread (albeit not always strongly expressed) among flowering plants. Consistent with these suggestions, Magnolia x soulangiana was found to have a low level of betaine, and to express a protein of Mr 63 000 which cross-reacted with antibodies to BADH from Spinacia oleracea. PMID:24212901

  8. Identification of the phytosphingosine metabolic pathway leading to odd-numbered fatty acids.

    PubMed

    Kondo, Natsuki; Ohno, Yusuke; Yamagata, Maki; Obara, Takashi; Seki, Naoya; Kitamura, Takuya; Naganuma, Tatsuro; Kihara, Akio

    2014-01-01

    The long-chain base phytosphingosine is a component of sphingolipids and exists in yeast, plants and some mammalian tissues. Phytosphingosine is unique in that it possesses an additional hydroxyl group compared with other long-chain bases. However, its metabolism is unknown. Here we show that phytosphingosine is metabolized to odd-numbered fatty acids and is incorporated into glycerophospholipids both in yeast and mammalian cells. Disruption of the yeast gene encoding long-chain base 1-phosphate lyase, which catalyzes the committed step in the metabolism of phytosphingosine to glycerophospholipids, causes an ~40% reduction in the level of phosphatidylcholines that contain a C15 fatty acid. We also find that 2-hydroxypalmitic acid is an intermediate of the phytosphingosine metabolic pathway. Furthermore, we show that the yeast MPO1 gene, whose product belongs to a large, conserved protein family of unknown function, is involved in phytosphingosine metabolism. Our findings provide insights into fatty acid diversity and identify a pathway by which hydroxyl group-containing lipids are metabolized. PMID:25345524

  9. Identification of the phytosphingosine metabolic pathway leading to odd-numbered fatty acids.

    PubMed

    Kondo, Natsuki; Ohno, Yusuke; Yamagata, Maki; Obara, Takashi; Seki, Naoya; Kitamura, Takuya; Naganuma, Tatsuro; Kihara, Akio

    2014-10-27

    The long-chain base phytosphingosine is a component of sphingolipids and exists in yeast, plants and some mammalian tissues. Phytosphingosine is unique in that it possesses an additional hydroxyl group compared with other long-chain bases. However, its metabolism is unknown. Here we show that phytosphingosine is metabolized to odd-numbered fatty acids and is incorporated into glycerophospholipids both in yeast and mammalian cells. Disruption of the yeast gene encoding long-chain base 1-phosphate lyase, which catalyzes the committed step in the metabolism of phytosphingosine to glycerophospholipids, causes an ~40% reduction in the level of phosphatidylcholines that contain a C15 fatty acid. We also find that 2-hydroxypalmitic acid is an intermediate of the phytosphingosine metabolic pathway. Furthermore, we show that the yeast MPO1 gene, whose product belongs to a large, conserved protein family of unknown function, is involved in phytosphingosine metabolism. Our findings provide insights into fatty acid diversity and identify a pathway by which hydroxyl group-containing lipids are metabolized.

  10. Stable isotope studies reveal pathways for the incorporation of non-essential amino acids in Acyrthosiphon pisum (pea aphids).

    PubMed

    Haribal, Meena; Jander, Georg

    2015-12-01

    Plant roots incorporate inorganic nitrogen into the amino acids glutamine, glutamic acid, asparagine and aspartic acid, which together serve as the primary metabolites of nitrogen transport to other tissues. Given the preponderance of these four amino acids, phloem sap is a nutritionally unbalanced diet for phloem-feeding insects. Therefore, aphids and other phloem feeders typically rely on microbial symbionts for the synthesis of essential amino acids. To investigate the metabolism of the four main transport amino acids by the pea aphid (Acyrthosiphon pisum), and its Buchnera aphidicola endosymbionts, aphids were fed defined diets with stable isotope-labeled glutamine, glutamic acid, asparagine or aspartic acid (U-(13)C, U-(15)N; U-(15)N; α-(15)N; or γ-(15)N). The metabolic fate of the dietary (15)N and (13)C was traced using gas chromatography-mass spectrometry (GC-MS). Nitrogen was the major contributor to the observed amino acid isotopomers with one additional unit mass (M+1). However, there was differential incorporation, with the amine nitrogen of asparagine being incorporated into other amino acids more efficiently than the amide nitrogen. Higher isotopomers (M+2, M+3 and M+4) indicated the incorporation of varying numbers of (13)C atoms into essential amino acids. GC-MS assays also showed that, even with an excess of dietary labeled glutamine, glutamic acid, asparagine or aspartic acid, the overall content of these amino acids in aphid bodies was mostly the product of catabolism of dietary amino acids and subsequent re-synthesis within the aphids. Thus, these predominant dietary amino acids are not passed directly to Buchnera endosymbionts for synthesis of essential amino acids, but are rather are produced de novo, most likely by endogenous aphid enzymes.

  11. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.

    PubMed

    Klisch, M; Häder, D-P

    2002-02-01

    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption.

  12. Abscisic acid is involved in the iron-induced synthesis of maize ferritin.

    PubMed

    Lobréaux, S; Hardy, T; Briat, J F

    1993-02-01

    The ubiquitous iron storage protein ferritin has a highly conserved structure in plants and animals, but a distinct cytological location and a different level of control in response to iron excess. Plant ferritins are plastid-localized and transcriptionally regulated in response to iron, while animal ferritins are found in the cytoplasm and have their expression mainly controlled at the translational level. In order to understand the basis of these differences, we developed hydroponic cultures of maize plantlets which allowed an increase in the intracellular iron concentration, leading to a transient accumulation of ferritin mRNA and protein (Lobréaux,S., Massenet,O. and Briat,J.F., 1992, Plant Mol. Biol., 19, 563-575). Here, it is shown that iron induces ferritin and RAB (Responsive to Abscisic Acid) mRNA accumulation relatively with abscisic acid (ABA) accumulation. Ferritin mRNA also accumulates in response to exogenous ABA. Synergistic experiments demonstrate that the ABA and iron responses are linked, although full expression of the ferritin genes cannot be entirely explained by an increase in ABA concentration. Inducibility of ferritin mRNA accumulation by iron is dramatically decreased in the maize ABA-deficient mutant vp2 and can be rescued by addition of exogenous ABA, confirming the involvement of ABA in the iron response in plants. Therefore, it is concluded that a major part of the iron-induced biosynthesis of ferritin is achieved through a pathway involving an increase in the level of the plant hormone ABA. The general conclusion of this work is that the synthesis of the same protein in response to the same environmental signal can be controlled by separate and distinct mechanisms in plants and animals.

  13. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  14. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )

    1989-12-01

    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  15. Approach to Merosesquiterpenes via Lewis Acid Catalyzed Nazarov-Type Cyclization: Total Synthesis of Akaol A.

    PubMed

    Kakde, Badrinath N; Kumar, Nivesh; Mondal, Pradip Kumar; Bisai, Alakesh

    2016-04-15

    A Lewis acid catalyzed Nazarov-type cyclization of arylvinylcarbinol has been developed for the asymmetric synthesis of carbotetracyclic core of merosesquiterpenes. The reaction works only in the presence of 2 mol % of Sn(OTf)2 and Bi(OTf)3 in dichloroethane under elevated temperature. The methodology offers the synthesis of a variety of enantioenriched arylvinylcarbinols from commercially available (3aR)-sclareolide 9 in six steps with an eventual concise total synthesis of marine sesquiterpene quinol, akaol A (1a). PMID:27028314

  16. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  17. Retro-biosynthetic screening of a modular pathway design achieves selective route for microbial synthesis of 4-methyl-pentanol.

    PubMed

    Sheppard, Micah J; Kunjapur, Aditya M; Wenck, Spencer J; Prather, Kristala L J

    2014-09-24

    Increasingly complex metabolic pathways have been engineered by modifying natural pathways and establishing de novo pathways with enzymes from a variety of organisms. Here we apply retro-biosynthetic screening to a modular pathway design to identify a redox neutral, theoretically high yielding route to a branched C6 alcohol. Enzymes capable of converting natural E. coli metabolites into 4-methyl-pentanol (4MP) via coenzyme A (CoA)-dependent chemistry were taken from nine different organisms to form a ten-step de novo pathway. Selectivity for 4MP is enhanced through the use of key enzymes acting on acyl-CoA intermediates, a carboxylic acid reductase from Nocardia iowensis and an alcohol dehydrogenase from Leifsonia sp. strain S749. One implementation of the full pathway from glucose demonstrates selective carbon chain extension and acid reduction with 4MP constituting 81% (90±7 mg l(-1)) of the observed alcohol products. The highest observed 4MP titre is 192±23 mg l(-1). These results demonstrate the ability of modular pathway screening to facilitate de novo pathway engineering.

  18. Solvent-free lipase-catalyzed synthesis of a novel hydroxyl-fatty acid derivative of kojic acid.

    PubMed

    El-Boulifi, Noureddin; Ashari, Siti Efliza; Serrano, Marta; Aracil, Jose; Martínez, Mercedes

    2014-02-01

    The aim of this work was the synthesis of a novel hydroxyl-fatty acid derivative of kojic acid rich in kojic acid monoricinoleate (KMR) which can be widely used in the cosmetic and food industry. The synthesis of KMR was carried out by lipase-catalysed esterification of ricinoleic and kojic acids in solvent-free system. Three immobilized lipases were tested and the best KMR yields were attained with Lipozyme TL IM and Novozym 435. Since Lipozyme TL IM is the cheapest, it was selected to optimize the reaction conditions. The optimal reaction conditions were 80 °C for the temperature, 1:1 for the alcohol/acid molar ratio, 600 rpm for stirring speed and 7.8% for the catalyst concentration. Under these conditions, the reaction was scaled up in a 5×10⁻³ m³ stirred tank reactor. ¹H-¹³C HMBC-NMR showed that the primary hydroxyl group of kojic acid was regioselectively esterified. The KMR has more lipophilicity than kojic acid and showed antioxidant activity that improves the oxidation stability of biodiesel.

  19. Towards Direct Synthesis of Alane: A Predicted Defect-Mediated Pathway Confirmed Experimentally.

    PubMed

    Wang, Lin-Lin; Herwadkar, Aditi; Reich, Jason M; Johnson, Duane D; House, Stephen D; Peña-Martin, Pamela; Rockett, Angus A; Robertson, Ian M; Gupta, Shalabh; Pecharsky, Vitalij K

    2016-09-01

    Alane (AlH3 ) is a unique energetic material that has not found a broad practical use for over 70 years because it is difficult to synthesize directly from its elements. Using density functional theory, we examine the defect-mediated formation of alane monomers on Al(111) in a two-step process: (1) dissociative adsorption of H2 and (2) alane formation, which are both endothermic on a clean surface. Only with Ti dopant to facilitate H2 dissociation and vacancies to provide Al adatoms, both processes become exothermic. In agreement, in situ scanning tunneling microscopy showed that during H2 exposure, alane monomers and clusters form primarily in the vicinity of Al vacancies and Ti atoms. Moreover, ball milling of the Al samples with Ti (providing necessary defects) showed a 10 % conversion of Al into AlH3 or closely related species at 344 bar H2 , indicating that the predicted pathway may lead to the direct synthesis of alane from elements at pressures much lower than the 10(4)  bar expected from bulk thermodynamics.

  20. Towards Direct Synthesis of Alane: A Predicted Defect-Mediated Pathway Confirmed Experimentally.

    PubMed

    Wang, Lin-Lin; Herwadkar, Aditi; Reich, Jason M; Johnson, Duane D; House, Stephen D; Peña-Martin, Pamela; Rockett, Angus A; Robertson, Ian M; Gupta, Shalabh; Pecharsky, Vitalij K

    2016-09-01

    Alane (AlH3 ) is a unique energetic material that has not found a broad practical use for over 70 years because it is difficult to synthesize directly from its elements. Using density functional theory, we examine the defect-mediated formation of alane monomers on Al(111) in a two-step process: (1) dissociative adsorption of H2 and (2) alane formation, which are both endothermic on a clean surface. Only with Ti dopant to facilitate H2 dissociation and vacancies to provide Al adatoms, both processes become exothermic. In agreement, in situ scanning tunneling microscopy showed that during H2 exposure, alane monomers and clusters form primarily in the vicinity of Al vacancies and Ti atoms. Moreover, ball milling of the Al samples with Ti (providing necessary defects) showed a 10 % conversion of Al into AlH3 or closely related species at 344 bar H2 , indicating that the predicted pathway may lead to the direct synthesis of alane from elements at pressures much lower than the 10(4)  bar expected from bulk thermodynamics. PMID:27535100

  1. Towards direct synthesis of alane: A predicted defect-mediated pathway confirmed experimentally

    DOE PAGESBeta

    Wang, Lin -Lin; Herwadkar, Aditi; Reich, Jason M.; Johnson, Duane D.; House, Stephen D.; Pena-Martin, Pamela; Rockett, Angus A.; Robertson, Ian M.; Gupta, Shalabh; Pecharsky, Vitalij K.

    2016-08-18

    Here, alane (AlH3) is a unique energetic material that has not found a broad practical use for over 70 years because it is difficult to synthesize directly from its elements. Using density functional theory, we examine the defect-mediated formation of alane monomers on Al(111) in a two-step process: (1) dissociative adsorption of H2 and (2) alane formation, which are both endothermic on a clean surface. Only with Ti dopant to facilitate H2 dissociation and vacancies to provide Al adatoms, both processes become exothermic. In agreement, in situ scanning tunneling microscopy showed that during H2 exposure, alane monomers and clusters formmore » primarily in the vicinity of Al vacancies and Ti atoms. Moreover, ball milling of the Al samples with Ti (providing necessary defects) showed a 10 % conversion of Al into AlH3 or closely related species at 344 bar H2, indicating that the predicted pathway may lead to the direct synthesis of alane from elements at pressures much lower than the 104 bar expected from bulk thermodynamics.« less

  2. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-01

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  3. An integrated metabonomics and transcriptomics approach to understanding metabolic pathway disturbance induced by perfluorooctanoic acid.

    PubMed

    Peng, Siyuan; Yan, Lijuan; Zhang, Jie; Wang, Zhanlin; Tian, Meiping; Shen, Heqing

    2013-12-01

    Perfluorooctanoic acid (PFOA) is one of the most representative perfluorinated compounds and liver is the major organ where PFOA is accumulated. Although the multiple toxicities had been reported, its toxicological profile remained unclear. In this study, a systems toxicology strategy integrating liquid chromatography/mass spectrometry-based metabonomics and transcriptomics analyses was applied for the first time to investigate the effects of PFOA on a representative Chinese normal human liver cell line L-02, with focusing on the metabolic disturbance. Fifteen potential biomarkers were identified on metabolic level and most observations were consistent with the altered levels of gene expression. Our results showed that PFOA induced the perturbations in various metabolic processes in L-02 cells, especially lipid metabolism-related pathways. The up-stream mitochondrial carnitine metabolism was proved to be influenced by PFOA treatment. The specific transformation from carnitine to acylcarnitines, which showed a dose-dependent effect, and the expression level of key genes involved in this pathway were observed to be altered correspondingly. Furthermore, the down-stream cholesterol biosynthesis was directly confirmed to be up-regulated by both increased cholesterol content and elevated expression level of key genes. The PFOA-induced lipid metabolism-related effects in L-02 cells started from the fatty acid catabolism in cytosol, fluctuated to the processes in mitochondria, extended to the cholesterol biosynthesis. Many other metabolic pathways like amino acid metabolism and tricarboxylic acid cycle might also be disturbed. The findings obtained from the systems biological research provide more details about metabolic disorders induced by PFOA in human liver.

  4. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.

    PubMed

    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György

    2016-01-01

    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  5. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  6. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  7. Ca2+- and PKC-dependent stimulation of PGE2 synthesis by deoxycholic acid in human colonic fibroblasts.

    PubMed

    Zhu, Yingting; Hua, Ping; Rafiq, Shazia; Waffner, Eric J; Duffey, Michael E; Lance, Peter

    2002-09-01

    We investigated prostanoid biogenesis by human colonic fibroblasts (CCD-18Co cells and nine primary fibroblast cultures) exposed to a primary (cholic, CA) or a secondary (deoxycholic, DCA) bile acid. Basal PGE2 levels in CCD-18Co cultures and fibroblast strains initiated from normal and adenocarcinomatous colon, respectively, were 1.7 +/- 0.3, 4.0 +/- 2.0, and 15.0 +/- 4.8 ng/mg protein. Peak levels 24 h after exposure to DCA (300 microM) rose, respectively, seven-, six- and sevenfold, but CA elicited no such responses. Increases in PGE2 synthesis were preceded by sequential increases in PGH synthase-2 mRNA and protein expression and were fully prevented by a nonselective (indomethacin) or a selective (celecoxib) nonsteroidal anti-inflammatory drug. DCA, but not CA, caused abrupt, transient increases in fibroblast intracellular Ca2+ concentration ([Ca2+]i) approximately 1 min after exposure. Increased [Ca2+]i was required for DCA-mediated induction of PGE2 synthesis, and protein kinase C was a further essential component of this signaling pathway. Colonic fibroblasts may be a major target for prostanoid biogenesis induced by fecal bile acids and, potentially, other noxious actions of these agents. PMID:12181161

  8. Platelet 12-lipoxygenase activation via glycoprotein VI: involvement of multiple signaling pathways in agonist control of H(P)ETE synthesis.

    PubMed

    Coffey, Marcus J; Jarvis, Gavin E; Gibbins, Jonathan M; Coles, Barbara; Barrett, Natasha E; Wylie, Oliver R E; O'Donnell, Valerie B

    2004-06-25

    Lipoxygenases (LOX) contribute to vascular disease and inflammation through generation of bioactive lipids, including 12-hydro(pero)xyeicosatetraenoic acid (12-H(P)ETE). The physiological mechanisms that acutely control LOX product generation in mammalian cells are uncharacterized. Human platelets that contain a 12-LOX isoform (p12-LOX) were used to define pathways that activate H(P)ETE synthesis in the vasculature. Collagen and collagen-related peptide (CRP) (1 to 10 microg/mL) acutely induced platelet 12-H(P)ETE synthesis. This implicated the collagen receptor glycoprotein VI (GPVI), which signals via the immunoreceptor-based activatory motif (ITAM)-containing FcRgamma chain. Conversely, thrombin only activated at high concentrations (> 0.2 U/mL), whereas U46619 and ADP alone were ineffective. Collagen or CRP-stimulated 12-H(P)ETE generation was inhibited by staurosporine, PP2, wortmannin, BAPTA/AM, EGTA, and L-655238, implicating src-tyrosine kinases, PI3-kinase, Ca2+ mobilization, and p12-LOX translocation. In contrast, protein kinase C (PKC) inhibition potentiated 12-H(P)ETE generation. Finally, activation of the immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing platelet endothelial cell adhesion molecule (PECAM-1) inhibited p12-LOX product generation. This study characterizes a receptor-dependent pathway for 12-H(P)ETE synthesis via the collagen receptor GPVI, which is negatively regulated by PECAM-1 and PKC, and demonstrates a novel link between immune receptor signaling and lipid mediator generation in the vasculature. PMID:15142951

  9. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  10. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  11. Molecular modeling and simulation of FabG, an enzyme involved in the fatty acid pathway of Streptococcus pyogenes.

    PubMed

    Shafreen, Rajamohmed Beema; Pandian, Shunmugiah Karutha

    2013-09-01

    Streptococcus pyogenes (SP) is the major cause of pharyngitis accompanied by strep throat infections in humans. 3-keto acyl reductase (FabG), an important enzyme involved in the elongation cycle of the fatty acid pathway of S. pyogenes, is essential for synthesis of the cell-membrane, virulence factors and quorum sensing-related mechanisms. Targeting SPFabG may provide an important aid for the development of drugs against S. pyogenes. However, the absence of a crystal structure for FabG of S. pyogenes limits the development of structure-based drug designs. Hence, in the present study, a homology model of FabG was generated using the X-ray crystallographic structure of Aquifex aeolicus (PDB ID: 2PNF). The modeled structure was refined using energy minimization. Furthermore, active sites were predicted, and a large dataset of compounds was screened against SPFabG. The ligands were docked using the LigandFit module that is available from Discovery Studio version 2.5. From this list, 13 best hit ligands were chosen based on the docking score and binding energy. All of the 13 ligands were screened for Absorption, Distribution, Metabolism, Excretion and Toxicity (ADMET) properties. From this, the two best descriptors, along with one descriptor that lay outside the ADMET plot, were selected for molecular dynamic (MD) simulation. In vitro testing of the ligands using biological assays further substantiated the efficacy of the ligands that were screened based on the in silico methods.

  12. Definition of a Novel Pathway Centered on Lysophosphatidic Acid To Recruit Monocytes during the Resolution Phase of Tissue Inflammation

    PubMed Central

    Gobbetti, Thomas; Kusters, Dennis H. M.; Reutelingsperger, Christopher P.; Flower, Roderick J.

    2015-01-01

    Blood-derived monocytes remove apoptotic cells and terminate inflammation in settings as diverse as atherosclerosis and Alzheimer’s disease. They express high levels of the proresolving receptor ALX/FPR2, which is activated by the protein annexin A1 (ANXA1), found in high abundance in inflammatory exudates. Using primary human blood monocytes from healthy donors, we identified ANXA1 as a potent CD14+CD16− monocyte chemoattractant, acting via ALX/FPR2. Downstream signaling pathway analysis revealed the p38 MAPK-mediated activation of a calcium independent phospholipase A2 with resultant synthesis of lysophosphatidic acid (LPA) driving chemotaxis through LPA receptor 2 and actin cytoskeletal mobilization. In vivo experiments confirmed ANXA1 as an independent phospholipase A2–dependent monocyte recruiter; congruently, monocyte recruitment was significantly impaired during ongoing zymosan-induced inflammation in AnxA1−/− or alx/fpr2/3−/− mice. Using a dorsal air-pouch model, passive transfer of apoptotic neutrophils between AnxA1−/− and wild-type mice identified effete neutrophils as the primary source of soluble ANXA1 in inflammatory resolution. Together, these data elucidate a novel proresolving network centered on ANXA1 and LPA generation and identify previously unappreciated determinants of ANXA1 and ALX/FPR2 signaling in monocytes. PMID:26101324

  13. Definition of a Novel Pathway Centered on Lysophosphatidic Acid To Recruit Monocytes during the Resolution Phase of Tissue Inflammation.

    PubMed

    McArthur, Simon; Gobbetti, Thomas; Kusters, Dennis H M; Reutelingsperger, Christopher P; Flower, Roderick J; Perretti, Mauro

    2015-08-01

    Blood-derived monocytes remove apoptotic cells and terminate inflammation in settings as diverse as atherosclerosis and Alzheimer's disease. They express high levels of the proresolving receptor ALX/FPR2, which is activated by the protein annexin A1 (ANXA1), found in high abundance in inflammatory exudates. Using primary human blood monocytes from healthy donors, we identified ANXA1 as a potent CD14(+)CD16(-) monocyte chemoattractant, acting via ALX/FPR2. Downstream signaling pathway analysis revealed the p38 MAPK-mediated activation of a calcium independent phospholipase A2 with resultant synthesis of lysophosphatidic acid (LPA) driving chemotaxis through LPA receptor 2 and actin cytoskeletal mobilization. In vivo experiments confirmed ANXA1 as an independent phospholipase A2-dependent monocyte recruiter; congruently, monocyte recruitment was significantly impaired during ongoing zymosan-induced inflammation in AnxA1(-/-) or alx/fpr2/3(-/-) mice. Using a dorsal air-pouch model, passive transfer of apoptotic neutrophils between AnxA1(-/-) and wild-type mice identified effete neutrophils as the primary source of soluble ANXA1 in inflammatory resolution. Together, these data elucidate a novel proresolving network centered on ANXA1 and LPA generation and identify previously unappreciated determinants of ANXA1 and ALX/FPR2 signaling in monocytes.

  14. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  15. The orphan GPCR, Gpr161, regulates the retinoic acid and canonical Wnt pathways during neurulation.

    PubMed

    Li, Bo I; Matteson, Paul G; Ababon, Myka F; Nato, Alejandro Q; Lin, Yong; Nanda, Vikas; Matise, Tara C; Millonig, James H

    2015-06-01

    The vacuolated lens (vl) mouse mutation arose on the C3H/HeSnJ background and results in lethality, neural tube defects (NTDs) and cataracts. The vl phenotypes are due to a deletion/frameshift mutation in the orphan GPCR, Gpr161. A recent study using a null allele demonstrated that Gpr161 functions in primary cilia and represses the Shh pathway. We show the hypomorphic Gpr161(vl) allele does not severely affect the Shh pathway. To identify additional pathways regulated by Gpr161 during neurulation, we took advantage of naturally occurring genetic variation in the mouse. Previously Gpr161(vl-C3H) was crossed to different inbred backgrounds including MOLF/EiJ and the Gpr161(vl) mutant phenotypes were rescued. Five modifiers were mapped (Modvl: Modifier of vl) including Modvl5(MOLF). In this study we demonstrate the Modvl5(MOLF) congenic rescues the Gpr161(vl)-associated lethality and NTDs but not cataracts. Bioinformatics determined the transcription factor, Cdx1, is the only annotated gene within the Modvl5 95% CI co-expressed with Gpr161 during neurulation and not expressed in the eye. Using Cdx1 as an entry point, we identified the retinoid acid (RA) and canonical Wnt pathways as downstream targets of Gpr161. QRT-PCR, ISH and IHC determined that expression of RA and Wnt genes are down-regulated in Gpr161(vl/vl) but rescued by the Modvl5(MOLF) congenic during neurulation. Intraperitoneal RA injection restores expression of canonical Wnt markers and rescues Gpr161(vl/vl) NTDs. These results establish the RA and canonical Wnt as pathways downstream of Gpr161 during neurulation, and suggest that Modvl5(MOLF) bypasses the Gpr161(vl) mutation by restoring the activity of these pathways. PMID:25753732

  16. Lysophosphatidic acid upregulates connective tissue growth factor expression in osteoblasts through the GPCR/PKC and PKA pathways.

    PubMed

    Yu, Zi-Li; Li, Dian-Qi; Huang, Xiang-Yu; Xing, Xin; Yu, Ru-Qing; Li, Zhi; Li, Zu-Bing

    2016-02-01

    Lysophosphatidic acid (LPA) is an efficient, bioactive phospholipid involved in various biological processes. In this study, LPA-induced connective tissue growth factor (CTGF/CCN2) expression and the underlying mechanisms were investigated using the MC3T3-E1 cell line. The MC3T3-E1 cells were stimulated with an inhibitor of LPA receptors, an activator and inhibitor of protein kinase C (PKC) and protein kinase A (PKA) for indicated periods of time. RT-qPCR and western blot analyses were used to measure the expression levels of CCN2. Immunofluorescence staining was used to observe the translocation of PKC. The mRNA expression level of CCN2 was increased following stimulation of the cells with LPA; LPA transiently induced the mRNA expression of CCN2; maximum expression levels were observed 2 h following stimulation with LPA. This increase was accompanied by CCN2 protein synthesis. LPA receptor1/3 was inhibited by Ki16425, a specific inhibitor of LPA1/3; as a result, the LPA-induced increase in CCN2 expression was abrogated. LPA also induced the membrane translocation of PKC and enhanced PKC activity in the osteoblasts. Pre-treatment of the osteoblasts with staurosporine prevented the increase in CCN2 expression by induced by LPA, and the activation of PKC by phorbol 12-myristate 13-acetate (PMA) enhanced CCN2 expression, indicating that the PKC pathway is involved in the LPA-induced increase in CCN2 expression. The interference of PKA signaling also led to the induction of CCN2 expresion by LPA. These data indicate that LPA increases CCN2 expression through the activation of PKC and PKA. Thus, the regulatory functions of the PKC and PKA pathways are implicated in the LPA-induced increase in CCN2 expression.

  17. Selenium Catalyzed Oxidation of Aldehydes: Green Synthesis of Carboxylic Acids and Esters.

    PubMed

    Sancineto, Luca; Tidei, Caterina; Bagnoli, Luana; Marini, Francesca; Lenardão, Eder J; Santi, Claudio

    2015-01-01

    The stoichiometric use of hydrogen peroxide in the presence of a selenium-containing catalyst in water is here reported as a new ecofriendly protocol for the synthesis of variously functionalized carboxylic acids and esters. The method affords the desired products in good to excellent yields under very mild conditions starting directly from commercially available aldehydes. Using benzaldehyde as a prototype the gram scale synthesis of benzoic acid is described, in which the aqueous medium and the catalyst could be recycled at last five times while achieving an 87% overall yield.

  18. Communic acids: occurrence, properties and use as chirons for the synthesis of bioactive compounds.

    PubMed

    Barrero, Alejandro F; Herrador, M Mar; Arteaga, Pilar; Arteaga, Jesús F; Arteaga, Alejandro F

    2012-01-01

    Communic acids are diterpenes with labdane skeletons found in many plant species, mainly conifers, predominating in the genus Juniperus (fam. Cupresaceae). In this review we briefly describe their distribution and different biological activities (anti- bacterial, antitumoral, hypolipidemic, relaxing smooth muscle, etc.). This paper also includes a detailed explanation of their use as chiral building blocks for the synthesis of bioactive natural products. Among other uses, communic acids have proven useful as chirons for the synthesis of quassinoids (formal), abietane antioxidants, ambrox and other perfume fixatives, podolactone herbicides, etc., featuring shorter and more efficient processes.

  19. Measurement of Microbial Activity and Growth in the Ocean by Rates of Stable Ribonucleic Acid Synthesis

    PubMed Central

    Karl, David M.

    1979-01-01

    A relatively simple and extremely sensitive technique for measuring rates of stable ribonucleic acid (RNA) synthesis was devised and applied to bacterial cultures and seawater samples. The procedure is based upon the uptake and incorporation of exogenous radiolabeled adenine into cellular RNA. To calculate absolute rates of synthesis, measurements of the specific radioactivity of the intracellular adenosine 5′-triphosphate pools (precursor to RNA) and of the total amount of radioactivity incorporated into stable cellular RNA per unit time are required. Since the rate of RNA synthesis is positively correlated with growth rate, measurements of RNA synthesis should be extremely useful for estimating and comparing the productivities of microbial assemblages in nature. Adenosine 5′-triphosphate, adenylate energy charge, and rates of stable RNA synthesis have been measured at a station located in the Columbian Basin of the Caribbean Sea. A subsurface peak in RNA synthesis (and therefore growth) was located within the dissolved oxygen minimum zone (450 m), suggesting in situ microbiological utilization of dissolved molecular oxygen. Calculations of the specific rates of RNA synthesis (i.e., RNA synthesis per unit of biomass) revealed that the middepth maximum corresponded to the highest specific rate of growth (420 pmol of adenine incorporated into RNA·day−1) of all depths sampled, including the euphotic zone. The existence of an intermediate depth zone of active microbial growth may be an important site for nutrient regeneration and may serve as a source of reduced carbon for mesopelagic and deep sea environments. PMID:16345461

  20. Role of the glyoxylate pathway in acetic acid production by Acetobacter aceti.

    PubMed

    Sakurai, Kenta; Yamazaki, Shoko; Ishii, Masaharu; Igarashi, Yasuo; Arai, Hiroyuki

    2013-01-01

    Wild-type Acetobacter aceti NBRC 14818 possesses genes encoding isocitrate lyase (aceA) and malate synthase (glcB), which constitute the glyoxylate pathway. In contrast, several acetic acid bacteria that are utilized for vinegar production lack these genes. Here, an aceA-glcB knockout mutant of NBRC 14818 was constructed and used for investigating the role of the glyoxylate pathway in acetate productivity. In medium containing ethanol as a carbon source, the mutant grew normally during ethanol oxidation to acetate, but exhibited slower growth than that of the wild-type strain as the accumulated acetate was oxidized. The mutant grew similarly to that of the wild-type strain in medium containing glucose as a carbon source, indicating that the glyoxylate pathway was not necessary for glucose utilization. However, in medium containing both ethanol and glucose, the mutant exhibited significantly poorer growth and lower glucose consumption compared to the wild-type strain. Notably, the mutant oxidized ethanol nearly stoichiometrically to acetate, which was retained in the medium for a longer period of time than the acetate produced by wild-type strain. The features of the aceA-glcB knockout mutant revealed here indicate that the lack of the glyoxylate pathway is advantageous for industrial vinegar production by A. aceti.

  1. Structural and biochemical characterization of Chlamydia trachomatis hypothetical protein CT263 supports that menaquinone synthesis occurs through the futalosine pathway.

    PubMed

    Barta, Michael L; Thomas, Keisha; Yuan, Hongling; Lovell, Scott; Battaile, Kevin P; Schramm, Vern L; Hefty, P Scott

    2014-11-14

    The obligate intracellular human pathogen Chlamydia trachomatis is the etiological agent of blinding trachoma and sexually transmitted disease. Genomic sequencing of Chlamydia indicated this medically important bacterium was not exclusively dependent on the host cell for energy. In order for the electron transport chain to function, electron shuttling between membrane-embedded complexes requires lipid-soluble quinones (e.g. menaquionone or ubiquinone). The sources or biosynthetic pathways required to obtain these electron carriers within C. trachomatis are poorly understood. The 1.58Å crystal structure of C. trachomatis hypothetical protein CT263 presented here supports a role in quinone biosynthesis. Although CT263 lacks sequence-based functional annotation, the crystal structure of CT263 displays striking structural similarity to 5'-methylthioadenosine nucleosidase (MTAN) enzymes. Although CT263 lacks the active site-associated dimer interface found in prototypical MTANs, co-crystal structures with product (adenine) or substrate (5'-methylthioadenosine) indicate that the canonical active site residues are conserved. Enzymatic characterization of CT263 indicates that the futalosine pathway intermediate 6-amino-6-deoxyfutalosine (kcat/Km = 1.8 × 10(3) M(-1) s(-1)), but not the prototypical MTAN substrates (e.g. S-adenosylhomocysteine and 5'-methylthioadenosine), is hydrolyzed. Bioinformatic analyses of the chlamydial proteome also support the futalosine pathway toward the synthesis of menaquinone in Chlamydiaceae. This report provides the first experimental support for quinone synthesis in Chlamydia. Menaquinone synthesis provides another target for agents to combat C. trachomatis infection. PMID:25253688

  2. Defects in mitochondrial fatty acid synthesis result in failure of multiple aspects of mitochondrial biogenesis in Saccharomyces cerevisiae.

    PubMed

    Kursu, V A Samuli; Pietikäinen, Laura P; Fontanesi, Flavia; Aaltonen, Mari J; Suomi, Fumi; Raghavan Nair, Remya; Schonauer, Melissa S; Dieckmann, Carol L; Barrientos, Antoni; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2013-11-01

    Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild haem deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a co-ordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell.